GB2580879A

GB2580879A - Biocatalytic techniques

Info

Publication number: GB2580879A
Application number: GB1819318.5A
Authority: GB
Inventors: Charles Paul Steele Jonathan; De Riso Antonio; Falcioni Francesco; Kerry Phipps Richard; Keith Wrigley Stephen; Jade Hopkins Emily; Rimu Khan Aksana; Linda Nytko Kinga; Poon Vincent; Maxim Ward John
Original assignee: UCL Business Ltd; Hypha Discovery Ltd
Current assignee: UCL Business Ltd; Hypha Discovery Ltd
Priority date: 2018-11-27
Filing date: 2018-11-27
Publication date: 2020-08-05
Anticipated expiration: 2038-11-27
Also published as: GB2580879B; GB201819318D0

Abstract

The present invention relates to the use of a cytochrome P450 (CYP450) enzyme from Streptomyces sp. NRRL 21489 for catalysing the hydroxylation of organic substrates. Also provided is a method for the production of a hydroxylated organic compound comprising reacting the organic compound with the cytochrome P450 enzyme described herein. The substrate is preferably bosentan, cyclosporine A or ritonavir. The method may use ferredoxin and ferredoxin reductase in combination with the CYP450. Also described are kits for carrying out the invention.

Description

BIOCATALYTIC TECHNIQUES

Field of the invention

The present invention relates to the use of a cytochrome P450 enzyme from Streptomyces sp. NRRL 21489 for catalysing the hydroxylation of organic substrates.

Background of invention

Cytochrome P450 (CYP) is a superfamily of haem-thiolate proteins named for the spectral absorbance peak of their carbon-monoxide bound species at 450 nm. They are found in all kingdoms of life such as animals, plants, fungi, protists, bacteria, archaea, and furthermore a putative P450 from giant virus A. polyphaga has been recently proposed, Lamb, DC; Lei, L; Warrilow, AG; Lepesheva, GI; Mullins, JG; Waterman, MR; Kelly, SL (2009). "The first virally encoded cytochrome P450". Journal of Virology. 83 (16): pp8266-9. Cytochrome P450 have not been identified in E. coli, Roland Sigel; Sigel, Astrid; Sigel, Helmut (2007). The Ubiquitous Roles of Cytochrome P450 Proteins: Metal Ions in Life Sciences. New York: Wiley. ISBN 0-470-01672-8; Danielson PB (December 2002). "The cytochrome P450 superfamily: biochemistry, evolution and drug metabolism in humans". Curr. Drug Metab. 3 (6): pp561-97.

Cytochrome P450s show extraordinary diversity in their reaction chemistry supporting the oxidative, peroxidative and reductive metabolism of a diversity and range of endogenous and xenobiotic substrates.

In humans, cytochrome P450s are best known for their central role in phase I drug metabolism where they are of critical importance for two of the most significant problems in clinical pharmacology: drug-drug interactions and inter-individual variability in drug metabolism.

The most common reaction catalyzed by cytochromes P450 is a monooxygenase reaction. Cytochrome P450 mono-oxygenases use a haem group to oxidase molecules, often making them more water-soluble by either adding or unmasking a polar group. In general the reactions catalysed by these enzymes can be summarised as: R-H R-CH2-OH R-CH=O R2 N-H R3N R25 RO-CH2R R2N-CH2R [CYP + 0] [CYP + 0] [CYP + 0] [CYP + 0] [CYP + [CYP + 0] [CYP + 0] [CYP + 0]

R-OH

RCH=0 + H2O RCOOH R2N-OH R3N >0 R2S=0 ROH + O=CHR R2NH + O=CHR Carbon oxidation Heteroatom oxidation Dealkviation Epoxide formation R-HCCH-R [CYP + IC&

R-HC-CH-R

In the first line example, R-H is the substrate and R-OH is the oxygenated substrate. The oxygen is bound to the haem group in the core of the CYP enzyme, protons (H+) are usually derived from the reduced cofactor NADH or NADPH through specific amino acids in the CYP enzyme. CYP enzymes can receive electrons from a range of redox partner proteins such as cytochrome b5, a ferredoxin reductase and a ferredoxin, and adrenodoxin reductase and adrenodoxin.

Although classification and nomenclature of cytochrome P450 is quite complex, they can be classified by their redox partner transfer protein system, proposed by I. Hanukoglu (1996). "Electron Transfer Proteins of Cytochrome P450 Systems". Advances in Molecular and Cell Biology. Advances in Molecular and Cell Biology. 14: 29-56. In summary, cytochromes P450 can be classified into the following groups: Microsomal P450 systems which utilise cytochrome P540 reductase or cytochrome b5 to transfer electrons from cofactor to cytochrome P450; Mitochondria! P450 systems which utilise adrenodoxin reductase and adrenodoxin to transfer electrons from reduced cofactor to cytochrome P450; Bacterial P450 systems which utilise ferredoxin reductase and ferredoxin to transfer electrons from reduced cofactor to cytochrome P450; CYB5R-cytb5-P450 systems, which utilise cytochrome b5 for the electron transfer from the cofactor to the cytochrome P450; FMN-Fd-P450 systems in which the electron partner reductase is a fused FMN domain; P450 only systems that do not require redox partner proteins, e.g., P450Bm_3.

Isolated bacterial cytochrome P450 enzymes are known, including P450. from Pseudomonas putida, J Biol Chem (1974) 249, 94; P450Bm_, and P450Bm_3 both from Bacillus megaterium ATCC 14581, Biochim Hiophys Acta (1985) 838, 302, and J Biol Chem (1986) 261, 1986, 7160; P450a, P450b, and P450c from Rhizobium japonicum, Biochim Biophys Acta (1967) 147, 399; and P450npd from Nocardia NHI, Microbios (1974) 9, 119.

