GB2573242A - Therapeutic agent - Google Patents

Abstract

A therapeutic agent which assists in wound healing for use in a method of treatment of a wound, wherein said method comprises determining whether the agent is needed and/or whether an increased amount of the agent is needed by a method of diagnosing wound type in an individual, or susceptibility to a particular wound type, comprising determining whether the individual possesses one or more inflammation related polymorphisms that affect wound healing. These polymorphisms are selected from rs 2228145 in IL-6R gene, rs 1927911 in TLR4 gene or rs 4986791 in TLR4 gene. Also claimed is a method of determining whether a particular polymorphism is associated with a particular wound type.

Description

THERAPEUTIC AGENT

Field of the Invention

The invention relates to a genetic test for determining wound type.

Background of the Invention

The treatment of wounds is a major burden on health services around the world. Improving such treatments will reduce costs and be beneficial to quality of life for patients. In the particular case of diabetes approximately 15% of all people with diabetes will be affected by a foot ulcer during their lifetime. Eighty five percent of lower extremity amputations are preceded by a diabetic leg or foot ulcer.

Summary of the Invention

The Applicant has found that certain genetic polymorphisms correlate with wound phenotypes, and in particular affect whether the wound is a healing or non-healing wound. Determining whether or not any of these polymorphisms are present can be used to choose how to treat the wound, for example whether to give more intensive therapy, such as more intensive microbiological scrutiny (and therapy) or anti-inflammatory therapy.

Accordingly the invention provides a method of diagnosing wound type in an individual, or susceptibility to a particular wound type, comprising determining whether the individual possesses one or more inflammation related polymorphisms that affect wound healing, wherein said determining typically comprises typing a position in the interleukin-6 receptor gene or the Toll-Like Receptor 4 gene, such as one or more of the following: - rs 2228145 in the interleukin-6 receptor gene - rs 1927911 in the Toll-Like Receptor 4 gene - rs 4986791 in the Toll-Like Receptor 4 gene

Detailed Description of the Invention

The invention relates to genetic analysis of wounds, and in particular using such analysis to stratify wounds into different types.

Wound type

The wound is typically associated with an inflammatory response, and may be one whose healing is being inhibited by an inflammatory response. The wound is typically an external one at the skin surface. In a preferred embodiment the wound is an ulcer, such as a recurrent or non-healing ulcer. The wound is typically a foot ulcer, leg ulcer, a diabetic ulcer, a neurotropic ulcer, a vasculitic ulcer, a pressure ulcer, an arterial ulcer, traumatic ulcer or malignant ulcer. The wound may be a diabetic foot ulcer. The wound may be caused by diabetes, an inflammatory condition, poor circulation, acute injury or be cancer associated.

The individual that is genetically typed and/or treated

The individual is typically a human, such as from a Caucasian population, a Chinese population or an African population. The individual may be from a European population. The individual may already have the wound or be suspected of being at risk of the wound, for example due to genetic, lifestyle or environmental risk factors. The individual may have a parent or a sibling with the particular wound type.

The individual may have type I or type II diabetes or may be at risk of developing type I or type II diabetes. The individual may have another condition which causes wounds, and in particular a condition which causes ulcers. The individual may previously have had ulcers, such as any of the ulcers listed herein, for example within the last 1000 days. The individual may be at least 50 years old. The individual may have neuropathy or nerve damage, for example caused by diabetes. The individual may have no sensation in a part of the body, such the feet. The individual may have poor compliance with preventative or therapeutic treatment regimens that would prevent a condition causing the wound.

Purpose of genetic typing

The genetic detection method of the invention may be carried out to diagnose the presence of, or susceptibility to, any of the wound types mentioned herein. As mentioned in sections below that allows selection of the optimal treatment and monitoring of the wound. The method can be used to select an appropriate therapy type (for example which therapeutic agent should be used) or therapy schedule (for example the dosage of the therapy which is given).

Detecting the polymorphism

The method of the invention comprises typing 1, 2 or 3 of the polymorphisms mentioned herein as associated with particular wound types. The term ‘typing’ typically refers to determining presence or absence of the relevant polymorphism. This can be done by analysing the relevant gene or a nucleic acid derived from the gene, such as mRNA or cDNA. Thus detection can be performed by genetic typing, which usually determines the identity of the nucleotide present at a defined position. In one embodiment typing is carried out by determining the presence or absence of a polymorphism which is in linkage disequilibrium with the polymorphism described herein. Such a linked polymorphism will typically be found to be present with the relevant polymorphism described herein in at least 80% of the alleles in the population.

The typing may be done by analysis of the relevant protein expressed from the gene. One or both alleles (chromosomes) of the individual may be typed. One or both forms of the expressed protein may be typed where the genetic polymorphism causes a change in the sequence of the expressed protein.

Specific Polymorphisms that are Detected

The polymorphism(s) that are detected are one of more of the following: - rs 2228145 in the interleukin-6 receptor gene. AA and AC genotypes correspond to healers. CC corresponds to non-healers. - rs 1927911 in the Toll-Like Receptor 4 gene. TT and TC correspond to healers. CC corresponds to non-healers. - rs 4986791 in the Toll-Like Receptor 4 gene. CC corresponds to healers. Possession of T on one or both alleles corresponds to non-healers.

These polymorphisms are defined further in the Examples with reference to position number and flanking sequence.

Samples from the individual

Detection may be carried out in vitro on a suitable sample from the individual, wherein the sample typically comprises nucleic acid and/or protein from the individual. The sample typically comprises a body fluid and/or cells of the individual and may, for example, be obtained using a swab, such as a mouth swab. The sample may be a blood, urine, saliva, skin, cheek cell or hair root sample. The sample is typically processed before the method is carried out, for example DNA extraction may be carried out. The polynucleotide or protein in the sample may be cleaved either physically or chemically, for example using a suitable enzyme. In one embodiment the part of polynucleotide in the sample is copied or amplified, for example by cloning or using a PCR based method prior to detecting the polymorphism.

