GB2452958A - HIV vaccine compositions - Google Patents

Abstract

A method of raising an immune response against a HIV-1 virus which comprises administering (1) one or more first immunogenic polypeptides derived from said virus; (ii) one or more polynucleotides encoding one or more second immunogenic polypeptides derived from said virus; and (iii) an adjuvant, wherein the one or more first immunogenic polypeptides, the one or more polynucleotides and the adjuvant are administered concomitantly. A vaccine composition comprising (i) one or more first immunogenic polypeptides derived from HIV-1 virus; (ii) one or more polynucleotides encoding one or more second immunogenic polypeptides derived from said virus; and (iii) an adjuvant

Description

Novel Method and Compositions

Field of the invention

This invention relates to novel vaccine compositions and their use in the stimulation of immune responses in mammals, especially humans, and in particular for the prevention and treatment of HIV infection. In particular it relates to compositions capable of inducing CD4+ and CD8+ 1-cell responses as well as antibody responses in subjects without recourse to complex prime-boost schedules.

Background to the invention

Inactivated whole organisms have been used in successful vaccination since the late nineteenth century. In more recent times, vaccines involving the administration of extracts, subunits, toxoids and capsular polysaccharides have been employed. Since genetic engineering techniques have been available, the use of recombinant proteins has been a favoured strategy, obviatmg many of the risks associated with use of purified proteins from natural sources.

Early vaccine approaches were based on the administration of proteins which stimulated some aspect of the immune response in vivo. Subsequently it was appreciated that immune responses could also be raised by administration of DNA which could be transcribed and translated by the host into an immunogenic protein.

The mammalian immune response has two key components: the humoral response and the cell-mediated response. The humoral response involves the generation of circulating antibodies which will bind to the antigen to which they are specific, thereby neutralising the antigen and favouring its subsequent clearance by a process involving other cells that are either cytotoxic or phagocytic. B-cells are responsible for generating antibodies (plasma B cells), as well as holding immunological humoral memory (memory B-cells), i.e. the ability to recognise an antigen some years after first exposure to it eg through vaccination. The cell mediated response involves the interplay of numerous different types of cells, among which are the T cells. T-cells are divided into a number of different subsets, mainly the CD4+ and CD8+ T cells.

Antigen-presenting cells (APC) such as macrophages and dendritic cells act as sentinels of the immune system, screening the body for foreign antigens. When extracellular foreign antigens are detected by APC, these antigens are phagocytosed (engulfed) inside the APC where they will be processed into smaller peptides. These peptides are subsequently presented on major histocompatibility complex class 11 (MHC II) molecules at the surface of the APC where they can be recognised by antigen- specific I lymphocytes expressing the CD4 surface molecules (CD4+ T cells). When CD4+ T cells recognise the antigen to which they are specific on MHC II molecules in the presence of additional adequate co-stimulatory signals, they become activated and secrete an array of cytokines that subsequently activate the other arms of the immune system. In general, CD4+T cells are classified into I helper 1 (Thi) or T helper 2 (Th2) subsets depending on the type of response they generate following antigen recognition. Upon recognition of a peptide-MHC II complex, Thi CD4+ T cells secrete interleukins and cytokines such as interferon gamma thereby activating macrophages to release toxic chemicals such as nitric oxide and reactive oxygen/nitrogen species. IL-2 and TNF-alpha are also commonly categorized as Th I cytokines. ln contrast, Th2 CD4+ T cells generally secrete interleukins such as IL-4, IL-5 or IL-13.

Other functions of the T hclper CD4+ T cells include providing help to activate B cells to produce and release antibodies. They can also participate to the activation of antigen-specific CD8+ T cells, the other major T cell subset beside CD4+ T cells.

CD8+ T cells recognize the peptide to which they are specific when it is presented on the surface of a host cell by major histocompatibility class I (MHC I) molecules in the presence of appropriate costimulatory signals. In order to be presented on MHC I molecules, a foreign antigen needs to directly access the inside of the cell (the cytosol or nucleus) as is the case when a virus or intracellular bacteria penetrate a host cell or after DNA vaccination. Inside the cell, the antigen is processed into small peptides that will be loaded onto MHC I molecules that are redirected to the surface of the cell. Upon activation CD8+T cells secrete an array of cytokines such as interferon gamma that activates macrophages and other cells. In particular, a subset of these CD8+ T cells secretes lytic and cytotoxic molecules (e.g. granzyme, perform) upon activation. Such CD8+ T cells are referred to as cytotoxic T cells.

More recently, an alternative pathway of antigen presentation involving the loading of extracellular antigens or fragments thereof onto MHC I complexes has been described and called "cross-presentation".

The nature of the 1-cell response is also influenced by the composition of the adjuvant used in a vaccine. For instance, adjuvants containing MPL & QS2I have been shown to activate Thi CD4+ T cells to secrete IIFN-gamma (Stewart et al. Vaccine. 2006, 24 (42-43):6483-92).

Whereas adjuvants are well known to have value in enhancing immune responses to protein antigens, adjuvants employed or admixed with proteins have not generally been added to DNA vaccines. Rather DNA is often delivered intradermally, for example employing a gold bead which is accelerated through the skin. Topical adjuvants such as imiquimod are employed in the area of the skin where the particle carrying the DNA vaccine is to be inserted.

In fact, in a vaccination protocol directed towards protection against P. falciparum infection, Jones et al(2001, J Infect Diseases 183, 303-312) have reported an adverse outcome after combining DNA, recombinant protein and adjuvant as a boosting composition following a prime by DNA. Indeed, the levels of parasitemia were significantly lower in a group in which the boosting composition contained protein and adjuvant only. It was concluded that use of the combination of DNA, recombinant protein and adjuvant in this protocol adversely affected the outcome on parasitemia as well as antibody responses.

It is generally thought that stimulation of both CD4+ and CD8+ cells are needed for optimal protective immunity treatment, especially in certain diseases such as HIV infection/AIDS. In order to induce an optimal immune response either prophylactically or therapeutically, stimulation of both CD4+ and CD8+ cells is desirable. This is one of the main goals of "prime-boost" vaccination strategies.

However, although prime-boost vaccine strategies may generally give rise to a greater or more balanced response, the requirement to vaccinate on more than one occasion and certainly on more than two occasions can be burdensome or even unviable, especially in mass immunization programs for the developing world.

Thus the objects of the invention include one or more of the following: (a) to provide a complete vaccination protocol and a vaccine composition which stimulates the production of CD4+ andlor CD8+ cells and/or antibodies and in particular which obviates or mitigates the need for repeated immunizations; (b) to provide a vaccination protocol and a vaccine composition which better stimulates (adequately stimulates) production of CD4+ cells and/or CD8+cells and/or antibodies relative to vaccine compositions containing an immunogenic polypeptide alone or a polynucleotide alone; (c) to provide a vaccine composition which stimulates or better stimulates ThI responses; (d) to provide a vaccine composition and vaccination protocol in which required doses of components are minimised; and (e) more generally to provide a useful vaccine composition and vaccination protocol for treatment or prevention of diseases caused by HIV infection. By "better stimulates" is meant that the intensity andlor persistence of the response is enhanced in comparison to single component (i.e. protein only or DNA) single vaccinations (i.e. non-prime boost).

Summary of the invention

Thus according to the invention there is provided a method of raising an immune response against a HIV-I virus which comprises administering (i) one or more first immunogenic polypeptides derived from said virus; (ii) one or more polynucleotides encoding one or more second immunogenic polypeptides derived from said virus; and (iii) an adjuvant; wherein the one or more first immunogenic polypeptides, the one or more polynucleotides and the adjuvant are administered concomitantly.

According to a specific aspect of the invention there is provided a vaccine composition comprising (i) one or more first immunogenic polypeptides derived from a HIV-I virus; (ii) one or more polynucleotides encoding one or more second immunogenic polypeptides derived from said virus; and (iii) an adjuvant.

There is also provided an immunogenic composition comprising said elements.

Said vaccines and immunogenic compositions suitably stimulate production of specific CD4+ T-cells and/or CD8+ T-cells and/or antibodies.

By "specific CD4+ T-cells and/or CD8+ T-cells and/or antibodies" is meant CD4+ T-cells and/or CD8+ T-cells and/or antibodies which specifically recognise the virus or a part (eg an immunogenic subunit such as an envelope protein, an immunogenic regulatory protein or the like) thereof. By "specifically recognise" is meant that the CD4+ T-cells and/or CD8+ T-cells and/or antibodies recognise in an immunospecific rather than a non-specific manner the virus (or part thereof).

There is also provided a method of stimulating an immune response in a mammal which comprises administering to a subject an immunologically effective amount of such a composition, or vaccine.

There is also provided use of such a composition(s) in the manufacture of a medicament for stimulating an immune response in a mammal.

There is also provided such a composition for use in stimulating an immune response in a mammal, such as a human.

There is also provided a method of stimulating the production of specific CD4+ T-cells andlor CD8+ T-cells and/or antibodies in mammals which comprises administering to said mammal (i) one or more first immunogenic polypeptides derived from a HIV-1 virus; (ii) one or more polynucleotides encoding one or more second immunogenic polypeptides derived from said virus; and (iii) an adjuvant; wherein the one or more first immunogenic polypeptides, the one or more polynucleotides and the adjuvant are administered concomitantly, for example by administering an immunologically effective amount of an aforeseaid composition.

There is also provided use of aforesaid compositions in the manufacture of a medicament for stimulating the production of specific CD4+ and/or CD8+ cells and/or antibodies in mammals directed to/against the virus.

For example, production of CD4+ T-cells or CD8+ T-cells or antibodies is stimulated.

Suitably production of 2 and especially 3 of CD4+ T-cells and/or CD8+ T-cells and/or antibodies is stimulated.

Suitably production of CD8+ T-cells is stimulated. Suitably production of CD4+ and CD8+ T-cells is stimulated. Suitably production of CD4+ and CD8+ T-cells and antibodies is stimulated.

Alternatively suitably production of CD4+ T-cells is stimulated. Suitably production of CD4+ and antibodies is stimulated.

Alternatively suitably production of antibodies is stimulated.

The methods of the invention are suitably intended to provide the steps adequate for a complete method for raising an immune response (although the method may, if desired, be repeated).

Therefore generally the methods do not involve use of a priming dose of: any immunogenic polypeptide, or polynucleotide encoding any immunogenic polypeptide.

For example, there is provided a method of raising an immune response against a HIV-1 virus which consists of: (a) administering (I) one or more first immunogenic polypeptides derived from said virus; (ii) one or more polynucleotides encoding one or more second immunogenic polypeptides derived from said virus; and (iii) an adjuvant; wherein the one or more immunogenic polypeptides, the one or more polynucleotides and the adjuvant are administered concomitantly; and (b) optionally repeating the steps of(a).

The steps of the method may be repeated (e.g. repeated once or twice) if a repeat gives rise to an improved immune response. An adequate response, at least as far as a T-ceIl response is concerned, may be obtained without any need for repetition.

There is also provided a method of raising an immune response against a HIV-1 virus which comprises: (a) administering (i) one or more first immunogenic polypeptides derived from said virus; (ii) one or more polynucleotides encoding one or more second immunogenic polypeptides derived from said virus; and (iii) an adjuvant; wherein the one or more first immunogenic polypeptides, the one or more polypeptides and the adjuvant are administered concomitantly; and wherein the method does not involve administering any priming dose of immunogenic polypeptide and/or polynucleotide encoding immunogenic polypeptide.

In one embodiment the invention employs a priming dose of an adjuvanted immunogenic polypeptide with a boosting dose employing the method/composition of the invention.

Nevertheless the composition or method of the invention can be employed as priming with a further dose employing the same or different antigens, for example in a formulation according the present invention. In one aspect the priming and the boosting will employ the same formulation/components.

Alternatively, the invention may employ priming with an adjuvanted protein and boosting with a composition/method according to the invention (or indeed visa versa).

In another embodiment the invention employs a priming dose of polynucleotide encoding an appropriate polypeptide, with a boosting dose employing the method/composition of the invention (or indeed visa versa).

There is also provided a kit comprising (i) one or more first immunogenic polypeptides derived from a HIV-1 virus; (ii) one or more polynucleotides encoding one or more second immunogenic polypeptides derived from said virus; and (iii) an adjuvant; and in particular comprising (i) one or more first immunogenic polypeptides derived from said virus and an adjuvant; and (ii) one or more second polynucleotides encoding one or more immunogenic polypeptides derived from said virus; for use in a method according to the invention.

Compositions and methods of the invention may be useful for the prevention of HIV infection in naïve subjects, or prevention of disease progression or retardation of development of the disease, for example to full blown AIDS, in a patient with HIV-1 infection.

Brief description of the figures

Figure 1 shows a graphical representation of the the construction of plasmid p73i-Tgrn Figure 2 shows the nucleotide sequence for p55gag insert for plasmid pGagOptrpr2 and the amino acid sequence encoded by the same.

Figure 3 shows the nucleotide sequence for p17/24truncated Nef insert for plasmid p1 7/24truncated Nef I and the amino acid sequence encoded by the same Figure 4 shows the nucleotide sequence for p1 7/24opt/truncated Nef insert for plasmid p1 7/24opt!truncated Nef 1 and the amino acid sequence encoded by the same Figure 4a shows a plasmid map for a plasmid including the insert of Figure 4 Figure 5 shows a nucleotide sequence of the RT insert for plasmid p7077-RT3 and the amino acid sequence encoded by same Figure 5a shows a plasmid map of plasmid p7077-RT3 Figure 6 shows a nucleotide sequence for the RT insert for plasmid p73i-RT3 and the amino acid sequence encoded by same.

Figure 6a shows a plasmid map for plasmid p73i-RT3 Figure 7 shows a nucleotide sequence for the Nef insert for plasmid 7O77trNef2O and the amino acid sequence encoded by same.

Figure 8 shows the nucleotide sequence for the RI insert for plasmid 7077RT8 and the amino acid sequence encoded by same.

Figure 9 shows the nucleotide sequence of the p17/24opt/RT/trNef insert for plasmid p1 7/24optIRT/trNefl 3 Figure 9a shows the plasmid map for p17/24GagRInef (also referred to as pcoGagRlnei) Figure 10 shows the nucleotide sequence for the p1 7/24opt(cor)RT/trNef insert for plasmid WRG7077 and the amino acid sequence encoded by same Figure lOa shows a plamid map for plasmid pGRN4l6 (also referred ti a WRG7077) Figure 11 shows a nucleotide sequence for p1 7/p24(opt)/RT(opt)trNef insert for plasmid p73i-GRN2 and the amino acid sequence encoded by same.

Figure 1 la shows a plasmid map for plasmid p73i-GRN2 Figure 12 shows the nucleotide sequence for the p17/p24opt/trNef insert for plasmid p73i-GN2 and the amino acid sequence encoded by same.

Figure 12a shows a plasmid map for plasmid p73i-GN2 Figure 13 shows the nucleotide sequence for the RT insert for plasmid w229k.

Figure 13a shows the plasmid map for plasmid w229k (also referred to as p73RT229.clo) Figure 14 shows the nucleotide sequence for the insert Tgrn for plasmid p73i-Tgrn and the amino acid sequence encoded by same Figure 14a shows the plasmid map for plasmid p73i-Tgrn Figure 15 shows the nucleotide sequence for Tnrg the insert for plasmid P73i-Tnrg and the amino acid sequence encoded by same Figure ISa shows the plasmid map for P73i-Tnrg Figure 16 shows the nucleotide sequence for the Tngr insert for plasmid p7313ie and the amino acid sequence encoded by same Figure 16a shows a plasmid map for plasmid P73i-Tngr Figure 17 shows the nucleotide sequence for the insert Trgn for plasmid #6 and the amino acid sequence encoded by same Figure 1 7a shows a plasmid map of plasmid p73i-Trgn (also referred to as #6) Figure 18 shows a nucleotide sequence of the insert mg for plasmid #11 and the amino acid sequence encoded by same.

Figure 18a shows a plasmid map for p73i-Tmg (also referred to as #11) Figure 19 shows a nucleotide sequence for the TgnR (Fl) insert for plasmid p73i-Tgnr and the amino acid sequence encoded for by same.

Figure 19a shows the plasmid map for plasmid p73i-Tgnr

Summary of sequence listings

Amino acid or polynucleotide description Sequence Identifier (SEQ ID No) HIV Gag-RT-Nef("GRN") (Clade B) (cDNA) 1 HIV Gag-RT-Nef("GRN") (Clade B) (amino 2 acid) HIV Gag-RT-integrase-Nef ("GRIN") (Clade 3 A) (cDNA) HIV Gag-RT-integrase-Nef ("GRIN") (Clade 4 A) (amino acid) HIV gpl4O (Clade A) (cDNA) 5 HJV gpl4O (Clade A) (amino acid) 6 HIV gpl2O (Clade B) (cDNA) 7 HIV gpl2O (Clade B) (amino acid) S HIV p24-RT-Nef-p17 (cDNA) 9 HIV p24-RT-Nef-p17 (amino acid) 10 The above recited sequences may be employed as polypeptides or polynucletides encoding polypeptides of use in exemplary aspects of the invention. Said polypeptides may consist of or comprise the above mentioned sequences. Initial Met residues are optional. N-terminal His residues (including His residues immediately following an initial Met) are optional and/or an N-terminal His tag, optionally each a different length, may be employed (eg typically up to 6 His residues may be employed to facilitate isolation of the protein). Analogue proteins which have significant sequence identity eg greater than 80% eg greater than 90% eg greater than 95% eg greater than 99% sequence identity over the whole length of the reference sequence may be employed, especially when the analogue protein has a similar function and particularly when the analogue protein is similarly immunogenic. For example up to 20 eg up to 10 eg 1-5 susbtitutions (eg conservative substitutions) may be tolerated. Nucleic acids which differ from those recited above which encode the same proteins, or the aforementioned analogue proteins, may be employed. Sequence identity may be determined by conventional means eg using BLAST. In one specific variant of SEQ ID No 10 that may be mentioned, residue 398 is Ser and notCys.

Detailed description of the invention

In one aspect of the invention the one or more first immunogenic polypeptides are selected from any HIV antigen or protein which may be employed to disrupt the life cycle of the virus, for example those described herein such as Gag, Pot, Env, Nef or Tat or a sub-unit or functional derivative thereof.

In one aspect of the invention the one or more second immunogenic polypeptides are selected from any HIV antigen or protein which may be employed to disrupt the life cycle of the virus, for example those described herein such as Gag, Pot, Env, Nef or Tat or a sub-unit or functional derivative thereof.

As used herein the term "concomitantly" means wherein the one or more immunogenic polypeptide(s), the one or more polynucleotide(s) and the adjuvant are administered within a period of no more than 12 hours e.g. within a period of no more than 1 hour, typically on one occasion e.g. in the course of the same visit to the health professional. Thus the one or more immunogenic polypeptides, the one or more polynucleotides and the adjuvant are administered sequentially or simultaneously.

As used herein, the term "epitope" refers to an immunogenic amino acid sequence. An epitope may refer to an a minimum amino acid sequence of typically 6-8 amino acids which minimum sequence is immunogenic when removed from its natural context, for example when transplanted into a heterologous polypeptide. An epitope may also refer to that portion of a protein which is immunogenic, where the polypeptide containing the epitope is referred to as the antigen (or sometimes "polypeptide antigen"). A polypeptide or antigen may contain one or more (eg 2 or 3 or more) distinct epitopes. The term "epitope" embraces B-cell and T-cell epitopes. The term "T-cell epitope" embraces CD4+ T-cell epitopes and CD8+ T-cell epitopes (sometimes also referred to as CTL epitopes).

