GB2379932A

GB2379932A - Cyclic nucleotide-gated ion channel polypeptide

Info

Publication number: GB2379932A
Application number: GB0219387A
Authority: GB
Inventors: Daniel Crowther; Andrew Jonathan Powell; Cynthia Ann Richards
Original assignee: Glaxo Group Ltd
Current assignee: Glaxo Group Ltd
Priority date: 2001-08-22
Filing date: 2002-08-20
Publication date: 2003-03-26
Also published as: GB0219387D0; GB0120350D0

Abstract

An isolated cyclic nucleotide gated ion channel polypeptide comprising <SL> <LI>(i) the amino acid sequence of SEQ ID NO: 2 or <LI>(iv) a variant thereof which is capable of binding to other CNG channel subunites to form a cyclic nucleotide gated ion channel or </SL> a fragment of (i) or (ii) which is capable of binding to other CNG channel subunits to form a cyclic nucleotide gated ion channel.

Description

Novel Protein Field of the Invention The present invention relates to cyclic nucleotide gated ion channel polypeptides.

Background of the Invention Ion channels are involved in a wide variety of neurological and other disorders in man. The cyclic nucleotide gated ion channel family consists of at least five distinct members (CNG1-5), the novel sequence claimed here is the human homologue of rat CNG5 (CNGX/rOCNC2). CNG1-3 are able to form functional homooligomeric channels. CNG4 & 5, although structurally related to CNG1-3, are unable to form functional homooligomeric channels. When CNG4 or 5 are co-expressed with CNGl-3 they heterooligomerise to yield channels with different physiological properties to the homooligomeric CNG1-3 channels. Thus the CNG4 & 5 subunits are considered to be modulatory (or ss) subunits of the CNG channels despite the fact that they are structurally related to CNG1-3 (also known as a-subunits). CNG1-5 channel subunits all have six transmembrane domains (with structural homology to voltage-gated potassium channels) and conserved cyclic nucleotide binding domains within their intracellular C-termini. The channels are most permeable to both calcium and sodium but at physiological concentrations of calcium the channels are more permeable to calcium than sodium.

The channels are directly activated by intracellular cyclic nucleotide (cAMP or cGMP) and the major function of the channels is to provide a second messenger-

regulated pathway for calcium influx. In rat olfactory neurons CNG5 heterooligomerises with CNG2 to yield a current that is more sensitive to cAMP than the CNG2 homooligomer current. In response to the binding of odorants to Gprotein-coupled receptors activate a Gs-like G-protein that increases adenylyl cyclase activity. The resulting increase in cAMP opens the CNG2/5 heterooligomeric channel in the cilia and dendrites of the olfactory neurons and the calcium efflux depolarises the cell membrane thereby triggering nerve impulses.

In non-olfactory cells CNG5-containing heterooligomeric channels will cause a calcium influx and membrane depolarisation in response to Gs-like G-protein-

coupled receptor activation.

Summary of the Invention A novel cyclic nucleotide gated ion channel subunit polypeptide, referred to herein as Hiphum 222, is now provided. Hiphum 222 is shown to be primarily expressed in testes, trachea and lung, cerebellum and adipose tissue. Hiphum 222 was also shown to be upregrulated in lung samples from Chronic Obstructive Pulmonary Disease (COPD) and Asthma patients. The cyclic nucleotide gated ion channels comprising the novel cyclic nucleotide gated ion channel subunit are screening targets for the identification and development of novel pharmaceutical agents, including modulators of cyclic nucleotide gated ion channel activity. These agents may be used in the treatment and/or prophylaxis of respiratory disorders such as COPD, Asthma, cough, Actute Bronchitis, Acute Respiratory Failure in COPD, Adult respiratory distress syndrome, cystic fibrosis or Emphysema.

Accordingly, the present invention provides an isolated cyclic nucleotide gated ion channel subunit polypeptide comprising: (i) the amino acid sequence of SEQ ID NO: 2; (ii) a variant thereof which is capable of binding to other CNG channel subunits to form a cyclic nucleotide gated ion channel; or (iii) a fragment of (i) or (ii) which is capable of binding to other CNG channel subunits to form a cyclic nucleotide gated ion channel.

According to another aspect of the invention there is provided a polynucleotide encoding a polypeptide of the invention which polynucleotide includes a sequence comprising: (a) the nucleic acid sequence of SEQ ID NO: 1 and/or a sequence complementary thereto; (b) a sequence which hybridises under stringent conditions to a sequence

as defined in (a) ; (c) a sequence that is degenerate as a result of the genetic code to a sequence as defined in (a) or (b); or (d) a sequence having at least 95% identity to a sequence as defined in (a), (b) or (c).

