GB2493662A - Salmonid alphavirus vaccine - Google Patents

Salmonid alphavirus vaccine Download PDF

Info

Publication number
GB2493662A
GB2493662A GB1219654.9A GB201219654A GB2493662A GB 2493662 A GB2493662 A GB 2493662A GB 201219654 A GB201219654 A GB 201219654A GB 2493662 A GB2493662 A GB 2493662A
Authority
GB
United Kingdom
Prior art keywords
virus
inactivated
salmonid alphavirus
salmonid
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
GB1219654.9A
Other versions
GB2493662B (en
GB201219654D0 (en
Inventor
Svein Alexandersen
Trygve Meum Eliassen
Inge Tom Solbakk
Marit Rode
Bernt Martinsen
Anne Aas-Eng
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pharmaq AS
Original Assignee
Pharmaq AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=40469649&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=GB2493662(A) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Pharmaq AS filed Critical Pharmaq AS
Publication of GB201219654D0 publication Critical patent/GB201219654D0/en
Publication of GB2493662A publication Critical patent/GB2493662A/en
Application granted granted Critical
Publication of GB2493662B publication Critical patent/GB2493662B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/0208—Specific bacteria not otherwise provided for
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/0233—Rickettsiales, e.g. Anaplasma
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/107—Vibrio
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/116—Polyvalent bacterial antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/295—Polyvalent viral antigens; Mixtures of viral and bacterial antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/08—RNA viruses
    • C07K14/18—Togaviridae; Flaviviridae
    • C07K14/1808—Alphaviruses or Group A arboviruses, e.g. sindbis, VEE, EEE, WEE, semliki forest virus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C12N7/02—Recovery or purification
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/521—Bacterial cells; Fungal cells; Protozoal cells inactivated (killed)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5252—Virus inactivated (killed)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55566—Emulsions, e.g. Freund's adjuvant, MF59
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/70—Multivalent vaccine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
    • C12N2720/00011—Details
    • C12N2720/10011—Birnaviridae
    • C12N2720/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
    • C12N2720/00011—Details
    • C12N2720/10011—Birnaviridae
    • C12N2720/10051—Methods of production or purification of viral material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/36011—Togaviridae
    • C12N2770/36111—Alphavirus, e.g. Sindbis virus, VEE, EEE, WEE, Semliki
    • C12N2770/36134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/36011—Togaviridae
    • C12N2770/36111—Alphavirus, e.g. Sindbis virus, VEE, EEE, WEE, Semliki
    • C12N2770/36151—Methods of production or purification of viral material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/36011—Togaviridae
    • C12N2770/36111—Alphavirus, e.g. Sindbis virus, VEE, EEE, WEE, Semliki
    • C12N2770/36161—Methods of inactivation or attenuation

Abstract

An inactivated salmonid alphavirus, for use as a vaccine for preventing or reducing the incidence of fish pancreatic disease, comprises at least 3.75x108 TCID50/dose inactivated salmonid alphavirus (as determined by titration on CHH cells) and is compatible with other vaccine components from other viral, bacterial or fungal fish pathogens. The inactivated salmonid alphavirus is preferably derived from the SAV3 subtype. The invention further provides isolated salmonid alphavirus strains, and viruses with related nucleic acid sequence or phenotypic characteristics.