Genetic typing and protein typing

The detection or genotyping of the polymorphism may comprise contacting a polynucleotide or polypeptide of the individual with a specific binding agent for the polymorphism and determining whether the agent binds to the polynucleotide or polypeptide, wherein binding of the agent indicates the presence of the polymorphism, and lack of binding of the agent indicates the absence of the polymorphism. In one embodiment a kit is provided comprising the specific binding agent(s) and then polymorphism detection is carried out using the specific binding agent(s) in the kit. A specific binding agent is an agent that binds with preferential or high affinity to the polynucleotide or polypeptide having the polymorphism but does not bind or binds with only low affinity to other polynucleotides or polypeptides. The specific binding agent may be a probe or primer. The probe may be a protein (such as an antibody) or an oligonucleotide. The probe may be labelled or may be capable of being labelled indirectly. The binding of the probe to the polynucleotide or polypeptide may be used to immobilise either the probe or the polynucleotide or protein.

Generally in the method, determination of the binding of the agent to the polymorphism can be carried out by determining the binding of the agent to the polynucleotide or polypeptide of the individual. However in one embodiment the agent is also able to bind the corresponding wild-type sequence, for example by binding the nucleotides/amino acids which flank the polymorphism position, although the manner of binding to the wild-type sequence will be detectably different.

The method may be based on an oligonucleotide ligation assay in which two oligonucleotide probes are used. These probes bind to adjacent areas on the polynucleotide which contains the polymorphism, allowing after binding the two probes to be ligated together by an appropriate ligase enzyme. However the presence of single mismatch within one of the probes may disrupt binding and ligation. Thus ligated probes will only occur with a polynucleotide that contains the polymorphism, and therefore the detection of the ligated product may be used to determine the presence of the polymorphism.

In one embodiment the probe is used in a heteroduplex analysis based system. In such a system when the probe is bound to polynucleotide sequence containing the polymorphism it forms a heteroduplex at the site where the polymorphism occurs and hence does not form a double strand structure. Such a heteroduplex structure can be detected by the use of single or double strand specific enzyme. Typically the probe is an RNA probe, the heteroduplex region is cleaved using RNase H and the polymorphism is detected by detecting the cleavage products.

The method may be based on fluorescent chemical cleavage mismatch analysis. In one embodiment a PCR primer is used that primes a PCR reaction only if it binds a polynucleotide containing the polymorphism, for example a sequence- or allele-specific PCR system, and the presence of the polymorphism may be determined by the detecting the PCR product. Preferably the region of the primer which is complementary to the polymorphism is at or near the 3' end of the primer. The presence of the polymorphism may be determined using a fluorescent dye and quenching agent-based PCR assay such as the Taqman PCR detection system.

The presence of the polymorphism may be determined based on the change which the presence of the polymorphism makes to the mobility of the polynucleotide or polypeptide during gel electrophoresis. In the case of a polynucleotide single-stranded conformation polymorphism (SSCP) or denaturing gradient gel electrophoresis (DDGE) analysis may be used. The presence of the polymorphism may be detected by means of fluorescence resonance energy transfer (FRET). The polymorphism may be detected by means of a dual hybridisation probe system. In one embodiment a polymorphism (or the polymorphism as a whole) is detected using a polynucleotide array, such as a gene chip.

Primers and probes which can be used in the invention will preferably be at least 10, preferably at least 15 or at least 20, or at least 40 nucleotides in length. They will typically be up to 40, 50, 60, 70, 100 or 150 nucleotides in length. They may be present in an isolated or substantially purified form. They will usually comprise sequence which is completely or partially complementary to the target sequence, and thus they will usually comprise sequence which is homologous to the relevant gene sequence. The skilled person will of course realise that sequences which target (bind) other sequences can be homologous (complementary) sequences that are capable of sufficient Watson-Crick base pairing to provide specific binding.

Polymorphisms may be detected by sequencing a region comprising the polymorphism, which may include sequencing the entire relevant gene or coding sequence.

In embodiments where an expressed protein is typed, one or more polymorphism-specific antibodies may be used, or fragments of such antibodies which retain the ability to bind the region comprising the polymorphism.

Choice of Treatment and Monitoring of the Wound

The method of the invention may be used to determine the choice of treatment for the wound. Individuals found to be non-healers will be given more intensive therapy for the wound. The choice of treatment may comprise determining how much of a therapeutic agent is administered to the individual, with individuals found to be non-healers given more of the therapeutic agent or a therapeutic agent with higher activity. An individual found to be a non-healer may be given an anti-inflammatory agent. The method of the invention may be used to choose the monitoring regime for the wound, for example whether or not to carry out a test to diagnose for presence of microbial agents and/or whether or not to administer an agent that is therapeutic for infection by microorganisms, such as an antibiotic.

The invention provides a therapeutic agent which assists in wound healing for use in a method of treatment of a wound, wherein the method of the invention is used to determine whether the agent is needed and/or whether an increased amount of the agent is needed. The agent is preferably an anti-microbial or anti-inflammatory agent, such as a silver containing anti-microbial agent. The agent may be one which is applied topically directly to the wound in which case it may be present within a dressing. Preferred dressings are a silver-containing anti-microbial dressing or a hydrogel dressing (such as a hydrogel dressing suitable for gentle debridement).

Therapeutic agents may be administered in association with appropriate diluents or carriers. They may be administered by appropriate routes, such as intravenously or topically, for example as part of a wound dressing. They may be administered in appropriate amounts, such as effective, non-toxic amounts. A Kit for Carrying Out the Invention A kit may be produced for carrying out the method of the invention. The kit may comprise means for determining the presence or absence of one or more polymorphisms in an individual. In particular, such means may include a probe, primer, pair or combination of primers, or antibody, including an antibody fragment, as defined herein which is capable of detecting or aiding detection of a polymorphism. The kit typically includes a set of instructions for carrying out the method.

Identifying Further Associated Polymorphisms

The invention provides a method of determining whether a given (candidate) genetic polymorphism causes susceptibility to a particular wound type (such as any wound mentioned herein) comprising determining whether the polymorphism is present in individuals with the particular wound type (such as healers and non-healers), and if the genetic polymorphism is found to be present in individuals with the particular wound type then typing one or more further individuals to determine whether they are susceptible to that wound type, and optionally based on the results of the test providing appropriate treatment or monitoring as described herein.