However, cytochrome P450 enzymes purified from Actinomycete microorganisms remain relatively unreported. The induction of a cytochrome P450 in Streptomyces griseus by soybean flour (P450soy) is described in Biochem and Biophys Res Comm (1986) 141, 405. Other reported examples include the isolation and properties of two forms of a P450 effecting pesticide inactivation (P450sui & su2) and two forms of 6-deoxyerythronolide B hydroxylase from Saccharopolyspora erythraea (originally classified as Streptomyces erythraeus) as described in Biochemistry (1987) 26, 6204. US6884608 describes enzymatic hydroxylation of epothilone B to epothilone F, effected with a hydroxylation enzyme produced by a strain of Amycolatopsis orientalis (originally classified as Streptomyces orientalis).

In the field of medicinal chemistry, modifications to chemical compounds are used to modify the properties of such chemical compounds. For example, tertiary butyl moieties are often used by medicinal chemists in the synthesis of drug-like molecules for introduction of hydrophobicity. However, further modifications thereof can be used to improve potency, selectivity and solubility profiles of such compounds, for example hydroxylations can be used. Hydroxylations are also the main route of metabolic degradation, another important aspect of pharmacology and medicinal chemistry. Methods for the production of these hydroxylated metabolites are sought using biotransformation with animal tissues.

Summary of the invention

It has surprisingly been found that a specific cytochrome P450 enzyme found in Streptomyces sp. NRRL 21489 can be used for the hydroxylation of organic substrates.

In particular, cytochrome P450 enzyme having the SEQ ID NOs: 2 can be used for the hydroxylation of organic compounds in order to activate or modify the compound's physicochemical and pharmacological properties. In a particularly preferred embodiment, the cytochrome P450 enzyme having the SEQ ID NO: 2 is useful for the hydroxylation of a variety of aliphatic and aromatic moieties, or chemicals containing such moieties, for the purposes of CH activation or modification of the compound's physicochemical and pharmacological properties.

A first aspect of the invention provides the use of a cytochrome P450 enzyme comprising SEQ ID NO: 2 or a variant enzyme having at least 70% identity thereto and having CYP450 activity, for the hydroxylation of an organic compound.

A second aspect of the invention provides a method for the production of a hydroxylated organic compound, comprising reacting the organic compound with an enzyme preparation containing in part cytochrome P450 enzyme comprising SEQ ID NO: 2 or a variant enzyme having at least 70% identity thereto and having CYP450 activity.

A third aspect of the invention provides a kit comprising i) a cytochrome P450 enzyme comprising SEQ ID NO: 2 or a variant enzyme having at least 70% identity thereto and having CYP450 activity, or ii) a microorganism that expresses a cytochrome P450 enzyme comprising SEQ ID NO: 2 or a variant enzyme having at least 70% identity thereto and having CYP450 activity, wherein the kit further comprises instructions and other cofactor reagents for use for the hydroxylation of an organic compound.

Brief description of the figures:

Fig. 1 shows schematic examples of the biotransformation effected by the use of a cytochrome P450 enzyme comprising SEQ ID NO: 2 of the present invention. Figure 1(a) shows hydroxylation of bosentan, figure 1(b) shows the hydroxylation of ritonavir; figure 1(c) shows hydroxylation of cyclosporine A. Fig. 2 shows various ID sequences. SEQ ID NO: 1 is the coding sequence of sspCO2; SEQ ID NO: 2 is the amino acid sequence of cytochrome SspCO2; Fig. 3 shows expression plasmid pHD05-SspCO2 Fig. 4 shows the carbon monoxide difference spectrum of the crude enzyme extract containing P450,,pc02 protein. The sample was prepared from !PIG-induced culture of E. coif BL21 (DE3) cells containing the pHD05-SspCO2 plasmid.

Figs. 5a-c show UPLC-MS chromatograms of various reactions performed at 100uL screening scale.

Description of the preferred embodiments

A first aspect of the invention provides the use of a cytochrome P450 enzyme comprising SEQ ID NO: 2, or a variant enzyme having at least 70% identity thereto and having CYP450 activity, for the hydroxylation of an organic compound.

Specifically, the present invention provides the use of the enzyme cytochrome P450sspc02. This enzyme has amino acid sequences as shown in SEQ ID NO: 2.

This enzyme is present in the strain Streptomyces sp., a deposit in the ARS Culture Collection, National Center for Agricultural Utilization Research, 1815 North University Street, Peoria, Illinois 61604, USA, under the Accession number NRRL 21489. The strain has also been deposited with various other Culture Collection, with the accession numbers A-93017, ATCC 55043 and MA6751.

When this enzyme or variants thereof, is combined with suitable reductase components, it is able to hydroxylate organic compounds.

The enzyme cytochrome P450sspc02 can be extracted, with or without purification from the known Streptomyces sp. NRRL 21489, or other bacterial strain, or similarly extracted, with or without purification from a recombinant expression system via cloning of cytochrome P4503,pc02 into an expression system, such as E. coli, as will be understood by the skilled person.

Actinomycetes including Streptomyces sp. NRRL 21489 readily undergo mutation both through natural causes and as a result of artificial treatments such as UV irradiation, radiation treatment and chemical treatment. The present invention embraces all productive mutants of Streptomyces sp. NRRL 21489.

These mutant strains also include any strains obtained by gene manipulation such as gene recombination, transduction and transformation. It is also well-known that the properties of Actinomycetes change in some degree even for the same strain after successive cultures. Therefore, strains cannot always be differentiated taxonomically because of a slight difference in culture properties.

This invention embraces all strains that can produce one or more of the cytochromes P450 enzymes, and especially strains that cannot be clearly differentiated from strain NRRL 21489 or its mutants.

One skilled in the art will appreciate that the present invention can include variants of those particular amino acids sequences which are exemplified herein.