Description

Polyvalent vaccine against salmonid aiphavirus infections
Technical field of the invention
The present invention relates to veterinary immunology and in particular to means for preventing or controlling infections with salmonid alphaviruses and outbreaks of fish pancreatic disease or sleeping disease using a polyvalent vaccine, such as a polyvalent vaccine including both viral and bacterial antigens.
Background of the invention
Pancreas disease has become a serious disease in farmed salmonids in several geographical areas. The disease was first reported from Scotland, and has later been reported from Ireland, Norway and North America. As of 2007 pancreatic disease had become endemic in most salmon rearing sites in Ireland and there have been reports of isolated outbreaks of pancreatic disease in North America. A differential diagnosis, sleeping diseaser is endemic in parts of France and has also been reported in Italy and Spain (McLoughlin & Graham, 2007). Recently, there have been informal reports that pancreas disease has also been observed in Chile.
In Norway the disease has spread over the last 10 years with 58 confirmed infected sites in 2006 and 98 confirmed infected sites in 2007. In 2006, the disease also spread to the county Møre og Romsdal, situated north of the earlier defined geographical area affected by salmonid pancreas disease. Pancreas disease is now the major health problem for the aquaculture industry in the western part of Norway. Pancreas disease (PD) and the related sleeping disease are both caused by alphaviruses, and can not be treated by any therapeutics.
The first alphavirus was isolated from fish in 1995 (Nelson et al 1995). Today, alphaviruses have been isolated from both Atlantic salmon suffering from pancreas disease, and rainbow trout suffering from sleeping disease (McLoughlin and Graham 2007).
The salmonid alphaviruses (SAV) are spherical (approximately 65 nm in diameter) enveloped RNA viruses. They contain a single stranded positive-sense RNA genome of 11-12 kB (McLoughlin and Graham 2007). In EP patent 712,926 it is described as being sensitive to chloroform, rapidly inactivated at pH=3 and at 50°C and with a buoyant density of 1.20 g/ml. Nucleotide sequencing studies assigns the salmonid aiphaviruses to three genetically different subtypes (Powers et al 2001, Hodneland et al 2005, Weston et al 2005). Salmonid alphavirus 2 (SAV2) is the causative agent of sleeping disease in rainbow trout, salmonid alphavirus 1 (SAV1) cause pancreas disease in Atlantic salmon in Ireland and Scotland, while salmonid alphavirus 3 (SAV3) cause pancreas disease in Atlantic salmon and sea reared rainbow trout in Norway. Recently, SAV4, SAV5 and SAV6 have been identified as subtypes related to SAV1.
In Norway, all farmed Atlantic salmon are vaccinated against the most common bacterial diseases and very often against infectious pancreatic necrosis virus (IPNV) before transfer to sea. While comprehensive vaccination programs are certainly desirable in order to avoid economic losses and further dissipation of infectious diseases, such programs are also associated with technical challenges.
Administration of vaccines requires extensive handling of the fish, causing stress and mortality since the fish must be pumped into holding tanks, transferred to a tank with anesthesia, injected with vaccine and pumped back to holding tanks.
Due to the large scale of modern aquaculture such vaccination programs are costly and labor-intensive and cause stress to the fish. For these reasons, vaccines against the various infectious diseases are preferentially administered in combined, polyvalent vaccines containing several antigens.
In theory, combination of vaccines should be straightforward. In practice, however, combining multiple vaccine antigens often leads to reduced efficacy of each individual antigen. Such problems associated with polyvalent vaccines are discussed for instance in André, E.F. (1999), which provides a review on strategies for human pediatric vaccination programs. Similar problems are of concern in animal vaccination programs, e.g. with respect to vaccines against ovine footrot as reviewed by O'Meara et al. (1993).
Despite the fact that the salmonid alphavirusses were isolated and characterized more than a decade ago, vaccination against pancreatic disease remains a challenge. In EP patent 712,926, example 11 presents data showing that a composition intended for vaccination purposes based on pancreatic disease virus SAV1, inactivated by addition of beta-propiolactone and NaOH is ineffective in protecting against subsequent infection. In the same experiment, a composition based on PDV treated with 0.1% formalin (35-38%) appears to elicit a protective immune response in experimental settings. However, since treatment with O.l% formalin is inadequate to inactivate PDV, one must conclude that the latter composition is one of live virus. Both compositions contained PD virus of the SAV1 subtype at a titre of 1075TCID50mP1.
As of February 2008 only one PD-vaccine, sold under the name Norvac compact PD, was commercially available. The vaccine is based on inactivated PD virus of the SAV1 subtype: A first generation product contained antigen in amounts of 10'2TC1D50/dose at a dosage volume of 100 jil. A second generation product has been developed containing 1075TC1D50/dose. Rodger & Mitchell (2005) investigated the effect of this vaccine: For 2003 they found that vaccination did not reduce the risk of outbreaks of pancreatic disease; for 2004 it appeared that vaccinated fish had a somewhat lower risk of infection, however, the result was not statistically significant. Further, in mixed populations of vaccinated and non-vaccinated fish there was a tendency of lower mortality in the vaccinated fish.
In the Summary of Product Characteristics, Norvac compact PD is described as being incompatible with other vaccines and immunological products. Accordingly, this monovalent PD-vaccine is recommended only for injection at least 210 degree days before injection of other multivalent vaccines protecting against common bacterial diseases and IPNV in farmed fish (Degree days are calculated as the product of days and temperature: 10 days with a temperature of 10°C equals 100 degree days). Under normal conditions Norvac compact PD must be administered 2 -3 weeks prior to administration of a polyvalent vaccine.
According to the Summary of Product Characteristics, no information is available on the safety and efficacy from the concurrent use of this vaccine with any other immunological product. However, the stated lack of compatibility with other vaccines is consistent with previous reports of multivalent PD-vaccines failing to elicit good protection against pancreas disease (Christie et al 1999 A, Intervet newsletter 2002, Christie et al 1999 B). Christie reported induction of neutralizing antibodies in 6O% of individuals vaccinated with a monovalent PD-vaccine. The modest efficacy was severely compromised when the vaccine was combined with other immunological products since the resulting polyvalent vaccine induced neutralizing antibodies in only 20Wo of vaccinated individuals.
In EP 1 075 523, the inventors are also concerned with the problem of PD-vaccines being incompatible with other vaccines. Paragraph [0004] states: "A drawback in the production of inactivated vaccines from the PD virus described in EP-A-712926 is the slow growth of the virus, in particular on cell cultures, which makes the manufacturing of said vaccines a relatively inefficient process. A further drawback with the inactivated vaccines is the instability of the inactivated virus in the presence of other inactivated pathogens resulting in potency loss. Fish vaccines are generally produced as multivalent vaccines, and significantly higher amounts of inactivated virus are required in the multivalent vaccines than would be necessary in a monovalent vaccine to compensate for the loss of potency." The inventors point to recombinant protein vaccines as a solution, but such recombinant vaccines have never been implemented in the management of pancreatic disease.
In conclusion, existing vaccination programs against fish pancreatic disease remain inefficient and have not been able to stop dissipation of the disease. Also, according to the general notion in the field, PD vaccines based on inactivated virus are only available at high production costs and they are incompatible with vaccines against other infectious diseases prevailing in farmed fish.
Therefore, there is still an urgent need for effective means for controlling fish pancreatic disease, both for ethical and economical reasons.
Summary of the invention
An object of the present invention relates to compositions and vaccines allowing combined and simultaneous vaccination against pancreatic disease and one or more other infectious diseases.
In particular, one aspect of the invention relates to a composition comprising salmonid alphavirus or an antigenic and/or immunogenic material derived thereof, combined with one or more components selected from the group consisting of: a. a live, attenuated, killed or inactiated bacterium, b. a virus other than salmonid aiphavirus, said virus preferably being attenuated or inactivated, c. a fungus, d. a parasite; and e. an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d).
Another aspect of the invention provides a dosage form of a composition according to the invention.
Yet another aspect of the present invention relates to a vaccine comprising a composition as defined above.
Further aspects of the present invention provide: A composition as described above for use in medicine; A composition as described above for use in preventing, or reducing the incidence of fish pancreatic disease; A composition as described above for use in preventing or reducing the incidence of infection by salmonid alphavirus; Use of an inactivated salmonid alphavirus (SAV) in the manufacture of a vaccine or an immunological composition which is compatible with other immunological products; Use of a composition acording to the invention for the manufacture of a medicament/vaccine for preventing or reducing the incidence of infection by salmonid alphavirus; Use of a composition as described above for the manufacture of a medicament/vaccine for preventing or reducing the incidence of fish pancreatic disease.
Another aspect of the invention pertains to the use of an inactivated salmonid alphavirus (SAV) in the manufacture of a vaccine or an immunological composition for administration simultaneously or in combination with one or more antigenic components selected from the group consisting of: a) a killed bacterium, b) an inactivated virus other than a salmonid aiphavirus, c) a fungus, d) a parasite; and e) an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d).
In a related aspect the invention provides the use of an inactivated salmonid alphavirus (SAV) in the manufacture of a dosage form for administration simultaneously or in combination with one or more antigenic components selected from the group consisting of: a) a killed bacterium, b) a inactivated virus other than a salmonid alphavirus, c) a fungus, d) a parasite; and e) an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d).
Still another aspect of the present invention is to provide a method of manufacturing a composition or a vaccine as described above, said method comprising combining a preferably inactivated salmonid alphavirus or an antigenic and/or immunogenic material derived thereof with one or more components selected from the group consisting of: i) a live, attenuated or killed bacterium, ii) a virus other than salmonid alphavirus, said virus preferably being attenuated or inactivated, iii) a fungus, iv) a parasite; and v) an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d).
Still further aspects of the invention provide a method of reducing the incidence of and/or treating or preventing infection by Salmonid Alphavirus in a fish population, said method comprising administering to the fish a composition or a dosage form as provided according to the invention.
In a final aspect the invention provides a method of improving a polyvalent vaccine, said method comprising including in the polyvalent vaccine an attenuated or inactivated salmonid alphavirus.
Brief description of the figures
Figure 1 shows SAV3 titres in crude supernatants from CHH-1 cell cultures inoculated with different SAV3 isolates or passages of isolates.
Figure 2 is a representation of SAV3 titres in crude supernatants from SAV3-infected CHSE-214 cell cultures.
Figure 3 A and B shows the % accumulated mortality after challenge of Atlantic salmon smolts with salmonid alphavirus type 3 (SAVB). The figure further shows the effect of vaccinating the fish in the parr stage against salmonid pancreas disease using a polyvalent vaccine according to the invention. Two parallel experiments were conducted in separate challenge tanks (A and B).
The present invention will now be described in more detail in the following.
Detailed description of the invention
The present invention is based on the observation that despite prior reports to the contrary, development of polyvalent vaccines combining inactivated salmonid alphavirus with vaccines against other fish pathogens is in fact the most effective way of protecting reared salmon against pancreatic disease. In particular, the present inventors made the following observations: i) Despite testing various different vaccine formulations it was not possible to establish any adverse effect other vaccine components on the stability of the pancreatic disease antigen. In other words: PD-vaccines based on inactivated virus are highly compatible with vaccines against currently prevailing fish pathogens; ii) in vaccines based on inactivated virus, a minimum antigen titre in the range of 3,75x10' TCID50/dose appears to be desirable in order to effectively induce protective immunity, indicating that previous vaccination programs have been based on vaccines containing insufficient amounts of antigen; iii) titres of salmonid alphavirus sufficient for large scale manufacture of vaccines with high efficacy can indeed be obtained using conventional technology for virus propagation and at a reasonable cost; Microbiological material In connection with the present invention, isolates of salmonid alphaviruses have been deposited under the Budapest Treaty with the European Collection of Cell Culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), SP4 OJG UK on the 12 December 2007 under the following accession numbers: 07121201, corresponding to isolate ALV4OS in the examples; 07121202, corresponding to isolate ALV 407 in the examples; and 07121203 corresponding to isolate ALV 409 in the examples.
The present invention pertains to compositions which, in addition to salmonid alphaviruses or parts thereof, comprise other antigenic components. Polyvalent vaccines containing antigens from typical fish pathogens other than salmonid alphaviruses are well known in the art and are already commercially available.
The identification and isolation of suitable antigens to be used in such vaccines are described in the literature, thus providing the skilled person with the capacity to generate and manufacture such polyvalent vaccines. In addition, representative isolates of relevant fish pathogens are available with no restrictions from various sources. For instance, the following bacterial species are available from LGCPromochem/American Type Culture Collection ATCC repository and distribution center (ATCC): A. sa/morücida (ATCC 33658TM, country of origin: not provided), Aeromonas hydrophila, V. salmonicida (ATCC 43839TM, country of origin: Norway), V. anguillarum serotype O1(ATCC 433Q5TM, country of origin: Denmark) and 02(ATCC 19264TM, country of origin: not provided), and Monte/la viscosa (ATCC BAA-lOSTM, country of origin: Norway), Flavobacterium columnaris (deposited as Cytophaga columnaris) is available under ATCC number 234631M (Country of origin: USA).
As for Piscirickettsia salmon/s, the present Applicant has deposited several useful isolates under the Budapest Treaty with the European Collection of Cell Culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), 5P4 OJO UK: three isolates are deposited on 9 June 2006 under accession numbers 06050901, 06050902, and 06050903 (isolate AL10005, AL10007 and AL10008).
A single isolate was deposited on 21 March 2007 under accession number 07032110 (country of origin: Chile). In a similar manner representative isolates of relevant viral species are available, including infectious pancreatic necrosis virus (IPNV, ATCC VR-1318, country of origin: not provided), Viral Hemorrhagic Septicemia Virus (VHSV, ATCC VR_1389, country of origin: Denmark); Infectious Hematopoietic Necrosis virus (IHNV, ATCC VR-1392, country of origin: USA)); Pancreatic Necrosis Virus; Spring Viremia of Carp (SVC, ATCC VR-1390, country of origin: Denmark); Channel Catfish Virus (CCV) (ATCC VR-665, country of origin: USA); Infectious Salmon Anaemia (ISA) virus (ATCC VR-1554, country of origin: Canada).
Patent deposits have previously been made by the present applicant of the following viral species: Heart and Skeletal Muscle Infection Virus (HSMIV, patent deposit nr ECACC 04050401, country of origin: Norway); Cardiomyopathic syndrome virus (CMSV, patent deposit nr ECACC 07032902, country of origin: Norway).
Definitions Prior to discussing the present invention in further details, the following terms and conventions will be defined: "An antigenic and/or immunogenic material" in the present context refers to a material which contains one or more protective epitopes. An epitope is protective if it can induce an immune response which is capable of effectively interfering with the extent or progression of infection with salmonid alphavirus, including SAV1, SAV2 and, in particular, SAV3. The term comprises polypeptides, including polypeptides which are prepared using recombinant techniques, and parts of such polypeptides.
The term "genotypic characteristics" refers broadly to the composition of one or more parts of an individual's genome which contributes to determining a specific trait.
In relation to the virus according to the invention, the term "related genotypic characteristics" is used in relation to viruses which possess nucleic acid sequences with a high degree of sequence identity when compared with known nucleic acid sequences of previously isolated salmonid alphaviruses. Comparison may be made with the nucleic acid sequences which encode any one of the nsPl, nsP2, nsP3 and nsP4 non-structural proteins. Further, comparison may be made with the nucleic acid sequences which encode the capsid, glycoprotein E2, glycoprotein E3 or 6K and gpEl proteins. In particular, the term is used to define viruses which have nucleic acid sequences with a high degree of sequence identity when compared with any such known amino acid sequences of deposited isolates ALV4OS, ALV 407 and/or ALV 409. For the purpose of defining the viral isolates used in relation to the present invention, reference is made in particular to nucleic acid sequences of the glycoprotein E2 and the nsP3 non-structural protein as provided herein and identified by SEQ ID NOs: 1-6. It will therefore be understood that the virus according to the invention possess nucleic acid sequences which are at least SO% identical, such as at least SS%, 9O%, 95%, 96%, 97%, 98%, OO%, 99.5%, 99.8% or 99.9% identical to the nucleic acid sequences of glycoprotein E2 and nsP3 non-structural protein as provided herein and identified by SEQ ID NOs: 1-6. The term "sequence identity" indicates a quantitative measure of the degree of homology between two amino acid sequences or between two nucleic acid sequences of equal length. If the two sequences to be compared are not of equal length, they must be aligned to give the best possible fit, allowing the insertion of gaps or, alternatively, truncation at the ends of the polypeptide sequences or nucleotide sequences. The sequence identity can be calculated as -, wherein Ndif is the total number of non-identical residues in the two sequences when aligned and wherein Nref is the number of residues in one of the sequences. Hence, the DNA sequence AGTCAGTC will have a sequence identity of 75% with the sequence AATCAATC (Ndif=2 and Nref=8). A gap is counted as non-identity of the specific residue(s), i.e. the DNA sequence AGTGTC will have a sequence identity of 75% with the DNA sequence AGTCAGTC (Ndif=2 and Nref=8).
With respect all embodiments of the invention relating to nucleotide sequences, the percentage of sequence identity between one or more sequences may also be based on alignments using the clustalW software (http:/www.ebi.ac. uk/clustalW/index.html) with default settings. For nucleotide sequence alignments these settings are: Alignment=3Dfull, Gap Open 10.00, Gap Ext. 0.20, Gap separation Dist. 4, DNA weight matrix: identity (TUB).
Alternatively, nucleotide sequences may be analysed using programme DNASTS Max and the comparison of the sequences may be done at http://www.paralian.org/. This service is based on the two comparison algorithms called Smith-Waterman (SW) and ParAlign. The first algorithm was published by Smith and Waterman (1981) and is a well established method that finds the optimal local alignment of two sequences. The other algorithm, ParAlign, is a heuristic method for sequence alignment; details on the method are published in Rognes (2001). Default settings for score matrix and Gap penalties as well as F-values were used.
The term "phenotypic characteristics" refers equally broadly to one or more observable properties of an organism that are produced by interaction of the inherited genotype of the individual with transmitted epigenetic factors, and/or non-hereditary environmental variation. In the context of the present invention, the term "related phenotypic characteristics" include any of the following characteristics: size, shape, pH stability, temperature stability, chloroform sensitivity and haemaglutination.
"Phenotypic characteristics further include the ability to induce any of the clinical signs of pancreatic disease and sleeping disease, including gross pathological signs and histopathological signs as described in the present application.
"Phenotypic characteristics" also include the ability of the virus to introduce such clinical signs in a laboratory challenge experiment as described herein. Still further, the term refers to the performance of the virus when grown on cell cultures, including growth kinetics and the ability to induce a cytopathogenic effect.
The expressions SAV1, SAV2 and SAV3 defines subtypes of salmonid alphaviruses: the SAV1 subtype is defined and characterised in Nelson et al. Diseases of Aquatic Organisms, 22, 25-32, 1995 and a representative isolate has been deposited at ECACC under deposit number V94090731. The SAV2 subtype, on the other hand, is the causative agent of "sleeping disease" and was first isolated and characterised by Castric et al. Bulletin of the European Association of Fish Pathologists 17, 27-30, 1997. The SAV3 subtype was first isolated and characterized by Hodneland et al. as described in Dis Aquat Organ. 2005 Sep 5;66(2):113-20 (Erratum in: Dis Aquat Organ. 2005 Nov 9;67(1-2):181). The terms SAV4, SAV5 and SAV6 define novel subtypes of the salmonid aiphaviruses found near Scotland and Ireland.
As the skilled person will understand, "cytopathogenic effect" refers to visible morphologic changes in cells infected with viruses. It may in particular include shutdown of cellular RNA and protein synthesis, cell fusion, release of lysosomal enzymes, changes in cell membrane permeability, diffuse changes in intracellular structures, presence of viral inclusion bodies, and chromosomal aberrations.
The term "component or part of said virus" refers to a component or part of the nucleic acid core of the virus or of the surrounding protein coat.
"Cell culture" refers to cultures of cells, such as transformed cells, established in vitro. Specifically, as used herein, cell line refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes can occur in karyotype during storage or transfer of such clonal populations. Therefore, cells derived from the cell line referred to may not be precisely identical to the ancestral cells or cultures, and the cell line referred to includes such variants. The term "cell lines" also includes immortalized cells.
The term "adjuvant" is used within its normal meaning, defining an agent that may stimulate the immune system and increase the response to a vaccine without having any specific antigenic effect in itself.
Similarly the term "emulsifier" is conventionally used to define a substance which stabilizes an emulsion, frequently a surfactant.
The term "detergent" defines another class of surfactant, which chemically will interact with both oil and water, thus stabilizing the interface between oil or water droplets in suspension.
Emulsions comprising water and oil are generally referred to as either water-rn-oil emulsions, oil-in-water or water-in-oil-in-water emulsions. Whether an emulsion turns into a water-in-oil emulsion or an oil-in-water emulsion depends on the volume fraction of both phases and on the type of emulsifier. Generally, emulsifiers and emulsifying particles tend to promote dispersion of the phase in which they do not dissolve very well. Proteins, for instance dissolve better in water than in oil and so tend to form oil-in-water emulsions (i.e., they promote the dispersion of oil droplets throughout a continuous phase of water).
In the present context, a "surfactant", also known as "a tenside", is a wetting agents that lowers the surface tension of a liquid, allowing easier spreading, and lower the interfacial tension between two liquids.
Finally, in the context of the present invention, a "polyvalent vaccine" (also known as multivalent vaccine) is used to define a combination of several antigens in one vaccine. Thus, a polyvalent vaccine may protect against more than one disease.
As opposed to a polyvalent vaccine, a "monovalent vaccine" is a vaccine containing vaccine components directed at only one pathogen. In particular, a monovalent vaccine may contain only one antigen, protecting against one particular disease.
Composition According to a first aspect the present invention provides a composition comprising a Salmonid Alphavirus or an antigenic and/or immunogenic material derived thereof, combined with one or more components selected from the group consisting of: a. a live, attenuated, killed or inactivated bacterium, b. a virus other than Salmonid Alphavirus, said virus preferably being attenuated or inactivated, c. a fungus, d. a parasite; and e. an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d).
