GB2554742A - Treatment - Google Patents

Abstract

The invention relates to DNA fragments, which may be generated by treatment of DNA with a DNase enzyme. Said fragments may be used in the treatment or prevention of Gram negative bacterial infections, in particular Pseudomonas aeruginosa infection. The fragments may be administered directly or may be generated in situ by administering DNase to an individual.

Description

(71) Applicant(s):

Ravi Bhongir Respiratory Medicine,

Department of Clinical Sciences Lund,

Lund University, Skane University Hospital, LUND SE-221 84, Sweden

Gopinath Kasetty Respiratory Medicine,

Department of Clinical Sciences Lund,

Lund University, Skane University Hospital, LUND SE-221 84, Sweden (56) Documents Cited:

WO 2015/061604 A1 WO 2001/066572 A2

WO 2014/009744 A1 US 20150209393 A1

J. Trauma Acute Care Surg., Vol.82, 2017, Simmons,

J. D. et al., Mitochondrial DNA damage associated..., pp.120-125

PLoS One, Vol.6, 2011, Conover, M. S. et al., Extracellular DNA is essential for maintaining..., Article No.: e16861

Chemotherapy, Vol.49, 2003, Nemoto, K. et al., Effect of Varidase..., pp.121-125

Int. J. Artificial Organs, Vol.32, 2009, Kaplan, J. B., Therapeutic potential of..., pp.545-554

Praveen Papareddy

Infection Medicine,

Department of Clinical Sciences Lund,

Lund University, Skane University Hospital, Lund, 221 84, Sweden (58) Field of Search:

Other: WPI, EPODOC, BIOSIS, MEDLINE

Heiko Herwald

Infection Medicine,

Department of Clinical Sciences Lund,

Lund University, Skane University Hospital, Lund, 221 84, Sweden

Arne Egesten

Respiratory Medicine,

Department of Clinical Sciences Lund,

Lund University, Skane University Hospital,

LUND SE-221 84, Sweden (72) Inventor(s):

Ravi Bhongir Gopinath Kasetty Praveen Papareddy Heiko Herwald Arne Egesten (74) Agent and/or Address for Service:

J A Kemp

South Square, Gray's Inn, LONDON, WC1R 5JJ, United Kingdom (54) Title of the Invention: Treatment

Abstract Title: Treatment of gram negative bacterial infection (57) The invention relates to DNA fragments, which may be generated by treatment of DNA with a DNase enzyme. Said fragments may be used in the treatment or prevention of Gram-negative bacterial infections, in particular Pseudomonas aeruginosa infection. The fragments may be administered directly or may be generated in situ by administering DNase to an individual.

Figure Ί A

B 6ALF

Long

Control 8acte^r,a a^!c*~e - DNase I

E .ρ*'·ίζΑ ·

EZ3 f&xiir

S^^i&sfexi :

<· «

1/7

Figure 2

E>

^Ό RMA-sitmulstton ftiritej

Oh 3h 18h + DNsae I

3h Wi-i

Human serum (¾}	0	10	2010 20 0
		&>$$$$
kb 10.0«			w
:3.0 **
1 0
0,5 -»			ll!||iii!il
0.2 ~			*
0.1 «			W5p·
			* <

2/7

Figure 3

e f

EOT Control INK dsDNA

DNA ;ΐθ pM)

NN Conirti:

3/7

Figure 4

£'. coii

S awreus

ui

Coniroi rfsDNA LL37

4/7

Figure 5

Bacteria survival {%)

CF Sputum ONA

CF Sputum DMA {DNase Ipeawntpteputum) CF Sputum DNA (DNase I treated patients) ex vixi

sn

Figure 6

CJ σι 2

OJ ,>

775 c

Φ w

II v>

II rr s?

u. o.

β» ja £

ο

Q.

£

1m o

o j:

Q, £

c o

c

II

E o,

CL ω

6/7

Figure Ί

Suppiementary Table 2

CF patient data

S. No.	Gender/age	rh DNase	FEV1%	FEV1/FVC%	vc%	TLC%	KV%	TLCO%	Mutation
1	M/32	-	37	40	74	108	206	59	dF508/2183AA-G
2/7’	M/23	-/+	46	40	97	121	221	103	dF508/394delTT
3/8*	F/32	-/+	48	49	82	109	190	96	dF508/dF508
4	M/23	-	72	68	88	95	124	70	dF508/dF508
5	F/35	-	44	49	74	115	238	64	dF508/dF508
6/9*	F/37	-/+	39	63	51	95	224	52	dF508/dF508
10	F/21	+	57	54	91	109	167	84	dF508/394delTT
11	F/24	+	77	80	82	88	108	79	dF508/dF508
12	M/34	+	41	44	76	113	230	79	dF508/394delTT

* The sputum samples were collected both without and with rbDNase treatment at a dose of 2.5 mg per day.

Figure 8

Supplementary Table 3

DNA sequences

Base pairs	Sense strand S’-S*	Antisense strand 5^3-1
10	ACAGGCTGGA	TCCAGCCTGT
30	CCTGAGGTCAGTACAGGCTGGAGGAGTAGA	TCTACTCCTCCAGCCTGTACTGACCTCAGG
30 (Scrambled)	AAGTGGCTGCGGAATCAAGTGTAGCGGCGA	TCGCCGCTACACTTGATTCCGCAGCCACTT
60	ATACCGCTCGCCGCAGCCGAACGACCGAGCG CAGCGAGTCAGTGAGCGAGGAAGCGGAAG	CTTCCGCTTCCTCGCTCACTGACTCGCTGC GCTCGGTCGTTCGGCTGCGGCGAGCGGTAT

7/7

TREATMENT

Field of the Invention

The invention relates to DNA fragments, which may be generated by treatment of DNA with a DNase enzyme. Said fragments may be used in the treatment or prevention of Gramnegative bacterial infections, in particular Pseudomonas aeruginosa infection. The fragments may be administered directly or may be generated in situ by administering DNase to an individual.

Background of the Invention

Gram negative bacteria are a group of bacteria characterised by a cell envelope composed of a thin peptidoglycan cell wall present between two cell membranes. The outer cell membrane contains lipopolysaccharides (LPS) as a major component. Gram negative bacteria cause a wide variety of infections and can exacerbate the symptoms of a variety of diseases and conditions. An example of a disease the symptoms of which are exacerbated by Gram negative bacterial infections is Cystic Fibrosis (CF), which is characterised by abnormally viscous mucus in the airways. Longstanding bacterial airway infections, in which Gram-negative bacteria are a major pathogen, are a significant clinical challenge in CF patients. Pseudomonas aeruginosa infections in particular can be very difficult to treat and constitute almost 45% of infections in CF patients.

A related issue is the biofilm-formation executed by these bacteria. Biofilm formation is important for the establishment of chronic infection and promotes survival of the bacteria. The biofilm consists of exopolysaccharides, proteins, and extracellular DNA (eDNA). A significant fraction of the eDNA is contributed by the bacteria themselves, although host DNA is also present. This is thought to originate largely from the long-lasting and dysregulated inflammatory response present in the airways of CF patients.

This inflammatory response results in excessive accumulation of immune cells in the airways, in particular neutrophils, which eventually succumb releasing DNA. Neutrophils can die in several ways, including necrosis, programmed cell death or apoptosis, or during formation of neutrophil extracellular traps (NETs). In the latter case, neutrophils actively release DNA that can exert host defence antimicrobial activities, which are associated with neutrophil granule proteins bound to the eDNA. However, eDNA is also a major contributor to the increased viscosity of mucus in CF patients, which itself contributes to the establishment of chronic infection. Aerosolized recombinant human (rh) DNase I has therefore been used therapeutically to reduce viscoelasticity of sputum in CF patients, and was found to reduce the number of exacerbations by 28% and 37% when administrated once and twice daily respectively.

However, there is a need for alternative treatments for Gram-negative bacterial infections, particularly in CF patients.

Summary of the Invention

Recently it was shown that eDNA has direct antibacterial activity against Gramnegative bacteria, including P. aeruginosa. The present inventors have determined that, surprisingly, this activity is size dependent. Specifically, bactericidal activity was apparent below a length of about 200 nucleotides (that is 200 base pairs in a double-stranded molecule). In vitro, small synthetic DNA-fragments but not large fragments or genomic DNA, were bactericidal against Gram-negative, but not Gram-positive bacteria. Addition of divalent cations reduced bacterial killing, suggesting that chelation of divalent cations by DNA results in destabilization of the LPS-envelope.