The invention also provides: an expression vector which comprises a polynucleotide of the invention and which is capable of expressing a polypeptide of the invention; a host cell comprising an expression vector of the invention; a method of producing a polypeptide of the invention which method comprises maintaining a host cell of the invention under conditions suitable for obtaining expression of the polypeptide and isolating the said polypeptide; an antibody specific for a polypeptide of the invention; a method for identification of a substance that modulates cyclic nucleotide gated ion channel activity and/or expression, which method comprises contacting a cyclic nucleotide gated ion channel comprising a polypeptide of the invention, or contacting a polynucleotide, expression vector or host cell of the invention with a test substance and determining the effect of the test substance on the activity and/or expression of the said polypeptide or the polypeptide encoded by the said polynucleotide, thereby to determine whether the test substance modulates cyclic nucleotide gated ion channel activity and/or expression; a compound which stimulates or modulates cyclic nucleotide gated ion channel activity and which is identifiable by the method referred to above; a method of treating a subject having a disorder that is responsive to Hiphum 222 stimulation or modulation, which method comprises administering to said subject an effective amount of substance of the invention; and use of a substance that stimulates or modulates cyclic nucleotide gated ion channel activity in the manufacture of a medicament for the treatment or prophylaxis of a disorder that is responsive to stimulation or modulation of cyclic nucleotide gated ion channel activity. Preferably the disorder is a respiratory disease selected from COPD, asthma, cough, actute bronchitis, acute respiratory failure in COPD, adult respiratory distress syndrome, cystic fibrosis or emphysema.

Brief Description of the Figures

Figure 1 shows the relative expression levels of Hiphum 222 in a variety of human tissues.

Figure 2 shows the expression of Hiphum 222 in a variety of normal and stimulated cell and tissue types.

Brief Description of the Sequences SEQ ID NO: 1 shows the nucleotide sequence of human protein Hiphum 222.

SEQ ID NO: 2 shows the amino acid sequence of Hiphum 222.

Detailed Description of the Invention Throughout the present specification and the accompanying claims the words "comprise"and"include"and variations such as"comprises","comprising", "includes"and"including"are to be interpreted inclusively. That is, these words are intended to convey the possible inclusion of other elements or integers not specifically recited, where the context allows.

The present invention relates to a human cyclic nucleotide gated ion channel subunit, referred to herein as Hiphum 222, and variants thereof. Sequence information for Hiphum 222 is provided in SEQ ID NO: 1 (nucleotide) and in SEQ ID NO: 2 (amino acid). A polypeptide of the invention thus consists essentially of the amino acid sequence of SEQ ID NO: 2 or of a variant of that sequence, or of a fragment of either thereof.

Polypeptides of the invention may be in a substantially isolated form. It will be understood that the polypeptide may be mixed with carriers or diluents which will not interfere with the intended purpose of the polypeptide and still be regarded as substantially isolated. A polypeptide of the invention may also be in a substantially purified form, in which case it will generally comprise the polypeptide in a preparation in which more than 50%, e. g. more than 80%, 90%, 95% or 99%, by weight of the polypeptide in the preparation is a polypeptide of the invention.

Routine methods, can be employed to purify and/or synthesise the proteins according to the invention. Such methods are well understood by persons skilled in the art, and include techniques such as those disclosed in Sambrook et al, Molecular Cloning: a Laboratory Manual, 2nd Edition, CSH Laboratory Press, 1989, the disclosure of which is included herein in its entirety by way of reference.

The term"variant"refers to a polypeptide which has a same essential character or basic biological functionality as Hiphum 222. The essential character of Hiphum 222 can be defined as follows: Hiphum 222 is a cyclic nucleotide gated ion channel subunit. Hiphum 222 may form a homomultimeric channel with other Hiphum 222 subunits. Alternatively, Hiphum 222 may form a heteromultimeric channel, which may comprise subunits from other cyclic nucleotide gated families such as ENG1, CNG2, CNG3 or CNG4. Said heteromultimeric channel may comprise more than one Hiphum 222 subunit, provided that at least one subunit from another family is present. Said heteromultimeric channel may alternatively comprise only one Hiphum 222 subunit, and further subunits exclusively from one family, or subunits selected from a variety of families.

As either a homomultimer or a heteromultimer, said channel preferably comprises 4 subunits. The channel comprising Hiphum 222 preferably operates as a cyclic nucleotide operated calcium channel that, when intracellular cyclic nucleotide levels are increased by G-protein coupled receptor activation, transduces a hormonally induced rise of the cellular cGMP/cAMP level into an influx of calcium.

Such a rise in intracellular calcium mediated by a channel comprising Hiphum 222 could trigger such diverse functions as cell motility, mitogenic responses, secretion or neural plasticity. Preferably a variant polypeptide is one which oligomerises by binding to the same CNG subunits as hiphum 222. A variant polypeptide may also be one which binds to the same cyclic nucleotide or nucleotides as Hiphum 222. A polypeptide having the same essential character as Hiphum 222 may be identified by testing for oligomerisation of the polypeptide with other CNG subunits, and monitoring for a function of the cyclic nucleotide gated ion channel comprising the variant polypeptide selected from, for example, cell motility, mitogenic responses, secretion or neural plasticity.

Typically, polypeptides with more than about 95% identity preferably at least 96% or at least 97% and particularly preferably at least 98% or at least 99% identity, with the amino acid sequences of SEQ ID NO: 2, are considered as variants of the proteins. Such variants may include allelic variants and the deletion, modification or addition of single amino acids or groups of amino acids within the protein sequence, as long as the peptide maintains a basic biological functionality of Hiphum 222.

Amino acid substitutions may be made, for example from 1,2 or 3 to 10, 20 or 30 substitutions. The modified polypeptide generally retains activity as the ability to form part of a cyclic nucleotide gated ion channel. Conservative substitutions may be made, for example according to the following Table. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other.

