GB2421729A - GAL4-VP16/TK-Zeo reporter system - Google Patents

Abstract

This invention is a new biological system used to identify novel and/or tissue specific and also known cytoplasmic site specific endoproteases. GAL4-VP16/TK-Zeo system provides an inducible HSV.tk-Zeo (i.e.. HSV.tk-Sh.ble) double selection marker used as the reporter gene whose transcription is under the control of GAL4-VP16 chimeric transcription activating protein. This system is based on the activation of HSV.tk-Zeo transcription in the presence of GAL4-VP16 and inactivation of its transcription following proteolytic cleavage of GAL4-VP16 that a chain of 15 amino acids, coded by 35 nucleotides constructing a multiple cloning site, was created between GAL4 and VP16 domains. GAL4-VP16/TK-Zeo system allows bringing simultaneously a wide range of amino acid sequences in contact with cytoplasmic and possibly nuclear endoproteases by incorporating oligonucleotide library or known endoproteases cleavage sites encoding sequences between GAL4 and VP16 DNA fragments using a multiple cloning site created between GAL4 and VP16. This system is composed of three plasmids called pHEJI (Figure 3), pG4mVP (Figure 7) which are used together and pDBHZG4mVP (Figure 8) which is used alone due to having all necessary elements assembled in one construct.

Description

GAL4-VP16/TK-Zeo System This invention is a new plasmid system developed

to identify novel and/or tissue specific cytoplasmic and possibly nuclear site specific endoproteases.

Additionally, this system can be used to study the distribution of known site specific cytoplasmic endoproteases. For instance, interleukin-l converting enzyme (ICE), which is a cytoplasmic cysteine protease, specifically cleaves the inactive pre-interleukin- 1 f3 at Asp' 16 Ala"7 bond to generate the mature form of the interleukin- 1 [3 cytokine. The ICE cleavage site is composed of four amino acids YVAD (Tyrosine- ValineAlanine- Aspartic acid), corresponding to 113-116 amino acids in preinterleukin- 1 [3 case, and a small hydrophobic amino acid in P' 1 position.

Several methods mainly based on chromatography techniques have been developed to identify endoproteases. The major problems with the previously developed systems is being time consuming and sometimes expensive. In these systems different amino acid sequences are synthesized and are exposed to cell extract, purified enzyme or cell culture. Then the substrate undergoes chromatography procedure and the cleaved substrates are marked. Sometimes it is necessary to conduct this procedure for every single synthesized sequence.

Therefore, by previously developed systems it will be very difficult or even impossible to simultaneously screen and study the cleavage of a wide range of amino acid sequences following undergoing reaction with cell lines' and tissues' cytoplasmic and possibly nuclear endoproteases in order to identify a novel site specific endoprotease.

An object of the present invention is to develop an easy, fast and reliable plasmid system in order to identify novel and/or tissue specific endoprotease cleavage sites. This invention provides a plasmid system, which allows bringing simultaneously a wide range of amino acid sequences in contact with cytoplasmic and possibly nuclear endoproteases in growing and intact cells in order to identify novel and/or tissue specific endoproteases which cleave specific amino acid sequences (i.e. site specific endoproteases). Moreover, the devised system can be used to study the distribution of known endoproteases in different cell lines and tissues.

This system is a combination of a selection marker and a transcription activating protein which controls the transcription of the selection marker. In this system HSV.tk-Zeo selection marker was employed as the reporter gene whose transcription was placed under the control of GAL4VP16.

GAL4-VP16 is a fusion transcription activating protein, which promotes transcription of target genes (i.e. reporter gene). GAL4-VP16 is composed of GAL4 DNA binding domain and VP16 transcription regulatory protein.

Different studies have revealed that GAL4 is composed of two domains called DNA binding and transactivator domains. This protein is able to promote the transcription of the genes when two domains are attached to each other.

Moreover, none of these domains is capable of promoting of the transcription when it is expressed alone and is not fused to the other domain. Therefore, to activate the transcription two domains should be attached to each other or to other proper transcription regulatory proteins. In this approach GAL4 DNA binding domain is fused to VP16 transcription regulator that provides a proper fusion transcription activating protein. Studies have shown that GAL4-VP16 fusion protein properly activates transcription of the target genes and two domains are proteolytically cleavable from each other. Proteolytic cleavage and separation of GAL4 and VP16 domains result in inactivation of the transcription of target gene.