Particularly preferred are variants having an amino acid sequence similar to that of the amino acid sequences disclosed herein, in which one or more amino acids residues are substituted, deleted or added in any combination. Especially preferred are silent substitutions, additions and deletions, which do not alter the properties and activities of the protein of the present invention. Various amino acids have similar properties, and one or more such amino acids of a substance can often be substituted by one or more other amino acids without eliminating a desired activity of that substance. Thus, the amino acids glycine, alanine, valine, leucine and isoleucine can often be substituted for one another (amino acids having aliphatic side chains). Of these possible substitutions it is preferred that glycine and alanine are used to substitute for one another (since they have relatively short side chains) and that valine, leucine and isoleucine are used to substitute for one another (since they have larger aliphatic side chains which are hydrophobic). Other amino acids which can often be substituted for one another include: phenylalanine, tyrosine and tryptophan (amino acids having aromatic side chains); lysine, arginine and histidine (amino acids having basic side chains); aspartate and glutamate (amino acids having acidic side chains); asparagine and glutamine (amino acids having amide side chains); and cysteine and methionine (amino acids having sulphur containing side chains). Variants include naturally occurring and artificial variants. Artificial variants may be generated using mutagenesis techniques, including those applied to nucleic acid molecules, cells or organisms. Preferably, the variants have substantial identity to the amino acid sequences exemplified herein. As used herein, the term "variant" or "mutant thereof" refers to amino acid sequences which have "substantial identity", preferably having at least 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95% 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%,99.5%, 99.6%, 99.1%, 99.8% or 99.9% identity with SEQ ID NO 2. Desirably, the term "substantial identity" indicates that said sequence has a greater degree of identity with any of the sequences described herein than with prior art amino acid sequences. One can use a program such as the CLUSTAL program to compare amino acid sequences. This program compares amino acid sequences and finds the optimal alignment by inserting spaces in either sequence as appropriate. It is possible to calculate amino acid identity or similarity (identity plus conservation of amino acid type) for an optimal alignment. A program like BLASTx will align the longest stretch of similar sequences and assign a value to the fit. It is thus possible to obtain a comparison where several regions of similarity are found, each having a different score. The above applied mutatis mutandis to all amino acid sequences disclosed in the present application.

In a preferred embodiment, the term "variant" or "mutant thereof' generally refers to a sequence having at least 70% identity to SEQ ID No 2 and CYP450 activity, more preferably least 90% identity thereto or at least 95% identity thereto, further preferably 96% identity thereto, even more preferably 97% identity thereto, most preferably 100% identity thereto.

A variety of different compounds can be hydroxylated using the claimed cytochrome P450 enzyme. In a preferred embodiment, the organic compound to be hydroxylated will have a rate of conversion to the resulting derivative of at least 3%, more preferably at least 5%, more preferably at least 10%, more preferably at least 25%, more preferably at least 50%, even more preferably at least 70% and most preferably a rate of conversion to the resulting derivative of 100%, using the same conditions described in Example 4 herein.

The compound to be hydroxylated by the cytochrome P450 enzyme may have an optionally substituted linear or branched alkyl group, such as methyl, isopropyl or tent-butyl, which is hydroxylated; or an aromatic group, such as an optionally substituted aryl or heteroaryl, which is hydroxylated.

There is a particularly high conversion rate from these compounds to their hydroxylated derivatives when using the claimed cytochrome P450 enzyme.

Preferably, the compound to be hydroxylated is of formula I: R3 R2 (I) where R represents the rest of the compound, and where R1, R2 and R3 are independently selected from H or C1.12 alkyl or 06_10 aryl, or wherein any two of R1, R2 and R3 may be joined to form an optionally substituted cycloalkyl or heterocycloalkyl or R1, R2 and R3 may be joined together with their bridging carbon to form an olefin, aryl or heteroaryl.

Preferably R is an optionally substituted alkyl; an optionally substituted olefin, an optionally substituted aryl, optionally substituted heteroaryl or optionally substituted heterocycloalkyl.

As used herein "alkyl" means a C1-Cio alkyl group, which can be linear or branched or cyclic. Examples include propyl and butyl, pentyl, hexyl, cyclopentyl and cyclohexyl. Preferably, it is a 03-C10 alkyl moiety. More preferably it is a C--C6 alkyl moiety. Preferably the alkyl is an optionally substituted cyclohexyl.

For the avoidance of any doubt, the term cycloalkyl is a cyclic alkyl group.

As used herein "aryl" means an optionally substituted monocyclic, bicyclic or tricyclic aromatic radical, such as phenyl, biphenyl, napthyl, anthracenyl. Preferably the aryl is an optionally substituted Ce aryl.

As used herein "heteroaryl" means an optionally substituted monocyclic, bicyclic or tricyclic aromatic radical containing at least one and up to four heteroatoms selected from oxygen, nitrogen and sulfur, such as furanyl, pyrrolyl, thiazolyl, isothiazolyl, tetrazolyl, imidazolyl, oxazolyl, isoxazolyl, thienyl, pyrazolyl, pyridinyl, pyrazinyl, pyrimidinyl, indolyl, azaindolyl, isoindolyl, quinolyl, isoquinolyl, triazolyl, thiadiazolyl, oxadiazolyl. Preferably the heteroaryl is an optionally substituted thioazole.

As used herein heterocycloalkyl means an optionally substituted cycloalkyl wherein one to four carbon atoms have been substituted with a heteroatom. Preferably, the heteroatoms are selected from nitrogen, oxygen, sulphur or phosphorous.

As used herein the term "optionally substituted" means an H has been removed from a compound and replaced with an organic fragment such as those those comprising a combination of any of carbon, hydrogen, nitrogen, oxygen and sulphur.

Preferably the compound of formula I has a molecular weight of from 50 to 1000, such as from 100 to 700, more preferably from 200 to 500.

Preferably at least 2 of R1, R2 and R3 are selected from C1-12 alkyl or C6_10 aryl. Preferably, R1, R2 and R3 are independently selected from H, 01_6 alkyl or 0610 aryl, preferably with the proviso that either one or none of R1, R2 and R3 is H. Most preferably, R1, R2 and R3 are independently selected from H, methyl, ethyl, propyl, butyl, t-butyl, pentyl and hexyl preferably with the proviso that either one or none of R1, R2 and R3 is H. In a particularly preferred embodiment, the cytochrome P450 enzyme is reacted with a compound such as bosentan, cyclosporine A or ritonavir.

The compounds of formula I are typically of the following structural formulae:

OH

The cytochrome P450 enzyme may optionally be used in combination with reductase components, which activate the cytochrome P450. In a preferred embodiment, ferredoxin and ferredoxin reductase components are used. Any components which activate the cytochrome P450 may also be used, including 0 0 \\// S,"CH3 NH 0 H3C H3C 3.:::::"..