Although compositions based on subunits of the virus, e.g. compositions comprising recombinant antigens may be contemplated, it is preferred that the compositions according to the invention are prepared on the basis of cultures of the virus. For the purpose of the present invention it is desirable that the composition contains salmonid alphavirus at a titre of at least 7.5x108 TCID50/ml.
While naturally occurring non-virulent strains of the salmonid alphaviruses virus and strains of the virus that have been attenuated in the laboratory may be contemplated, the composition according to the invention preferably contains a salmonid alphavirus which is killed or inactivated.
Similarly, the bacterial, fungal and parasitic components of the vaccine are preferably killed or by other means made incapable of infecting/infesting the fish.
Inactivation of the virus may be obtained by chemical or physical means.
Chemical inactivation can be carried out by treatment of the viruses by for example, but not limited to, treatment with enzymes, with formaldehyde, I-propiolactone or ethyleneimine or a derivative thereof, with organic solvent (e.g. halogenated hydrocarbon) and/or detergent, e.g. Triton® or Tween®.
Physiological inactivation can advantageously be carried out by subjecting the viruses to energy-rich radiation, such as UV light, gamma irradiation or X-rays. If necessary, the inactivating agent can be neutralized with thiosulphate. If required, the pH is subsequently returned to about pH 7.
While inactivation with formaldehyde has previously been considered sub-optimal as a means for inactivating salmonid alphavirus, the present inventors have experienced that formaldehyde inactivation is indeed a useful approach. In a preferred embodiment the virus is inactivated by addition of 1.5-2.5 g/kg of formaldehyde and subsequent incubation for 12-96 hours, such as for 48-84 hours at a temperature from 13-17 °C, such as from 14160C.
The virus is incubated with formaldehyde for a period of 12-96 hours, such as from 24-96 hours, from 36-96 hours, from 36-72 hours, from 36-60 hours, or such as from 48-96 hours, from 48-72 hours or such as from 48-60 hours. The inventors have found that when using 2,0 g/kg formaldehyde, a 48 hour-incubation is generally sufficient in order to ensure adequate inactivation of the virus. However, in order to meet specific regulatory requirements longer incubation periods may be preferred, such as an incubation period of at least 72 hours. The virus is preferably incubated with formaldehyde at a temperature of 13-17 ocr such as at a temperature of 14-17°c, 15-17°c, 16-17°c, 13-16°c, 13- 15°C, 14-16°C or such as a temperature of 14-15°C.
As for the bacterial components of the composition it is likewise to be understood that several applicable methods for inactivation are available to the skilled person.
In presently preferred embodiments, the bacteria have been inactivated using a procedure comprising addition of 3.5-4.5 g/kg formaldehyde and subsequent incubation for 1-2 hours at a temperature of 20°C While each of the viral, bacterial, fungal and parasitic, components of the vaccine may be killed or inactivated prior to being combined with the other components, they may also me inactivated or killed subsequent to being added to the vaccine.
In further embodiments the said live attenuated, killed or inactivated bacterium is of a species which is a recognised fish pathogen. Accordingly, bacterium is preferably selected from the group consisting of bacteria of the species Piscirickettsias spp., Aeromonas spp., Vibrio spp., Listone/Ja spp., Nor/tel/a viscosa, Photobacterium damsela, Flavobacterium spp., Yersinia spp., Renibacterium spp., Streptococcus 5PP, Lactococcus spp., Leuconostoc spp., Bifidobacterium spp., Pediococcus spp., Brevibacterium spp., Edwarsiella spp., Francisella spp., Pseudomonas spp., Cytophaga spp., Nocardia spp., /-iaphnia spp.
and Mycobacerium spp.
According to more specific embodiments the bacterium is selected from the group consisting of Aeromonas spp., Vibrio spp., F/a vobacterium spp., /-laphnia spp., Piscirickettsia spp. and Monte/la viscosa. Even more specifically, the bacterium is selected from the group consisting of Aeromonas hydrophila, Aeromonas salmonic/da, V/hi-Jo salmon/cf da, Vibrio anguillarum, Vibrio ordali, F/a voba cterium co/umnaris, Haphnia sp., Piscirickettsia salmon/s and Monte/la viscosa.
In certain preferred embodiments the composition according to the invention comprises killed or inactivated bact:eria of one or more species selected from the group consisting of A. salmon/cida, V. salmonicida, V. anguil/arum and N. viscosa.
According to equally preferred embodiments the composition comprises, said bacteria are of the species V/hi-Jo ordali and/or P/scinfcketts/a salmon/s.
According to other embodiments the composition comprises bacteria of one or more species selected from the group consisting of Aeromonas hydroph/la, F/a vobactenfum columnaris and Haphnfa sp.
In certain embodiments, the composition according to the invention is contemplated primarily for use in relation to farming of Atlantic salmon, in particular in the northern Atlantic. Bacteria of the species Aeromonas sp. in particular A. salmonic/da; Vibrio sp., in particular V. salmonicida and V. anguillarum serotype 01 and 02; and Mon/tel/a viscosa, provide a challenge to fish farming in Norwegian waters and therefore it may be preferred that the live attenuated killed or inactivated bacterium in the composition according to the invention is selected from this particular group of bacterial species.
In alternative embodiments, the composition is intended for use in South America, including Chile, and in these embodiments the bacterium is selected from the group of bacterial species consisting of V/hi-jo sp, in particular Vibr/o orda//, and Piscirickettsia sp., in particular Pisc/rickettsia salmons.
In other alternative embodiments, primarily intended for use in South East Asia, the bacterium is selected from ths group consisting of:Aeromonas sp., in particular Aeromonas hydnophila, F/a vobacter/um sp., in particular Flavobacterium columnar/s1 and Haphnia sp.
In a similar manner, the said virus other than Salmonid Alphavirus is a recognised fish pathogen. Accordingly, it is preferably selected from the group consisting of: infectious pancreatic necrosis virus (IPNV), Viral Hemorrhagic Septicemia Virus (VHSV); Viral Hemorrhagic Septicemia Virus (VHSV); Infectious Hematopoietic Necrosis virus (IHNV); Pancreatc Necrosis Virus; Spring Viremia of Carp (SVC); Channel Catfish Virus (CCV); Infectious Salmon Anaemia (ISA) virus; nodavirus; iridovirus, koi herpes virus; Heart and Skeletal Muscle Inflammation Virus (HSMV) and Card iomyopathy Syndrome Virus.
Of these viruses, infectious pancreatic necrosis virus (IPNV) is particularly relevant in relation to Norwegian farming of salmon. Therefore, it is preferred in certain embodiments that said virus other than salmonid alphavirus is infectious pancreatic necrosis virus (IPNV).
The fungus is preferably selected from the group consisting of: Sapro/egnia Sp., Branchiomyces sanguinis, Branchiomyces demigrans and Icthyophonus hoferi.
Furthermore, the parasite may in particular be selected from the group consisting of: Lepeophtheirus Sp., Ca/igus Sp. and Ichthyophthirius Sp.
For the sake of convenience it is often preferred that approaches to controlling infections in fish populations are aimed at all, or at least most of the potentially relevant pathogens. Therefore, it may be preferred that the composition according to the invention comprises two or more viral, bacterial, fungus and/or parasite components as defined above, such as 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more or 10 or more components as defined above. In particular, compositions according to the invention may comprise 2, 3, 4, 5, 6, 7, 8 or 10 viral, bacterial, fungus and/or parasite components selected amongst those defined above.
It will be understood that the composition according to the invention should contain antigens in amounts which are sufficient in order to elicit an immune response, preferably a protective response, after injection of the composition into a fish. In general, it is preferred that the composition according to the invention has a relatively high content of Salmonid Alphavirus as this is believed to improve the protective immune response when the composition is used for vaccination purposes. The present inventors have observed that, in general, it is possible to culture salmonid alphavirus to reach a satisfactory titre in cell culture, and that production costs do not hamper the development of multi-valent vaccines.
Further, the availability of isolates of a particular SAV3 subtype which exhibit excellent growth kinetics when grown on cell cultures has allowed the present inventors to develop an extremely cost-effective Pancreatic Disease Virus vaccine component.
In particular, the vaccine may comprise an amount of salmonid alphavirus antigen, such as an amount of SAV3 antigen, which corresponds to 1.5x108-ixtO" TCID50/ml vaccine, such as from 1.5x108-SxlO10, from 1.5x1O8-1x1O°, from 1.5x108-5x109, from 1.5x108-2x109, from 1.5x108-9x108, from 1.5x108- 8x108, from 1.5x108-7x108, 1.5x108-6x108, 2.5x108-lxlO", 5x108-1x1011, 7.5x109-1x1011, lxlO'°-lxlO", 2.SxlO'°-lxlO", SxlO'°-1x1011, 7.5x1O'°-1x1O1, 2.5x108-75x1010, 5x108-SxlO'°, 5x108-7x109, 5x108-6x109, 5x108-5x109, 5x10°-4x109, 5x108-3x109, 5x108-2x109, from 5x10°-1x109, 6x108-7x109, 6x108- 6x109, 6x108-5x109, 6x108-4x109, 6x108-3x109, 6x108-2x109, 6xl08-1x109, 7x108-7x109, 7x108-6x109, 7x10°-5x109, 7x108-4x109, 7x10°-3x109, 7x108- 2x109, 7x108-1x109, 8x10B7x109, 7.5x1064x10'°, 8x10B6x109, 8x10°-SxlO°, 8x108-4x109, 8x108-3x109, 8x108-2x109, 8x108-1x109, 9x108-7x109, 9x108- 6x109, 9x108-5x109, 9x108-4x109, 9x108-3x109, or from 9x108-2x109, 1x109- 7.SxlO'°, 7.5x103-5x10'°, 1x109-2.SxlO'°, 1x109-lxlO'°, lxlO°-8x109, 1x109- 5x109, 1x109-2.5x109, 2.5x109-lxlO'° or from 5x109-7.5x109 TCID50/ml vaccine.
As the skilled person will be aware, several methods and means for administration of vaccines may be applicable in the aquaculture. It is thus to be understood that the vaccine according to the invention may be formulated for administration by a route selected from the group consisting of: intraperitoneal injection, bath, immersion, intramuscular injection and oral administration or combinations hereof.
When vaccines are to be administered by injection, a fairly small dosage volume is generally required. Accordingly, it is desirable to formulate the composition according to the invention so that each dose has a volume of 25-200M1* More preferably, each dose has a volume of 40-120 p1, such as a volume of 9O-llOpl or 45-55pl. At present a dosage volume of SOpI is preferred.
When formulated for injection, the composition according to the invention may, in particular, be formulated for intraperitoneal injection into a teleostei including, but not limited to salmonids, basses, breams, cods, snappers, flatfish, catfish, yellowtails and tilapias. Preferably, the vaccine is formulated for injection into a salmonid.
In preferred embodiments, when the composition is intended for injection, it may be formulated so that an aliquot of 25-200pJ, preferably an aliquot of 40-120 jii, such as an aliquot of 90-ilOpi or 45-55jl, and most preferably an aliquot of SOpI, contains salmonid alphavirus in amounts corresponding to 0.75x1O'-O.Sx1O° TCID50, such as from 0.75x10'-2.5x109, from 0.75x10'-0.5x109, from 0.75x107- 2.5x108, from O.75x10'-1x108, from 0.75x107-4.5x107, from 0.75x107-4x10', from 0.75x107-3.5x107, 0.75x107-3x10', 1.25x107-0.5x1010, 2.5x10'-O.SxlO'°, 3.75x108-O.SxlO'°, O.5x109-O.5x10'°, 1.25x1O°-O.Sx10°, 2.5x109-O.5x10'°, 3.75x109-0.5x1010, 1.25x10'-3.75x109, 2.5x107-2.5x1019, 2.5x107-3.75x108, 2.5x107-3x108, 2.5x10'-2.5x108, 2.5x107-2x108, 2.5x107-l.5x108, 2.5x107- 1x108, from 2.5x10J0.5x1OB, 3xlO'-3.5x108, 3x10'-3x108, 3x10'-2.5x108, 3x107-2x108, BxlO'-1.5x108, 3x107-1x108, 3x10'-O.5x108, 3.SxlO'-3.5x108, 3.SxlO'-3x108, 3,5x10'-2.5x108, 3.SxlO'-2x108, 3.SxlO'-1.5x108, 3.SxlO'- 1x108, 3.5x107-0.5x108, 4x107-3.5x108, 3.75x10'-0.5x109, 4x107-3x108, 4x10'- 2.5x108, 4x107-2x10°, 4x10'-1.5x108, 4x107-1x108, 4x10'-0.5x108, 4.5x10'- 3.5x108, 4.5x10'-3x10°, 4.SxlO'-2.SxlO°, 4.5x10'-2x108, 4.SxlO'-1.5x10°, or from 4.5x107-1x108, 0.5x10°-3.75x109, 0.5x108-1.25x109, 0.5x108-05x109, 0.5x108-4x108, O.5x108-2.5x108, 0.5x108-1.25x109,1.25x10°-O.5x109 or to 2.5x10°-3.75x108 TCID50.
As mentioned above it is desirable that the composition contains salmonid alphavirus at a titre of at least 7.5x108 TCID50/ml. This preferably yields an amount of salmonid alphavirus of at least 3,75x107 TCID50/dose.
It is to be understood that for the purpose of the present invention the specified amounts of salmonid alphavirus are determined by titration on CHH cells as illustrated in the examples. An alternative approach is titration on CHSE cells. As established in example 3, CHH cells are approximately twice as sensitive to the salmonid alphavirus as the CHSE cells; therefore when determining virus titres on CHH cells the values obtained are approximately twice as high as when determined by titration on CHSE cells.
In EP patent 712,926, CHSE cells are used for titration. It is therefore reasonable to assume that virus titres in the PD-vaccine, which is commercially available from the proprietor of EP 712,926 are also determined by titration on CHSE cells.
Therefore, the declared antigen content of 1072TC1D50/dose in the first generation monovalent vaccine from the patent proprietor would correspond to 3.2x107TCID50/dose if determined using CHH cells for titration. Likewise, the declared antigen content of 10'5TC1D50/dose in the second generation vaccine would correspond to 6.4x107TCID50/dose when titrated on CHH cells.
According to presently preferred embodiments of the invention, the composition comprises inactivated salmonid alphavirus (SAV) at a titre of 5x108 -5x101° TCID50/ml. (providing an antigen content of 2,5x107 -2,5x109 TCID50/dose at a dosage volume of 50 1d) Further it is preferred that the said live attenuated or killed bacterium is present in amounts corresponding to 0.2 x108-2.5xlO9cells/ml (0.1 xlO'- 1.2SxlO8cells/dose), such as 0.5 x108-2.5x10°cells/ml (0.25 x107- 1.2SxlO8cells/dose), 0.5 x108-lxlO°cells/ml (0.25 x107-0.SxlO8cells/dose), 0.5 x108-0,SxlO9cells/ml (0.25 xlO'-0.2SxlO8cells/dose), 1x108-SxlO9cells/ml (0. 5x10'-O. 2SxlO5cells/dose), 2. 5x10°-SxlO9cells/ml (1. 25x10'- 2.5xlO8cellsJdose), 5 x105-SxlO9cells/ml (2.5 xlO'-2.SxlO8cellsJdose), 7.5 x108- SxlO9cells/ml (3.75 x107-2.Sxlo8cellsJdose), l-SxlO9cells/ml (0.5- 2.SxlO5cells/ml), 2-SxlO9cells/ml (1-2.SxlO8cells/dose), 3-SxlO9cells/ml (1.5- 2. SxlO8cells/dose), or 4-SxlO9cells/ml (2-2.SxlO8cells/dose). It is further preferred that the bacterial antigen is added in amounts, which elicit a protection resulting in a relative percent survival (RPS) above 70 for the relevant disease using a challenge model for the disease using intraperitoneal injection for challenge.
According to more specific embodiments the said bacterium is present in amounts corresponding to 1 x x lO9cells/ml. At a dosage volume of 50 jil this corresponds to 5x106 -4x108 cells/dose. Preferably, the bacterium is present in amounts corresponding to 0.9 5 x109 cells/mi, corresponding to 0.45 -2.5x105 cells/dose at a dosage volume of 50 jii.
In a particular embodiment primarily aimed at the Norwegian market, the said live attenuated or killed bacterium is present in amounts corresponding to »=2.9x10° cells/mi (»=l.45x107 cells/dose) of Aeromonas salmonicida, »=7.4xlO7cells/ml (»=3.7xlO6cells/dose) of Vibrio salmonicida, »= 4.3xlo5cells/ml (»= 1.65xlO7cells/dose) of V. anguillarum serovar 0Th, »=3. 2x10° cells/mi (»= 1.6x10' cells/dose) of V. anguillarum serovar 01 and »= 2.7xlO7cells/ml (»= 1.35x106 cells/dose) of Monte/la viscosa. In further preferred embodiments intended for the same purpose, the composition comprises inactivated Aeromonas salmon/c/cia, inactivated Vibrio. Salmon/c/cia, inactivated Vibrio angu/liarum, and inactivated Mon/tells viscose, each bacterial antigen being present in an amount corresponding to 0.9 -5xlO9cells/ml.
In preferred embodiment, presently intended for the Chilean market the composition comprises: inactivated Vibrio ordali and inactivated P/scirickettsia salmonis, both in an amount corresponding to 0.9 -SxlO9cells/ml.
In preferred embodiment, presently intended for East Asia, the composition comprises: inactivated Aeromonas hydrophila, inactivated Flavobacterium columnar/s and inactivated Haphnia sp., each in an amount corresponding to 0.9 -SxlO9cells/ml.
The virus other than salmonid alphavirus may preferably be present in amounts corresponding to »=5x106 PFU/ml. In particular these amounts are relevant when the virus is infectious pancreatic necrosis virus (IPNV). According to specific embodiments, the virus is present in amounts corresponding to 1.0 -5 x109 PFU/ml or 2-8 antigenicity units (AU)/ml when infectious pancreatic necrosis virus (IPNV). At a dosage size of 50 jil, this corresponds to 0.5 -2.5x108 PFU/dose and 0.2-0.8 antigenicity units/dose, respectively.
As the skilled person will realize it is possible to include one or more recombinantly produced antigens in the vaccines according to the invention. In particular, the antigenic and/or immunogenic material derived from the salmonid alphavirus may be a material which is produced using recombinant techniques. In addition, the antigenic and/or immunogenic material derived from said bacterium in item a), from said virus in item b), from said fungus in item c) or from said parasite in item d) as defined above may be produced using recombinant techniques.
Such techniques, including techniques for the cloning, expression, synthesis and purification of peptides and polypeptides, are of course available and well known to the skilled person.
Suitable recombinant antigens may be polypeptides cloned from fish pathogens or immunogenic portions of such polypeptides. An immunogenic portion of a polypeptide may comprise a T-cell and/or a B-cell epitope. T-cell epitopes, which are linear, may be identified by investigating the effect of deletion mutantions introduced systematically into the polypeptide sequence. B-cell epitopes may be identified by analysing the B-cell responses to overlapping peptides covering the polypeptide sequence of interest. The skilled person will be aware that, in general, immunogenic amino acid sequences will have a minimum length of 6 amino acids in a consecutive sequence. Longer amino acids sequences may of course be preferred, including amino acid sequences of at least 7, 8, 9, 10, 12, 15, 20, 30, 50, 100, 150 or 200 amino acids in a consecutive sequence.
The skilled person will acknowledge that, when contemplated for the purpose of eliciting a protective immune response, the composition according to the invention may further comprise an organic adjuvant and/or an inorganic adjuvant.
The organic adjuvant is preferably selected from the group consisting of: mineral oil, squalene (2,6,10,15, 19,23-hexamethyl-2,6, 10,14, 18,22-tetracosahexaene), virosomes, Montanide and CpG oligodeoxynucleotides. Other examples of adjuvants frequently used in fish and shellfish farming are muramyldipeptides, lipopolysaccharides, several glucans and glycans, mineral oil and Carbopol®. Also adjuvants such as interleukin and glycoproteins may be used. An extensive overview of adjuvants suitable for fish and shellfish vaccines is given in the review paper by Jan Raa (1996), the content of which is incorporated herein by reference in its entirety.
Useful inorganic adjuvants will be known to the skilled artisan and are described IC Aguilar and EG Rodriguez, 2007, Vaccine 25, 3752 -3762, the content of which is incorporated herein by reference in its entirety.
In particular, the inorganic adjuvant which is optionally included in the composition according to the invention is selected from the group consisting of Al(OH)3 (Aluminium hydroxide), Ca3(P04)2 (Calcium phosphate), and water un-soluble salts of aluminium, calcium, iron or zirconium.
The composition of the invention may further comprise a suitable pharmaceutical carrier. In a currently preferred embodiment, the vaccine is formulated as an emulsion of water in oil. The vaccine may also comprise a so-called "vehicle". A vehicle is a device to which the antigen adheres, without being covalently bound to it. Such vehicles are i.a. biodegradable nano/micro-particles or -capsules of PLGA (poly-lactide-co-glycolic acid), alginate or chitosan, liposomes, niosomes, micelles, multiple emulsions and macrosols, all known in the art. A special form of such a vehicle, in which the antigen is partially embedded in the vehicle, is the so-called ISCOM (European patents EP 109.942, EP 180.564 and EP 242.380, the content of which is incorporated herein by reference in its entirety).
In addition, the composition may comprise one or more suitable surface-active compounds, detergents and/or emulsifiers.
In particular, the detergent is selected from the group consisting of non-ionic detergents, cationic detergents and anionic detergents.
As the skilled person will realize esters of non-PEG-ylated or PEG-ylated sorbitan with fatty acids are examples of useful emulsifiers. As illustrated in the examples the emulsifier may in particular be polysorbate or sorbitan oleate. More specifically, the said detergent and/or emulsifier may be selected from the group consisting of polyoxyethylene (20) sorbitan monooleate (Tween®80), Sorbitane monooleate (Span®80), Cremophore, Tween® and Span®.
In certain embodiments, the composition according to the invention is selected from the group consisting of a water-in-oil emulsion, a water-in-oil-in-water emulsion and an oil-in-water emulsion. As presently preferred the composition according to the invention is a water-in-oil emulsion.
In specific embodiments, the composition comprises a mineral oil.
Particular embodiments of the invention pertain to a vaccine comprising an oil phase and a water phase, each phase constituting from 2O-8O% (v/v) of the total volume of said vaccine.
In further preferred embodiments the vaccine comprises an oil phase constituting from 50-80% (v/v) of the total volume of said vaccine, such as from 55-75% (v/v), from 45-62% (v/v), from 45-60% (v/v), from 50-70°Io (v/v), from 5570% (v/v), from 50-65% (v/v), from 50-60% (v/v) from 55-GO% (v/v) or from 57- 60% (v/v) the total volume of said vaccine.
In still further preferred embodiments, the vaccine comprises a water phase constituting from 2O-5S% (v/v) of the total volume of said vaccine, such as from 2O-SO% (v/v) from 20-45% (v/v), from 20-40% (v/v)1 from 30-55% (v/v), from 30-52% (v/v), from 3050'Yo (v/v), from 37-55% (v/v)1 from 375O% (v/v),or such as from 37-45% (v/v) of the total volume of said vaccine.
In further preferred embodiments, the composition comprises an oil phase and a water phase, each phase constituting from 30-?O% (v/v) of the total volume of said vaccine.
In yet further preferred embodiments, the composition comprises an oil phase constituting from 4S-7O/n (v/v) of the total volume of said vaccine, such as from 45-65% (v/v), from 45-62% (v/v), from 45-60% (v/v)1 from 50-70% (v/v), from 55-70% (v/v), from 50-65% (v/v), from SO-6O% (v/v) from 55-60% (v/v) or from 57-60% (v/v) the total volume of said vaccine.
In still further preferred embodiments the composition comprises a water phase constituting from JO-55% (v/v) of the total volume of said vaccine, such as from 30-50% (v/v) from 3O-45% (v/v), from 30-40% (v/v), from 35-55% (v/v), from 35-52% (v/v), from 35-50% (v/v), from 37-55% (v/v), from 37-5O% (v/v),or such as from 37-45% (v/v) of the total volume of said vaccine.
In further preferred embodiments the composition comprises an oil phase constituting from SO-SOo/n (v/v) of the total volume of said vaccine, such as from 55-75% (v/v)1 from 45-62% (v/v), from 45-60% (v/v)7 from 50-70% (v/v)1 from 55-70% (v/v), from 50-65% (v/v), from 50-60% (v/v) from 55-60% (v/v) or from 57-60% (v/v) the total volume of said vaccine.
In still further preferred embodiments, the composition comprises a water phase constituting from 20-55% (v/v) of the total volume of said vaccine, such as from 20-50% (v/v) from 30-45% (v/v)7 from 20-40% (v/v), from 30-55% (v/v), from 30-52% (v/v), from 30-50% (v/v), from 37-55°k (v/v), from 37-50% (v/v),or such as from 37-45% (v/v) of the total volume of said vaccine.
It is to be understood that the Salmonid Alphavirus in the composition according to the invention may be a virus of any of the presently know SAV subtypes, SAV1, SAV 2, SAV 3, SAV4 SAV5 and SAV6 as defined above. The present inventors have observed that previously described strains of salmonid alphaviruses are indeed effective when used as antigenic component in polyvalent vaccines and provide good protection against subsequent infection.
Representative isolates of the SAV1 and SAV 2 subtypes are described in the art: A patent deposit of SAV1 has previously been made under the Budapest Treaty at the ECACC under deposit number V94090731. The deposited SAV1 isolate corresponds to the isolate described in Nelson et al. 1995 and the isolate provided in EP 712,926.
Preferably the Salmonid Alphavirus in the composition according to the invention is a salmonid alphavirus subtype 3 (SAV3) virus. In the presently most preferred embodiments, the Salmonid Alphavirus of the composition is selected from the group consisting of the virus strains deposited under the Budapest Treaty with the European Collection of Cell culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), SP4 OJG UK on December 12 2007 under Deposit numbers 07121201, 07121202 and 07121203.
Related genotypic characteristics: In further embodiments, the virus is a strain or isolate with genotypic characteristics which are related or similar to those of the deposited strains specified above, in particular any of the deposited SAV3 strains.
While the genomic organizations of all characterized SAys are equal, the nucleotide sequence similarity between SAV3 and SAV1 is only 91.6%, and between SAV3 and SAV2 92.9% (Hodneland et al 2005). If the comparison is limited to certain genes, e.g. the non-structural protein nsP3, the similarity between subtypes is as low as 81.5 % (Weston et al 2005).