The term "immunogenic polypeptide" refers to a polypeptide which is immunogenic, that is to say it is capable of eliciting an immune response in a mammal, and therefore contains one or more epitopes (eg T-cell and/or B-cell epitopes). Immunogenic polypeptides may contain one or more polypeptide antigens eg in an unnatural arrangement such as in a fusion protein.

Immunogenic polypeptides will typically be recombinant proteins produced eg by expression in a heterologous host such as a bacterial host, in yeast or in cultured mammalian cells.

The term "polypeptide derived from HIV-1 virus" means a polypeptide which partially or wholly contains sequences (i.e. antigens) which occur naturally in the virus such as structural proteins, for example envelope proteins or proteins, which are generated in the life cycle of the virus (for example as described herein), such as regulatory proteins, or alternatively bear a high degree of sequence identity to any of the above. (eg more than 95% identity over a stretch of at least 10 eg at least 20 amino acids or over the whole length of the protein). The definition also extends to whole inactivated virus or subunits thereof. There portions derived from natural virus "components" may be fused to linkers and/or carrier proteins to form a final fusion protein,with improved properties, such as immunogenicity, antigenicity, stability and/or expression, in comparison to the most relevant naturally occurring HIV protein.

Inactivated virus can be prepared by treatment with a chemical agent such as an aldehyde, particularly formaldehyde or glutaldehyde. Alternatively inactivation may be performed by physical treatment, for example irradiation or the like.

Immunogenic polypeptides may contain one or more (eg 1, 2, 3 or 4) polypeptide antigens.

Unless otherwise specified, an "immune response" may be a cellular and/or a humoral response.

In one embodiment of the invention one or more of said one or more first immunogenic polypeptides is/are substantially the same as one or more of said one or more second immunogenic polypeptides. For example one of the at least one first immunogenic polypeptides and one of the at least one second immunogenic polypeptides may have an overall sequence identity of 90% or more eg 95% or more eg 98% or 99% or more over the length of one or other immunogenic polypeptides.

In another embodiment of the invention one or more of said one or more first immunogenic polypeptides contains at least one antigen which is substantially the same as an antigen contained in one or more of said one or more second immunogenic polypeptides (encoded for by said polynucleotide). For example one of the at least one first immunogenic polypeptides and one of the at least one second immunogenic polypeptides may have an overall sequence identity of 90% or more eg 95% or more eg 98% or 99% or more over a stretch of 20 amino acids or more eg 40 amino acids or more eg 60 amino acids or more, such as over the full length.

Suitably one or more first immunogenic polypeptides comprise at least one T cell epitope.

Suitably one or more second immunogenic polypeptides comprise at least one T cell epitope.

Suitably the one or more first immunogenic polypeptides comprise at least one B cell epitope.

Suitably the one or more second immunogenic polypeptides comprise at least one B cell epitope h-i another embodiment of the invention one or more of said one or more first immunogenic polypeptides and one or more of said one or more second immunogenic polypeptides share one or more identical B-cell and/or T-cell epitopes. Suitably they share one or more identical amino acid sequences of length 10 amino acids or more eg 15 amino acids or more eg 25 amino acids or more.

In one embodiment they may not share any B-cell or 1-cell epitopes. For example, they may not share any identical amino acid sequences of length 10 amino acids or more eg at 15 amino acids or more eg 25 amino acids or more.

In one aspect the first one or more polypeptide(s) is a fusion.

In one embodiment the one or more second polypeptide(s) is a fusion protein.

In one specific embodiment of the invention a first immunogenic polypeptide and a second immunogenic polypeptide contain the same antigens in the same arrangement or in a different arrangement (eg in a different arrangement). By "different arrangement" is meant that they may be arranged in a different order and/or they may be divided (nevertheless the components parts are the same). So for example wherein the immunogenic polypeptide is a NefTat fusion protein a different arrangement would be a TatNef fusion protein or alternatively individual unfused Tat and Nef Alternatively, for example a portion of Nef may be linked to Tat with another portion of Nef7remaining portion of Nef at the other end of the Tat thereby forming a Tat sandwich.

These examples of arrangements may also be extended to other antigens.

In another specific embodiment of the invention a first immunogenic polypeptide and a second immunogenic polypeptide are the same.

The composition according to the invention may contain one first immunogenic polypeptide as the only immunogenic polypeptide in the composition. Alternatively the composition according to the invention may contain more than one first immunogenic polypeptides eg 2 or 3 or 4 or more immunogenic polypeptides.

The composition according to the invention may comprise one polynucleotide. Alternatively it may comprise more than one polynucleotide eg 2 polynucleotides.

In compositions according to the invention a polynucleotide encodes for one second immunogenic polypeptide or it may encode for more than one second immunogenic polypeptide under the control of more than one promoter.

Polynucleotide for use in the invention i ncludes DNA or RNA provided in the form of a plasmid vector or as so-called naked DNA. It does NOT include a viral vector compring a polynucleotide.

The invention is intended to provid a vaccine or a component for a vaccine suitable for raising an immune response in a mammal, such as a human. This in-imune response may in some circumstances provide prophylactic protection against infection with HIV or treatment of HIV or AIDS when used in an appropriate treatment regime and optionally in combination with other vaccines.

Thus in addition to prophylactic vaccination, the compositions of the invention may also be used in individuals that are already infected with HJV, and result in improved immunological control of the established infection. Thus in one aspect the invention results in retardation of the progression of the disease. In the case of HIV, this control is believed to be achieved by CD8-positive T cells that specifically recognize HIV-infected cells.

The induction of both types of immune response is particularly useful, and maybe achieved by combining different vaccine compositions. A combination of an adjuvanted protein and a polynucleotide is of particular interest. The HIV-infected patients that will benefit from the above-described vaccination are either in the primary infection, latency or terminal phase of HIV infection at the time of vaccination. The patients may or may not undergo other therapeutic treatment interventions for the disease (for example highly active antiretroviral therapy) at the time of vaccination.

The invention is thought to be advantageous in providing a balance immune response, for example at least CD4 positive cells and CD8 positive cells, which are thought to be necessary in providing appropriate protectionltreatment. It also provides a cost effect and efficient vaccine.

It is thought that a vaccination program employing the same is more likely to be success in countries such as Africa, where infra-structure is limited and compliance with complicated treatment regimes are likely to be difficult or impossible.

En one embodiment the adjuvanted proteinlantigenlfirst polypeptide is administered as a vaccine employing a traditional needle and syringe and the polynucleotide(s) of part (ii) is/are 1 5 administered intradermally concomitantly, for example using PMED (particle mediated epidermal delivery) type technology.

In an alternative embodiment the adjuvanted proteinlantigenlfirst polypeptide is administered as a vaccine employing a traditional needle and syringe and the polynucleotide of part (ii) is administered concomitantly as a separate formulation as a vaccine employing a traditional needle and syringe.

In a separate embodiment the adjuvanted protein/antigen/first polypeptide is co-formulated with said polynucleotide(s) of part (ii).

Co-formulated in the context of the present invention is intended to mean formulated together in one container (one-pot). By "co-formulated" is meant that the first immunogenic polypeptide and the adjuvant are contained within the same composition eg a pharmaceutical composition.

Where the formulation is a co-formulation it may be desirable to mix the protein and adjuvant together before adding the DNA component.

Antigens In the context of this specification antigen and immunogenic polypeptide are used interchangeably.

Antigens may be selected from H[V derived antigens, particularly MW-I derived antigens. HIV-I antigens suitable for use in the invention are listed below.

HIV Tat and Nef proteins are early proteins, that is, they are expressed early in infection and in the absence of structural protein.

The Nef gene encodes an early accessory HIV protein which has been shown to possess several activities. For example, the Nef protein is known to cause the removal of CD4, the HIV receptor, from the cell surface, although the biological importance of this function is debated.

Additionally Nef interacts with the signal pathway of T cells and induces an active state, which in turn may promote more efficient gene expression. Some HIV isolates have mutations or deletions in this region, which cause them not to encode functional protein and are severely compromised in their replication and pathogenesis in vivo.

The Gag gene is translated from the full-length RNA to yield a precursor polyprotein which is subsequently cleaved into 3 -5 capsid proteins; the matrix protein p17, capsid protein p24 and nucleic acid binding protein (Fundamental Virology, Fields BN, Knipe DM and Howley M 1996

2. Fields Virology vol 2 1996).

The Gag gene gives rise to the 55-kilodalton (Kd) Gag precursor protein, also called p55, which is expressed from the unspliced viral mRNA. During translation, the N terminus of p55 is myristoylated, triggering its association with the cytoplasmic aspect of cell membranes. The membrane-associated Gag polyprotein recruits two copies of the viral genomic RNA along with other viral and cellular proteins that triggers the budding of the viral particle from the surface of an infected cell. After budding, p55 is cleaved by the virally encoded protease (a product of the Pol gene) during the process of viral maturation into four smaller proteins designated MA (matrix [p17]), CA (capsid [p24]), NC (nucleocapsid [p9]), and p6(4).

In addition to the 3 major Gag proteins (p17, p24 and p9), all Gag precursors contain several other regions, which are cleaved out and remain in the virion as peptides of various sizes. These proteins have different roles e.g. the p2 protein has a proposed role in regulating activity of the protease and contributes to the correct timing of proteolytic processing.

The MA polypeptide is derived from the N-terminal, myristoylated end of p55. Most MA molecules remain attached to the inner surface of the virion lipid bilayer, stabilizing the particle.

A subset of MA is recruited inside the deeper layers of the virion where it becomes part of the complex which escorts the viral DNA to the nucleus. These MA molecules facilitate the nuclear transport of the viral genome because a karyophilic signal on MA is recognized by the cellular nuclear import machinery. This phenomenon allows HIV to infect non-dividing cells, an unusual property for a retrovirus.

The p24 (CA) protein forms the conical core of viral particles. Cyclophilin A has been demonstrated to interact with the p24 region of p55 leading to its incorporation into HIV particles. The interaction between Gag and cyclophilin A is essential because the disruption of this interaction by cyclosporine inhibits viral replication.

The NC region of Gag is responsible for specifically recognizing the so-called packaging signal of HIV. The packaging signal consists of four stem loop structures located near the 5' end of the viral RNA, and is sufficient to mediate the incorporation of a heterologous RNA into HJV-l virions. NC binds to the packaging signal through interactions mediated by two zinc-finger motifs. NC also facilitates reverse transcription.

The p6 polypeptide region mediates interactions between p55 Gag and the accessory protein Vpr, leading to the incorporation of Vpr into assembling virions. The p6 region also contains a so-called late domain which is required for the efficient release of budding vinons from an infected cell.

The Pol gene encodes three proteins having the activities needed by the virus in early infection, reverse transcriptase RT, protease, and the integrase protein needed for integration of viral DNA into cellular DNA. The primary product of Pol is cleaved by the virion protease to yield the amino terminal RT peptide which contains activities necessary for DNA synthesis (RNA and DNA directed DNA polymerase, ribonuclease H) and carboxy terminal integrase protein. RN RT is a heterodimer of full-length RT (p66) and a cleavage product (p51) lacking the carboxy terminal RNase H domain.

RT is one of the most highly conserved proteins encoded by the retroviral genome. Two major activities of RT are the DNA Pol and ribonuclease H. The DNA Pol activity of RT uses RNA and DNA as templates interchangeably and like all DNA polymerases known is unable to initiate DNA synthesis de novo, but requires a pre existing molecule to serve as a primer (RNA).

The RNase H activity inherent in all RT proteins plays the essential role early in replication of removing the RNA genome as DNA synthesis proceeds. It selectively degrades the RNA from all RNA -DNA hybrid molecules. Structurally the polymerase and nbo H occupy separate, non-overlapping domains within the Pol covering the amino two thirds of the Pol.

The p66 catalytic subunit is folded into 5 distinct subdomains. The amino terminal 23 of these have the portion with RT activity. Carboxy terminal to these is the RNase H domain.

After infection of the host cell, the retroviral RNA genome is copied into linear double stranded DNA by the reverse transcnptase that is present in the infecting particle. The integrase (reviewed in Skalka AM 99 Adv in Virus Res 52 27 1-273) recognises the ends of the viral DNA, trims them and accompanies the viral DNA to a host chromosomal site to catalyse integration. Many sites in the host DNA can be targets for integration. Although the integrase is sufficient to catalyse integration in vitro, it is not the only protein associated with the viral DNA in vivo -the large protein -viral DNA complex isolated from the infected cells has been denoted the pre-integration complex. This facilitates the acquisition of the host cell genes by progeny viral genomes.

The integrase is made up of 3 distinct domains, the N terminal domain, the catalytic core and the C terminal domain. The catalytic core domain contains all of the requirements for the chemistry of polynucleotidyl transfer.

HIV-1 derived antigens for use in the invention may thus for example be selected from Gag (for example full length Gag), p17 (a portion of Gag), p24 (another portion of Gag), p41, p40, Pot (for example full lemgth Pol), RT (a portion of Pol), p51 (a portion of RT), integrase (a portion of Pol), protease (a portion of P01), Env, gpl2O, gpl4O or gpl6O, gp4l, Nef, Vif, Vpr, Vpu, Rev, Tat and immunogenic derivatives thereof and immunogenic fragments thereof, particularly Env, Gag, Nef and Pol and immunogenic derivatives thereof and immunogenic fragments thereof including p1 7, p24, RT and integrase. HIV vaccines may comprise polypeptides and/or polynucleotides encoding polypeptides corresponding to multiple different HIV antigens for example 2 or 3 or 4 or more HIV antigens which may be selected from the above list. Several different antigens may, for example, be comprised in a single fusion protein. More than one first immunogenic polypeptide and/or more than one second immunogenic polypeptide each of which is an HIV antigen or a fusion of more than one antigen may be employed. A combination of a fusion protein and one or more immunogenic polypeptide(s) may also be employed.

In one embodiment the fusion protein does not consist of NefTat or any permutation of same.

For example an antigen may comprise Gag or an immunogenic derivative or immunogenic fragment thereof, fused to RT or an immunogenic derivative or immunogenic fragment thereof, fused to Nef or an immunogenic derivative or immunogenic fragment thereof wherein the Gag portion of the fusion protein is present, for example at the 5' terminus end of the polypeptide.

A Gag sequence of use according to the invention may exclude the Gag p6 polypeptide encoding sequence. A particular example of a Gag sequence for use in the invention comprises p17 and/or p24 encoding sequences.

A RT sequence may contain a mutation to substantially inactivate any reverse transcriptase activity (see W003/025003).

The RT gene is a component of the bigger pol gene in the HIV genome. It will be understood that the RT sequence employed according to the invention may be present in the context of Pol, or a fragment of Pol corresponding at least to RT. Such fragments of Pot retain major CTL epitopes of Pol. In one specific example, RT is included as just the pSi or just the p66 fragment of RT.

The RT component of the fusion protein or composition according to the invention optionally comprises a mutation to remove a site which serves as an internal initiation site in prokaryotic expression systems.

Optionally the Nef sequence for use in the invention is truncated to remove the sequence encoding the N terminal region i.e. removal of from 30 to 85 amino acids, for example from 60 to 85 amino acids, particularly the N terminal 65 amino acids (the latter truncation is referred to herein as trNef). Alternatively or additionally the Nef may be modified to remove the myristylation site. For example the Gly 2 myristylation site may be removed by deletion or substitution. Alternatively or additionally the Nef may be modified to alter the dileucine motif of Leu 174 and Leu 175 by deletion or substitution of one or both leucines. The importance of the dileucine motif in CD4 downregulation is described e.g. in Bresnahan P.A. et al (1998) Current Biology, 8(22): 1235-8.

The Env antigen maybe present in its full length as gpl6O or truncated as gpl4O or shorter (optionally with a suitable mutation to destroy the cleavage site motif between gpl2O and gp4l).

The Env antigen may also be present in its naturally occurring processed form as gpI2O and gp4I. These two derivatives of gp 160 may be used individually or together as a combination.

The aforementioned Env antigens may further exhibit deletions (in particular of variable loops) and truncations. Fragments of Env may be used as well.

An exemplary gpl2O amino acid sequence is shown in SEQ ID No 8. An exemplary gpI4O sequence is shown in SEQ ID No 6.

Immunogenic polypeptides according to the invention may comprise Gag, Pol, Env and Nef wherein at least 75%, or at least 90% or at least 95%, for example, 96% of the CTL epitopes of these native antigens are present.

In immunogenic polypeptides according to the invention which comprise p1 7ip24 Gag, p66 RI, and truncated Nef as defined above, 96% of the CTL epitopes of the native Gag, Pol and Nef antigens are suitably present.

One embodiment of the invention provides an immunogenic polypeptide containing p17, p24 Gag, p66 RI, truncated Nef (devoid of nucleotides encoding terminal amino-acids 1-85 - "trNef') in the order Gag, RT, Nef. In polynucleotides encoding immunogenic polypeptides of the invention, may be codon optimized, for example the p24 Gag and p66 RT portions are codon optimized.

Specific polynucleotide constructs and corresponding polypeptide antigens according to the invention include: 1. p1 7, p24 (codon optimized) Gag -p66 RI (codon optimized) -truncated Nef; 2. truncated Nef-p66 RT (codon optimized) -p17, p24 (codon optimised) Gag; 3. truncated Nef -p17, p24 (codon optimized) Gag -p66 RI (codon optimized); 4. p66 RI (codon optimized) -pl7, p24 (codon optimized) Gag -truncated Nef; 5. p66 RT (codon optimized) -truncated Nef -p17, p24 (codon optimized) Gag; 6. p17, p24 (codon optimized) Gag -truncated Nef -p66 RT (codon optimized).

An exemplary fusion is a fusion of Gag, RT and Nef particularly in the order Gag-RT-Nef (see eg SEQ ID No 2). Another exemplary fusion is a fusion of p17, p24, RT and Nef particularly in the order p24-RT-Nef-p17 (see eg SEQ ID No 10, referred to elsewhere herein as "F4").

In another embodiment an immunogenic polypeptide contains Gag, RT, integrase and Nef, especially in the order Gag-RT-integrase-Nef (see eg SEQ ID No 4).

In other embodiments the HIV antigen may be a fusion polypeptide which comprises Nef or an immunogenic derivative thereof or an immunogenic fragment thereof, and p17 Gag andlor p24 Gag or immunogenic derivatives thereof or immunogenic fragments thereof, wherein when both p17 and p24 Gag are present there is at least one HIV antigen or immunogenic fragment between them.

For example, Nef is suitably full length Nef.

For example p17 Gag and p24 Gag are suitably full length p17 and p24 respectively.

In one embodiment an immunogenic polypeptide comprises both p17 and p24 Gag or immunogenic fragments thereof. In such a construct the p24 Gag component and p17 Gag component are separated by at least one further HIV antigen or immunogenic fragment, such as Nefandlor RT or immunogenic derivatives thereof or immunogenic fragments thereof. See In fusion proteins which comprise p24 and RT, it may be preferable that the p24 precedes the RT in the construct because this may assist the expression.

Some constructs according to the invention include the following: 1. p24-RT-Nef-p17 2. p24_RT*_Nefp17 3. p24-p5IRT-Nef-p17 4. p24_p51RT*Nefp17 5. p17-p51RT-Nef 6. pl7p51RT*Nef 7. Nef-p17 8. Nef-p17 with linker 9. p17-Nef 10. p17 -Nef with linker * represents RT methionine592 mutation to lysine En another aspect the present invention provides a fusion protein of HIV antigens compriing at least four HIV antigens or immunogenic fragments, wherein the four antigens or fragments are or are derived from Nef, Pol and Gag. In one aspect Gag is present as two separate components which are separated by at least one other antigen in the fusion. In one aspect the Nef is full length Nef. In one aspect the Polls p66 or p5 1RT. In one aspect the Gag is p17 and p24 Gag.