Homologous Sequences

Homologous sequences are mentioned herein. Such sequences typically have at least 70% homology, preferably at least 80%, 90%, 95%, 97% or 99% homology with the original sequence, for example over a region of at least 15, 20 or 40 or more contiguous nucleic acids (of the original sequence). Methods of measuring homology are well known in the art and it will be understood by those of skill in the art that in the present context, homology is calculated on the basis of nucleic acid identity (sometimes referred to as "hard homology").

For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology (for example used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p3 87-395). The PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (typically on their default settings), for example as described in Altschul S. F. (1993) J Mol Evol 36 : 290-300 ; Altschul, S, F et al (1990) J Mol Biol 215 : 403-10.Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi. nlm.nih.gov/).

This algorithm involves first identifying high scoring sequence pair (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positivevalued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al, supra). These initial neighbourhood word hits act as seeds for initiating searches to find HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.

The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands. The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e. g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P (N)), which provides an indication of the probability by which a match between two nucleotide sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

The homologous sequence typically differs from the original sequence by no more than 2, 5, 10, 15 or 20 mutations (which may be substitutions, deletions or insertions). These mutations may be measured across any of the regions mentioned above in relation to calculating homology.

The invention is illustrated by the following Examples:

Example 1

Identifying IL6 Receptor Polymorphisms Associated with Wound Phenotype

Summary

Patients enrolled in this study had previously been diagnosed with either type 1 or type 2 diabetes mellitus and exhibited some degree of foot ulceration. Each patient attended two hospital visits (t=0 and t=l). Upon each visit, the length, width and depth of the patient’s wound was measured. The wound was photographed and its position recorded.

Using a mobile wound analysing application (MOWA), the surface areas of patient wounds were calculated for t=0 and t=l. The rate of healing was determined and patients were grouped into “healers” or “non-healers”.

Two single nucleotide polymorphisms (SNPs) were identified as being associated with inflammation pathways and hence potentially associated with non-healing wounds, which we are assuming may be “trapped” in an inflammatory phase. These SNPs are as follows, IL6 G-174C and IL6-R Asp358Ala.

Two primer sets capable of amplifying the region in which these SNPs are located were designed and prepared. The PCR and sequencing conditions for each primer set were optimised. All patients (n=58) were genotyped for IL6 G-174C and IL6-R Asp358Ala.

Chi-squared test was used to determine any significant association between IL6 G-174C and IL6-R Asp358Ala genotypes and healers or non-healers. It was found that no statistically significant link exists between IL6-174 G-C genotype and wound status. However the data shows that the CC genotype for IL-6R Asp358Ala is associated with non-healing wounds.

Introduction

One hypothesis for the case of non healing wounds is that they are trapped in a biochemical/physical state which does not allow for cell proliferation or remodelling. This “state” could, in part, be involved in inflammatory pathways and signaling via molecules in said pathways. One such molecule is the cytokine Interleukin 6 (IL-6). SNPs in IL-6 and its cognate receptor IL6-R have been associated with aberrant inflammatory processes. As a means to assess the relevance of these molecules to the wound healing process, we have examined the frequency of certain polymorphisms within patients participating in this study. These SNPs are as follows, IL-6 G-174C and IL6-R Asp358Ala. IL-6 G-174C is a mutation within the IL-6 gene which results in a change from the ancestral allele G to C. A CC genotype can result in decreased levels of IL-6. IL-6 is an important cytokine in the first steps of inflammation. IL-6 is secreted by various cells which participate in inflammation and in particular is involved in the acute phase response and in the immune response through T and B cell activation. IL6-R Asp358Ala is a mutation on the IL-6R gene that results in an amino acid change from Aspargine to Alanine. An A to C SNP on the IL-6R gene has been shown to have an effect on IL-6R and consequently IL-6 levels. Subjects with the CC genotypes may have higher levels of IL-6, thereby increasing the acute inflammatory response to trauma.

Objectives 1. To identify the occurrence of the SNPs IL-6 G-174C and IL6-R Asp358Ala study. 2. Examine the possibility of an association between the SNPs IL-6 G-174C and IL6-R Asp358Ala with the healing of diabetic foot ulcers.

Sample collection

Patients were from the UK. They had previously been diagnosed with either type 1 or type 2 diabetes mellitus and exhibited some degree of foot ulceration. Staff at Leeds Teaching Hospital Trust collected buccal cells from patients participating in this study by means of oral swabbing. The swabs were transported to SensaPharm Ltd where upon delivery the samples were logged and stored at -20°C.

Each patient attended two hospital visits (t=0 and t=l). Upon each visit, the length, width and depth of the patients wound was measured. The wound was photographed and recorded. DNA Extraction DNA was extracted from the samples using the protocol SPL/WE100 “DNA extraction from i4i buccal swabs (cotton) using QIAmp mini spin columns”. The method was as follows, 1ml phosphate buffered saline (PBS) was added to a microcentrifuge tube. A buccal swab was placed into the microcentrifuge tube and agitated to transfer any buccal cells from the swab into the PBS solution. This was repeated using a second swab to increase the yield of buccal cells. 400μ1 of lysis buffer and 20μ1 of proteinase K was added and the solution was incubated at 56°C to break open any cells and release the DNA. Ethanol was added to precipitate the DNA out of solution. The mixture was passed through a solid phase extraction column. The column retains any DNA in the mixture whilst the “waste” passes through. 150μ1 of elution buffer was added to the column. The buffer, along with any purified DNA was eluted into a collection tube and retained for amplification.

Polymerase Chain Reaction PCR is a technique used to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. The DNA extracted from the samples was subjected to PCR for each of the SNPs in question using protocol CGL/WI/166 “Setting up a standard PCR reaction”. For each 25μΐ reaction, conditions were as follows, 2.5pi of lOx buffer, 2.5μ1 DNTP mix (2mM; Invitrogen), 1 μΐ of each primer (Table 1) (lOmM; IDT), 1 μΐ MgCh (25mM), 0.2μ1 Taq polymerase and 6.8 μΐ microbiology grade water. 1 Ομί of template DNA was used.