In particular embodiments, the salmonid alphavirus used in relation to the present invention comprises a nucleic acid sequence which is at least 90%, such as 95%, 97% or 99% identical to any one of the sequences set forth in SEQ ID NO: 1-3.
SEQ ID NO: 1 aagaagtgca ccagattttc caccaccccg aagaagtccg ccccctacct cgttgacgtg tacgacgctc tgccgatttc tgtagagatt agcaccgttg taacatgcaa cgacaatcag tgcacagtqa aggtgccacc cggtaccaca qtqaaattcq ataagaagtg caagagcgct gcccaagcga ccgttacctt taccagcgac tcccagacgt ttacgtgtga ggagccggtt ctgacggccg ccagtatcac ccagggcaag ccgcacctta gatcatctat gttgcccagc ggaggcaagg aagtgaaggc gaggatccca ttcccgttcc cgccagagac cgcgacc; SEQ ID NO: 2: aagaaatgta ccagattttc cactactcca aaaaagtccg cactatacct: cgttgatgtg tacgacgctc tgccgatttc cgtagagatt agcaccgtcg taacatgcaa cgatagccag tgcacagtga gggtgccacc cggcaccaca gtgaaattcg acaaaaaatg caagagcgct gcctcggcga ccgtcacttt caccagcgac tcccagacgt ttacgtgcga ggagccggtc ctaacggctg ccagtatcac ccagggcaag ccacacctca gatcggcaat gttgcctagt ggaggcaagg aagtgaaagc aaggatcccg ttcccgttcc cgccggaaac tgcaact; SEQ ID NO: 3 aagaaatgca ccaggttttc caccaccccg aagaagtccg cgctctatct cgttgatgtg tatgatgctc tgccgatttc tgtagagatc agcaccgtgg tgacatgcaa cgaaagacag tgcacagtga ggqtqccacc cggtaccaca gtgaaattcg ataagaagtg caagaacgtt gccaaagaga ccgtcacctt caccagcgac tcccagacgt ttacgtgcga ggagccggtc ctaacggccg ccagcatcac ccagggcaag ccgcacctta gatcgtcaat gttgcccagc ggaggcaaag aggtgaaagc gaggattcca ttcccgttcc cyccagagac tgcgact.
In further embodiments the salmonid aiphavirus used in relation to the present invention comprises a nucleic acid sequence, which is at least 80%, such as 85%, 9Q%, 95%, 9801o or 99% identical to the sequence set forth in any one of SEQ ID NO: 4-6.
SEQ ID NO: 4 gttacgccag cggcatcatt ggcgggcagc gtccacggcc atagtgtacg cagcgcccct gccatgaggg ccgccagcac aggtgccaga agcgtgcgca gtgtccagtc cggttcagcc gggcatagaa ctgacgtcgc cagcgtcgcc ggctcagcgg ggctgcctag agggctaaca cgggaccagt tcggcgccgt gagagctagg gcccgcaggg acttagagct ggagggatca gagcatggca gtcagactag cttccgttcc ggctcgctga tggtggagag caccgctagt ggctacagcc aacgttctga cgatcaggac acgggctcc SEQ ID NO: 5: gtcgcgccag cggcatcatt ggcgggcagc gtccacagcc atagtgtgcg cagcgcccct gccattctga gggccgccag cacaggagcc agaagcgtgc gcagtgtcca gtccggctta accgggcaca gagatgatgc cgttagcgtc gccggttcgg tgagacagcc cagtgggccg cccagcagcg tgagcacgcc cgccgcgcct agagggctaa cacgggaaca gttcggcgcc gtaagagcta gggcccgcag ggacctagag ttggagggac cggagcatgg cagccaggcc agcttccgtt ccggctcgct ggtggtgggg agcaccgcca gtagctacag ccaacgtcct gacgaccagg acacgggctc t; SEQ ID NO: 6: gttgtgccgg cgacatcgtc gacgggcagc gtccacagcc gcagtagcgc ccctgctatt ttgagggccg ccagcgcggg tgccagaagc gtgcgcagcg cccaacccgg ccccgccggg catagagcgg gcgccttcag cgtcgctggc tcggtgagac agcccagcgg gccgcctagt agcgtgagca cgcccgccgc gaccagaggg ctgacacggg accagtttga cgtcgtgaga gctagggccc gtaggaactt ggaaccggag gggtcggagc atggcagcca agccagcttc cgctccggct: cgctgacggt ggggagctct gctagtagct acagccaacg ttccgacgat caggacacgg gcacc Sequence identifier Source SEQ ID NO: 1 (Norwegian salmonid aiphavirus isolate F04- 170(7) E2 (E2) gene, partial cds., Fringuelli, E., ]. Fish Dis. 31 (11), 811-823 (2008) Genbank accession No: EF675594): SEQ ID NO: 2 (Salmon pancreas disease virus isolate FOS- 124(5) E2 (E2) gene, partial cds. Fringuelli, E., J. Fish Dis. 31 (11), 811-823 (2008) Genbank accession No: EF675577): SEQ ID NO: 3 (Sleeping disease virus isolate F04-198(22) E2 (E2) gene, partial cds. Fringuelli, E., J. Fish Dis. 31 (11), 811-823 (2008) Genbank accession No: FF675590): SEQ ID NO: 4 Norwegian salmonid alphavirus isolate F04- 170(3) non-structural protein P3 (nsP3) gene, partial cds. Fringuelli, E., ]. Fish Dis. 31 (11), 811-823 (2008) Genbank accession No: EF675545 SEQ ID NO: S Sleeping disease virus isolate F04-198(22) nonstructural protein P3 (nsP3) gene, partial cds. Fringuelli, F., J. Fish Dis. 31 (11), 811- 823 (2008) Genbank accession No: EF675542 SEQ ID NO: 6 Salmon pancreas disease virus isolate FOS- 124(5) nonstructural protein P3 (nsP3) gene, partiai cds. Fringueili, F., J. Fish Dis. 31 (11), 811-823 (2008) Genbank accession No: FF675529 In preferred embodiments of the present invention relating to virus of the SAV3 variant, it will be understood that the virus comprises a nucleic acid sequence which is at least 98%, 99%, or 99.5%, identical to the sequence set forth in SEQ ID NO: 1.
For the purpose of the present invention, a suitable test for determining whether a virus isolate has genotypic characteristics, which are related or similar to those of the deposited strains specified above is provided in exmple 2: the skilled person will realize that in preferred embodiments, the salmonid alphavirus according to the invention is a virus, which is positive in the SAV reverse transcriptase quantitative PCR (RT-QPCR) identity test as described in example 2, in particular when using a set of primers designed to amplify part of a salmonid alphavirus glycoprotein E2 nucleotide sequence, such as the primers set forth in SEQ ID NO5: 7 and 8.
Related phenotypic characteristics: In still further embodiments the virus is a strain or isolate with phenotypic characteristics, which are related or similar to those of the deposited strains, in particular any of the deposited SAV3 strains.
Phenotypic differences do exist between isolates within the three SAV groups, as well as between groups (Christie et al. Dis. Aquat. Org. 75: 13-22, 2007, Hodneland et al, 2005, Taksdal et al): In a study by Taksdal et al. all Atlantic salmon and 76% of the Rainbow trout infected with virus of the SAV3 subtype had severe pancreatic lesions in the late/regenerative stage. This was in contrast with reports from Irish and Scottish cases where fish infected with SAV1 usually had normal, probably recovered, exocrine pancreatic tissue. A further characteristic feature of pancreatic disease caused by the SAV3 subtype is the presence of numerous cells in the kidney containing cytoplasmic eosinophilic granules (EG). In Taksdal's studies, EG-containing cells were found in 4O% of the rainbow trout and in 4°/a of the Atlantic trout. In addition, it is characteristic that rainbow trout and Atlantic salmon are equally susceptible to infections with SAV3 while rainbow trout appear to be somewhat resistant to infection with SAV1.
Finally the heart seems to recover earlier from infections with SAV3 as compared to infections with SAV1.
According to further embodiments, the virus which is included in the composition according to the invention is capable of inducing mortality of at least 25%, such as at least 3Q%, at least 35%, at least 4O%, at least 45%, at least 5Q%, at least SS%, or preferably at least 6O% in a laboratory challenge model, said model comprising smoltifying Atlantic salmon according to standard methods and challenge the post-smolts by intraperitoneal injection with a SAV3 dose of at least 108TC1D50 per fish, such as at least 109TC1D50, at least 10'°TCTD50 or preferably at least 3.5 x 108 TCID50 per fish, within one day after transfer to seawater (25%o) at 12°C.
The new variant of the Salmonid Alphavirus subtype SAV3, is characterised by having the ability of growing to high titres in vitro in cultures of host cells.
Accordingly, this virus may be capable of growing to a titre, in the supernatant/growth medium, of at least 1x108, 5x108, 1x109, 5x109, lxlO'°, and 5x10'° or such as at least lxlO" TCID50/ml. when cultured using host cells which are selected from the group consisting of CHH-1 cells or CHSE-214 cells.
In particular, such high titres of virus may be obtained when: 1) Cells are cultured using host cells which have been seeded at a density of 0.1-1x105 cells cm2; H) The host cells are cultured for 4-6 days prior to virus infection; Hi) The host cells are grown to a density of from 0.1-1.0 x106 cells cm2 at the time of infection with said virus isolate; iv) The host cells are cultured in a growth medium comprising EMEM (EBSS)+ 10% Fetal Bovine Serum (FBS) + 2mM L-Glutamine + 1% Non Essential Amino Acids (NEAA) + 0.1% gentamicine; and v) The infected cells are cultured at a temperature of 150G. for a period of 10-14 days.
It will further be understood that the SAV 1, SAV3, SAV4, SAV5 or SAV6 virus, which is included in the composition according to the invention is a virus which, unless attenuated or inactivated, is capable of causing the symptoms associated with fish pancreatic disease. General symptoms of fish pancreatic disease have been reviewed in McLoughlin and Graham, Journal of Fish Disease 2007, 30, 511- 531, the content of which is incorporated herein in its entirety. The symptoms include: i) Death/mortality U) Inappetance Ui) Impaired swimming behaviour iv) Lethargy v) Pancreatic necrosis vi) Cardiomyopathy and skeletal myopathy, including oesophageal muscle lesions vii) Kidney lesions, affected kidneys containing numerous interstitial cells filled with eosinophilic material viii) Focal gliosis in the brain.
Generally, the course of disease following from infections with fish pancreatic disease virus can be characterised as comprising an acute stage and a late/chronic stage, each stage being associated with various histopathological symptoms. The virus provided according to the present invention may in particular be capable of causing at least one of the following histopathological symptoms in the acute stage: i) destruction of the majority of pancreatic acinar tissue and a variable inflammatory response ranging from no inflammation to moderate inflammation; ii) fibrosis of periacinar tissue.
Also, the virus provided according to the present invention may be capable of causing at least one of the following histopathological symptoms in the late! chronic stage: i) significant loss of pancreatic acinar tissue with or without fibroplasia of periacinar tissue; U) multifocal cardiomyocytic necrosis, affected cells having a shrunken,deeply eosinophilic cytoplasm and pyknotic nuclei.
As opposed to infections with SAV1 and 3, infections with SAV2 in rainbow trout is reported to cause lower mortality, but a mortality up to 22% has been reported (Boucher and Baudin 1994,). Sleeping disease, however, may cause the fish to rest on their side on the bottom of tanks or raceways. If disturbed, the fish swim for some time and then return to the bottom. This sign is primarily due to extensive necrosis of skeletal red muscle.
Macroscopic lesions do not occur, but occasionally, secondary ulcerations of the skin or petechiae on the pyloric organ. Necrosis of the skeletal red muscle may be present and histopathological examination may reveal inflammation of exocrine pancreas and heart. In the individual fish, these lesions may be present with or without any behavioural alterations.
It will be understood that the SAV 2 virus, which may be included in the composition according to the invention is a virus which, unless attenuated or inactivated, is capable of causing the symptoms associated sleeping disease in fish.
It is further to be understood that the virus according to the invention may have a visible cytopathogenic effect during early passage in cell culture, such as during the first, second, third or fourth passage on a culture of CHSE cells. As mentioned, the present inventors have identified a new variant of the Salmonid Alphavirus subtype SAV3. This variant of the virus showed visible cytopathogenic effect during first passage in cell culture. While previous isolates of salmonid alphaviruses have not had visible cytopathogenic effect before becoming adapted to the in vitro culture conditions, the ability of causing a cytopathogenic effect without having been passed on a cell line may therefore apply as a further characteristic of the virus according to the present invention.
It is to be understood that the deposited viruses may mutate or otherwise change characteristics, for instance when being passed on host cells in vitro (JD Watson et al.(1987). As the skilled person will realize, replication of RNA virus genomes is accompanied by very high mutation rates (Watson et al. 1987). This is due to the lack of proofreading activity of RNA virus polymerases, which leads to a constant generation of new genetic variants e.g. during virus propagation (Elena and Sanjuán (2005). Also, Domingo and Holland (1997) concludes that different constellations of mutations may be associated with a similar biological behaviour.
Therefore, the salmonid alphavirus used for the purpose of the present invention may be a strain which is obtainable by introducing one or more substitutions, deletions and/or additions of nucleotides into the genome of any one of the deposited strains mentioned above. In other words, the salmonid aiphavirus used for the purpose of the present invention may be a genetic variant of any one of the above-mentioned deposited strains.
In the course of screening new SAV 3 isolates from outbreaks in Norwegian salmon farms, the present inventors have discovered a variant of the virus with properties diverging significantly from those previously described. Thus, the finding that this variant of the SAV3 subtype showed visible cytopathogenic effect during their first passage in cell culture, and produced mortality when injected into Atlantic salmon was highly surprising. In addition, it is greatly encouraging that vaccines based on antigenic material from this variant of the virus gives an excellent protection against subsequent infection with salmonid alphavirus, also when the vaccine is provided as a polyvalent vaccine comprising additional antigens. In addition, this newly discovered variant of the virus has fine growth properties when grown in vitro on cultures of host cells.
It will be understood that the cultures of salmonid alphavirus which are used in relation to the invention, are substantially free of other viral or microbial material.
In particular, contamination of virus isolates according to the invention by IPNV is a concern since, often, fish infected with salmonid alphavirus are also infected with IPNV. In the course of isolating the virus according to the invention it may therefore be necessary to add an antibody directed against IPNV in order to eliminate the IPNV virus from isolates or cultures of the virus according to the invention. In cultures of virus on host cells this antibody will inhibit infection of the host cells with IPNV.
In a specific and currently preferred embodiment, presently intended for use in Northern Europe, including Norway, the composition of the invention comprises: i) inactivated Salmonid Alphavirus, such as subtype SAV3 in an amount corresponding to 7.5x108 -5x109 TCID50/ml (in order to preferably provide 3.75x10' -2.5x108 TCID50/dose at a dosage volume of 50 jil), preferably 1x109 -5x109 TCID50/ml (in order to preferably provide 0.5x10° -2.5x108 TCID50/dose at a dosage volume of 50 kl), ii) inactivated Aeromonas salmonicida in an amount corresponding to 0.9 - 5xlO9cells/ml (in order to preferably provide 0.45 -2.5x108 cells/dose), UI) inactivated V/hi-jo. salmonicida in an amount corresponding to 0.9 - 5xlO9cells/ml (in order to preferably provide 0.45 -2.5x108 cells/dose at a dosage volume of 50 p1), iv) inactivated V/hi-jo anguillarum in an amount corresponding to 0.9 - 5xlO9cells/ml (in order to preferably provide 0.45 -2.5x108 cells/dose at a dosage volume of 50 p1), v) inactivated Monte/la viscosa in an amount corresponding to 0.5 - 5xlO9cells/ml (in order to preferably provide 0.45 -2.5x108 cells/dose at a dosage volume of 50 pl), vi) inactivated infectious pancreatic necrosis virus (IPNV) in an amount corresponding to 1.0-5.0x109 PFU/ml live virus (in order to preferably provide 0.5 -2.5x108 PFU/dose at a dosage volume of 50 p1) or 2-8 antigenicity units (AU)/ml (in order to preferably provide 0.2-0.8 antigenicity units/dose at a dosage volume of 50 jil), vii) an adjuvant, preferably mineral oil; and viii) a detergent and/or emulsifier.
In alternative embodiments, presently intended primarily for use in South America, including Chile, the composition according to the invention comprises: i) inactivated Salmonid Alphavirus, such as subtype SAV3 in an amount corresponding to 7.5x108 -5x109 TCID50/ml (in order to preferably provide 3.75x107 -2.5x1O8 TCID50/dose at a dosage volume of 50 1ii), preferably 1x109 -5x109 TCID50/ml (in order to preferably provide 0.5x108 -2.5x108 TCID50/dose at a dosage volume of 50 p1), U) inactivated V/hi-jo ordali in an amount corresponding to 0.9 -SxlO9cells/ml (in order to preferably provide 0.45 -2.5x108 cells/dose at a dosage volume of 50 p1), Ui) inactivated Piscirickettsia salmon/s in an amount corresponding to 0.9 - 5xlO9cellsJml (in order to preferably provide 0.45 -2.5x108 cells/dose at a dosage volume of 50 RI), iv) inactivated infectious pancreatic necrosis virus (IPNV) in an amount corresponding to 1*05*010 PFU/ml live virus (in order to preferably provide 0.5 -2.5x108 PFU/dose at a dosage volume of 50 RI) or 2-8 antigenicity units (AU)/ml (in order to preferably provide 0.2-0.8 antigenicity units/dose at a dosage volume of 50 p1), v) an adjuvant, preferably mineral oil; and vi) a detergent and/or emulsifier.
In other alternative embodiments, presently intended primarily for use in South East Asia, the composition according to the invention comprises: i) inactivated Salmonid Alphavirus, such as subtype SAV3 in an amount corresponding to 7.5x108 -5x109 TCID0/ml (in order to preferably provide 2.5x107 -2.5x108 TCID50/dose at a dosage volume of 50 R1).
preferably 1x109 -5x109 TCID50/ml (in order to preferably provide 0.5x108 -2.5x108 TCID50/dose at a dosage volume of 50 R1).
U) inactivated Aeromonas hydrophila in an amount corresponding to 0.9 -SxlO9cells/ml (in order to preferably provide 0.45 -2.5x108 cells/dose at a dosage volume of 50 p1), iii) inactivated F/a vobacterium columnar/s in an amount corresponding to 0.9 -SxlO9cells/ml (in order to preferably provide 0.45 -2.5x108 cells/dose at a dosage volume of 50 pl), iv) inactivated Haphnia sp. in an amount corresponding to 0.9 -SxlO9cells/ml (in order to preferably provide 0.45 -2.5x108 cells/dose at a dosage volume of 50 pl), v) inactivated infectious pancreatic necrosis virus (IPNV) in an amount corresponding to 1.0-5.0x109 PFU/ml (in order to preferably provide 0.5 -2.5x108 PFU/dose at a dosage volume of 50 pl) or 2-8 antigenicity units (ALJ)/ml (in order to preferably provide 0.2-0.8 antigenicity units/dose at a dosage volume of 50 p1), vi) an adjuvant, preferably mineral oil; and vii) a detergent and/or emulsifier.
Dosage form Yet another aspect of the invention provides a dosage form of a composition according to the invention.
While other dosage forms may be contemplated, including solid dosage forms based on a fish feed, the dosage form according to the invention is preferably a liquid dosage form, more preferably a liquid dosage form for injection, such as intraperitoneal injection. When intended for injection the dosage form preferably has a volume of 25-200pl, more preferably a volume of 40-120 R1' such as a volume of 90-ilOpI or 45-55pl. At present a dosage volume of 50jd is the most preferred for convenience reasons.
In relation to the dosage form the same preferences with respect to dosage volume and antigen content apply as described in relation to the composition according to the invention.
In particular, the dosage form according to the invention preferably comprises salmonid alphavirus in amounts corresponding to 0.75x107-0.5x101° TCID50/dose, such as from O.75x107-2.5x109, from 0.75x107-0.5x109, from 0.75x107-2.5x108, from O.75x107-1x108, from 0.75x107-4.5x10', from 0.75x107-4x10', from 0.75x10'-3.5x107, 0.75x107-3x10', 1.25x10'-0.5x1010, 2.5x10'-0.5x1010, 3.75x108-0.5x10'°, 0.5x109-0.5x1010, 1.25x109-0.5x1010, 2.5x109-0.5x1010, 3.75x109-0.5x1010, 1.25x107-3.75x109, 2.5x10'-2.5x10'9, 2.5x107-3.75x108, 2.5x107-3x108, 2.SxlO'-2.5x108, 2.5x107-2x108, 2.5x107-1.5x108, 2.5x107- 1x108, from 2.SxlO'-0.5x108, 3x10'-3.5x10°, 3x10'-3x108, 3x10'-2.5x10°, 3x10'-2x108, 3x107-1.5x10°, 3x10'-1x108, 3x107-O.SxlO°, 3.5x107-3.5x108, 3.SxlO'-3x108, 3,5x107-2.5x10°, 3.5x107-2x108, 3.5x10'-1.5x10°, 3.5x107- 1x108, 3.5x10'-0.5x108, 4x1073.5x108r 3.75x10'-0.5x109, 4xl07-3x108, 4x107- 2.5x108, 4x10'-2x10°, 4x107-1.5x108, 4x10'-1x108, 4x10'-0.5x108, 4.5x10'- 3.5x108, 4.5x10'-3x108, 4.SxlO'-2.5x108, 4.5x107-2x108, 4.5x107-1.5x108, or from 4.5x107-1x108, 0.5x10°-3.75x109, 3.73x107-2.5x109, 0.5x108-0.5x109, 0.5x108-4x108, 0.5x108-2.5x108, O.5x1O8-1.25x1O9, 1.25x108-0.5x109 or from 2.5x108-3.75x108 TCID50/dose.
Vaccine A further aspect of the invention provides a vaccine comprising a composition or a dosage form as defined above. It is to be understood that all embodiments and features as described above will also apply to the vaccine according to the invention.
As the skilled person will be aware several methods and means for administration of vaccines may be applicable in the aquaculture. It is thus to be understood that the vaccine according to the invention may be formulated for administration by a route selected from the group consisting of: intraperitoneal injection, bath, immersion, intramuscular injection and oral administration or combinations hereof.
For the sake of convenience it is preferred that the vaccine is administered to salmon parr, preferably parr of 10 -60 grams. As the skilled person will realize however, the vaccine according to the invention may also be administered to salmon in other stages, including any of the salt water stages.
As demonstrated in the examples the compositions according to the inventions provide extremely effective protection against infection with salmonide alphavirus when tested in laboratory challenge experiments, in which the vaccinated fish are challenged with high titres of highly virulent SAV3 isolates. In the field, where the fish are exposed to much lower titres of the virus it is to be expected that protective efficacy of the vaccines provided according to the invention is even higher than what is shown in the present examples.
Medical use/method of prophylaxis Other aspects of the present invention provide the use of inactivated salmonid alphavirus in the manufacture of a medicament, e.g. as an immunological composition such as a vaccine, and/or dosage form for administration simultaneously or in combination with one or more antigenic components selected from the group consisting of: a) a killed bacterium, b) a inactivated virus other than a salmonid alphavirus, c) a fungus, d) a parasite; and e) an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d); It will be understood that in accordance with the invention, the said dosage form preferably contains inactivated salmonid alphavirus in an amount corresponding to at least 3.75x107 TCID50/dose. Likewise, it is preferred that said vaccine/immunological composition contains inactivated salmonid alphavirus in an amount corresponding to at least 7.5x108 TCID50/ml.
Another aspect pertains to the use of an inactivated salmonid alphavirus in the manufacture of a vaccine or an immunological composition, which is compatible with other immunological products, wherein said vaccine comprises inactivated salmonid alphavirus in an amount corresponding to at least 7.5x108 TCID50/ml (corresponding to 3.75x107 TCID50/dose at a dosage volume of 50 jl).
In still another aspect, the invention provides a composition as described above for use in medicine. In particular, the composition may be for use in preventing, or reducing the incidence of fish pancreatic disease or, alternatively phrased, for use in preventing or reducing the incidence of infection by salmonid alphavirus. A related aspect provides a vaccine according to any of the embodiments described above for use in preventing, or reducing the incidence of fish pancreatic disease.
Other aspects of the invention provide a vaccine as described above for use in preventing or reducing the incidence of infection by salmonid alphavirus. It is contemplated that a polyvalent vaccine based on a composition comprising a combination of viral, bacterial, fungal and/or parasitic antigens as described above can provide a successful approach to controlling infections with any of the currently known groups of salmonid alphavirus, SAV1, SAV2, SAV3, SAV4, SAVS and SAV6.
Further aspects of the invention relates to the use of a composition as described above for the manufacture of a medicament/vaccine for preventing or reducing the incidence of infection by salmonid alphavirus.
Still further aspects pertain to the use of a composition as described above for the manufacture of a medicament/vaccine for preventing or reducing the incidence of fish pancreatic disease and/or sleeping disease. In yet another aspect the invention provides a method of reducing the incidence of and/or treating or preventing infection by Salmonid Alphavirus in a fish population, said method comprising administering to the fish a composition, vaccine or dosage form as defined above.
Method of making a vacccine The invention also provides a method of manufacturing a composition and/or vaccine and/or a dosage form as defined above. The method comprises combining a, preferably attenuated or inactivated, Salmonid Aiphavirus or an antigenic and/or immunogenic material derived thereof with one or more components selected from the group consisting of: a. a live, attenuated, killed or inactivated bacterium, b. a virus other than Salmonid Alphavirus, said virus preferably being attenuated or inactivated, c. a fungus, d. a parasite; and e. an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d).
Preferably, the amount of salmonid alphavirus is adjusted to provide a composition or vaccine comprising at least 7.5x108 TCID50/ml inactivated salmonid alphavirus or a dosage form comprising at least 2.5x10' TCID50/dose.
In this context, the viral, bacterial, fungal and parasitic antigen components are preferably as specified above, depending on the fish pathogens which prevail in the area in which the vaccine is to be used.
As the salmonid alphavirus must be grown on cultures of host cells, the method according to this aspect of the invention may further comprise a. establishing a culture of host cells; b. infecting said host cells with an isolate of a virus of the Salmonid Alphavirus, and c. culturing the infected cells under conditions allowing said virus to reach, in the supernatant/growth medium, a titre of at least 7.5x108 TCID50/ml, such as at least 1x109, 5x109, lxlO'° or at least 5x10'° TCID50/ml.
In the method according to the invention the said host cells are either cultured on a solid support or as suspension cultures.