Other suitable features and properties of the antigen components of the fusion in this aspect of the invention are as described herein.

Particularly suitable embodiments of this aspect of the invention are the four component fusions as already listed above: 1. p24-RT-Nef-p17 2. p24_RT*_Nef_p17 3. p24-p5IRT-Nef-p17 4. p24_p5lRT*Nef_pl7 The immunogenic polypeptides of the present invention may have linker sequences present in between the sequences corresponding to particular antigens such as Gag, RT and Nef. Such linker sequences may be, for example, up to 20 amino acids in length. In a particular example they may be from I to 10 amino acids, or from I to 6 amino acids, for example 4-6 amino acids.

Further description of such suitable HIV antigens containing linkers can be found in HIV antigens of the present invention may be derived from any HIV dade, for example dade A, dade B or dade C. For example the HIV antigens may be derived from dade A or B, especially B. In one specific embodiment of the invention, a first immunogenic polypeptide is a polypeptide comprising Gag andlor Pot and/or Nef or a fragment or derivative of any of them (eg p24-RT-Nef-p17). In one specific embodiment of the invention a second immunogenic polypeptide is a polypeptide comprising Gap and/or Pol and/or Nef or a fragment or derivative of any of them (eg Gag-RT-Nef or Gag-RT-integrase-Nef).

Thus in one specific embodiment, a polypeptide comprising Gag and/or Pol and/or Nef or a fragment or derivative of any of them (eg p24RT-Nef-p 17) is a first immunogenic polypeptide and a polypeptide comprising Gag and/or Pol and/or Nef or a fragment or derivative of any of them (eg Gag-RT-Nef or Gag-RT-integrase-Nef) is a second immunogenic polypeptide.

In another specific embodiment of the invention, a first immunogenic polypeptide is Env or a fragment or derivative thereof eg gpl2O, gpl4O or gpI6O (especially gpl2O). In one specific embodiment of the invention a second immunogenic polypeptide is a polypeptide comprising Gag and/or Pol and/or Nef or a fragment or derivative of any of them (eg p24-RT-Nef-p 17).

Thus in one specific embodiment, Env or a fragment or derivative thereof eg gpl2O, gpl4O or gpl6O (especially gpl2O) is a first immunogenic polypeptide and a polypeptide comprising Gag and/or Pol and/or Nef or a fragment or derivative of any of them (eg p24-RT-Nef-p 17) is a second immunogenic polypeptide.

In another specific embodiment of the invention, a first immunogenic polypeptide is a polypeptide comprising Gag and/or Pol and/or Nef or a fragment or derivative of any of them (eg p24-RT-Nef-p17). In one specific embodiment of the invention a second immunogenic polypeptide is Env or a fragment or derivative thereof eg gpl2O, gpl4O or gpl6O (especially gpl2O).

Thus in one specific embodiment, a polypeptide comprising Gag and/or Pol and/or Nef or a fragment or derivative of any of them (eg p24-RT-Nef-p 17) is a first immunogenic polypeptide and Env or a fragment or derivative thereof eg gp 120, gp 140 or gp 160 (especially gp 120) is a second immunogenic polypeptide.

Although two or more polynucleotides encoding immunogenic polypeptides may be linked as a fusion, the resulting protein may be expressed as a fusion protein, or it may be expressed as separate protein products, or it may be expressed as a fusion protein and then subsequently broken down into smaller subunits.

Immunogenic derivatives and immunogenic fragments of antigens The aforementioned antigens may be employed in the form of immunogenic derivatives or immunogenic fragments thereof rather than the whole antigen.

As used herein the term "immunogenic derivative" in relation to an antigen of native origin refers to an antigen that has been modified in a limited way relative to its native counterparts.

For example it may include a point mutation which may change the properties of the protein eg by improving expression in prokaryotic systems or by removing undesirable activity, eg enzymatic activity. Immunogenic derivatives will however be sufficiently similar to the native antigens such that they retain their antigenic properties and remain capable of raising an immune response against the native antigen. Whether or not a given derivative raises such an immune response may be measured by a suitably immunological assay such as an ELISA (for antibody responses) or flow cytometry using suitable staining for cellular markers (for cellular responses).

Immunogenic fragments are fragments which encode at least one epitope, for example a CTL epitope, typically a peptide of at least 8 amino acids. Fragments of at least 8, for example 8-10 amino acids or up to 20, 50, 60, 70, 100, 150 or 200 amino acids in length are considered to fall within the scope of the invention as long as the polypeptide demonstrates antigenicity, that is to say that the major epitopes (eg CTL epitopes)are retained by the polypeptide.

Plasmid DNA As discussed above the invention does not extend to or employ viral vectors incorporating DNA.

Thus DNA in the context of this specification will mean plasmid DNA or equivalent DNA, sometime referred to as naked DNA.

DNA vaccines usually consist of a bacterial plasmid vector into which is inserted a strong promoter, the gene of interest which encodes for an antigenic peptide and a polyadenylation /transcriptional termination sequences. The gene of interest may encode a full protein or simply an antigenic peptide sequence as required. The plasmid can be grown in bacteria, such as for example E.coli and then isolated and prepared in an appropriate medium (most desirably serum free), depending upon the intended route of administration, before being administered to the host. Following administration the plasmid is taken up by cells of the host where the encoded peptide is produced. The plasmid vector will preferably be made without an origin of replication which is functional in eukaryotic cells, in order to prevent plasmid replication in the mammalian host and integration within chromosomal DNA of the animal concerned.

There are a number of advantages of DNA vaccination relative to traditional vaccination techniques. First, it is predicted that because of the proteins which are encoded by the DNA sequence are synthesised in the host, the structure or conformation of the protein will be similar to the native protein associated with the disease state. It is also likely that DNA vaccination will offer protection against different strains of a virus, by generating cytotoxic T lymphcyte response that recognise epitopes from conserved proteins. Furthermore, because the plasmids are taken up by the host cells where antigenic protein can be produced, a long-lasting immune response will be elicited. The technology also offers the possibility of combing diverse immunogens into a single preparation. Furthermore, DNA vaccines are thought to favour inducement of CD8 positive cells.

Helpful background information in relation to DNA vaccination is provided in Donnelly et al "DNA vaccines" Ann. Rev Immunol. 1997 15: 6 17-648, the disclosure of which is included herein in its entirety by way of reference.

The DNA code has 4 letters (A, T, C and G) and uses these to spell three letter "codons" which represent the amino acids the proteins encoded in an organism's genes. The linear sequence of codons along the DNA molecule is translated into the linear sequence of amino acids in the protein(s) encoded by those genes. The code is highly degenerate, with 61 codons coding for the 20 natural amino acids and 3 codons representing "stop" signals. Thus, most amino acids are coded for by more than one codon -in fact several are coded for by four or more different codons.

Where more than one codon is available to code for a given amino acid, it has been observed that the codon usage patterns of organisms are highly non-random. Different species show a different bias in their codon selection and, furthermore, utilisation of codons may be markedly different in a single species between genes which are expressed at high and low levels. This bias is different in viruses, plants, bacteria and mammalian cells, and some species show a stronger bias away from a random codon selection than others. For example, humans and other mammals are less strongly biased than certain bacteria or viruses. For these reasons, there is a significant probability that a mammalian gene expressed in E.coli or a foreign or recombinant gene expressed in mammalian cells will have an inappropriate distribution of codons for efficient expression. It is believed that the presence in a heterologous DNA sequence of clusters of codons or an abundance of codons which are rarely observed in the host in which expression is to occur, is predictive of low heterologous expression levels in that host.

In an embodiment of the present invention provides a polynucleotide sequence which encodes an amino acid sequence, wherein the codon usage pattern of the polynucleotide sequence resembles that of highly expressed mammalian genes. More specfically the polynucleotide sequence is a DNA sequence. Desirably the codon usage pattern of the polynucleotide sequence is typical of highly expressed human genes.

In the polynucleotides of the present invention, the codon usage pattern is altered from that typical of human immunodeficiency viruses to more closely represent the codon bias of the target organism, e.g. a mammal, especially a human. The "codon usage coefficient" is a measure of how closely the codon pattern of a given polynucleotide sequence resembles that of a target species. Codon frequencies can be derived from literature sources for the highly expressed genes of many species (see e.g. Nakamura et.al. Nucleic Acids Research 1996, 24:214-215). The codon frequencies for each of the 61 codons (expressed as the number of occurrences per 1000 codons of the selected class of genes) are normalised for each of the twenty natural amino acids, so that the value for the most frequently used codon for each amino acid is set to 1 and the frequencies for the less common codons are scaled to lie between zero and 1. Thus each of the 61 codons is assigned a value of 1 or lower for the highly expressed genes of the target species. In order to calculate a codon usage coefficient for a specific polynucleotide, relative to the highly expressed genes of that species, the scaled value for each codon of the specific polynuc leotide are noted and the geometric mean of all these values is taken (by dividing the sum of the natural logs of these values by the total number of codons and take the anti-log). The coefficient will have a value between zero and I and the higher the coefficient the more codons in the polyriucleotide are frequently used codons. If a polynucleotide sequence has a codon usage coefficient of 1, all of the codons are "most frequent" codons for highly expressed genes of the target species.

According to the present invention, the codon usage pattern of the polynucleotide will preferably exclude codons with an RSCU value of less than 0.2 in highly expressed genes of the target organism. Alternatively, the codon usage pattern will exclude codons representing <10% of the codons used for a particular amino acid. A relative synonymous codon usage (RSCU) value is the observed number of codons divided by the number expected if all codons for that amino acid were used equally frequently. A polynucleotide of the present invention will generally have a codon usage coefficient (or RSCU) for highly expressed human genes of greater than 0.3, preferably greater than 0.4, most preferably greater than 0.5. Codon usage tables for human can also be found in Geriebank.

In comparison, a highly expressed beta actin gene has a RSCU of 0.747. The codon usage table for a homo sapiens is set out below:

Codon Usage Table 1:

Hoino sapiens [gbpri] : 27143 CDS's (12816923 codons) fields: [triplet] [frequency: per thousand] ([number]) UUU 17.0(217684) UCU 14.8(189419) UAU 12.1(155645) UGU 10.0(127719) UUC 20.5(262753) UCC 17.5(224470) UAC 15.8(202481) TJGC 12.3(157257) UUA 7.3( 93924) UCA 11.9(152074) UAA 0.7( 9195) UGA 1.3( 16025) UUG 12.5(159611) UCG 4.5( 57572) UAG 0.5( 6789) UGG 12.9(165930) CTJU 12.8(163707), CCIJ 17.3(222146) CAU 10.5(134186) CGU 4.6( 59454) CUC 19.3(247391) CCC 20.0(256235) CAC 14.9(190928) CGC 10.8(137865) CUA 7.0( 89078) CCA 16.7(214583) CAA 12.0(153590) CGA 6.3( 80709) CUG 39.7(509096) CCG 7.0( 89619) CAG 34.5(441727) CGG 11.6(148666) AU1J 15.8(202844) ACU 12.9(165392) AAU 17.0(218508) AGU 12.0(154442) AUC 21.6(277066) ACC 19.3(247805) AAC 19.8(253475) AGC 19.3(247583) AUA 7.2( 92133) ACA 14.9(191518) AAA 24.0(308123) AGA 11.5(147264) AUG 22.3(285776) ACG 6.3( 80369) AAG 32.6(418141) AGG 11.3(145276) GUU 10.9(139611) GCU 18.5(236639) GAU 22.4(286742) GGU 10.8(138606) GUC 14.6(187333) GCC 28.3(362086) GAC 26.1(334158) GGC 22.7(290904) GUA 7.0( 89644) GCA 15.9(203310) GAA 29.1(373151) GGA 16.4(210643) GUG 28.8(369006) GCG 7.5( 96455) GAG 40.2(515485) GGG 16.4(209907) Coding GC 52.51% 1st letter GC 56.04% 2nd letter GC 42.35% 3rd letter GC 59.13%

Codon Usage Table 2:

Codon usage for human (highly expressed) genes 1/24/91 (human_high. cod) AmAcid Codon Number /1000 Fraction Gly GGG 905.00 18.76 0.24 Gly GGA 525.00 10.88 0.14 Gly GGT 441.00 9.14 0.12 dy GGC 1867.00 38.70 0.50 Glu GAG 2420.00 50.16 0.75 Glu GAA 792.00 16.42 0.25 Asp GAT 592.00 12.27 0.25 Asp GAC 1821.00 37.75 0.75 Val GTG 1866.00 38.68 0.64 Val GTA 134.00 2.78 0.05 Val GTT 198.00 4.10 0.07 Val GTC 728.00 15.09 0.25 Ala GCG 652.00 13.51 0.17 Ala GCA 488.00 10.12 0.13 Ala GCT 654.00 13.56 0.17 Ala GCC 2057.00 42.64 0.53 Arg AGG 512.00 10.61 0.18 Arg AGA 298.00 6.18 0.10 Ser AGT 354.00 7.34 0.10 Ser AGC 1171.00 24.27 0.34 Lys AAG 2117.00 43.88 0.82 Lys AAA 471.00 9.76 0.18 Asn AAT 314.00 6.51 0.22 Asn AAC 1120.00 23.22 0.78 Met ATG 1077.00 22.32 1.00 lie ATA 88.00 1.82 0.05 Tie ATT 315.00 6.53 0.18 lie ATC 1369.00 28.38 0.77 Thr ACG 405.00 8.40 0.15 Thr ACA 373.00 7.73 0.14 Thr ACT 358.00 7.42 0.14 Thr ACC 1502.00 31.13 0.57 Trp TOG 652.00 13.51 1.00 End TGA 109.00 2.26 0.55 Cys TGT 325.00 6.74 0.32 Cys TGC 706.00 14.63 0.68 End TAG 42.00 0.87 0.21 End TAA 46.00 0.95 0.23 Tyr TAT 360.00 7.46 0.26 Tyr TAC 1042.00 21.60 0.74 Leu TTG 313.00 6.49 0.06 Leu TTA 76.00 1.58 0.02 Phe TTT 336.00 6.96 0.20 Phe TTC 1377.00 28.54 0.80 Ser TCG 325.00 6.74 0.09 Ser TCA 165.00 3.42 0.05 Ser TCT 450.00 9.33 0.13 Ser TCC 958.00 19.86 0.28 Arg CGG 611.00 12.67 0.21 Arg CGA 183.00 3.79 0.06 Arg CGT 210.00 4.35 0.07 Arg CGC 1086.00 22.51 0.37 Gin CAG 2020.00 41.87 0.88 Gin CAA 283.00 5.87 0.12 His CAT 234.00 4.85 0.21 His CAC 870.00 18.03 0.79 Leu CTG 2884.00 59.78 0.58 Leu CTA 166.00 3.44 0.03 Leu CTT 238.00 4.93 0.05 Leu CTC 1276.00 26.45 0.26 Pro CCG 482.00 9.99 0.17 Pro CC.A 456.00 9.45 0.16 Pro CCT 568.00 11.77 0.19 Pro CCC 1410.00 29.23 0.48 As discussed above, the present invention includes use of plasmid DNA and appropriate initiators, promoters, enhancers and other elements, such as for example polyadenylation signals which may be necessary, and which are positioned in the correct orientation, in order to allow for protein expression.

DNA vaccines may be administered in the form of "naked DNA", for example in a liquid formulation administered using a syringe or high pressure jet, or DNA formulated with liposomes or an irritant transfection enhancer, or by particle mediated DNA delivery (PMDD also referred to as particle mediated epidermal delivery PMED). All of these delivery systems are well known in the art.

In a one embodiment the DNA sequence is formulated onto the surface of inert particles or beads suitable for particle mediated drug delivery, for example employing gold beads. In this embodiment of the invention that the polynucleotides of the invention may be utiliscd with immunostimulatory agents. The immunostimulatory agent may be administered at the same time as the polyriucleotide of the invention. In some embodiments the immunostimulatory agent is co-formulated with the DNA vaccine component.

In a one embodiment, the composition is delivered intradermally, by means of a gene gun particularly particle bombardment administration techniques which involve coating the vector on to a bead (eg gold) which are then administered under high pressure into the epidermis; such as, for example, as described in Haynes et al, J Biotechnology 44: 37-42 (1996).

In one illustrative example, gas-driven particle acceleration can be achieved with devices such as those manufactured by Powderject Pharmaceuticals PLC (Oxford, UK) and Powderject Vaccines Inc. (Madison, WI), some examples of which are described in U.S. Patent Nos. 5,846,796; 6,010,478; 5,865,796; 5,584,807; and EP Patent No. 0500 799. This approach offers a needle-free delivery approach wherein a dry powder formulation of microscopic particles, such as polynucleotide, are accelerated to high speed within a helium gas jet generated by a hand held device, propelling the particles into a target tissue of interest, typically the skin. The particles are preferably gold beads of a 0.4 -4.0.tm, more such as 0.6 -2.0 jim diameter and the DNA conjugate coated onto these and then encased in a cartridge or cassette for placing into the "gene gun".

In a related embodiment, other devices and methods that may be useful for gas-driven needle-less injection of compositions of the present invention include those provided by Bioject, Inc. (Portland, OR), some examples of which are described in U.S. Patent Nos. 4,790,824; 5,064,413; 5,312,335; 5,383,851; 5,399,163; 5,520,639 and 5,993,412.

Other methods of administering the nucleic acid directly to a recipient include ultrasound, electrical stimulation, electroporation and microseeding which is described in US-5,697,901.

Uptake of nucleic acid constructs may be enhanced by several known transfection techniques, for example those including the use of transfection agents. Examples of these agents includes cationic agents, for example, calcium phosphate and DEAE-Dextran and lipofectants, for example, lipofectam and transfectam. The dosage of the nucleic acid to be administered can be altered.

Immunostimulatory agents suitable for at least co-administration with DNA include, but this list is by no means exhaustive and does not preclude other agents: synthetic imidazoquinolines such as imiquimod [S-26308, R-837], (Harrison, et al. Reduction of recurrent HSV disease using imiquimod alone or combined with a glycoprotein vaccine', Vaccine 19: 1820-1826, (2001)); and resiquimod [S-28463, R-848] (Vasilakos, et al. Adjuvant activites of immune response modifier R-848: Comparison with CpG ODN', Cellular immunology 204: 64-74 (2000).), Schiff bases of carbonyls and amines that are constitutively expressed on antigen presenting cell and T-cell surfaces, such as tucaresol (Rhodes, J. et a!. Therapeutic potentiation of the immune system by costimulatory Schiff-base-forming drugs', Nature 377: 71-75 (1995)), cytokine, chemokine and co-stimulatory molecules as either protein or peptide, this would include pro-inflammatory cytokines such as GM-CSF, IL-i alpha, IL-i beta, TGF-alpha and TGF -beta, Thi inducers such as interferon gamma, IL-2, IL-12, IL-l5 and IL-18, Th2 inducers such as IL- 4, IL-5, IL-6, IL-lO and IL-13 and other chemokine and co-stimulatory genes such as MCP-l, MIP-l alpha, MIP-l beta, RANTES, TCA-3, CD8O, CD86 and CD4OL, , other immunostimulatory targeting ligands such as CTLA-4 and L-selectin, apoptosis stimulating proteins and peptides such as Fas, (49), synthetic lipid based adjuvants, such as vaxfectin, (Reyes etal., Vaxfectin enhances antigen specific antibody titres and maintains Thl type immune responses to plasmid DNA immunization', Vaccine 19: 3778-3786) squalene, alpha-tocopherol, polysorbate 80, DOPC and cholesterol, endotoxin, [LPS], Beutler, B., Endotoxin, Toll-like receptor 4, and the afferent limb of innate immunity', Current Opinion in Microbiology 3: 23-30 (2000)) ; CpG oligo-and di-nucleotides, Sato, Y. et a!., Immunostimulatory DNA sequences necessary for effective intradermal gene immunization', Science 273 (5273): 3 52-354 (1996).