HSV.tk-Zeo, which is used as the reporter gene in this system, consists of two HSV.tk and Zeo domains. HSV.TK domain confers susceptibility to GCV and Zeo domain induces resistance to zeocin (i.e. GCVS/Zeo).

This system is based on the activation of the transcription of HSV.tk-Zeo selectable marker (i.e. HSV.tk fused to Zeo) in the presence of GAL4-VP16 and inactivation of HSV.tk-Zeo transcription following proteolytic cleavage of GAL4-VP16. Therefore, in the absence of endoproteolytic cleavage the GAL4- VP16 transactivates the transcription of HSV.tk-Zeo. However, in the presence of an appropriate endoprotease activity the GAL4 and VP16 domains are separated, thus resulting in loss of HSV.TK-Zeo expression.

Incorporation of endoprotease cleavage sites between GAL4 and VP 16 allows endoproteolytic cleavage and therefore separation of GAL4 DNA binding domain from VP16 transcription regulatory domain that results in inactivation of the HSV.TK-Zeo expression. The cells in which GAL4 is proteolytically cleaved from VP16 will have GCVVZeoS (i.e. susceptible to zeocin and resistant to GCV) phenotype compared to the cells containing fused GAL4- VP16 which have GCVS/ZeoR phenotype and are killed in the presence of GCV. Accordingly, it is possible to select the cells in which GAL4-VP 16 undergoes proteolytic cleavage from those cells in which GAL4-VP16 remains fused to each other using GCV cytotoxicity.

In order to identify novel endoproteases, an oligonucleotide library will be incorporated between GAL4 and VP16 using the created multiple cloning site between two domains. Once the oligonucleotide library was incorporated between GAL4 and VP16 the cells are transfected with the corresponding plasmid(s). Then the cells are selected with G41 8 to select the untransfected cells and GCV to select the cells in which GAL4 is proteolytically cleaved from VP16 domain from those cells in which GAL4 remains fused to VP 16.

Then the selected colonies are picked up for RT-PCR and PCR reactions and then sequencing to identify the specific amino acid sequences that are cleaved in the cells. Two pG4mVP and DBHZG4mVP plasmids developed in this invention are used to incorporate oligonucleotide library to encode a wide range of amino acid sequences between GAL4 and VP 16.

The GAL-VP 16/TK-Zeo system consists of three plasmids called pFIEJI (application number: GB 2390606), pGAL4mVP16 and pDBHZG4mVP, from those the last plasmid (i.e., plasmid pDBHZG4mVP) is a combination of two prior plasmids. Plasmid pHEJI, which was already filed with GB 2390606 patent application number and used in thIs system, was developed to "study transcription activating function of different transcription activating proteins" and also to "evaluate various DNA sequences to which transcription activating proteins bind". In fact, plasmid pHEJI is utilized to "study transcription elements roles and activity". While, this system was developed to "study proteolytic activity of different site specific endoproteases" and also to "identify novel and/or tissue specific endoproteases". Therefore, GAL4- VP16/TK-Zeo system's applications (i.e., proteolytic activity and endoproteases) are completely different from the applications of plasmid pHEJI.

Plasmid pHEJ1 is a 7.1kb plasmid containing HSV.tk-Zeo fusagene inducible cassette. This cassette composed of five repeats of 19 bp GAL4 DNA binding sequence followed by TATA box and HSV.tk-Zeo fusagene. The number of GAL4 DNA biding sequence repeats can be increased or decreased in order to promote or reduce the GAL-VP16 transcription activity. The HSV. tk-Zeo fusagene is adenylated by SV4O polyadenylation sequence in this cassette.

HSV.I'K-Zeo (i.e. HSV.TK-Sh.ble) is a fusion protein composed of HSV.TK and Zeo (i.e. Sh.ble). HSV.TK moiety of this fusion protein confers susceptibility to prodrug GCV (i.e. negative selection). Therefore, the cells in which the reporter gene (i.e. HSV.tk-Zeo) is transcriptionally activated via a corresponding transcription activating protein can be negatively selected with GCV (i.e. ganciclovir).

This plasmid encodes neomycin resistance gene (i.e. neomycin phosphotransferase) driven by SV4O promoter and SV4O polyadenylation signal. The presence of neomycin cassette in this plasmid allows selecting transfected cells with G4 18. This is in addition to GCV and zeocin selection.