ALIPHATIC Non-polar GAP ILV Polar-uncharged C S T M N Q Polar-charged D E KR AROMATIC H F W Y

Shorter polypeptide sequences are within the scope of the invention. For example, a peptide of at least 20 amino acids or up to 50,60, 70,80, 100,150, 200, 300,400 or 500 amino acids in length is considered to fall within the scope of the invention as long as it demonstrates a basic biological functionality of Hiphum 222.

In particular, but not exclusively, this aspect of the invention encompasses the situation when the protein is a fragment of the complete protein sequence and may represent a cyclic nucleotide-binding region. Such fragments can be used to construct chimeric receptors preferably with another cyclic nucleotide gated ion channel subunit or channel. Such fragments of Hiphum 222 or a variant thereof can also be used to raise anti-Hiphum 222 antibodies. In this embodiment the fragment may comprise an epitope of the Hiphum 222 polypeptide and may otherwise not demonstrate the cyclic nucleotide binding or other properties of Hiphum 222.

Polypeptides of the invention may be chemically modified, e. g. posttranslationally modified. For example, they may be glycosylated or comprise modified amino acid residues. They may also be modified by the addition of

histidine residues to assist their purification or by the addition of a signal sequence to promote insertion into the cell membrane. Such modified polypeptides fall within the scope of the term"polypeptide"of the invention.

The invention also includes nucleotide sequences that encode for Hiphum 222 or variant thereof as well as nucleotide sequences which are complementary thereto. The nucleotide sequence may be RNA or DNA including genomic DNA, synthetic DNA or cDNA. Preferably the nucleotide sequence is a DNA sequence and most preferably, a cDNA sequence. Nucleotide sequence information is provided in SEQ ID NO: 1. Such nucleotides can be isolated from human cells or synthesised according to methods well known in the art, as described by way of example in Sambrook et al, 1989.

Typically a polynucleotide of the invention comprises a contiguous sequence of nucleotides which is capable of hybridizing under selective conditions to the coding sequence or the complement of the coding sequence of SEQ ID NO: 1.

A polynucleotide of the invention can hydridize to the coding sequence or the complement of the coding sequence of SEQ ID NO: 1 at a level significantly above background. Background hybridization may occur, for example, because of other cDNAs present in a cDNA library. The signal level generated by the interaction between a polynucleotide of the invention and the coding sequence or complement of the coding sequence of SEQ ID NO : 1 is typically at least 10 fold, preferably at least 100 fold, as intense as interactions between other polynucleotides and the coding sequence of SEQ ID NO: 1. The intensity of interaction may be measured, for example, by radiolabelling the probe, e. g. with 32p. Selective hybridisation may typically be achieved using conditions of medium to high stringency. However, such hybridisation may be carried out under any suitable conditions known in the art (see Sambrook et al, 1989). For example, if high stringency is required suitable conditions include from 0. 1 to 0.2 x SSC at 60 C up to 65 C. If lower stringency is required suitable conditions include 2 x SSC at 60 C.

The coding sequence of SEQ ID NO: 1 may be modified by nucleotide substitutions, for example from 1,2 or 3 to 10, 25,50 or 100 substitutions. The polynucleotide of SEQ ID NO: 1 may alternatively or additionally be modified by one or more insertions and/or deletions and/or by an extension at either or both ends.

A polynucleotide may include one or more introns, for example may comprise

genomic DNA. Additional sequences such as signal sequences which may assist in insertion of the polypeptide in a cell membrane may also be included. The modified polynucleotide generally encodes a polypeptide which has Hiphum 222 activity. Alternatively, a polynucleotide encodes a cyclic nucleotide-binding portion of a polypeptide or a polypeptide which inhibits Hiphum 222 activity. Degenerate substitutions may be made and/or substitutions may be made which would result in a conservative amino acid substitution when the modified sequence is translated, for example as shown in the Table above.

A nucleotide sequence which is capable of selectively hybridizing to the complement of the DNA coding sequence of SEQ ID NO: 1 will generally have at least 95%, for example at least 96%, 97% 98% or preferably at least 99% sequence identity to the coding sequence of SEQ ID NO: 1 over a region of at least 20, preferably at least 30, for instance at least 40, at least 60, more preferably at least 100 contiguous nucleotides or most preferably over the full length of SEQ ID NO: 1.

For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology (for example used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p387-395). The PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (typically on their default settings), for example as described in Altschul (1993) J. Mol. Evol.

36: 290-300; Altschul et al (1990) J. Mol. Biol. 215: 403-10.

Software for performing BLAST analyses is publicly available through the National Centre for Biotechnology Information (http : //www. ncbi. nlm. nih. gov/).

This algorithm involves first identifying high scoring sequence pair (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al, 1990). These initial neighbourhood word hits act as seeds for initiating searches to find HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.

The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoffand Henikoff (1992) Proc. Natl. Acad.

Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.

The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e. g. , Karlin and Altschul (1993) Proc. Nat Acad. Sci.

USA 90: 5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P (N) ), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

Any combination of the above mentioned degrees of sequence identity and minimum sizes may be used to define polynucleotides of the invention, with the more stringent combinations (i. e. higher sequence identity over longer lengths) being preferred. Thus, for example a polynucleotide which has at least 95% sequence identity over 25, preferably over 30 nucleotides forms one aspect of the invention, as does a polynucleotide which has at least 95% sequence identity over 40 nucleotides.