Hemmi, H. et al., A Toll-like receptor recognizes bacterial DNA', Nature 408: 740-745, (2000) and other potential ligands that trigger Toll receptors to produce Thi -inducing cytokines, such as synthetic Mycobacterial lipoproteins, Mycobacterial protein p1 9, peptidoglycan, teichoic acid and lipid A. A nucleic acid sequence of the present invention may also be administered by means of transformed cells. Such cells include cells harvested from a subject. The naked polynucleotide or vector of the present invention can be introduced into such cells in vitro and the transformed cells can later be returned to the subject. The polynucleotide of the invention may integrate into nucleic acid already present in a cell by homologous recombination events. A transformed cell may, if desired, be grown up in vilro and one or more of the resultant cells may be used in the present invention. Cells can be provided at an appropriate site in a patient by known surgical or microsurgical techniques (e.g. grafting, micro-injection, etc.) In one embodiment the polynucleotide is co-formulated with said polypeptides optionally in the presence of an appropriate adjuvant.

In one embodiment the polynucleotide is NOT delivered intrademally.

In one embodiment the DNA vaccine component is NOT delivered/accelerated through the epidermis into the dermis.

Adjuvant The adjuvants described are likely to be suitable for co-administration and/or co-formulation with a protein/polypeptide and/or DNA component of compositions and methods according to the invention. Nevertheless the suitability may depend on the exact formulation employed.

Adjuvants are described in general in Vaccine Design -the Subunit and Adjuvant Approach eg Powell and Newman, Plenum Press, New York, 1995.

Suitable adjuvants include an aluminium salt such as aluminium hydroxide or aluminium phosphate, but may also be a salt of calcium, iron or zinc, or may be an insoluble suspension of acylated tyrosine, or acylated sugars, cationically or anionically derivatised polysaccharides, or polyphosphazenes.

In one embodiment the formulation of the invention it is preferred that the adjuvant composition employed induces a Th 1 response. However it will be understood that other responses, including other humoral responses, are not excluded.

It is known that certain vaccine adjuvants are particularly suited to the stimulation of either Th I or Th2 -type cytokine responses. Traditionally the best indicators of the Thl:Th2 balance of the immune response after a vaccination or infection includes direct measurement of the production ofThl or Th2 cytokines by T lymphocytes in vitro after restimulation with antigen, and/or the measurement of the IgGI:IgG2a ratio of antigen specific antibody responses.

Thus, a Th I -type adjuvant is one which stimulates isolated T-cell populations to produce high levels of Thi-type cytokines in vivo (as measured in the serum) or ex vivo (cytokines that are measured when the cells are re-stimulated with antigen in vitro), and induces antigen specific imrnunoglobulin responses associated with Thi-type isotype.

Preferred Thl-type immunostimulants which may be formulated to produce adjuvants suitable for use in the present invention include and are not restricted to the following: The Toll like receptor (TLR) 4 ligands, especially an agonist such as a lipid A derivative particularly monophosphoryl lipid A or more particularly 3-deacylated monophoshoryl lipid A (3D-MPL).

3D-MPL is sold under the trademark MPL� by GlaxoSmithKline and primarily promotes CD4+ T cell responses characterized by the production of IFN-g (Thi cells i.e. CD4 T helper cells with a type-I phenotype). It can be produced according to the methods disclosed in GB 2 220 211 A. Chemically it is a mixture of 3-deacylated monophosphoryl lipid A with 3, 4, 5 or 6 acylated chains. Suitably in the compositions of the present invention small particle 3D-MPL is used.

Small particle 3D-MPL has a particle size such that it may be sterile-filtered through a 0.22 jim filter. Such preparations are described in W094/2 1292. Synthetic derivatives of lipid A are known and thought to be TLR 4 agonists including, but not limited to: OM 174 (2-deoxy-6-o-{2-deoxy-2-[(R)-3-dodecanoyloxytetra-decanoylamino] -4-o-phosphono--D-glucopyranosyl]-2-[(R)-3-hydroxytetradecanoylamino] -a-D-glucopyranosyldihydrogenphosphate), (W095/ 14026); OM 294 DP (3S, 9 R) -3--[(R)-dodecanoyloxytetradecanoylamino] -4-oxo-5-aza-9(R)-[(R)-3-hydroxytetradecanoylamino]decan-1,1 0-diol, 1,1 0-bis(dihydrogenophosphate) (W099 /64301 and W000/0462); OM 197 MP-Ac DP (3S-, 9R) -3 -[(R) -dodecanoyloxytetradecanoylamino]-4-oxo-5 -aza-9-{(R)-3-hydroxytetradecanoylamino]decan:I, I 0-diol, I -dihydrogenophosphate 1 0-(6-aminohexanoate) (WOOl/46127).

Other TLR4 ligands which may be used are alkyl glucosaminide phosphates (AGPs) such as those disclosed in W09850399 or US6303347 (processes for preparation of AGPs are also disclosed therein), or pharmaceutically acceptable salts of AGPs as disclosed in US6764840.

Some AGPs are TLR4 agonists, and some are TLR4 antagonists. Both are thought to be useful as adjuvants.

Saponins are also preferred Thi immunostimulants suitable for use in accordance with the invention. Saponins are well known adjuvants and are taught in: Lacaille-Dubois, M and Wagner H. (1996. A review of the biological and pharmacological activities of saponins.

Phytomedicine vol 2 pp 363-386). For example, Quil A (derived from the bark of the South American tree Quillaja Saponaria Molina), and fractions thereof, are described in US 5,057,540 and "Saponins as vaccine adjuvants", Kensil, C. R., Crit Rev Ther Drug Carrier Syst, 1996, 12 (1-2):1-55; and EP 0362 279 BI. The haemolytic saponins QS2I and QSI7 (HPLC purified fractions of Quil A) have been described as potent systemic adjuvants, and the method of their production is disclosed in US Patent No. 5,057,540 and EP 0 362 279 BI Also described in these references is the use of QS7 (a non-haemolytic fraction of Quil-A) which acts as a potent adjuvant for systemic vaccines. Use ofQS2l is further described in Kensil eta!. (1991. J. Immunology vol 146, 43 1-437). Combinations ofQS2l and polysorbate or cyclodextnn are also known (WO 99/10008). Particulate adjuvant systems comprising fractions of QuilA, such as QS2I and QS7 are described in W096/33739 and W096/1 1711. One such system is known as an Iscom and may contain one or more saponins.

The adjuvant of the present invention may in particular comprises a Toll like receptor (TLR) 4 ligand, especially 3D-MPL, in combination with a saponin.

Other suitable adjuvants include TLR 9 ligands (agonists). Thus in one aspect the immunostimulant is an immunostimulatory oligonucleotide containing unmethylated CpG dinucleotides ("CpG"). CpG is an abbreviation for cytosine-guanosine dinucleotide motifs present in DNA. CpG is known in the art as being an adjuvant when administered by both systemic and mucosal routes (WO 96/02555, EP 468520, Davis et al., J.Immunol, 1998, 160(2):870-876; McCluskie and Davis, .J.Immunol., 1998, 16l(9):4463-6). Historically, it was observed that the DNA fraction of BCG could exert an anti-tumour effect. In further studies, synthetic oligonucleotides derived from BCG gene sequences were shown to be capable of inducing immunostimulatory effects (both in vitro and in vivo). The authors of these studies concluded that certain palindromic sequences, including a central CG motif, carried this activity.

The central role of the CG motif in immunostimulation was later elucidated in a publication by Krieg, Nature 374, p546 1995. Detailed analysis has shown that the CG motif has to be in a certain sequence context, and that such sequences are common in bacterial DNA but are rare in vertebrate DNA. The immunostimulatory sequence is often: Purine, Purine, C, G, pyrimidine, pyrimidine; wherein the CG motif is unmethylated. Other unmethylated CpG sequences are also known to be immunostimulatory and may be used in the present invention.

In certain combinations of the six nucleotides a palindromic sequence is present. Several of these motifs, either as repeats of one motif or a combination of different motifs, can be present in the same oligonucleotide. The presence of one or more of these immunostimulatory sequences containing oligonucleotides can activate various immune subsets, including natural killer cells (which produce interferon y and have cytolytic activity) and macrophages (Wooldrige et al Vol 89 (no. 8), 1977). Other unmethylated CpG containing sequences not having this consensus sequence have also now been shown to be immunomodulatory.

CpG when formulated into vaccines, is generally administered in free solution together with free antigen (W096/02555; McCluskie and Davis, supra) or covalently conjugated to an antigen (W098/l 6247), or formulated with a carrier such as aluminium hydroxide ((Hepatitis surface antigen) Davis eta!. supra; Brazolot-Millan et a!., Proc.Natl.Acad.Sci., USA, 1998, 95(26), 53-8).

Other TLR9 agonists of potential interest include immunostimulatory CpR motif containing oligonucleotides and YpG motif containing oligonucleotides (Idera).

Such immunostimulants as described above may be formulated together with carriers, such as for example liposomes, oil in water emulsions, and or metallic salts, including aluminium salts (such as aluminium hydroxide). For example, 3D-MPL may be formulated with aluminium hydroxide (EP 0 689 454) or oil in water emulsions (W095/17210); QS21 may be advantageously formulated with cholesterol containing liposomes (W096/33739), oil in water emulsions (W095/l7210) or alum (W098/15287); CpG may be formulated with alum (Davis et al. supra; Brazolot-Millan supra) or with other cationic carriers.

Combinations of immunostimulants may also be employed in aspects of the present invention, in particular a combination of a monophosphoryl lipid A and a saponin derivative (W094/00 153; W095/17210; WO96/33739; W098/564l4; W099/12565; W099/1 1241), more particularly the combination of QS21 and 3D-MPL as disclosed in W094/00153. Alternatively, a combination of CpG plus a saponin such as QS21 also forms a potent adjuvant for use in the present invention. Alternatively the saponin may be formulated in a liposome or in an ISCOM and combined with an immunostimulatory oligonucleotide.

Thus, suitable adjuvant systems include, for example, a combination of monophosphoryl lipid A, such as 3D-MPL, together with an aluminium salt (eg as described in W000/23 105).

An enhanced system involves the combination of a monophosphoryl lipid A and a saponin derivative particularly the combination ofQS2l and 3D-MPL as disclosed in W094/OOl 53, or a less reactogenic composition where the QS2I is quenched in cholesterol containing liposomes (DQ) as disclosed in W096/33 739. This combination may additionally comprise an immunostimulatory oligonucleotide.

Thus an example adjuvant comprises QS2I and/or MPL and/or CpG.

A particularly potent adjuvant formulation involving QS2I, 3D-MPL & tocopherol in an oil in water emulsion is described in W095/1 7210 and is another preferred formulation for use in the invention.

Another preferred formulation comprises a CpG oligonucleotide alone or together with an aluminium salt.

In a further aspect of the present invention there is provided a method of manufacture of a vaccine formulation as herein described, wherein the method comprises admixing one or more first immunogenic polypeptides according to the invention with a suitable adjuvant.

Particularly preferred adjuvants for use in the formulations according to the invention are as follows: i) 3D-MPL + QS21 in a liposomal formulation (see eg Adjuvant B below) ii) Alum + 3D-MPL iii) Alum + QS21 in a liposomal formulation + 3D-MPL iv) Alum + CpG v) 3D-MPL + QS21 + oil in water emulsion vi) CpG vii) 3D-MPL + QS2I (eg in a liposomal formulation) + CpG viii) QS21+ CpG.

Preferably, the adjuvant is presented in the form of a liposome, ISCOM or an oil-in-water emulsion. In one example embodiment of the invention the adjuvant comprises an oil-in-water emulsion. In another example embodiment of the invention the adjuvant comprises liposomes.

Suitably the adjuvant does not contain any virus components.

Compositions, dosage and administration The present invention further provides a pharmaceutical composition comprising a polynucleotide sequence according to the invention, such as a DNA sequence. In some embodiments the composition comprises a plurality of particles, preferably gold particles, coated with DNA. In alternative embodiments, the composition comprises a pharmaceutically acceptable excipient and a DNA according to the present invention. The composition may also include an adjuvant.

The vaccine compositions of the present invention will generally employ plasmids incorporating the polynucleotide sequence.

In one embodiment the polynucleotide(s) such as DNA is co-formulated with the polypeptide(s)/protein(s).

In one embodiment the co-formulation further comprises adjuvant.

In one embodiment the polynucleotide(s) and polypeptide(s) are co-lyophilised and reconstituted with an adjuvant formulation prior to use.

The compositions of the present invention can be delivered by a number of routes such as intramuscularly, subcutaneously, intraperitonally, intravenously or mucosally.

The quantity of DNA to be administered, is generally in the range of one picogram to I milligram, preferably I picogram to 10 micrograms for particle-mediated delivery, and 100 nanograms to 1 milligram, preferably 10 micrograms to 1 milligram, for other routes, of nucleotide per dose. Alternatively the does may in the range I iL to 1000 p1, for example 1 j.tL to 500 jiL such as 50 p.L to 250 i.tL, more particularly 10, 20, 30, 40, 50, 60, 70, 80, 90 or lOOpL.

The exact quantity may vary considerably depending on the weight of the patient being immunised and the route of administration.

Where PMED delivery is employed the relevant quantity of polynucleotide may be loaded on the the particle.

It is possible for the immunogen component comprising the nucleotide sequence encoding the antigenic peptide, to be administered on a once off basis or to be administered repeatedly, for example, between I and 7 times, preferably between I and 4 times, at intervals between about I day and about 18 months, such as I a month for 1, 2, 3, 4, 5, 6, 7 or more months or I every 3 months for a total of 1, 2, 3, 4, 5, 6, 7 or more deliveries. However, this treatment regime will be significantly varied depending upon the size the patient concerned, the amount of nucleotide sequence administered, the route of administration, and other factors which would be apparent to a skilled.

In one embodiment the DNA vaccine is delivered by sub-cutaneous intra-muscular and/or intravenous or similar parenteral vaccination route or routes.

The naked polynucleotide may be present together with a pharmaceutically acceptable excipient, such as phosphate buffered saline (PBS). DNA uptake may be further facilitated by use of facilitating agents such as bupivacaine, either separately or included in the DNA formulation.

In methods of the invention, the immunogenic polypeptide(s), the polynucleotides and the adjuvant are administered concomitantly.

The adjuvant will be co-formulated with an immunogenic polypeptide. Suitably the adjuvant will also be co-formulated with any other immunogenic polypeptide to be administered.

Typically the polynucleotide is contained in a composition eg a pharmaceutical composition.

The one or more first immunogenic polypeptides, the one or more polynucleotide and an adjuvant may be co-formulated.

Thus, there are provided compositions according to the invention which comprise one or more immunogenic polypeptides, one or more polynucleotides, and an adjuvant.

Compositions and methods according to the invention may involve use of more than one immunogenic polypeptide and/or more than one polynucleotide. Use of multiple antigens is especially advantageous in raising protective immune responses to HIV. Compositions according to the invention may comprise more than one adjuvant.

It may be desirable in co-formulations to mix all the excipients including the adjuvant, followed by addition of the polypetide(s), with the polynucleotide component being added last.

Compositions and methods employed according to the invention may typically comprise a carrier eg an aqueous buffered carrier. Components such as sugars may be included.

Compositions should be administered in sufficient amounts to transduce the target cells and to provide sufficient levels of gene transfer and expression and to permit pathogen-specific immune responses to develop thereby to provide a prophylactic or therapeutic benefit without undue adverse or with medically acceptable physiological effects, which can be determined by those skilled in the medical arts. Conventional and pharmaceutically acceptable routes of administration include, intravenous, intramuscular, intratracheal, subcutaneous, intradermal, epidermal, and other parenteral routes of administration. Routes of administration may be combined, if desired, or adjusted depending upon the gene product or the condition. Most suitably the route is intramuscular, intradermal or epidermal.

Target issues for delivery include muscle, skin and mucous membranes.

When the first immunogenic polypeptide, adjuvant and polynucleoticie are not co-formulated, the different formulations (eg polypeptide/adjuvant and polynucleotide formulations) may be administered by the same route of administration or by different routes of administration.

In on aspect the invention employs around 1-1000tg, or about 2-lOOp.g eg around 4-40p.g, such as 10, 20, 30,40, 50, 60, 70, 80 or 90 p.g immunogenic polypeptide in the relevant formulation.

Dosages will range depending upon the size of the individual and the route of administration.

One of skill in the art may adjust these doses, depending on the ro ute of administration, and the therapeutic or vaccinal application for which the composition is employed.

The amount of adjuvant will depend on the nature of the adjuvant and the immunogenic polypeptide, the condition being treated and the age, weight and health of the subject. Typically for human administration an amount of adjuvant of 1-100 g eg 10-50 tg per dose such as 10, 20, 30, 40, 50, 60, 70, 80 or 90.tg may be suitable.

Suitably an adequate immune response is achieved by a single concomitant administration of the composition or compositions of the invention in methods of the invention. However if the immune response is further enhanced by administration of a further on a second or subsequent occasion (for example after a month or two months) then such a protocol is embraced by the invention. The boosting dose may be selected from polypeptide and ajuvant, DNA, viral vectors such as adeno viral vectors encoding one or more HIV antigens, or a combination of two or of the same such as combination of a polypeptide, polynucleotide and an adjuvant as hereinbefore desscribed according to the invention.

It is thought that specific CD4+ and/or CD8+ T-cell responses may typically be raised after a single concomitant administration of the composition or compositions of the invention in methods of the invention. However we have found that a good antibody responses may require a second or further concomitant administration of the composition or compositions of the invention.

Adjuvant preparations I) The preparation of oil in water emulsion followed the protocol as set forth in W095/17210.

The emulsion contains: 42.72 mg/mI squalene, 47.44 mg/mI tocopherol, 19.4 mg/mI Tween 80.

The resulting oil droplets have a size of approximately 180 nm Tween 80 was dissolved in phosphate buffered saline (PBS) to give a 2% solution in the PBS.

To provide 100 ml two fold concentrate, emulsion 5g of DL alpha tocopherol and 5m1 of squalene were vortexed until mixed thoroughly. 90m1 of PBS/Tween solution was added and mixed thoroughly. The resulting emulsion was then passed through a syringe and finally microfluidised by using an Ml lOS microfluidics machine. The resulting oil droplets have a size of approximately 180 rim 2) Preparation of oil in water emulsion with QS2I and MPL Sterile bulk emulsion was added to PBS to reach a final concentration of 500 jii of emulsion per ml (v/v). 3 D-MPL was then added. QS21 was then added. Between each addition of component, the intermediate product was stirred for 5 minutes. Fifteen minutes later, the pH was checked and adjusted if necessary to 6.8 +1-0.1 with NaOH or HCI. The final concentration of 3D-MPL and QS2 I was 100 j.ig per ml for each.

3) Preparation of liposomal MPL A mixture of lipid (such as phosphatidylcholine either from egg-yolk or synthetic) and cholesterol and 3D-MPL in organic solvent, was dried down under vacuum (or alternatively under a stream of inert gas). An aqueous solution (such as phosphate buffered saline) was then added, and the vessel agitated until all the lipid was in suspension. This suspension was then microfluidised until the liposome size was reduced to about 100 nm, and then sterile filtered through a 0.2 jim filter. Extrusion or sonication could replace this step.

Typically the cholesterol: phosphatidyicholine ratio was 1:4 (w/w), and the aqueous solution was added to give a final cholesterol concentration of 1 0 mg/mI.

The final concentration of MPL is 2 mg/mI.