The PCR conditions used are as follows, initial denaturation at 95°C for 5 min, followed by 35 cycles of a 30-sec 95°C denaturation, 1 min annealing at 59°C and 1 min elongation at 72°C, all followed by a final extension of 10 min at 72°C.

Table 1 forward and reverse primers used in PCR for each SNP. SNP Forward Primer Reverse Primer

IL-6 G- TCGTGCATGACTTCAGCTTT TCCTATATTTATTGGGGGTTGAGA

174C

IL6-R GGTTGTCAGAGCTGTTTCAT TCAGAATGGGCAAAGGAAAG

Asp358Ala DNA Sequencing

The PCR products from each sample were then sequenced using an ABI 3130 genetic analyser in accordance with CGL/WI/113 “preparing, running and analyzing sequencing reactions for running on the ABI 3130 using BigDye XTerminator clean up kit”.

Chromatograms produced from the sequencing where analysed using the software package Chromas Pro. This allowed for genotype identification by aligning the unknown sequences against a reference sequence.

Wound Analysis

Digital wound images were transferred to a tablet computer for use with the Mobile Wound Analyser (MOWA). MOWA is an application for advanced management of pressure ulcers from diabetes and vascular disease. The wound analysis software enables the accurate measurement of the surface area of the wound providing that some form of measurement or scale is included. MOWA is a Medical Device of Class I, Medical Devices Directive 93/42/EEC, and amended by 2007/47/CE. The medical device is in conformity with the essential requirements of Annex I of the EEC directive. The conformity assessment procedure was performed according to Annex VII (class I) of the EEC directive. MOWA was used to measure the surface area of patient wounds from photographs taken at each hospital visit (t=0 and t=l). The change in wound area (cm2) between t=0 and t=l was calculated. The change in area was then divided by the time (days) between t=0 and t=l to produce a rate of change or “healing rate” (cm2/day). A wound with a negative healing rate is reducing in size and can be considered to be healing. A wound with a positive healing rate is getting larger and can be considered as not healing (Table 2).

Results

Table 2 patient genotypes and healing rate.

Statistical Analysis

Chi-squared testing via SPSS Mac, version 22 (IBM SPSS, Chicago, IL) was performed using genotype and healing status data from Table 2. x2 was used to compare the proportions of genotypes to healing and non-healing wounds. P values of less than 0.05 were considered to be of significance.

IL6-174 G-C

Patients were separated into two distinct groups, healing or non-healing. These groups were then sub-divided by genotype with regards to the SNP IL6-174 G-C. In the “healing” group there were 27 patients with the GG/GC genotype and 7 patients with the CC genotype. In the “non-healing” group there were 16 patients with the GG/GC genotype and 8 patients with the CC genotype (Table 3). Pearsons Chi-squared test was

used to examine the frequency of genotypes within the healing and non-healing groups. The x2 test returned a P value of 0.275 (72.5% confidence), suggesting that there is no statistically significant link between our IL6-174 G-C genotype groups and wound status.

Table 3 Healing status of 58 patients in relation to IL6-174 G-C genotype.

Wound Status

IL6-174 G-C Healing Not healing P GG/GC 27 16 CC 7 8

The GG/GC band was then separated to produce a further group resulting in a total of three patient groups (GG, GC and CC). These groups were then split into “healing” and “non healing” and the genotype frequencies (%) were calculated. Pearsons Chi-squared test was used to examine the frequency of genotypes within the “healing” and and “nonhealing” groups. The x2 test returned a P value of 0.893 (10.7% confidence) suggesting that there is no statistically significant link between the IL6-174 G-C genotype and wound status.

Table 4 Genotype frequency for healing and non healing wounds.

Genotype frequency %

Wound Status GG GC CC P |

Healing 50 47.8 46.7

Not healing 50 52.2 53.3 U IL-6R Asp358Ala

Again, patients were separated into “healing” and “non-healing” groups. These two groups were then sub-divided by genotype with regards to the SNP IL-6R Asp358Ala. In the “healing” group 29 patients had the AA or AC genotype whilst only 6 patients had the CC genotype. In the “non-healing” group, there were 14 patients with the AA or AC genotype and 9 patients with the CC genotype (Table 5).

Pearsons Chi-squared test was used to examine the frequency of genotypes within the “healing” and “non-healing” groups. The x2 test returned a P value of 0.089 (91.1% confidence).

Table 5 Healing status of 58 patients in relation to IL6R Asp358Ala genotype.

Wound Status

Asp358Ala Healing Not healing P A^/AC 28 0.089

The AA/AC band was then separated to produce a further group resulting in a total of three patient groups (AA, AC and AA). These groups were then split into “healing” and “non healing” and the genotype frequencies (%) were calculated. Pearsons Chi-squared test was used to examine the frequency of genotypes within the healing and non-healing groups (Table 6). The x2 test returned a P value of 0.0000012 (99.999% confidence), suggesting a statistically significant link exists between the IL-6R Asp358Ala genotype and wound status.

Table 6 Genotype frequency for healing and non healing wounds.

Genotype frequency %

Wound Status AA AC CC P | XTHe.al11;? 0.0000012 Not healing 23.5 42.3 60

Conclusions

In this study 58 patients were genotyped for the SNPs IL-6 G-174C and IL6-R Asp358Ala. For IL-6 G-174C it was found that 43 patients were either wild-type homozygous (GG) or heterozygous (GC) whilst 15 patients were found to have the mutant CC genotype. From Table 3 it can be seen that no statistically significant link exists between IL6-174 G-C genotype groups (GG/GC and CC) and wound status (P=0.275, x2 test). When patient groups were further split (GG, GC and CC) and the frequency compared to healing and non-healing (Table 4), again it was found that no statistically significant link exists between IL6-174 G-C genotype and wound status (P=0.893, x2 test).

Of the 58 patients genotyped for IL-6R Asp358Ala 43 were either wild-type homozygous (AA) or heterozygous (AC). 15 patients were found to have the mutant homozygous CC genotype. From Table 4 it can be seen that there is a borderline statistically significant association between IL-6R Asp358Ala genotype and the healing status of patients ¢7=0.089, x2 test).