Thus, the present inventors have discovered a novel antibacterial strategy, where DNA fragments administered directly or generated in situ, can be used to treat Gram-negative bacterial infections, circumventing mechanisms involved in resistance against conventional antibiotics. The opens a new avenue for the prevention or treatment of Gram-negative bacterial infections, and for the prevention or treatment of diseases or conditions whose symptoms are exacerbated by Gram-negative bacterial infections. These diseases and conditions include Cystic Fibrosis and COPD.

Thus, the present invention provides:

A method for the prevention or treatment of Gram-negative bacterial infection comprising administering to an individual DNA fragments of between about 5 and about 200 nucleotides(nt) in length;

- DNA fragments of between about 5 and about 200 nt in length for use in a method for the prevention or treatment of Gram-negative bacterial infection in an individual; and DNA fragments of between about 5 and about 200 nt in length, or DNase, for use in the manufacture of a medicament for the prevention or treatment of Gram negative bacterial infection.

Brief Description of Figures

Figure 1. DNase-Treatment Enhances Survival and Decrease Bacterial Load in P. aeruginosa Airway Infection

a) The survival of mice infected with bacteria (P. aeruginosa, strain Xen 41) treated with vehicle alone or DNase I was monitored for 7 days (only the course during the first 96 hours is shown in the figure). At the time of infection, mice were subject to intranasal challenge o

with 50 μΐ of PBS containing 2x10 cfu/mL bacteria (five animals in each group). This was followed subsequent treatment with either one intranasal dose of recombinant human DNase I (5 pg) or vehicle alone, administered 15 hours post-infection. Statistically significant differences were found comparing the groups infected with bacteria followed by treatment with DNase I with the group infected with bacteria followed by treatment with vehicle. Statistical comparisons of survival curves were performed using the Mantel-Cox’s test. **P=0.0079.

b) To investigate effects from DNase I treatment on bacterial load, mice were inoculated intranasally with P. aeruginosa as described above. Fifteen hours post- infection, the mice were treated with either vehicle alone (intranasal administration) or with DNase I (intranasal administration at dose of 5 pg). After 6 hours, the mice were sacrificed and bronchoalveolar lavage fluid (BALF) and lungs were collected, homogenized and plated on agar plates to determine bacterial cfu. The data shown represent mean ± SEM. Each group consisted of five mice. **P<0.0E

c) Following infection and treatment (vehicle or DNase I at 5 pg), lungs were processed for immunohistochemistry to detect myeloperoxidase (MPO) of neutrophils or stained with haematoxylin and eosin (H&E). MPO-containing cells and released MPO were detected by a peroxidase-reaction resulting in a brownish staining. Bar=100 pm.

d) Quantification of MPO-staining, expressed as pixels/mm , was performed on lung tissue sections, five animals in each group. A decrease was seen in infected mice treated with DNase compared with infected mice treated with vehicle alone. ns>0.05.

e) Following intranasal infection with P. aeruginosa and treatment (vehicle or DNase I at 5 pg), BALF was collected and total number of cells was determined. DNase I treatment caused a decrease in the total number of cells compared to untreated mice (five mice in each group).

f) To determine the phenotype of cells, cytospin and Wright-Giemsa staining were performed. A decrease in the number of neutrophils was observed in DNase I treated animals. The data shown represent mean ± SEM. Each group consisted of five mice. ns>0.05.

g) Measurement of cytokines in BALF and lung tissue 6 hours after treatment with DNase I or vehicle alone. The results are expressed as mean ± SEM (five animals in each group). ns>0.05, and **P<0.01.

h) DNA isolated from the BAL fltud (500 μΐ) was separated on agarose gels and stained (SYBR safe) to visualize size distribution in the infected mice treated with or without DNase

I. DNA-fragments around 100-200 base pairs accumulate in mice receiving DNase at a dose of 5 pg.

Figure 2. Degradation of NETs and Incubation of Genomic DNA with Serum Generates DNA-Dependent Bactericidal Activity against P. aeruginosa.

a) DNA from non-stimulated neutrophils (0 hours) or neutrophils activated with PMA (20 nM) for 3, and 18 hours to induce formation of NETs (at 200 pg/mL) was incubated with P. aeruginosa (strain PA01) in the presence of sodium chloride at a physiological concentration (140 mM), for 1 hour at 37°C. Bacterial viability was determined by colony counts (cfu/mL) and is presented as percent survival. Genomic DNA was also incubated with DNase I (100 U/mL) for 10 minutes and, after purification used in viable counts assay. The data represent mean ± SD from three separate experiments. ns>0.05, *P<0.05 and ***/’0.005.

b) DNA separated on agarose-gels and stained (SYBR safe) to visualize size distribution. DNA from non-stimulated neutrophils (0 hours), and after stimulation with PMA (20 nM) for 3 and 18 hours respectively. DNA isolated from non- stimulated neutrophils and incubated with DNase I (100 U/mL) for 10 minutes is shown in the right lane.

c) Visualization of DNA-fragmentation in NETs using TUNEL-technique and fluorescence microscopy. Neutrophils were stained on coverslips immediately after isolation (Oh) or after stimulation with PMA (20 nM) in culture medium for 3 or 18 hours. Fragmentation of DNA and all extracellular DNA were stained for. A marked increase in fragmentation staining is observed after 18 hours of incubation.

d) Quantitative assessment of DNA-fragmentation using TUNEL-technique expressed as percent stained cells after 3 and 18 hours of incubation. The data represent mean ± SD from three separate experiments. *P < 0.05.

e) SEM micrographs showing P. aeruginosa trapped in NETs. In the left panel, bacteria were incubated with PMA-stimulated (20 nM) neutrophils for 3 hours. High amounts of DNA-strands (light grey fibers) are visible and the bacteria (rod shapes) appear intact. In the right panel, the bacteria were incubated with neutrophils for 18 hours. A reduction of extracellular DNA is apparent as visualized by few fiber-like structures. Some bacteria appear intact while other are disrupted, showing shrinkage, and leakage of intracellular contents. Bar=2 pm.

f) Generation of DNA-dependent bactericidal activity after incubation of genomic DNA with serum. Genomic DNA from leukocytes was incubated with 10 and 20% human serum respectively for 3 or 18 hours, purified and incubated with P. aeruginosa (strain PA01) at 200 pg/mL for 1 hour at 37°C. The bacterial viabilities were determined by colony counts (cfu/mL) and are presented as percent survival. Statistical comparisons were made between DNA incubated in buffer alone (3 and 18 hours) and DNA incubated with 10% or 20% human serum for 3 and 18 hours respectively. The data represent mean ± SD from three separate experiments. ****P<0.0001.

g) Genomic DNA was separated using agarose-gel electrophoresis and stained (SYBR safe) to visualize size distribution after incubation with serum (10% or 20%) for 3 and 18 hours respectively. Genomic DNA incubated in buffer alone for 3 and 18 hours respectively served as control.

Figure 3. Size-Dependent Bactericidal Activity of DNA.

a) DNA (200 pg/mL) of decreasing lengths starting with genomic DNA, double- stranded DNA of 1455 base pairs (bp), 1054 bp, 193 bp, 60 bp, 30 bp, and 10 bp respectively were incubated with /< aeruginosa (strain PA01) in presence of sodium chloride at a physiological concentration (140 mM), for 1 hour at 37°C. Bacterial viability was determined by colony counts (cfu/mL) and is presented as percent survival compared with bacteria incubated in buffer alone. The data represent mean ± SD from five to eight separate experiments. *P<0.05, ***P<0.005, and ****P<0.0001.

b) DNA of 10 bp, 30 bp, and 60 bp respectively (3 pM) were pre-incubated for 1 hour at 37°C in presence or absence of DNase I (100 U/mL). After pre-incubation, the fragments were accessed for their bactericidal activity against P. aeruginosa (strain PA01). An equimolar mixture of dNTPs (3 pM) was incubated with P. aeruginosa (strain PA01). The bacterial viabilities were determined by direct plate counts (cfu/mL). The data represent mean ± SD of eight separate experiments. ****P<0.0001.

c) Increasing concentrations of 30 bp double-stranded (ds)DNA, dsDNA (scrambled sequence), 30 bases of single-stranded (ss)DNA (sense and anti-sense) were incubated with P. aeruginosa (strain PA01) for 1 hour at 37°C. Bacterial viability was determined by colony counts (cfu/mL) and presented as percent survival compared with bacteria incubated in buffer alone. The data represent mean ± SD of three to six separate experiments.