The liposomes have a size of approximately 100 nm and are referred to as SUV (for small unilamelar vesicles). The liposomes by themselves are stable over time and have no ftisogenic capacity.

4) Preparation of Adjuvant B ("adj B") Sterile bulk of SUV was added to PBS. PBS composition was Na2HPO4: 9 mM; KJ-12P04: 48 mM; NaCI: 100 mM pH 6.1. QS21 in aqueous solution was added to the SUV. The final concentration of 3D-MPL and QS2 1 was 100.tg per ml for each. This mixture is referred as Adjuvant B. Between each addition of component, the intermediate product was stirred for 5 minutes. The pH was checked and adjusted if necessary to 6.1 +1-0.1 with NaOH or HCI.

Preparation of p24-RT-Nef-P17 protein ("F4") F4 was prepared as described in W02006/013 106 Example I, codon-optimised method.

EXAMPLES

Example 1: Optimisation of p55 gag (p17, p24, p13) to resemble codon usage of highly expressed human genes.

Gene of interest A synthetic gene coding for the p55gag antigen of the HIV-1 dade B strain HXB2 (GenBank entry K03455), optimised for expression in mammalian cells was assembled from overlapping oligonucleotides by PCR.

Optimisation involved changing the codon usage pattern of the viral gene to give a codon frequency closer to that found in highly expressed human genes. Codons were assigned using a statistical Visual Basic program called Syngene (an updated version of Calcgene, written by R.S.

Hale and G. Thompson, Protein Expression and Purification Vol. 12 pp 185-188, 1998) Cloning: The 1 528bp gag PCR product was gel purified, cut with restriction endonucleases NotI and Barn HI and ligated into NotlIBamHI cut vector WRG7077. This places the gene between the CMV promoter/intron A and the Bovine growth hormone polyadenylation signal.

Clones were sequenced and checked for errors. No single clone was 100% correct. Regions of correct sequence from two clones were therefore combined by overlapping PCR using appropriate combinations of the optimisation oligo set to give a full length codon optimised gag gene. This final clone was subsequently found to contain a single nucleotide deletion which resulted in a frame shift and premature termination of translation. The deletion was repaired by cutting out the region of the gene containing the incorrect sequence and cloning in the correct sequence from the equivalent region of another clone. This gave the final codon optimised p55 gag clone: Gagoptrpr2. (See figure 2) Example 2: Production of a pl7/p24 truncated Nef fusion gene Gene of interest The p17 and p24 portions of the p55gag gene derived from the HIV-1 dade B strain HXB2 was PCR amplified from the plasmid pHXB2Pr (B.Maschera, � Furfine and E.D. Blair 1995 J.Virol 69 543 1-5436). pHXB2Pr. 426bp from the 3' end of the HXB2 nef gene were amplified from the same plasmid. Since the HXB2 nef gene contains a premature termination codon two overlapping PCRs were used to repair the codon (TGA [stop] to TGG [Trp]) The p17/p24linker and trNEFlinker PCR products were joined to form the pl7p24trNEF fusion gene (figure 3) in a PCR reaction (antisense).

The I 542bp product was gel purified, cut with restriction endonucleases NotI and BamHI and cloned into the NotI BamHI sites of vector WRG7077. This places the gene between the CMV promoter/intron A and the Bovine growth hormone polyadenylation signal.

Example 3: Production of an Gag p17/24opt/trNefl (Gagopt/NeP) fusion gene.

Gene of interest The p171p24 portion of the codon optimised p55gag gene derived from the HJV-1 dade B strain HXB2 was PCR amplified from the plasmid pGagOPTrpr2. The truncated HXB2 Nef gene with the premature termination codon repaired (TGA [stop] to TGG [Tip]) was amplified by PCR from the plasmid 7O77trNef2O. The two PCR products were designed to have overlapping ends so that the two genes could be joined in a second PCR.

The 1544bp product was gel purified, cut with restriction endonucleases Noti and Bami-il and cloned (see figures) into the NotI Bam}1I sites of vector WRG7077. This places the gene between the CMV promoter/intron A and the Bovine growth hormone polyadenylation signal.

Example 4: Plasmid: p7077-RT3 Clone #A Gene of interest: A synthetic gene coding for the RT portion of the poi gene of HJV-1 dade B strain HXB2, optimised for expression in mammalian cells assembled from overlapping oligonucleotides by PCR. The sequence cloned is equivalent to positions 2550-4222 of the HXB2 reference sequence (GenBank entry K03455). To ensure expression the cloned sequence has two additional codons at the 5' end not present in the original gene -AUG GGC (Met Gly).

Optimisation involved changing the codon usage pattern of the viral gene to give a codon frequency closer to that found in highly expressed human genes, but excluding rarely used codons. Codons were assigned using a statistical Visual Basic program called Syngene (an updated version of Calcgene, written by R.S. Hale and G. Thompson, Protein Expression and Purification Vol. l2pp 185-188, 1998) The final clone was constructed from two intermediate clones, # 16 and #21.

Cloning: The 1.7kb PCR products were gel purified, cut with NotI and Bami-Il and PCR cleaned, before being ligated with NotI / Bami-lI cut pWRG7O77. This places the gene between the CMV promoter and bovine growth hormone polyadenylation signal. Clones were sequenced. No clone was 100% correct, but clone #16 was corrected by replacing the 403bp KpnI-BamI-II fragment containing 3 errors with a correct Kpnl-BamHI fragment from clone#21. The final clone was verified by sequencing. (see figure 5) Example 5: Optimised RT Gene of interest The synthetic gene coding for the RI portion of the pol gene of HIV-1 dade B strain HXB2, optimised for expression in mammalian cells was excised from plasmid p7077-RT3 as a 1697bp NotI / BamHI fragment, gel purified, and cloned into the NotI & BamHI sites of p731 3-ie (derived from pspC3l) to place the gene downstream of an Iowa length HCMV promoter + exoni, and upstream of a rabbit globin poly-adenylation signal. (R7004 p27) (figure 6)

Example 6

Plasmid: 7O77trNef2O Gene of interest The insert comprises part of the Nef gene from the HIV-1 dade B strain HXB2. 195bp are deleted from the 5' end of the gene removing the codons for the first 65 amino acids of Nef. In addition the premature termination codon in the published HXB2 nef sequence has been repaired (TAG to TGG [Trp]) as has been described for plasmid p1 7/24trNEF1. The truncated nef sequence was PCR amplified from the plasmid p1 7/24trNefl. The sequence cloned is equivalent to positions 8992-9417 of the HXB2 reference sequence (GenBank entry K03455). To ensure expression the cloned sequence has an additional codon at the 5' end not present in the original gene -AUG (Met).

Primers: StrNef (sense) ATAAGAATGCGGCCGCCATGGTGGGTTTTCCAGTCACACCTT [SEQ ID NO: 11] AStrNef (antisense) CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [SEQ ID NO: 12] PCR: 94° C 2mm, then 25 cycles: 940 C 3Osec, 500 C 3Osec, 72° C 2mm, ending 720 C 5mm Cloning: The 455bp RT PCR product was gel purified, cut with restriction endonucleases Noti and Barn HI and ligated into NotI/BamHI cut vector WRG7077. This places the gene between the CMV promoter/intron A and the Bovine growth hormone polyadenylation signal.

Example 7

Plasmid: 7077RT 8 Gene of interest The RT portion of the pol gene was derived from the HIV-1 dade B strain HXB2. It was PCR amplified from the plasmid p7077Poll4.

The sequence cloned is equivalent to positions 2550-4234 of the HXB2 reference sequence (GenBank entry K03455). To ensure expression the cloned sequence has two additional codons at the 5' end not present in the original gene -AUG GGC (Met Gly).

Primers: SRT (sense) ATAGAATGCGGCCGCCATGGGCCCCATTAGCCCTATTGAGACT [SEQ ID NO: 13] ASRT (antisense) CGCGGATCCTTAATCTAkAAATAGTACTTTCcTGATT [SEQ ID NO: 14] PCR: 94° C 2mm, then 25 cycles: 94° C 30sec, 50° C 30sec, 72° C 4mm, ending 72° C 5mm Cloning: The 1 720bp RT PCR product was gel purified, cut with restriction endonucleases NotI and Barn HI and ligated into NotIIBamHI cut vector WRG7077. This places the gene between the CMV promoter/intron A and the Bovine growth hormone polyadenylation signal.

Example 8

p1 7/24optfRT/trNefl3 (GagoptfRT/Nef') This construct contains a PCR that causes an R to H amino acid change.

Gene of interest: The pl7/p24 portion of the codon optimised p55gag gene derived from the HIV-I dade B strain HXB2 was PCR amplified from the plasmid pGagOPTrpr2. The RT coding sequence was PCR amplified from the plasmid 7077RT 8. The truncated HXB2 Nef gene with the premature termination codon repaired (TGA [stop] to TGG [TrpJ) was amplified by PCR from the plasmid 7O77trNef2O. The three PCR products were designed to have overlapping ends so that the three genes could be joined in a second PCR.

Primers: (P17/24) Spl7p24opt (sense) ATAGAATGCGGCCGCCATGGGTGCCCGAGCTTCGGT [SEQ ID NO: 15] ASpl7p24optRTlinker (antisense) TGGGGCCCATCAACACTCTGGCTTTGTGTC [SEQ ID NO: 16] PCR: 94° C 1mm, then 20 cycles: 94° C 3Osec, 50° C 30sec, 72° C 2mm, ending 72° C 4mm The II l4bp p17/24opt product was gel purified. (RT)

Spl7p24optRTlinker (sense) CAGAGTGTTGATGGGCCCCATTAGCCCTAT [SEQ ID NO: 17] ASRTtrNef linker (antisense) AACCCACCATATCTAAAAATAGTACTTTCC [SEQ ID NO: 18] PCR: as above The 1711 bp RT PCR product was gel purified (5' truncated nef) SRTtrNef linker (sense) CTATTTTTAGATATGGTGGGTTTTCCAGTCAC [SEQ ID NO: 9] AStrNef (antisense) CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [SEQ ID NO: 10] PCR as above.

The 448bp product was gel purified.

The three PCR products were then stitched together in a second PCR with primers Sp I 7/24opt and AstrNef.

PCR: 940 C 1mm, then 30 cycles: 940 C 3Osec, 500 C 30sec, 72° C 4mm, ending 72° C 4mm The 3253bp product was gel purified, cut with restriction endonucleases Noti and BamHI and cloned into the Noti BamHI sites of vector WRG7077. This places the gene between the CMV promoter/intron A and the Bovine growth hormone polyadenylation signal.

Example 9

Plasmid: pGRN#l6 (p17/p24opt corr IRT/trNef.) Gene of interest: The polyprotein generated by p1 7/24opt/RT/trNefl 3 (GagoptlRT/Nef') was observed to express a truncated product of --3OkDa due to a cluster of unfavourable codons within p24 around aminoacid 270. These were replaced with optimal codons by PCR stitching mutagenesis.

p17/24optIRT/trNefl 3 was used as a template to amplify the portion of Gag 5' to the mutation with primers Sp17/p24opt and GTR-A, and the portion of Gag 3' to the mutation with primers GTR-S and Asp I 7/p24optRTlinker. The overlap of the products contained the codon changes, and the gel purified products were stitched together using the Sp 1 7/p24opt and Asp 1 7/p24optRTlinker primers. The product was cut with NotI and Agel and inserted into similarly cut p1 7/24opt/RT/trNefl 3, to generate pGRN. Clone #16 was verified and progressed.

Primers: 5' PCR: Spl7p24opt (sense) ATAAGAATGCGGCCGCCATGGGTGCCCGAGCTTCGGT [SEQ ID NO: 21] GTR-A (Antisense) GCGCACGATCTTGTTCAGGCCCAGGATGATCCACCGTTTATAGATTTCTCC [SEQ ID NO: 221 3' PCR Sense: GTR-S (Sense) ATCCTGGGCCTGAACAAGATCGTGCGCATGTACTCTCCGACATCCATCC [SEQ ID NO: 23] ASpl7p24optRTlinker (antisense) TGGGGCCCATCAACACTCTGGCTTTGTGTC [SEQ ID NO: 241 PCR conditions for individual products and stitch, using PWO DNA polymerase (Roche): 95°C 1mm, then 20 cycles 95°C 30s, 55°C 30s, 72°C 180s, ending 72°C 120s and 4°C hold.

The 11 l4bp product was gel purified and cut with Not! and Age! to release a 6647bp fragment which was gel purified and ligated into Not! / AgeI cut gel purified p17/24opt/RT/trNefl3 to generate pGRN#16.

Example 10:

Plasmid: p73i-GRN2 Clone #19 (p17/p24(opt)/RT(opt)trNel) -repaired Gene of interest: The pi7/p24 portion of the codon optimised gag, codon optimised RT and truncated Nef gene from the HIV-1 dade B strain HXB2 downstream of an Iowa length HCMV promoter + exon 1, and upstream of a rabbit 3-globin poly-adenylation signal.

Plasmids containing the trNef gene derived from plasmid p1 7/24trNefl contain a PCR error that gives an R to H amino acid change 19 amino acids from the end of nef. This was corrected by PCR mutagenesis, the corrected nefPCR stitched to codon optimised RT from p7077-RT3, and the stitched fragment cut with Apal and BamHI, and cloned into ApaIfBamHI cut p73i-GRN.

Primers: PCR coRT from p7077-RT3 using primers: (Polymerase = PWO (Roche) throughout.

Sense: Ui

GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGTGCCGGTGPGCTGCCCG

GGAT (SEQ ID NO: 25) AScoRT-Nef GGTGTGACTGGAAAACCCACCATCAGCACCTTTCTAATCCCCGC [SEQ ID NO: 261 Cycle: 95°C(30s) then 20 cycles 95°C(30s), 55°C(30s), 72°C(180s), then 72°C(120s) and hold at 4°C The 1.7kb PCR product was gel purified.

PCR 5' Nef from p17/24trNefl using primers: Sense: S-Nef ATGGTGGGTTTTCCAGTCACACC [SEQ ID NO: 17] Antisense: ASNef-G: GATGAAATGCTAGGCGGCTGTCAAACCTC [SEQ ID NO: 18] Cycle: 95°C(30s) then 15 cycles 95°C(30s), 55°C(30s), 72°C(60s), then 72°C(120s) and hold at 4°C PCR 3' Nef from p17/24trNefl using primers: Sense: SNEF-G GAGGTTTGACAGCCGCCTAGCATTTCATC [SEQ ID NO: 29] Ant isense: AStrNef (antisense) CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [SEQ ID NO: 30] Cycle: 95°C(30s) then 15 cycles 95°C(30s), 55°C(30s), 72°C(60s), then 72°C(120s) and hold at 4°C The PCR products were gel purified. Initially the two Nef products were stitched using the 5' (S-Net) and 3' (AstrNef) primers.

Cycle: 95°C(30s) then 15 cycles 95°C(30s), 55°C(30s), 72°C(60s), then 72°C(180s) and hold at 4°C.

The PCR product was PCR cleaned, and stitched to the RT product using the UI and AstrNef pnmers: Cycle: 95°C(30s) then 20 cycles 95°C(30s), 55°C(30s), 72°C(180s), then 72°C(180s) and hold at 4°C The 2.1kb product was gel purified, and cut with Apal and BamHI. The plasmid p731-GRN was also cut with Apal and BamHI gel purified and ligated with the Apal-Bam RT3trNef to regenerate the p1 7/p24(opt)[RT(opt)trNef gene.

Example 11

p731-GN2 Clone #2 (p17/p24opt/trNel) -repaired Gene of interest: The p1 7/p24 portion of the codon optimised gag and truncated Nef genes from the HIV-I dade B strain HXB2 downstream of an Iowa length HCMV promoter + exoni, and upstream of a rabbit f3-globin poly-adenylation signal.

Plasmids containing the trNef gene derived from plasmid p1 7/24trNefl contain a PCR error that gives an R to H amino acid change 19 amino acids from the end of Nef. This was corrected by PCR mutagenesis and the corrected fragment cut with BglII and BamHI, and cloned into BglIIIBamHI cut p73 I-GN. (Figure 12) regenerate the corrected p1 7/p24optltrNef fusion gene downstream of the Iowa length HCMV promoter + exon 1, and upstream of the rabbit -globin polyadenylation signal.

PCR 5' Nef from p17/24trNefI using primers: Polymerase = PWO (Roche) throughout.

Sense: S-Nef ATGGTGGGTTTTCCAGTCACACC [SEQ ID NO: 311 Antisense: ASNef-G: GATGAAATGCTAGGCGGCTGTCAAACCTC [SEQ ID NO: 321 Cycle: 95°C(30s) then 15 cycles 95°C(30s), 55°C(30s), 72°C(60s), then 72°C(120s) and hold at 4°C PCR 3' Nef from p17/24trNefl using primers: Sense: SNEF-G GAGGTTTGACAGCCGCCTAGCATTTCATC [SEQ ID NO: 231 Antisense: AStrNef CGCGGATCCTCAGCAGTTCTTGAGTACTCC (SEQ ID NO: 24] Cycle: 95°C(30s) then 15 cycles 95°C(30s), 55°C(30s), 72°C(60s), then 72°C(120s) and hold at 4°C The PCR products were gel purified, and stitched using the 5' (S-Nef) and 3' (AstrNef) primers.

Cycle: 95°C(30s) then 15 cycles 95°C(30s), 55°C(30s), 72°C(60s), then 72°C(l 80s) and hold at 4°C.

The PCR product was PCR cleaned, cut with BglII / BamHI, and the 367bp fragment gel purified and cloned into BglII/BamHI cut gel purified p73i-GN.

Example 12

Plasmid: p731-RT w229k (inactivated RT) Gene of Interest: Generation of an inactivated RT gene downstream of an iowa length HCMV promoter + exon 1, and upstream of a rabbit -globin poly-adenylation signal.

Due to concerns over the use of an active HIV RT species in a therapeutic vaccine inactivation of the gene was desirable. This was achieved by PCR mutagenesis of the RT (derived from P731-GRN2) amino acid position 229 from Trp to Lys (R7271 p1-28).

Primers: PCR 5' RT + mutation using primers: (polymerase = PWO (Roche) throughout) Sense: RT3-u:1 kATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGTGCCGGTGAAGCTGAAACCCG GGAT [SEQ ID NO: 35] Antisense: ASc0RT-Trp229Lys GGAGCTCGTAGCCCATCTTCAGGAATGGCGGCTCCTTCT [SEQ ID NO: 361 Cycle: I x [94°C (3 Os)] 15 x [94°C (30s)/55°C (30s)/72°C (60s)] 1 x [72°C (1 80s)] PCR gel purify PCR 3' RT + mutation using primers: Antiense: RT3-1:1

GAATTCGGATCCTTACAGCACCTTTCTAATCCCCGCACTCACCAGCTTGTCGACCTGCTCGTTG

CCGC [SEQ ID NO: 37] Sense: Sc0RT-Trp229Lys CCTGAAGATGGGCTACGAGCTCCATG [SEQ ID NO: 38] Cycle: 1 x [94°C (30s)] 15 x [94°C (30s)/55°C (30s)/72°C (óOs)] I x [72°C (180s)] PCR gel purify The PCR products were gel purified and the 5' and 3' ends of RT were stitched using the 5' (RT3-U1) and 3' (RT3-L1) primers.

Cycle: I x [94°C (30s)J x [94°C (30s)/55°C (30s)/72°C (120s)] 1 x [72°C (180s)] The PCR product was gel purified, and cloned into p7313ie, utilising NotI and BamHl restriction sites, to generate p731-RT w229k. (See figure 13)

Example 13:

Plasmid: p73i-Tgrn (#3) Gene of interest: The p17/p24 portion of the codon optimised gag, codon optimised RT and truncated Nef gene from the HIV-1 dade B strain HXB2 downstream of an Iowa length HCMV promoter + exon 1, and upstream of a rabbit 3-globin poly-adenylation signal.