The nucleotides according to the invention have utility in production of the proteins according to the invention, which may take place in vitro, in vivo or ex vivo.

The nucleotides may be involved in recombinant protein synthesis or indeed as therapeutic agents in their own right, utilised in gene therapy techniques. Nucleotides complementary to those encoding Hiphum 222, or antisense sequences, may also be used in gene therapy.

Polynucleotides of the invention may be used as a primer, e. g. a PCR primer, a primer for an alternative amplification reaction, a probe e. g. labelled with a revealing label by conventional means using radioactive or non-radioactive labels, or the polynucleotides may be cloned into vectors.

Such primers, probes and other fragments will preferably be at least 10, preferably at least 15 or at least 20, for example at least 25, at least 30 or at least 40 nucleotides in length. They will typically be up to 40,50, 60,70, 100 or 150

nucleotides in length. Probes and fragments can be longer than 150 nucleotides in length, for example up to 200,300, 400,500, 600,700, 1000,1500 or 2000 nucleotides in length, or even up to a few nucleotides, such as five or ten nucleotides, short of the coding sequence of SEQ ID NO: 1.

The present invention also includes expression vectors that comprise nucleotide sequences encoding the proteins or variants thereof of the invention. Such expression vectors are routinely constructed in the art of molecular biology and may for example involve the use of plasmid DNA and appropriate initiators, promoters, enhancers and other elements, such as for example polyadenylation signals which may be necessary, and which are positioned in the correct orientation, in order to allow for protein expression. Other suitable vectors would be apparent to persons skilled in the art. By way of further example in this regard we refer to Sambrook et al. 1989.

Polynucleotides according to the invention may also be inserted into the vectors described above in an antisense orientation in order to provide for the production of antisense RNA. Antisense RNA or other antisense polynucleotides may also be produced by synthetic means. Such antisense polynucleotides may be used as test compounds in the assays of the invention or may be useful in a method of treatment of the human or animal body by therapy.

Preferably, a polynucleotide of the invention or for use in the invention in a vector is operably linked to a control sequence which is capable of providing for the expression of the coding sequence by the host cell, i. e. the vector is an expression vector. The term"operably linked"refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.

A regulatory sequence, such as a promoter,"operably linked"to a coding sequence is positioned in such a way that expression of the coding sequence is achieved under conditions compatible with the regulatory sequence.

The vectors may be for example, plasmid, virus or phage vectors provided with a origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter. The vectors may contain one or more selectable marker genes, for example an ampicillin resistence gene in the case of a bacterial plasmid or a resistance gene for a fungal vector. Vectors may be used in vitro, for example for the production of DNA or RNA or used to transfect

or transform a host cell, for example, a mammalian host cell. The vectors may also be adapted to be used in vivo, for example in a method of gene therapy.

Promoters and other expression regulation signals may be selected to be compatible with the host cell for which expression is designed. For example, yeast

promoters include S. cerevisiae GAL4 and ADH promoters, S. pombe nmtl and adh promoter. Mammalian promoters include the metallothionein promoter which can be induced in response to heavy metals such as cadmium. Viral promoters such as the SV40 large T antigen promoter or adenovirus promoters may also be used. All these promoters are readily available in the art.

Mammalian promoters, such as -actin promoters, may be used. Tissuespecific promoters are especially preferred. Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR), the rous sarcoma virus (RSV) LTR promoter, the SV40 promoter, the human cytomegalovirus (CMV) IE promoter, adenovirus, HSV promoters (such as the HSV IE promoters), or HPV promoters, particularly the HPV upstream regulatory region (URR). Viral promoters are readily available in the art.

The vector may further include sequences flanking the polynucleotide giving rise to polynucleotides which comprise sequences homologous to eukaryotic genomic sequences, preferably mammalian genomic sequences, or viral genomic sequences. This will allow the introduction of the polynucleotides of the invention into the genome of eukaryotic cells or viruses by homologous recombination. In particular, a plasmid vector comprising the expression cassette flanked by viral sequences can be used to prepare a viral vector suitable for delivering the polynucleotides of the invention to a mammalian cell. Other examples of suitable viral vectors include herpes simplex viral vectors and retroviruses, including lentiviruses, adenoviruses, adeno-associated viruses and HPV viruses. Gene transfer techniques using these viruses are known to those skilled in the art. Retrovirus vectors for example may be used to stably integrate the polynucleotide giving rise to the polynucleotide into the host genome. Replication-defective adenovirus vectors by contrast remain episomal and therefore allow transient expression.

The invention also includes cells that have been modified to express the Hiphum 222 polypeptide or a variant thereof. Such cells include transient, or preferably stable higher eukaryotic cell lines, such as mammalian cells or insect

cells, using for example a baculovirus expression system, lower eukaryotic cells, such as yeast or prokaryotic cells such as bacterial cells. Particular examples of cells which may be modified by insertion of vectors encoding for a polypeptide according to the invention include mammalian HEK293T, CHO, HeLa, BHK, 3T3 and COS cells. Preferably the cell line selected will be one which is not only stable, but also allows for mature glycosylation and cell surface expression of a polypeptide.

