GB2537153A - Induction of somatic embryogenesis in plants - Google Patents

Abstract

The invention relates to a method of inducing somatic embryogenesis (SE) in a plant comprising transforming a plant, organ, part or cell, so as to increase the level of expression of PLETHORA 1 (PLT1). Also claimed is a plant somatic embryo comprising an additional copy number of PLT1 compared to a genotypically identical untransformed plant cell. Also claimed is a plant somatic embryo which over-expresses PLT1 compared to a genotypically identical untransformed plant cell. Alternatively, the invention relates to a method of inducing somatic embryogenesis in a plant comprising transforming a plant, organ, part or cell, so as to increase the level of expression of PLETHORA 2 (PLT2), PLETHORA 3 (PLT3, AINTEGUMENTA-LIKE 6 OR AIL6) and/or PLETHORA 7 (PLT7). Also claimed is a plant somatic embryo comprising an additional copy number of PLT2, PLT3 and/or PLT7 compared to a genotypically identical untransformed plant cell. Also claimed is a plant somatic embryo which over-expresses PLT2, PLT3 and/or PLT7 compared to a genotypically identical untransformed plant cell.

Description

INDUCTION OF SOMATIC EMBRYOGENESIS IN PLANTS

Field of the Invention

The invention relates to the field of plant regeneration and in particular to methods, techniques, nucleic acids and proteins for the ectopic induction of somatic embryogenesis in plants.

Background to the Invention

Embryogenesis in plants may be zygotic; that is, initiated from a fertilization event 10 between an egg cell and sperm. Alternatively, embryos may develop from several types of somatic cells, which are not ordinarily involved in embryo development.

Somatic embryogenesis (SE) is an example of cellular totipotency, where embryos develop from vegetative cells rather than from gamete fusion. Somatic embryogenesis can therefore be harnessed for micropropagation applications to propagate genetically uniform plant material from individual plant cells or in horticultural applications to eliminate plant pathogens and in scientific research to generate source tissue for genetic transformation. Consequently an ability to control this regenerative capacity of somatic cells is of great economic importance.

Abiotic stress and chemical cues are known to induce embryogenesis in tissue culture, including phytohormones such as auxin and cytokinin, as well as elevated temperature, metal, salt and osmotic stresses (Takahata 1997; Jitender and Manchikatla 1998; Kong et al. 1998; Hanai et al. 2000; Dyachok et al. 2002; Ikeda-lwai et al. 2003).

However, the method of inducing somatic embryogenesis is delicate and unreliable; not all species and genotypes of a species respond uniformly to chemical induction and the methods employed must be optimized for each species or genotype. Some recalcitrant species and genotypes remain resistant to the induction of somatic embryogenesis and its use is therefore of limited application. Additionally, methods involving chemical induction carry a relatively high risk of genetic or epigenetic mutations, so called somaclonal variation.

Several genes are known to be involved in embryogenesis in plants. The AINTEGUMENTA-LIKE (AIL) transcription factor family comprises eight genes, which redundantly regulate meristem identity and growth. Ectopic expression of the AIL genes BABY BOOM (BBM) or PLETHORA5/AIL5, is sufficient to induce SE in Arabidopsis thaliana seedlings, but the roles of the other AIL genes in this process, as well as the signaling pathways underlying AIL-mediated SE, are not known.

The ability to induce somatic embryogenesis in plants is useful for the regeneration of genetically uniform plant material. Plant material obtained by regeneration in this way can be used in clone or plant tissue cultivation applications, for genetic research or in the micropropagation of endangered or rare species.

Some plant species and genotypes are more amenable to chemical or environmental induction of somatic embryogenesis and therefore regeneration than other species. Several species and genotypes are recalcitrant to the induction of somatic embryogenesis. Obtaining clones of this plant material is not reliable and in some cases impossible with presently available methods.

Although the control networks regulating establishment and maintenance of the stem cell niche in meristems of higher plants is well characterised very little is known about genes which can establish embryo cell fate. Since 2002, two genes have been identified, overexpression of which results in induction of somatic embryogenesis in plants.

Specifically, overexpression of BABY BOOM (BBM) has been found to induce somatic embryogenesis in Arabidopsis thaliana (AtBBM) (Boutilier et al., 2002 The Plant Cell 14:1737-1749), and soybean, Glycine max, (GmBBM) (Ouakfaoui et al., 2010 Plant Mol Biol 74:313-326) and sweet pepper (Capsicum annuum; Heidmann et al., 2011, Plant Cell Rep. 30:1107-1115).

More recently, EMBRYOMAKER/CHOTTO1/PLETHORA 5 (PLT5) in Arabidopsis thaliana has been found to induce somatic embryogenesis (Tswamoto et al. 2010, Plant Mol Biol 73:481-492).

AINTEGUMENTA-LIKE (AIL) genes form a small Glade of eight members within the AP2 group of APETALA2/ethylene-responsive element-binding factor (AP2/ERF) transcription factors (Kim et al., (2006) Mol Biol Evol 23:107-120) and comprise AINTEGUMENTA (ANT), AILl, PLETHORA1 (PLT1), PLT2, PLT3/AIL6, CHOTTO1 (CH01)/EMBRYOMAKER (EMK)/PLT5/AIL5 (hereafter named PLT5/AIL5), PLT7 and BABY BOOM (BBM). AIL genes are expressed in dividing tissues, including root, shoot and floral meristems (Nole-Wilson et al., (2005) Plant Mol Biol 57:613628), where they act in a redundant manner to maintain a meristematic state (reviewed in Horstman et al., (2014) Trends Plant Sci 19:146-157). Single knock-out mutants of AIL genes show only minor defects, but double or triple mutants have stronger phenotypes related to reduced cell proliferation or altered cell identity. For example, the ant single mutant has smaller floral organs with partial loss of identity, a phenotype that is enhanced in the ant;p1t3/ail6 double mutant (Klucher et al., (1996) The Plant Cell 8:137-153; Krizek (2009) Plant Phys 150:1916-1929; Sharma et al., (2013) BMC Plant Biology 13:170). Combinations of pftl, plt2, plt3/ail6 and bbm mutants are embryo lethal (p1t2;bbm), rootless (p1t1;p1t2;p1t3/ail6) or have a short root (p1t1;pft2) (Aida et al., 2004, Cell 119:109-120; Galinha et al., 2007, Nature 449:1053-1057) and the ant;p1t3/ail6;p1t7 triple mutant is impaired in shoot meristem maintenance (Mudunkothge and Krizek (2012) The Plant Journal 71:108-121).

In line with their loss-of-function phenotypes, overexpression of AIL transcription factors induces cell overproliferation phenotypes. Ectopic overexpression of PLT5/AIL5 promotes somatic embryo and ectopic organ formation on seedlings (Tswamoto et al., 2010, Plant Mol Biol 73:481-492), while overexpression of PLT1 and PLT2 leads to ectopic development of hypocotyls, roots and quiescent centre cells (Aida et al., 2004, Cell 119:109-120). Besides promoting enhanced pluripotency and totipotency, AIL overexpression can also lead to an enlarged root meristem (PLT2) (Galinha et al., 2007, Nature 449:1053-1057) and to increased floral organ size due to increased cell number, as shown for ANT, PLT5/AIL5 and PLT3/AIL6 overexpression (Krizek, 1999, Developmental Genetics 25:224-236; Nole-Wilson et al., 2005 Plant Mol Biol 57:613-628; Krizek and Eaddy 2012, Plant Mol Biol 78:199-209). In contrast, sepals of seedlings expressing higher levels of PLT3/AIL6 are small and undifferentiated, suggesting that high PLT3/AIL6 levels inhibit cell differentiation (Krizek and Eaddy, 2012, Plant Mol Biol 78:199-209).

Genetic analysis shows both specific and overlapping roles for AIL genes, and that AIL proteins can partially or fully complement phenotypes of other all mutants (Galinha et al., 2007, Nature 449:1053-1057) but it has been difficult to assign specific AIL functions based on the overexpression studies.

AIL genes that show redundancy in loss-of-function studies, such as BBM and PLT2, do not show the same overexpression phenotypes (Boutilier et al., 2002, The Plant Cell 14:1737-1749; Aida et al., 2004, Cell 119:109-120) while overexpression of the same gene e.g. PLT5/AlL5, can result in different overexpression phenotypes (Nole-Wilson et al., 2005, Plant Mol Biol 57:613-628; Yano et al., 2009, Plant Phys, 151:641-654; Tswamoto et al., 2010, Plant Mol Biol 73:481-492). Whether these different phenotypes are due to differences in the expression level of the transgene or due to the screening approach is not clear. AIL target genes have only been identified for BBM (Passarinho et al., 2008, Plant Mol Biol 68:225-237) thus it is not known whether AIL proteins have the same or partially overlapping target genes.

A number of other transcription factors have been identified that can induce or enhance somatic embryogenesis (SE) when ectopically expressed (Feher, 2014, Biochim Biophys Acta). These include two LEAFY COTYLEDON 1 (LEC1)/LEc1-LIKE; ABSCISIC ACID (ABA)-INSENSITIVE3 (ABI3); FUSCA3 (FUS3); LEC2 (LAFL) seed maturation genes (Jia et al., 2013, Plant Phys 163:1293-1305), LEC1 and LEC2 (Lotan et al., 1998, Cell 93:1195-1205; Stone et al., 2001, PNAS 98:11806-11811) and the MADS-domain transcription factor AGAMOUS-LIKE15 (AGL15) (Harding et al., 2003, Plant Phys 133:653-663; Zheng et al., 2009, The Plant Cell 21:2563-2577). The developmental programs regulated by AGL15 and LEC2 have been well characterized and their pathways are interconnected, as LEC2 and AGL15 positively regulate each other's function (Braybrook et al., 2006, 103:3468-3473; Zheng et al., 2009, The Plant Cell 21:2563-2577). Similar embryogenic phenotypes are observed in loss-of-function mutants of epigenetic regulators, including the CHD3 protein PICKLE (PKL) (Ogas et al., 1999, PNAS 96:13839-13844), the B3-domain proteins VP1/ABI3-LIKE1 (VAL1) and VAL2 (Suzuki et al., 2007, Plant Physiology 143:902-911), and the Polycomb Group proteins CURLY LEAF (CLF), SWINGER (SWN), EMBRYONIC FLOWER2 (EMF2), VERNALIZATION2 (VRN2), and FERTILIZATION INDEPENDENT ENDOSPERM (FIE) (Chanvivattana et al., 2004, Development 131:5263-5276; Bouyer et al., 2011, PLoS Genetics 7), which function to repress LAFL gene expression during the transition to post-embryonic growth.

Independent overexpression of PLT1 and PLT2 was previously thought to specify root identity (Aida et al., 2004, Cell 119:109-120).

Summary of the Invention

The inventors have surprisingly discovered that somatic embryogenesis in plants may be ectopically induced by independent overexpression of PLT1, PLT2, PLT3 and PLT7.

Accordingly, the present invention provides a method of inducing somatic embryogenesis (SE) in a plant, comprising transforming a plant, organ, part or cell, so as to increase the level of expression of one of more of PLETHORA 1 (PLTI), PLT2, PLT3 and PLT7.

Accordingly, the present invention provides a method of inducing somatic embryogenesis (SE) in a plant, comprising transforming a plant, organ, part or cell, so as to increase the level of expression of one of more of PLETHORA 1 (PLT1) [SEQ ID NO: 1], PLT2 [SEQ ID NO: 2], PLT3 [SEQ ID NO: 3] and PLT7 [SEQ ID NO: 4] For each of PLTI PLT2, PLT3 or PLT7, this includes functional variants of each of these genes, as defined by being a sequence of at least 80% identity with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4, respectively. Preferably, nucleotide sequences encoding PLTI, PLT2, PLT3 or PLT7 have at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity with the relevant reference sequence. In preferred embodiments, nucleotide sequences encoding PLT1, PLT2, PLT3 and PLT7 have at least 90% sequence identity with the relevant reference sequence.

Also included are functional variants of each of PLT1 PLT2, PLT3 or PLT7 represented by polynucleotides which are hybridizable under stringent conditions to respective reference sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4. Also, such variant sequences optionally may include one, two, three, four, five or six contiguous or non-contiguous amino acid substitutions, deletions or insertions. These may be conservative or non-conservative, but preferably conservative.

The overexpression of PLT1 PLT2, PLT3 or PLT7 genes therefore results in increased levels of PLT1 PLT2, PLT3 or PLT7 gene products respectively. Such gene products are proteins or polypeptides of SEQ ID NOs 14 to 17 respectively. Therefore included within the scope of the invention is overexpression of variant polypeptides to achieve somatic embryogenesis in transformed plant material, such variants being of at least 80% sequence identity with any of SEQ ID NOs 14 to 17. Optionally, and in preferred aspect, such variants include at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity to SEQ ID NOs 14 to 17 respectively.

In other aspects, the one or more of PLT1, PLT2, PLT3 and PLT7 encodes a protein or polypeptide comprising; the amino acid motif FX1VWNX2 [SEQ ID NO: 5]; and/or the amino acid motif AX2X3X3X4WPX5QX1 [SEQ ID NO: 6]; and not comprising the amino acid motif LSMIKTWLR [SEQ ID NO: 7]; wherein X1 is one of Serine or Threonine, X2 is one of Aspartic Acid or Glutamic Acid, X3 is one of Phenylalanine or Tyrosine, X4 is independently selected from Leucine, Valine or Isoleucine and X5 is one of Histidine or Asparagine.

In aspects of the invention relating to the overexpression of PLT1 alone or in combination with PLT2, the protein further comprises the amino acid motif CRREGQSRKGRQV [SEQ ID NO: 8].

In aspects of the invention relating to the overexpression of PLT3 alone or in combination with PLT7, the protein further comprises the amino acid motif CRREGQARKGRQV [SEQ ID NO: 9].

In all aforementioned aspects of the present invention, amino acid residues may be substituted conservatively or non-conservatively. Conservative amino acid substitutions refer to those where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g. charge or hydrophobicity) and therefore do not alter the functional properties of the resulting polypeptide.

Similarly it will be appreciated by the skilled reader that nucleic acid sequences may be substituted conservatively or non-conservatively without affecting the function of the polypeptide. Conservatively modified nucleic acids are those substituted for nucleic acids which encode identical or functionally identical variants of the amino acid sequences. It will be appreciated by the skilled reader that each codon in a nucleic acid (except AUG; typically the only codon for methionine) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a polynucleotide or polypeptide, which encodes a polypeptide of the present invention, is implicit in each described polypeptide sequence.

Similarly in the nucleic acid molecules of the invention defined above, the nucleotide sequence may be that which encodes a protein or polypeptide comprising the respective SEQ ID NOs: 5 to 9. Where variant sequences are concerned these include nucleotide sequences hybridizable to such nucleotide sequences, preferably under stringent conditions, more preferably under highly stringent conditions.

The term "stringent conditions" may be understood to describe a set of conditions for hybridization and washing and a variety of stringent hybridization conditions will be familiar to the skilled reader. Hybridization of a nucleic acid molecule occurs when two complementary nucleic acid molecules undergo an amount of hydrogen bonding to each other known as Watson-Crick base pairing. The stringency of hybridization can vary according to the environmental (i.e. chemical/physical/biological) conditions surrounding the nucleic acids, temperature, the nature of the hybridization method, and the composition and length of the nucleic acid molecules used. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001); and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993).

The Tm is the temperature at which 50% of a given strand of a nucleic acid molecule is hybridized to its complementary strand.

In any of the references herein to hybridization conditions, the following are exemplary and not limiting: Very High Stringency (allows sequences that share at least 90% identity to hybridize) Hybridization: 5x SSC at 65°C for 16 hours Wash twice: 2x SSC at room temperature (RT) for 15 minutes each Wash twice: 0.5x SSC at 65°C for 20 minutes each High Stringency (allows sequences that share at least 80% identity to hybridize) Hybridization: 5x-6x SSC at 65°C-70°C for 16-20 hours Wash twice: 2x SSC at RT for 5-20 minutes each Wash twice: lx SSC at 55°C-70°C for 30 minutes each Low Stringency (allows sequences that share at least 50% identity to hybridize) Hybridization: 6x SSC at RT to 55°C for 16-20 hours Wash at least twice:2x-3x SSC at RT to 55°C for 20-30 minutes each.

In preferred methods, the one or more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 is comprised in an expression construct having a suitable promoter.