\\."..,"A H3C CH3 \/ 0

NH

"NH-r''N 0 CH3 CH3 CH3 HsO

H

N

N''''''''-'-----rN N'''''''''''''...

I I

H

H3C 0 CH3

C

H3C H3 CH3 those fused directly or by peptide linkage. In a particularly preferred embodiment, the enzyme cytochrome P450sspc02 having SEQ ID NO 2 or a variant enzyme having at least 70% identity thereto and having CYP450 activity, is combined with suitable ferredoxin and ferredoxin reductase components to give an effective system to convert a substrate compound to a resulting hydroxylated derivative.

In a preferred embodiment, the cytochrome P450 enzyme or variant thereof is present in Streptomyces sp. NRRL 21489 cells.

In another preferred embodiment, the cytochrome P450 enzyme or variant thereof is expressed by at least one recombinant microorganism comprising heterologous nucleic acid encoding the enzyme, derived from Streptomyces sp. NRRL 21489. As used herein the term "comprising" is intended to mean containing at least the claimed sequences, but may include other sequences. In one embodiment, the recombinant microorganism comprises a heterologous nucleic acid encoding the enzyme or variant thereof.

In an alternative embodiment, the recombinant microorganism also comprises a heterologous nucleic acid encoding a reductase agent.

In another aspect of the invention, there is provided a method for the production of a hydroxylated organic compound, comprising reacting the organic 20 compound with a cytochrome P450 enzyme comprising SEQ ID NO: 2 or a variant enzyme having at least 70% identity thereto and having CYP450 activity. The choice of compound to be hydroxylated is discussed above.

In a preferred embodiment, the enzyme is used to catalyse the hydroxylation of an alkyl or aryl group.

In a particularly preferred embodiment, the compound to be hydroxylated is bosentan, cyclosporine A or ritonavir.

Optionally, one or more additional component(s) may be used to activate the cytochrome P450 enzyme. In an embodiment according to the present invention, the cytochrome P450 enzyme is used in combination with reductase components, preferably with ferredoxin and ferredoxin reductase components.

In a preferred embodiment of the invention, the cytochrome P450 enzyme or variants thereof are present in Streptomyces sp. NRRL 21489 cells. The cells may be dosed with the organic compound to be hydroxylated. The method may optionally comprise an additional step wherein the cells are subsequently harvested and purified to obtain the hydroxylated compound.

Culture of the Streptomyces sp. NRRL 21489 to produce the P450 enzyme extracts is suitably performed by seeding of a conventional culture medium containing nutrients well-known for use with such microorganisms. Thus, the culture medium contains sources of assimilable carbon and of assimilable nitrogen. The culture medium may also contain inorganic salts. Examples of sources of assimilable carbon include glucose, sucrose, starch, glycerin, millet jelly, molasses and soybean oil. Examples of sources of assimilable nitrogen include soybean solids (such as soybean meal or soybean flour), wheat germ, meat extracts, peptone, corn steep liquor, dried yeast and ammonium salts, such as ammonium sulphate. If required, inorganic salts, such as sodium chloride, potassium chloride, calcium carbonate and various phosphates, may also be included. The medium is preferably sterilized and has a pH adjusted to 5 to 8.

The skilled person will understand that the particular cultivation technique employed is not critical to the invention and any technique commonly used for the cultivation of Actinomycete bacteria may equally be employed with the present invention. In general the techniques employed will be chosen having regard to industrial efficiency. Thus, liquid culture is generally preferred and the submerged culture method is most convenient from the industrial point of view.

Cultivation is preferably carried out under aerobic conditions.

The enzyme of this invention is an inducible enzyme, and are not produced unless an induction agent is present. For preference, but not limited to, the induction agent is selected to be the same as the intended substrate for the isolated enzyme. When from 4 hours to 3 days have elapsed after inoculation, preferably 0.05 to 5 mM, more preferably 0.2 mM of induction agent is added, and then cultivation is continued for 2 hours to 1 week, preferably for about one day. The temperature of cultivation is typically 20° to 45° C., preferably 25° to 30° C., optimally about 27° C. Shake culture or aeration techniques can be adopted.

The cells obtained by the cultivation may be disrupted by cell disruption techniques such as high-pressure homogenisation in buffer solution. The supernatant obtained by centrifugation gives the crude enzyme solution. For example, the enzyme of the present invention can be obtained in a supernatant produced by centrifugation at 38,000xg for 20 minutes.

In an alternative embodiment, the cytochrome P450 enzyme or variants thereof are expressed by at least one recombinant microorganism comprising heterologous nucleic acid encoding the enzyme, derived from Streptomyces sp.

NRRL 21489.

Here, the at least one recombinant microorganism can be dosed with an organic compound to be hydroxylated. This method may optionally comprise a purification step to obtain the hydroxylated compound.

In a preferred embodiment, this can be achieved by the recombinant expression of the functional cytochrome P450sspc02 protein with intact haem. Each can be expressed with any or all of the cofactor enzymes. In a particularly preferred embodiment, ferredoxin and ferredoxin reductase may be expressed. This can be achieved by polycistronic plasmid use or via fusion, either via linkers or directly into a single protein product.

Alternatively, the functional cytochrome P4505 02 protein may be expressed alone without mixing with cofactor enzymes. In a preferred embodiment, cofactor enzymes may be titrated in to provide the active enzyme reaction after material production. The cofactors may be obtained by extraction from wild-type or recombinant materials derived from plants or microbial fermentation. Hussain & Ward,. Appl Environ Microbiol. 2003; 69(1):373-382, describe the cloning techniques that may be used.

The native organism, host strain expressing the recombinant enzyme or extracted enzyme is contacted directly with the substrate, preferably in an aqueous medium, either mono or biphasic. Reaction conditions, including choice of pH and temperature will be evident to the skilled person, based on conventional techniques. For example, a selected microbial growth medium or phosphate buffer solution at a pH value in the range of from 5 to 11, more preferably 6.5 to 9.0, most preferably around 8 may be used. The reaction temperature is preferably within the range from 20° to 45° C., more preferably from 25° to 30° C. The concentration of the substrate in the reaction medium is preferably within the range from 0.01 to 5.0% by weight. The time allowed for the reaction is normally from 1 minute to 5 days, more usually from 1 day to 5 days, although this may vary, depending upon the concentration of substrate in the reaction mixture, the reaction temperature, and other factors. The extracted enzyme material can either be used directly after extraction, after storage in frozen solution. In a particularly preferred embodiment, the extracted enzyme material can be dried, preferably by lyophilisation, for later use with or without the addition of other components required for reaction, such as other enzyme cofactor components.