d) Double-stranded DNA of 30 bp with increasing GC (0 to 80%) content at concentrations of 3 μΜ and 30 μΜ respectively, were incubated with P. aeruginosa (strain PA01) for 1 hour at 37°C and the viability of the bacteria was determined by direct plate count (cfu/mL) and presented as percent survival. The data represent mean ± SD from three separate experiments.

e) Divalent cations impede the bactericidal activity of DNA. dsDNA, and ssDNA (sense, and anti-sense) fragments of 30 bp at concentrations of 10 pM were incubated with P. aeruginosa (strain PA01) either in presence or absence of Ca (1 mM) or Mg (1 mM) followed by viable counts. The data represent mean ± SD from six separate experiments. ****P<0.0001.

f) Antibacterial activity of eDNA in comparison with LL-37 against clinical CF strains of P. aeruginosa. Double-stranded DNA (30 bp) or antimicrobial peptide LL- 37 were incubated with clinical CF strains of P. aeruginosa at concentrations of 3 pM in buffer with a physiological sodium chloride concentration (140 mM; pH 7.4) for 1 hour at 37°C and the bacterial viability was determined by colony counts (cfu/mL) and are presented as percent survival compared with bacteria incubated in buffer alone. The data represent mean ± SD of three separate experiments. ns>0.05 and *P<0.05.

Figure 4. Bactericidal Activity of DNA-Fragments against Pseudomonas aeruginosa, Escherichia coli, and Staphylococcus aureus.

a) Increasing concentrations of dsDNA of 10, 30, and 60 bp sizes were incubated with P. aeruginosa (strain PA01), E. coli (strain ATCC 25922), or S. aureus (strain ATCC 29213) in the presence of sodium chloride at a physiological concentration (140 mM) for 1 hour at 37°C. Bacterial viability was determined by colony counts (cfu/mL) and is presented as percent survival compared with bacteria incubated in buffer alone. The data shown represent mean ± SEM of four to eight separate experiments.

b) Bacterial membrane permeabilization visualized using detection of internalization of the green fluorescent dye FITC in E. coli (upper panel shows bright field view and middle panel corresponding dark field view with fluorescence of the same area) and by scanning electron microscopy in P. aeruginosa (lower panel). The bacteria were incubated in buffer (control), with dsDNA (30 μΜ), or with the antibacterial peptide LL-37 (3 μΜ) for 1 hour at 37°C. Both DNA and the antimicrobial peptide LL-37 cause internalization of FITC (upper; fluorescence microscopy, Bar=50 pm) and protrusions and loss of structure (lower; SEM,

Bar=l μιη).

c) Gold-labelled (5 nm colloidal gold particles) 30 bp dsDNA was incubated with P. aeruginosa (strain PA01) for 0, 30, and 120 minutes and visualized using negative staining followed by transmission electron microscopy. The DNA associates with the bacterial surface and accumulate at sites where the bacterial integrity is disturbed. Bar=100 nm.

Figure 5. Bactericidal Activity of Sputum-Derived DNA.

a) Genomic DNA, DNA isolated from CF patient sputum (sputum DNA), DNA isolated from sputum of patients treated with nebulized DNase I (2.5 mg daily), and DNA isolated from sputum incubated ex vivo with DNase I at 200 pg/mL were incubated with P. aeruginosa (strain PA01) for 1 hour at 37°C. The bacterial viabilities were determined by colony counts (cfu/mL) and are presented as percent survival. The data represent mean ± SD from six separate experiments. **P<0.01 and ***P<0.005.

b) DNA separated on agarose gels and stained (SYBR safe) to visualize size distribution in sputum from CF patients without DNase-treatment (left panel), sputum from DNase-treated CF patients (center panel), and sputum treated in vitro with DNase I (right panel). A fragmentation to small-size DNA (100-200 bp) is apparent in the case of DNase-treatment performed ex vivo.

Figure 6. Supplementary Table 1

The characteristics of the clinical P. aeruginosa strains obtained from CF patients (195B, 032, 022A, 041E, and 335A) are described in Supplementary Table 1, Figure 6. All clinical strains used were chronic P. aeruginosa isolates of patients who were colonized for at least three years. Only non-mucoid strains were used to allow the viable counts assay.

Figure 7. Supplementary Table 2

Sputum samples were collected from CF patients. The sputum samples were either incubated in buffer alone or with 10 pg of DNase I (Abeam) for 60 min at 37°C. rhDNase = recombinant human DNase I.

Figure 8. Supplementary Table 3

Sequence information of synthesized sense and antisense single stranded DNA oligonucleotides of 60, 30, and 10 bases (Eurofins Genomics, Ebersberg, Germany). Equimolar concentrations of respective sense and antisense strands were annealed to generate double stranded DNA fragments of 60, 30, and 10 base pairs (bp).

Detailed Description

The singular forms “a”, “an”, and “the” used in this specification and the appended claims include plural references unless the content clearly dictates otherwise. Thus, for example, reference to “a DNA fragment” includes “fragments”, and the like.

All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

DNA fragments

The present invention provides DNA fragments of between about 5 and about 200 nucleotides (nt) in length. The present invention provides methods for the prevention or treatment of diseases or conditions by administering DNA fragments of between about 5 and about 200 nucleotides in length to an individual.

The DNA fragments can be single or double stranded. The DNA fragments can be of any sequence. The DNA fragments can be created synthetically or can be created in the body of the individual to be treated by administering DNase to the individual. The DNA fragments can be created from extracellular DNA already present in the individual to be treated, for example in the airways of the individual. The DNA fragments can be created from extracellular DNA derived from neutrophil extracellular traps (NETs). The NETs can be present in the airways of the individual to be treated. The main source of extracellular DNA in the airways is immune cells, mainly neutrophils that have succumbed to cell death. Examples of mechanisms of death of neutrophils include apoptosis, necrosis, efferocytosis and necroptosis, there are many suggested mechanisms for cell-death during inflammation. The DNA fragments can also be created from genomic DNA present in the airways of the individual to be treated.

The DNA fragments are between about 5 and about 200 nucleotides (nt) in length. The DNA fragments can be between about 5 and about 100 nucleotides in length. The DNA fragments can be between about 100 and about 200 nucleotides in length. The DNA fragments can be between about 5 and about 60 nucleotides in length. The DNA fragments can be between about 10 and about 60 nucleotides in length. The DNA fragments can be between about 5 and about 50 nucleotides in length. The DNA fragments can be between about 20 and about 100 nucleotides in length. The DNA fragments can be between about 5 and about 30 nucleotides in length. The DNA fragments can be between about 5 and about 35 nucleotides in length. The DNA fragments can be between about 5 and about 25 nucleotides in length. The DNA fragments can be between about 25 and about 50 nucleotides in length. The DNA fragments can be between about 10 and about 30 nucleotides in length. Preferably, the DNA fragments are between about 25 and about 35 nucleotides in length.

DNase

The present invention also provides methods for the prevention or treatment of diseases or conditions, wherein the method comprises administering DNase to an individual in an amount sufficient to cleave extracellular DNA to create DNA fragments of between about 5 and about 200 nt in length. Preferably, the dose of DNase administered is higher than the dose provided in the method of treating CF patients known in the art. The DNase is preferably DNase I.

Neither endogenous DNase, nor existing exogenous DNase treatments, for example administered to reduce sputum viscosity in CF patients, achieve a concentration in the airways which is sufficient to produce a high enough concentration of DNA fragments of between about 5 and about 200 nt in length to have bactericidal activity against Gramnegative bacteria, such as P. aeruginosa.

Thus, the present invention provides a DNase-treatment regimen which is able to treat individuals suffering from infection with Gram negative bacteria, such as P. aeruginosa, and a regimen able to prevent Gram negative bacterial infection in such individuals, said regimen comprising administration of DNase in an amount sufficient to cleave extracellular DNA in the individual to create DNA fragments of between about 5 and about 200 nt in length.

The DNA fragments or DNase of the invention can be used to prevent or treat Gram9 negative bacterial infections. The DNA fragments or DNase of the invention are administered in a therapeutically and prophylactically effect amount.

The DNA fragments or DNase can be used to prevent or treat Gram negative bacterial infection, preferably P. aeruginosa infection. P. aeruginosa is a Gram negative bacterium. Serious infection of the bacterium is often superimposed in acute or chronic morbidity, such as for patients with CF or those with traumatic burns. P. aeruginosa infection can be associated with illnesses, for example nosocomial infections such as ventilator-associated pneumonia and various sepsis syndromes.