In order to provide optimal growth conditions the host cells are preferably cultured at a pH between 6.5 and 8.5, such as between 7.0 and 8.0, between 7.2 and 8.0, between 7 and 7.5 or between 7.2 and 7.5.
The method according to the invention is developed with the particular purpose of producing the salmonid alphavirus vaccine component in large amounts.
Therefore, in presently preferred embodiments the process is adapted for producing Salmonid Alphavirus material in batches of 25-2000 litres, such as of 25-1000 litres, of 50-2000 litres, of 50-1000 litres or of 50 -500 litres.
In particular embodiment it is a further characteristic of the method according to the invention that the said host cells, when grown on a solid support, are seeded at a density of 0.1-1.5x105 cells cm2, 0.2.-1.5x105 cells cm2, 0.2-1.25x105 cells cm2 0.2-1x105 cells cm2 or 0.2-1x105 cells cm2.
According to further embodiments, the said host cells are cultured for 3-8 days prior to virus infection, such as from 4-8 days, 4-7 days or for 4-6 days.
In still further embodiments the said host cells are grown to a density of 8x105 cells cm2 at the time of infection with said virus isolate.
In particular, the host cells may be grown to a density of from 5x105 cells cm2 to 5x106 cells cm2 at the time of infection with said virus isolate.
As for the growth medium, it may be preferred that the host cells are cultured in a growth medium selected from the group consisting of EMEM (EBSS)+ 10% Fetal Bovine Serum (EBS) + 2mM L-Glutamine + l% Non Essential Amino Acids (NEAA) + 0.1°k gentamicine.
After infection of the cells, the infected cells are preferably cultured at a temperature from 12-16 °C, such as at a temperature of 13-16°C, 13-15°C, 14.- 16°C, or 14-15°C, and for a period of 6-20 days, such as a period of 8-20 days, 8-18 days, 8-16 days, 9-20 days, 9-18 days, 9-16 days, 10-20 days, 10-18 days, 10-16 days or 10-14 days.
Also, it may be preferred that the infected cells are cultured until 30% of the host cells are lysed or have detached, such as until 40%, 5O%, GO%, 70%, 80% or 90% of the host cells are lysed or have a cytopathogen effect consisting of rounded cells.
As explained above it may be preferred that said Salmonid Alphavirus is a virus of the SAV3 subtype.
As for the host cells, these are preferably selected from the group consisting of cells derived from heart tissue of juvenile chum salmon (Onchorhynchus keta), cells derived from Chinook salmon (Oncorhynchus tshawytscha) embryo.
More specifically it is preferred to use host cells which are selected from the group consisting of CHH-1 cells and CHSE-214 cells. CHH-1 cells are available from ATCC under deposit number CRL-1680, CHSE-214 cells are available from ATCC, deposit number CRL 1681 and from ECACC under deposit number 91041114.
Bacterial antigens for use in the polyvalent vaccine according to the invention can be prepared using conventional techniques, for instance by growing the bacteria in tryptic soy broth with 2% NaCI at 12-15°C, or in brain heart infusion broth with 3% NaCI at 12-15°C (Atlas, RM,2004, Handbook of Microbiological Media, Third edition, CRC press, page 1820 and 246).
As for the infectious pancreatic necrosis virus (IPNV), this virus can be can be propagated for the purpose of the preparation of a vaccine in CHSE-214 cells according to Dobos P and Roberts TE, 1982, Canadian Journal of Microbiology, 29, 377 -384.
The cultivation of these representative pathogens are also described at htto://www. lcicpromochem-atcc.com/.
A related aspect of the invention provides a method of improving a polyvalent vaccine. The method comprises including in the polyvalent vaccine (an immunogenic amount of) an attenuated or inactivated Salmonid Alphavirus. In a preferred embodiment the said polyvalent vaccine comprises one or more components selected from the group consisting of: a. a live, attenuated, inactivated or killed bacterium, b. a virus other than Salmonid Alphavirus, said virus preferably being attenuated or inactivated, c. a fungus, d. a parasite; and e. an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d).
In relation to this method the same preferences with respect to dosage volume and antigen content apply as described in relation to the composition according to the invention.
An example of such a polyvalent vaccine which could advantageously be improved by including an antigen preparation of Salmonid Alphavirus is A] 6-2 already marketed by the present applicant.
It should be noted that embodiments and features described in the context of one of the aspects of the present invention also apply to the other aspects of the invention.
All patent and non-patent references cited in the present application, are hereby incorporated by reference in their entirety.
The invention will now be described in further details in the following non-limiting
examples.
Examples
Example 1: Isolation of PD virus from fish with clinical PD infection (ALV- 405, ALV 406 and ALV-407) Materials Organ material Hearts were sampled from fish with clinical symptoms of pancreas disease in commercial fish farms. The hearts were kept cold at 4°C.
Cell cultures * CHH-1, 145th passage.
* CHSE-214, 36Lh passage * GF-1, 4th passage Cells were seeded two -three days before use.
Growth media * CHH-1 growth medium: EMEM (Sigma M7278), 10% EBS (Sigma F-3885), 1% L-glutamine (Sigma G-7513), 1% NEAA (Sigma M-7145), 0.1% gentamicine (Sigma G1397).
* CHSE-214 growth medium: EMEM (Sigma M7278), lOW0 FBS (Sigma F- 3885), l% [-glutamine (Sigma G-7513), 0.l% gentamicine (Sigma G 1397).
* GE-i growth medium: L-15 (Sigma L-5520 lot), 10% FBS (Sigma F-3885), i% [-glutamine (Sigma G-7513), 0.1°k gentamicine (Sigma G1397).
Filter: Minisart plus (Sartorius #17829) Anti IPNV antibodies: Rabbit anti IPNV antiserum (CP54/1996) Hearts from Atlantic salmon were homogenised using a porcelain mortar and quarts sand with some added medium (ca 8-20m1). The homogenate was centrifuged at 2000 x g for 10 minutes at 4°C, before 0.45 jm filtration through a syringe filter. The homogenates were dispatched in cryo vials and frozen at -80 oc.
Samples of some of the organ homogenates were mixed 1:100 with anti IPNV antiserum and incubated for two hours at 15°C. Subsequently 50-200jiI of homogenate with or without added anti-IPNV antiserum was inoculated into the different cell cultures (50-90% confluency) in 75/175 cm2 Nunc cell flasks with 15/50 ml of the appropriate medium according to table 1.
When passaging the virus into new cell cultures, 1 ml of supernatant was transferred into new cell culture flasks.
Table 1
Identity Anti-Cell Passage Passage Passage Passage Passage IPNV line 1 2 3 4 5 ALV 405 + GE-i + ++ +++ +++ +++ dpi 12 dpi 14 dpi 21 dpi 12 dpi 6.8 x108 TCID50 ALV 406 + CHSE ++ ++ +++ +++ dpi 8 dpi 14 dpi 21 dpi 12 dpi ALV 407 -GF-l ++ 22 dpi 28 dpi 14 dpi 4.2x 108 TCID50 -CHH-+++ 1 lodpi 3.7x TCID50 -CHSE +÷+ 1 Od pi 1,3x10° TCID50 +,++,++4-designates the degree of cytopathogen effect observed in the cells XX dpi; xx days post infection when cytopathogen effect was observed in the cells X:X x lox TCID50 Titration result of supernatant from the specific flask
Conclusions
* SAV3 was isolated from hearts collected from Atlantic salmon with pancreas disease.
* Cytopathogen effect was visible in the cell cultures from passage 1 * The passage 1 SAV3 isolates had a titer of up to 1,3x108 TCID50 * SAV3 can be isolated in passage 1 on several different cell lines Example 2: Identity test for SAV3, and test for absence of IPNV in SAV3 isolates To confirm the identity of different isolates of SAV3 and to test them for the absence of Infectious Pancreatic Necrosis Virus (IPNV), a Reverse Transcription-Quantitative PCR (RT-QPCR) procedure using primers specific for SAV and IPNV was applied.
Materials Virus isolates: ALV-405 p5 and p6, ALV 407 p1, ALV 408 p1, ALV 409 lpA and lpB (two separate isolations). Positive control: IPNV ALV 103.
RNA isolation: QIAamp Viral RNA Mini Spin Protocol Reverse transcription and QPCR: Brilliant® II QPCR and QRT-PCR Reagents from Stratagene.
Table 2: Primers
Virus Forward primer Reverse primer
SAV CGTCACTTTCACCAGCGACTCCCAGACG GGATCCATTCGGATGTGGCGTTGCTATGG
(SEQ ID NO: 7) (SEQ ID NO: 8) IPNV GTCCGGTGTAGACATCAAAG (SEQ ID TGCAGTTCCTCGTCCATCC (SEQ ID NO: NO: 9) 10) RT-PCR conditions: IPNV test: 50°C,30 mm -95 °C,10 mm -(95 °C,30 sec -57 °C,60 sec -72 °C,30 sec) *40 SAV3 test: 50°C,30 mm -95°C,10 mm -(95°C,30 sec -57°C,60 sec -72°C,30 sec)'1'40 Results: All SAV3 isolates were positive in the SAV RT-QPCR and negative in the IPNV RT-QPCR. These tests show that all the SAV3 isolates are indeed SAV and not contaminated by IPNV.
Example 3: Titration of salmon pancreas disease virus using different cell lines.
SAV3 was titrated on two different cell lines; CHH and CHSE as described in examples 4 and 5, respectively. The TOlD50 values obtained with the two cell lines are presented in table 3. The CHH cell line is approximately twice as sensitive to the virus as the CHSE cell line.
Table 3:
:CHSE***Y 1 6,49x109 TCID5Q 3,32x109 TCID50 2 2,87x1O9TC1D50 2,14x1O9TC1D50 3 5162x109 TOO50 2,37x105 TCID50 4 422x1O9TClD50 9,O9x1O8TC1D50 Example 4: Cultivation of SAV3 in CHH-1 cell culture flasks with high cell density.
Intention The aim was to evaluate the potential PD yields of different virus isolates in CHH- 1 cell culture flasks with high cell density.
Materials and methods Cell cultures and nrowth media 3 x 175cm2 flasks, CHH-1, 160th passage with 100 x 106 cells per flask (5.7 x io C/cm2) CHH-1 growth medium: EMEM (Sigma M7278), 10% FBS (Invitrogen), l'Yo L-glutamine (Sigma G-7513), 1% NEAA (Sigma M-7145), 0.1% gentamicine (Sigma G1397).
Virus/infection material ALV-405, p6, titre: 5.01 x 108 TCID50/ml ALV-407, p1, titre: 3.41 x 10' TCID50/ml ALV-407, p4, titre: 4.14 x 10' TCID50/ml Table 4. Cell cultures and experimental data.
Flask no Infection material Cell number per MOl Medium Virus stock Volume flask volume 1 ALV-405, p6 30p1 100 x 106 0.15 50m1 2 ALV-407, p1 SOOpI 100 x 106 0.18 SOmI 3 ALV-407, p4 SOUp1 100 x 106 0.21 50m1 Immediately before infection was the growth medium of the flasks replaced with 50m1 fresh growth medium, and then were the respective infection materials added (table 1). All flasks were incubated at 15°C with tightly closed caps.
Samplinci, titration and microscopic observations Microscopic observations and titration of samples were performed 7, 10, 13 and 18 days pi on CHH-1.
Results/discussion Microscopic observations Detachment and rounding of cells appeared about one week pi in all flasks. At the end of the observation period (18 days p1) flask 2 had the most prominent CPE with 80°k of the cells detached, whereas flask 1 and 3 had 20% and 40% detached cells, respectively.
Titration results The three isolates/passages had all titres at io TCID50/ml or higher. Surprisingly was the yields highest in the flask infected with the 1st passage of ALV-407 (figure 1, ALV-407 p2), but this flask had also had the most prominent CPE. The results confirm that CHH-1 cells produce high SAV3 yields, also from low passage virus stocks. Results are shown in figure 1.
Conclusions
* The highest yields were 1.78 x tO TCID50/ml in a sample obtained 13 days after inoculation with ALV-407 p1 at MOT 0.2.
* Production of low passage SAV3 in CHH-1 cells gives a good yield of SAV3.
Example 5: Cultivation of SAV3 in CHSE cells.
Intention The aim was to evaluate the potential SAV3 yields of different virus stocks in CHSE-214 cell cultures.
Materials and methods Cell culture and growth medium * CHSE-214: 19th passage with ca 80% confluence.
* CHSE-214 growth medium: EMEM (Sigma M7278), 10% EBS (Invitrogen), lOb L-glutamine (Sigma G-7513), 0.1% gentamicine (Sigma G1397).
Virus stock * ALV-404, 8p.
Table 5. Cell cultures and experimental data. All flasks were 75cm2, had 20m1 growth medium and were inoculated with lOOpl of the virus stock.
Flask no Cell Days after Cell Virus stock MOl line seeding density 1-2 CHSE 2 80% ALV-404, 8p >1.2 (CHSE) The flasks were cooled down to 15°C before they were infected without medium change. All flasks were incubated at 15°C with tight caps.
Sample of the virus seed materials were titrated on 96 wells plates.
Microscopic observation and titration of samples from all flasks were performed 6, 12, 15, 20 and 27 days pi.
Results/discussion Microscopic observations The infection (lysis and detachment of cells) developed quickly in the CHSE cultures, with more than OO% lysis 12 days pi. Samples from the two flasks were collected and titrated on 96 well plates on day 6, 12, 15, 20 and 27 days post infection. The average values from the two parallel flasks are shown in figure 2.
This experiment shows that CHSE-214 is a suitable cell line for production of SAV3 since high virus titers are produced from a low passage stock of SAV3.
Example 6: Vaccination of salmon parr using a polyvalent vaccine comprising SAV3 The present example presents a multivalent pancreas disease vaccine based on salmonid alphavirus subtype 3 antigenic material, showing excellent protection in an experimental challenge model with high mortality in the unvaccinated control group.
Table 6: Outline of experiment Task Activity Environmental parameters Experimental week Acciimatisation 12h/12 light, fresh wate,ow of fish 0.8 litre/kg biomass Start of Vaccination and 1 experiment marking Smoltification Start of 24 hour light, fresh water, 1-4 smoltification 12°C, flow 0.8 litre/kg biomass Smoltification Smoltification 24 hour light, Fresh water 4-6 15°C, flow 0.8 litre/kg biomass Transfer to sea Transfer of the 12h/12h light, 25°/oo sea water, 6 water fish to seawater flow 0.8 litre/kg biomass (25%o sea water).
Challenge The SAy 12h/12h light, 250/oo sea water, 6 challenge is flow 0.8 litre/kg biomass performed the day after transfer to sea water by i. p. injection.
Disease Dead and 12h/12h light, 250/oo sea water, 6-11 development moribound fish flow 0.8 litre/kg biomass are recorded and removed daily ____________________________________ Termination of 11 the experiment Atlantic salmon parr with an average weight of 25.7 grams were vaccinated with 0.1 ml of a polyvalent water-in-oil vaccine. The vaccine contained inactivated antigen from the following pathogens: Table 7: Vaccine components Components Amount Inactivated SAV3 2 x io TCID50 /ml Inactivated Aeromonas salmonicida 3 x iO cells/mi Inactivated Vibrio salmon/c/cIa 3 x io cells/mi Inactivated Vibrio anguilfarum 01 3 x io cells/mi Inactivated Vibrio anguillarum 02 3 x 108 cells/mi Inactivated Nor/tel/a viscosa 3 x io cells/mi Inactivated IPN virus 3 x io PFU/ml Paraffin light liquid Polysorbate -Sorbitan oleate All components were inactivated by addition of 2.0 g/kg formaldehyde and subsequent incubation for 72 hours at a temperature of 15 °C.
Table 8: Tagging and vaccination Group Vaccine Content Number of fish Tagging Control fish PBS PBS 100 unmarked vaccinated fish Polyvalent 4.28 x io 100 left maxillae 4.28 x 1O TCID50 /ml SAV3 TCID0/ml After smoltification, the fish were distributed in two tanks containing seawater (25%o) and challenged by injection of 2nd passage, freshly prepared ALV-407. The challenge dose was 5.36 x 108 TCID50 per fish. In the challenge tanks, mortality reached 86% in the control group in tank 1 and 66% in tank 2, whereas no mortality was recorded in the groups vaccinated with the polyvalent vaccine protecting against salmonid pancreas disease. Results are shown in figure 3. This experiment shows that a polyvalent vaccine can indeed protect against salmonid pancreas disease.
Example 7: Dosis/response -vaccination with monovalent and polyva lent SAV3 vaccine.
The present example presents a dose-response experiment with monovalent and multivalent pancreas disease vaccine.
Table 9: Outline of experiment Task Activity Environmental txpeñmentth parameters week Acclimatisation 12h/12h light, fresh water, 0 of fish flow 0.8 litre/kg biomass Start of Vaccination 1 experiment and marking Smoltification Start of 24 hour light, fresh water, 1-4 smoltification 12°C, flow 0.8 litre/kg biomass Smoltification Smoltification 24 hour light, Fresh water 4-6 15°C, flow 0.8 litre/kg biomass Transfer to sea Transfer of the 12h/12h light, 2S%o sea 6 water fish to water, flow 0.8 litre/kg seawater biomass (25%c sea water).
Challenge The SAy 12h/12h light, 25%o sea 6 challenge is water, flow 0.8 litre/kg performed the biomass day after transfer to sea water by i.p.
injection.
Disease Dead and 12h/12h light, 25%o sea 6-11 development moribound fish water, flow 0.8 litre/kg are recorded biomass and removed daily Termination of 11 the experiment Atlantic salmon parr with an average weight of 25.7 grams were vaccinated with 0.1 ml of a polyvalent water-in-oil vaccine. The vaccine contained inactivated antigen from the following pathogens: Table 10: Vaccine components, multivalent vaccines.
Components Amount Vaccine Vaccine Vaccine Vaccine
A B C D
Inactivated SAV3 2 x 10' 1 x io 2 x io 4 x i0 TCID50 /mi TCID50 /mi TCID5 /mi TCID50 /mi Inactivated Aeromanas salmon/c/cIa 3 x io cells/mi Inactivated V/br/a salmonic/da 3 x 10 cells/mi Inactivated V/br/a anguil/arum 01 3 x io cells/mi Inactivated V/br/a anguil/arum 02 3 x 108 cells/mi Inactivated Mor/te/la v/scosa 3 x iO cells/mi Inactivated IPN virus 3 x iO PFU/ml Paraffin light liquid Polysorbate -Sorbitan oleate Table 11: Vaccine components, monovalent vaccines.
Components Amount Inactivated SAV3 Vaccine Vaccine Vaccine Vaccine
E F G H
2x107 1x109 2x109 4x109 TcID50/mi Tc1050/mi TcID50/mi TCID50 /mi Paraffin light liquid Polysorbate -Sorbitan oleate All components were inactivated by addition of 2.0 g/kg formaldehyde and subsequent incubation for 72 hours at a temperature of 15 °C.
Tagging and vaccination For each group, 40 fish were tagged by fin clipping and vaccinated with 0.05 ml vaccine or 0.05 ml PBS and left for immunisation and smoltification. After smoltification, the fish were distributed in two tanks containing seawater (25%o) and challenged by injection of 2nd passage, freshly prepared ALV-407. The challenge dose was 6,5 x 108 TCID50 per fish.
Results:
Table 12:
Polyvalent Control A B C D (PBS) PD-1 1 (PD= 2x10' -x 0 TCID50 /mI) TCID50 /mI) Mortality 72.5% 26.3% 7.7% Relative % 63.7 96.5 89.4 96.6 survival Monovalent Control E F G H (PBS) (PD= 2 10' (PD= 1 x io (PD= 2 x io9 (PD= 4 x l0 TCID50 /mI) TCID50 /mI) TCJD50 /mI) TCID /mI) Mortality 50 43.6% 12.801o 4.9% 5.O% Relative % 12.8 74.4 90.2 90.0 survival In the challenge, the polyvalent vaccine gave better protection than the monovalent vaccine at the lowest antigen doses. This experiment shows that a polyvalent vaccine with a PD antigen content of 1 x io TcJD /mI, when given in doses of 0.5 x 108 TCID50 /dose can effectively protect against salmonid pancreas disease. Since the vaccine provides some protection against subsequent infection even when given in doses of 106 TCID50, it is reasonable to conclude that a reasonable level of protection can also be provided when the vaccine is administered is doses containing somewhat less than 0.5 x 108 TCID50 /dose.
Example 8: Vaccination of salmon parr using a polyvalent vaccine comprising SAV1 The present example presents a multivalent pancreas disease vaccine containing SAV1 antigenic material. The vaccine shows good protection in an experimental challenge model with high mortality in the unvaccinated control group.
An isolate of saimonid alphavirus subtype 1 is isolated from outbreaks of pancreatic disease in Atlantic salmon in Scotiand.SAV1 antigenic material is prepared from a culture of this virus, grown on CHSE cells according to a similar procedure as described in the preceding examples.
A vaccine containing the following components is prepared: Table 13: Vaccine components Components Amount Inactivated SAV1 2 x io TCID50 /ml Inactivated Aeromonas 3 x io cells/mi sa/monicida Inactivated V/br/a salmonicida 3 x io cells/mi Inactivated Vibr/o anguillarurn 01 3 x io cells/mi Inactivated V/br/a anguillarum 02 3 x 108 cells/mi Inactivated Mar/tel/a viscosa 3 x io cells/mi Inactivated IPN virus 3 x io PFU/mi Paraffin light liquid Poiysorbate -Sorbitan oleate The SAV1 virus was inactivated by addition of 2.0 g/kg formaldehyde and subsequent incubation for 72 hours at a temperature of 15 °C.
The vaccine is administered to Atlantic salmon parr. The fish is vaccinated and tagged, and vaccinated fish and control fish are subsequently smoitified as described in the preceding example.
After smoltification, the fish are distributed in tanks containing seawater (25%o) and challenged by injection of 2 passage, freshly prepared SAV3. The challenge dose is3-6 x 108 TCID50 per fish. This experiment shows that a polyvalent vaccine comprising salmonid aiphavirus typel antigenic material can indeed protect against saimonid pancreas disease SAV3.
Example 9: Vaccination of salmon parr using a vaccine comprising SAV1 The present example presents a multivalent pancreas disease vaccine containing SAV1 antigenic material. The vaccine shows good protection in an experimental challenge model with high mortality in the unvaccinated control group.
An isolate of salmonid alphavirus subtype 1 is isolated from outbreaks of pancreatic disease in Atlantic salmon in Scotland. SAV1 antigenic material was prepared from a culture of this virus, according to a similar procedure as described in the preceding examples.
A vaccine containing the following components was prepared: Table 14: Vaccine components Vaccine A: :.AiII%OtIflt Inactivated SAV1 2 x uj TCID50 /mi Inactivated Aeromonas 3 x 1O cells/mi sa/mon/cida Inactivated V/br/a salmonic/da 3 x io cells/mi Inactivated V/br/a anguillarum 01 3 X iO cells/mi Inactivated V/br/a anguil/arum 02 3 x 1D cells/mi Inactivated Mar/tel/a viscosa 3 X iü cells/mi Inactivated IPN virus 3 x io PFU/mi Paraffin light liquid Polysorbate -Sorbitan oleate Vaccine B and C: Components Vaccine content Vaccine B Vaccine C Inactivated SAV1 5 x 10 TCID50 /ml 1 x io TCID50 /ml Paraffin light liquid Polysorbate Sorbitan oleate The SAV1 virus was inactivated by addition of 2.0 g/kg formaldehyde and subsequent incubation for 72 hours at a temperature of 15 °C. Vaccines were formulated as water-in-oil emulsions using standard methods.
fish were tagged by fin clipping and vaccinated with 0.05 ml vaccine or 0.05 ml PBS and left for immunisation and smoltification as described in the preceding
example.
After smoltification, the fish were distributed in a tank containing seawater (25%o) and challenged by injection of 2t passage, freshly prepared SAVE. The challenge dose was 3.01 x 108 TCID50 per fish.
Table 15: Results.
Vaccine % mortality RPS (°/omortality vaccinated group/% mortality control group)* 100 PBS 70 Polyvalent A 3.3 95.2 Monovalent B 16.7 76.2 Monovalent C 6.1 87.9 Mortality in the control group reached 7O%, while mortality in the group vaccinated with a polyvalent vaccine comprising 2 x i09 TCID50 /ml inactivated SAV1 reached 3.3% giving a relative % survival of 95.2. This experiment shows that a polyvalent vaccine comprising salmonid alphavirus typel antigenic material can indeed protect against salmonid pancreas disease. In this experiment, the SAV1 antigen dose is doubled compared to the monovalent SAV1 vaccine C, and there is an increase in the RPS observed. This suggests that the same antigen dose can be used in polyvalent PD vaccines eliciting the same protection as monovalent PD vaccines. This is in contrast to the conventional wisdom in the
field of fish vaccinology.
Example 10: Vaccination of salmon parr using a polyvalent vaccine comprising SAV2 The present example presents a multivalent pancreas disease vaccine containing SAV2 antigenic material. The vaccine shows good protection in an experimental challenge model with high mortality in the unvaccinated control group.
An isolate of salmonid alphavirus subtype 2 is isolated from outbreaks of sleeping disease in rainbow trout reared in fresh water in France. SAV2 antigenic material is prepared from a culture of this virus, grown on CHSE cells according to a similar procedure as described in the preceding examples.
A vaccine containing the following components is prepared: Table 16: Vaccine components Components Amount Inactivated SAV2 2 x io TCID50 /mi Inactivated Aeromonas 3 x i0 cells/mi sa/monic/da Inactivated V/br/o salmon/c/cIa 3 x io cells/mi Inactivated V/br/a angu/ilarum 01 3 x iO cells/mi Inactivated V/br/a anguillarum 02 3 x 108 cells/mi Inactivated [br/tel/a v/scosa 3 x io cells/mi Inactivated IPN virus 3 x io PFLJ/mi Paraffin light liquid Polysorbate -Sorbitan oleate The SAV2 virus is inactivated by addition of 2.0 g/kg formaldehyde and subsequent incubation for 72 hours at a temperature of 15 °C.
The vaccine is administered to Atlantic salmon parr. The fish is vaccinated and tagged, and vaccinated fish and control fish are subsequently smoitified as described in the preceding example.
After smoltification, the fish are distributed in tanks containing seawater (25%o) and challenged by injection of 2 passage, freshly prepared SAV3. The challenge dose is 3-6 x 108 TCID50 per fish. This experiment shows that a polyvalent vaccine comprising saimonid aiphavirus type2 antigenic material can indeed protect against subsequent infection with saimonid aiphavirus SAV3.
Example 11: Vaccination of salmon parr using a polyvalent vaccine comprising SAV3 The present example presents a multivalent pancreas disease vaccine containing SAV3 antigenic material. The vaccine shows good protection in an experimental challenge model with high mortality in the unvaccinated control group.
An isolate of salmonid alphavirus subtype 3 is isolated from outbreaks of pancreatic disease in Atlantic salmon in Scotland. SAV3 antigenic material is prepared from a culture of this virus, grown on CHSE cells according to a similar procedure as described in the preceding examples.
A vaccine containing the following components is prepared: Table 17: Vaccine components Components Amount Inactivated Aeromonas 3 x io cells/mi hydrophila Inactivated Flavobacter!um 3 x i0 cells/mi columnar/s Inactivated I-iaphnia sp 3 x io cells/mi Inactivated SAV3 2 x io TCID50 /ml Inactivated IPN virus 3 x io PFU/ml Paraffin light liquid Polysorbate -Sorbitan oleate The SAV3 virus was inactivated by addition of 2.0 g/kg formaldehyde and subsequent incubation for 72 hours at a temperature of 15 °C. Bacterial antigens were inactivated by addition of 4 g/kg formaldehyde and subsequent incubation for 1.5 hours at a temperature of 20 °C A water-in-oil emulsion is made according to standard methods.
The vaccine is administered to Atlantic salmon parr. The fish is vaccinated and tagged, and vaccinated fish and control fish are subsequently smoltified as described in the preceding example.