After completion of the conversion reaction, the resulting hydroxylated compound can be isolated using conventional procedures, including, for instance, filtration, solvent extraction, chromatography, crystallization, and other isolation procedures. Such procedures will be selected having due regard to the identity of the product. Before, during or after the isolation, the product may or may not be derivatised, as desired.

The starting materials as substrates for the enzyme may by either derived from synthetic routes, naturally occurring, either via natural biomass such as plant material, or produced by fermentation, or by mixed routes thereof. Enzyme reactions can also be performed using pure or non-purified materials, the resulting reaction may be used to aid later purifications of reacted or unreacted components.

Of the substrate compounds used as starting materials, free bases, alkali metal salts, e.g. the sodium or potassium salts, or acid salts of organic or inorganic nature such as tosylate or hydrochlorides, are suitable for use.

After completion of the conversion reaction, the desired compound can be obtained from the reaction system, collected, isolated and purified by conventional means if required, or onward used directly in unpurified form. For example, the reaction product is centrifuged or filtered and the supernatant or filtrate is extracted with a hydrophobic resin, ion-exchange resin or water-immiscible organic solvent such as ethyl acetate. After evaporation of the solvent of the extract, the remaining crude, for example the remaining crude hydroxylated compound, may be purified by subjecting it to column chromatography using silica gel or alumina or reversed-phase stationary phase, and by eluting with a suitable eluent. If the starting material is a mixture, then the product can be isolated as a mixture of hydroxylated compounds which if desired can be separated using chromatography or other suitable techniques.

In general, the resulting hydroxylated compound may have improved pharmaceutical or agrochemical properties, such as bioactivity potency, improved solubility characteristics, reduced off-target interactions, or simply of further utility, such as for onward synthesis, or be useful for an analytical standard. Particularly preferred are the hydroxylated compounds of formula (I) above.

When the cytochrome P450 enzyme preparations of this invention is reacted with substrate compound at pH 7.4 for 5 minutes with (a) ferredoxin, (b) ferredoxin-NADP+ -reductase, (c) NADP+, (d) NADPH regeneration system, and (e) dissolved oxygen, the temperature of reaction ranges at least from 4° C. to 60° C. The optimum pH for each cytochrome ranges from 6.5 to 8.0. Each cytochrome is stable when kept for 24 hours at 4° C. in the pH range between 6.0 and 9.0.

The use of ferredoxin, ferredoxin-NADP+ -reductase, oxygen and NADPH is not essential. Any components which can activate the cytochrome P450 may be adopted.

Measurement of the enzyme activity is normally effected in one of two ways: (i) Measurement on cytochrome P450 Measurement is performed according to the method of Omura and Sato et al. (J Biol Chem, 239. 1964, 2370). That is to say, cytochrome P450 is analyzed quantitatively using the following formula, based on the difference in the absorbance of the reduced CO versus the reduced difference spectrum at 450 nm and 490 nm.

Abs(450nm) -Abs(490nm) Cytochrome P450 (704) 91 (mM cm-1) x / (cm) (ii) Measurement of rate of formation of hydroxylated substrate compound from substrate compound The following cocktail of components is employed: Potassium phosphate buffer pH 7.4 50 mM MgC12 5 mM Enzyme solution containing expressed Fd, FdR, P450 Native concentration when pellet extracted at a rate of 0.3g cell wet weight per ml extraction buffer NADP+ 1 mM Glucose-6-phosphate 5 mM Glucose-6-phosphate dehydrogenase 1 UN/ml Substrate compound 0.1 mg/ml Total volume 0.1 -0.5 ml To measure enzyme activity the components of the table are mixed, the solution is shaken at 30° C for 16-20 hours, and then 100 -500 pl of ACN is added and the reaction stopped. The amount of hydroxylated substrate formed by the enzyme system is determined with HPLC or UPLC.

Using the test methods for determining activity, the loss of activity with change in temperature and pH can be determined.

For example, the cytochrome is fully inactivated at pH 7.4 and 70° C. for 60 minutes in the presence of 20% glycerol and 2 mM dithiothreitol. The cytochrome is inactivated at pH 3 or a more acidic pH, and at pH 11 or a more basic pH (when treated at 4° C. for 24 hours in the presence of 20% glycerol and 2 mM dithiothreitol).

In a further aspect, the invention provides a kit comprising i) a cytochrome P450 enzyme comprising SEQ ID NO: 2 or a variant enzyme having at least 70% identity thereto and having CYP450 activity, or ii) a microorganism that expresses a cytochrome P450 enzyme comprising SEQ ID NO: 2 or a variant enzyme having at least 70% identity thereto and having CYP450 activity, and wherein the kit further comprises instructions for use for the hydroxylation of an organic compound.

The kit allows the user to screen for the hydroxylation of compounds of interest.

In a preferred embodiment, the kit further comprises electron donating agents. The kit may preferably comprise as the electron donating agents ferredoxin reductase and a ferredoxin with cofactors NADH or NADPH or cofactor regeneration systems such as NAD+ or NADP+, glucose or glucose-6-phosphate, and glucose-dehydrogenase or glucose-6-phosphate dehydrogenase. However, any suitable electron donating agents may be used.

Optionally, the kit may further comprise a buffer, either separately or contained with the other components.

Preferably, the kit may further comprise one or more other CYP450 10 enzymes.

Preferably, the cytochrome P450 enzyme or microorganism is lyophilised or immobilised or tethered to other macromolecules or support materials such alginate beads, Nickel columns and electrochemical electrodes.

The methods of the present invention are demonstrated in the examples below. These examples are provided as an illustration only and should not be construed as limiting on the present invention.