Other Gram-negative bacterial infections which may be prevented or treated by the DNA fragments or DNase of the invention include infections of Neisseria meningitides, Neisseria gonorrhoeae, Haemophilus influenza (including H. influenzae type B and Nontypeable H. influenzae), Burkholderia cepacia, Escherichia coli (for example EHEC and ESBL), Moraxellla catarrhalis, Klebsiella pneumonia, Legionella spp., Salmonella spp., Shigella spp., Baderoides spp., Prevotella spp., Porphyromonas spp., Fusobaderium spp., and Veilonella spp.

The DNA fragments or DNase can be used to prevent or treat Gram-negative bacterial infections in individuals who are immunocompromised.

Individuals who are immunocompromised can be defined as having an immune system whose ability to fight infectious disease, or bacterial infection, is compromised or entirely absent. Individuals can become immunocompromised by extrinsic factors, such as HIV infection, tuberculosis, hepatitis C infection, hepatitis B infection, advanced age or malnutrition. Other extrinsic factors include the administration of immuno-suppressive drugs. Non-limiting examples of such drugs include steroids, chemotherapeutics, cytostatics, antibodies, interferon, opioids, ciclosporin, tacrolimus, sirolimus, everolimus and TNF binding proteins. Individuals can become immunocompromised as a result of cancer treatment. Examples of when immuno-suppressive drugs can be administered include after transplant surgery as an anti-rejection measure and to treat individuals suffering from an over-active immune system. Individuals can also become immunocompromised by intrinsic factors, if they are born with a primary immunodeficiency.

The DNA fragments or DNase can be used to prevent or treat conditions caused by Gram negative bacterial infections in an individual. The DNA fragments or DNase can be used to prevent or treat diseases or conditions that are exacerbated by Gram-negative bacterial infections in an individual, such as wherein the individual has been diagnosed with at least one of a respiratory disease, cancer, alcoholic liver disease, kidney disease, sepsis, acute or chronic wounds, burns, urinary tract infections, prosthesis infections, bloodstream infections, meningitis, brain abscess, lung abscess, bacterial peritonitis, joint infection, osteomyelitis, or wherein the individual has undergone a surgical procedure.

The DNA fragments or DNase can be used to prevent or treat sepsis. Sepsis is a life threatening condition where, as a consequence of the body’s response to infection, tissues and organ of the body are injured. Infection by Gram- negative bacteria can lead to sepsis.

The DNA fragments or DNase can be used in the prevention of infection. The DNA fragments or DNase can be used in the prevention of infection after a surgical procedure, for example wherein said surgical procedure involves the implantation of foreign material, such as prosthesis, pacemaker, tooth, indwelling catheter or other implant. Further examples of surgical procedures encompasses in the present invention include organ transplants, bone marrow transplant or a biopsy sampling such as from the prostate. The DNA fragments or DNase can be instilled in the urinary tract to prevent infections. The DNA fragments or DNase can be injected during sampling of biopsies from the prostate to prevent Gramnegative infections.

The DNA fragments or DNase can be used in preventive therapy for individuals with cancer, wherein said individuals have been previously been treated with chemotherapeutic or cytostatic drugs. An example of such treatment is preventative inhalation therapy after treatment with cytostatics.

The DNA fragments or DNase can be used to prevent or treat respiratory diseases or conditions. The DNA fragments or DNase can be used to treat respiratory diseases or conditions such as bronchiectasis, chronic bronchitis, pneumonia, acute pneumonia, empyema of the pleura. Preferred examples of respiratory diseases or conditions that can be treated by the DNA fragments or DNase include Cystic Fibrosis and Chronic Obstructive Pulmonary Disease (COPD).

COPD is a group of lung conditions that cause breathing difficulties. Examples of conditions include emphysema and chronic bronchitis. Cystic Fibrosis is an autosomal recessive disease resulting from mutations in the CFTR gene. The disease affects several organs but chronic bacterial infections, inflammatory bouts and highly viscous sputum of the lower airways present major clinical challenges, often causing premature death. The present invention provides treatment for Cystic Fibrosis patients in the form of treatment of the underlying Gram-negative bacterial infection present in individuals with CF. The present invention provides DNA fragments or DNase as described herein for use in methods of treating CF. As such the invention also provides methods of preventing the symptoms of CF by administration of the DNA fragments or DNase.

Administration

An individual to be treated by the administration of the DNA fragments or DNase of the invention may be a human or non-human animal. The term non-human animal includes all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dogs, cats, horses, cows, chickens, amphibians, reptiles, etc. Administration to humans is preferred.

The DNA fragments or DNase can be administered to an individual to be treated according to methods known in the art. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results. The DNA fragments or DNase can be administered in the form of an aerosol. The DNA fragments or DNase can be inhaled in aerosolized form. The DNA fragments or DNase can be sprayed or applied as a solution on wounds. The DNA fragments or DNase can be sprayed or gargled as a solution in the oro-pharynx and naso-pharynx. The DNA fragments or DNase can be injected intraperitoneally or injected intrathecally. The DNA fragments or DNase can be instilled in the urinary bladder. The DNA fragments or DNase can be injected into the pleura. The DNA fragments or DNase can be injected through a tracheostoma. The DNA fragments or DNase can be administered through intraarticular injections.

The method for the prevention or treatment of Gram negative bacterial infections of the invention may involve the DNA fragments or DNase administered by topical application, for example in the airways,, by inhalation, by topical application to chronic wounds or bums, via an indwelling catheter, or by instillation in the urinary bladder.

Preferred routes of administration for the DNA fragments or DNase include, cutaneous, topical, intravenous, intramuscular, intradermal, intraocular, intraperitoneal, subcutaneous, spinal or other parenteral routes of administration. The phrase parenteral administration as used herein means modes of administration other than enteral and topical administration, usually by injection for example or infusion. Alternatively, the DNA fragments or DNase can be administered via a non-parenteral route, such as a topical, epidermal or mucosal route of administration.

The DNA fragments or DNase will typically be formulated into pharmaceutical compositions, together with a pharmaceutically acceptable carrier. As used herein, pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Preferably, the carrier is suitable for parenteral, e.g. intravenous, intramuscular administration, subcutaneous administration, cutaneous administration, topical application, administration by inhalation, application on indwelling catheters, or for instillation in the urinary bladder.

Depending on the route of administration, the compositions of the invention may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound.

The pharmaceutical compounds may include one or more pharmaceutically acceptable salts. A pharmaceutically acceptable salt refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects. Examples of such salts include acid addition salts and base addition salts.

Preferred pharmaceutically acceptable carriers comprise aqueous carriers or diluents. Examples of suitable aqueous carriers that may be employed in the pharmaceutical compositions of the invention include water, buffered water and saline. Examples of other carriers include ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.

Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration.

The compositions may be administered for prophylactic and/or therapeutic treatments. In therapeutic applications, compositions are administered to an individual already suffering from a disease or condition as described above, in an amount sufficient to cure, alleviate or partially arrest the condition or one or more of its symptoms. Such therapeutic treatment may result in a decrease in severity of disease symptoms, or an increase in frequency or duration of symptom-free periods. An amount adequate to accomplish this is defined as a therapeutically effective amount.

In prophylactic applications, compositions are administered to an individual at risk of a disease or condition as described above, in an amount sufficient to prevent or reduce the subsequent effects of the condition or one or more of its symptoms. An amount adequate to accomplish this is defined as a “prophylactically effective amount”. Effective amounts for each purpose will depend on the severity of the disease or injury as well as the weight and general state of the individual.

A suitable dosage of the compositions may be determined by a skilled medical practitioner. Actual dosage levels of the active ingredients in the pharmaceutical compositions of the invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular individual, composition, and mode of administration, without being toxic to the individual. The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions for use in the methods of present invention employed, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the individual being treated, and like factors well known in the medical arts.

A suitable dose may be, for example, in the range of from about 0.1pg/kg to about lOOmg/kg body weight of the individual to be treated. For example, a suitable dosage may be from about I ug/kg to about lOmg/kg body weight per day, 5pg/kg to about 5mg/kg body weight per day or from about 10 pg/kg to about 1 mg/kg body weight per day.

For example, the regular dose of DNase I used for the purpose of reducing the viscosity of sputum in the airways of CF patients is 2.5-5 mg once or twice daily in aerosolized form. Doses reaching 50 mg have been tried without toxic side-effects.