The expression of one or more of PLETHORA 1 (PLTI), PLT2, PLT3 and PLT7 from the expression construct is preferably inducible. Where the expression is inducible then the expression construct may be a two-part inducible expression construct and the transformed plant, organ, part or cell is exposed to an inducer for a period of time, for example in the growth media. Suitable two-component expression systems comprise a driver/activator and an effector (Borghi, 2010, Methods Mol Biol., 655:65- 75). The two components may or may not be on the same DNA construct and the driver/activator may or may not be induced by/post-translationally activated with, for example, 13-estradiol, dexamethasone, alchohol or heat stress.

In preferred methods of the invention, PLT protein activity is inducible. The post-translational induction of one or more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 protein activities is preferred. Where one or more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 protein activities is induced then the PLT protein may be fused to (part of) a steroid hormone receptor and activated using a steroid hormone. Preferably, the PLT protein may be fused to (part of) an estradiol or a glucocorticoid receptor (GR) and activated using 13-estradiol or dexamethasone, respectively. More preferably, PLT:GR fusions are localised in the cytoplasm where they are inactive and upon induction with f3-estradiol or dexamethasone become localised to the nucleus where they are active.

The levels of overexpression of the transcription factor genes or proteins which induce somatic embryogenesis may be at least 1.5 times greater than compared to a genotypically identical untransformed plant, organ, part or cell. In other embodiments, the overexpression may be at least 2 times greater, preferably at least 3 times greater; possibly at least 5, 10 or 20-fold greater, than compared to a genotypically identical untransformed plant, organ, part or cell.

The levels of PLTI, PLT2, PLT3 and PLT7 increase relative to a genotypically identical untransformed plant, organ, part or cell may optionally be; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500 -fold.

In preferred methods of the invention above, the plant, organ, part or cell is stably transformed with an expression construct which provides overexpression of the one of more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7. "Stable" refers to an heritable character whereby the expression construct is integrated into the plant genome and is heritable through at least one generation to progeny plants. Mature plants raised from somatic embryos of the invention may be used as parent plant in crossing for breeding purposes, whether with similar transformed plants raised from somatic embryos in accordance with the invention or other plants, transformed or otherwise.

According to the present invention, whole plants, plant material or plant pads may be stably or transiently transformed as desired, wherein stable transformation refers to polynucleotides which become incorporated into the plant host chromosomes such that the host genetic material may be permanently and heritably altered and the transformed cell may continue to express traits caused by this genetic material, even after several generations of cell divisions. Transiently transformed plant cells refer to cells which contain heterologous DNA or RNA, and are capable of expressing the trait conferred by the heterologous genetic material, without having fully incorporated that genetic material into the cell's DNA. Heterologous genetic material may be incorporated into nuclear or plastid (chloroplastic or mitochondrial) genomes as required to suit the application of the invention. Where plants are transformed with more than one polynucleotide it is envisaged that combinations of stable and transient transformations are possible. Commonly, plants may be stably or transiently transformed with polynucleotides encoding one or more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7.

Plants transformed with a polynucleotide or expression construct of the invention may be produced by standard techniques for the genetic manipulation of plants which are known in the art. DNA may be introduced into plant cells using any suitable technology, such as gene transfer via a disarmed Ti-plasmid vector carried by Agrobacterium tumefaciens, using Agrobacterium sp.-mediated transformation, vacuum infiltration, floral dip, spraying, particle or microprojectile bombardment, protoplast transformation, electroporation, microinjection, electrophoresis, pollen-tube pathway, silicon carbide-or liposome-mediated transformation, uptake by the roots, direct injection into the xylem or phloem or other forms of direct DNA uptake. Microprojectile bombardment, electroporation and direct DNA uptake are preferred where Agrobacterium is inefficient or ineffective. Alternatively, a combination of different techniques may be employed to enhance the efficiency of the transformation process, e.g. bombardment with Agrobacterium-coated microparticles or microprojectile bombardment to induce wounding followed by co-cultivation with Agrobacterium.

In accordance with method so the invention defined herein, the plant, organ, part or cell may be cultured for a period of time whilst overexpression of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 takes place. In some instances, the culturing may take place for a period of time in the absence of inducer. In other words there is a period of induction and overexpression of the PLETHORA gene in accordance with the invention followed by an optional period of no overexpression. The somatic embryos may result during the period of induction and overexpression or not.

Modulating the levels or activity of a polypeptide encoded by a nucleic acid molecule may be achieved by various means. For example, elevating mRNA levels encoding said polypeptide by placing the nucleotide under the control of a strong promoter sequence or altering the gene dosage by providing a cell with multiple copies of said gene. Alternatively, the stability of the mRNA encoding said polypeptide may be modulated to alter the steady state levels of an mRNA molecule, this is preferably achieved via alteration to the 5' or 3' untranslated regions of the mRNA. Similarly, the production of a polypeptide may be modified by altering the efficiency of translational processing, increasing or decreasing protein stability or by altering the rate of post translational modification (e.g. proteolytic cleavage) or secretion.

Commonly, where a plant naturally expresses one or more of said of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 modification of their expression may be achieved by altering the expression pattern of the native gene(s) and/or the processing and/or production of the polypeptide. This may be achieved by any suitable method, including, but not limited to altering transcription of the gene, and/or translation of the mRNA into polypeptide, and post-translational modification of the polypeptide.

Altering the expression pattern of a native gene may be achieved by placing it under control of a heterologous regulatory sequence, which is capable of directing the desired expression pattern of the gene. Suitable regulatory sequences may be placed 5' and/or 3' of the endogenous gene and may include, but are not limited to promoter sequences, terminator fragments, polyadenylation sequences or enhancer sequences (e.g. VP16 transactivation domain) operably linked to the sequences of interest.

The polypeptide sequences and polynucleotides used in the present invention may be isolated or purified. By "purified" is meant that they are substantially free from other cellular components or material, or culture medium. "Isolated" signifies that they may also be free of naturally occurring sequences which flank the native sequence, for example in the case of nucleic acid molecule, isolated may mean that it is free of 5' and 3' regulatory sequences. According to the present invention, for use in altering the expression of one or more of the PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 genes in a cell of a plant, polynucleotide sequences may be integrated into an expression cassette comprising a regulatory sequence to modulate the expression of the native PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 genes in a plant. Preferably, the regulatory sequences are designed to be operably linked to the native gene, in order to direct expression in a manner according to the present invention.

The polynucleotides as described herein, and/or a regulatory sequence are preferably provided as part of an expression cassette for expression of the polynucleotide in a cell or tissue of interest. Suitable expression cassettes for use in the present invention may be constructed by standard techniques known in the art, to comprise 5' and 3' regulatory sequences, including, but not limited to promoter sequences, terminator fragments, polyadenylation sequences or enhancer sequences (e.g. VP16 transactivation domain) operably linked to the sequences of interest. Such elements may be included in the expression construct to obtain the optimal expression and function of PLTI, PLT2, PLT3 and PLT7 in the plant or plant part. In addition, polynucleotides encoding, for example, selectable markers and reporter genes may be included. The expression cassette preferably also contains one or more restriction sites, to enable insertion of the nucleotide sequence and/or a regulatory sequence into the plant genome, at pre-selected loci. Also provided on the expression cassette may be transcription and translation initiation regions, to enable expression of the incoming genes, transcription and translational termination regions, and regulatory sequences. These sequences may be native to the plant being transformed, or may be heterologous. The expression cassettes may be a bifunctional expression cassette which functions in multiple hosts.

A regulatory sequence is a nucleotide sequence which is capable of influencing transcription or translation of a gene or gene product, for example in terms of initiation, accuracy, rate, stability, downstream processing and mobility. Examples of regulatory sequences include promoters, 5' and 3' UTR's, enhancers, transcription factor or protein binding sequences, start sites and termination sequences, ribosome binding sites, recombination sites, polyadenylation sequences, sense or antisense sequences. They may be DNA, RNA or protein. The regulatory sequences may be plant-, bacteria-, fungal-or virus derived, and preferably may be derived from the same species of plant as the plant being modulated.

Typically, the promoters controlling the expression of PLTI, PLT2, PLT3 and PLT7 preferably generate high levels of expression compared to the native genes, for example the Cauliflower Mosaic Virus 35S (CaMV 35S) promoter. These promoters may be constitutive, whereby they direct expression under most environmental conditions or developmental stages. Alternatively, they may be developmental stage specific, tissue-specific, organ-specific or inducible such that expression of one or more of PLTI, PLT2, PLT3 and PLT7 can be directed to a particular organ or tissue as desired. In certain aspects, the promoter may be inducible, to direct expression in response to environmental, chemical or developmental cues, such as temperature, light, chemicals, drought, and other stimuli. Preferably, however, the promoter is constitutive, initiating transcription in the all tissues at high levels. Preferably, in this situation protein activity is inducible, for instance by fusion to a steroid hormone receptor.

Suitable promoter sequences may include but are not limited to those of the T-DNA of A. tumefaciens, including mannopine synthase, nopaline synthase, and octopine synthase; alcohol dehydrogenase promoter from Zea mays; light inducible promoters such as ribulose-biphosphate-carboxylase small subunit gene from various species and the major chlorophyll a/b binding protein gene promoter; histone promoters, actin promoters; Zea mays ubiquitin 1 promoter; 35S and 19S promoters of cauliflower mosaic virus; developmentally regulated promoters such as the waxy, zein, or bronze promoters from Zea mays; as well as synthetic or other natural promoters including those promoters exhibiting organ-specific expression or expression at specific plant development stages, such as the alpha-tubulin promoter. These promoters may be derived from Arabidopsis or any other suitable organism.

The expression cassette comprising the heterologous nucleic acid may also comprise sequences coding for a transit peptide, to drive the protein coded by the heterologous gene into a desired pad of the cell, for example the cell wall, nucleus or chloroplasts. Such transit peptides are well known to those of ordinary skill in the art, and may include single transit peptides, as well as multiple transit peptides obtained by the combination of sequences coding for at least two transit peptides (e.g. optimized transit peptide or chloroplast transit peptide), comprising in the direction of transcription a first DNA sequence encoding a first chloroplast transit peptide, a second DNA sequence encoding an N-terminal domain of a mature protein naturally driven into the chloroplasts, and a third DNA sequence encoding a second chloroplast transit peptide.

Subsequently, in preferred embodiments of the present invention the expression levels of the protein in host organisms of interest may be determined. In some instances, it may be possible to directly determine functional expression, e.g. as with GFP to generate a detectable optical signal. In some instances it may be chosen to determine physical expression, e.g. by antibody probing, and rely on separate test to verify that physical expression is accompanied by the required function.

In preferred embodiments of the invention, PLT expression will be detectable by a high-throughput screening method, for example, relying on detection of an optical signal. For this purpose, it may be necessary for the protein of interest (P01) to incorporate a tag, or be labelled with a removable tag, which permits detection of expression. Such a tag may be, for example, a fluorescence reporter molecule translationally-fused to the POI, e.g. Green Fluorescent Protein (GFP), Yellow Fluorescent Protein (YFP), Red Fluorescent Protein (RFP), Cyan Fluorescent Protein (CFP) or mCherry. Such a tag may provide a suitable marker for visualisation of functional PLT expression since its expression can be simply and directly assayed by fluorescence measurement in host organisms of interest. It may be an enzyme which can be used to generate an optical signal. Tags used for detection of expression may also be antigen peptide tags. Any tag employed for detection of expression may be cleavable from the POI. Other kinds of label may be used to mark the nucleic acid including organic dye molecules, radiolabels and spin labels which may be small molecules.

In the present invention, plants, plant material or plant part may refer to leaves, stems, roots, seed, grain, embryo, pollen, ovules, flowers, ears, cobs, husks, stalks, root tips, anthers, pericarp, silk, tissue or cells.

In some method of the invention described, transformed plant cells are taken and cultured in a liquid medium. These cells may then be used to generate callus. These transformed plant cells may or may not be induced at this stage.

When callus is formed and then used to generate somatic embryos, this can be obtained from either tissue or cell cultures. The callus is then cultured so as to overexpress the at least one or more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 genes to generate somatic embryos.

Depending on the explant PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 overexpression might first induce embryogenic callus formation from which somatic embryos develop.

In other method of the invention a transformed plant organ or tissue is cultured on solid medium for a period of time to generate somatic embryos.

In any of the aforementioned methods, the plant material is preferably cultured in a basal medium in the absence of plant growth regulators. Particularly the culturing in basal medium without plant growth regulators takes place during the period of overexpression of the one or more PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 genes or proteins.

Once the transformed plant materials defined above have been established and grown to achieve the necessary overexpression of the one or more PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 genes or proteins resulting in the formation of one or more somatic embryos, then the embryos may become detached from the explant or may be removed, for example by microdissection and then cultured separately. The cultured embryos may then be grown into plants.

The invention therefore also provides a plant somatic embryo of any species, comprising an additional copy number of one or more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 genes compared to a genotypically identical untransformed plant cell.

The invention further provides a plant somatic embryo which overexpresses one or more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 transcription factors compared to a genotypically identical untransformed plant cell.

In certain somatic embryos in accordance with the invention, the overexpression of one or more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 is inducible by exposing the somatic embryo to an inducer; preferably wherein the inducer is dexamethasone.

In any aspect of the invention, whether method or somatic embryo, the PLETHORA genes may be used alone or in any combination of two, three, or four.

Preferred embodiments include overexpression of just PLT1. Alternatively, overexpression of just PLT2, or of just PLT3, or of just PLT7.

When combined overexpression is used, the levels of overexpression may not be the same for each PLETHORA gene. In some instances the levels of overexpression of each PLETHORA gene in the combination may differ.

The invention is applicable to any angiosperm plant species, whether Monocot or Dicot.

Preferably, plants which may be subject to the methods and uses of the present invention are crop plants such as cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, pea, and other root, tuber or seed crops. Important seed crops are oil-seed rape, sugar beet, maize, sunflower, soybean, and sorghum. Other plants to which the present invention may be applied may include tomato, cucumber, peppers, lettuce, endive, and vegetable brassicas including cabbage, broccoli, and cauliflower, and carnations, geraniums, tobacco, cucurbits, carrot, strawberry, sunflower, pepper, chrysanthemum.

Grain plants that provide seeds of interest and to which methods and uses of the invention can be applied include oil-seed plants and leguminous plants. These include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc. Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils and chickpea.

In particular, the invention is applicable to crop plants such as those including: corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annua), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberculosum), peanut (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (lpomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus tree (Citrus spp.) cocoa (Theobroma cacao), tea (Camellia senensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifer indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), oats, barley, vegetables and ornamentals.

Similarly, the invention can be applied to perennial fast growing herbaceous and woody plants, for example trees, shrubs and grasses. A non-exhaustive list of examples of tree types that can be subjected to the methods and uses of the invention includes poplar, hybrid poplar, willow, silver maple, black locust, sycamore, sweetgum and eucalyptus. Shrubs include tobacco. Perennial grasses include switchgrass, reed canary grass, prairie cordgrass, tropical grasses, Brachypodium distachyon, and Miscanthus.

Detailed Description

The invention will now be described in detail with reference to the examples and to the drawings in which: Figure 1 shows BBM and PLT2 have dose-dependent overexpression phenotypes. 35S::BBM-GR and 35S::PLT2-GR seedlings were grown for two weeks on medium containing different dexamethasone (DEX) concentrations to post-translationally activate the BBM-GR or PLT2-GR protein. Frequency of 35S::BBM-GR (A) and 35S::PLT2-GR (H) phenotypes (n=62 to 196 seedlings). No additional phenotypes were observed in treatments above 1 pM DEX. Leaf, ectopic leaves; root, ectopic root; SE, somatic embryogenesis. (B-G) Representative phenotypes of 35S::BBMGR seedlings grown on the DEX concentration (pM) indicated in each picture. (B) A normal looking seedling grown without DEX. (C) A small seedling showing epinastic growth of leaves and cotyledons. (D) A small, epinastic seedling with a trichome-bearing ectopic leaf (arrow) on the cotyledon petiole. (E) A seedling with ectopic leaves on the petioles of both cotyledons (arrows). (F) A magnified view of the ectopic leaf (arrow) in (E). (G) A seedling with somatic embryos on the cotyledon margins (arrowheads). (I-N) Representative phenotypes of 353::PLT2-GR seedlings grown on the DEX concentration (pM) indicated in each picture. (I) A wild-type seedling grown in the absence of DEX. (J) A small seedling showing epinastic growth of leaves and cotyledons. (K) A small epinastic seedling with ectopic root formation on the cotyledon (arrow). (L) A magnified view of the ectopic root (arrow) shown in (K). (M, N) Seedlings with somatic embryos on the cotyledons (arrowheads). Scale bars represent 2.5 mm.