Examples

Example 1: Cloning of P450sspc02 from Streptomyces sp. NRRL 21489 Extraction of genomic DNA Streptomyces sp. NRRL 21489 Genomic DNA (gDNA) was isolated from cell pellet of fermentation material of Streptomyces sp. NRRL 21489. Culture medium containing 4g/L yeast extract; 10g/L malt extract; 4g/L glucose and adjusted to pH 7.0. Two Erlenmeyer flasks of 250 ml volume, each of which contained 50 ml of the medium, were sterilized 115°C for 20 minutes. Streptomyces sp. NRRL 21489 was recovered from cryovial stocks stored in liquid nitrogen and inoculated into the two flasks containing 50 ml of the above growth medium. After 2 days of growth at 27°C and 200rpm, 50m1s of culture were transferred to 50m1 centrifuge tubes and centrifuged to collect the pelleted cells. The pellet was washed once with an isotonic buffer to remove residual medium components before freezing the pellet at -80°C for later extraction of genomic DNA as described below. The cell pellet was defrosted and resuspended in 7.5 ml TE buffer (10 mM Tris-HCI pH 7.5, 1 mM Na2EDTA). Seventy-five pl of 20 mg/ml lysozyme solution was added and the solution was incubated at 37°C for 1 hour, followed by addition of 750 pl of 10% (w/v) SDS and mixing by inverting. After addition of 20 pl of 20 mg/ml pronase and incubation at 37°C for 1.5 hours, the solution was supplemented with 16 pl of 10 mg/ml RNase solution, followed by another incubation step at 37°C for 1 hour and 50°C for 1 hour. Nine hundred pl of 0.5 M NaCI solution was added before the solution was extracted twice with an equal volume of phenolchloroform-isoamylalcohol (25:24:1; Sigma-Aldrich). The aqueous layers were collected and gDNA was precipitated with 1 volume of isopropanol and centrifugation (10,000 x g, 30 min, 20°C). The gDNA pellet was washed once with 100% ethanol and twice with 70% ethanol (-30 ml each wash step).The gDNA pellet was air-dried and resuspended in 5 ml TE buffer. Concentration and purity of the gDNA was measured using a NanoDrop instrument (Thermo Scientific) and gDNA integrity was assessed by agarose gel electrophoresis.

PCR reactions P450sspc02 (SEQ ID NO: 1 -2) was cloned from Streptomyces sp. NRRL 21489 in a total reaction volume of 50 pl using primers SspCO2 J (5-primer sequence-3': ATTTTGTTTAACTTTAAGAAGGAGATATACATATGCCAACACCTTCATGCCC GGCGGGGAAG) (SEQ ID NO: 3) and SspCO2_r (5-primer sequence-3': CGATCCGCACTCACCCGCATGGTCATGAATTCTGTTTCCTATAATTATCCGT CCGTGGTGACCGGAAGGGCGAC) (SEQ ID NO: 4). PCR reactions contained 10 pl of 5x GC Green buffer (Thermo Scientific), 2.5 pl of DMSO (Sigma), 10 pL of 5M betaine (Sigma) and 1pL of formamide (Sigma), 1 pl of 10 mM of dNTPs (Thermo Scientific), 1 unit of HotStart II Phusion® High-Fidelity DNA Polymerase (Thermo Scientific), 90 ng of genomic DNA, 0.5 pM of each forward and reverse primer and the reaction was filled up to a total volume of 50 pl with PCR reactions were performed on an Eppendorf Mastercycler ep Gradient system with the following cycling conditions: 98°C for 2 minutes, 35 cycles (98°C for 45 seconds, 72°C for 30 seconds, 72°C for 2 minute), 72°C for 15 minutes. The PCR reaction was analysed by agarose gel electrophoresis and products were extracted from the agarose gel using the Thermofisher GeneJet Gel Extraction Kit and Qiagen QlAquick 96 PCR Purification Kit. The concentration of the expected 1282 by amplicon was measured using the Biochrome Genequant 1300 instrument and on the Molecular Devices Spectramax 384 plus plate reader.

Construction of pHDO5 vector The pHDO5 vector is a derivative of pHDO2 (See W02018091885A1) containing the cer sequence. The cer sequence was amplified from pKS450 plasmid (Summers and Sherratt., EMBO J. 1988; 7(3):851-858.) by PCR using the primers serf (5-primer sequence-3':

GGGTCCTCAACGACAGGAGCACGATCATGCCGGAAATACAGGAACGCACG

CTG) (SEQ ID NO: 227) and ser r (5-primer sequence-3': TTATCGCCGGCATGGCGGCCCCACGGGTGCCGGGGCACAACTCAATTTGC GGGTAC) (SEQ ID NO: 228). The expected 439 by amplicon was extracted from the agarose gel using the Thermofisher GeneJet Gel Extraction Kit and cloned into the FspAl site of pHDO2 by Gibson assembly. The plasmids containing the cer sequence were analysed by PCR screening and DNA sequence was confirmed by Sanger sequencing at LGC Genomics (Germany). The plasmid containing the cer sequence was designated as pHD05.