Preferably the dose of DNase used in the method of the invention is higher than the regular dose of DNase I used in CF patients for the purpose of reducing the viscosity of sputum in the airways, wherein higher can be defined as at least 2-fold, at least 3-fold, at least 5-fold, or at least 10-fold higher dose.

Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, a single dose may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the individuals to be treated; each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.

Administration may be in single or multiple doses. Multiple doses may be administered via the same or different routes and to the same or different locations. Alternatively, doses can be via a sustained release formulation, in which case less frequent administration is required. Dosage and frequency may vary depending on the half-life of the antagonist in the individual and the duration of treatment desired.

The present invention also provides DNA fragments of between about 5 and about 200 nt in length for use in a method for the prevention or treatment of Gram-negative bacterial infection in an individual. The DNA fragments for use in the invention may be generated in vivo by administering DNase in an amount sufficient to cleave extracellular DNA in the individual to create DNA fragments of between about 5 and about 200 nt in length. The prevent invention encompasses the DNA fragments or DNase for use in the prevention or treatment of any of the diseases or conditions described herein.

The present invention also provides the use of DNase for inhalation or topical application elsewhere to cleave DNA, resulting in bactericidal activity against Gram-negative bacteria. The prevent invention encompasses the use of DNase for inhalation or topical application elsewhere to fragmentise eDNA, resulting in bactericidal activity against Gramnegative bacteria.

The present invention also provides DNA fragments of between about 5 and about 200 nt in length, or DNase, for use in the manufacture of a medicament for the prevention or treatment of Gram negative bacterial infection. The present invention encompasses the DNA fragments or DNase as described herein for use in the manufacture of a medicament for the treatment or prevention of any of the diseases or conditions described herein.

The present invention encompasses the DNA fragments or DNase as described herein for use as bactericidal agents for the treatment or prevention of Gram-negative bacterial infections. The present invention encompasses the DNA fragments or DNase as described herein for use as bactericidal agents for the treatment or prevention of any disease or condition as described herein. The present invention encompasses the DNA fragments or DNase as described herein for use as a bactericidal agent for the treatment or prevention of Gram negative bacterial infections.

Combination therapies

The DNA fragments or DNase of the invention can be administered in combination with, or subsequently or sequentially to, any other suitable active compound. The DNA fragments or DNase of the invention can be administered in combination with, or subsequently or sequentially to, each other. Suitable active compounds may include known compounds for the treatment of Gram-negative bacterial infections, P. aeruginosa infection, CF or COPD. The DNA fragments or DNase of the invention can be administrated subsequently or sequentially to, in parallel with, or in combination with solutions aiming at neutralizing the pH at the site of infection.

Kits

Also within the scope of the present invention are kits comprising the DNA fragments and/or DNase of the invention and instructions for use. The kit may further contain one or more additional reagents, such as an additional therapeutic or prophylactic agent as discussed herein.

Examples

Materials and Methods

Animals

C57BL/6 male mice (7-8 weeks old) were maintained under pathogen-free conditions and had free access to commercial chow and water. All mouse experiments were conducted according to the institutional guidelines and were approved of by the Malmo-Lund Animal Care Ethics Committee (Ml38-13).

P. aeruginosa inoculation

Bioluminescent P. aeruginosa (strain Xen 41, derived from the parental pleural isolate PA01; PerkinElmer, Waltham, MA) possesses a copy of the luxCDABE operon of Photorhabdus luminescens integrated at a single site on the chromosome. Bacteria were grown in Todd Hewitt Broth (TH) broth aerobically at 37°C to logarithmic phase (OD₆2o~0-5), harvested, washed in PBS, and diluted in the same buffer to an OD of 0.02.

Each animal was infected with intranasal instillation of 50 μΐ bacteria. Non-infected control animals received PBS alone. For evaluation of animal survival, mice showing the defined and approved humane end-point criteria (immobilization and shaking) were sacrificed by an overdose of isoflurane (Abbott Laboratories, North Chicago, IL) and counted as nonsurvivors.

DNase I treatment

Recombinant human DNase I (Abeam, Cambridge, UK) was diluted in PBS solution. Vehicle-treated control animals received an intranasal administration of PBS (50 μΐ), whereas the test group received an intranasal administration of DNase I (5 pg diluted in 50 μΐ of PBS). For the experiments measuring infection and inflammatory indices, the DNase I was administered 15 hours post inoculation of bacteria and animals were sacrificed 6 hour after treatment.

Bronchoalveolar lavage and cell counts

To obtain bronchoalveolar lavage fluid (BALF), mice were euthanized 21 hours post infection. A total volume of 1 ml PBS containing 0.1 mM EDTA was used to lavage the lungs. When required, red blood cells were removed by resuspending the BALF cells in 100 μΐ lysis buffer (150 mM NH₄C1, 10 mM KHCO3, and 0.1 mM EDTA; pH 7.2) for 2 min at room temperature (RT) followed by washing in 1 mL of PBS. The total number of cells was then counted and adjusted to cells/mL of BALF. For differential counts, cytospin preparation of cells were stained with Modified Wright- Giemsa stain (Sigma-Aldrich, St. Louis, MI) and a minimum of 300 cells were counted per BALF sample.

Determination of bacterial colony forming units

In order to study bacterial dissemination, the right lung lobes were harvested from euthanized animals. The lung lobes were mechanically homogenized and serial dilutions were subsequently plated on TH agar plates overnight at 37°C in order to enumerate the colony-forming units (cfu) present in the tissue.

Collection of lungs for immunohistochemistry and homogenization

Post sacrifice, the left lung lobes were submerged in 6% formaldehyde (Histofix: Histolab, Goteborg, Sweden). Thereafter, dehydration and paraffin embedding were performed and 3 pm sections were generated from the tissue blocks. After rehydration and antigen retrieval, sections were incubated with goat antibodies against murine myeloperoxidase (MPO) or preimmune goat IgG (R&D Systems, Abingdon, England). Following rinsing, bound antibodies were detected using horseradish peroxidase- conjugated secondary rabbit anti-goat antibodies (diluted 1:2,500) and visualized using 3,3diaminobenzidine as a chromogen. Some sections were also used for staining with hematoxylin and eosin (H&E).

To obtain tissue homogenates, the right lung lobes were snap-frozen in liquid nitrogen and stored at -80°C until further processing. The snap-frozen lungs were thawed and homogenized in T-PER solution (Thermo Scientific, Goteborg, Sweden) containing protease inhibitor (Pefabloc SC, Sigma-Aldrich) at a final concentration of 1 mM. Lung homogenates were centrifuged at 9,000 x g for 10 minutes at 4°C and the supernatants were collected. Cytokine assay

The cytokines IL-6, MCP-1, and TNF-α were measured in BALF and lung tissue homogenates from mice 21 hours post-infection with P. aeruginosa using a cytometric bead array (Mouse Inflammation Kit; Becton Dickinson, Franklin Lakes, NJ) used according to the manufacturer’s instructions.

Bacterial strains

P. aeruginosa (strain PAO1), Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 29213 (ATCC, Rockville, MD), and S. aureus (strain 5120, derived from a patient with septic shock; Department of Clinical Microbiology, Skane University Hospital, Lund) were grown in Todd-Hewitt (TH) medium at 37°C. The characteristics of the clinical P. aeruginosa strains obtained from CF patients (195B, 032, 022A, 041E, and 335A) are described in Supplementary Table 1, Figure 6. All clinical strains used were chronic P. aeruginosa isolates of patients who were colonized for at least three years. Only non-mucoid strains were used to allow the viable counts assay.

Isolation of DNA from patient sputum

The sputum samples were either incubated in buffer alone or with 10 pg of DNase I (Abeam) for 60 min at 37°C. Thereafter, the sputum was freeze-dried and the DNA isolated using the phenol-chloroform-isoamyl alcohol method (4). The DNA was separated on 1% agarose gels and visualized with SYBR safe DNA stain (Life Technologies).