Triple fusion constructs which contain an active form of RT, may not be acceptable to regulatory authorities for human use thus inactivation of RT was achieved by Insertion of a NheI and Apal cut fragment from p73i-RT w229k, into NheJIApaI cut p73i-GRN2#19 (Figure 14). This results in a W -+ K change at position 229 in RI.

Example 14

p731-Tnrg (#16) Gene of interest: The truncated Nef, inactivated codon optimised RT and p1 7/p24 portion of the codon optimised gag gene from the HIV-1 dade B strain HXB2 downstream of an Iowa length HCMV promoter + exoni, and upstream of a rabbit 3-globin poly-adenylation signal.

The order of the genes in the polyprotein encoded by p73i-Tgrn were rearranged by PCR and PCR stitching to generate p731-Tnrg (Figure 15). Each gene was PCR amplified and gel purified prior to PCR stitching of the genes to form a single polyprotein. The product was gel purified, NotIIBamHI digested and ligated into NotI/BamHI cut p7313ie.

Primers: trNef PCR S-Nef (Not I) CATTAGAGCGGCCGCGATGGTGGGTTTTCCAC [SEQ ID NO: 39] AS-Nef-coRT linker GATGGGACTGATGGGGCCCATGCAGTTCTTGAACTACTCCGG [SEQ ID NO: 40) RTw229k PCR S-coRT ATGGGCCCCATCAGTCCCATCGAG [SEQ ID NO: 41] AS-coRT-p17p24 linker CAGTACCGAAGCTCGGGCACCCATCAGCACCTTTCTAATCCCCGC [SEQ ID NO: 42] pl7p24opt PCR S-pl7p24opt ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 43] AS-pl7p24opt (BarnHI) GATGGGGGATCCTCACAACACTCTGGCTTTGTGTCC [SEQ ID NO: 44] PCR conditions for individual products and stitching using VENT DNA polymerase (NEB): 1 x [94°C (3 Os)] x [94°C (30s)/55°C (30s)/72°C (120s [p1 7p24 or RT] or 60s [trNefj)} I x [72°C (240s)] The PCR products were gel purified and used in a PCR stitching utilising the primers S-trNef (NotI) and AS-p 1 7p24opt (BamHI): I x [94°C (3Os)] 25 x [94°C (3Os)/55°C (30s)/72°C (210s)] I x [72°C (240s)] The 3000bp product was gel purified and cut with NotI and BamHI which was PCR cleaned and ligated into NotI/BamHI digested gel purified p7313ie to generate p73i-Tnrg.

Example 15:

Plasmid: P73i-Tngr (#3) Gene of Interest: The truncated Nef, p1 7/p24 portion of the codon optimised gag and inactivated codon optimised RT gene from the HIV-I dade B strain HXB2 downstream of an Iowa length HCMV promoter + exoni, and upstream of a rabbit 3-g1obin poly-adenylation signal.

The order of the genes in the polyprotein encoded by p73i-Tgrn were rearranged by PCR to generate p731-Tngr (Figure 16). Codon optimised pl'7/p24 and RT were generated as a single product, and PCR stitched to amplified trNef. The product was gel purified, NotTfBamHI digested and ligated into NotI/BamHI cut p7313ie.

Primers: P17/p24 -RT 3'PCR: Spl7p24opt (sense) ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 45] RT3 1:1 (antisense)

GAATTCGGATCCTTACAGCACCTTTCTAATCCCCGCACTCACCAGCTTGTCGACCTGCTCGTTG

CCGC [SEQ ID NO: 46] TrNef 5'PCR S-Nef (NotI) CATTAGAGCGGCCGCGATGGTGGGTTTTCCAC [SEQ ID NO: 47] AS-Nef-p17p24 CAGTACCGAAGCTCGGGCACCCATGCAGTTCTTGAACTACTCCGG [SEQ ID NO: 48] PCR conditions for individual products and stitching using VENT DNA polymerase (NEB): I x [94°C (30s)] x [94°C (30s)/55°C (30s)/72°C (180s [p17p24+RT] or 60s [trNef] or 210s [stitching])] I x [72°C (240s)] The 3000bp product was gel purified and cut with NotI and BaniHI which was PCR cleaned and ligated into NotI/BamHI digested gel purified p7313ie to generate p73i-Tngr.

Example 16:

Plasmid: p731-Trgn (#6) Gene of interest: The inactivated codon optimised RT, pl7/p24 portion of the codon optimised gag and truncated Nef gene from the HIV-i dade B strain HXB2 downstream of an Iowa length HCMV promoter + exoni, and upstream of a rabbit -globin poly-adenylation signal.

The order of the genes within the construct was achieved by PCR amplification of p17p24-trNef and RTw229k from the plasmids p731-GN2 and p731-RTw229k respectively. PCR stitching was performed and the product gel purified and NotI/BamHI cut prior to ligation with NotIIBamHI digested p7313ie. Sequencing revealed that p17p24 was not fully optimised a 700bp fragment was then AgeIIMunI cut from the coding region and replaced with MunIIAge fragment from p73i-Tgrn#3 containing the correct coding sequence. (See figure 17).

Primers: p17p24-trNef PCR S-pl7p24opt ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 49] AstrNef (BamNI) RTw229k RT3-U: 1

GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGTGCCGGTGAAGCTGAAACCCG

GGAT [SEQ ID NO: 50] AS-coRT-pl7p24opt linker CAGTACCGAAGCTCGGGCACCCATCAGCACCTTTCTAJTCCCCGC [SEQ ID NO: 51] PCR conditions for individual products and stitching using VENT DNA polymerase (NIEB): I x [94°C (3 Os)] x [94°C (30s)/55°C (30s)/72°C (120s (PCR) or 180s (stitching) I x [72°C (240s)] The 3000bp product from the PCR stitch was gel purified and cut with NotI and BamBI which was PCR cleaned and ligated into NotIfBamHI digested gel purified p7313ie to generate p73i-Tngr. Sequence analysis showed that p1 7p24 sequence obtained from p731-GN2 was not fully codon optimised and that this had been carried over into the new plasmid. This was rectified by cutting a 700bp fragment from p73i-Tngr cut with MunI and Agel, and replacing it by ligation with a 700bp MunIlAgeI digested product from p73i-Tgrn to generate the construct p73!-Tngr#6.

Example 17:

Plasmid: p73i-Trng (#11) Gene of Interest: The inactivated codon optimised RT, truncated Nef and p17/p24 portion of the codon optimised gag gene from the HIV-. 1 dade B strain HXB2 downstream of an Iowa length HCMV promoter + exon I, and upstream of a rabbit f3-globin poly-adenylation signal.

The order of the genes within the construct was achieved by PCR amplification of the RT-trNef and p17p24 genes from p73i-Tgrn. PCR stitching of the two DNA fragments was performed and the 3kb product gel purified and NotIJBamHI cut prior to ligation with NotIIBamHI digested p7313ie, and yielded p731 Trng (#1 1).

Primers: RTw229k-trNef RT3 -U: 1

GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGTGCCGGTGAAGCTGAPACCCG

GGAT [SEQ ID NO: 52] AS-Nef-pl7p24opt linker CAGTACCGAAGCTCGGGCACCCATGCAGTTCTTGAACTACTCCGG [SEQ ID NO: 53] P17p24 S-pl7p24opt ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 54] AS-pl7p24opt (BamHI) GATGGGGGATCCTCACA.CACTCTGGCTTTGTGTCC [SEQ ID NO: 55] PCR conditions for individual products and stitching using VENT DNA polymerase (NEB): I x [94°C (3 Os)] x [94°C (30s)/55°C (30s)/72°C (120s (PCR of genes) or 180s (stitching) 1 x [72°C (240s)] The 3000bp product from the PCR stitch was gel purified and cut with NotI and Bami-lI which was PCR cleaned and ligated into NotIfBamHl digested gel purified p7313ie to generate p73i-Tngr.

Example 18 :

p73i-Tgnr (#11) Gene of interest: The p1 7ip24 portion of the codon optimised gag, truncated Nef and codon optimised inactivated RT gene from the HIV-I dade B strain HXB2 downstream of an Iowa length HCMV promoter + exoni, and upstream of a rabbit 3-globin poly-adenylation signal.

The order of the genes within the construct was achieved by PCR amplification ofpl7p24-trNef and RTw229k from the plasmids p73i-GN2 and p731-RTw229k respectively. PCR stitching was performed and the product gel purified and NotIfBamHI cut prior to ligation with Noti/Bami-LI digested p7313ie. Two sequence errors were spotted in the sequence (pl7p24 and RT) which were subsequently repaired by replacement with correct portions of the genes utilising restriction sites within the polyprotein. (See figure 19).

Primers: p17p24-trNef PCR S-pl7p24opt ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 561 AS -Nef -coRTi inker GATGGGACTGATGGGGCCCATGCAGTTCTTGAACTACTCCGG [SEQ ID NO: 573 RTw22 9k S- coRT ATGGGCCCCATCAGTCCCATCGAG [SEQ ID NO: 581 RT3-1:1

GAATTCGGATCCTTACAGCACCTTTCTAATCCCCGCACTCACCAGCTTGTCGACCTGCTCGTTG

CCGC [SEQ ID NO: 59] PCR conditions for individual products and stitching using VENT DNA polyrnerase (NEB): 1 x [94°C (30s)] x [94°C (30s)/55°C (30s)/72°C (120s (PCR) or 180s (stitching) 1 x [72°C (240s)] The 3000bp product was gel purified and cut with NotI and BamHI which was PCR cleaned and ligated into NotIJBamHI digested gel purified p7313ie to generate p73i-Tngr. Sequencing revealed that p17p24 was not fully optimised a 700bp fragment was subsequently AgeIfMunI cut from the coding region and replaced with MunIIAge fragment from p73i-Tgrn#3 containing the correct coding sequence. The polyprotein also contained a single point mutation (G2609A) resulting in an amino acid substitution ofThrto Ala in the RT portion of the polyprotein. The mutation was corrected by ApaLfBamHl digestion of the construct and PCR clean up to remove the mutated sequence, which was replaced by ligation with an ApalIBamHI digested portion of RT from p73i-Tgnr.

Example 19:

Preparation of plasmid-coated gold slurry' for gene gun' DNA cartridges Plasmid DNA (approximately I tgIti), eg. 100 ug, and 2tm gold particles, eg. 50 mg, (PowderJect), were suspended in 0.05M spermidine, eg. 100 j.tL, (Sigma). The DNA was precipitated on to the gold particles by addition of IM CaCl2, eg. lOOp.L (American Pharmaceutical Partners, Inc., USA). The DNA/gold complex was incubated for 10 minutes at room temperature, washed 3 times in absolute ethanol, eg. 3 x 1 ml, (previously dried on molecular sieve 3A (BDH)). Samples were resuspended in absolute ethanol containing 0.05mg/mi of polyvinylpyrrolidone (PVP, Sigma), and split into three equal aliquots in 1.5 ml microfuge tubes, (Eppendorf). The aliquots were for analysis of(a) gold slurry', (b) eluate-plasmid eluted from (a) and (c) for preparation of goldl plasmid coated Tefzel cartridges for the gene gun', (see Example 3 below). For preparation of samples (a) and (b), the tubes containing piasmid DNA / gold slurry' in ethanol / PVP were spun for 2 minutes at top speed in an Eppendorf 5418 microfuge, the supernatant was removed and the gold slurry' dried for 10 minutes at room temperature. Sample (a) was resuspended to 0.5 -1.0 p.g / Ill of plasmid DNA in TE pH 8.0, assuming approx. 50 % coating. For elution, sample (b) was resuspended to 0.5 - 1.0 ug / ul of plasmid DNA in TE pH 8.0 and incubated at 37°C for 30 minutes, shaking vigorously, and then spun for 2 minutes at top speed in an Eppendorf 5418 microfuge and the supernatant, eiuate, was removed and stored at -20°C. The exact DNA concentration eluted was determined by spectrophotometric quantitation using a Genequant 11 (Pharmacia Biotech).

Example 20:

Preparations of Cartridges for DNA immunisation Preparation of cartridges for the Acceli gene transfer device was as previously described (Eisenbraun et al DNA and Cell Biology, 1993 Vol 12 No 9 pp 791-797; Pertner et al). Briefly, piasmid DNA was coated onto 2 tm gold particles (DeGussa Corp., South Piainfieid, N.J., USA) and loaded into Tefzel tubing, which was subsequently cut into 1.27 cm lengths to serve as cartridges and stored desiccated at 4°C until use. In a typical vaccination, each cartridge contained 0.5 mg gold coated with a total of 0.5 tg DNA/cartridge.

Example 21:

Method for measuring Immune Response to HIV antigens following DNA vaccination utilising the gene gun.

Mice may be vaccinated with antigens encoded by polynucleotide.

Plasmid can be delivered to the shaved target site of abdominal skin of, for example Fl (C3H x Balb/c) mice. Mice may, for example be given a primary immunisation DNA on day 0 and on the same given an immunization with adjuvanted protein. Cellular responses may then be detected, for example on day 40 using IFN.-gamma Elispot.

Example 22:

Assays for Immunogenicity of Vaccine Constructs 1. Cellular Assays One cellular immune response comprises cytotoxic CD8 cells and helper CD4 cells. A sensitive method to detect specific CD8 and CD4 cells is the ELispot assay which can be used to quantify the number of cells capable of secreting interferon-i or IL-2. The ELispot assay relies on the capture of cytokines secreted from individual cells. Briefly, specialised microtitre plates may be coated with anti-cytokine antibodies. Splenocytes isolated from immunised animals are incubated overnight in the presence of specific peptides representing known epitopes (CD8) or proteins (CD4). If cells are stimulated to release cytokines they will bind to the antibodies on the surface of the plate surrounding the locality of the individual producing cells. Cytokines remain attached to the coating antibody after the cells have been lysed and plates washed. The assay is generally developed in a similar way to an ELISA assay using a biotinlavidin amplification system. The number of spots equates to the number of cytokine producing cells.

CD8 responses to the following K2drestricted murine epitopes: Gag (AMQMLKETI), Nef (MTYKAAVDL) and RT (YYDPSKDLI) and CD4 responses to Gag and RT proteins may be recorded for all 6 constructs.

2. Humoral Assays Blood samples may be collected for antibody analysis at, for example 7 and 14 days post-last vaccination from two experiments. Serum is separated and stored frozen until antibody titres can be measured using specific ELISA assays. All samples are for example tested for antibodies to Gag, Nef and RT. Briefly, ELISA plates may be coated with the relevant protein. Excess protein is washed off before diluted serum samples are incubated in the wells. The serum samples are washed off and anti-mouse antiserum conjugated to an appropriate tag is added. The plate is developed and read on a plate reader.