This plasmid also encodes ampicillin resistance gene for selection and maintenance in E.coli. It also contains Fl and pUC replication origin.

Plasmid pG4VP is a 6.5 kb plasmid encoding GAL4-VP16 fusion protein. The backbone of this plasmid is pcDNA3.1 (-), which encodes either neomycin or hygromycin selection markers. This plasmid encodes neomycin or hygromycin selection markers to select transfected cells from untransfected cells. Once the feasibility of this inducible system was confirmed a multiple cloning sites was created between GAL4 and VP16. This multiple cloning site allows incorporating known specific protease sites or oligonucleotide library sequences between GAL4 and VP16 fragments. For this purpose two oligonucleotides called NX(L) (AArFCGCGGCCGCCCCCTCTAGAC) and NX(R) (AATFGTCTAGAGGGGGCGGCCGCG) were designed. Then the oligonucleotides (i.e. NX(L) and NX(R)) were ligated into pHEJI plasmid using EcoPJ site between GAL4 and VP16 moieties resulting in generation of pG4mVP plasmid. Plasmid pG4mVP has three unique restriction sites (i.e. EcoRI, NotI and XbaI) between GAL4 and VP16. As in the case of pG4VP plasmid, this plasmid also encodes neomycin or hygromycin resistance gene for selection of the transfected cells Plasmid pGAL4mVP16 is an 8.3 kb plasmid driven from pG4VP plasmid encoding GAL4-VP16 fusion transcription activating protein. This fusion protein is driven by CMV promoter and adenylated by Bovine Growth Hormone polyadenylation sequence. As in the case of pHEJI plasmid, the backbone of this plasmid is pcDNA3.1 (-) and induces resistance to G4 18 (or hygromycin) due to expression of neomycin (or hygromycin) resistance gene driven by SV4O promoter. This plasmid also contains ampicillin resistance gene for selection of E.coli.

In practice the oligonucleotide library is incorporated between GAL4 and VP16 domains in pDBHZG4mVP plasmid and cells are transfected with the plasmid mixture (i.e. every single plasmid encode an amino acid sequence which is different from the encoded sequence by the other plasmids). Then the cells are double selected with G41 8 and GCV. G4 18 selects untransfected cells from transfected cells and GCV selects the cells in which GAL4 is proteolytically cleaved from VP 16 from those cells they remain fused to each other.

It is also possible to conduct this procedure in two steps using pHEJT and pG4mVP plasmids. In this case, the cells are first transfected with pHEM plasmid and selected with G4 18. The oligonucleotide library is incorporated between GAL4 and VP16 in pG4mVP plasmid. In this case the selection marker encoded by pG4mVP plasmid should be hygromycin (i.e. any mammalian selection marker except neomycin and zeocin which are present in pFLEJT plasmid). Then the cells are transfected with pG4mVP plasmid in which the oligonucleotide library has already been incorporated. Finally the cells are double selected with GCV and hygromycin. Hygromycin selects the transfected cells from untransfected cells and GCV selects the cells in which GAL4 is proteolytically cleaved from VP16 from those cells in which GAL4- VP 16 is not cleaved. Then the isolated colonies are used for further RT- PCR, PCR and sequencing experiments in order to identify the sequences, which are cleaved in the cells.

The construction and drug resistance induction feature of the invention will now be described with reference to the accompanying drawing in which: FIGURE 1 shows activation of HSV.tk-Zeo transcription with GAL4- VP16 transcription activating protein; FIGURE 2 illustrates the activation of tk-Zeo reporter gene in the presence of GAL4-VP16 transcription activator and inhibition of HSV.TK-Zeo expression due to proteolytic cleavage of GAL4-VP16; FIGURE 3 shows the construction of pHEJI plasmid; FIGURE 4 shows the HSV.tk-Zeo (i.e. HSV.tk-Sh.ble) selection marker cassette; FIGURE 5 represents the construction of pG4VP plasmid; FIGURE 6 represents the insertion of NotI and XbaI site between GAL4 and VP16 fragments to generate pG4mVP plasmid.