Sputum samples were collected from CF patients (Supplementary Table 2, Figure 7). All patients were in a stable clinical condition when the sputum samples were obtained and the outcomes were not followed. The individual sputum samples were either incubated in 250 μΐ of buffer alone (10 mM Tris-HCl, 1 mM MgCh, 0.5 mM CaCh, pH 7.4) or with 10 pg of DNase I (Abeam) for 60 min at 37°C. Thereafter, the sputum was freeze-dried and the DNA isolated using the phenol-chloroform-isoamyl alcohol method (7). The DNA was separated on 1% agarose gels and visualized with SYBR safe DNA stain (Life Technologies), individual patient sputum samples were investigated separately for antibacterial activity using viable counts. Neutrophil DNA

Neutrophils were isolated from heparinized whole blood using Lymphoprep (AxisShield, Oslo, Norway) according to the manufacturer’s instructions. Neutrophils (0.2 xl0⁶/ml in RPMI 1640; neutrophil purity were 95-98%) were stimulated with phorbol 12-myristate 13acetate (PMA) at 20 nM for 3 and 18 hours respectively at 37°C to induce formation of NETs. After the incubations, DNA was isolated from both non-stimulated (controls incubated in medium alone) and stimulated neutrophils. The DNA was isolated using the phenolchloroform-isoamyl alcohol method (4). Thereafter, the DNA was separated on 1% agarose gels and visualized with SYBR safe DNA stain (Life Technologies). Part of the isolated DNA was incubated with bacteria (P. aeruginosa, strain PAO1) for one hour followed by viable counts as described below.

Terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL).

Neutrophils incubated with PMA (20 nM) were labelled using TUNEL-technique to detect DNA-fragmentation applying an in situ BrdU-Red DNA fragmentation assay kit (Abeam). Extracellular DNA was stained with SYTOX green as per the manufacturer’s instructions (Thermo Fisher Scientific, Goteborg, Sweden). The images were captured using an Eclipse TE300 (Nikon, Tokyo, Japan) inverted fluorescence microscope equipped with a Hamamatsu C4742-95 cooled charge- coupled device camera (Hamamatsu; Shizuoka, Japan) and a x20 objective (Olympus, Orangeburg, NY). The DNA fragmentation was quantified by counting the nuclear material stained by the TUNEL-staining, indicating free ends of DNA after cleavage.

Incubation of bacteria in NETs and visualization by scanning electron microscopy

Bacteria (P. aeruginosa, strain PA01) (2 x 10⁶ CFU/sample) were incubated with neutrophils (4 x 10⁴ in RPMI 1640) for 3 and 18 hours respectively at 37°C and were subsequently processed for scanning electron microscopy (SEM) as described below (see Electron microscopy section).

DNA fragments

Genomic DNA isolated from whole blood, PCR products of decreasing lengths (1455, 1054, and 193 base pairs), sense and antisense single stranded DNA oligonucleotides of 60, 30, and 10 bases were synthesized (Eurofins Genomics, Ebersberg, Germany). Equimolar concentrations of respective sense and antisense strands were annealed to generate double stranded DNA fragments of 60, 30, and 10 base pairs (bp). Sequence information is shown in Supplementary Table 3, Figure 8.

Degradation of DNA by serum and DNase I

Genomic DNA or DNA fragments were incubated with recombinant human DNase I (Abeam) at a concentration of 100 U/ml at 37°C for 10 min or with human serum (10% and 20% respectively) at 37°C for 3 or 18 hours respectively. After incubation, the DNA was isolated using the phenol-chloroform-isoamyl alcohol method (4).

Bacterial viability by colony counts

P. aeruginosa, E. coli, and S. aureus were grown to mid-log phase (OD620-0.4) in TH medium followed by washing in incubation buffer (10 mM Tris, 5 mM glucose, and 140 mM NaCl; pH 7.4), either in the presence or absence of calcium (1 mM) or magnesium (1 mM). 2 x 10⁶ CFU/ml bacteria were incubated in 50 μΐ incubation buffer at 37°C for 60 minutes, with double stranded DNA, single stranded DNA, or deoxynucleotides (dNTPs) at indicated concentrations. This was followed by serial dilutions and plating on TH agar, followed by incubation at 37°C overnight and enumeration of cfu.

Visualization of bacterial membrane damage by fluorescence microscopy

Fluorescein isothiocyanate (FITC; Sigma-Aldrich, St. Louis, MO) was used to monitor bacterial membrane permeabilization. E. colt bacteria were grown to mid- logarithmic phase in TH medium followed by washing and resuspension in incubation buffer to yield a y

suspension of 1 x 10 CFU/ml. Aliquots (100 pi) of bacterial suspension were incubated in buffer alone (control), or in the presence of either 30 bp double stranded DNA (30 μΜ) or the antimicrobial peptide LL-37 (3 μΜ) (Schafer-N, Copenhagen, Denmark) at 37°C for 30 min. Microorganisms were then immobilized on poly (L-lysine)-coated cover slips and incubated for 45 min at 37°C, followed by addition onto cover slips with 200 pi of FITC (6 pg/ml) in buffer and a final incubation for 30 min at 30°C. The cover slips were washed and the bacteria were fixed in 4% paraformaldehyde (first for 15 min at 4°C, then at room temperature for 45 min). The cover slips were subsequently mounted on slides using ProLong Gold Antifade reagent mounting medium (Invitrogen, Waltham, MA). Bacteria were visualized using an Eclipse TE300 (Nikon, Tokyo, Japan) inverted fluorescence microscope equipped with a Hamamatsu C4742-95 cooled charge-coupled device camera (Hamamatsu) and a Plan Apochromat xl00 objective (Olympus). Differential interference contrast (Nomarski prism) imaging was used for visualization of the bacteria.

Electron Microscopy

For scanning electron microscopy (SEM) and visualization of ultrastructural effects from DNA, P. aeruginosa (2 x 10⁶ CFU/sample) were incubated for 60 min at 37°C with 30 bp double stranded DNA at 30 pM, LL-37 (3 μΜ), or buffer alone. After the incubation, bacteria were fixed overnight at room temperature with 2.5% glutaraldehyde in cacodylate buffer, processed as described earlier (5) followed by examination in a JEOL JSM-350 scanning electron microscope (JEOL, Tokyo, Japan). For negative staining and transmission electron microscopy (TEM), P. aeruginosa was incubated with gold-labelled 30 bp double stranded DNA for 0, 30, and 120 min at 37°C. The samples were adsorbed to 400-mesh carbon-coated copper grids and stained with 0.75% (w/v) uranyl-formate as described (6). Statistical analyses

For statistical evaluation of two experimental groups, the Mann-Whitney U-test was used. To compare more than two groups one-way or two-way ANOVA with Kruskal-Wallis test or Bonferoni post-test were used. For survival studies Log-rank (Mantel-Cox) test was used. All statistical evaluations were performed using the GraphPad Prism software 6.0 (GraphPad Software, La Jolla, CA) with ns > 0.05, *p < 0.05, **<0.01, ***p < 0.001 and ****p < 0.0001.

Ethics statement

The study was approved by The Regional Ethics Committee in Lund (2011/434). All individuals gave their written informed consent to participate in the study. In the case of children written consent was obtained from the parent or a guardian.

Example 1- DNase-treatment enhances survival and decreases bacterial load in a murine model of acute Pseudomonas aeruginosa airway infection.

In order to investigate possible effects from DNA-fragmentation during P. aeruginosa airway infection, mice were subject to intranasal challenge with bacteria and after 15 hours, vehicle or DNase I (5 pg) were instilled intranasally followed by observation for 7 days (Figure la). DNase I treatment significantly enhanced survival, compared with infected mice treated with vehicle. Non-infected mice treated with DNase I did not show decreased survival nor any symptoms during seven days of observation (data not shown). Next, bacterial load in the airways was investigated using viable counts (Figure lb). Mice were challenged intranasally with P. aeruginosa followed by treatment with vehicle or DNase I (5 pg, 15 hours postinfection). After another 6 hours, the mice were euthanized followed by collection of bronchoalveolar lavage fluid (BALF) and lungs. In both BALF and lung tissue, a significant decrease in bacterial load was observed in mice treated with the DNase I (5 pg) (Figure IB).

No bacterial dissemination could be detected in any of the groups as reflected by lack of bacterial growth in homogenized and plated samples from liver, spleen, and kidneys. To investigate the cellular components of the inflammatory response, BALF and lung tissue were collected 6 hours after DNase I treatment. The number of neutrophils in lung tissue showed a non-significant decrease in DNase I treated animals, as detected by immunohistochemistry (IHC) for MPO, in P. aeruginosa infected animals (Figure lc and d). In BALF, DNase I treatment caused a non-significant decreases in the total number of cells and neutrophils (Figure le and f).

The levels of selected pro-inflammatory cytokines (IL-6, MCP-1, and TNF-oc) were measured in BALF and lung tissue homogenates 6 hours after treatment (Figure lg). DNase I treatment significantly decreased IL-6 and TNF-oc in both BALF and lung tissue. MCP-1 showed a non-significant decrease in both BALF and lung tissue with DNase I treatment.