SEQUENCE LISTINGS

SEQ ID No 1: 1 atgggtgccc gagcttcggt actgtctggt ggagagCtgg acagatggga 51 gaaaattagg ctgcgcccgg gaggcaaaaa gaaatacaag ctcaagcata 101 tcgtgtgggc ctcgagggag cttgaacggt ttgccgtgaa cccaggcctg 151 ctggaaacat ctgagggatg tcgccagatc ctggggcaat tgcagccatc 201 cctccagacc gggagtgaag agctgaggtc cttgtataac acagtggcta 251 ccctctactg cgtacaccag aggatcgaga ttaaggatac caaggaggcc 301 ttggacaaaa ttgaggagga gcaaaacaag agcaagaaga aggcccagca 351 ggcagctgct gacactgggc atagcaacca ggtatcacag aactatccta 401 ttgtccaaaa cattcagggc cagatggttc atcaggccat cagcccccgg 451 acgctcaatg cctgggtgaa ggttgtcgaa gagaaggcct tttctcctga 501 ggttatcccc atgttctccg ctttgagtga gggggccact cctcaggacc 551 tcaatacaat gcttaatacc gtgggcggcc atcaggccgc catgcaaatg 601 ttgaaggaga ctatcaacga ggaggcagcc gagtgggaca gagtgcatcc 651 cgtccacgct ggcccaatcg cgcccggaca gatgcgggag cctcgcggct 701 ctgacattgc cggcaccacc tctacactgc aagagcaaat cggatggatg 751 accaacaatc ctcccatccc agttggagaa atctataaac ggtggatcat 801 cctgggcctg aacaagatcg tgcgcatgta ctctccgaca tccatccttg 851 acattagaca gggacccaaa gagcctttta gggattacgt cgaccggttt 901 tataagaccc tgcgagcaga gcaggcctct caggaggtca aaaactggat 951 gacggagaca ctcctggtac agaacgctaa ccccgactgc aaaacaatct 1001 tgaaggcact aggcccggct gccaccctgg aagagatgat gaccgcctgt 1051 cagggagtag gcggacccgg acacaaagcc agagtgttga tgggccccat 1101 cagtcccatc gagaccgtgc cggtgaagct gaaacccggg atggacgqcc 1151 ccaaggtcaa gcagtggcca ctcaccgagg agaagatcaa ggccctggtg 1201 gagatctgca ccgagatgga gaaagagggc aagatcagca agatcgggcc 1251 ggagaaccca tacaacaccc ccgtgtttgc catcaagaag aaggacagca 1301 ccaagtggcg caagctggtg gatttccggg agctgaataa gcggacccag 1351 gatttctggg aggtccagct gggcatcccc catccggccg gcctgaagaa 1401 gaagaagagc gtgaccgtgc tggacgtggg cgacgcttac ttcagcgtcc 1451 ctctggacga ggactttaga aagtacaccg cctttaccat cccatctatc 1501 aacaacgaga cccctggcat cagatatcag tacaacgtcc tcccccaggg 1551 ctggaagggc tctcccgcca ttttccagag ctccatgacc aagatcctgg 1601 agccgtttcg gaagcagaac cccgatatcg tcatctacca gtacatggac 1651 gacctgtacg tgggctctga cctggaaatc gggcagcatc gcacgaagat 1701 tgaggagctg aggcagcatc tgctgagatg gggcctgacc actccggaca 1751 agaagcatca gaaggagccg ccattcctga agatgggcta cgagctccat 1801 cccgacaagt ggaccgtgca gcctatcgtc ctccccgaga aggacagctg 1851 gaccgtgaac gacatccaga agctggtggg caagctcaac tgggctagcc 1901 agatctatcc cgggatcaag gtgcgccagc tctgcaagct gctgcgcggc 1951 accaaggccc tgaccgaggt gattcccctc acggaggaag ccgagctcga 2001 gctggctgag aaccgggaga tcctgaagga gcccgtgcac ggcgtgtact 2051 atgacccctc caaggacctg atcgccgaaa tccagaagca gggccagggg 2101 cagtggacat accagattta ccaggagcct ttcaagaacc tcaagaccgg 2151 caagtacgcc cgcatgaggg gcgcccacac caacgatgtc aagcagctga 2201 ccgaggccgt ccagaagatc acgaccgagt ccatcgtgat ctgggggaag 2251 acacccaagt tcaagctgcc tatccagaag gagacctggg agacgtggtg 2301 gaccgaatat tggcaggcca cctggattcc cgagtgggag ttcgtgaata 2351 cacctcctct ggtgaagctg tggtaccagc tcgagaagga gccCatCgtg 2401 ggcgcggaga cattctacgt ggacggcgcg gccaaccgcg aaacaaagct 2451 cgggaaggcc gggtacgtca ccaaccgggg ccgccagaag gtcgtcaccc 2501 tgaccgacac caccaaccag aagacggagc tgcaggccat ctatctcgct 2551 ctccaggact ccggcctgga ggtgaacatc gtgacggaca gccagtacgc 2601 gctgggcatt attcaggccc agccggacca gtccgagagc gaactggtga 2651 accagattat cgagcagctg atcaagaaag agaaggtcta cctcgcctgg 2701 gtcccggccc ataagggcat tggcggcaac gagcaggtcg acaagctggt 2751 gagtgcgggg attagaaagg tgctgatggt gggttttcca gtcacacctc 2801 aggtaccttt aagaccaatg acttacaagg cagctgtaga tcttagccac 2851 tttttaaaag aaaagggggg actggaaggg ctaattcact cccaaagaag 2901 acaagatatc cttgatctgt ggatctacca cacacaaggc tacttccctg 2951 attggcagaa ctacacacca gggccagggg tcagatatcc actgaccttt 3001 ggatggtgct acaagctagt accagttgag ccagataagg tagaagaggc 3051 caataaagga gagaacacca gcttgttaca ccctgtgagc ctgcatggga 3101 tggatgaccc ggagagagaa gtgttagagt ggaggtttga cagccgccta 3151 gcatttcatc acgtggcccg agagctgcat ccggagtact tcaagaactg 3201 ctga SEQ ID No 2: 1 MGARASVLSG GELDRWEKIR LRPGGKKKYK LKHIVWASRE LERFAVNPGL 51 LETSEGCRQI LGQLQPSLQT GSEELRSLYN TVATLJYCVHQ RTEIKDTKEA 101 LDKIEEEQNK SKKKAQQAAA DTGHSNQVSQ NYPIVQNIQG QMVHQAISPR 151 TLNAWVKVVE EKAFSPEVIP MFSALSEGAT PQDLINTMLNT VGGHQAAMQM 201 LKETINEEAA EWDRVI-IPVHA GPIAPGQMRE PRGSDIAGTT STLQEQIGWM 251 TNNPPIPVGE IYKRWIILGL NKIVRMYSPT SILDIRQGPK EPFRDYVDRF 301 YKTLRAEQAS QEVKNWMTET LLJVQNANPDC KTILKALGPA ATLEEMMTAC 351 QGVGGPGHKA RVLMGPISPI ETVPVKLKPG MDGPKVKQWP LTEEKIKALV 401 EICTEMEKEG KISKIGPENP YNTPVFAIKK KDSTKWRKLV DFRELNKRTQ 451 DFWEVQLGIP HPAGLKKKKS VTVLDVGDAY FSVPLDEDFR KYTAFTIPSI 501 NNETPGIRYQ YNVLPQGWKG SPAIFQSSMT KILEPFRKQN PDIVIYQYMD 551 DLYVGSDIEI GQHRTKIEEL RQHLLRJGLT TPDKKHQKEP PFLKMGYELH 601 PDKWTVQPIV LPEKDSWTVN DIQKLVGKLN WASQIYPGIK VRQLCKLLRG 651 TKALTEVIPL TEEAELELAE NREILKEPVH GVYYDPSKDL. IAEIQKQGQG 701 QWTYQIYQEP FKNLKTGKYA RMRGAHTNDV KQLJTEAVQKI TTESIVIWGK 751 TPKFKLPIQK ETWETWWTEY WQATWIPEWE FVNTPPLVKL WYQLEKEPIV 801 GAETFYVDGA ANRETKLGKA GYVTNRGRQK VVTLTDTTNQ KTELQAIYLA 851 LQDSGLEVNI VTDSQYALGI IQAQPDQSES ELVNQIIEQL IKKEKVYLAW 901 VPAHKGIGGN EQVDKLVSAG IRKVLMVGFP VTPQVPLRPM TYKAAVDLSH 951 FLKEKGGLEG LIHSQRRQDI LDLWIYHTQG YFPDWQNYTP GPGVRYPLTF 1001 GWCYKLVPVE PDKVEEANKG ENTSLLIHPVS LHGMDDPERE VLEWRFDSRL 1051 PFHI-IVARELH PEYFKNC SEQ ID No 3: 1 atggccgcca gagccagcat cctgagcggg ggcaagctgg acgcctggya 51 gaagatcaga ctgaggcctg gcggcaagaa gaagtaccgg ctgaagcacc 101 tggtgtgggc cagcagagag ctggatcgct tcgccctgaa tcctagcctg 151 ctggagacca ccgagggctg ccagcagatc atgaaccagc tgcagcccgc 201 cgtgaaaacc ggcaccgagg agatcaagag cctgttcaac accgtggcca 251 ccctgtactg cgtgcaccag cggatcgacg tgaaggatac caaggaggcc 301 ctggacaaga tcgaggagat ccagaacaag agcaagcaga aaacccagca 351 ggccgctgcc gacaccggcg acagcagcaa agtgagccag aactacccca 401 tcatccagaa tgcccagggc cagatgatcc accagaacct gagccccaga 451 accctgaatg cctgggtgaa agtgatcgag gaaaaggcct tcagccccga 501 agtgatccct atgttcagcg ccctgagcga gggcgccacc ccccaggacc 551 tgaacgtgat gctgaacatt gtgggcggac accaggccgc catgcagatg 601 ctgaaggaca ccatcaatga ggaggccgcc gagtgggaca gactgcaccc 651 cgtgcaggcc ggacccatcc cccctggcca gatcagagag cccagaggca 701 gcgacatcgc cggcaccacc tccacccctc aagaacagct gcagtggatg 751 accggcaacc ctcccatccc tgtgggcaac atctacaagc ggtggatcat 801 cctgggcctg aacaagattg tgcggatgta cagccccgtg tCCatCCtgg 851 atatcaagca gggccccaag gagcccttca gagactacgt ggaccggttc 901 ttcaaggccc tgagagccga gcaggccacc caggacgtga agggctggat 951 gaccgagacc ctgctggtgc agaacgccaa ccccgactgc aagagcatcc 1001 tgaaggccct gggcagcggc gccacactgg aggagatgat gaccgcCtgC 1051 cagggagtgg gcggacccgg ccacaaggcc agagtgctgg ccgaggccat 1101 gagccaggcc cagcagacca acatcatgat gcagcggggc aacttcagag 1151 gccagaagcg gatcaagtgc ttcaactgcg gcaaggaggg ccacctggcc 1201 agaaactgca gagcccccag gaagaagggc tgctggaagt gtggcaagga 1251 agggcaccag atgaaggact gcaccgagag gcaggccaat ttcctgggca 1301 agatttggcc tagcagcaag ggcagacccg gcaatttccc ccagagcaga 1351 cccgagccca ccgcccctcc cgccgagctg ttcggcatgg gcgagggCat 1401 cgccagcctg cccaagcagg agcagaagga cagagagcag gtgccccccc 1451 tggtgtccct gaagtccctg ttcggcaacg atcctctgag ccagggatcc 1501 cccatcagcc ccatcgagac cgtgcccgtg accctgaagc ccggcatgga 1551 tggccccaaa gtgaaacagt ggcccctgac cgaggagaag attaaggccc 1601 tgaccgaaat ctgtaccgag atggagaagg agggcaagat cagcaagatc 1651 ggccccgaga acccctacaa cacccccatc ttcgccatca agaagaagga 1701 cagcaccaag tggcggaaac tggtggactt ccgggagctg aacaagagga 1751 cccaggactt ctgggaagtg cagctgggca tcccCCaCCC tgCCggCCtg 1801 aagaagaaga agtccgtgac agtgctggat gtgggcgacg cctacttcag 1851 cgtgcccctg gacgagaact tcaggaagta caccgccttc accatcccca 1901 gcaccaacaa cgagaccccc ggagtgagat accagtacaa cgtgctgcct 1951 cagggctgga agggcagccc cgccatcttc cagagcagca tgaccaagat 2001 cctggagccc ttccggagca agaaccccga gatcatcatc taccagtaca 2051 tggccgccct gtatgtgggc agcgatctgg agatcggcca gcacaggacc 2101 aagatcgaag agctgagggc ccacctgctg agctggggct tcaccacccc 2151 cgataagaag caccagaagg agcccccttt cctgtggatg ggctaCgagC 2201 tgcaccccga taagtggacc gtgcagccca tcatgctgcc cgataaggag 2251 agctggaccg tgaacgacat ccagaaactg gtgggcaagc tgaattgggc 2301 cagccaaatc tacgccggca ttaaagtgaa gcagctgtgc aggctgctga 2351 gaggcgccaa agccctgaca gacatcgtga cactgacaga ggaggccgag 2401 ctggagctgg ccgagaacag ggagatcctg aaggaccccg tgcacggcgt 2451 gtactacgac cccagcaagg acctggtggc cgagattcag aagcagggcc 2501 aggaccagtg gacctaccaa atctaccagg agcctttcaa gaacctgaaa 2551 accgggaagt acgccaggaa gagaagcgcc cacaccaacg atgtgaggca 2601 gctggccgaa gtggtgcaga aagtggctat ggagagcatc gtgatctggg 2651 gcaagacccc caagttcaag ctgcccatcc agaaggagac ctgggaaacc 2701 tggtggatgg actactggca ggccacctgg attcctgagt gggagttcgt 2751 gaacaccccc cctctggtga agctgtggta tcagctggag aaggacccca 2801 tcctgggcgc cgagaccttc tacgtggacg gagccgccaa tagagagacc 2851 aagctgggca aggccggcta cgtgaccgac agaggcagac agaaagtggt 2901 gtctctgacc gagacaacca accagaaaac cgagctgcac gccatcctgc 2951 tggccctgca ggacagcggc agcgaagtga acatcgtgac cgactcccag 3001 tacgccctgg gcatcattca ggcccagccc gatagaagcg agagcgagct 3051 ggtgaaccag atcatcgaga agctgatcgg caaggacaaa atctacctga 3101 gctgggtgcc cgcccacaag ggcatcggcg gcaacgagca ggtggacaag 3151 ctggtgtcca gcggcatccg gaaagtgctg tttctggacg gcatcgacaa 3201 ggcccaggag gaccacgaga gataccacag caactggcgg acaatggCca 3251 gcgacttcaa cctgcctccc atcgtggcca aggagatcgt ggccagctgc 3301 gataagtgtc agctgaaggg cgaggccatg cacggccagg tggactgcag 3351 ccctggcatc tggcagctgg cctgcaccca cctggagggc aaagtgattc 3401 tggtggccgt gcacgtggcc agcggctaca tcgaggccga agtgattccc 3451 gccgagaccg gccaggagac cgcctacttc ctgctgaagc tggccggcag 3501 atggcccgtg aaagtggtgc acaccgccaa cggcagcaac ttcacctctg 3551 ccgccgtgaa ggccgcctgt tggtgggcca atatccagca ggagttcggc 3601 atcccctaca accctcagag ccagggcgtg gtggccagca tgaacaagga 3651 gctgaagaag atcatcggcc aggtgaggga ccaggccgag cacctgaaaa 3701 cagccgtgca gatggccgtg ttcatccaca acttcaagcg gaagggcggc 375]. attggcggct acagcgccgg agagcggatc atcgacatca tcgccaccga 3801 tatccagacc aaggaactgc agaagcagat caccaagatt cagaacttca 3851 gagtgtacta ccgggacagc agggacccca tctggaaggg ccctgccaag 3901 ctgctgtgga agggcgaagg cgccgtggtg atccaggaca acagcgacat 3951 caaagtggtg ccccggagga aggccaagat tctgcgggac tacggcaaac 4001 agatggccgg cgatgactgc gtggccggca ggcaggatga ggacagatct 4051 atgggcggca agtggtccaa gggcagcatt gtgggctggc ccgagatccg 4101 ggagagaatg agaagagccc ctgccgccgc tcctggagtg ggcgccgtgt 4151 ctcaggatct ggataagcac ggcgccatca ccagcagcaa catcaacaac 4201 cccagctgtg tgtggctgga ggcccaggaa gaggaggaag tgggcttCCC 425]. tgtgagaccc caggtgcccc tgagacccat gacctacaag ggcgCCttcg 4301 acctgagcca cttcctgaag gagaagggcg gcctggacgg cctgatctac 4351 agccggaagc ggcaggagat cctggatctg tgggtgtacc acacccaggg 4401 ctacttcccc gactggcaga attacacccc tggccctgga gtgcggtatc �4- 4451 ccctgacctt cggctggtgc ttcaagctgg tgcctatgga gcccgacgaa 4501 gtggagaagg ccacagaggg cgagaacaac agcctgCtgC accctatctg 4551 ccagcacggc atggacgatg aggagcggga agtgctgatc tggaagttcg 4601 acagcaggct ggccctgaag cacagagccc aggaactgca cccagagttc 4651 tacaaggact gctga SEQ ID No 4: 1 MAARASILSG GKLDAWEKIR LRPGGKKKYR LKHLVWASRE LDRFALNPSLJ 51 LETTEGCQQI MNQLQPAVKT GTEEIKSLFN TVATLYCVFIQ RIDVKDTKEA 101 IjDKIEEIQNK SKQKTQQAAA DTGDSSKVSQ NYPIIQNAQG QMIHQNLSPR 151 TLNAWVKVIE EKAFSPEVIP MFSALSEGAT PQDLNVMLNI VGGHQAAMQM 201 LKDTINEEAA EWDRLHPVQA GPIPPGQIRE PRGSDIAGTT STPQEQLQWM 251 TGNPPIPVGN IYKRWIILGL, NKIVRMYSPV SILDIKQGPK EPFRDYVDRF 301 FKALRAEQPT QDVKGWMTET LLVQNANPDC KSILKALGSG ATLEEMMTAC 351 QGVGGPGHK1 RVLAEANSQA QQTNIMMQRG NFRGQKRIKC FNCGKEGHLA 401 RNCRAPRKKG CWKCGKEGHQ MKDCTERQAN FLGKIWPSSK GRPGNFPQSR 451 PEPTAPPAEL FGMGEGIASL PKQEQKDREQ VPPLVSLKSL FGNDPLSQGS 501 PISPIETVPV TLKPGMDGPK VKQWPLTEEK IKAITEICTE MEKEGKISKI 551 GPENPYNTPI FAIKKKDSTK WRKLVDFREL NKRTQDFWEV QLGIPHPAGL 601 KKKKSVTVLID VGDAYFSVPL DENFRKYTAF TIPSTNNETP GVRYQYNVLP 651 QGWKGSPAIF QSSMTKILEP FRSIUTPEIII YQYMAALYVG SDL1EIGQHRT 701 KIEELRAHL1L SWGFTTPDKK HQKEPPFLWM GYELHPDKWT VQPIMLPDKE 751 SWTVNDIQKL VGKLNWASQI YAGIKVKQLC RLLRGAKALT DIVTLTEEAE 801 LELAENREIL KDPVHGVYYD PSKDIJVAEIQ KQGQDQWTYQ IYQEPFKNLK 851 TGKYARKRSA HTJDVRQIjAE VVQKVANESI VIWGKTPKFK IJPIQKETWET 901 WWMDYWQATW IPEWEFVNTP PLVKLWYQLE KDPILGAETF YVDGAANRET 951 KLGKAGYVTD RGRQKVVSIT ETTNQKTELH AILLALQDSG SEVNIVTDSQ 1001 YALGIIQAQP DRSESELVNQ IIEKLIGKDK IYLSWVPAIiK GIGGNEQVDK 1051 LVSSGIRKVL FLDGIDKAQE DHERYHSNWR TMASDFNLPP IVAKEIVASC 1101 DKCQLKGEA1 HGQVDCSPGI WQLIACTHLEG KVILVAVHVA SGYIEAEVIP 1151 AETGQETAYF LLKLAGRWPV KVVHTANGSN FTSAA\JKAAC WWANIQQEFG 1201 IPYNPQSQGV VASMNKELKK IIGQVRDQAE HLKTAVQMAV FIHNFKRKGG 1251 IGGYSAGERI IDIIATDIQT KELQKQITKI QNFRVYYRDS RDPIWKGPAK 1301 LLWKGEGAVV IQDNSDIKVV PRRKAKILRD YGKQMAGDDC VAGRQDEDRS 1351 MGGKWSKGSI VGWPEIRERM RRAPAAAPGV GAVSQDLDKH GAITSSNINN 1401 PSCVWLEAQE EEEVGFPVRP QVPLRPMTYK GAFDLSHFLK EKGGLDGLIY 1451 SRKRQEILDL WVYHTQGYFP DWQNYTPGPG VRYPIJTFGWC FKLVPMEPDE 1501 VEKATEGENN SLLHPICQHG MDDEEREVLI WKFDSRLALK HRAQELHPEF 1551 YKDC SEQ ID No 5: 1 atgagggtga tggagatcca gcggaactgc cagcacctgc tgagatgggg 51 catcatgatc ctgggcatga ttatcatctg cagcaccgcc gacaacctgt 101 gggtgaccgt gtactacggc gtgcctgtgt ggagagatgc cgagaccacc 151 ctgttctgcg ccagcgacgc caaggcctac agcaccgaga agcacaatgt 201 gtgggccacc cacgcctgcg tgcctaccga tcccaaccct caggagatce 251 ccctggacaa cgtgaccgag gagttcaaca tgtggaagaa caacatggtg 301 gaccagatgc acgaggacat catcagcctg tgggaccaga gcctgaagcc 351 ctgcgtgcag ctgacccccc tgtgcgtgac cctgaactgc agcaacgcca 401 gagtgaacgc caccttcaac tccaccgagg acagggaggg catgaagaac 451 tgcagcttca acatgaccac cgagctgcgg gataagaagc agcaggtgta 501 cagcctgttc taccggctgg acatcgagaa gatcaacagc agcaacaaca 551 acagcgagta ccggctggtg aactgcaata ccagcgccat cacccaggcc 601 tgccctaagg tgaccttcga gcccatcccc atccactact gcgcccctgc 651 cggcttcgcc atcctgaagt gcaacgacac cgagttcaat ggcaccggcc 701 cctgcaagaa tgtgagcacc gtgcagtgca cccacggcat caagcccgtg 751 gtgtccaccc agctgctgct gaacggcagc ctggccgaga gagaagtgcg 801 gatcaggagc gagaacatcg ccaacaacgc caagaacatc atcgtgcagt 851 tcgccagccc cgtgaagatc aactgcatcc ggcccaacaa caatacccgg 901 aagagctaca gaatcggccc tggccagacc ttctacgcca ccgacattgt 951 gggcgacatc agacaggccc actgcaacgtgtccaggacc gactggaaca 1001 acaccctgag actggtggcc aaccagctgc ggaagtactt cagcaacaag 1051 accatcatct tcaccaacag cagcggcgga gacctggaga tcaccaccca 1101 cagcttcaat tgtggcggcg agttcttcta ctgcaacacc tccggCctgt 1151 tcaatagcac ctggaccacc aacaacatgc aggagtccaa cgacaccagc 120]. aacggcacca tcaccctgcc ctgccggatc aagcagatca tccggatgtg 1251 gcagcgcgtg ggccaggcca tgtacgcccc tcccatcgag ggcgtgattc 1301 gctgcgagag caacatcacc ggcctgatcc tgaccagaga tggcggcaac 1351 aacaattccg ccaacgagac cttcagacct ggcggcggag atatccggga 1401 caactggcgg agcgagctgt acaagtacaa ggtggtgaag atcgagcccc 1451 tgggcgtggc ccccaccaga gccaagagaa gagtggtgga gcgggagaag 1501 a9agccgtgg gcatcggcgC cgtgtttctg ggcttcctgg gagccgccgg 1551 atctacaatg ggagccgcca gcatcaccct gaccgtgcag gccagacagc 1601 tgctgagcgg catcgtgcag cagcagagca atctgctgag agccatcgag 1651 gcccagcagc agctgctgaa gctgacagtg tggggcatca agcagctgca 1701 ggccagggtg ctggccgtgg agagatacct gagggaccag cagctcctgg 1751 gcatctgggg ctgcagcggc aagctgatct gcaccaccaa cgtgcCCtgg 1801 aatagcagct ggagcaacaa gagctacgac gacatctggc agaacatgac 1851 ctggctgcag tgggacaagg agatcagcaa ctacaccgac atcatctaca 1901 gcctgatcga ggagagccag aaccagcagg agaagaacga gcaggatctg 1951 ctggccctgg acaagtgggc caacctgtgg aactggttcg acatcagcaa 2001 gtggctgtgg tacatcagat cttga SEQ IDN06: 1 MRVMEIQRNC QHL1LRWGIMI LGMIIICSTA DNLWVTVYYG VPVWRDAETT 51 LFCASDAKAY STEKHNVWPT HACVPTDPNP QEIPLDNVTE EFNMWKNNNV 101 DQMHEDIISL WDQSLKPCVQ LTPLCVTLNC SNARVNATFN STEDREGMKN 151 CSFNMTTELR DKKQQVYSLF YRLDIEKINS SNNNSEYRLV NCNTSAITQA 201 CPKVTFEPIP IHYCAPAGFA ILKCNDTEFN GTGPCKNVST VQCTHGIKPV 251 VSTQLLLNGS LAEREVRIRS ENIANNAKNI IVQFASPVKI NCIRPNNNTR 301 KSYRIGPGQT FYATDIVGDI RQA}!CNVSRT DWNNTLRI.IVA NQLRKYFSNK 351 TIIFTNSSGG DLEITTHSFN CGGEFFYCNT SGLFNSTWTT NNMQESNDTS 401 NGTITLPCRI KQIIRMWQRV GQAMYAPPIE GVIRCESNIT GLILTRDGGN 451 NNSANETFRP GGGDIRDNWR SELYKYKWK IEPLGVAPTR AKRRVVEREK 501 RAVGIGAVFL GFLJGAAGSTM GAASITLTVQ ARQLLSGIVQ QQSNLLRAIE 551 AQQQLIKLTV WGIKQLQARV LAVERYLRDQ QLjLGIWGCSG KLICTTNVPW 601 NSSWSNKSYD DIWQNMTWLQ WDKEISNYTD IIYSLIEESQ NQQEKNEQDL 651 LALDKWANLW NWFDISKWI4W YIRS SEQ ID No 7: atgaaagtga aggagaccag gaagaattat cagcacttgt ggagatgggg 50 caccatgctc cttgggatgt tgatgatctg tagtgctgca gaacaattgt 100 gggtcacagt ctattatggg gtacctgtgt ggaaagaagC aactaccact 150 ctattctgtg catcagatgc taaagcatat gatacagagg tacataatgt 200 ttgggccaca catgcctgtg tacccacaga ccccaaccca caagaagtag 250 tattgggaaa tgtgacagaa tattttaaca tgtggaaaaa taacatggta 300 gaccagatgc atgaggatat aatcagttta tgggatcaaa gcttgaagcc 350 atgtgtaaaa ttaaccccac tctgtgttac tttagattgc gatgatgtga 400 ataccactaa tagtactact accactagta atggttggac aggagaaata 450 aggaaaggag aaataaaaaa ctgctctttt aatatcacca caagcataag 500 agataaggtt caaaaagaat atgcactttt ttataacctt gatgtagtac 550 caatagatga tgataatgct actaccaaaa ataaaactac tagaaacttt 600 aggttgatac attgtaactc ctcagtcatg acacaggcct gtccaaaggt 650 atcatttgaa ccaattccca tacattattg tgccccggct ggttttgcga 700 ttctgaagtg taacaataag acgtttgatg gaaaaggact atgtacaaat 750 gtcagcacag tacaatgtac acatggaattAaggccagtag tgtcaactca 800 actgctgtta aatggcagtc tagcagaaga agaggtagta attagatctg 850 acaatttcat ggacaatact aaaaccataa tagtacagct gaatgaatct 900 gtagcaatta attgtacaag acccaacaac aatacaagaa aaggtataca 950 tataggacca gggagagcct tttatgcagc aagaaaaata ataggagata 1000 taagacaagc acattgtaac cttagtagag cacaatggaa taacacttta 1050 aaacagatag ttataaaatt aagagaacac tttgggaata aaacaataaa 1100 atttaatcaa tcctcaggag gggacccaga aattgtaagg catagtttta 1150 attgtggagg ggaatttttc tactgtgata caacacaact gtttaatagt 1200 acttggaatg gtactgaagg aaataacact gaaggaaata gcacaatcac 1250 actcccatgt agaataaaac aaattataaa catgtggcag gaagtaggaa 1300 aagcaatgta tgcccctccc atcggaggac aaattagatg ttcatcaaat 1350 attacagggc tgctattaac aagagatggt ggtaccgaag ggaatgggac 1400 agagaatgag acagagatct tcagacctgg aggaggagat atgagggaca 1450 attggagaag tgaattatat aaatataaag tagtaaaagt tgaaccacta 1500 ggagtagcac ccaccagggc aaagagaaga gtggtgcaga gataa 1545 SEQ ID No 8: MKVKETRKNY QHLWRWGTMI LGMLMICSAA EQLWVTVYYG VPVWKEATTT 50 LFCASDAKAY DTEVHNVWAT HACVPTDPNP QEVVLGNVTE YFNMWKNNMV 100 DQMHEDIISL WDQSLKPCVK LTPLCVTLDC DDVNTTNSTT TTSNGWTGEI 150 RKGEIKNCSF NITTSIRDKV QKEYALFYNL DVVPIDDDNA TTKNKTTRNF 200 RLIHCNSSVM TQACPKVSFE PIPIHYCAPA GFAILKCNNK TFDGKGTJCTN 250 VSTVQCTHGI RPVVSTQLLL NGSLAEEEVV IRSDNFMDNT KTIIVQLNES 300 VAIMCTRPNN NTRKGIHIGP G?AFYAARKI IGDIRQAHCN LSRAQWNNTL 350 KQIVIKLREH FGNKTIKFNQ SSGGDPEIVR HSFNCGGEFF YCDTTQLFNS 400 TWNGTEGNNT EGNSTITL1PC RIKQIINMWQ EVGKAMYAPP IGGQIRCSSN 450 ITGILLTRDG GTEGNGTENE TEIFRPGGGD MRDNWRSELY KYKVVKVEPL 500 GVAPTRAKRR VVQR 514 SEQ ID No 9: atggtcattg ttcagaacat acagggccaa atggtccacc aggcaattag 50 tccgcgaact cttaatgcat gggtgaaggt cgtggaggaa aaggcattct 100 ccccggaggt cattccgatg ttttctgcgc tatctgaggg cgcaacgccg 150 caagacctta ataccatgct taacacggta ggcgggcacc aagccgctat 200 gcaaatgcta aaagagacta taaacgaaga ggccgccgaa tgggatcgag 250 tgcacccggt gcacgccggc ccaattgcac caggccagat gcgcgagccg 300 cgcgggtctg atattgcagg aactacgtct acccttcagg agcagattgg 350 gtggatgact aacaatccac caatcccggt cggagagatc tataagaggt 400 ggatcatact gggactaaac aagatagtcc gcatgtattc tccgacttct 450 atactggata tacgccaagg cccaaaggag ccgttcaggg actatgtcga 500 ccgattctat aagacccttc gcgcagagca ggcatcccag gaggtcaaaa 550 attggatgac agaaactctt ttggtgcaga atgcgaatcc ggattgtaaa 600 acaattttaa aggctctagg accggccgca acgctagaag agatgatgac 650 ggcttgtcag ggagtcggtg gaccggggca taaagcccgc gtcttacaca 700 tgggcccgat atctccgata gaaacagttt cggtcaagct taaaccaggg 750 atggatggtc caaaggtcaa gcagtggccg ctaacggaag agaagattaa 800 ggcgctcgta gagatttgta ctgaaatgga gaaggaaggc aagataagca 850 agatcgggcc agagaacccg tacaatacac cggtatttgc aataaagaaa 900 aaggattcaa caaaatggcg aaagcttgta gattttaggg aactaaacaa 950 gcgaacccaa gacttttggg aagtCcaact agggatccca catccagccg 1000 gtctaaagaa gaagaaatcg gtcacagtcc tggatgtagg agacgcatat 1050 tttagtgtac cgcttgatga ggacttccga aagtatactg cgtttactat 1100 accgagcata aacaatgaaa cgccaggcat tcgctatcag tacaacgtgc 1150 tcccgcaggg ctggaagggg tctccggcga tatttcagag ctgtatgaca 1200 aaaatacttg aaccattccg aaagcagaat ccggatattg taatttacca 1250 atacatggac gatctctatg tgggctcgga tctagaaatt gggcagcatc 1300 gcactaagat tgaggaactg aggcaacatc tgcttcgatg gggcctcact 1350 actcccgaca agaagcacca gaaggagccg ccgttcctaa agatgggcta 1400 cgagcttcat ccggacaagt ggacagtaca gccgatagtg ctgcccgaaa 1450 aggattcttg gaccgtaaat gatatteaga aactagtcgg caagcttaac 1500 tgggcctctc agatttaccc aggcattaag gtccgacagc tttgcaagct 1550 actgagggga actaaggctc taacagaggt catcccatta acggaggaag 1600 cagagcttga gctggcagag aatcgcgaaa ttcttaagga gccggtgcac 1650 ggggtatact acgacccctc caaggacctt atagccgaga tccagaagca 1700 ggggcagggc caatggacgt accagatata tcaagaaccg tttaagaatc 1750 tgaagactgg gaagtacgcg cgcatgcgag gggctcatac taatgatgta 1800 aagcaactta cggaagcagt acaaaagatt actactgagt ctattgtgat 1850 atggggcaag accccaaagt tcaagctgcc catacagaag gaaacatggg 1900 aaacatggtg gactgaatat tggcaagcta cctggattcc agaatgggaa 1950 tttgtcaaca cgccgccact tgttaagctt tggtaccagc ttgaaaagga 2000 gccgatagta ggggcagaga ccttctatgt cgatggcgcc gcgaatcgcg 2050 aaacgaagct aggcaaggcg ggatacgtga ctaatagggg ccgccaaaag 2100 gtcgtaaccc ttacggatac caccaatcag aagactgaac tacaagcgat 2150 ttaccttgca cttcaggata gtggcctaga ggtcaacata gtcacggact 2200 ctcaatatgc gcttggcatt attcaagcgc agccagatca aagcgaaagc 2250 gagcttgtaa accaaataat agaacagctt ataaagaaag agaaggtata 2300 tctggcctgg gtccccgctc acaagggaat tggcggcaat gagcaagtgg 2350 acaagctagt cagcgctggg attcgcaagg ttcttgcgat ggggggtaag 2400 tggtctaagt ctagcgtagt cggctggccg acagtccgcg agcgcatgcg 2450 acgcgccgaa ccagccgcag atggcgtggg ggcagcgtct agggatctgg 2500 agaagcacgg ggctataact tccagtaaca cggcggcgac gaacgccgca 2550 tgcgcatggt tagaagccca agaagaggaa gaagtagggt ttccggtaac 2600 tccccaggtg ccgttaaggc cgatgaccta taaggcagcg gtggatcttt 2650 ctcacttcct taaggagaaa ggggggctgg agggcttaat tcacagccag 2700 aggcgacagg atattcttga tctgtggatt taccataccc aggggtactt 2750 tccggactgg cagaattaca ccccggggcc aggcgtgcgc tatcccctga 2800 ctttcgggtg gtgctacaaa ctagtcccag tggaacccga caaggtcgaa 2850 gaggctaata agggcgagaa cacttctctt cttcacccgg taagcctgca 2900 cgggatggat gacccagaac gagaggttct agaatggagg ttcgactctc 2950 gacttgcgtt ccatcacgta gcacgcgagc tgcatccaga atatttcaag 3000 aac tgccgcc caatgggcgc cagggccagt gtacttagtg gcggagaact 3050 agatcgatgg gaaaagatac gcctacgccc ggggggcaag aagaagtaca 3100 agcttaagca cattgtgtgg gcctctcgcg aacttgagcg attcgcagtg 3150 aatccaggcc tgcttgagac gagtgaaggc tgtaggcaaa ttctggggca 3200 gctacagccg agcctacaga ctggcagcga ggagcttcgt agtctttata 3250 ataccgtcgc gactctctac tgcgttcatc aacgaattga aataaaggat 3300 actaaagagg cccttgataa aattgaggag gaacagaata agtcgaaaaa 3350 gaaggcccag caggccgccg ccgacaccgg gcacagcaac caggtgtccc 3400 aaaactacta a 3411.