When patient groups were further split (AA, AC and CC) and the frequency compared to healing and non-healing (Table 6), it was found that a statistically significant link exists between IL-6R Asp358Ala genotype and wound status ¢7=0.0000012, x2 test).

The IL-6 G -174C homozygous mutant CC genotype results in decreased levels of IL-6 and we would not expect this genotype to potentiate the inflammation process. However, the IL6-R Asp358Ala CC genotype causes higher levels of IL-6, possibly constitutive, thereby increasing/maintaining the acute inflammatory response.

Example 2

Identifying Toll-Like Receptor 4 (TLR4) Polymorphisms Associated with Wound Phenotype

Summary

An investigation was carried out to determine if single nucleotide polymorphisms (SNPs) in the Toll-Like Receptor 4 gene are associated with non-healing wounds. The SNPs under investigation are rsl927911, rsl927914, rs4986790 and rs4986791.

Specific primers were designed to amplify the regions of the gene in which the SNPs are located. All SNPs were amplified separately apart from rs4986790 and rs4986791, which were amplified as a single PCR product. The PCR conditions were optimized for each set of primers and a total of 57 patients were genotyped for the SNPs by either sequencing or RFLP.

Introduction

Diabetic Foot Ulcers (DFU) are chronic non-healing wounds common in patients with type 2 diabetes, as unresolved wound healing is a major symptom of the disease. DFU occurs in type 1 diabetes too, although the percentages are not as high. The inability to heal wounds properly means that the ulcers often become infected, causes more health complications to the individuals. TLR4 has been linked to wound healing recently, with wounds lacking in TLR4 healing slowly or turning into chronic non-healing ulcers. A hypothesis for the occurrence of non-healing wounds is that the wound is “trapped” in the inflammatory phase of healing, and so cell proliferation and remodelling are not being allowed to occur. A structural change in the receptor could cause this modification of the healing process, and so SNPs could potentially have a crucial role in the healing of DFUs. This hypothesis suggests that each individual’s genetic make-up can influence their healing responses, and the aim of this study is to determine whether there is any evidence to support or refute the hypothesis that polymorphisms in the Toll-Like receptor 4 gene could affect the severity of diabetic foot ulcers.

Objectives

To determine if single nucleotide polymorphisms (SNPs) in the Toll-Like 4 Receptor affect the healing of diabetic foot ulcers (DFUs). DNA Extraction DNA was extracted from the samples using the protocol SPL/WI/100 “DNA extraction from i4i buccal swabs (cotton) using QIAmp mini spin columns”. The method was as follows: 1ml phosphate buffered saline (PBS) was added to a microcentrifuge tube. A buccal swab was placed into the microcentrifuge tube and agitated to transfer any buccal cells from the swab into the PBS solution. This was repeated using a second swab to increase the yield of buccal cells. 400μ1 of lysis buffer and 20μ1 of proteinase K was added and the solution was incubated at 56°C to break open any cells and release the DNA.Ethanol was added to precipitate the DNA. The Ethanol precipitate was passed through a solid phase extraction column. The column retains DNA. 150μ1 of elution buffer was added to the column. The DNA was eluted into a collection tube, quantified with the NanoDrop 2000 and retained for amplification.

Polymerase Chain Reaction

The Extracted DNA was amplified using PCR for each one of the SNPs in question using the work instruction CGL/WI/116 “Setting up a standard PCR reaction”. The reaction volume was 25μ1 and the volumes of reagents were as follows: 2.5μ1 10X Reaction Buffer, 2.5μ1 dNTP mix (2mM; Invitrogen), 1.5μ1 MgCh (25 mM), 1 μΐ Forward Primer (lOmM; IDT), 1 μΐ Reverse Primer (lOmM; IDT), 0.2μ1 Taq Polymerase and 6.3μ1 microbiology grade water. 1 Ομί of template DNA was added to this master mix.

The PCR conditions used are as follows, initial denaturation step of 95°C for 5 minutes, followed by 35 cycles of a 40 second denaturation step of 94°C, a 45 second annealing step of variable temperature, a 40 second elongation step of 72°C, all followed by a final extension step at 72°C for 10 minutes.

Genotyping

Polymorphisms rs4986790, rs4986791 and rsl927914 were genotyped using endpoint genotyping. Endpoint genotyping analysis uses two sequence-specific probes (e.g. TaqMan probes) that are designed for wild type and mutant target DNA and these probes are labelled with different fluorescent dyes. Each probe contains two labels (a fluorescent reporter and a quencher), which are in close proximity to each other. When the probe is intact, the quencher can suppress the reporter signal. During the elongation process the probe is cleaved thus separating the reporter and the quencher from each other and that is seen as a fluorescent signal from the reporter. The software determines the genotype of the sample by measuring the intensity distribution of used dyes after PCR.

The polymorphism rs 1927911 was genotyped using restriction fragment length polymorphism (RFLP). For each patient sample, 5μΐ of 203bp PCR product was added to 3μ1 Styl enzyme (NE Biolabs), 5μ1 ΙΟχ NE Buffer, and 37μ1 FLO. Each sample was allowed to digest overnight at 37 °C. The restricted products were ran out on a 2.5% gel. The TT genotype is not cut by the enzyme resulting in one band of 203bp. The C allele does cut, resulting in 178 and 25bp products. A TC genotype would therefore result in two bands of 203 and 178bp whilst a CC genotype would result in one band of 178bp. 20% of the samples genotyped by RFLP were also genotyped using an ABI 3130 Genetic Analyser for quality purposes.

Results

Table 7. Patient genotypes for Toll 4 polymorphisms and healing rates.

rs 1927911 (present in an intron)

Patients were separated into two distinct groups, healing or non-healing. These groups were then sub-divided by genotype with regards to the SNP rs 1927911. Using the data from Table 7, the frequencies of each genotype were calculated for healers and nonhealers. The distribution of the genotypes in healers and non-healers is shown in Table 8.

Table 8 Genotypes and genotype frequencies of patients with healing and nonhealing wounds.