To characterize eDNA in the airways, BALF was collected and the DNA of the cell-free supernatants was isolated. The DNA from the DNase I treated mice were fragmented with increased accumulation of smaller fragments of sizes around and below 200 bp (Figure lh). In this model, also release of DNA-associated antimicrobial peptides may contribute to the increased bactericidal activity after treatment with DNase I, as previously demonstrated.

Example 2- DNA-dependent bactericidal activity against P. aeruginosa occurs during prolonged incubation of NETs and degradation of genomic DNA by serum.

Release of NETs was induced in purified neutrophils using stimulation with PMA (3 and 18 hours respectively). After isolation, the DNA was used in a viable counts assay with P. aeruginosa in the presence of sodium chloride (140 mM). Increasing bactericidal activity was found with time using eDNA from neutrophils stimulated with PMA (Figure 2a). In parallel experiments, DNA from these conditions were separated by gel-electrophoresis, showing increased degradation (Figure 2b). The increased fragmentation of eDNA in NETs upon longer incubation times was also visualized by labelling the nicked ends of nucleic acids (using TUNEL-technique) (Figure 2c and d). Scanning electron microscopy showed that bacteria trapped in the neutrophil eDNA for longer time-points exhibited severely disturbed morphology including protrusions of the cell wall and leakage of intracellular contents (Figure 2e). The disturbed bacterial morphology paralleled with a disappearance of long DNA-fibers. DNases of neutrophils are likely to be involved in the degradation. Candidate DNases include the Ca -/Mg -dependent DNase I and the DNase Il-like acidic endonuclease.

In another set of experiments, Genomic DNA was incubated with human serum (10% and 20% respectively) for 3 and 18 hours. After purification of the DNA, increased bactericidal activity against P. aeruginosa was apparent but less pronounced than that of NET-derived eDNA (Figure 2f). After 18 hours, most of the DNA appeared degraded to a high extent (Figure 2g). In CF, there is a leakage of plasma-proteins that can be detected in BALF. The DNase-activity of serum is explained by the presence of DNase I that is a major nuclease in the body. Thus, DNase I of plasma is likely to contribute to DNA-fragmentation in the airways in vivo.

Example 3- The bactericidal activity of DNA against P. aeruginosa is size-dependent.

To investigate if the bactericidal activity of DNA is size-dependent, fragments of various sizes including genomic DNA and double-stranded DNA-fragments down to a size of base pairs (bp) (all at a concentration of 200 pg/ml) were incubated with P. aeruginosa followed by colony counts. Interestingly, a strong bactericidal activity was found in the case of smaller DNA-fragments of 200 bp in length or below, in particular below 100 bp (Figure 3a). Pretreatment of DNA- fragments (10 bp, 30 bp, and 60 bp) with DNase I resulted in decreased bactericidal activity and single oligonucleotides (dNTPs) lacked significant activity (Figure 3b). Altogether, this suggests that there is an upper and lower size-limitation of the DNA to retain the bactericidal properties.

To investigate whether there is a difference in activity comparing double- and singlestranded DNA, 30 bp double-stranded (ds)DNA, dsDNA (scrambled sequence), 30 bases of single-stranded (ss)DNA (sense and anti-sense) were incubated with P. aeruginosa followed by viable counts. Scrambling the sequence of dsDNA did not affect the bactericidal activity while ssDNA showed a lower activity compared with dsDNA, suggesting that an increased anionic charge is of importance (Figure 3c). Increasing the GC-content resulted in some variations in bactericidal activity but effects from hybridization and hairpin-formation cannot be ruled out (Figure 3d). Chelation of divalent cations results in killing of Gram-negative bacteria including P. aeruginosa. To investigate if a possible chelating activity of DNA is important, dsDNA- and ssDNA-fragments (30 bp) were incubated with P. aeruginosa either in presence or absence of Ca (1 mM) or Mg (1 mM) followed by colony counts (Figure 3e). Both calcium and magnesium inhibited the bactericidal activity of the DNA-fragments, suggesting that DNA-mediated chelation of cations are of importance for the bactericidal activity. The Ca or Mg alone did not have an effect on the bacterial viability.

Is the bactericidal activity of DNA-fragments generalizable to clinical isolates of P. aeruginosa from CF patients? Double stranded (ds)DNA (30 bp) or antimicrobial peptide FF37 (both at 3 μΜ) were incubated with several clinical CF strains (characterized in Supplementary Table 1, Figure 6) followed by viable counts (Figure 3f). The sensitivity of the bacterial strains against DNA was higher or similar compared with the antimicrobial peptide FF-37.

Example 4-Bactericidal activity of DNA-fragments against P. aeruginosa, Escherichia coli, and Staphylococcus aureus.

To compare the bactericidal activity of DNA-fragments against common Gramnegative and Gram-positive bacterial pathogens, increasing concentrations of dsDNA (10, 30, and 60 bp respectively) were incubated with P. aeruginosa, E. coli, and S. aureus followed by viable counts. The DNA-fragments showed strong bactericidal activity against both E. coli and P. aeruginosa, but not against S. aureus (Figure 4a). Thus, the bactericidal activity of DNA-fragments seems confined to Gram-negative bacteria. To investigate possible disturbance of bacterial integrity, E. coli was incubated with DNA-fragments in the presence of the fluorescent dye FITC. The DNA-fragments caused bacterial internalization of FITC, demonstrating loss of cell integrity (Figure 4b). In P. aeruginosa, scanning electron microscopy demonstrated protrusions and severely disturbed morphology after incubation with DNA-fragments, similar to alterations induced by the “classical” antibacterial peptide LL-37 (Figure 4b). To investigate possible alterations at an ultra-structural level, goldlabelled 30 bp dsDNA was incubated with P. aeruginosa and visualized using negative staining followed by transmission electron microscopy. Gold-labelled DNA associated with the bacterial surface at sites where the cell wall integrity was disturbed. (Figure 4c).

Example 5-Bactericidal activity of sputum-derived DNA.

To investigate if there is a spontaneous degradation of eDNA in the airways in vivo and also investigate possible effects from DNase I treatment in vivo and ex vivo, DNA was isolated from sputum of CF patients (Figure 5). DNA (genomic and from different clinical CF conditions) was isolated and incubated with P. aeruginosa (strain PA01) followed by viable counts. DNA isolated from sputum had higher bactericidal activity than genomic DNA, the latter lacking antibacterial activity. Interestingly, DNA from sputum treated with DNase I ex vivo for 60 minutes, showed increased bactericidal activity compared to DNA from untreated sputum (Figure 5a). Incubation of sputum with DNase I ex vivo resulted in accumulation of DNA of sizes around and below 200 bp (Figure 5b). This was also found both in patients treated with nebulized DNase I and in untreated patients though more pronounced in the former.

Discussion

How is the bactericidal activity against P. aeruginosa executed by DNA-fragments? The Gram-negative bacterial outer membrane has a phospholipid-rich inner leaflet and an outer leaflet composed of lipopolysaccharides (LPS). LPS are polyanionic molecules as a consequence of phosphate groups present in the lipid A and core oligosaccharide regions. The negative charges result in repulsive forces that are screened and bridged by divalent cations (i.e., Mg²⁺ and Ca²⁺)· As a result, the divalent cations are crucial to maintain the integrity of the outer membrane of Gram- negative bacteria and their removal results in collapse of the bacterial integrity.

For more than fifty years it has been known that chelation of divalent cations, for example by exposure to EDTA, results in permeabilization and killing of Gram-negative bacteria, including P. aeruginosa. DNA can chelate divalent cations and pre-treatment of DNA with phosphatase to remove the anionic phosphate groups, resulted in loss of antibacterial activity (2). In the literature, both Ca and Mg have been shown to bind DNA and affect its conformation and interaction with lipid bilayers. In addition, the small DNA fragments may have the best access to the cation binding sites of LPS by penetrating the Oantigen moieties of LPS, while larger DNA may be sterically hindered from accessing the cations. A likely explanation for the lack of activity from DNA-fragments against S. aureus is that, instead of an outer LPS-envelope stabilized by divalent cations, these bacteria have a outer cell-wall consisting of peptidoglycans.

To investigate possible cytotoxic effects from DNA-fragments on eukaryotic cells, human bronchial epithelial cells (i.e, the cell line BEAS-2B) were incubated with 30 bp DNAfragments (at concentrations reaching 30 μΜ). However, no cytotoxicity could be detected as measured by release of LDH after overnight incubation.