Expression may be achieved in transformed oocytes. A polypeptide of the invention may be expressed in cells of a transgenic non-human animal, preferably a mouse. A transgenic non-human animal expressing a polypeptide of the invention is included within the scope of the invention. A polypeptide of the invention may also be expressed in Xenopus laevis oocytes, in particular for use in an assay of the invention. A polypeptide of the invention may be purified from any suitable cell type from any species for reconstitution into lipid bilayers or vesicles.

According to another aspect, the present invention also relates to antibodies, specific for a polypeptide of the invention. Such antibodies are for example useful in purification, isolation or screening methods involving immunoprecipitation techniques or, indeed, as therapeutic agents in their own right.

Antibodies may be raised against specific epitopes of the polypeptides according to the invention. Such antibodies may be used to block cyclic nucleotide binding to the polypeptide, or to block heterologomerisation of the channel with other cyclic nucleotide gated subunits, such as CNG1, CNG2 or CNG3. An antibody, or other compound,"specifically binds"to a protein when it binds with preferential or high affinity to the protein for which it is specific but does substantially bind not bind or binds with only low affinity to other proteins. A variety of protocols for competitive binding or immunoradiometric assays to determine the specific binding capability of an antibody are well known in the art (see for example Maddox et al, J. Exp. Med. 158, 1211-1226,1993). Such immunoassays typically involve the formation of complexes between the specific protein and its antibody and the measurement of complex formation.

Antibodies of the invention may be antibodies to human polypeptides or fragments thereof. For the purposes of this invention, the term"antibody", unless specified to the contrary, includes fragments which bind a polypeptide of the invention. Such fragments include Fv, F (ab') and F (ab') 2 fragments, as well as

single chain antibodies. Furthermore, the antibodies and fragment thereof may be chimeric antibodies, CDR-grafted antibodies or humanised antibodies.

Antibodies may be used in a method for detecting polypeptides of the invention in a biological sample, which method comprises: providing an antibody of the invention; II incubating a biological sample with said antibody under conditions which allow for the formation of an antibody-antigen complex; and III determining whether antibody-antigen complex comprising said antibody is formed.

A sample may be for example a tissue extract, blood, serum and saliva.

Antibodies of the invention may be bound to a solid support and/or packaged into kits in a suitable container along with suitable reagents, controls, instructions, etc.

Antibodies may be linked to a revealing label and thus may be suitable for use in methods of in vivo Hiphum 222 imaging.

Antibodies of the invention can be produced by any suitable method. Means for preparing and characterising antibodies are well known in the art, see for example Harlow and Lane (1988)"Antibodies : A Laboratory Manual", Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. For example, an antibody may be produced by raising antibody in a host animal against the whole polypeptide or a fragment thereof, for example an antigenic epitope thereof, herein after the "immunogen".

A method for producing a polyclonal antibody comprises immunising a suitable host animal, for example an experimental animal, with the immunogen and isolating immunoglobulins from the animal's serum. The animal may therefore be inoculated with the immunogen, blood subsequently removed from the animal and the IgG fraction purified.

A method for producing a monoclonal antibody comprises immortalising cells which produce the desired antibody. Hybridoma cells may be produced by fusing spleen cells from an inoculated experimental animal with tumour cells (Kohler and Milstein (1975) Nature 256,495-497).

An immortalized cell producing the desired antibody may be selected by a conventional procedure. The hybridomas may be grown in culture or injected intraperitoneally for formation of ascites fluid or into the blood stream of an

allogenic host or immunocompromised host. Human antibody may be prepared by in vitro immunisation of human lymphocytes, followed by transformation of the lymphocytes with Epstein-Barr virus.

For the production of both monoclonal and polyclonal antibodies, the experimental animal is suitably a goat, rabbit, rat or mouse. If desired, the immunogen may be administered as a conjugate in which the immunogen is coupled, for example via a side chain of one of the amino acid residues, to a suitable carrier.

The carrier molecule is typically a physiologically acceptable carrier. The antibody obtained may be isolated and, if desired, purified.

An important aspect of the present invention is the use of polypeptides according to the invention in screening methods. The screening methods may be used to identify substances that bind to cyclic nucleotide gated ion channels and in particular which bind to Hiphum 222. Screening methods may also be used to identify agonists or antagonists which may modulate cyclic nucleotide gated ion channel activity, inhibitors or activators of Hiphum 222 activity, agents which upregulate or down-regulate Hiphum 222 expression, agents which prevent or enhance heterooligomerisation of Hiphum 222 with other members of the cyclic nucleotide gated ion channel family and/or agents that activate or inhibit the translocation of the protein from the cytosol to the plasma membrane. In general, activators will be channel openers, and inhibitors will be channel blockers (which includes statedependent modulators of the channel).

Any suitable format may be used for the assay. In general terms such screening methods may involve contacting a polypeptide of the invention with a test substance and monitoring for binding of the test substance to the polypeptide or measuring receptor activity. A polypeptide of the invention may be incubated with a test substance. Modulation of cyclic nucleotide gated ion channel activity may be determined. In a preferred aspect, the assay is a cell-based assay. Preferably the assay may be carried out in a single well of a microtitre plate. Assay formats which allow high throughput screening are preferred.