FIGURE 7 represents the construction of pG4mVP plasmid; FIGURE 8 shows the construction of pDBHZG4mVP plasmid; As shown in figure 1 the HSV.tk- Zeo activity is not shown in the absence of GAL4-VP16. Therefore, the cells transfected with this plasmid will have a GCV resistance and zeocin sensitive phenotype. Once the GAL4-VP16 is expressed, it binds to the GAL4 DNA binding site (UAS) and promotes transcription of HSV.tk-Zeo. The expression of HSV.tk-Zeo is detected by quantification of TK and Zeo function in the cells.

GAL4-VP16 chimeric protein promotes the transcription of HSV.tk-Zeo resulting in induction of TK and Zeo activity. Once a protease cleavage sequence is inserted between GAL4 and VP16, the chimeric protein could be cleaved by the enzyme into GAL4 DNA binding and VP16 transactivation domains. The split form of GAL4 and VP16 is unable to activate transcription of HSV.tk-Zeo, as illustrated in figure 2. Therefore, the cells will loss their susceptibility to GCV and resistance to zeocin.

As shown in figure 3, the pHEJI plasmid composed of HSV.tk-Zeo cassette, an independent expression cassette containing a multiple cloning site to clone the gene of interest driven by CMV promoter for high level expression, neomycin resistance gene for selection of transfected mammalian cells, ampicillin resistance gene for selection of E. coli, pUC origin and fi origin.

As shown in figure 4, the HSV.tk-Zeo reporter gene composed of five repeats of GAL4 DNA binding sequence followed by TATA box, HSV.tk-Zeo fusion gene and SV4O poly adenylation sequence. The complete sequence of a single box of GAL4 DNA binding sequence is: TCCGCTCGGAGGACAGTAC.

The HSV.tk-Zeo cassette remains transcriptionally inactive in mammalian cells, unless a transcription activator protein is expressed in the cells. To confirm that the HSV.tk-Zeo cassette cloned within the invented plasmid remains transcriptionally inactive in mammalian cells, HeLa cells were transfected with pHEJI plasmid and selected with G418. Then the pHEJI transfected HeLa cells were re-transfected with pG4VP plasmid encoding GAL4-VP16 chimeric transcription activating protein. The construction of pG4VP plasmid is shown if figure 5.

To investigate the expression of the HSV.tk-Zeo encoding sequence in these cells the proliferation of the pHEJI and pHEJI+pG4VP cells were analysed in the presence of various concentrations of GCV ranging from 0- 250 jtg/ml using MTT proliferation assay. In this experiments untransfected HeLa cells were used as negative control. In this experiment 1 x i04 cells/100p1 DMEM were seeded in each well of 96-well plates. The next day the cells were treated with a range of different concentrations of GCV from 0-250 ig/m1 for 6 days.

Then the proliferation using MU method was assayed on day 6 of GCV treatment.

The results showed that the pHEJI transfected and untransfected HeLa cells had a similar proliferation profile, which was quite different from that of the pHEJI+pG4VP cells. The pHEJT and untransfected cells appeared to be very resistant to GCV, while the pFIEJT+pG4VP cells were highly sensitive to GCV cytotoxicity. For instance, in the presence of 10 g/ml GCV the survival of pHEJI and parental HeLa cells was about or more than 80% and their survival rate did not come less than 40% at the highest concentration of GCV (i.e. 250 j.iglml). While, the survival of pHEJI+ pG4VP cells was only about 3% in the presence of 10.ig/m1 GCV. Furthermore, these results demonstrated that about 0.25 p.g/ml of GCV was required to kill 50% of pHEJT+pG4VP cells, while this amount for untransfected and pHE.J1 transfected cells was equal or more than 200.tg/m1. Comparison of these amounts of GCV indicates that HeLa/pHEJI+pG4VP cells were more than 800-fold more susceptible to GCV than HeLa/pHEJI cells. This experiment confirmed that the HSV.tk-Zeo cassette introduced in HeLa cells using invented plasmid remains transcriptionally silent in the absence of GAL4-VP16 chimeric protein.

Moreover, this cassette successfully is transcribed in the presence of GAL4- VP16 transcription activating protein.

Further experiments showed that pHEJI transfected and untransfected HeLa cells were very sensitive to zeocin, while pFIEJI+pG4VP cells were greatly resistant to zeocin. For instance, in the presence of! OOp.g/ml zeocin about 20% of pHEJI transfected and untransfected cells survived, while the survival rate of the pHEJI+pG4VP cells at this concentration of zeocin was more than 95%.