Patient genotype was broken down to examine the allelic frequencies within patient groups. The distribution of rs 1927911 alleles in healing and non-healing groups can be seen in Table 9.

Table 9 Allelic frequencies of patients with healing and non-healing wounds.

The frequency of the T allele was 38.2% and 18.8% in healing and non-healing groups, respectively. The frequency of the C allele was 61.8% and 81.2% in healing and nonhealing groups, respectively. Statistical analysis of our data showed a significant increase in the frequency of the T allele amongst healers and of the C allele amongst non-healers (p=0.002). rs 1927914 (present in 5’ UTR)

Patients were separated into two distinct groups, healing or non-healing. These groups were then sub-divided by genotype with regards to the SNP rs 1927914. Using the data from Table 7, the frequencies of each genotype were calculated for healers and nonhealers. The distribution of the genotypes in healers and non-healers is shown in Table 10.

Table 10 Genotypes and genotype frequencies of patients with healing and nonhealing wounds.

Patient genotype was broken down to examine the allelic frequencies within patient groups. The distribution of rs 1927914 alleles in healing and non-healing groups can be seen in Table 11.

Table 11 Allelic frequencies of patients with healing and non-healing wounds.

The frequency of the T allele was 57.4% and 65.2% in healing and non-healing groups, respectively. The frequency of the C allele was 42.6% and 34.8% in healing and nonhealing groups, respectively. Statistical analysis of our data showed no significant change in the distribution of T or C alleles amongst healers and non-healers (p=0.399). rs 4986790 (present in exon 3, also known as Asp299Gly and 896A/G. G polymorphism causes Asp to Glycine amino acid change)

Patients were separated into two distinct groups, healing or non-healing. These groups were then sub-divided by genotype with regards to the SNP rs 4986790. Using the data from Table 7, the frequencies of each genotype were calculated for healers and nonhealers. The distribution of the genotypes in healers and non-healers is shown in Table 12.

Table 12 Genotypes and genotype frequencies of patients with healing and nonhealing wounds.

Patient genotype was broken down to examine the allelic frequencies within patients groups. The distribution of rs 4986790 alleles in healing and non-healing groups can be seen in Table 13.

Table 13 Allelic frequencies of patients with healing and non-healing wounds.

The frequency of the A allele was 95.6% and 89.6% in healing and non-healing groups, respectively. The frequency of the G allele was 4.4% and 10.4% in healing and non

healing groups, respectively. Statistical analysis of our data showed no significant change in the distribution of A or G alleles amongst healers and non-healers (p=0.208). rs 4986791 (present in exon 3. T polymorphism cause amino acid change of threonine to isoleucine)

Patients were separated into two distinct groups, healing or non-healing. These groups were then sub-divided by genotype with regards to the SNP rs 4986791. Using the data from Table 7, the frequencies of each genotype were calculated for healers and nonhealers. The distribution of the genotypes in healers and non-healers is shown in Table 14.

Table 14 Genotypes and genotype frequencies of patients with healing and nonhealing wounds.

Patient genotype was broken down to examine the allelic frequencies within patients groups. The distribution of rs 4986791 alleles in healing and non-healing groups can be seen in Table 15.

Table 15 Allelic frequencies of patients with healing and non-healing wounds.

The frequency of the C allele was 97.1% and 89.6% in healing and non-healing groups, respectively. The frequency of the T allele was 2.9% and 10.4% in healing and nonhealing groups, respectively. Statistical analysis of our data showed a borderline significant increase in the frequency of the C allele amongst healers and the T allele amongst non-healers (p=0.096).

Methodology for each SNP rs!927911

Melting temps of primers: 58.78°C and 58.72°C PCR optimisation at 57, 58, 59 and 60°C with 1.5 μΐ MgCh PCR Conditions: 95°C 5 Minutes 1 cycle 94°C 40 seconds 57°C 45 seconds 3 cycles 72°C 40 seconds 72°C 10 minutes 1 cycle

Restriction digested with the enzyme Styl (Restriction Site - C|CWWGG) and the following method:

Genotype from the agarose gel using the following key: TT-339, 153 TC-339, 153, 85 and 68 CC-339, 85 and 68

Reagents Required:

Distilled Water

Reaction Buffer

MgCh DNTPs DNA Polymerase

Corresponding Primers

Enzyme Styl NEBuffer3.1

rs!927914

Melting temps of primers: 59.05°C and 57.32°C PCR optimisation at 57, 58, 59 and 60°C with 1.5μ1 MgCh PCR Conditions: 95°C 5 Minutes 1 cycle 94°C 40 seconds 57°C 45 seconds 3 cycles 72°C 40 seconds 72°C 10 minutes 1 cycle

Restriction digested with the enzyme SphI (Restriction Site - GCATG|C) and the following method:

Genotype from the agarose gel using the following key: TT - 375 TC-375, 113 and 262 CC - 113 and 262

Reagents Required:

Distilled Water

Reaction Buffer

MgCh DNTPs DNA Polymerase

Corresponding Primers

Enzyme SphI NEBuffer2.1

rs4986790 and rs4986791

Melting temps of primers: 59.01°C and 57.91°C PCR optimisation at 57, 58, 59 and 60°C with 1.5μ1 MgCk PCR Conditions: 95°C 5 Minutes 1 cycle 94°C 40 seconds 58°C 45 seconds 3 cycles 72°C 40 seconds 72°C 10 minutes 1 cycle SAP/EXO samples. Sequence using the forward primer.