Modulator activity can be determined by contacting cells expressing a polypeptide of the invention with a substance under investigation and by monitoring an effect mediated by the polypeptide. The cells expressing the polypeptide may be

in vitro or in vivo. The polypeptide of the invention may be naturally or recombinantly expressed. Preferably, the assay is carried out in vitro using cells expressing recombinant polypeptide. Preferably, control experiments are carried out on cells which do not express the polypeptide of the invention to establish whether the observed responses are the result of activation of the polypeptide. Typically the cells will express other cyclic nucleotide gated ion channels such as CNG1, CNG2 or CNG3.

The binding of a test substance to a polypeptide of the invention can be determined directly. For example, a radiolabelled test substance can be incubated with the polypeptide of the invention and binding of the test substance to the polypeptide can be monitored. Typically, the radiolabelled test substance can be incubated with cell membranes containing the polypeptide until equilibrium is reached. The membranes can then be separated from a non-bound test substance and dissolved in scintillation fluid to allow the radioactive content to be determined by scintillation counting. Non-specific binding of the test substance may also be determined by carrying out a competitive binding assay.

Substances that inhibit the interaction of a polypeptide of the invention with cyclic nucleotides or other cyclic nucleotide gated subunits may also be identified through a yeast 2-hybrid assay or other protein interaction assay such as a coimmunoprecipitation or an ELISA based technique.

Assays may be carried out using cells expressing Hiphum 222, and incubating such cells with the test substance. The results of the assay are compared to the results obtained using the same assay in the absence of the test substance. Cells expressing Hiphum 222 constitutively may be provided for use in assays for Hiphum 222 function. Additional test substances may be introduced in any assay to look for inhibitors or enhancers of binding of Hiphum 222 to cyclic nucleotides or inhibitors or enhancers of Hiphum 222-mediated activity, .

The acitivity of the channel comprising Hiphum 222 can be assayed by measuring changes in the membrane potential of cells expressing the channel, upon channel activation or inhibition. Changes in current passing across the cell membrane may be measured by electrophysiology, following inhibition or activation of the channel when expressed in cells. This may be done by inside out patch clamp electrophysiology, with the channel being expressed in oocytes or HEK293 cells

The ability of a test substance to modulate the Hiphum 222 regulated flow of calcium or sodium ions through cyclic nucleotide gated ion channels may also be determined using fluorescence based assays using a Fluorometric Imaging Plate Reader (FLIPR) and membrane voltage sensitive dyes, such as DiBac or the three bis-bartbituric acid oxonols, or calcium or sodium sensitive dyes. FRET/BRET based membrane voltage sensitive dyes with VIPR may also be used.

Reporter assays using Calcium or sodium ion sensitive photoproteins that increase or decrease light emission on the influx or efflux of calcium or sodium ions can also be used. This change in light emission can be detected using an imaging system. Also useful are reporter gene assays that link the intracellular calcium or sodium concentration to a signalling cascade that causes up or down regulation of expression of a readily detectable reporter protein such as luciferase.

Assays may also be carried out by measuring the influx or efflux of radioactive calcium, barium, sodium or guanidine ions in cells expressing a polypeptide of the invention.

Electrophysiological recordings of cell membrane currents or membrane potentials from cells expressing a polypeptide of the invention and one or more subunits from cyclic nucleotide gated ion channel 1, 2 or 3 may also be used to assay for modulatory activity of a test substance.

Preferably, electrophysiological assays and/or assays comprising measuring changes in intracellular calcium or sodium ion concentration are performed on cells expressing a polypeptide of the invention and expressing one or more subunits from cyclic nucleotide channels 1,2 or 3, and further comprising cyclic nucleotides.

Assays may also be carried out to identify substances which modify Hiphum 222 expression, for example substances which up-or down-regulate expression.

Such assays may be carried out for example by using antibodies for Hiphum 222 to monitor levels of Hiphum 222 expression. Other assays which can be used to monitor the effect of a test substance on Hiphum 222 expression include using a reporter gene construct driven by the Hiphum 222 regulatory sequences as the promoter sequence and monitoring for expression of the reporter polypeptide.

Further possible assays could utilise membrane fractions from overexpression of Hiphum 222 polypeptide either in X laevis oocytes or cell lines such as HEK293,

CHO, COS7, BHK, 3T3 and HeLa cells. For these assay, Hiphum 222 could also be expressed in Xenopus Oocytes following injection of plasmid DNA or in-vitro transcribed complementary RNA. Hiphum 222 may also be expressed in insect or mammalian cells using baculovirus or BacMam expression systems.

Additional control experiments may be carried out.

Suitable test substances which can be tested in the above assays include combinatorial libraries, defined chemical entities and compounds, peptide and peptide mimetics, oligonucleotides and natural product libraries, such as display (e. g. phage display libraries) and antibody products.

Typically, organic molecules will be screened, preferably small organic molecules which have a molecular weight of from 50 to 2500 daltons. Candidate products can be biomolecules including, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.

Test substances may be used in an initial screen of, for example, 10 substances per reaction, and the substances of these batches which show inhibition or

activation tested individually. Test substances may be used at a concentration of from InM to 1OOOpM, preferably from lM to lOOuM, more preferably from IjM to 10, uM. Preferably, the activity of a test substance is compared to the activity shown by a known activator or inhibitor. A test substance which acts as an inhibitor may produce a 50% inhibition of activity of the channel. Alternatively a test substance which acts as an activator may produce 50% of the maximal activity produced using a known activator.