As the concentration of zeocin increased, the proliferation of the untransfected and pHEJI transfected HeLa cells continued decreasing so that less than 5% of these cells survived in the presence of 1000 j.tg/ml zeocin. Whilst, the pFLEJI+pG4VP cells continued proliferating and their survival rate in the presence of 1000 ig/ml zeocin was more than 90%. This finding demonstrates that the HSV.tk-Zeo cassette remains transcriptionally inactive in the cells and do not induce zeocin resistance unless GAL4-VP16 is expressed in the cells.

Furthermore, these results confinned that theGAL4-VP16IHSV.tk-Zeo system is a proper biological inducible system in which HSV.tk-Zeo reporter gene's expression is completely under the control of GAL4-VP1 6 transcription activating protein ant also is correlated with the activity and function of GAL4- VP 16 inside the cell.

As illustrated in figure 6, NX(L) and NX(R) oligonucleotides were inserted between GAL4 and VP16 domains using EcoRI site in pG4VP plasmid to generate pG4mVP plasmid whose map is illustrated in figure 7.

Plasmid pHEJI contains an independent expression cassette to clone gene of interest. This cassette contains a multiple cloning site containing IVheI, NotI, EcoRI, HindIll and AfiuI unique restriction sites for this purpose. Using NheI and HindIll sites, GAL4-m-VP16 was ligated into pHEJII plasmid resulting in generation of final pDBHZG4mVP plasmid, as shown in figure 8. To construct this plasmid G4mVP fragment (i.e. GAL4 - multiple cloning site - VP 16) was cut out of pG4mVP plasmid by NheI and HindIII double digestion. Plasmid pHEJI was also double digested with MzeI and Hindu enzymes and the G4mVP fragment was ligated into this plasmid. The pDBHZG4mVP plasmid is a 8325 pb vector containg: 1) The HSV.tk-Zeo cassette. HSV.tk-Zeo cassette being composed of 5 repeats of GAL4 DNA binding sequence, followed by TATA box placed upstream of HSV.tk-Zeo coding sequence. The HSV.tk-Zeo transcripts will be adenylated by the SV4O olyadenylation signal.

2) Plasmid pDBHZG4mVP encodes the GAL4-VP16 chimeric protein. GAL4- VP16 is driven by the CMV promoter and followed by BGH polyadenylaton sequence. The expression of GAL4-VP16 activates transcription of HSV.TK- Zeo cassette. Expression of HSV.TK-Zeo results in GCV mediated toxicity and a zeocin resistant phenotype.

3) There is a multiple cloning site between GAL4 and VP16 DNA segements.

The cloning site consists of unique EcoRJ and NotI sites. In addition to these sites there is a Smal and a XbaI restriction sites in the multiple cloning site.

However, the cutter sites are not unique in this plasmid. 3.A) By incorporating identified endoprotease cleavage sites between GAL4 and VP16 domains, the presence of a particular protease activity in mammalian cells can be quickly confirmed. 3.B) Additionally, this plasmid can be used to indentify new endoproteases by inserting a DNA oligonucleotide library in the multiple cloning site.

4) Plasmid pDBHZG4mVP also encodes the neomycin resistance gene driven by SV4O promoter and followed by SV4O polyadenylation signal. This allows for G418 mediated selection of the transfected cells.

5) Thiplasmid also contains ampicillin resistance gene in order to amplify the plasmid by transforming bacterial cells.

Once the cells are transfected with plasmid bearing oligonucleotide library between GAL4 and VP 16 the transfected cells will be positively selected with G418. Those cells in which GAL4-VP16 is not cleaved, should be very sensitive to GCV cytotoxicity but resistant to zeocin. However, those cells in which GAL4-VP 16 is cleaved will be resistant to GCV cytotoxicity. These cells will be selected by their GCV residstance from those cells in which GAL4-VP16 is not cleaved. Therefore, double (G418 and GCV) selection will allow the selection of the cells in which GAL4 and VP16 are proteolytically cleaved. The isolated colonies would be then used for RT-PCR application and sequencing to identify the specific protease sequence responsible for the cleavage of GAL4-VP1 6. 4q

Claims (8)