Reagents required for sequencing:

Distilled Water

Antarctic Phosphatase

Exonuclease I

Big Dye Terminator 3.1 Mix 5X Sequencing Buffer

Corresponding primers SAM solution

Xterminator

Further Description of the Associated Polymorphisms IL6-R Asp358Ala rs number rs2228145 [Homo sapiens] rs8192284 has merged into rs2228145 [Homo sapiens] rs52837205 has merged into rs2228145 [Homo sapiens] rs58037860 has merged into rs2228145 [Homo sapiens] rsl 17579727 has merged into rs2228145 [Homo sapiens] (from hitpy/www.nchi.nim.nih.gov/snp, accessed 04 Sept 2015)

Mutation position • Position 1510 (mRNA sequence NM_000565.3) or • Position 358 protein sequence (NP_000556.1) (hlipl.ifr:NN.:lNGnfrpi,}bP.gp^:/prpiecis/SNP/snp__ref,cgiPrs^2228145, accessed 04 Sept 2015)

Flanking sequence

Homo sapiens interleukin 6 receptor (IL6R), transcript variant 1, mRNA, NCBI Reference Sequence (polymorphic position underlined): 1381 ggacagaatc caggagtcct ccagctgaga acgaggtgtc cacccccatg caggcactta 1441 ctactaataa agacgatgat aatattctct tcagagattc tgcaaatgcg acaagcctcc 1501 cagtgcaaga ttcttcttca gtaccactgc ccacattcct ggttgctgga gggagcctgg 1561 ccttcggaac gctcctctgc attgccattg ttctgaggtt caagaagacg tggaagctgc 1621 gggctctgaa ggaaggcaag acaagcatgc atccgccgta ctctttgggg cagctggtcc (NM 000565.3, frtpi/2y/4/wniGPmhnmfrl:S//y/niiccore/NM 000565G, accessed 04 Sept 2015) TLR4 SNP1 rs number rsl 927911 [Homo sapiens] rs60903652 has merged into rsl927911 [Homo sapiens] rs386549387 has merged into rsl 927911 [Homo sapiens] (from http:/.(www.ncbi.nlm.nih.gov/snp, accessed 04 Sept 2015)

Mutation position • Position 8595 (NCBI reference sequence NG_011475.1) (http://vwyv.ncbi.nlm.nih.gov/projects/SNP'snp_ref.cgi?rs------1927911, accessed 04 Sept 2015)

Flanking sequence

Homo sapiens toll-like receptor 4 (TLR4), RefSeqGene on chromosome 9 NCBI Reference Sequence: NG 011475.1 (polymorphic position underlined) 8401 attcagaaat tagatgggag cgttagagaa ttaggcttac aaagaatgtg ggaaagtagg 8461 ctagaaagca gtgtaaaaac aaagacagca taaagcactt gaccttattt actaggttcc 8521 accatgggaa tccatgcact ctaaagattt ccccctattt ctacatcact ttgctcaagg 8581 gtcaatgagc caagaaaaag aatgcagttg tcaaaatctg ggccatgact aaggaaggtc 8641 tggacatctt gactgccaga cagtctcccc aatgatatgg agtatttaaa atgatactgg 8701 atattttatt tattttttgt attttcaact tttaagttca gaggcacatg tgcagagcat 8761 gcaggtttat tacataagta aatgtgtgcc atggtgattt gctgcataga tcatgaaaat (http://wwty.ncbi.nlm.nih.gov/huccore/NG 011475.1, accessed 04 Sept 2015) TLR4 SNP1 rs number rs4986791 [Homo sapiens] rs52826331 has merged into rs4986791 [Homo sapiens] (from http://wvirw.ncbi.nhn.nih.gov/snp, accessed 07 Sept 2015)

Mutation position • Position 14143 (NCBI reference sequence NG_011475.1) (http://www.ncbi.nlm.nih.gov/projects/SNP/snp refcgi?rs=4986791, accessed 07 Sept 2015)

Flanking sequence

Homo sapiens toll-like receptor 4 (TLR4), RefSeqGene on chromosome 9 NCBI Reference Sequence: NG 011475.1 (polymorphic position underlined) 13921 acttttctta taatttcgga tggcaacatt tagaattagt taactgtaaa tttggacagt 13981 ttcccacatt gaaactcaaa tctctcaaaa ggcttacttt cacttccaac aaaggtggga 14041 atgctttttc agaagttgat ctaccaagcc ttgagtttct agatctcagt agaaatggct 14101 tgagtttcaa aggttgctgt tctcaaagtg attttgggac aascagccta aagtatttag 14161 atctgagctt caatggtgtt attaccatga gttcaaactt cttgggctta gaacaactag 14221 aacatctgga tttccagcat tccaatttga aacaaatgag tgagttttca gtattcctat 14281 cactcagaaa cctcatttac cttgacattt ctcatactca caccagagtt gctttcaatg 14341 gcatcttcaa tggcttgtcc agtctcgaag tcttgaaaat ggctggcaat tctttccagg 14401 aaaacttcct tccagatatc ttcacagagc tgagaaactt gaccttcctg gacctctctc 14461 agtgtcaact ggagcagttg tctccaacag catttaactc actctccagt cttcaggtac

The following clauses define features of the invention.

Clause 1: A method of diagnosing wound type in an individual, or susceptibility to a particular wound type, comprising determining whether the individual possesses one or more inflammation related polymorphisms that affect wound healing, wherein said determining comprises typing one or more of the following: - rs 2228145 in the interleukin-6 receptor gene - rs 1927911 in the Toll-Like Receptor 4 gene - rs 4986791 in the Toll-Like Receptor 4 gene.

Clause 2: A method according to clause 1 wherein: - both alleles of the individual are typed at one or more of the specified gene locations, and/or - a position is typed which is in linkage disequilibrium with the specified position to determine the identity of the nucleotide at the specified position, and/or - said typing comprises determining the identity of the nucleotide at the specified position(s) by sequencing.

Clause 3: A method according to clause 1 or 2 wherein the wound type is associated with an inflammatory response.

Clause 4: A method according to any one of the preceding clauses wherein the wound type is an ulcer, optionally: a foot ulcer, leg ulcer, a diabetic ulcer, a neurotropic ulcer, a vasculitic ulcer, a pressure ulcer, an arterial ulcer, traumatic ulcer or malignant ulcer.

Clause 5: A method according to any one of the preceding clauses wherein: - the individual has type I or type II diabetes or is at risk of developing type I or type II diabetes, and/or - the individual has a condition which causes ulcers, and/or - the individual has previously had ulcers, such as any of the ulcers listed in claim 4, and/or - the individual is at risk of being wounded, and/or - the individual is at least 50 years old.