Another aspect of the present invention is the use of polynucleotides encoding the Hiphum 222 polypeptides of the invention to identify mutations in Hiphum 222 genes which may be implicated in human disorders. Identification of such mutations may be used to assist in diagnosis or susceptibility to such disorders and in assessing the physiology of such disorders. Polynucleotides may also be used in hybridisation studies to monitor for up-or down-regulation of Hiphum 222

expression. Polynucleotides such as SEQ ID NO: 1 or fragments thereof may be used to identify allelic variants, genomic DNA and species variants.

The present invention provides a method for detecting variation in the expressed products encoded by Hiphum 222 genes. This may comprise determining the level of Hiphum 222 expressed in cells or determining specific alterations in the expressed product. Sequences of interest for diagnostic purposes include, but are not limited to, the conserved portions as identified by sequence similarity and conservation of intron/exon structure. The diagnosis may be performed in conjunction with kindred studies to determine whether a mutation of interest cosegregates with disease phenotype in a family.

Diagnostic procedures may be performed on polynucleotides isolated from an individual or alternatively, may be performed in situ directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary. Appropriate procedures are described in, for example, Nuovo, G. J., 1992, "PCR In Situ Hybridization: Protocols And Applications", Raven Press, NY). Such analysis techniques include, DNA or RNA blotting analyses, single stranded conformational polymorphism analyses, in situ hybridization assays, and polymerase chain reaction analyses. Such analyses may reveal both quantitative aspects of the expression pattern of a Hiphum 222, and qualitative aspects of Hiphum 222 expression and/or composition.

Alternative diagnostic methods for the detection of Hiphum 222 nucleic acid molecules may involve their amplification, e. g. by PCR (the experimental embodiment set forth in U. S. Patent No. 4,683, 202), ligase chain reaction (Barany, 1991, Proc. Natl. Acad. Sci. USA 88: 189-193), self sustained sequence replication (Guatelli et al., 1990, Proc. Natl. Acad. Sci. USA 87: 1874-1878), transcriptional amplification system (Kwoh et al., 1989, Proc. Natl. Acad. Sci. 15 USA 86: 1173- 1177), Q-Beta Replicase (Lizardi et al., 1988, Bio/Technology 6: 1197) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.

Particularly suitable diagnostic methods are chip-based DNA technologies such as those described by Hacia et al., 1996, Nature Genetics 14: 441-447 and

Shoemaker et al., 1996, Nature Genetics 14: 450-456. Briefly, these techniques involve quantitative methods for analyzing large numbers of nucleic acid sequence targets rapidly and accurately. By tagging with oligonucleotides or using fixed probe arrays, one can employ chip technology to segregate target molecules as high density arrays and screen these molecules on the basis of hybridization.

Following detection, the results seen in a given patient may be compared with a statistically significant reference group of normal patients and patients that have Hiphum 222 related pathologies. In this way, it is possible to correlate the amount or kind of Hiphum 222 encoded product detected with various clinical states or predisposition to clinical states.

Another aspect of the present invention is the use of the substances that have been identified by screening techniques referred to above in the treatment of disease states, which are responsive to regulation of cyclic nucleotide gated ion channel activity. The treatment may be therapeutic or prophylactic. The condition of a patient suffering from such a disease state can thus be improved.

In particular, such substances may be used in the treatment of a respiratory disease selected from COPD, Asthma, cough, Actute Bronchitis, Acute Respiratory Failure in COPD, Adult respiratory distress syndrome, cystic fibrosis or Emphysema.

Additional disease states that may be treated include Idiopathic Pulmonary Fibrosis, Idiopathic Langerhans'Cell Granulomatosis, Pleurisy, Respiratory Acidosis, Respiratory Alkalosis, Respiratory Distress Syndrome, Adenocarcinoma, Bronchogenic Carcinoma, Large Cell Lung Cancer, Small Cell Lung Cancer, Squamous Cell Carcinoma, Allergic Bronchopulmonary Aspergillosis, Asbestosis, Atelectasis, Berylliosis, Bronchiectasis, Castellani's Disease, Coal Worker's Pneumoconiosis, Cor Pulmonale, Croup, Desquamative Interstitial Pneumonia, Goodpasture's Syndrome, Hemothorax, Idiopathic Bronchiolitis Obliterans With Organizing Pneumonia, Pulmonary Hemosiderosis, Legionnaire's Disease, Lung Abscess, Lymphocytic Interstitial Pneumonitis, Pleural Effusion and Empyema, Pleural Fibrosis and Calcification, Pneumonia, Pneumothorax, Pulmonary Alveolar Proteinosis, Pulmonary Edema, Pulmonary Embolism and Infarction, Respiratory Bronchiolitis-Associated Interstitial Lung Disease, Sarcoidosis, Silicosis, Infant Sudden Death Syndrome, Tuberculosis.

Substances identified according to the screening methods outlined above may be formulated with standard pharmaceutically acceptable carriers and/or excipients as is routine in the pharmaceutical art. For example, a suitable substance may be dissolved in physiological saline or water for injections. The exact nature of a formulation will depend upon several factors including the particular substance to be administered and the desired route of administration. Suitable types of formulation are fully described in Remington's Pharmaceutical Sciences, Mack Publishing Company, Eastern Pennsylvania, 1 ih Ed. 1985, the disclosure of which is included herein of its entirety by way of reference.