Figure 2 shows the effect of applying of a relatively high BBM (A) or PLT2 dose (B) at different time points after sowing (d0-d5). The seedling phenotypes were scored two weeks after the DEX application. For each time point, between 31 and 70 seedlings were analysed. The quantification is shown for single 35S::BBM-GR and 358::PLT2-GR lines, but similar results were obtained with other independent lines.

SE, somatic embryogenesis, SAM, shoot apical meristem.

Figure 3 shows 35S::BBM-GR (A) and 35S::PLT2-GR (B) lines treated with 10 pM DEX at different time points (day 0 (d0),d2, and d4). The development of the seedlings was followed in time post-treatment. The culture time after DEX application is indicated on the bottom right of each picture. The images at different times are from different individuals. The arrowheads and arrows indicate callus and somatic embryos/embryogenic tissue, respectively. The lower-most images in (A) and (B) are magnifications of the boxed regions in the respective +14' images, and show the indirect development of somatic embryos from callus.

Figure 4 shows sections of 35S::BBM-GR and wild-type Col-0 seedlings that were DEX-induced at dO (A) or d4 (B) and cultured for the additional period indicated at the bottom right of each image (+1 to +14 days). The schematic illustrations depict the cotyledon regions (blue boxes) that were sectioned in the images below. BBMGR activation at both dO and d4 induces anticlinal, periclinal and oblique cell divisions, indicated by the horizontal, vertical and oblique arrows, respectively, on the adaxial side of the cotyledon. BBM-GR activation at dO (A) induces cell divisions (+1, +2), and thickening of the cotyledon tip (+4), followed by the direct development of a somatic embryo from this area (+7). By contrast, BBM-GR activation at d4 (B) induces oblique and less compact cell divisions (+1, +3) and the formation of more compact cell masses (arrowheads) from which globular somatic embryos with a distinct epidermis (asterisks) develop. Scale bars, 100 pm.

Figure 5 shows sections of 353::PLT2-GR and wild-type Col-0 seedlings grown in medium supplemented with 10 pM DEX at d4 (A, B) or d2 ( C), and cultured for the additional period indicated on the bottom right of each image (+2 to +9 days). The schematic illustrations depict the cotyledon regions (blue boxes) that were sectioned in the images below. (A, B) PLT2-GR activation at d4 induces cell divisions (+2, arrows) in/around the cotyledon vasculature (+4) in both the distal (A) and proximal (B) parts of the cotyledon. Extensive callus production is observed after 6 days, from which somatic embryos arise later (+9). (C) PLT2-GR activation at d2 induces growth of the region below the SAM and swelling of the cotyledons.

Figure 6 shows the influence of BBM binding on embryo-specific genes. Panel A shows ChIP-seq BBM binding profiles for embryo-expressed genes in somatic embryo tissue. The binding profiles from the 35S::BBM-GFP (upper profile) and BBM::BBM-YFP (lower profile) ChIP-seq experiments are shown. The x-axis shows the nucleotide position of DNA binding in the selected genes (TAIR 10 annotation), the y-axis shows the ChIP-seq score, and the brackets indicate the direction of gene transcription. Peaks with scores above 1.76 (for 35S::BBM-GFP) and 3.96 (for pBBM::BBM-YFP) are considered statistically significant (FDR<0.05).

(B) The relative expression of embryo-specific genes was determined by quantitative real-time RT-PCR for DEX+CHX treated 35S::BBM-GR and 35S::PLT2-GR seedlings at dl and d5 using DEX+CHX treated Col-0 as the calibrator and the SAND gene (Czechowski et al., 2005, Plant Phys 139:5-17) as the reference. Error bars indicate standard errors of the three biological replicates. Statistically significant differences (*) between 35,3::BBM-GR/35S::PLT2-GR and Col-0 were determined using a Student's t-test (p<0.01). ND, not detected.

Figure 7 shows BBM-GR activates LECI expression in a developmentally 5 specific manner Wild-type Col-0 (A), LECI::LECI-GFP (B) and LECI::LECI-GFP + 35S::BBM-GR (C, D) seedlings were treated with 10 pM DEX at dl or d4 and the GFP signal was observed from 1 to 10 days later (indicated on the bottom right of each picture). The images show the adaxial sides of cotyledons, unless indicated otherwise (ab, abaxial side). The green signal in Col-0 (A) and LEC1::LEC1-GFP (B) cotyledon tips is autofluorescence. Seedlings that were treated with DEX before germination show the first patches of ectopic LECI expression one day after BBM activation (C). Seedlings that were treated with DEX after seed germination (D) show LECI expression around 10 days after BBM-GR activation (d4+10), when embryogenic clusters are visible (arrows). The arrowhead in (d4+7) indicates the callus that is formed on the distal end of the cotyledon blade. The outline of the cotyledon margins in (D) is shown with dashed lines. Red autofluorescence was used to delineate the tissue. Scale bars, 250 pm.

Figure 8 shows (A) the percentage of primary embryogenic transformants obtained after transformation of the 35S::BBM-GR construct to wt (Ws/Col) or the indicated mutants. Statistically significant differences (*) between the mutant and the corresponding wt line were determined using a Pearson's chi-squared test (p<0.05). The total number of transformants per line is indicated above each bar. Panel B shows phenotypes of embryogenesis mutants that contain the 35S::BBM-GR construct. In the lec1-2 and fus3-3 mutants, BBM-GR activation leads to severe growth inhibition, the /ec1-2 mutant was obtained via embryo rescue (C). Severe growth inhibition was also observed in the /ec2-1 mutant (left), but also embryogenic seedlings could be obtained (right). In the ag115-3 mutant, BBM-GR activation leads to milder growth inhibition (left) and SE (right). Arrowheads indicate the somatic embryos formed on the cotyledon tips. Panel C shows phenotype and genotype of the (progeny of) the embryogenic transformants obtained in the lec1-2+1-and fus3-3+6 segregating populations. The numbers of rescued embryos do not reflect the lec1-2 phenotype segregation ratio. Phosphinothricin-resistance was used to select the 35S::BBM-GR transgene.

Figure 9 shows a schematic representation of the genetic interactions between genes involved in SE. The solid lines indicate DNA binding plus transcriptional activation or repression, while the dashed lines indicate DNA binding in the absence of transcriptional regulation.

Figure 10 shows somatic embryo phenotypes of Arabidopsis primary transformants: 10 358::PLT1 (A); 35S::PLT2 (B); 35S::PLT3/AIL6 (C); and 358::PLT7 (D). Seedlings were grown on selection medium for 12 days (C), 3 weeks (D), 4 weeks (B) or 7 weeks (A).

Figure 11 shows the effect of different concentrations of dexamethasone (DEX) on 15 wild-type Arabidopsis.

Figure 12 shows a confocal microscopy image of Arabidopsis cells expressing 35S::BBM::GFP::GR in response to induction by varying concentrations of DEX. BBM-GFP-GR cytoplasmic/nuclear localization can be regulated by the concentration of DEX. Higher DEX concentrations lead to increased nuclear localization, the site where the BBM transcription factor is active.

Figure 13 shows the effects of a low BBM/PLT2 dose on the differentiation of leaf epidermal cells. The abaxial sides of cleared first leaves of nine day-old 35S::BBM-GR (A, C) and 358::PLT2-GR (B, D) seedlings grown on medium without DEX (A, B) or with 0.1 or 0.02 pM DEX (C, D). A relatively low BBM or PLT2 dose leads to the development of smaller and less-lobed leaf pavement cells compared to the control. Scale bars, 25 pm.

(E) Stomata! differentiation in DEX-treated 35S::BBM-GR and 35S::PLT2-GR seedlings is reduced compared to untreated seedlings. Fewer mature stomata were found in leaves of DEX-treated 35S::BBM-GR/PLT2-GR seedlings, as reflected by a lower stomatal index (SI), while the number of stomata! meristemoids was increased (meristemoid index, MI). The stomata! lineage index (SLI), reflecting the total number of stomata and stomatal precursors, was lower in DEX-treated 35S::BBM-GR/PLT2-GR leaves than in the control. For each index, eight images were analysed with total cell numbers between 125 and 350 per image. Error bars indicate standard errors.*, statistically significant difference compared to the control (p<0.05 in Student's t-test).

Figure 14 shows BBM/PLT2 dose-dependent overexpression phenotypes in independent transgenic lines. Effect of DEX dose on a the development of additional, independent 35S::BBM-GR and 358::PLT2-GR lines. The experimental conditions were the same as for the lines shown in Figure 1. No additional phenotypes were observed in treatments above 1 pM DEX. n=200 to 350 seedlings. Leaf, ectopic leaves; root, ectopic root; SE, somatic embryogenesis.

The inventors have surprisingly discovered that overexpression of all AIL genes, except for the phylogenetically-distinct AIL1 and AINTEGUMENTA, induces SE, suggesting extensive overlap in AIL function. Using BBM and PLT2 as representatives of AIL function, the inventors have discovered that AIL-mediated SE is dose-and context-dependent, where a relatively high dose induces SE and a relatively low dose induces shoot (BBM) or root (PLT2) organogenesis and early expression of BBM or PLT2 induces SE directly from seedling tissues, whereas late expression induces SE indirectly from callus.

Figure 15 shows the results of an in silico alignment of the amino acid sequences of PLT genes 1, 2, 3, 4, 5, 7 and BBM were aligned and compared in silico. Several motifs were identified as characteristic of individual PLT proteins and the relative 25 positions of these are shown on the schematic diagram.

Below are polynucleotide and amino acid sequences of PLT genes used in accordance with the invention: [SEQ ID NO: 1] AT3G20840.1 (PLT1 FULL LENGTH GENOMIC) 1 _PGA ' ,...k; :;k T PAX:" AI\ F F TT::T TTC:(...NCTCCTC A.A.;t10::::1A-...,4:::'....;I:AA::::tAlt..-..,-1.,\V...(71.PE 11::: ,, '.,!:.:CACACGGTEEArTGAG:GA.:..GA, . , 7GAAGGA:(3A.H:GAGT!ICCAAHA,(3TG.G.CCEGA.

E.........4.."."T...0...t<:4...''...,:''..X--d.dA*t.d.":,.-iT',.i:::::. Att:1"::::AAtEH.1.-5A.J.1ti'...t.,Ad' A9JH.... 7c.;.-'?...''.A-c7S, .. 1: ........................................

'..E4 5T.. '..".EVP(,,,;(;A:4TAAI.. AC.A1:1rtl.AtA....:'.C.T. ... .. t.':;t:GAt:Tt:Ay.ATA7.:I:Ct:11._k c,Zr"..c.:,!:.LEE1.7,47.,,.:1,7:1;7.(1..i,W;(;.... 1: .... 37r....:(VVil-r!.'"...1'>..c_1.!LEHE...71.Q.cTc1V;:::::":'-',1:'HE.:;;;; (-7211'>.(...;T71c1=;:::!',1.. 511'..1:1';',tqlq't::EHEA!..1ttl...,:::33:1A.:.(7HE:::::_ACHJ.:(::::: ''12t:';'..:')_:-.,4,E:::E:i....44.:,'.4iVi';',.!.-17:::',:,V11:::(4.;_: TE:::±Hg..;'.:_:1-c:(:!:1,k'ji':: 1.,,....601HHD"._74.:CA.a.:,.:JC..G.HAGA:::::!',...7,1AC,CC.CIH,H(..:1;C:: :ATik.c,,:GCT,I,,ACX,K71.:CAX:AGCC.G.'1..1.... AH:1::GTTGAEAC.G.HGCCACCC,AAHGACGPGCATTI,H:GGAACTTCHHGACAAGG',:',..A 1::11.QMyH:EcTc7.2,j.:271..7c747:77..cH.:.,1W.-;...77.7.:_.-='i...,::7, 1HH,7,7,7...'7'=.1..'ir.:17'..c77:.

1$1Hy1h.-....'11.:',7T!4.ill...11."1-:..."..J1AIHI'fl,M..S....1'..!,:.. .r1,1.;r1,'14,...:;;4.:1.. (1..?:-.',.'1.A,'....C.A.::":.:',.-_;:.:()',.

:::::.....0....IyW-Y4*ca.:',.),'-..A:t...:-.,.._''',....2)4::(±2.4.... c;(,yHl.."...:(....:'',."6.4.:6Hytl1('"24',1:.

S....4...H:ctr-'..',;'....t...5:,,OHTV',.-..1r?..,...c'...._40.).--A4t. f.:..7A01:::IM....7'11-',:"..?..,AP0Z.A.Z.1;.."A:::;:.: ...........:::04:EH:E....'A6t.:(..i7.}.._'4VTA::::.11......(t;t....._'... '",:_tI1Z;H:4*:=:::t1A0:1'..11:61....c...i.i,tt...tT)'.,.%0...HrMI11.t... 00... 15:::::::::::r.J.H:...:±3TCATALE:TRA:::CTAa.TTITA.HATTTGTC: r1CHAI7c7!TXTIHTIc3ATEQYc-;T: k1.!'(:#:';T:iAt..1::...4'w.:::....,:-',::::::......t.,T,,.4'...H:..':..i; ..::::(....;''-!;!./44..:::VA:-.4ctl'.....;7-i:E.c'4t........::::::::.t... c.4th(t....,1 1..::1:H::...::"XiATE,....",.=,(..i.1A_TAIACZTIV=Zt....17,Z:H1nTAT:A=C1)77 (:A!..:1'..P.:AH:..H::(..=AAA1:2111-.N1:11: I04.EHEE:.ETAT,:ATC:AAA7::EE:.7C77:GC:77YiATAE1.EE',P:7GCAI':'..A.T. GEHYACAAA',A1=s:r:ci'ii'AH/T'.;:AACSY1-]CA.

4:...ITa...E5±..AaTJA.T.:(;HATC..TA:c::',.C.T.c:CHHACIIAA",(11j1ACHHTG: (3GG.TC!'CTIIEHHCAACIAC:TME. 20TJ::::......01:46114....,.t:.g"..H:4..t....4...t..f.:icA044..!i..!):.... 4A.1.:,tA:EHt..Ott..'t:.: -;:tlt..OHAt...,:,:;:tt?:.J...AAH......ttlittOtHAt0..;Al6t..H:El%tAt'..,.. .: &F)IA_5A45,..91-4VC(1i1j...-.:11AHLEGAcAAIA:HAG...(ACVNAtHHOA-JAAAAJ1: ia..5.MHETTCGTGCTGEE:::CCZN5E.',X,..ALGEE.H.G±UTTECETTXTE...-35GTTJ.J:T: CWHE:TMA....G.GC1-.',37 1...4,;)4HH11:!(...tAAAIAAAHLEIttAAAt..tAHYTIAAt.C5hAl:H'ICAAC...TH. TAAIHHA1211.1AA 1A5THETCAC!,R3R:7];AGTA(Tr.TEGGLITEE,..E7T7CGAG&rci',E...... GCTETCGATCiHHTA7..C..GAGGAB: :"...2.'...(14HHHJt...'.PAAA4T'EHVtAVAt':.TAAT..PYIItiAHVT..).-PAIIHE.. HHPt4AAAA. LS.......5',..,AH*J,1tIttAtttHttttItA±HHJtitt4ttHE.Itt..;:t:tt::4.ti. HEHEtAtt:.,','±kt:CItE.

iH6tAhHEAtAtAtAE.H:.t:;(t.:;LAAt:Atti:klA..6At6tAZH!:(:T'.'AAt,Att'.o. httt::. 7.1:...j...E.,...):,,HEc4q7r..,c7.:341.q..E..E..,:c::c7:777.,77G.c:77.: 07T177....E,RG,TAAGTATc.HE.AG.T.TA17:97.AA 30AT..4%:;.r.':4';.';'r%T.T'..fAMHA-'.'PM(.'A.-,'110t'..AVIAAAAEtttlA'AA:: .I'A41'.. 11E.AdtAtIAt4.,JHAA..1.i.:1-.t..'AE.HYAi(t.'.:.t:A.(i±E.ITA±.A..,,tActHH. 1=A...^ ,Y1.14...d.....::c.,:.04 ::::Al...11:::::RCC7TACG,H.CA7ATACA7(7_,:,,HCCA4:AfCakA:HHAA: CATAACTFTGAACCA.(.7C.