In the animal model used in this study, DNase-treatment also resulted in reduced inflammatory activity, i.e. lower levels of the proinflammatory cytokines IL-6 and TNF-cx. This is likely a consequence of the decreased bacterial load in the airways, lowering the state of inflammation.

In the animal model, the decreased presence of neutrophils in lung tissue but unaltered numbers in BALF after DNase-treatment and reduced bacterial load may seem paradoxical. However, there is likely a dynamic situation with regard to compartmentalization of neutrophils at different stages of inflammation. During resolution of inflammation, neutrophils may change compartment and emigrate to the bronchial lumen.

The accumulation of eDNA in the airways of CF patients has been considered, to a large extent, to be attributed to NETs (10). However, the antimicrobial activity of NETs has been questioned since DNase-treatment in vitro can release viable bacteria (i.e. S. aureus) from NETs (11). In addition, bacteria expressing nucleases can escape NETs without being killed. According to most studies, bacterial species escaping NETs without being killed are Gram-positive pathogens. Thus, it may be that fragmented DNA of NETs, rather than entrapped neutrophil granule proteins, as shown for the fungal pathogen Candida albicans, exerts bactericidal activity against Gram-negative bacteria. The recent reports of antibacterial activity of eDNA against P. aeruginosa (2, 3), importantly did not investigate or disclose the size requirement of the eDNA, as described herein.

innate host defense functions are compromised in CF, both at cellular and molecular level. One example is that the antibacterial activity of antimicrobial peptides (AMPs) is likely to be impaired in CF. This could be explained by a higher salt concentration of the perici Gary liquid (PCL) in CF airways compared to that of healthy individuals, resulting in inactivation of several AMPs. The salt concentration in the PCL of CF has been a matter of debate and more recently, using a porcine model of CF, no altered Na⁺-concentrations were detected. In any case, the bactericidal activity of DNA-fragments reported in the current study was not affected by sodium chloride at 140 mM and thus, a potential problem with regard to salt is circumvented in contrast to the effects on AMP activity.

In CF airways, there is also a high proteolytic activity that plays important roles in the pathophysiology of the disease. Both proteases released by neutrophils and bacterial proteases contribute to the impaired host defence by inactivating immune cells and degrading host defence proteins. In the light of this another therapeutic advantage using fragmented DNA is that possible consequences from the high proteolytic activity is avoided.

A clinical consequence of the size-dependent antibacterial activity of DNA is to aim for intensified DNase-treatment regimens, or the use of DNA-fragments of about 5 to about 200 nt in length, in individuals suffering from infection with Gram negative bacteria, such as P. aeruginosa.

References

1. Hodson ME. Aerosolized dornase alfa (rhDNase) for therapy of cystic fibrosis. Am J Respir Crit Care Med. 1995;151(3 Pt2):S70-4.

2. Whitchurch CB, Tolker-Nielsen T, Ragas PC, Mattick JS. Extracellular DNA required for bacterial biofilm formation. Science. 2002;295(5559):1487.

3. Brinkmann V, Reichard U, Goosmann C, Fauler B, Uhlemann Y, Weiss DS, Weinrauch Y, Zychlinsky A. Neutrophil extracellular traps kill bacteria. Science. 2004;303(5663): 1532-5.

4. Urban CF, Ermert D, Schmid M, Abu-Abed U, Goosmann C, Nacken W, Brinkmann V, Jungblut PR, Zychlinsky A. Neutrophil Extracellular Traps Contain Calprotectin, a Cytosolic

Protein Complex Involved in Host Defense against Candida albicans. Plos Pathog. 2009;5(10).

5. Halverson TWR, Wilton Μ, Poon KKH, Petri B, Lewenza S. DNA Is an Antimicrobial Component of Neutrophil Extracellular Traps. Plos Pathog. 2015; 11(1).

6. Mulcahy H, Charron-Mazenod L, Lewenza S. Extracellular DNA Chelates Cations and Induces Antibiotic Resistance in Pseudomonas aeruginosa Biofiims. Plos Pathog. 2008;4(l 1).

7. Green M, Sambrook J. Molecular Cloning - A Laboratory Manual. US: Cold Spring

Harbor Laboratory Press; 2012.

8. Shan Q, Dwyer M, Rahman S, Gadjeva M. Distinct Susceptibilities of Corneal Pseudomonas aeruginosa Clinical Isolates to Neutrophil Extracellular Trap-Mediated Immunity. Infect Immun. 2014;82(10):4135-43.

9. Gottlieb RA, Giesing HA, Engler RL, Babior BM. The Acid Deoxyribonuclease of

Neutrophils - a Possible Participant in Apoptosis-Associated Genome Destruction. Blood. 1995;86(6):2414-8.

10. Leive L. A Nonspecific Increase in Permeability in Escherichia Coli Produced by Edta. Proceedings of the National Academy of Sciences of the United States of America. 1965; 53:74520 50.

11. Mengistu DH, Bohinc K, May S. Binding of DNA to zwitterionic lipid layers mediated by divalent cations. J Phys Chem B. 2009;! 13(36):12277-82.

Claims (15)

1. A method for the prevention or treatment of Gram-negative bacterial infection comprising administering to an individual DNA fragments of between about 5 and about 200 nucleotides in length.

2. The method of claim 1, wherein said fragments are generated in vivo by administering DNase in an amount sufficient to cleave extracellular DNA in the individual to create DNA fragments of between about 5 and about 200 nt in length.

3. The method of claim 1 or 2, wherein the DNA fragments or the DNase are administered by topical application in the airways, by inhalation, by topical application to chronic wounds or burns, via an indwelling catheter, or by instillation in the urinary bladder.

4. The method of any one of the preceding claims, comprising the administration of DNase as an aerosol, optionally wherein said DNase is DNase I.

5. The method of any one of the preceding claims, wherein the Gram-negative bacterial infection an infection by one or more of Neisseria meningitides, Neisseria gonorrhoeae, Haemophilus influenza /including H. influenzae type B and Non-typeable H. influenzae), Burkholderia cepacia, Escherichia coli (for example EHEC and ESBL), Moraxellla catarrhalis, Klebsiella pneumonia, Legionella spp., Salmonella spp., Shigella spp., Bader oides spp., Prevotella spp., Porphyromonas spp., Fusobaderium spp., Vei lone Ila spp, and P. aeruginosa infection, preferably wherein the infection is P. aeruginosa infection.

6. The method of any one of the preceding claims, wherein the individual is immunocompromised.

7. The method of any one of the preceding claims, wherein the individual has been diagnosed with at least one of a respiratory disease, cancer, alcoholic liver disease, kidney disease, sepsis, acute or chronic wounds, burns, urinary tract infections, prosthesis infections, bloodstream infections, meningitis, brain abscess, lung abscess, bacterial peritonitis, joint infection, osteomyelitis, or wherein the individual has undergone a surgical procedure.

8. The method of claim 7, wherein said surgical procedure involves the implantation of foreign material, such as a prosthesis, pacemaker, tooth, indwelling catheter, or other implant, or wherein the procedure is an organ transplant or bone marrow transplant, or wherein the procedure is a biopsy sampling such as from the prostate.

9. The method of claim 7, wherein the individual with said cancer has been previously treated with chemotherapeutic or cytostatic drugs.

10. The method of claim 7 or 8, wherein the DNA fragments or DNase are administered prior to or concurrently with the surgical procedure to prevent Gram-negative infection.

11. The method of claim 7, wherein said respiratory disease is Cystic Fibrosis, Chronic Obstructive Pulmonary Disease (COPD), bronchiectasis, chronic bronchitis, pneumonia, acute pneumonia or empyema of the pleura.

12. The method of any one of the preceding claims, wherein the DNA fragments are between about 5 and about 100 nt in length, or between about 5 and about 50 nt in length, or between about 20 and about 100 nt in length, or between about 20 and about 50 nt in length, or between about 25 and about 35 nt in length.

13. DNA fragments of between about 5 and about 200 nt in length for use in a method for the prevention or treatment of Gram-negative bacterial infection in an individual.

14. DNA fragments for use according to claim 13, wherein said method comprises generating said DNA fragments in vivo by administering DNase in an amount sufficient to cleave extracellular DNA in the individual to create DNA fragments of between about 5 and about 200 nt in length.

15. DNA fragments of between about 5 and about 200 nt in length, or DNase, for use in the manufacture of a medicament for the prevention or treatment of Gram negative bacterial infection.

Intellectual

Property

Office

Application No: GB1617107.6 Examiner: Dr Jeremy Kaye