After smoltification, the fish are distributed in tanks containing seawater (25%o) and challenged by injection of 2nd passage, freshly prepared SAV3. The challenge dose is3-6 x 108 TCID50 per fish. This experiment shows that a polyvalent vaccine comprising salmonid alphavirus antigenic material and several bacterial antigens can indeed protect against salmonid pancreas disease.
Example 12: Vaccination of salmon parr using a polyvalent vaccine comprising SAV3 The present example presents a multivalent pancreas disease vaccine containing SAV3 antigenic material. The vaccine shows good protection in an experimental challenge model with high mortality in the unvaccinated control group.
An isolate of salmonid alphavirus subtype 3 is isolated from outbreaks of pancreatic disease in Atlantic salmon in Scotland. SAV3 antigenic material is prepared from a culture of this virus, grown on CHSE cells according to a similar procedure as described in the preceding examples.
A vaccine containing the following components is prepared: Table 18: Vaccine components Inactivated SAV3 2 x i0 TCID50 /ml Inactivated V/hi-jo ordali 3 x i0 cells/mi Inactivated Piscir/ckettsia 3 x iO cells/mi salmon/s Inactivated IPN virus 3 x i09 PFU/ml Paraffin light liquid Polysorbate -Sorbitan oleate The SAV3 virus was inactivated by addition of 2.0 g/kg formaldehyde and subsequent incubation for 72 hours at a temperature of 15 DC. Bacterial antigens were inactivated by addition of 4 g/kg formaldehyde and subsequent incubation for 1.5 hours at a temperature of 20 °C A water in oil emulsion is made according to standard methods.
The vaccine is administered to Atlantic salmon parr. The fish is vaccinated and tagged, and vaccinated fish and control fish are subsequently smoltified as described in the preceding example.
After smoltification, the fish are distributed in tanks containing seawater (25%o) and challenged by injection of 2nd passage, freshly prepared SAV3. The challenge dose is 3-6 x io TCID50 per fish. This experiment shows that a polyvalent vaccine comprising salmonid alphavirus antigenic material and several bacterial antigens can indeed protect against salmonid pancreas disease.
Example 13: Vaccination of salmon parr using a polyvalent vaccine comprising SAV3 The present example presents a multivalent pancreas disease vaccine containing SAV3 antigenic material. The vaccine shows good protection in an experimental challenge model with high mortality in the unvaccinated control group.
An isolate of salmonid alphavirus subtype 3 is isolated from outbreaks of pancreatic disease in Atlantic salmon in Scotland. SAV3 antigenic material is prepared from a culture of this virus, grown on CHSE cells according to a similar procedure as described in the preceding examples.
A vaccine containing the following components is prepared: Table 19: Vaccine components Components Amount Inactivated SAV3 2 x io TCID50 /mI Inactivated Aeromonas 3 x i0 cells/mi sa/mon/cida Inactivated V/br/a sa/monicida 3 X i0 cells/mi Inactivated Vibr/o angul/larurn 01 3 x iO° cells/mi Inactivated V/br/a angu/ilarurn 02 3 x 108 cells/mi Inactivated Mar/tel/a viscosa 3 x io cells/mi Inactivated IPN virus 3 x io PFU/mi Montanide ISA 736 B 70°/a v/v The SAV3 virus is inactivated by addition of 2.0 g/kg formaldehyde and subsequent incubation for 72 hours at a temperature of 15 °C. Bacterial antigens were inactivated by addition of 4 g/kg formaldehyde and subsequent incubation S for 1.5 hours at a temperature of 20°C A water-in-oil emulsion is made according to standard methods.
The vaccine is administered to Atlantic salmon parr. The fish is vaccinated and tagged, and vaccinated fish and control fish are subsequently smoitified as described in the preceding example.
After smoltification, the fish are distributed in tanks containing seawater (25%o) and challenged by injection of 2nd passage, freshly prepared SAV3. The challenge dose is 3-6 x 108 TCID50 per fish. This experiment shows that a polyvalent vaccine comprising saimonid aiphavirus antigenic material and Montanide ISA 7366 can indeed protect against saimonid pancreas disease.
Receipts for deposits of microorganisms: Health Protection Agency, Porton Down and European Collection of Cell Cultures This document certifies that Virus Salmon Alphavirus 3 ALV-405 Deposit Reference 07121201 has been accepted as a patent deposit, in accordance with The Budapest Treaty of 1977, with the European Collection of Cell Cultures on 12 December 2007 ECACC Patent Supervisor FLII!pean QojIeFJnn o Ijel Cultures, FIsu!th Protcutiuji Aflencv, Oenva Fnr Eriiurgenoy Preparedness end Pespunse [arEas Dovn. Gelishury WiLshire, 6P4 OdD, UK Tel: 44 ID) ififtO 512512 Fox. Ii (U] SBD D11215 Elan'': eescc@hpe.sre.uh. Web EEc: w,'an.eeses,erjik Health Protection Agency, Porton Down and European Collection of Cell Cultures This document certifies that Virus Salmon Alphavirus 3 ALV-407 Deposit Reference 07121202 has been accepted as a patent deposit, in accordance wEth The Budapest Treaty of 1977, with the European Collection of Cell Cultures on 12 December 2007 ECACC Patent Supervisor Eui'oica,i Ocitucion ot Cell Cultures, Heath Protecton Aermy, Centre For Frourgenov Preporedneos ard Response. Perton Down, Gakebory, Wiltshire, SP4 OJC. UK.
Tel: 44 (D} 198D B12512 Fax: 44(0] 1980 611315 Ernst: oco@hpo erule Wet Sire v.vwturactrguk Health Protection Agency, Porton Down and European Collection of Cell Cultures This document certifies that Virus Salmon alphavirus 3 ALV-409 Deposit Reference 07121203 has been accepted as a patent deposit, in accordance with The Budapest Treaty of 1977, with the European Collection of Cell Cultures on 12 December 2007 ECACC Patent Supervisor Euiopoon CoIIecturi of Cell Cultures, Heeltfi Pretp.stioji 1Oericy. Centre For Erneipsiucy Preparedness end Response, Penten Dosjn, Sulishury, Wiltshire, SP4 DIG UK.
Tel: 44 (01 1080 012512 Fee: 44 [U) 1UBO 611315 Ems eeu:e@hpe oro.uJn Web site inm.eeeee,uru.uk Health Protection Agency, Porton Down and European Collection of Cell Cultures This document certifies that Virus HEART & SKELETAL MUSCLE INFLAMMATION VIRUS (HSMI) Deposit Reference 04050401 has been accepted as a patent deposit, in accordance with The Budapest Treaty of 1977, with the European Collection of Cell Cultures on 04 May 2004 DrDHLe General Manager.
ECACC
Furopeen Colection of CSI Cultures, Health ProteotLon Agency. Porton Down Salishiry, 5P4 OdD UK.
Tel: 44(0) 1080 &121 F: 44 (ft 1980 611215 Email; scaochpa.org.ut Web Site: ecacc.oruk Health ProtectbnAency, Porton Down Euwpean CoUecaon of Cell Cultures 1tr:I:E::1t Gttj CardomyopaUv £yndrome virus (CMS: )?3R: J,),C.dUL fl4::taflt depost. n accordnc iith JheHa; Treaty of 1077.
wft tIle LTcro.c: C.ttIOfl <.)1 C& CLtUVS 1(V)? ECACG Paet Scv: Health Protection Agency, Porton Down and European Collection of Cell Cultures This document certifies that Bacteria ALl 0005 Deposit Reference 06050901 has been accepted as a patent deposit, in accordance with The Budapest Treaty of 1977, with the European Collection of Cell Cultures on 09 May2006 ((9 DrDHLewis General Manager
ECACC
European CollecLion of Cell Cultures, Health Protection Agency. Centre For Irilerycricy Prepcredneos and esponce, Porton Down, Salishuryi fltsbire. SF4 U,JB. UK.
Tel: QQ (03 1900 612512 Fax: 44 CD] 19U0C11315 En,efl ncecc@lnaa.uio.uk Vkb Bun: www.erurr..orcuk Health Protection Agency, Porton Down and European Collection of Cell Cultures This document certifies that Bacteria AL10007 Deposit Reference 06050902 has been accepted as a patent deposit, in accordance with The Budapest Treaty of 1977, with the European Collection of Cell Cultures on 09 May 2006 (p Dr D H Lewis General Manager
ECACC
:uropean Calleotioii uf Cell Ctiisree, Health Protection Agency, Centre hr Elnurgenoy Preparedreen and Reeponse, Porter Jovn, Sulisury, Wiltulere, 6P4 DUG. UK.
Tel: 44 (01 1980 612512 Fax: 44 0) 12511 Hi 1315 Email: eoece@hya.ere.,k Weh Silo eww.ern.crg.uk Health Protection Agency, Porton Down and European Collection of Cell Cultures This document certifies that Bacteria ALl 0008 Deposit Reference 06050903 has been accepted as a patent deposit, in accordance with The Budapest Treaty of 1977, with the European Collection of Cell Cultures on 09 May2006 (p Dr U H Lewis General Manager
ECACC
European Collecliun oF Cell Culeureu, Healch Protection Agency! Centre For Feicryciacy Preparedness and Response. Perten Down. Setsoury, Wiltshire. 5P4 WG, UK.
tel; 44 (0) 1980 012512 Fox; 44 ID) 1980 611315 Fmeil; er.nr.r@hpa.or,Jk Wh Site: vx;wecnccera,uF Health Protection Agency, Porton Down and European Collection of Cell Cultures THs document certifies that Bacteria Piscirickettsia saImons Deposit Reforenca 07032110 has been accepted as a patent deposit, in accordance with The Budapest Treaty of 1977, with the European Collection of Cell Cultures on 21 March2007 ECACC Patent Supervisor European Ucliection c Dell Cultures, health Protection Agencp, Centre Fe' Emergency PrnpBrsnP.nn Ad Ikupunne, Porter Doin En isbury, Wiltshire, 9P4 UJE, UK.
Tel: 44(0) 1080 612512 rux: 44 (0) 1900 611315 Ems I: ecnec@hpe.org.uh unh np.: muwu.ncncnrq.uh References Aguilar JC and Rodriguez EG (2007), Vaccine adjuvants revisited, Vaccine 2007, 25, 3752 -3762, 2007.
Alderborn G and Aulton M (2002) Pharmaceutics; The Science of Dosage Form Design, 2002, Elsevier Science Castric J, baudin Laurencin F, Bremont M, jeffroy J, Le yen A and Bearzotti NI (1997) Bulletin of the European Association of Fish Pathologists 17, 27-30, 1997.
Boucher P and Baudin Laurencin F (1994) Sleeping disease (SD) of salmonids, Bull of the European Association of Fish Pathologists, 14, 179-180 Gastric J, baudin Laurencin F, Bremont M, jeffroy J, Le yen A and Bearzotti M (1997) Bulletin of the European Association of Fish Pathologists 17, 27-30, 1997.
Christie KE, Koumans JTM, Fyrand K, Goovaerts D and Rødseth OM (1999A) Vaccination against pancreas disease in Atlantic salmon (Salmo salar L). IXth International Conference of the European Association of Fish Pathologists, Rohdes, September 1999, oral presentation with abstract Christie KE, Fyrand K and Rødseth OM (1999B) Vaksine mot pancreas disease hos laks og ørret, meeting Frisk Fisk, Tromsø January 1999, oral presentation with a bstra ct.
Hodneland K, Bratland A, Christie KE, Endresen C, Nylund A. (2005), New subtype of salmonid alphavirus (SAy), Togaviridae, from Atlantic salmon Sa/mo salar and rainbow trout Oncorhynchus mykiss in Norway, Dis Aquat Organ. 2005 Sep 5;66(2):113-20, Erratum in: Dis Aquat Organ. 2005 Nov 9;67(1-2):181.
Intervet Newsletter, March 2002.
LOpez-DOripa MV, Smail DA, Smith RJ, Doménech A. Gastric J, Smith PD. Ellis AE.
Isolation of salmon pancreas disease virus (SPDV) in cell culture and its ability to protect against infection by the wild-type' agent. Fish Shellfish Immunol. 2001 Aug; 11(6): 505-22.
McLoughlin MF and Graham DA (2007), Alphavirus infections in salmonids -a review, Journal of Fish Diseases 2007, 30, 511-531.
Nelson RT, McLaughlin MF, Rowley HM, Platten MA and McCormick JI (1995) Isolation of a toga-like virus from Atlantic salmon Salmo salar with pancreas disease (1995) Diseases of Aquatic Organisms, 22, 25-32, 1995.
Powers AM, Brault AC, Shirako Y, Strauss EG, kang W, Strauss JH and Weaver SC (2001) Evolutionary relationships and systematics of the alphaviruses, Virology 75, 10118-10131 2001.
Raa J (1996), Reviews in Fisheries Science 4(3):229-228 1996.
Rognes T ( 2001), ParAlign: a parallel sequence alignment algorithm for rapid and sensitive database searches, Nucleic Acids Research, 29, 1647-1652 2001.
Smith TF and Waterman MS (1981) Identification of common molecular sub-sequences.Journal of Molecular Biology, 147, 195-197.
Taksdal T, Olsen, A B, Bjerks I, Hjortaas M J, Dannevig B H, Graham D A, McLoughlin M F (2007), Pancreas disease in farmed Atlantic salmon, Sa/mo salar L., and rainbow trout, Oncorhynchus mykiss (Wa/baum), in Norway, Journal of Fish Disease 2007, 30, 545-558.
Watson JD, Hopkins NH, Roberts JW, Steitz JA, Weiner AM (1987) Molecular biology of the gene, Chapter 24 The extraordinary diversity of eucaryotic viruses (898-961) Rodger, H & Mitchell, S. Pancreas disease in Ireland: Epidemiological survey results for2003 and 2004 in Ruane N, Rodger H, Graham D, Foyle L, Norris A, Ratcliff J, Murphy K, Mitchell 5, Staples C, Jewherst H, Todd D, Geoghegan F and Cinneide MO: Marine Environment and health service No 22 2005 Research on Pancreas disease in Irish farmed Salmon 2004/2005 -Current and Future in initiatives. 2005.
André, F F: Development and clinical application of new polyvalent combined paediatric vaccines, Vaccine 17(1999), 1620-1627 O,Meara et al.: Recombinant vaccines against ovine footrot, Immunology and Cell Biology (1993) 71, 473-488.
Elena, SF and Sanjuán, R et al. Adaptive Value of High Mutation Rates of RNA viruses: Separating Causes from Consequences (2005), Journal of Virology, 79, 11555-11558.
Domingo, E and Holland, JJ et al. RNA virus mutations and fitness for survival (1997), Annu. Rev. Microbiol., 51, 151-78.
Watson JD, Hopkins NH, Roberts JW, Steitz JA, Weiner AM (1987), Molecular biology of the gene, Chapter 24 The extraordinary diversity of eucaryotic viruses (898-961) 1. A composition comprising inactivated salmonid aiphavirus (SAV) at a titre of at least 7.5x108 TCID50/ml and one or more components selected from the group consisting of: a) a killed/inactivated bacterium, b) an inactivated virus other than a salmonid alphavirus, c) a fungus, d) a parasite; and e) an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d).
2. The composition according to claim 1, said composition comprising inactivated salmonid alphavirus (SAV) at a titre of 7.5x108 -1x101° TC ID 50/ ml.
3. The composition according to claim 1, wherein said inactivated salmonid alphavirus is of the SAV1, SAV2, SAV3, SAV4, SAV5 or SAV6 subtype, or is a combination thereof.
4. The composition according to claim 1 or 2 wherein said salmonid alphavirus is selected from the group consisting of: i) the virus strains deposited under the Budapest Treaty at the ECACC under deposit number V94090731 and with the European Collection of Cell culture (ECACC), Health Protection Agency, Porton Downy Salisbury, Wiltshire (UK), SP4 OJG UK on December 12 2007 under Deposit numbers 07121201, 07121202 and 07121203, and ii) a strain with genotypic and/or phenotypic characteristics related to those of any of the deposited virus strains in i), such as a strain which is a mutant of any one of the strains in i).
5. The composition according to any of the preceding claims, wherein said salmonid aiphavirus comprises a nucleic acid sequence which is at least 95°k identical to the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO: 3 and/or at least 9801o identical to the sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5 and/or SEQ ID NO: 6.
6. The composition according to any of the preceding claims, wherein said salmonid alphavirus is inactivated using a procedure comprising addition of 1.5-2.5 g/kg, formaldehyde and subsequent incubation for 12-96 hours at a temperature from 13-17 °C: 7. The composition according to any of the preceding claims, wherein said inactivated bacterium has been inactivated using a procedure comprising addition of 3.5-4.5 g/kg formaldehyde and subsequent incubation for 1-2 hours at a temperature of 20°C; 8. The composition according to any of the preceding claims, said composition being a water-in-oil emulsion, a water-in-oil-in-water emulsion or an oil-in-water emulsion.
9. The composition according to claim 8, wherein the composition is a water-in-oil emulsion.
10.The composition according to claim 8 or 9, wherein the composition comprises a mineral oil.
11.The composition according to any of the preceding claims, further comprising a detergent and/or emulsifier.
12.The composition according to claim 11, wherein the emulsifier is an ester of non-PEG-ylated or PEG-ylated sorbitan with fatty acids.
13. The composition according to claim 12, wherein the emulsifier is polysorbate or sorbitan oleate.
14.The composition according to any of the preceding claims, wherein said killed/inactivated bacterium is selected from the group consisting of bacteria of the species Piscirickettsias spp., Aeromonas spp., Vibrio spp., Liston el/a spp., Monte/la viscosa, Photobactenium damsela, F/a voba ctenium spp., Yersinia spp., Ref/bacterium spp., Streptococcus spp., Lactococcus spp., Leuconostoc spp., Bifidobacterium spp., Pediococcus spp., Brevibacterium sp p., Edvvars/eI/a sp p., Franc/se/la sp p., Pseudomonas spp., Cytophaga spp., Nocardia spp., Haphnia spp. and Mycobacerium spp.
15.The composition according to any of the preceding claims, wherein said killed/inactivated bacterium is selected from the group consisting of Aeromonas spp., Vibnio spp., F/a vobactenium spp., Haphnia spp., P/scirickettsia s pp. and Monte/la viscosa.
16.The composition according to any of the preceding claims, wherein said killed/inactivated bacterium is selected from the group consisting of Aenomonas hydrophila, Aeromonas salmonicida, Vibrio salmonicida, V/bnio anguillarum, Vibnio ordali, Flavobactenium columnar/s7 Haphnia sp., Piscirickettsia salmon/s and Mon/tel/a viscosa.
17.The composition according to any of the preceding claims, wherein said killed or inactivated bacterium is of one or more species selected from the group consisting of A. sa/monic/da, V. sa/monic/da, V. angui/lanum and N. v/scosa.
18.The composition according to any of the preceding claims, wherein said killed or inactivated bacterium is V/br/n ordali and/or Piscirickettsia salmon/s.
19.The composition according to any of the preceding claims, wherein said killed or inactivated bacterium is of one or more species selected from the group consisting of Aeromonas hydrophila, Flavobactenium columnar/s and Haphn/a sp.
20.The composition according to any of the preceding claims, wherein said virus other than Salmonid Alphavirus is selected from the group consisting of: infectious pancreatic necrosis virus (IPNV), Viral Hemorrhagic Septicemia Virus (VHSV); Viral Hemorrhagic Septicemia Virus (VHSV); Infectious Hematopoietic Necrosis virus (IHNV); Pancreatic Necrosis Virus; Spring Viremia of Carp (SVC); Channel Catfish Virus (CCV); Infectious Salmon Anaemia (ISA) virus; nodavirus; iridovirus; koi herpes virus; Heart and Skeletal Muscle Inflammation Virus (HSMV) and Cardiomyopathy Syndrome Virus (CMS).
21. The composition according to any of the preceding claims, wherein said virus other than salmonid alphavirus is infectious pancreatic necrosis virus (IPNV).
22. The composition according to any of the preceding claims, wherein said fungus is selected from the group consisting of: Saprolegnia Sp., Bi-anchiomyces sanguinis, Branchiomyces demigrans and Icthyophonus hoferi.
23.The composition according to any of the preceding claims, wherein said parasite is selected from the group consisting of: Lepeophtheirus spp., Ca/igus spp. and Ichthyophthirius spp.
24.The composition according to any of the preceding claims, said composition comprising two or more components as defined in any of claims 14-23.
25.The composition according to any of the preceding claims, wherein said killed or inactivated bacterium is present in amounts corresponding to 1 x 1o68 x lO9cells/ml., preferably in amounts corresponding to 0.9 -5 x109 cells/rn I. 2&.The composition according to any of the preceding claims, wherein said virus other than salmonid alphavirus is present in amounts corresponding to 1.0 -5 x109 PFU/rnl or 2-8 antigenicity units (AU)/ml when infectious pancreatic necrosis virus (IPNV).
27.The composition according to any of the preceding claims, said composition comprising: i) inactivated Salmonid Alphavirus subtype SAV3 in an amount corresponding to 7.5x108 -5x109 TCID50/ml, U) inactivated Aeromonas salmonicida in an amount corresponding to 0.2 -xl 0 9ce lls/ ml, UI) inactivated V/hi-jo. salmonicida in an amount corresponding to 0.9 - 5xlO9cells/ml, iv) inactivated Vibrio anguillarum in an amount corresponding to 0.9 - 5xlO9cells/ml, v) inactivated Moritella viscosa in an amount corresponding to 0.5 - 5xlO9cells/ml, vi) inactivated infectious pancreatic necrosis virus (IPNV) in an amount corresponding to 1.0-5.0x109 PFU/ml live virus or 2-8 antigenicity units (A U)/ ml, vii) an adjuvant, preferably mineral oil; and viii) a detergent and/or emulsifier.
28.The composition according to any of the preceding claims, said composition comprising: i) inactivated Salmonid Alphavirus subtype SAV3 in an amount corresponding to 7.5x108 -5x109 TCID50/ml, ii) inactivated Vibrio ordali in an amount corresponding to 0.9 -SxlOkells/ml, UI) inactivated Piscirickettsia salmon/s in an amount corresponding to 0.9 -xl 0 9ce II s/ ml, iv) inactivated infectious pancreatic necrosis virus (IPNV) in an amount corresponding to l.0-5.0x109 PFU/ml live virus or 2-8 antigenicity units (AU)/ml.
v) an adjuvant, preferably mineral oil; and vi) a detergent and/or emulsifier.
29.The composition according to any of the preceding claims, said composition comprising: I) inactivated Salmonid Alphavirus subtype SAV3 in an amount corresponding to 7.5x108 -5x109 TCID50/ml, U) inactivated Aeromonas hydrophila in an amount corresponding to 0.9 -SxlO9cells/ml, UI) inactivated F/a vobacterium columnar/s in an amount corresponding to 0.9 -5xlO9cells/ml, iv) inactivated Haphnia sp. in an amount corresponding to 0.9 - 5xlO9cells/ml, v) inactivated infectious pancreatic necrosis virus (IPNV) in an amount corresponding to 1.0-5.0x109 PFU/ml or 2-8 antigenicity units (AU)/ml, vi) an adjuvant, preferably mineral oil; and vii) a detergent and/or emulsifier.
30.A dosage form of a composition according to any of the preceding claims.
31.The dosage form according to claim 30, said dosage form being a liquid dosage form.
32.The dosage form according to any of claims 30 and 31 having a volume of 0.05-0.2 ml, preferably 45-55 R1* 33.An inactivated salmonid alphavirus (SAV) for use as a vaccine or an immunological composition, wherein said vaccine or immunological composition is compatible with other immunological products and comprises inactivated salmonid alphavirus in an amount corresponding to at least 7.5x108 TCID50/ml.
34.An inactivated salmonid alphavirus (SAV) for use as a vaccine or an immunological composition for administration simultaneously or in combination with one or more antigenic components selected from the group consisting of: a) a killed bacterium, b) an inactivated virus other than a salmonid alphavirus, c) a fungus, d) a parasite; and e) an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d); wherein said vaccine/immunological composition contains inactivated salmonid alphavirus in an amount corresponding to at least 7.5x108 TCID50/ml 35.An inactivated salmonid aiphavirus (SAV) for use as a dosage form for administration simultaneously or in combination with one or more antigenic components selected from the group consisting of: a) a killed bacterium, b) a inactivated virus other than a salmonid alphavirus, c) a fungus, d) a parasite; and e) an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d); wherein said dosage form contains inactivated salmonid aiphavirus in an amount corresponding to at least 3.75x107 TCID50.
36.A method of manufacturing a composition as defined in any of claims 1-29 or a dosage form as defined in any of claims 30-32, said method comprising combining inactivated salmonid alphavirus with one or more antigenic components selected from the group consisting of: a) a killed bacterium, b) a inactivated virus other than a salmonid alphavirus, c) a fungus, d) a parasite; and e) an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d); to provide a composition comprising at least 7.5x108 TCID50/ml inactivated salmonid alphavirus.
37.The method according to claim 36, said method further comprising the steps of: i) establishing a culture of host cells; H) infecting said host cells with an isolate of a virus of the Salmonid Alphavirus, and Hi) culturing the infected cells under conditions allowing said virus to reach, in the supernatant/growth medium, a titre of at least 7.5x108 TC ID so/mI.
38.A composition as claimed in any of claims 1-29, a dosage form as claimed in claim 30 or 31, or an inactivated virus as claimed in any of claims 33-35, for use as a vaccine and/or for treating, preventing or controlling salmonid aiphavirus infection, pancreatic disease, sleeping disease, or pancreatic disease and one or more other infectious disease, in fish.
39. Use of an inactivated salmonid alphavirus (SAV) in the manufacture of a vaccine or an immunological composition which is compatible with other immunological products, wherein said vaccine comprises inactivated salmonid alphavirus in an amount corresponding to at least 7.5x108 TC ID o/ ml.
40.Use of an inactivated salmonid alphavirus (SAV) in the manufacture of a vaccine or an immunological composition for administration simultaneously or in combination with one or more antigenic components selected from the group consisting of: a) a killed bacterium, b) an inactivated virus other than a salmonid alphavirus, c) a fungus, d) a parasite; and e) an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d); wherein said vaccine/immunological composition contains inactivated salmonid alphavirus in an amount corresponding to at least 7.5x108 TCID50/ml 41. Use of an inactivated salmonid alphavirus (SAV) in the manufacture of a dosage form for administration simultaneously or in combination with one or more antigenic components selected from the group consisting of: a) a killed bacterium, b) a inactivated virus other than a salmonid aiphavirus, c) a fungus, d) a parasite; and e) an antigenic and/or immunogenic material derived from said bacterium in a), from said virus in b), from said fungus in c) or from said parasite in d); wherein said dosage form contains inactivated salmonid aiphavirus in an amount corresponding to at least 3.75x107 TCID50.
42. Use of a composition as claimed in any of claims 1-29, a dosage form as claimed in claim 30 or 31, or an inactivated virus as claimed in any of claims 33-35, for the manufacture of a medicament for use as a vaccine and/or for treating, preventing or controlling salmonid alphavirus infection, pancreatic disease, sleeping disease or pancreatic disease and one or more other infectious disease, in fish.
43.A composition, dosage form, inactivated salmonid alphavirus (SAy), or method of manufacturing a composition or dosage form substantially as described in the examples herein before set out.