±....,-,:,,,1,,H,I."..,LY,t4,..-....2'.-4A',..4,41,H....4A:,4),.',.:,.. ...1...".,,.1.',..,,i:44Sci.c-,,:...]:L±f:,......11,:--q1....1....1/'=:i. -..]):c.:1., -,1-:,.......$43':HLIT.,7'...!...1;Q1:2(.-7'..,i:1:...ql::1.H.::::A.,A!;; ",rtP1:A11(VNI:.,7..'21HHcg^ (.7ci:,...T*-7-,Ze..,1,;:q ::EAAAC;...GC!TCAEH;....AA.GAAt:TCA::EE:EAGCTCTTAGEEEETCITCAAGA '' [SEQ ID NO: 2] AT1G51190.1 (PLT2 FULL LENGTH GENOMIC) 25:LIAAE.,1411HA.,6,.;0....ATAE.ttHIAAAAHWIAMINS.AgHtlnYjitt arTn77-21-72, k.2.1Amm---21r " _. ."..

I. C...1.7\2't'l.i'C 2.f LY.1 G A:2 l'r A '1 G 4C1 A2STTI,-.2,2A2 TrIAT,..CGC(.1JJ' CATATZC1,:',if H I; g: , ,* , , 1.* I.; 5C1 TAPjU'LTCaAA.A.C.X2TCATC CACATG1FTT A....2.2(1ATTr1TTA TG.TT(..72!,11714:TA T-1--.1'2O,TTGT-11 TTTTTA.C.:2A. ATTTTTGTTT GGTTTCAC: 601 AT211\ATT*niA 1)ICJ.T2CInA TTAGGAIGGPI ATSTG11-TCAA TccncATGGT 61 (.2,-.CAGGCC AA-C3GTGCACA GGTTOC:AARa GIGE,C7CATT TCTT2),,C5,GACT 701 GA...GOAA_AfOG CGG,12CP,T1 CAACCTOGTA OCTTAT:1...ACG 71:91,'CATTCATCA 11..-i):Ce."12,CGCC: TCCGACTACT ACTTTC:A.AAC CA7-',.T.P,.(101TG 8C1 TTACCTACAC TOGTCACTTC TCCCTOT;AT GCTOCTAATA,AfTATC:',ACCT 8S1 TC-A..-AGAGST GCACACAAfri C1-CTCTCICT ATCGGAACTA 901 CTGGAC3.07GC CGCTRCT\GA:A GTCGCCP,CTC TGAAT!,GCCTC GCCGGCTGJ(AG 10.LE., 1 " C Lc /*:99'"9'7 'PG.( 2,-; CAL:\ . 1 C11 1 'Si, :2,2 A ATITTHSAAAttIVCHAVEMAtAiVI'IHEH(J:IAA!.17SIZAHL:ttsZLTI:::'41.1:A. 70'.-a5.,..I.EE...E1RA.C3T7E.EHA.:(.77CT:CeHAATTET7kEE..97GAT1.SCOTH7: 01T7AGAT II...04HHATAAIACHAAA'.6:Y.3AAIHA:0A.7.:6P-!'l.;.I'-:,TOE.HAAAAAtAl7AHHC, A?.'..:AA:E.-I'l-'-'.iE,cii 201 11GATCTETAC TIGGCA.Af1=J1 TLACIAA(1.-P,A TAAA.TATTA.P, 00.-ATGCTAT 7.\...7 71,T A)1 T riT (T.; C71A2,...1(9.,.AHT 12.17:17:: 7 TA,7" . .11.7 T (17. A T 1:21 2 1 11'1 '1.2,1/21.1n..19 i&7.17 -AP ff (Jr 2.....3L11:::CASCAGA.CHETTATECACAIAHEGC1GCGATAHATTTCGAGGEHTCLACGC:(4 2,3,51,HEETTACAAACTEITT(...:3AGA!rAAA,H1C,(161A1(17:ATEHIriAAACCCAHiTCC. rt..,(17:ASAn 24fl"CaAACAaAC!TTC1.1:CT1AffA131?.:GHCGT(:::GTGEGCE11T:AAAC111CCTCCA: AAGAA.C2CCE 04HAOtAAT1TAHSAAIT.(15AAtAHl'i:1.:AIIHGVXCH11ATA [SEQ ID NO: 3] AT5G10510.3 (PLT3 FULL LENGTH GENOMIC) 51 TCCTIC1=-F1.1C TITTGTTTTA loI. A.r2OTTOTTCT ACCTCCTakT TA:TCCTTTTC TCIAACTOTTC 151 TTETICTTOT.17,,'t'; ATIGTACTA.Al P:12.,,iCiTC1fAAC 2.(j] rTrnmcm-,IT,77 \AAL,'A-Acn LnflAanA.ALL 1 Z: '7'\'.'. A.1. T. n T15,111-'1.: r&T T.21AC TT (TT AG C, c (2C 1'(71(cT T TrnrnmI TC'T If 351 ATkAILITTTA CTTTAAAATA TAATC13CA11(1 CT(IAGGAAA111 CGTTMACCAA rA.,AGTAA 77 37 GraCEE.:::17C7CEiTrAAAC7.A.::::7CA_G_P,517C7THEHHOETALTAAAA.E.H...H.: 3A7TCTGA_TE: 30::::TTJUCTTRTA_TbTAMTTGATFG::::7CA7707: 2:4-1(1:::::::977T7CATTCHA(7771AA: CO1 CTEE: =AgCCAARTHE:=C7CTTECT 7.0 1 T T OCTTO 10111 7-;_.-AjvrYor-pT./7 TTIS'ATCTTC7 ril flTT-FSTTUT.fli-.; .7'innTrFin4 MTTTerCflGTS S. G.',W'cc.AC7T:EHHCCATCACC..E.ACHEHEGAJ2.T7CIA.AA'A

II

23n,HEE:ATTTTTTGCRHTT7C=AIGE:GGGCCAAP.:::ZT7777T.TTA::.!Jl:TCACA'AT 23.51,,HEACTt.VTAL.IYTEHEAATIT,AtC,HAAAAAA'..1'.AAA1::;A:ATAE:..,A,ALTAA: AA:tA, IH::::.FHAkCTCaTAG::::':ATAqATAc4::HTGATTTGACG:H::i.TTATGCAGGCH:HATTGAV:; r17.G 11 ' f'ri, .^"' f f 15;4.....:OTH.TQTTTQJ7QTHTVTc.,A7MH.Q3...QT.1:c.:AHT(W.!47..TATJH 3......)04EHEE:ATCTAGGCT7:TGAK:XWATCEE:HECAACC.7.TT?H,7CGTCTT7T..:AHE 11H:::AACT3.R.TTATCAH.ACaCAGGAAR::14:nTAGC1C.7.:::.1-T:b7C717CTAAGGGCT7C. C..7.:A::CA 39Z1".".1:,:qAGCCIA:2A,"al,'MV.;:,.:.NSiaN.H.2: ±7CALATTECAEEGhGGAAXAALEitGCTI22:1'.., 2L4:::::tAGAGCATT:H:AACIICf2TCHI7HTGECI45:::::::TTC1-3C7TT:H3A3TX:a.. CAA"ji: 15. . . . . . . . . : : : : : : 4.....tA:..EHE:ACACAIAAGC:.EHEIGACMAfS. A?HAA1CTTAAAAHAICTCACTTIH1G3TTITGAIT: [SEQ ID NO: 4] AT5G65510.1 (PLT7 FULL LENGTH GENOMIC) 20....11.At(i.t.O.CliCtlH(1!.AAItMC-:AXHVVI,,,t'.:11:.A.=;1T.TIA(i=. 11tMthATE.(15.EGA EET.(DJEEHCY'TM,:::ETP...r2M3C..HETTA..:TCdN'INWHH3AiQtN.C.VDCHZEE.:: NTGGTAAkYAAEEEECAM'AA:_MTTTE 7.:H,7*7*"7:7" * '''''' 7*7 7:7 7 7.:7 ' 777, '' "" "7,"**"7.:7 707 Th77:77.:.7:77 '' * *** *** *** 7 707 ***** .7:7:7* * * H[ H.:* * * ** (.7-.7)(7.* .7 (7.'7, (7.7 7.7-:77771-.7:777 7,.7.7777 H7.77:::77'777.L77H-77'7:-Hf*77.-77.:'77 * 77*,...74 77. 7.7 ' '' '' 77:77 ' * 4..: *"7.7:7 7 7 '' * '' "7.:"** 7 7 ALA ***

T

77.77!: 7: :H E: HT EH 7: 77 T. 7: H.* 77E 7:7:7E7' 77::: 7 E 7TE 7777 77 7-7HE EGCACJAINTOG T.TEE EE TAT] YVA7f!IPETE EE TL'IZTTGATT TTGI'I'CCTAGTCCTGAI..

/..rnm:T.CM-'71r,rrn M'Y'''7T(7-7.rnef'7.:77 7T71,77.17,MMTCC TmT7kAccmTT 451 CATIII%CilL'A.:SAA. 1CIGI-.1G5ZP AT\CCICOTCC: GTE3C-ijVLrLA 3A5 4'; Thr 1 rii:7-:1-** \ T c' * 1... * - :S 1. 2111.1/212-1(irAa5IC.:X_; 401 rn13,,T2'7,T 701 T 751 GCTI,n7([2',7rr' 8C1 CGGCGAGTT AGGGTTTI--/A2!: GGTGATTGCA CCACCACCGG Al;;GAGTTTTG 851 ICICTAGGC:,G TIALCAACAC: ATCAGATCA:,... OCTITC;nGOT 9C1 CGAGT-1:3AGG-7 ACA4?=,..GA'Af.--_]Aa RACP,.GTTICT rPTCAAA(:A1:: 1LIHAACT.T.11.:C;AGHA1'TIIT.C.::".1..::::TTHGGC...12A1H.CAIGT.T.: (1CAIEHHTAAH.C.:AAAftk 15...1::::::::9..:HH1A-TTTQTTLf:-:iHTIY.A..";.311:H3A3TIQAAHETQ777::(";:;. -)1;ATEHT'::AAA;:',.;.;Q IE.04EHEE:HAA.CTACqTTLGH::ATT7GCGTTA:AAAA.CAAACA:EHE7T7A7C7TTHEH. AACT77TkTG 1:;...5i--)1'HT;.rnAA:..kAtCH1TA1t...t:.45'1TA1:..(-XLHAt"."t:tAA!.PHE.J.. ;.C(iCl:''.'J..

1-::AtAhLEItAAtAAAtAE.*tAttItttlHHAA,J.:JAttkgAd'ffAtAtt.: tAtAh!h!tAJtttttd 2...151:...7.7',TRC",C.TITG7H,GT57177ACC:H7T7TGc:7T7G::R?)77:....(3R2TG: H7.7.17sAAAT(7:T: 3.)li,,H,IfTTCTCACCCH,ATTT7T7TTAT,H11.GTGMATI.H.AMATGTTA,HTTATCITTIT.T, 2.....4TaHqGTGAATGATLETT.TTGrAAT.G:icic.TAAAczTGE":Tc7T7cTT.Tc""T.T7TAcAA 01,,H;40.:''.Tr.G.01T.V1t±irttEHLAtt6(i....4'...t.:6,:::;HtlftT*TtA...: i=i&HAJ:34.6t.g.,:::t1A.

2z:z1HH...G.GTAAG.cA2,--HIAAIRrIclAT3Q:LWA4E'LAAVAT4THH.AT(...2,A74a(i ZO'1]HY'K':-:':.r.-rE0A-TEETE(ATE(71PHP::77A-TET(",AhH'.:0QT0c-li.TY: 1T'A'i?,:,..:A:-(4.A.

'4::..1HI:<)'..1Q7:1c.c...;:c7(..?-7:QH):T7(.7.-1]:c...Q--'i.E-(5.. c7H777;171-7,.':(77::.c:.74 7tItAt,:,PP:::CHA,AIt,ttn,_"qi't,11':,I,A:'jtP,:.tITHEHTI,V1-i,A,::.,,In, A,.,nq,HEH:;.(_1:lqilt,Ilt Z7::EfqHTP,h:c;:.7X17T';.'TTTT.(;'T_777H7_;TLIET7...C.,'::::::;TT.T:A; C!7T1,:'-CHHTTcATC.7 2:8H0411CIATqATT:H:ATATtICkiH3Af2CAkHAA:k1ACTIT.GA:k',AAAIk._;AAT.: AATGACCAACAAJTTHHTAfffEiATC.THCTAGGAGGTHHGINI-\TAAA 2....gt11:1:':7PIXAAtTA:!ATATAITIH:H.:(:!tl'AtHT5CA:::::.AAAttAA..:tt:::: M111":17:::ft:I=.,:.:".:1.,,.'..r: :551H::1::tt.::i,tTHVAA::,1!:::HT;4AA±11tY:'.111:::tA.A..AAti..t.HHAZt. ±dit..Tg.TICAA.AC 3:G 0 IH HIT C PAT.22...21PiTH HP..J;"'LGGIGT.f C:L1;::H:C:1;:;f;i:::: 15i:Eli-VEC1;:::H17CIUC::CiiiGGTHHC:GET:TGG1:::"U;;::::::: ATZTT..TACTH: C: ,ACCT T 7 ?J '...:T H.c3(T....,T:1:-.1'..C.c-::1:H 71:'..Pt_7.07:.:77:E72:7Z.H l'7,...4':4.;(h:.4 W GT CH.7":A77CT7C.A. H.:CIC:f.;:.7'17.;GAAA'AA 3I::SAH1(..:;,..0(OTIHAII:t.:01-1AVAH1-4,1T0A1A.t::(--:AA:::4Tij..(:::::: :.:,:..,2......QH.....;.A.G'ASQfliA".:4H:1;;;;A:Q..;r.::/ItE.O.E:';;Z:', QHH(-').(1:2V.:::).:;VV.:4a:112Q4'...4..c4IS:4ATI::::;:&(',.CA(4:t.4:: tttt,;AA0H1',,1T.:atM:1dH::::Ai..,:.,:4,:::Ttt!:;AtH:/:Atlt.t:V i..1'3ciAHH17:1-.CTGE7q:Gik.G.GO:1...:-GCH7G,(;I:HG-:;(:*1AZ.Z\C..7rHHA:A. :C70(3.-.<.:7,(11:7 1,H,HkAq4(EHEt:1!-PtAtA4HEH::itC.,;:jlitt...:::_:,...,::::,d,EAAtt.tttA,:: :(::::A....,4tEli..,-.A1;:i.t, 20:,441H::::'XQO'T4',=a'H':I,..:::.:..::;:=1:.,,1(,-:,..,'.,'.)..Ar.I',j., ',.c-:;:',T.,,:AA,1:.4.7.7cHHA4cQ,1:.,-;:.:',-1.(.,=,,T: 4::$,'MH:0::::;1-.Att.r':-..t)i.,:t0A4t.Jt(Aldt(:Et'..:',.:tlA0)A.:t.:: MAJAtJttlEttt JEEH:(}.}.A_TETPJc:(:::.E').."HE7TE.(.;:..(:7...:(..:Tc".0.(7.;H.J...3::: XCTA(:A14::.jITIEH.:J)C.:ME.(3.CJV..C;i7EEHli'........r.E(.::::;IAAH.(7.;, ...cAX".....0 a::..1HHLZt0A?,:t.,T1'.PTITIH(111.:5:'.1ttlHAA....(tAti,11.VH1X1AA.