Cloning of P450sspco2 into pHDO5 plasmid The purified P450sspeo2 amplicon was assembled into pHDO5 vector digested with Ndel and Ecott so that that the cytochrome P450 is introduced into a polycistronic operon containing a ferredoxin (fd) and ferredoxin reductase (scfl5a). The vector was digested with restriction endonuclease (New England Biolabs). Restriction digestion was carried out for 16 h at 37°C in a total volume of 100 p1 containing 10 pl of 10x CutSmart buffer®, 2 pl of each restriction endonuclease (40 units; New England Biolabs), 5 tag of plasmid DNA. The reaction was stopped by inactivation of the restriction endonuclease at 65°C for 20 min. The expected digested products were purified using the Thermo Scientific GeneJET Gel Extraction Kit and Qiagen QlAquick 96 PCR Purification Kit. The purified digested vector and purified P450 amplicon were assembled together using Gibson assembly in a total volume of 20 pL containing -10Ong of digested vector and 1:3 (vector:insert) molar concentration of insert, 6.65% PEG 8000, 133mM Tris-Hcl (Fisher), pH7.5, 13.3mM MgC12 (Sigma), 13.3mM DTT (Sigma), 0.266mM dNTP (New England Biolabs), 1.33mM NAD (New England Biolabs), 0.495 Unit of Phusion DNA polymerase (New England Biolabs), 79.5 Units of Taq DNA ligase (New England Biolabs) and 0.075 Units of T5 exonuclease (New England Biolabs). The reaction mixture was incubated at 50 °C for 1 hour and 1 pL was introduced into 25 pL of chemically competent cells E. coil DH5a (Invitrogen) by chemical transformation. Clones were selected on Miller's Luria broth (LB) plates containing 50 lag/mL kanamycin after 16 hours of incubation at 37°C. Clones were picked and cultivated in 5 mL LB containing the same antibiotic and recombinant plasmids were isolated from the cultures using the Thermo Scientific GeneJET Plasmid Extraction Kit. DNA sequences of the P450, ferredoxin and ferredoxin reductase were analysed by PCR screening and DNA sequence was confirmed by Sanger sequencing at LGC genomics (Germany). The constructed plasmid was designated as pHD05-SspCO2.

Construction of the recombinant expression strain The strain E. coli BL21 (DE3) (Merck) was used as a host for recombinant expression of P450sspco2, ferredoxinFd and ferredoxin reductasescH5A. To construct this expression strain, E. coli BL21 (DE3) cells were transformed with the expression plasmid using chemical transformation. Twenty-five pl of chemically competent cells were mixed with 1 pl (-10Ong) of pHD05-SspCO2 plasmid followed by incubation on ice for 30 min. Heat shock was performed at 30 sec in a water bath at 42 °C and cells were subsequently chilled on ice for 2 min. One millilitre of LB was added to the cells and incubated for 1 hour at 37 °C and shaking at 250 rpm. The transformation mixture was plated onto LB plates containing 50 lag/ml kanamycin. Plates were incubated at 37 °C for 16 hours. To prepare glycerol stocks of this expression strain, several colonies was picked with a sterile loop and inoculated into 5 ml LB media containing the same antibiotics and cultivated at 37 °C and 250 rpm for 16 h. Five hundred millilitres of this culture were mixed with 500 p1 of 50% (wN) glycerol in cryovials and stored at -80 °C.

Example 2: Expression of recombinant P450 Preculture: Five milliliters of LB Miller media (Sigma) supplemented with 50 tag/ml of kanamycin was inoculated with a loop scraped from a cryovial containing E. coli BL21 (DE3) harbouring the pHD05-SspCO2 expression plasmid. Cells were grown overnight at 37°C and 250 rpm in a New Brunswick Scientific Innova 4230.

Seed: Into a 250 ml baffled flask, 50 ml of PCM8.1 media supplemented with 50 tag/ml of kanamycin was inoculated with the overnight preculture to an OD600 of 0.1 and incubated at 37°C and 200 rpm until the end of the day.

The components of PCM8.1 were MgSO4 (0.49 gC), Na2HPO4*7H20 (6.7 gL-1), KH2PO4 (3.4 gL-1), NH4CI (2.68 gL-1), Na2SO4 (0.71 gL-1), arginine (0.2 gL-1), histidine (0.15 gL-1), lysine (0.2 gL-1), phenylalanine (0.2 gL-1), serine (0.2 gL-1), threonine (0.2 gL-1), tryptophan (0.2 gL-1), methionine (0.2 gL-1), monosodium glutamate (8 gL-1), glucose (0.5 gL-1), glycerol (10 gL-1) and a 1000-fold diluted trace element solution with FeCI3 (81.1 gL-1), CaCl2*6H20 (4.38 gL-1), MnCl2*4H20 (1.98 gL-1), ZnSO4*7H20 (2.88 gL-1), CoCl2*6H20 (0.48 gL-1), CuCl2*2H20 (0.34 gL-1), NiCl2*6H20 (0.48 gL-1), Na2Moa42H20 (0.48 gL-1)., Na2Se03 (0.35 gL-1), and H3B03 (0.12 gL-1).

Production: At the end of the day, a 1 L baffled flask containing 200 mL of PCM8.1 media supplemented with 50 tag/ml of kanamycin, 23.8 tag/ml of IPTG, 320 tag/ml of 5'-aminolevulinic acid and 55 tag/ml of FeSO4"7H20 were inoculated with the seed cultures to an OD of 0.6. The induced production cultures were incubated at 27°C and 200 rpm until the cultures had reached stationary phase (approximately 16-20 hours). The cultures were harvested by centrifugation at 3,000 rpm for 15 minutes. The pellets were washed with 30 mL of wash buffer (isotonic 0.85% NaCI with 5% glycerol) and transferred into a fresh 50 mL falcon tube. The cells were further centrifuged at 4,000 rpm for 2535 minutes and the pellet was stored at -20°C for processing.

Example 3: Extraction & processing of enzyme materials Suspended cell pellets were provided as described in Example 2, containing recombinant P450, ferredoxin and ferredoxin reductase in 50mM potassium phosphate buffer pH 7.4, 5 mM MgCl2, 0.1 mM DTT, and 1 mM PMSF in a ratio of 3.33 ml of buffer per lg of cells. Lysed cells were produced by high pressure disruption using three cycles of 30 kpsi. Lysed material was centrifuged at 38,000xg for 30 minutes (4°C) and the supernatant was sterilized by passing through 0.2 micron filter to provide the enzyme preparation containing recombinant P450, ferredoxin and ferredoxin reductase. The crude extract was then dispensed into glass vials (0.5m1 per 2m1 vial), frozen and lyophilised using an Edwards Superrnodulyo Freeze-dryer before being stored in a standard laboratory freezer at -20°C until required for use.

Measurement of the concentration of cytochrome P450 were performed according to the method of Omura and Sato et al. (J Biol Chem, 239. 1964, 2370). Cytochrome P450 concentration of cell-free extracts of induced E. coil BL21 (DE3) cells harbouring pHD05-SspCO2 was 10.9 pM. Carbon monoxide difference spectrum for P450sspc02 is shown in Fig 4.