Claims (22)

  1. <claim-text>Claims 1. An inactivated salmonid alphavirus (SAV) for use as a vaccine for preventing or reducing the incidence of fish pancreatic disease, wherein said vaccine is compatible with other immunological products and comprises inactivated salmonid alphavirus in an amount corresponding to at least 3,75x107 TCID50/dose, determined by titration on CHH cells.</claim-text> <claim-text>2. The inactivated salmonid alphavirus for use according to claim 1, wherein said inactivated salmonid alphavirus is of the SAV1, SAV2, SAV3, SAV4, SJAVS or SAV6 subtype, or is a combination thereof.</claim-text> <claim-text>3. The inactivated salmonid alphavirus for use according to claim 1 or 2, wherein said inactivated salmonid alphavirus is of the SAVB subtype, 4. The inactivated salmonid alphavirus for use according to any of the preceding claims, wherein said salmonid alphavirus is selected from the group consisting of: a. the virus strains deposited under the Budapest Treaty at the ECACC under deposit number V94090731 and with the European Collection of Cell culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), SP4 OJG UK on December 12 2007 under Deposit numbers 07121201 and 07121202, and b. a strain which is a mutant of any one of the strains in i). wherein the virus is positive in a SAV reverse transcriptase quantitative PCR-identity test using a primer set corresponding to the primers set forth in SEQ ID NO: 7 and 8 and the concitions 50 °C, 30 mm -95°C, 10 mm -(95 °C, 30 sec -57°c, 60 sec -72°C,30 sec)*40.5. The inactivated salmonid alphavirus for use according to any of the preceding claims, wherein said salmonid alphavirus comprises a nucleic acid sequence which is at least 95% identical to the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO: 3 and/or at least 98% identical to the sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5 and/or SEQ ID NO: 6.6. The inactivated salmonid alphavirus for use according to any of the preceding claims, wherein said salmonid alphavirus has been inactivated by addition of formaldehyde.7. The inactivated salmonid alphavirus for use according to any of the preceding claims, wherein said salmonid alphavirus is inactivated using a procedure comprising addition of 1.5-2.5 g/kg, formaldehyde and subsequent incubation for 12-96 hours at a temperature from 13-17 °C: 8. The inactivated salmonid aiphavirus for use according to any of the preceding claims, wherein each dose has a volume of 25-200 p1.9. The inactivated salmonid aiphavirus for use according to any of the preceding claims, wherein each dose has a volume of 90-110 p1.10. The inactivated salmonid alphavirus for use according to any of the preceding claims, wherein each dose has a volume of 45-55 jtl.11. The inactivated salmonid alphavirus for use according to any of the preceding claims, wherein each dose has a volume of 50 p1.12. Pancreatic disease virus vaccine component comprising salmonid alphavirus, wherein said salmonid alphavirus is selected from the group consisting of a. the virus strains deposited under the Budapest Treaty at the ECACC under deposit number V94090731 and with the European Collection of Cell culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), 5P4 OJG UK on December 12 2007 under Deposit numbers 07121201 and 07121202, and b. a strain which is a mutant of any one of the strains in i). wherein the virus is positive in a SAV reverse transcriptase quantitative PCR-identity test using a primer set corresponding to the primers set forth in SEQ ID NO: 7 and Sand the concitions 50°C, 30 mm -95°C, 10 mm -(95°C, sec -57 DC, 60 sec -72 °C,30 sec)t40.13. Virus vaccine component according to claim 12, wherein said salmonid alphavirus has been inactivated by addition of formaldehyde.14. Virus vaccine component according to claim 12 or 13, wherein said salmonid alphavirus wherein said salmonid alphavirus is inactivated using a procedure comprising addition of 1.5-2.5 g/kg, formaldehyde and subsequent incubation for 12- 96 hours at a temperature from 13-17 °C: 15. An isolated salmonid alphavirus of the subtype SAV3, said salmonid alphavirus being selected from the group consisting of a. the virus strains deposited under the Budapest Treaty at the ECACC under deposit number V94090731 and with the European Collection of Cell culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), 5P4 DiG UK on December 12 2007 under Deposit numbers 07121201 and 07121202, and b. a strain or isolate with phenotypic characteristics, which are related or similar to those of any of the deposited strains in a), wherein the virus has a visible cytopathogenic effect during early passage in cell culture, and wherein the virus is capable of inducing mortahty of at least 25% in a laboratory challenge model, said model comprising smoltifying Atlantic salmon according to standard methods and challenge the post-smolts by intraperitoneal injection with a SAV3 dose of at least 108TC1D50 per fish, such as at least 109TC1D50, at least 1010TC1D50 or preferably at least 3.5 x io TCID5O per fish, within one day after transfer to seawater at 12°C.16. An isolated virus according to claim 15, wherein said virus has a visible cytopathogenic effect during early passage in cell culture, such as during the first, second, third or fourth passage on a culture of CHSE cells 17. An isolated virus according to claim 15 or 16, wherein the virus has the ability of growing to a titre, in the supernatant/growth medium, of at least 1x108 TCID50/ml when cultured using host cells which are selected from the group consisting of CHH-1 cells and CHSE-214 cells.18. An isolated virus according to claim 17, wherein said titre of at least 1x108 TCID50/ml is obtained when: a. Cells are cultured using host cells which have been seeded at a density of 0.1-1x105 cells cm2; b. The host cells are cultured for 4-6 days prior to virus infection; c. The host cells are grown to a density of from 0.1-1.0 x106 cells cm2 at the time of infection with said virus isolate; ci. The host cells are cultured in a growth medium comprising EMEM (EBSS)+ lO% Fetal Bovine Serum (FBS) + 2mM L-Glutamine + l%i Non Essential Amino Acids (NEAA) + 0.1°/a gentamicine; and e. The infected cells are cultured at a temperature of 15°C, for a period of 10-14 days.19. An isolated virus according to any of claims 15 -18, wherein said virus comprises a nucleic acid sequence which is at least 95% identical to the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO: 3.20. An isolated virus according to any of claims 15 -19, wherein said virus comprises a nucleic acid sequence which is at least 98% identical to the sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5 and/or SEQ ID NO: 6.21. An isolated virus according to any of claims 15 -20, wherein the virus is a mutant of any one of the strains in claim 15 a), wherein the virus is positive in a SAV reverse transcriptase quantitative PCR-identity test using a primer set corresponding to the primers set forth in SEQ ID NO: 7 and 8 and the concitions 50 °C, 30 mm -95 °C, 10 mm -(95 °C, 30 sec -57°C, 60 sec -72 °C,30 sec)*40.22. An isolated virus according to any of claims 15 -21, wherein said virus is a genetic variant of any one of the virus strains deposited under the Budapest Treaty at the ECACC under deposit number V94090731 and with the European Collection of Cell culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), 5P4 OJG UK on December 12 2007 under Deposit numbers 07121201 and 07121202, and Amendments to the claims have been filed as follows.Claims 1. An inactivated salmonid alphavirus (SAV) for use as a vaccine for preventing or reducing the incidence of fish pancreatic disease, wherein said vaccine is compatible with other immunological products and comprises inactivated salmonid alphavirus in an amount corresponding to at least 1x109 -2.5x101° TCID50/ml, determined by titration on CHH cells.
  2. 2. The inactivated salmonid alphavirus for use according to claim 1, wherein said inactivated salmonid alphavirus is of the SAV1, SAV2, SAV3, SAV4, SJAVS or SAV6 subtype, or is a combination thereof.
  3. 3. The inactivated salmonid alphavirus for use according to claim 1 or 2, wherein said inactivated salmonid alphavirus is of the SAVB subtype,
  4. 4. The inactivated salmonid alphavirus for use according to any of the preceding claims, wherein said salmonid alphavirus is selected from the group consisting of: (Y) a. the virus strains deposited under the Budapest Treaty at the ECACC under deposit number V94090731 and with the European Collection of Cell culture (ECACC), Health Protection Agency, Porton Down, Salisbury, o Wiltshire (UK), SP4 OJG UK on December 12 2007 under Deposit numbers 07121201 and 07121202, and 0 b. a strain which is a mutant of any one of the strains in i). wherein the virus is positive in a SAV reverse transcriptase quantitative PCR-identity test using a primer set corresponding to the primers set forth in SEQ ID NO: 7 and 8 and the concitions 50 °C, 30 mm -95°C, 10 mm -(95 °C, 30 sec -57°c, 60 sec -72°C,30 sec)*40.
  5. 5. The inactivated salmonid alphavirus for use according to any of the preceding claims, wherein said salmonid alphavirus comprises a nucleic acid sequence which is at least 95% identical to the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO: 3 and/or at least 98% identical to the sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5 and/or SEQ ID NO: 6.
  6. 6. The inactivated salmonid alphavirus for use according to any of the preceding claims, wherein said salmonid alphavirus has been inactivated by addition of formaldehyde.
  7. 7. The inactivated salmonid alphavirus for use according to any of the preceding claims, wherein said salmonid alphavirus is inactivated using a procedure comprising addition of 1.5-2.5 g/kg, formaldehyde and subsequent incubation for 12-96 hours at a temperature from 13-17 °C:
  8. 8. The inactivated salmonid aiphavirus for use according to any of the preceding claims, wherein each dose has a volume of 90-110 p1.
  9. 9. The inactivated salmonid aiphavirus for use according to any of claims 1-7, wherein each dose has a volume of 45-55 ill.
  10. 10. The inactivated salmonid alphavirus for use according to claim 9, wherein each dose has a volume of 50 p1.
  11. 11. Pancreatic disease virus vaccine component comprising inactivated salmonid alphavirus, wherein said salmonid alphavirus is selected from the group consisting of a. the virus strains deposited under the Budapest Treaty at the ECACC under deposit number V94090731 and with the European Collection of Cell culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), 5P4 OJG UK on December 12 2007 under C?) Deposit numbers 07121201 and 07121202, and b. a strain which is a mutant of any one of the strains in a). and which o prior to inactivation has a visible cytopathogenic effect during early C.,, passage in cell culture, and wherein the virus is capable of inducing o mortality of at least 25% in a laboratory challenge model, said model comprising smoltifying Atlantic salmon according to standard methods and challenging the post-smolts by intraperitoneal injection with a SAV3 dose of at least 108TC1D50 per fish, within one day after transfer to seawater at 12°C.
  12. 12. Virus vaccine component according to claim 11, wherein said salmonid alphavirus has been inactivated by addition of formaldehyde.
  13. 13. Virus vaccine component according to claim 11 or 12, wherein said salmonid aiphavirus is inactivated using a procedure comprising addition of 1.5-2.5 g/kg, formaldehyde and subsequent incubation for 12-96 hours at a temperature from 13-17 °C:
  14. 14. An isolated salmonid alphavirus of the subtype SAV3, said salmonid alphavirus being selected from the group consisting of a. the virus strains deposited under the Budapest Treaty at the ECACC under deposit number V94090731 and with the European Collection of Cell culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), 5P4 DiG UK on December 12 2007 under Deposit numbers 07121201 and 07121202, and b. a strain or isolate which is closely related to! is a mutant of, or is a variant of, any of the deposited virus strains in a), wherein the virus has a visible cytopathogenic effect during early passage in cell culture, and wherein the virus is capable of inducing mortahty of at least 25% in a laboratory challenge model, said model comprising smoltifying Atlantic salmon according to standard methods and challenging the post-smolts by intraperitoneal injection with a SAV3 dose of at least 108TC1D50 per fish, within one day after transfer to seawater at 12°C.
  15. 15. An isolated virus according to claim 14, wherein said virus has a visible cytopathogenic effect during the first! second, third or fourth passage on a culture of CHSE cells.(Y)
  16. 16. An isolated virus according to claim 14, wherein the virus is capable of inducing mortality of at least 25% in a laboratory challenge model, said model comprising smoltifying Atlantic salmon according to standard methods and challenge the post-o smolts by intraperitoneal injection with a SAV3 dose of at least 3.5 x io TCID50 per fish.O
  17. 17. An isolated virus according to any of claims 14-16, wherein the virus has the ability of growing to a titre, in the supernatant/growth medium, of at least 1x108 TCID50/ml when cultured using host cells which are selected from the group consisting of CHH-1 cells and CHSE-214 cells.
  18. 18. An isolated virus according to claim 17, wherein said titre of at least 1x108 TCID50/ml is obtained when: a. Cells are cultured using host cells which have been seeded at a density of 0.1-1x105 cells cm2; b. The host cells are cultured for 4-6 days prior to virus infection; c. The host cells are grown to a density of from 0.1-1.0 x106 cells cm2 at the time of infection with said virus isolate; d. The host cells are cultured in a growth medium comprising EMEM (EBSS)+ lO% Fetal Bovine Serum (FBS) + 2mM L-Glutamine + 1% Non Essential Amino Acids (NEAA) + 0.l°/a gentamicine; and e. The infected cells are cultured at a temperature of 15°C, for a period of 10-14 days.
  19. 19. An isolated virus according to any of claims 14-18, wherein said virus comprises a nucleic acid sequence which is at least 95% identical to the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO: 3.
  20. 20. An isolated virus according to any of claims 14-19, wherein said virus comprises a nucleic acid sequence which is at least 98% identical to the sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5 and/or SEQ ID NO: 6.
  21. 21. An isolated virus according to any of claims 14-20, wherein the virus is a mutant of any one of the strains in claim 15 a), wherein the virus is positive in a SAV reverse transcriptase quantitative PCR-identity test using a primer set corresponding to the primers set forth in SEQ ID NO: 7 and Band the concitions 50°C, 30 mm -95°C, 10 mm -(95°C, 30 sec -57°C, 60 sec -72°C,30 sec)*40.
  22. 22. An isolated virus according to any of claims 14-21, wherein said virus is a genetic (Y) variant of any one of the virus strains deposited under the Budapest Treaty at the ECACC under deposit number V94090731 and with the European Collection of Cell culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), O SP4 OJG UK on December 12 2007 under Deposit numbers 07121201 and 07121202. C)</claim-text>
GB1219654.9A 2008-02-08 2009-02-06 Salmonid alphavirus vaccine Active GB2493662B (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
NO20080711 2008-02-08
NO20080885 2008-02-20
NO20090290A NO333242B1 (en) 2008-02-08 2009-01-20 Composition, medical application and method comprising salmonid alphavirus