[SEQ ID NO: 10] AT3G20840.1 (PLT1 cDNA) ZKi.PZX.117QTAHEXWc:(47-7cictHQc..,..ic777,WITEETT7cAc...:SAEEEAc8Tc71-.7E EHHH.5I"1T,]'iCa,,..ZO,JXMt..At'AHEW.,:rrr:,_lEH00:Ia4.M(-_Wt't4'.0A(.:,-4 EEETLaEEEEE:AOCTTTTCAEEEEEAACACAAOAEEEEEM=kT. ATCaEEHTCAAETCCACAEEHCCCCGCACA 1GACT.74.-TIi:(G5-.GTH:H:::CCCAAMGTG::::":77icCGA):XT:T::::37.:GS5TCAG Ej2.:(i1ti4,A_At,.,0,:...=.p_.,.ry,t1,it.4.4..-.:;tiE.-4.4..:;,1:I.,,:,::: w4.-:....-;,.;.,;..ot:0A.:.6 1:::::.P41..c1AHCT:':::t.H:::C...:CZ....,t;AL..(47,<;AA_I!H:ifi,.:..,:::0. 414.::(14TV4;.....T(.,A:HE;24/1A4,AZ.1::i:: Ii-,":::-±.h.i'i,1.:....1:Y.,-.:Y.2)'7,,:(11:0p4:::4,.),.4.1p..*:P,;:(;:.. ,.Tc4044......."4...4 H.....:Es..ti,..1:11,6401nAAkHr.r.,A6AM.E:C.±.7P.k:AAAT.._4(TAH.11.:(..Al. tA.:0...t.A16: 401.HHGGACCA:CGqH7G.(3qAA2'ATHHGIGARAEA:AAGCT7CATELATCGGAWC I:At7nTIGTAL:::::nAACk3qAAtCt;tC,Yrk21AMHAAnt:A7ACH.i..AA:GT.TIA:.(217' . 1.1.....±3.AffOGAGE.AE:THTACAA!Aff"1"CACCIAACAICHHG7tiAEATGGAP:C.:CAACTiG. A2c.

7.1..i..Q1'E.::JETCCARCC7:7HE71AAAAGTE.HETAECITATI:CHE:(717CCS7GAI?,..: ',1AACCH.G.G [SEQ ID NO: 11] AT1G51190.1 (PLT2 cDNA) : : . : . . : . : . . : . : : .. . .. . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . .. . .. . . . . . . . . . . . . . . . . . . . . . . .. . .. . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . .. . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . .. . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2D1 ATTC:I.'21/21C TAGGTTTGGT EI,c.:7::; G:::17ETCAPATEEACT:1;;GC:TGE$VIJIHT -:::E.PLC:EEE11:1GAEC:Z.A:14PLTCEEEEGGSCTA7,1E EE:::.4:LIEEH:;:tTCCCACTAtHETAtqITCAAAEHECaIVMVM?EEHG11:: ACCTAAEHGTCMCACITE EH.T451EHEE::E5TnCCTCTAAEEHTntItCAATEE::EAA1ZATC_;At::EHTVnAGACHE:: ItAYjiACAAT 1.::"...7111::H:".rc;TTiGA7.GAGAHAGG.AC7A7CAHG".(7,1AAGG_?,-=,,AH: GRCAACTCTAHC7:2:AGC;TGGG 1.5...04HH1t,Att..Tht.AA.:HEA..C.AAlitAl.'.1t(-C.E.t.LEAkII.1:-..'17.;.t.. (t.'..!".17A.T.kif.L1A.C..A.T.:.t7..AE..

19C1 GhGTCTIOTT GATTATAGT,I GGATTTAGTG TTITYAffITTO 1TAETI1TSI1/2-CCGCf--3TJ3.25T ttTV1HHTA6031ATE::::EATA..:':....:',:VAAAIEE::::TAA:.:4AgtA, 2......c,ifiqEHEE.irrAATTTTRE:::::::TT:i=*AAA...(Jzr...TEE::::AtAcr,.:TTr. T.qA.r7AATTTTTHHcA'ArTT.,.74.T.A 24b4HE4..":tt-Aki.......HAihAA±tthL6Hr.i"71t:::7::::rTY(::;:t:±E.HEtttrf. A: [SEQ ID NO: 12] AT5G10510.3 (PLT3 CDS) CGATC':-AAAHT(YZITAt(T::J:tTTTC:!:J;CT:c.;'r:::'4C<W,Y1.':G'1'i: 4:"::::04,1tT:=HE'tt:1-tl:V:;',::::1::(!Iii.if4tt:41tHHTttrPtt'itl"H:o.4.. ,:tt::TV :HT:Q:My:HcTcccf::Y,-77,7:Hc71*-7:77.:(2-7::71."qcT:c,77:(-1:1-7.:M777, 71Ty:17c7377:7-11H::::::-..4.kr.LAA4:7A:1:::tlitAx's,:(1',1,111::::11: CAIA1P-4:::,,A:1-,:::::::(±AA:::±;:(2:titA,(nEH:H:T3A:AC 10H'..::2::iHH:....A'Ec.f,':'.":',7_;2:1;HJSC-.;4fT.'i':Hc.j.i"-.:f:'QT.. T.Z:2,:s.,HH:-rj0Z.,'Irrj':(5XH::X.,I=Ac:,c."/=.:QVg t.....,;',[::.....:::.-41.--00...-V:(AA.....,A.1:17.1n1:.(tT.1'.0.:.(:,? {1:::;.-::,M Tc7711cTATc,Q.317CGTTAHHCTCCGERCHHAG7CAAACCGT2iZACAZ7'.AZA tI.HHtH:41.:,::::::::cit'Jt,H:Hk::::7.::::0:,./.,:?tly4:7::,:(aA.L.:,(::. J:,.60:Is.j,.':;:(-'4..4.;.t4...'r.:..ri)4::.4:4:'.,:k.7=.;(;:;(4 40AH1LEY?ttPt...0tHH,:7J.:74J:'7,7).r7t...).:.'4.;...H:,,t0ct.4t41 t:JttAYET,,:;:..It...4 15:::4TA:::::::(1'..(,qHH,:qTA:::::p".,17.,Aw(n-,:ce4i:Htipizr_tiA(7H,..t. .c*:,*:!-ITYypiH:Hr..q..(±:rmh(7,;.

:01AAP(Wa[t,..c.t:HtlI(:::(:!1:J5A::::::X1lalliIi=HIZV(Y5TIHH6A::: Patilt1,..11: 4::HZ:5!n:0(t,ATC,Mt:H:A.::(Ellt.::::AtH:7:1(4q(11ANC:f=A:c4:/ltI:*(it. AtIltIii.: :±::).14:72:UV::NTA:QA:Z;::TJ::17*:-A7c-1:.1c4Q:Ea:TcTL:::::7':'PZ70::H::: ".::.:ATE:TA: :1::H:po.,:A,::4:::Av:,*(4(AitEA:::AEJAAEAE,-.*APE:i:Eit,:spA.itApv -: - : : : ---. --, ---:: ,-, ,:-:-*, :--: ---!-: ::-: : :--- ' ,-**-: ,: :±:-:--::-:H:--:.- F-: : :.,--:-:-, : * Hr:-HTT,.:)4EETAVaAGRAGA.CHEAZATTCV5HAGGAGA.A.G.GEHCTGTTGTC.GCEEHW3GCAAAEA 151H1CACIRTTGTTEHOT..P,ATAAGA'REHGRT7G0.7.GATHE3cGTT7c17EH.AAp.,..GGAEE. 77. **E:04::HAT:qqALA:H:VI:AttiH:H:6M:HIPSAOAl:**(16r..,AA:AHHAPlAA:6::::A ATOt.77kEHT:ATATAE..*.:(21riTHEAA540AA.,OTrAM.TJET:OEHOAA%.04=',E77n :4::Hit..Eittttt:H::::A:(.:tttttttHOt61:Jti=',.tttt:H*.t.Atttt.:tAtHt: t-iktit:IAtE6: 251HHTTTG1fTCTGEHCT72ARTCREEHAaTY:.GTGGATAEH7,X.Q.EHk7.Qc.=.:).:, iticJEEHEf7SAI:-.;c2..7THEEQQZCT7TWEHEcicrTRP=AN:ZEEACETGGANTGCEHTAcT (-1TACC f:;:54:;HEw:JT:;::xv;T:.:1;±zc.::;;cTi.vJ7:):N.cEc;py::>:;EHT::EEI:scr,i, LT!c:,Ec1pf;E-r:.:E:EHqpH14-::.rr:EEyrci:s:i.vap,HH.AisTJp:GEp..Js1A IAHHt'4AP.t:O!!H.:.:a0:MtI(;AHlti,:-.):;;:..O.A:7.1"J7t.A4HH.-AlWt 1:15iAtt[l....ttAfTALHAtrit.:(:.72t-E:±AHL:h.ii.:Att(::1At4:71:iiA:±A: tt-tt:.:..ttA.,c:A 1:;..:.IH'.;10-.=4Vli..:;0AAaAA.::4AIHH1040A'41HOgaOO*V1:.ti',1 4f..2,1t,AAtt',HAJttttkAtt--:tHAA*HY1,...:'titsAAtHHtAA'.t..A 1H::.:Y.,?..:1...:::'.-.:A1,4HAVai,.2:,k;X::::::M=4N16H::::1'.i44:14.t.:AA (111HHT.:0AcT(...7.:-..W 44-.::40,1:11',40;-:Afr:.!JOIHP:-$.0-4.t44.4.-4\::0,":-4.:(E."4...(0gA: IrP.40-:.)4,',.....2:-..(: ACJhGCTAKAC4TT.AAGTCTJ:TGGAGG:H:Tc:,.C7YC;CT7CAH:H:TC:GA.X.;:.CAC;A.

744.60144.,qAATCrTTTE...42r2.:AA:f,..4AZt14.241CTTIAttHEACtACtACCX..::: 4AtAACAA:.(4An 5')±...:TEE11E1..c',...4.Thc....c1;c1:1ic24...:(5.c4N6-(.23P.:15.',.cE. L77c:774.4;clic4E4..,a77.77::(2f....c.i.-7.

L..9..014.4..,J,C1HCACIHCTT....4.ACf_PAA [SEQ ID NO: 13] AT5G65510.1 (PLT7 CDS) < " 101 OTTOTACTCC TTA2CTC-ATC GATAACTTCT ATGOTTTCAA 151 GAG.n,rAG.AAG CTGOTGCTCC: TTCAi:IGGOG COTTATOTAC 201 7:7TTTTOG!2 ArfTCCAG.2;-TTCAGhSTC:C AAAnCTG.(31',A CATT7CT:LTG 251 GTGATTTCTT TGTCCSTTPC TTTCTAACC AAACI',CACAC OC.:',1CACTCYT 301 TCTTCTOTaA OTC:C:2J.TCIA CG-3:-11-OnACGT CAI:CO:COG TTGCCGA1C.G 351. AGTT::=AGGGSOCA:GATTTC: 7CTCGC2,:E,CC AGAA4A4J7CTTC1 GAT57-'CTAA Cizs.SOGGTEG7 4S1 ACTCATOTTT CC-1GTT-j"_VCG1 GGTGAC.;TTA_ TOAACCCGG 501 (.2.143TTP,CG45.142 GATTCCP,CCACOLL-4,CGGA.C'_4C 2),.GTTTTGTCT 51 --ACT!',72sCP.C2--sfC 1s(;A4fOLACC2.1: TTGAGCTGL(-', ACAA42GGCGA GAG:ACGTGGA 01:CACAGTAACA. AGAAG-A.AT-.2f72. A7-(90,AAACT-IT 01CATGATTO 651 G ATTGrfCCPA ATTT:TC.GTG 761 (..AGOACOCC Af".:,ATAR42CC ACGAAG(2.CCA ICTAIGG(2,1'A:2 AACI;CTICTI"). CGACCGTA:AGC TLA.ACCOAC3A AAAGS-ACGTC LA.C3TGT.P,LTT' 13r1 GACA-ACC,AA-c; A:AGA-GCARC TARAGOC7AT GACTTGGORG C,51 OTTrAAAATA. CTGGGGI'TC:I' ACTGCT.AL:TA cAAnifTTTcc GGToTcGAGT 901 TA:TrCAF,AG AAC:ITGAR*GA PJGA12.122,AC:1:: 954 TGO,A=TCTT GT.P:GOGGTTT 0C1.RTAGRGETGT C7'CAGGC:-'117 CATCAAC-A7.2 GTCGCTGGC?-ACA-A-GAATO 01 GGOCGTGTCG CAGGAAACAA A1,-;A:rOTTTAC OTOGGAACC7' TTGOAAII:CGA 1 I 1 A.CAGC-TZ-,r-2..-,(-'1. GCACAC GT T T Al ACA T TCC AGO £_. nfl 151 TCAACCCAST AACTAACTIT CACATGAACA CCTkTGACAT 1::-...1".PT....-:.:.,I,;...:7-(7...Elf7777cc77::::...?q*..q....'f:,:::::. .Y.-.j.f.;."-,7qc...i,:77:".......;'iJc.,:,;..4:17.\..7. J::::"::'q'l-.'e:ic7f::,..ciq7E::":c:TT.T.0t*:::;:.W"::'77cT7:cT..q.'qg:. !..T,!..c'T.::H::::...il:;';E:W:cg...'...Ij..Eqc LaLl,, :AACAACAEAH............................. . .... .. ......cc...Tc...q..($m.c..,r.c......Q...T.......,..4w. 1E:2E:44H.... :..1[t.RRT-qcc.,g7LH.T.:G........cl.:,,x77c(:.::"H".......,..7.77,.7:,,.. i.7..(:-.::TEHEcAqTT.....cTTHHEAT....T.,;...:;..cc..;.(7...A.

',1±..4..QT.. 1:::;:.TT..r.',=4.7TTEE.H.. -.c.cTik-ZHEJ.,a77...:7::(5:..cjigE 4,$1.......,,.....:±ET'tt...!..:1J..?.i.:..i..:11--:,.....c....,........E. ..CITAtA.,111.C.....,........,TtA.itIAA [SEQ ID NO: 14] AT3G20840.1(PLT1 PROTEIN) I MNSNNWLCFP ILSPNN=LP HEYNLGI,Y51) IIL)NPFVf,JK aNMINPHCGC 51 GOELTSEVI±Ki ADFIlVSKET ENQSNHLVAY NaS=:FliTh SLMPSVINti VVICP.SNI' PNNSST1177,() 105.A.7NT.L.T ISMC77AGNN VVDAflPSTT '., Tut:NASGGAT, Avvf:ukTPRE '1:j)il 33333155. 1:1.3T1 TCRAHL,Pih, 201 NSCRREGVSP. KGIA)V-).:LGE1,-i: 21<EDKAARSY 13LAA1K2WGP SITTNi:?11IN 351 GEV1T51;NKD1Y LGTI'fliYHbA AhA:LLAAAIK. 5RGLN2-WTNE FINkriThilg'.1 35I Lb5551.P155 SAAKRLEE.[IQ.i-j.j.:.:SS.LK.6SEA EM1A1GSSFE2).:GGGSSTGSG 401 STSSPLO.LCP YETZTOCTi7, P7-5ST,ONNDT SHYNNFNARD SSSITNUHSYT 451 OTQLHLHCS,)T NFY01(:)T)5SC: MSQCLYN:AYL IIS1P:ATJ.7fli, VST?TVMNNN '501 1113005306IN TAAFLGNI-IGi 0-I050/55.5-VGS TT.TERTVKLD iDMPSSDGI.G 'Db.., G'..(3bifffi2SY 00513.1-007 FT MWNE [SEQ ID NO: 15] AT1G51190A (PLT2 PROTEIN) i P:r..j5NNIA0.12,70 11:31-'17H5S1H? :4.1H.S5c)NSHW IMGLVNT1C NPF-c0:HQGW-NM 51 IN-PHGC-ICES GEVTKVADFL GVSK-SG-011lif 2HNLVEINDi nOTNASilinif 101 CaNSLWPIVV 151 SNAL-141-1:i LL3WESAHN12.). SLILSMCSWC Al1721.12,1AnK 151 ASPATCCSADN SSSTTNTSG.C) 7ATVFATPRRT T.F5JAM(DRPST VT.:2:7,77T.5fMqT 201 (.1R-YEAHIJW.HN SCHF.E.0()SRN (21-A521500YD NEENAARAYD LAAIKYWCP.S 205Y TMTH.HTNI FKKYFH-IHKEM IiTc.ii'-7,::1.,, i-(RS,-.3:F3..c:ALTA SN'Y',",:litins5i 301 QH-GRWQ.AR1U-RVAGNisiDL1L CH1L0DX152EAA FA-L0)111/2ILLKY RGLNAVI.HiSE i.'_-)! 11L1P7157K1A1 F.SNTLPTC,Cc A92,1/5CRI,KFAC.:=, IY,SSRF-E1riEM -fkLEZSNFE102Y 41:11 r:57\ A.3 GSSSPAS S SI*" -21-* Q j-j v PD,--: 13301? I° H04 ° H UR ciP IL ILTI i CY \ TN IN 12 L 3 cri H 451 70":".17SYTOTQL HT:HOCKITTINY T.C? ''.-:::.51-PTIS Or * INTAYThOSMPG Tr T J-TC:117.75..TTNN 501 NI,05.; t!'11:..-0NNE.v 15:.11 GSSS'i' VC.'-'. S Alt i.; H. H PAV KVID YIVIPSG 551 GESAQGSNPG CVFTMWNE [SEQ ID NO: 16] AT5G10510.3 (PLT3 PROTEIN) 111412 PITIHNW ji 7 7)16 77:TAT:WIN S 5(5 Q 53755SlIPS 55 P)5ifli \ I 7Y iii;15 K 5 FAQ iAAA SN 110 ST I Li) T v:,POS.HHSQNH I PK15 SPOIL) ±UL 5515101.15 511: I0)Lle.13H.2H5:11 11E)/105FI55111-i INS 5513 V U-DSAS 10111111 LAKI 01.C-M.Y5/ S SF. 1..G 55 SGS 2(1: \in,: NEN H1r5055: NiN (70iiK.1110514111 NN MP:rciiii).S_H KEIXTVJVE 2 511. s DC SNY K AV 15r1112P Tflr7K RJ-Ti0R1-4K Y15,,AH DN S n RRYGuAHKG,R ri 1 QV FY S 5110110 51,155011.1 LIK INSG Y7I' K7: TYIK7AI:07, 77j \ ASKSW TA 3 51 1105191121155 yi-,icrviTP111450) 401 511111111115117 AGNKLILLL..ili itYlliLEI5A,0YA iNAVTNYThi55 451 P51171111 Tl'AKS 111.21552111KB LKLSKI':A c..JCP T 1..CHH QT iN7TOCKM 501 c)XTic;i5c)SH 111-155 114 N FA r:c 5115 Avv30(,:i 1 1. RCN r N Ai 4!0' H '4(,a)(2).