SEQ ID No 10: MVIVQNIQGQ MVHQAISPRT LNAWVKVVEE KAFSPEVIPM FSALSEGATP 50 QDLNTMLNTV GGHQAAMQML KETINEEAAE WDRVHPVHAG PIAPGQMREP 100 RGSDIAGTTS TLQEQIGWMT NNPPIPVGEI YKRWIILIGLN KIVRMYSPTS 150 ILDIRQGPKE PFRDYVDFY KTLRAEQASQ EVKNWMTETL LVQNANPDCK 200 TIIJKALGPAA TLEEMMTACQ GVGGPGHKAR VLHMGPISPI ETVSVKLKPG 250 MDGPKVKQWP LTEEKIKALV EICTEMEKEG KISKIGPENP YNTPVFAIKK 300 KDSTKWRKIJV DFRELNKRTQ DFWEVQLGIP HPAGJJKKKKS VTVLDVGDAY 350 FSVPLDEDFR KYTAFTIPSI NNETPGIRYQ YNVLPQGWKG SPAIFQSCMT 400 KILEPFRKQN PDIVIYQYMD DLYVGSDLEI GQHRTKIEEL1 RQHLLRWGLT 450 TPDKKHQKEP PFLIKMGYELH PDKWTVQPIV LPEKDSWTVN DIQKLVGKLN 500 WASQIYPGIK VRQLCKL1RG TKALTEVIPL TEEAELELIAE NREILKEPVH 550 GVYYDPSKDL IAEIQKQGQG QWTYQIYQEP FKNLKTGKYA RMRGA}ITNDV 600 KQL.TEAVQKI TTESIVIWGK TPKFKLPIQK ETWETWWTEY WQATWIPEWE 650 FVNTPPLVKL WYQLEKEPIV GAETFYVDGA ANRETKLGKA GYVTNRGRQK 700 VVTLTDTTNQ KTELQAIYLA LQDSGLEVNI VTDSQYALGI IQAQPDQSES 750 ELVNQIIEQL IKKEKVYIJAW VPANKGIGGN EQVDKLVSAG IRKVLAMGGK 800 WSKSSVVGWP TVRERMRRAE PAADGVGAAS RDLEKHGAIT SSNTAATNAA 850 CAWLEAQEEE EVGFPVTPQV PLIRPMTYKAA VDLSHFLKEK GGIJEGLIHSQ 900 RRQDILDLWI YHTQGYFPDW QNYTPGPGVR YPLITFGWCYK LVPVEPDICVE 950 EANKGENTSLI LHPVSLHGMD DPEREVLEWR FDSRLAFHHV ARELiHPEYFK 1000 NCRPMGAP.AS VLSGGELDRW EKIRLRPGGK KKYKLKHIVW ASRELERFAV 1050 NPGLLETSEG CRQIIGQLQP SLQTGSEELR SLYNTVATLY CVHQRIEIKD 1100 TKEALDKIEE EQNKSKKKAQ QAAADTGHSN QVSQNY 1136

Claims (25)

1. Claims 1. A method of raising an immune response against a HIV-I virus which comprises administering (I) one or more first immunogenic polypeptides derived from said virus; (ii) one or more polynucleotides encoding one or more second immunogenic polypeptides derived from said virus; and (iii) an adjuvant; wherein the one or more first immunogenic polypeptides, the one or more polynucleotides and the adjuvant are administered concomitantly.
2. 2. A method according to claim I wherein one or more immunogenic polypeptides, one or more polynucleotides and an adjuvant are co-formulated.
3. 3. A method according to claim 1 or 2 wherein production of HJV-1 specific CD4+ T-cells and CD8+ T-cells and optionally antibodies is stimulated.
4. 4. A vaccine composition comprising (i) one or more first immunogenic polypeptides derived from HIV-1 virus; (ii) one or more polynucleotides encoding one or more second immunogenic polypeptides denved from said virus; and (iii) an adjuvant.
5. 5. A method or vaccine composition according to any one of claims I to 4 wherein one or more of said one or more first immunogenic polypeptides is substantially the same as one or more of said one or more second immunogenic polypeptides.
6. 6. A method or vaccine composition according to any one of claims 1 to 4 wherein one or more of said one or more first immunogenic polypeptides contains at least one antigen which is substantially the same as an antigen contained in one or more of said one or more second immunogenic polypeptides.
7. 7. A method or vaccine composition according to any one of claims 1 to 6 wherein one or more the first immunogenic polypeptides comprises at least one T cell epitope.
8. 8. A method or vaccine composition according to any one of claims 1 to 7 wherein the one or more first immunogenic polypeptide comprises at least one B cell epitope.
9. 9. A method or vaccine composition according to any one of claims I to 8 wherein one or more of said one or more first immunogenic polypeptides and one or more of said one or more second immunogenic polypeptides share one or more identical B-cell andlor T-cell epitopes.
10. 10. A method or vaccine composition according to any one of claims 1 to 8 wherein none of the one or more of said one or more first immunogenic polypeptides is substantially the same as or contains any antigen in common with one or more of said one or more second immunogenic polypeptides.
11. 11. A method or vaccine composition according to any one of claims 1 to 10, wherein the polynucleotide(s) is in the form of DNA. cl
12. 12. A method or vaccine composition according to claim 11, wherein the DNA is delivered to the epidermis.
13. 13. A method or vaccine composition according to any one of claims Ito 12 wherein the immunogenic polypeptides contain HIV derived antigens which are selected from Env, Nef, Gag, and Pot and immunogenic derivatives thereof and immunogenic fragments thereof.
14. 14. A method or vaccine composition according to claim 13 wherein a first immunogenic polypeptide is p24-RT-Nef-p17.
15. 15. A method or vaccine composition according to claim 13 or claim 14 wherein a second immunogenic polypeptide is Gag-RT-Nef.
16. 16. A method or vaccine composition according to any one of claims ito 15 wherein the adjuvant comprises a preferential stimulator oflhl responses.
17. 17. A method or vaccine composition according to claim 16 wherein the adjuvant comprises QS2I andlor 3D-MPL andlor CpG.
18. 18. A method or vaccine composition according to claim 16 wherein the adjuvant comprises QS21 and 3D-MPL.
19. 19. A method or vaccine composition according to any one of claims I to 18 wherein the adjuvant contains an oil-in-water emulsion.
20. 20. A method or vaccine composition according to any one of claims 1 to 18 wherein the adjuvant contains tiposomes.
21. 21. A method of stimulating an immune response in a mammal which comprises administering to a subject an immunologically effective amount of a vaccine composition according to any one of claims 4 to 20.
22. 22. Use of a vaccine composition according to any one of claim 4 to 20 in the manufacture of a medicament for stimulating an immune response in a mammal.
23. 23. A vaccine composition according to any one of claims 8 to 33 for use in stimulating an immune response in a mammal.
24. 24. A kit comprising (i) one or more first immunogenic polypeptides derived from HIV-1 virus; (ii) one or more polynucleotides encoding one or more second immunogenic polypeptides derived from said virus; and (iii) an adjuvant.
25. 25. A kit according to claim 24, wherein the one or more first immunogenic polypeptides, the one or more polynucleotides and the adjuvant are suitable for concomitant administration.