Publications (3)

Publication Number Publication Date
GB201219654D0 GB201219654D0 (en) 2012-12-12
GB2493662A true GB2493662A (en) 2013-02-13
GB2493662B GB2493662B (en) 2013-04-17

Family

ID=40469649

Family Applications (2)

Application Number Title Priority Date Filing Date
GB1219654.9A Active GB2493662B (en) 2008-02-08 2009-02-06 Salmonid alphavirus vaccine
GB0901913.4A Active GB2457158B (en) 2008-02-08 2009-02-06 Polyvalent vaccine against salmonid alphavirus infections

Family Applications After (1)

Application Number Title Priority Date Filing Date
GB0901913.4A Active GB2457158B (en) 2008-02-08 2009-02-06 Polyvalent vaccine against salmonid alphavirus infections

Country Status (4)

Country Link
CA (2) CA2653300C (en)
CL (1) CL2009000287A1 (en)
GB (2) GB2493662B (en)
NO (2) NO333242B1 (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2688587B2 (en) 2011-03-25 2023-08-16 Intervet International B.V. Salmonid alphavirus vaccine
US9303071B2 (en) 2012-09-17 2016-04-05 Novartis Tiergesundheit Ag Salmonid alphavirus and uses thereof
NO344938B1 (en) * 2018-12-13 2020-07-20 Patogen As Pancreas Disease Virus Markers
BE1028701B1 (en) * 2020-10-13 2022-05-16 Poulpharm Bvba METHOD FOR AUTOVACCINE PRODUCTION AND OBTAINED AUTOVACCINE
CN112877399B (en) * 2021-01-20 2023-05-16 中国水产科学研究院黑龙江水产研究所 Salmon and trout pathogenic bacteria drug sensitivity detection method, drug sensitivity detection kit and preparation method
CA3230802A1 (en) * 2021-08-31 2023-03-09 Zoetis Services Llc Attenuated alphavirus

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0712926A2 (en) * 1994-10-18 1996-05-22 Akzo Nobel N.V. Fish pancreatic disease virus
WO1999058639A2 (en) * 1998-05-08 1999-11-18 Akzo Nobel N.V. Structural proteins of fish pancreatic disease virus and uses thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003101482A2 (en) * 2002-05-31 2003-12-11 Genesis Group Inc. Liposome vaccine formulations for fin-fish
DK179025B1 (en) * 2005-09-16 2017-08-28 Intervet Int Bv fish vaccine
CL2007001893A1 (en) * 2006-06-29 2008-01-04 Pharmaq As Process to grow a bacterium of the genus piscirickettsia in a medium free of host cells; process to obtain said bacteria; vaccine comprising said bacteria; and food comprising said vaccine for the prevention of infections in fish with bacteria of the genus piscirickettsia.

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0712926A2 (en) * 1994-10-18 1996-05-22 Akzo Nobel N.V. Fish pancreatic disease virus
WO1999058639A2 (en) * 1998-05-08 1999-11-18 Akzo Nobel N.V. Structural proteins of fish pancreatic disease virus and uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Diseases of Aquatic Organisms (2005); Vol 66, pp 113-120, "New subtype of salmonid alphavirus...", Hodneland et al & NCBI Accession No AY604238.1 *
Fish & Shellfish Immunology (2001); Vol 11, pp 502-522, "Isolation of salmon pancreas disease virus...", Lopez-Doriga et al *

Also Published As

Publication number Publication date
CA3090088C (en) 2023-01-31
GB2493662B (en) 2013-04-17
GB2457158B (en) 2013-04-03
NO2015019I1 (en) 2015-08-10
CA2653300A1 (en) 2009-08-08
CL2009000287A1 (en) 2010-08-27
CA3090088A1 (en) 2009-08-08
GB0901913D0 (en) 2009-03-11
NO333242B1 (en) 2013-04-15
CA2653300C (en) 2020-11-17
GB201219654D0 (en) 2012-12-12
GB2457158A (en) 2009-08-12
NO20090290L (en) 2009-08-10

Similar Documents

Publication Publication Date Title
Urbano et al. African swine fever control and prevention: an update on vaccine development
Ikegami et al. Rift valley fever vaccines
CA3090088C (en) Polyvalent vaccine against salmonid alphavirus infections
Hsieh et al. DNA-mediated vaccination conferring protection against infectious bursal disease in broiler chickens in the presence of maternal antibody
Mikalsen et al. Protective effects of a DNA vaccine expressing the infectious salmon anemia virus hemagglutinin-esterase in Atlantic salmon
US20160122728A1 (en) Ipn vaccine
US20210269488A1 (en) Recombinant rotavirus expression system and recombinant rotaviruses
JP2011504367A (en) Method for producing virus strains for vaccines of reoviridae viruses
Naylor et al. Charged amino acids in the AMPV fusion protein have more influence on induced protection than deletion of the SH or G genes
CA2839941C (en) Recombinant low virulence bovine herpesvirus 1 (bohv-1) vaccine vectors
US10894081B2 (en) Recombinant bivalent inactivated vaccine against foot-and-mouth disease virus, preparation method and use thereof
KR100737434B1 (en) Mixed live vaccine of transmissible gastroenteritis virus, porcine epidemic diarrhea virus and porcine rotavirus, and the vaccination method using the same
NO346254B1 (en) Isolated salmonid alphavirus and its use
JP4664901B2 (en) Inactivated nodavirus vaccine
NO20130080L (en) Polyvalent vaccine against salmonid alphavirus infections
AU2014201189B2 (en) Method for producing vaccinal viral strain of a virus of the Reoviridae family
EP2640832B1 (en) New ethiological agent
US20050169939A1 (en) Chicken anemia virus vaccine from cell line
WO2024003035A1 (en) Vaccines for piscirickettsiosis (salmonid rickettsial septicaemia)
Sharma Development and Evaluation of Vaccine Candidates for Senecavirus A
Vázquez-Salgado et al. A Potential Nervous Necrosis Virus (NNV) Live Vaccine for Sole Obtained by Genomic Modification
WO2021123099A1 (en) Reassorted isa virus
US20190060442A1 (en) Reoviridae vaccine
JPH05503209A (en) Attenuated canine parvovirus vaccine containing canine parvovirus (CPV) and prevention of CPV infection in canines
AU2002332925A1 (en) Chicken anemia virus vaccine from cell line

Legal Events

Date Code Title Description
732E Amendments to the register in respect of changes of name or changes affecting rights (sect. 32/1977)

Free format text: REGISTERED BETWEEN 20130815 AND 20130821