55.! QE(:)Xc,QCMN FF5115P1351112 NV1.2,itiv02,1_11A 601 115.51 [SEQ ID NO: 17] AT5G65510.1 (PLT7 PROTEIN) 1 'M T 75 1_I) P51519K 5111551111555 31)111 SIT PIP Il DNJK1.:VE Tx EU.

5111. 91: TY, 1951 Thk b Lin, 1 K rr):)E kAiR7i bi[M(.2i1ETQl 191 SS= Fa DP HR: G V TG 555D11115255 KT INILLP D.DSTTSNIGG IL 51 TITTVE S 51.TPKII,CFITC DCTTTG0LUT,S M0: YNN T S) e0P fli R i 550510/5K 1YR:GVii'PliRf 251 N 5 RBE COR 505 OJ\..nc.i G. G0fi 1115Lt1*112 1)1 b j:TiE:[1-0v13:3 301 V.,17)F,77:IvflJN NTE:CT0H iWoH ASTKmCWrn5i 3 51. fl97^77ViN5NTY11Tl 1.1197 TAT FT.7,TAYnT2257K PRO 1:1 NAVT1LTF TENP7TiTE AV 401 MSSiHjvC,70A Al2.KR1JKI..KIJ11. SE 325 53 513 TI: HN1.:5554) 1' 5 p 5. 55P 5551922 451 512055512FLici SVIY0(HQNjiii5 c!ii.LE)LV2.3a: Ir")AtiMNO.ALY Example 1: Plant material and growth conditions The lec2-1 (CS3868), lec1-2 (CS3867), fus3-3 (CS8014), ag115-3 (CS16479), fie (SALK_042962), and pk1-1 (CS3840) mutants were obtained from Nottingham Arabidopsis Stock Centre. The vall-2 (hsi2-5), va11-2;va12-1, abi3-8, abi3-9, abi3-10 and abi5-7 mutants have been previously described (Nambara et al., 2002, Genetics 161:1247-1255; Suzuki et al., 2007, Plant Physiology 143:902-911; Sharma et al., 2013, BMC Plant Biology 13:170). The LEC1::LEC1-GFP (Li et al., 2014, The Plant Cell 26:195-209) marker and the 358::BBM and 35S::BBM-GR constructs were described previously (Boutilier et al., 2002; The Plant Cell 14:1737-1749; Passarinho et al., 2008, Plant Mol Biol 68:225-237). The 35S::BBM-GR construct was introduced into the mutant lines by a well-established floral dip transformation procedure (Clough and Bent, 1998, Plant Journal 16:735-743).

Seeds were sterilized with liquid bleach (1 minute in 70% ethanol, followed by 20 minutes in commercial bleach (4%) containing 0.03% Tween-20, and then washed 45 times with sterile MilliQ water) before plating on solid medium (%MS-10: half-strength Murashige and Skoog salts and vitamins, pH 5.8, with 0.8% agar and 1% sucrose). Embryo rescue of the lec1-2 mutant was performed by culturing ovules from sterilized siliques on solid 1/2MS-10 medium. For some experiments, sterilized seeds were dispensed in 190 ml containers (Greiner) with 30 ml liquid %MS-10 medium. DEX and CHX (both Sigma) were added to the medium as described. Solid and liquid (rotary shaker, 60 rpm/min) cultures were kept at 21 °C and 25 °C, respectively (16 hour light/8 hour dark regime). Plants were grown for seed collection at 21 °C (16h light/8h dark regime) on rockwool plugs (Grodan (Rockwool B.V.), Roermond, The Netherlands) supplemented with 1 g/L Hyponex fertilizer.

Example 2: Vector construction and transformation The ANT, PLT3/AIL6, PLT7 and PLT1 protein coding regions were amplified from Arabidopsis Col-0 genomic DNA and the PLT2 protein coding region from cDNA, using the primers listed in Table 1. The DNA fragments were cloned into the Gateway (GW) binary vector pGD625, which contains a double-enhanced cauliflower mosaic virus 35S promoter and an AMV translational enhancer (Im m ink et al., 2002, PNAS, 99, 2416-2421). BBM-GFP was amplified from the BBM::BBM-GFP plasmid as described herein. The GW-compatible destination vector pARC146 (Danisman et al., 2012, Plant Physiology 159, 1511-1523) was used for inducible ectopic activity of PLT2 and BBM-GFP. This vector contains a double-enhanced cauliflower mosaic virus 35S promoter and an AMV translational enhancer, as well as the coding region of the ligand binding domain of the rat glucocorticoid receptor (GR) downstream of the GW cassette.

BBM-YFP and BBM-GFP The pBBM::BBM-YFP construct was generated as described in previous work (Galinha et al., 2007, Nature 449:1053-1057). For ChIP-seq experiments, a pBBM::NLS-GFP construct (negative control) was generated in pGREEN using a 4.2 kb pBBM fragment. The p35S::BBM-GFP construct was using the BBM (At5g17430) Col-0 cDNA in pK7FWG2.0 (Karimi et al., 2002, TIPS 7:193-195).

Table 1. Primers used in this study Cloning

ANT FW GGGGACAAGTTTGTACAAAAAAGCAGGCTCAATGAAGT CTTTTTGTGATAATGATGA

RV GGGGACCACTTTGTACAAGAAAGCTGGGTATCAAGAAT CAGCCCAAGCAG

A/LI FW GGGGACAAGTTTGTACAAAAAAGCAGGCTCAATGAAGA AATGGTTGGGATTTT

RV GGGGACCACTTTGTACAAGAAAGCTGGGTATTAGTGG CCGGCGC

PL T3/A/L6 FW GGGGACAAGTTTGTACAAAAAAGCAGGCTCAATGATGG CTCCGATGACG

RV GGGGACCACTTTGTACAAGAAAGCTGGGTATTAGTAAG ACTGATTAGGCCAGAGG

PL T7 FW GGGGACAAGTTTGTACAAAAAAGCAGGCTCAATGGCTC CTCCAATGACG

RV GGGGACCACTTTGTACAAGAAAGCTGGGTATTAGTAAG ACTGGTTAGGCCACAA

PLTI FW GGGGACAAGTTTGTACAAAAAAGCAGGCTCAATGAATT CTAACAACTGGCTTGG

RV GGGGACCACTTTGTACAAGAAAGCTGGGTATTACTCAT TCCACATAGTGAAAACAC

PLT2 FW GGGGACAAGTTTGTACAAAAAAGCAGGCTCAATGAATT CTAACAACTGGCTCG RV+stop GGGGACCACTTTGTACAAGAAAGCTGGGTATTATTCAT

TCCACATCGTGAAAAC

RV-stop GGGGACCACTTTGTACAAGAAAGCTGGGTATTCATTCC ACATCGTGAAAAC

BBM-GFP FW GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGAACT CGATGAATAACTGGTT

RV-stop GGGGACCACTTTGTACAAGAAAGCTGGGTACTTGTACA GCTCGTCCATGC Gene expression analysis

SAND FW AACTCTATGCAGCATTTGATCCACT

RV TGATTGCATATCTTTATCGCCATC

LECI FW ACAAGAACAATGGTATCGTGGTCC

RV GAGATTTTGGCGTGAGACGGTAA

LEC2 FW ATCGCTCGCACTTCACAACAG

RV AACAAGGATTACCAACCAGAGAACC

FUS3 FW TCTTCTTCCTTTAACCTTCTCTCTTTCC

RV ACCGTCCAAATCTTCCATTCTTATAGG

ABI3 FW GGCAGGGATGGAAACCAGAAAAGA

RV GGCAAAACGATCCTTCCGAGGTTA

AGL 15 FW GAACGATTGCTGACTAACCAACTTG

RV GCAAAGTTGTGTCTGAATCGGTGTT

Example 3: Leaf imaging and quantification of stomata! development The first leaf pairs of nine day-old untreated or 0.1 pM DEX-treated 35S::BBM-GR seedlings were placed overnight in 70% ethanol at 4 °C, then transferred to 85% ethanol for 6 hours, and subsequently to 3% bleach overnight or until imaging.

Leaves were mounted in HCG solution (80 g chloral hydrate, 10 ml glycerol, 30 ml water) prior to imaging with a Nikon Optiphot microscope.

The stomata!, meristemoid and stomatal lineage indices (SI, MI and SLI) were calculated as previously described (Peterson et al., 2013, Development, 140:1924- 1935): SI = (number of stomata/(total number of stomata + non-stomatal epidermal cells)) x 100. For the SI, only mature stomata with a pore were counted. MI = (number of meristemoids/(total number of stomata + non-stomatal epidermal cells)) x 100. SLI = (number of stomata and stomata precursors/(total number of stomata + non-stomatal epidermal cells)) x 100.

Example 4: Tissue sectioning 35S::BBM-GR and 35S::PLT2-GR seedlings were fixed overnight in 3:1 ethanol (100%):acetic acid and dehydrated stepwise from 70 to 100% ethanol. The samples were then infiltrated in Technovit 7100 (including hardener 1) in three steps (Hereaus Kulzer, Germany), followed by Technovit 7100 plus hardeners 1 and 2 (Hereaus Kulzer, Germany). Four micron-thick sections were prepared using a rotary microtome (Zeiss HM340E) and Technovit blades (Adamas, The Netherlands). Sections were stained with 0.05% Toluidine Blue (Merck, Germany) for three minutes, and then rinsed well with water and air-dried. The sections were mounted in Euparal (Roth, Germany) and images were taken using an IX70 microscope (Olympus) with a DP70 camera and CellSens software (Olympus). Seven to ten seedlings per line per treatment were observed.

Example 5: Confocal laser scanning microscopy LECV:LEC1-GFP seedlings were fixed for one week at 4 °C in 1x microtubule stabilizing buffer (MTSB: 50mM PIPES, 5mM MgSO4, 5 mM EGTA, pH7.4) containing 4% paraformaldehyde. Fixed seedlings were washed three times with 0.2x MTSB and mounted in the same buffer containing 1% glycerol prior to imaging. Roots were counterstained with 10 pg/mL propidium iodide (PI). Confocal laser scanning microscopy was performed with a Leica SPE DM5500 upright microscope using the LAS AF 1.8.2 software. GFP was excited with a 488-nm solid-state laser and its emission was detected at a band width of 500-530 nm. PI (roots) and red autofluorescence (cotyledons) were used as a background signals (excited with a 532 nm laser and detected at 600-800 nm).

Example 6: ChIP-seq

ChIP-seq experiments and data analysis were carried out as described in Chapter 3.

Somatic embryo material generated from either 2,4-dichlorophenoxyacetic acid (2,4-D)-induced cultures or from a BBM overexpression line were used for ChIP. Somatic embryos from a BBM::NLS-GFP line, or embryogenic 35S::BBM seedlings served as negative controls for the BBM::BBM-YFP and 35S::BBM-GFP ChIPs, respectively. ChIP-seq results were visualized using Integrated Genome Browser (IGB) 8.1.11 (Nichol et al., 2009, Bioinformatics 25:2730-2731). The ChIP-seq data is available via NCBI (GEO accession: GSE52400).

ChIP-seq experiments were carried out using a GFP antibody on 1) 14-to 17-dayold 2,4-dichlorophenoxyacetic acid (2,4-D)-induced somatic embryo cultures (Mordhorst et al., 1998, Genetics 149:549-563) (4.8 g, ectopic shoots and callus removed) carrying a pBBM::BBM-YFP construct (Galinha et al., 2007, Nature 449:1053-1057) in the bbm-1 (SALK 097021; NASC) mutant background and on 2) embryogenic seedlings (1.75 g) derived from a p35S::BBM-GFP line. The pBBM::BBM-YFP construct complemented the embryo lethal phenotype of the bbm;plt2 double mutant (not shown). 2,4-D somatic embryo cultures from a pBBM::NLS-GFP line and p35S::BBM seedlings served as negative controls for experiment 1) and 2), respectively. ChIP samples were prepared as described previously (Kaufmann et al., 2010, PNAS 109:1560-1565; Smaczniak et al., 2012, PNAS 109:1560-1565).

ChIP-seq libraries were sequenced on the Illumina HiSeq 2000 platform. Sequence reads that failed the CASAVA quality filter were eliminated. Sequence reads were mapped to the unmasked Arabidopsis genome (TAIR10; ftp://ftp.arabidopsis.org) using the SOAPaligner (v2) program (Li et al., 2009, Bioinformatics 25:1966-1967).

A maximum of two mismatches and no gaps were allowed. Reads mapping in multiple genomic locations or to the chloroplast or mitochondrial genomes were discarded. ChIP-seq peaks were detected using CSAR (Muino et al., 2011, Plant Methods 7:11) with default parameter values except for "backg", which was set to 2. Enrichment was calculated as the ratio of normalized extended reads between the pBBM::BBM-YFP or p35S::BBM-GFP samples versus their corresponding controls. False discovery rate (FDR) thresholds were estimated by permutation of reads between IP and control sample using CSAR. ChIP-seq results were visualized using Integrated Genome Browser 8.1.2 (Nicol et al., 2009). The ChIP-seq data is made available via NCBI (GEO accession: GSE52400).

Example 7: Expression analysis of BBM/PLT2 target genes One-and five-day-old Col-0, 35S::BBM-GR and 35S::PLT2-GR seedlings (3 biological replicates of each) were treated for 3 hours with 10 pM DEX plus 10 pM CHX. RNA was extracted using the NucleoSpin RNA kit (Machery-Nagel) kit in combination with Plant RNA Isolation Aid (Ambion), treated with DNA-free (Ambion) and then used for cDNA synthesis with M-MLV Reverse Transcriptase (Life Technologies). Quantitative real-time RT-PCR (qPCR) analysis of BBM/PLT2 target genes was performed using the BioMark HD System (Fluidigm)..

Biomark RNA was extracted using the Invitek RNA isolation kit, treated with TURBO DNase (Ambion) and used to synthesize cDNA using the Taqman cDNA synthesis kit (Applied Biosystems. Expression analysis was performed using a 96.96 dynamic array chip on a BioMark HD System (Fluidigm) after a specific target amplification (STA; 10 min 95°C, 15 sec 95°C, 4 min 60°C, 12 cycles) on individual cDNAs with a pool of all primers at 180 nM each (the used primers are listed in Table 1). The SAND gene was used as the reference gene). The sample plate was prepared with SsoFast EvaGreen Supermix (BIO-RAD) from the diluted STA mix as well as an assay plate (18 pM individual primer combinations) and loaded onto the chip according to the manufacturer's instructions. After each cycle (15 sec 95°C, 60 sec 60°C, 50 cycles) an image was automatically captured and further analysed using the Fluidigm Real-Time PCR Analysis Software package.