Clause 6: A method according to any of the proceeding clauses comprising contacting a specific binding agent with a polynucleotide of the individual and determining the identity of the nucleotide at the specified position based on whether or not binding to the polynucleotide occurs, wherein optionally: the specific binding agent is a polynucleotide, and/or is provided in the form of a kit, and/or is in the form of a gene array.

Clause 7: A method according to any one of clauses 1 to 6 which is carried out by analysis of the expressed interleukin-6 receptor protein or Toll-Like Receptor 4 protein of the individual, wherein preferably a specific binding agent is contacted with said protein from the individual and to determine the presence or absence of a polymorphism in the protein based on whether or not binding to the protein occurs, and wherein optionally: the specific binding agent is an antibody and/or is provided in the form of a kit.

Clause 8: A method according to any one of the preceding clauses which is carried out to determine the choice of treatment for the wound, and wherein optionally: - said choice comprises determining how much of a therapeutic agent is administered to the individual, and/or - the method further comprises providing a treatment to the individual which treatment is selected based on which genotype the individual possesses at any of the specified positions.

Clause 9: A method according to any one of the preceding clauses which is carried out to determine the choice of type of monitoring for the wound, wherein preferably the method further comprises monitoring the wound in a manner determined by which genotype the individual possesses at any of the specified positions, wherein optionally said choice is whether or not to diagnose for microbial infection at the wound.

Clause 10: A therapeutic agent which assists in wound healing for use in a method of treatment of a wound, wherein said method comprises determining by the method of any one of clauses 1 to 9 whether the agent is needed and/or whether an increased amount of the agent is needed, and administering the chosen agent to the individual; wherein said agent is preferably an anti-microbial or anti-inflammatory agent, and is optionally a silver containing anti-microbial dressing or a hydrogel dressing suitable for gentle debridement.

Clause 11: A method of determining whether a given genetic polymorphism causes susceptibility to a particular wound type comprising determining whether the polymorphism is present in individuals with the particular wound type, and if the genetic polymorphism is found to be present in individuals with the particular wound type then typing one or more further individuals to determine whether they are susceptible to that wound type.

Claims (10)

1. A therapeutic agent which assists in wound healing for use in a method of treatment of a wound, wherein said method comprises determining whether the agent is needed and/or whether an increased amount of the agent is needed by a method of diagnosing wound type in an individual, or susceptibility to a particular wound type, comprising determining whether the individual possesses one or more inflammation related polymorphisms that affect wound healing, wherein said determining comprises typing one or more of the following: - rs 2228145 in the interleukin-6 receptor gene - rs 1927911 in the Toll-Like Receptor 4 gene - rs 4986791 in the Toll-Like Receptor 4 gene, and administering the chosen agent to the individual; wherein said agent is preferably an anti-microbial or anti-inflammatory agent, and is optionally a silver containing anti-microbial dressing or a hydrogel dressing suitable for gentle debridement.

2. A therapeutic agent according to claim 1 wherein, in the method of diagnosing wound type in an individual, or susceptibility to a particular wound type, - both alleles of the individual are typed at one or more of the specified gene locations, and/or - a position is typed which is in linkage disequilibrium with the specified position to determine the identity of the nucleotide at the specified position, and/or - said typing comprises determining the identity of the nucleotide at the specified position(s) by sequencing.

3. A therapeutic agent according to claim 1 or 2 wherein, in the method of diagnosing wound type in an individual, or susceptibility to a particular wound type, the wound type is associated with an inflammatory response.

4. A therapeutic agent according to any one of the preceding claims wherein, in the method of diagnosing wound type in an individual, or susceptibility to a particular wound type, the wound type is an ulcer, optionally: a foot ulcer, leg ulcer, a diabetic ulcer, a neurotropic ulcer, a vasculitic ulcer, a pressure ulcer, an arterial ulcer, traumatic ulcer or malignant ulcer.

5. A therapeutic agent according to any one of the preceding claims wherein, in the method of diagnosing wound type in an individual, or susceptibility to a particular wound type, - the individual has type I or type II diabetes or is at risk of developing type I or type II diabetes, and/or - the individual has a condition which causes ulcers, and/or - the individual has previously had ulcers, such as any of the ulcers listed in claim 4, and/or - the individual is at risk of being wounded, and/or - the individual is at least 50 years old.

6. A therapeutic agent according to any one of the preceding claims, wherein the method of diagnosing wound type in an individual, or susceptibility to a particular wound type, comprises contacting a specific binding agent with a polynucleotide of the individual and determining the identity of the nucleotide at the specified position based on whether or not binding to the polynucleotide occurs, wherein optionally: the specific binding agent is a polynucleotide, and/or is provided in the form of a kit, and/or is in the form of a gene array.

7. A therapeutic agent according to any one of claims 1 to 6, wherein the method of diagnosing wound type in an individual, or susceptibility to a particular wound type, is carried out by analysis of the expressed interleukin-6 receptor protein or Toll-Like Receptor 4 protein of the individual, wherein preferably a specific binding agent is contacted with said protein from the individual and to determine the presence or absence of a polymorphism in the protein based on whether or not binding to the protein occurs, and wherein optionally: the specific binding agent is an antibody and/or is provided in the form of a kit.

8. A therapeutic agent according to any one of the preceding claims, wherein the method of diagnosing wound type in an individual, or susceptibility to a particular wound type, is carried out to determine the choice of treatment for the wound, and wherein optionally: - said choice comprises determining how much of the therapeutic agent is administered to the individual, and/or - the method further comprises providing a treatment to the individual which treatment is selected based on which genotype the individual possesses at any of the specified positions.

9. A therapeutic agent according to any one of the preceding claims, wherein the method of diagnosing wound type in an individual, or susceptibility to a particular wound type, is carried out to determine the choice of type of monitoring for the wound, wherein preferably the method further comprises monitoring the wound in a manner determined by which genotype the individual possesses at any of the specified positions, wherein optionally said choice is whether or not to diagnose for microbial infection at the wound.

10. A method of determining whether a given genetic polymorphism causes susceptibility to a particular wound type comprising determining whether the polymorphism is present in individuals with the particular wound type, and if the genetic polymorphism is found to be present in individuals with the particular wound type then typing one or more further individuals to determine whether they are susceptible to that wound type.