Example 4: Hydroxylase activity/spectrum testing Cell-free assay Lyophilised material of recombinant P450, ferredoxin and ferredoxin reductase proteins was made as described in Example 3 and reconstituted in high purity water to 90% the original volume. Biocatalysis was performed at 27°C in the following conditions: 50 mM potassium phosphate pH 7.4, 5 mM MgC12, 0.1 mg/ml substrate compound such as bosentan, cyclosporine A or ritonavir, native concentration of P450, ferredoxin and ferredoxin reductase as extracted (Example 3). Reactions were initiated by addition of 10x stock of cofactor mixture (50mM G6P, 10 mM NADP, 10UN/m1 G6PDH) to provide a final volume of e.g., 100 pL. After 16-20 hours, reactions were extracted with an equal volume of acetonitrile, centrifuged to remove precipitated proteins and conversion assessed by UPLC-MS analysis.

UPLC data was obtained as follows: Column: Acquity UPLC BEH Shield RP18 1.7pm 2.1mm i.d. 50mm length Solvents: H2O, B: Acetonitrile, both with 0.1% Formic acid Flow rate: 1.0m1/min Detector: Waters Acquity UPLC PDA (UV-Vis detection) and Waters Acquity UPLC QDA (MS) To confirm the identities of reaction products their chromatographic retention time, mass and ultraviolet spectra were compared with those of authentic metabolite standards.

Claims

CLAIMS1. Use of a cytochrome P450 enzyme comprising any of SEQ ID NO: 2 or a variant enzyme having at least 70% identity thereto a mutant having cytochrome P450 activity, for the hydroxylation of an organic compound.
2. The use according to claim 1, wherein the cytochrome P450 enzyme used to catalyse the hydroxylation of an organic compound is preferably consisting of SEQ ID NO: 2 or a variant enzyme having at least 70% identity thereto and having cytochrome P450 activity.
3. The use according to claims 1 or 2, wherein the cytochrome P450 enzyme is used to catalyse the hydroxylation of an alkyl or aryl group.
4. The use according to claims 1, 2 or 3, wherein the compound to be hydroxylated is of formula (I), where R represents the rest of the compound and where R1, R2 and R3 is alkyl or H: R3 R2 (I)
5. The use according to any preceding claim, wherein the compound to be hydroxylated is selected from bosentan, cyclosporine A or ritonavir.
6. The use according to any preceding claim, wherein the cytochrome P450 enzyme is used in combination with reductase components, preferably with ferredoxin and ferredoxin reductase components.
7. The use according to any preceding claim, wherein the cytochrome P450 enzyme comprises a sequence having at least 90% identity thereto, preferably 95% identity thereto, more preferably 96% identity thereto, even more preferably 97% identity thereto, most preferably 100% identity thereto.
8. The use according to any preceding claim, wherein the cytochrome P450 enzyme is in purified or part-purified form, crude enzyme extract, in a recombinant host cell or a natural host cell.
9. The use according to any preceding claim, wherein the cytochrome P450 enzyme or variant thereof is present in Streptomyces sp. NRRL 21489 cells.
10. The use according to any preceding claim, wherein the cytochrome P450 enzyme or variant thereof is expressed by at least one recombinant microorganism comprising heterologous nucleic acid encoding the enzyme, derived from Streptomyces sp. NRRL 21489.
11. A method for the production of a hydroxylated organic compound, comprising reacting the organic compound with a cytochrome P450 enzyme comprising SEQ ID NO: 2 or a variant enzyme having at least 70% identity thereto and having cytochrome P450 activity.
12. The method according to claim 11, wherein the cytochrome P450 enzyme used to catalyse the hydroxylation of an organic compound is preferably consisting of SEQ ID NO: 2 or a variant enzyme having at least 70% identity thereto and having cytochrome P450 activity.
13. The method according to claims 11 or 12, wherein the cytochrome P450 enzyme is used in combination with reductase components, preferably with ferredoxin and ferredoxin reductase components.
14. The method according to claims 11 to 13, wherein the cytochrome P450 enzyme comprises a sequence having at least 90% identity thereto, preferably 95% identity thereto, more preferably 96% identity thereto, even more preferably 97% identity thereto, most preferably 100% identity thereto.
15. The method according to claims 11 to 14, wherein the cytochrome P450 enzyme is in purified form, part-purified form, crude enzyme extract, in a recombinant host cell or a natural host cell.
16. A method according to claims 11 to 15, wherein the cytochrome P450 enzyme or variant thereof is present in Streptomyces sp. NRRL 21489 cells and wherein said cells are dosed with an organic compound to be hydroxylated, optionally wherein the cells are subsequently harvested and purified to obtain the hydroxylated compound.
17. A method according to claims 11 to 16, wherein the cytochrome P450 enzyme or variant thereof is expressed by at least one recombinant microorganism comprising heterologous nucleic acid encoding the enzyme, derived from Streptomyces sp. NRRL 21489, wherein the at least one recombinant microorganism is dosed with an organic compound to be hydroxylated, optionally followed by a purification step to obtain the hydroxylated compound.
18. A kit comprising i) a cytochrome P450 enzyme comprising SEQ ID NO: 2, or a variant enzyme having at least 70% identity thereto and having cytochrome P450 activity, or ii) a microorganism that expresses a cytochrome P450 enzyme comprising SEQ ID NO: 2, or a variant enzyme having at least 70% identity thereto and having cytochrome P450 activity, and wherein the kit further comprises instructions for use for the hydroxylation of an organic compound.
19. The kit according to claim 18, wherein the cytochrome P450 enzyme used to catalyse the hydroxylation of an organic compound is preferably consisting of SEQ ID NO: 2 or a variant enzyme having at least 70% identity thereto and having cytochrome P450 activity
20. A kit for use according to claim 18 or 19, wherein the kit further comprises a reducing agent, preferably ferredoxin reductase and a ferredoxin, optionally wherein the kit further comprises a buffer.
21. A kit according to claims 18 or 20, further comprising one or more other 15 cytochrome P450 enzymes.
22. A kit according to claims 18 to 21 wherein the cytochrome P450 enzyme or microorganism is lyophilised.