The data were normalized against the SAND gene (Czechowski et al., 2005, Plant Phys 139:5-17) and relative gene expression was calculated according to Livak and Schmittigen (Livak and Schmittgen, 2001, Methods 25:402-408) by comparison with DEX + CHX-treated wild-type Col-0. The DNA primers are shown in Table 1.

Example 8: All BBM and PLT proteins induce SE BBM and PLT2 have redundant roles in embryogenesis and root meristem maintenance (Galinha et al., 2007, Nature 449:1053-1057) but show different overexpression phenotypes (Boutilier et al., 2002, The Plant Cell 14:1737-1749; Galinha et al., 2007, Nature 449:1053-1057; Ouakfaoui et al., 2010, Plant Mol Biol 74:313-326). This observation, together with reported differences in the overexpression phenotypes described for the same AIL gene (PLT5/AIL5) (NoleWilson et al., 2005, Plant Mol Biol 57:613-628; Yano et al., 2009, Plant Phys, 151:641-654; Tswamoto et al., 2010, Plant Mol Biol 73:481-492) prompted us to investigate the overexpression phenotypes of the AIL family members using the same overexpression vector and under the same growth conditions. We generated Arabidopsis 35S::AIL overexpression lines for the six AIL genes that have not been reported to induce SE when overexpressed, namely ANT, AlL1, PLTI, PLT2, PLT3/AIL6 and PLT7, and found that overexpression of all these genes except the phylogenetically-distinct ANTI and AIL1 (Kim et al., 2006, Mol Biol Evol 23:107-120) induced somatic embryogenesis in 7-26% of the primary transformants (Figure 11, Table 2). These numbers are in line with the percentage of embryogenic seedlings obtained after transformation with 35S::BBM (Table 2). We observed the large flower phenotype that has been reported previously for 358::ANT (Krizek, 1999, Plant Phys 150:1916-1929; Mizukami and Fischer, 2000, PNAS 97: 942-947) demonstrating that the protein is expressed, but did not observe the previously reported conversion of the shoot apical meristem (SAM) into root identity in PLT1 or PLT2 overexpression lines (Aida et al., 2004, Cell 119:109-120; Galinha et al., 2007, Nature 449:1053-1057) neither in the primary transformants nor in subsequent generations. No mutant phenotypes were observed upon AIL1 overexpression. These results show that all AIL proteins, except for ANT and AIL1, have the capacity to induce SE, and suggest that all BBM-clade proteins are functionally interchangeable with respect to somatic embryo induction.

Table 2. The efficiency of AIL-induced SE Construct No. of primary transformants No. of transformants with SE % SE 35S::ANT 89 0 - 35S;;AIL1 228 0 35S::A1L6 171 45 26% 35S::A1L7 57 10 18% 35S::PLT1 136 9 7% 35S::PL T2 96 10 10% 35S::BBM 81 19 22% Example 9: BBM and PLT2 have dose-dependent overexpression phenotypes PLT2 functions in a dose-dependent manner in the root, with different levels of PLT2 protein instructing different cellular outputs (Galinha et al., 2007, Nature 449:1053- 1057). We employed fusions between two representative AIL proteins, BBM and PLT2, and the glucocorticoid receptor ligand-binding domain (GR, 35S::AIL-GR) to investigate the dose-dependency of AIL overexpression phenotypes. The amount of nuclearly localized BBM-GFP-GR protein could be controlled by manipulating the DEX concentration. In the absence of DEX, GFP was localized to the cytoplasm, but became increasingly nuclear-localized with higher DEX concentrations, such that cytoplasmic GFP could no longer be detected in the presence of 1 pM DEX (Figure 12). These experiments demonstrated that the proportion of a nuclear-localized GR fusion protein, and by extension AIL-GR protein, can be controlled by exposing plant tissue to different amounts of DEX.

35S::BBM-GR and 35S::PLT2-GR seedlings were grown for two weeks on medium containing different DEX concentrations. Representative phenotypes of 35S::BBMGR seedlings grown on the DEX concentration (pM) are indicated in Figure 1, panels B-G.

The same DEX concentration range was used to regulate AIL-GR activity in 35S::A1L-GR seedlings (Figure 1). Control seedlings (wild-type seedlings + DEX) did not show aberrant phenotypes when grown on DEX, whereas 35S::BBM-GR and 35S::PLT2-GR seedlings showed dose-dependent mutant phenotypes. The DEX concentration required to induce a specific phenotype was dependent on the strength of the transgenic line. No additional phenotypes were observed in treatments above 1 pM DEX.

The dose-dependent phenotypes of strong AIL-GR lines (i.e. lines that show highly 30 penetrant SE at a high DEX dose) are shown in Figure 1. At the lowest effective DEX concentrations 35S::BBM-GR seedlings were stunted, with epinastic leaves (Figure 1A). Analysis of the first leaf pair and stomata! development suggested that a low BBM/PLT2 dose inhibits cell differentiation (Figure 13). At intermediate DEX concentrations the seedlings were still small, but now formed leaf-like structures from their cotyledon petioles, which ranged from trichome-bearing protrusions (Figure 1D) to ectopic leaves (Figure 1E, F). At the highest effective DEX concentration, 5 35S::BBM-GR seedlings also developed somatic embryos on their cotyledons (Figure 1A, G)(Passarinho et al., 2008, Plant Mol Biol 68:225-237). 35S::PLT2-GR seedlings also showed stunted growth and somatic embryo formation at the lowest and highest effective DEX concentrations tested, respectively, but ectopic roots were more prevalent than shoots at intermediate DEX concentrations (Figure 1 H, K, L). 10 Representative phenotypes of 35S::PLT2-GR seedlings grown on the DEX concentration (pM) indicated in Figure 1, panels I-N.

Phenotypically weaker 35S::BBM-GR and 35S::PLT2-GR transgenic lines showed a similar dose-dependent response, but the penetrance and severity of the phenotypes was lower. For example, although the number of SE-forming seedlings was high in these weaker lines, they only produced a few somatic embryos at the tip of the cotyledon. Our data suggest that BBM and PLT2 overexpression phenotypes are dose-dependent, with similar phenotypes at relatively low (stunted) and high doses (embryogenesis) and divergent phenotypes at an intermediate dose (shoot or root organogenesis).

Example 10: BBM and PLT2 promote context-specific embryogenesis Previously, we showed that there is an optimal developmental window for BBMmediated SE; a significant drop in the number of seedlings that form somatic embryos is observed when DEX is added four days after seed germination (Passarinho et al., 2008, Plant Mol Biol 68:225-237). We examined this developmental competence in more detail by activating BBM-GR and PLT2-GR at different time points before and after germination. Germination is defined as the emergence of the radicle through the surrounding structures (Bewley, 1997, The Plant Cell 9:1055-1066) and is a two-step process in Arabidopsis, comprising testa rupture (dl) followed by radicle protrusion through the endosperm (endosperm rupture, d2).

The effect of applying of a relatively high BBM (A) or PLT2 dose (B) at different time points after sowing (d0-d5) is shown in Figure 2. The seedling phenotypes were scored two weeks after the DEX application. For each time point, between 31 and 70 seedlings were analysed. The quantification is shown for single 35S::BBM-GR and 35S::PLT2-GR lines, but similar results were obtained with other independent lines.

Additionally, 35S::BBM-GR (A) and 35S::PLT2-GR (B) lines were treated with 10 pM DEX at different time points (dO, d2, and d4), and the development of the seedlings was followed in time (Figure 3) (culture time after DEX application is indicated on the bottom right of each picture).

When 35S::BBM-GR seeds were placed directly in DEX-containing medium prior to or at endosperm rupture (d0-d2), 100% of the seedlings formed somatic embryos directly on their cotyledons after circa one week (Figure 2A; Figure 3A). In contrast, post-germination DEX treatment (d3-d4) induced callus formation on the adaxial side of the cotyledons, from which visible somatic embryos developed approximately 14 days after BBM activation (ca. 40%; Figure 2A; Figure 3A). 35S::PLT2-GR seedlings treated with DEX at the same time points, showed similar phenotypes (Figure 2B; Figure 3B) with two exceptions. Firstly, when 35S::PLT2-GR seedlings were DEXtreated at endosperm rupture (d2), they did not form somatic embryos directly from the cotyledon as for BBM, but rather formed a whitish protrusion at the SAM that contained leaf-like tissue on its distal end (Figure 2B; Figure 3B), which developed somatic embryos 12 days after PLT2 activation (Figure 2B; Figure 3B).

Secondly, post-germination (d3-d4) DEX treatment of 35S::PLT2-GR plants induced callus and somatic embryo formation on both the petioles and the cotyledons (Figure 2B; Figure 3B). These results suggest that the response to BBM and PLT2 ectopic expression depends on the developmental context in which the proteins are expressed.

BBM induced both direct and indirect SE (Figure 4). Sections of 35S::BBM-GR and wild-type Col-0 seedlings that were DEX-induced at dO (A) or d4 (B), and cultured for the additional period indicated at the bottom right of each image (+1 to +14 days) are shown in Figure 4. The schematic illustrations depict the cotyledon regions (blue boxes) that were sectioned in the images below.

BBM-GR activation at both dO and d4 induces anticlinal, periclinal and oblique cell divisions, indicated by the horizontal, vertical and oblique arrows, respectively, on the adaxial side of the cotyledon. BBM-GR activation at dO (A) induced cell divisions (+1, +2), and thickening of the cotyledon tip (+4), followed by the direct development of a somatic embryo from this area (+7). By contrast, BBM-GR activation at d4 (B) induced oblique and less compact cell divisions (+1, +3) and the formation of more compact cell masses (arrowheads) from which globular somatic embryos with a distinct epidermis (asterisks) develop.

After about four days of BBM-GR activation, a bump formed on the tip of the cotyledon that developed into a bipolar somatic embryo a few days later (Figure 4A).

Later, somatic embryos also developed on more proximal parts of the cotyledon and secondary embryos formed on the primary somatic embryo on the cotyledon tip (Figure 3A +10 and +14). PLT2-GR activation at dO induced a similar developmental change (Figure 3B). BBM-GR activation at d4 predominantly induced oblique cell divisions in the subepidermal cell layers on the adaxial side of the cotyledon and did not induce cell division at the cotyledon tips (Figure 4B). Moreover, in contrast to early BBM induction, larger, irregularly-shaped, vacuolate cells were formed proximal to the tip, resulting in a rough cotyledon surface (Figure 4B). Small clusters of small, cytoplasm-rich cells were observed on the cotyledon surface around seven days after BBM activation (Figure 4B). Ten days after BBM-GR activation, we observed larger globular-shaped structures enclosed by a smooth epidermis, which were set off from the underlying tissue by a thicker cell wall. These structures are reminiscent of globular-stage somatic embryos (Figure 4B).

Sections were also made of 35S::PLT2-GR and wild-type Col-0 seedlings grown in medium supplemented with 10 pM DEX at d4 (A, B) or d2 (C), and cultured for the additional period indicated on the bottom right of each image (+2 to +9 days) and are shown in Figure 5. The schematic illustrations depict the cotyledon regions (blue boxes) that were sectioned in the images below. We observed the same phenotype after post-germination PLT2-GR activation, although somatic embryos developed faster (Figure 5A). Notably, BBM-GR and especially PLT2-GR activation induced proliferation of the cotyledon vasculature (Figure 5B). Somatic embryos always formed above this tissue, but we did not observe a direct connection between the proliferating vascular tissue and the somatic embryos.

PLT2-GR activation at d4 induces cell divisions (+2, arrows) in/around the cotyledon vasculature (+4) in both the distal (Figure 5A) and proximal (Figure 5B) parts of the cotyledon. Extensive callus production is observed after 6 days, from which somatic embryos arise later (+9). PLT2-GR activation at d2 induces growth of the region below the SAM and swelling of the cotyledons (Figure 5C).

AIL-mediated SE is therefore induced in two ways depending on the developmental stage of the explant: directly from cotyledons in a narrow window surrounding germination, and indirectly via a callus phase after germination. The data imply that the developmental competence for SE relies on context-specific co-factors.

Example 11: BBM activates embrvogenesis regulators To understand the regulatory networks underlying AIL-mediated SE, genes that were directly bound by BBM during somatic embryo development were identified.

Chromatin immunoprecipitation coupled to next-generation sequencing (ChIP-seq) showed that BBM bound to the promoter regions of transcription factor genes that have roles in promoting zygotic and/or somatic embryo development, including the LAFL seed maturation genes, LEC1, LEC2, ABI3 and FUS3 (but not LEC1-LIKE), and the MADS box transcription factor AGL15 (Figure 6A).

Figure 6 shows BBM binds and activates embryo-specific genes. ChIP-seq BBM binding profiles for embryo-expressed genes in somatic embryo tissue are shown in Figure 6A. The binding profiles from the 35S::BBM-GFP (upper profile) and BBM::BBM-YFP (lower profile) ChIP-seq experiments are shown. The x-axis shows the nucleotide position of DNA binding in the selected genes (TAIR 10 annotation), the y-axis shows the ChIP-seq score, and the brackets indicate the direction of gene transcription. Peaks with scores above 1.76 (for 35S::BBM-GFP) and 3.96 (for pBBM::BBM-YFP) are considered statistically significant (FDR<0.05).

Whether BBM binding regulates the expression of these genes during direct and indirect SE was examined by inducing one day-old (early, direct) and five day-old (late, indirect) 35S::BBM-GR and 35S::PLT2-GR seedlings with DEX in the presence of the translational inhibitor cycloheximide (CHX) (Corte et al., 2011, Methods in Molecular Biology 754:119-141) and examining target gene expression using quantitative RT-PCR (qPCR). The relative expression of embryo-specific genes was determined by quantitative real-time RT-PCR for DEX+CHX treated 35S::BBM-GR and 35S::PLT2-GR seedlings at dl and d5 using DEX+CHX treated Col-0 as the calibrator and the SAND gene (Czechowski et al., 2005, Plant Phys 139:5-17) as the reference (Figure 6B). Error bars in Figure 6B indicate standard errors of the three biological replicates. Statistically significant differences (") between 35S::BBM-GR/35S::PLT2-GR and Col-0 were determined using a Student's t-test (p<0.01).

Early activation of BBM/PLT2-GR was characterized by upregulation of LEC1, LEC2, FUS3 and ABI3 gene expression (Figure 6B). In contrast, expression of LEC1, LEC2, FUS3 and ABI3 was not detected in five day-old induced Col-0 seedlings, nor was it detected in DEX-induced 35S::BBM-GR and 35S::PLT2-GR seedlings (Figure 6B). AGL15 expression was not much affected by BBM/PLT2-GR activation at either of the two time points (Figure 6B). It might be that LEC genes are in an epigenetically silent state in five day-old seedlings and only become accessible after re-differentiation of the cells into callus.

Next, we used the LEC1::LEC1-GFP reporter (Li et al., 2014, The Plant Cell 26:195209) to chart the dynamics of LEC1 expression during BBM-induced SE (Figure 7). Wild-type Col-0 (Figure 7A), LEC1::LEC1-GFP (Figure 7B) and LEC1::LEC1-GFP + 35S::BBM-GR (Figure 7C, D) seedlings were treated with 10 pM DEX at dl or d4 and the GFP signal was observed from 1 to 10 days later (indicated on the bottom right of each picture). The images show the adaxial sides of cotyledons, unless indicated otherwise (ab, abaxial side). The green signal in Col-0 (Figure 7A) and LEC1::LEC1-GFP (Figure 7B) cotyledon tips is autofluorescence. Seedlings that were treated with DEX before germination show the first patches of ectopic LEC1 expression one day after BBM activation (Figure 7C). Seedlings that were treated with DEX after seed germination (Figure 7D) show LEC1 expression around 10 days after BBM-GR activation (d4+10), when embryogenic clusters are visible (arrows). The arrowhead in (d4+7) indicates the callus that is formed on the distal end of the cotyledon blade. The outline of the cotyledon margins in (Figure 7D) is shown with dashed lines. Red autofluorescence was used to delineate the tissue.

Figure 7 shows BBM-GR activates LEC1 expression in a developmentally specific manner. When DEX is added before germination (d1) 35S::BBM-GR seedlings form somatic embryos directly on the cotyledon tip. Under these conditions, LEC1-GFP was observed one day after BBM-GR activation, in small patches of cells on the abaxial side of the cotyledon (Figure 7C, dl +1).