1. A biological system was developed to identify new and/or tissue specific cytoplasmic and possibly nuclear site specific endoproteases (i. e., specific amino acid sequences cleaving endoproteases), and composed of three pHEJI, pG4mVP and pDBHZG4mVP plasmids, from those plasmid pDBHZG4mVP is used alone due to containing all necessary elements, but plasmid pG4mVP is used along with pI-IEJI plasmid which contains HSV.ik- Zeo (i.e., HSV.tk-Sh.ble) double selection marker as the reporter gene, whose expression is under the control and also correlated with the activity and function of GAL4-VP 16 transcription activator encoded by pG4mVP plasmid, in which a multiple cloning site was created between GAL4 and VPI6 encoding sequences in order to incorporate oligonucleotide library or known endoproteases cleavage sites encoding sequences between GAL4 and VPI6 fragments providing a wide range of amino acid sequences in contact with endoproteases resulting in proteolytic cleavage of GAL4-VPI6 and subsequently inactivation of the transcription of l-ISV.tk-Zeo, resulting in changing the phenotype of the cells from GCVS/ZeoR (i.e., sensitive to GCV and resistant to zeocin cytotoxic agents) to GCVK/Zeo) (i.e., resistant to GCV and sensitive to zeocin) that makes it possible to select the cells in which GAL4-VPI6 undergoes proteolytic cleavage from those cells in which (AL4- VP16 remains fused to each other in the presence of GCV and finally use the surviving cells to identify the sequences encoding amino acid chains cleaved by the endoproteases.

2. A system as claimed in Claim I, is developed to identify new and/or tissue specific cytoplasmic and possibly nuclear site specific endoproteases (i.e., specific amino acid sequences cleaving endoproteases) and composed of three pFIEJI.

pG4mVP and pDBHZG4mVP plasmids. from those plasmid pl-IEJI was already developed and filed with GB 2390606 patent application number.

3. A system as claimed in Claim I and Claim 2. with 1dentifying site specific endoproteases" and "site specific endoprotease activity study' applications that whose applications are different from the applications of its component (i.e.. the systems component), plasmid pHEJI that is mainly used to "study transcription elements by evaluating transcription activating function of different transcription activating proteins" and also "DNA sequences to which transcription activators bind".

4. A system, as claimed in Claim I, which contains two plasmids called pHEJI and pG4rnVP, from those pHEJI plasmid contains neomycin selection marker expression cassette to select the transfected cells from untransfected cells and also contains HSV.ik-Zeo inducible cassette composed of multiple yeast GAL4 DNA binding sequence (upstream activator sequence; UAS) followed by TATA box and HSV.tk-Zeo coding sequence which remains transcriptionally silent in the absence of GAL4-VPI6 and is transcriptionally active in the presence of GAL4- VPI6 indicating that the expression of I-IS V.TK-Zeo is correlated with activity and function of GAL4-VPI6, which is encoded by pG4mVP plasmid in which a multiple cloning site composed of 35 nucleotides coding 15 amino acids and consisting EcoRl, Notl and Xbal restriction sites was created between GAL4 and VP 16 encoding sequences.

5. A system as claimed in Claim I and Claim 2 and Claim 4, provides a system to identify novel and/or tissue specific endoproteases by incorporating oligonucleotide library between GAL4 and VP16 DNA fragments using EcoRl, Noll and XbaI unique restriction sites in pG4mVP or EcoRl and Noil unique restriction sites in pDBHZG4mVP plasmid providing a wide range of amino acid sequences in contact with cytoplasmic or possibly nuclear site specific endoproteases resulting in the proteolytic cleavage ofGAL4-VPI6.

6. A system as claimed in Claim I and Claim 2 and Claim 5. additionally, provides a system to study the presence of known endoproteases in different cells and tissues by incorporating known endoproteases cleavage site encoding sequences between GAL4 and VPI6 fragments resulting in bringing known endoproteases substrates in contact with target endoproteases.

7. A system as claimed in Claim I, composed of three pHEil, pG4mVP and pDBHZG4mVP plasmids, from which plasmid pDBHZG4mVP is used alone due to containing all necessary elements including HSV.ik-Zeo inducible cassette, GAL4-VPI6 expression cassette and neomycin or hygromycin selection marker expression cassette assembled in a single construct.

8. A biological plasmid system as described herein with reference to Figures 1-8 of the accompanying figures.