LEC1 expression expanded to the cotyledon tip and in patches of cells on the adaxial cotyledon blade (Figure 7C, d1+2), and then became stronger in the cotyledon and extended to the first leaves at the time when the cotyledon tip began to swell (Figure 7C, di +3). Later, LEC1 expression was observed in the outer layer of the somatic embryos, but not in the underlying seedling cotyledon (Figure 7C, d1+6). When DEX is added after germination (d4), 35S::BBM-GR seedlings form callus on the cotyledon blade from which somatic embryos develop. LEC1-GFP could only be detected 10 days after DEX-induction (Figure 7D, 4+7, 4+10), where it was localized to the large globular-like embryo structures (Figure 5B). These results reinforce our qPCR-based expression analysis in which we observed rapid LEC expression when BBM was activated before germination, but no LEC expression when BBM is activated after germination. The observation that LEC1-GFP is initially absent from the callus that forms after post-germination BBM-GR activation, suggests that somatic embryo identity is established much later in this indirect pathway.

Example 12: LAFL genes and AGL15 are important for BBM-mediated direct SE The genetic relationship between BBM and its direct gene targets was investigated. Both LEC1 and LEC2 overexpression induces spontaneous SE in seedlings, while the LEC2 target AGL15 enhances the embryogenic potential in 2,4-D induced SE tissue culture when overexpressed (Lotan et al., 1998, Cell 93:1195-1205; Stone et al., 2001, PNAS 98:11806-11811; Harding et al., 2003, Plant Phys 133:653-663; Zheng et al., 2009, The Plant cell 21:2563-2577). The other two LAFL proteins FUS3 and ABI3 do not induce SE when overexpressed, but FUS3 overexpression confers cotyledon identity to leaves (Gazzarrini et al., 2004, Dev Cell 7:373-385), and ABI3 overexpression increases the expression of seed storage protein genes in leaves in response to ABA (Parcy et al., 1994, Plant Cell 6:1567-1582; Parcy and Giraudat, 1997, Plant J 11:693-702). Since BBM overexpression lines cannot be outcrossed without loss of the BBM phenotype, we introduced the 35S::BBM-GR construct into the lec1-2+1-, lec2-1, fus3-3.A, ag115-3 and abi3 (three alleles) mutant backgrounds via transformation. These mutants, except ag115-3, display defects during the later stages of embryogenesis with regard to storage protein accumulation, the acquisition of desiccation tolerance and dormancy (Meinke et al., 1994, The Plant Cell 6:1049-1064; Nambara et al., 2002, Genetics 161:1247-1255).

The lec1-2 and fus3-3 seeds are desiccation intolerant (Meinke et al., 1994, The Plant Cell 6:1049-1064) therefore heterozygous mutants were used for transformation.

Figure 8A shows the percentage of primary embryogenic transformants obtained after transformation of the 35S::BBM-GR construct to wt (Ws/Col) or the indicated mutants. Statistically significant differences (*) between the mutant and the corresponding wt line were determined using a Pearson's chi-squared test (p<0.05). In wild-type Arabidopsis, 6-7% of the primary (T1) 35S::BBM-GR transformants was embryogenic when grown on DEX (Figure 8A). Transformation of the lec1-2+1-, lec2-1, fus3-3+I and ag115-3 mutants, resulted in a reduced percentage of 35S::BBM-GR seedlings that formed embryogenic tissue (Figure 8A).

35S::BBM-GR also severely inhibited growth and caused swelling of the cotyledons in the lec1-2, fus3-3 and lec2-1 backgrounds (15-20%; Figure 8B), a phenotype which was not observed in DEX-activated 353::BBM-GR lines. Phenotypes of embryogenesis mutants that contain the 35S::BBM-GR construct are shown in Figure 8B. In the lec1-2 and fus3-3 mutants, BBM-GR activation leads to severe growth inhibition, the lec1-2 mutant was obtained via embryo rescue (Figure 8C).

Severe growth inhibition was also observed in the lec2-1 mutant (left), but also embryogenic seedlings could be obtained (right). In the ag115-3 mutants, BBM-GR activation leads to milder growth inhibition (left) and SE (right), but not cotyledon swelling (Figure 8B), a phenotype that was also observed in the wild-type background and that resembles 35S::BBM-GR seedlings treated with low DEX concentrations (Figure 1C). Figure 8C shows the phenotype and genotype of the (progeny of) the embryogenic transformants obtained in the lec1-2+/-and fus3-3+/-segregating populations. Phosphinothricin-resistance was used to select the 35S::BBM-GR transgene. The numbers of rescued embryos do not reflect the lecl-2 phenotype segregation ratio. Of the few embryogenic seedlings that were found in the lec1-2+/-and fus3-3+/-segregating populations none contained the fus3-3 mutant allele, and only one contained the lec1-2 mutant allele in the heterozygous state (Figure 8C).

Immature embryos from this lec1-2+1/35S::BBM-GR plant were rescued to bypass the lec1-2 desiccation intolerance. The embryos were separated phenotypically into lec1-2 homozygous mutant and lec1-2 heterozygous mutant/wild-type classes and placed on DEX-containing selective medium.

Somatic embryos formed in wild-type/heterozygous lec1-2 seedlings, but not in the homozygous /ecl-2 mutant seedlings (Figure 8B, C). Instead, growth was severely inhibited in the lec1-2/35S::BBM-GR mutants (Figure 8C). We could also obtain a few homozygous fus3-3/358::BBM-GR lines, showing that the fus3-3 seed maturation phenotype is not fully penetrant. However, no SE was observed in these lines (Figure 8B). These results suggest that LEC1, LEC2, FUS3 are positive regulators of BBM-mediated SE, and that LEC1 and FUS3 are absolutely required for this process. Surprisingly, we found that AGL15 also is a positive regulator of BBM-induced SE even though it is not transcriptionally regulated by BBM overexpression at the two time points examined; AGL15 might be regulated by BBM at a later time point or function downstream of the LAFL genes (Braybrook et al., 2006, 103:3468-3473) in BBM-induced SE.

In contrast to the results obtained with the fus3, /ec and ag115 mutants, transformation of the 35S::BBM-GR construct to three different abi3 mutants led to an enhanced SE response (Figure 8A). Notably, abi3 is the only LAFL mutant that is insensitive to ABA and overexpression of A813 does not lead to somatic embryogenesis (Parcy et al., 1994, The Plant Cell 6:1567-1582; Parcy and Giraudat, 1997, Plant J 11:693-702). Of the three examined abi3 alleles, abi3-9 had the mildest effect on BBM-induced SE (Figure 8A). Interestingly, the abi3-9 mutant was also found to be sensitive to ABA in the presence of glucose, in contrast to abi3-8 and abi3-10, which were ABA-insensitive under these conditions (Nambara et al., 2002, Genetics 161:1247-1255). In order to separate the effects of ABA-insensitivity and other embryo defects of abi3 mutants on the BBM phenotype, we tested another ABA-insensitive mutant, abi5-7, which does not have any other reported embryo defects (Nambara et al., 2002, Genetics 161:1247-1255). We also observed an enhanced BBM phenotype in the abi5-7 mutant compared to wild-type (Figure 8A). These data suggest that BBM-mediated SE is suppressed by ABA signalling and that the enhanced BBM response in the abi3 mutants is due to ABA-insensitivity, rather than to other defects in the abi3 mutants.

Finally, whether transcriptional repressors of the LAFL genes, PKL and VAL proteins, have an effect on the BBM phenotype was tested. It was observed that pk11 and van-2 (hsi2-5) mutants enhanced the efficiency of BBM-mediated SE, as measured by a higher percentage of embryogenic primary transformants (Figure 8A). In the vall-2;va12-1 double mutant, no significant change in SE-induction could be observed, which may be due to the lower number of transformants obtained in this mutant.

Together, the data show that members of the LAFL network, as well their upstream and downstream regulators are important components of the BBM signalling pathway during somatic embryo induction (Figure 9). A schematic representation of the genetic interactions between genes involved in SE is shown in Figure 9.

Example 13: Bioinformatic analysis identifies amino acid motifs defining PLT 1 2 3 and 7 To further define the structure of the PLT proteins and in order to identify amino acid motifs which distinguish PLT proteins from one another, the amino acid sequences of PLT genes 1, 2, 3, 4, 5, 7 and BBM were aligned and compared in silico. Several motifs were identified as characteristic of PLT proteins and the relative positions of these are shown on a schematic of the proteins in Figure 15. All PLT proteins included in the analysis contained an AP2 domain. The sequences of which were as follows: AP2 R1 domain (CRRE.GQXRKGROV), where X=S (PLT1, PLT2, AND PLT5/AIL5/CHOVEMK) X= T (BBM) X=A (PLT317) In addition to the sequence differences within the AP2 domains, further motifs were identified which distinguished the PLT proteins from one another: Motif 1-WL(G/A)FSLS Motif 2-PKLE(D/N)FL Motif 3 -Lasm Motif 4 -F(S/T)VWN(D/E [SEQ ID NO: 5] Motif 5 -LSMIKTWLR;SEQ ID NO: 7] Motif 6 --WCK(Q/P)EQD Motif 7 -A(D/E)(FIY)(F/Y)(LN/I)WP(FUN)0(S/T)) [SEC) ID NO: 6] Motif 8 -(F/Y)OTPI(FIY)GME).

Therefore, each PLT protein or pairs of related proteins are defined by a unique combination of motifs in and outside the AP2 domains: PLT1 and PI.32: domains 1. 2. 4, and X=S in AP2 R1 domain PLT3 and PL-17: domains 1, 2, 7, and X=Ain AP2 R1 domain BBM: domains 1, 2, 3, 5, 6, and X= I in AP2 R1 domain PLT51AIL5/CHO1 /EMK domains 1. 2 and 8, and X-S in AP2 R1 domain The AP2/ERF family comprises transcription factors containing at least one highly conserved AP2 DNA binding domain. The AP2 domain extends for about 68 amino acids with an 18 amino acid core region corresponding to an amphipathic a-helix and was originally described in the protein APETALA2 associated with meristem identity and floral organ specification. The AP2/ERF family is divided into subfamilies based on the number of AP2 domains: one (ERF subfamily) or two separated by a linker region (AP2 subfamily -R1 and R2 domains). The AP2 subfamily comprises 3 different lineages: a) AP2 lineage defined by the presence of a miR172 binding motif in the C-terminal region; b) WRI1 lineage with a 10-amino acid insertion in the R1 domain and 1-amino acid insertion in R2 domain; c) PLT lineage, same insertions as WRI1 lineage but longer N-terminal region containing both 2 conserved motifs (motif 1 -WL(G/A)FSLS; motif 2 -PKLE(D/N)FL) (Kim et al., 2006, Mol Bio Evol 23:107-120).

There are six genes in Arabidopsis thaliana encoding PLT-like genes (PLT1, PLT2, PLT3, BBM, PLT5 and PLT7). PLT1-PLT2 and PLT3-PLT7 are pairs of genes coming from a recent whole genome duplication in Brassicales and each pair shares the same common motifs and a high degree of similarity throughout the amino acid sequence (70-80%).

PLT1/PLT2 and BBM share one motif in the N-terminal region (motif 3 -LSLSM) and one in the C-terminal region (motif 4 -F(S/T)VWN(D/E)). Additionally, BBM is characterized for the presence of one additional motif in the N-terminal region (motif -LSMIKTWLR;) and one more in the C-terminal region (motif 6 -WCK(Q/P)EQD;). PLT3/PLT7 is characterized by the presence of a motif in the C-terminal region (motif 7 -A(D/E)(F/Y)(F/Y)(LN/I)WP(H/N)Q(S/T)), while PLT5 is characterized by a motif in the C-terminal region (motif 8 -(FN)QTPI(F/Y)GME).

Moreover, each PLT is characterized by a specific position conserved in the AP2 R1 domain (CRREGQXRKGRQV) -X=S (PLT1/PLT2/PLT5), X= T (BBM) or X=A (PLT3/7). CRREGQSRKGRQV [SEQ ID NO: 8]; CRREGQARKGRQV [SEQ ID NO: 9].

Claims (27)

1. CLAIMS1. A method of inducing somatic embryogenesis (SE) in a plant, comprising transforming a plant, organ, part or cell, so as to increase the level of expression of one of more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7.
2. 2. A method as claimed in claim 1, wherein the nucleotide sequence of PLT1 is SEQ ID NO:1 or a sequence of at least 80% identity therewith.
3. 3. A method as claimed in claim 1 or claim 2, wherein the nucleotide sequence of PLT2 is SEQ ID NO:2, or a sequence of at least 80% identity therewith.
4. 4. A method as claimed in any of claims 1 to 3, wherein the nucleotide sequence of PLT3 is SEQ ID NO:3, or a sequence of at least 80% identity therewith.
5. 5. A method as claimed in any of claims 1 to 3, wherein the nucleotide sequence of PLT7 is SEQ ID NO:4, or a sequence of at least 80% identity therewith.
6. 6. A method as claimed in any preceding claim, wherein one or more of PLT1, PLT2, PLT3 and PLT7 encodes a protein comprising; the amino acid motif FX1VWNX2 [SEQ ID NO: 5]; and/or the amino acid motif AX2X3X3X4WPX5QX1 [SEQ ID NO: 6]; and not comprising the amino acid motif LSMIKTWLR [SEQ ID NO: 7]; wherein X1 is one of Serine or Threonine, X2 is one of Aspartic Acid or Glutamic Acid, X3 is one of Phenylalanine or Tyrosine, X4 is independently selected from Leucine, Valine or Isoleucine and X5 is one of Histidine or Asparagine.
7. 7. A method as claimed in claim 6, wherein the protein further comprises the amino acid motif CRREGQARKGRQV [SEQ ID NO: 8].
8. 8. A method as claimed in claim 2, wherein the protein further comprises the amino acid motif CRREGQARKGRQV [SEQ ID NO: 9].
9. 9. A method as claimed in any preceding claim, wherein the one or more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 is comprised in an expression construct having a suitable promoter.
10. 10.A method as claimed in claim 5, wherein expression of the one or more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 from the expression construct is inducible.
11. 11.A method as claimed in claim 6, wherein the expression construct is a two-component inducible expression construct and the transformed plant, organ, part or cell is exposed to an inducer for a period of time.
12. 12.A method as claimed in any preceding claim, wherein the overexpression is at least 10 times greater than compared to a genotypically identical untransformed plant, organ, part or cell.
13. 13.A method as claimed in claim 8, wherein the overexpression is at least 2 times greater, preferably at least 25 times greater than compared to a genotypically identical untransformed plant, organ, part or cell.
14. 14.A method as claimed in any of claims 7 to 9, wherein the two-part inducible expression system comprises a glucocorticoid receptor (GR) and uses dexamethasone as the inducer.
15. 15.A method as claimed in any preceding claim, wherein the plant, organ, part or cell is stably transformed with an expression construct which provides overexpression of the one of more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7.
16. 16.A method as claimed in any preceding claim comprising culturing the plant, organ, part or cell for a period of time whilst overexpression of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 takes place.
17. 17. A method as claimed in claim 12, wherein the culturing takes place for a period of time in the absence of inducer.
18. 18.A method as claimed in claim 12 or claim 13, wherein transformed plant cells are cultured in liquid medium.
19. 19.A method as claimed in claim 12 or claim 13, wherein callus is generated from the transformed plant cells or tissue and the callus is cultured to provide the somatic embryos.
20. 20.A method as claimed in claim 12 or claim 13, wherein a plant organ or tissue is cultured on solid medium for a period of time to provide somatic embryos.
21. 21.A method as claimed in any of claims 12 to 16, wherein the plant material is cultured in a basal medium in the absence of plant growth regulators.
22. 22.A method as claimed in claim 15 or claim 16, wherein a somatic embryo is removed from the transformed plant, organ, tissue or callus.
23. 23.A plant somatic embryo comprising an additional copy number of one or more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 compared to a genotypically identical untransformed plant cell.
24. 24. A plant somatic embryo as claimed in claim 23, wherein the PLT1, PLT2, PLT3 and PLT7 are as defined in any of claims 2 to 8.
25. 25.A plant somatic embryo which overexpresses one or more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 compared to a genotypically identical untransformed plant cell.
26. 26.A plant somatic embryo as claimed in claim 25, wherein the overexpression of one or more of PLETHORA 1 (PLT1), PLT2, PLT3 and PLT7 is inducible by exposing the somatic embryo to an inducer.
27. 27.A plant somatic embryo as claimed in claim 26 wherein the inducer is dexamethasone.