The substances may be administered by enteral or parenteral routes such as via oral, buccal, anal, pulmonary, intravenous, intra-arterial, intramuscular, intraperitoneal, topical or other appropriate administration routes.

A therapeutically effective amount of a modulator is administered to a patient. The dose of a modulator may be determined according to various parameters, especially according to the substance used; the age, weight and condition of the patient to be treated; the route of administration; and the required regimen. A physician will be able to determine the required route of administration and dosage for any particular patient. A typical daily dose is from about 0.1 to 50 mg per kg of body weight, according to the activity of the specific modulator, the age, weight and conditions of the subject to be treated, the type and severity of the degeneration and the frequency and route of administration. Preferably, daily dosage levels are from 5 mg to 2 g.

Nucleic acid encoding Hiphum 222 or a variant thereof which inhibits or enhances Hiphum 222 activity or antisense nucleic acid may be administered to the mammal. Nucleic acid, such as RNA or DNA, and preferably, DNA, is provided in the form of a vector, such as the polynucleotides described above, which may be expressed in the cells of the mammal.

Nucleic acid administered to the mammal for gene therapy may encode functional Hiphum 222 or a variant thereof with an impaired function such as a dominant negative mutant.

Nucleic acid encoding the polypeptide may be administered by any available technique. For example, the nucleic acid may be introduced by needle injection, preferably intradermally, subcutaneously or intramuscularly. Alternatively, the

nucleic acid may be delivered directly across the skin using a nucleic acid delivery device such as particle-mediated gene delivery. The nucleic acid may be administered topically to the skin, or to mucosal surfaces for example by intranasal, oral, intravaginal or intrarectal administration.

Uptake of nucleic acid constructs may be enhanced by several known transfection techniques, for example those including the use oftransfection agents.

Examples of these agents includes cationic agents, for example, calcium phosphate and DEAE-Dextran and lipofectants, for example, lipofectam and transfectam. The dosage of the nucleic acid to be administered can be altered. Typically the nucleic acid is administered in the range of 1 pg to 1 mg, preferably to 1 pg to I Opg nucleic acid for particle mediated gene delivery and lOg to lmg for other routes.

The following Examples illustrate the invention.

Example 1: Characterisation of the sequence A cyclic nucleotide gated ion channel subunit, designated as Hiphum 222 has been identified. The nucleotide and amino acid sequences of the receptor protein have been determined. These are set out below in SEQ ID NOs: 1 and 2. Suitable primers and probes were designed and used to analyse tissue expression. Hiphum 222 was found to be primarily expressed in testes, trachea and lung, cerbellum and adipose. When Taqman was carreid out on a respiratory"disease"plate, Hiphum 222 was also found to be expressed in samples from lungs of COPD and asthma patients.

The chromosomal localization was also mapped. Human Hiphum 222 has been mapped to 1 lpl5. 4. Genetic association studies have found that this regiion is associated with asthma phenotypes: CSGA 1997 study: In 77 American Caucasian families with at least 2 sibs are affected with the disease. This link is not detected in the African Americans as well as in Hispanics in USA, in the same study.

Clinical asthma phenotype was linked to 1 lpl5 region (MLod=1.22 ; p=0. 0089). Not significant, but showed a clear evidence that this locus contributes to the disease phenotype. The low stat score might be explained by the small population collection as well. It is the first study, which reported this locus.

Ober et al : 1998 ; 1999 ; 2000 : 1 lpl5 region is linked (marker DllS899 ; LR X2=0.0003) to the positive skin prick test (+SPT) for mold in genetically isolated founder population, Canadian Hutterites (Caucasian origin). They have screened 693 members of this community in the latest report to get this score. Earlier studies have picked up the locus with weak stat score.

Wist (1999) & Wist et al (1999) : Genome scan carried out in German nationals for different phenotypes. Specific IgE levels were linked to this region (p=0. 0036).

Dizier et al (2000): French study on 279 sibs from 107 families with at least two sibs affected. IgE level is linked to 1 Ipl 5 area at p=0.02 (Dl 1S922) and at p=0. 01 (D 11 S569) levels.

This region is associated with the asthma phenotypes, but the significance level is not great. Lower statistical score can be explained by small sample collection as well as the background noise level contributed by the environmental factors as well as other genes.

HIPHUM222 (Human CNG5) is likely to interact with other CNG channel subunits (CNG1-3) to form a functional CNG channel through heterooligomerisation. It is also possible that Hiphum 222 will form a functional CNG channel through homooligomerisation. Any oligomeric channel comprising Hiphum 222 is likely to contain 4 CNG subunits.

Increases in intracellular cAMP or cGMP will activate oligomeric channels containing human CNG5 (HIPHUM222). Like other members of the cyclic nucleotide gated ion channel family, human CNG5 (HIPHUM222) has a conserved cyclic nucleotide-binding domain (between residues 375-391). Activity associated with this channel subunit is likely to be modulated by phosphorylation. It has a consensus site for cAMP-and cGMP-dependent protein kinases (at residues 314- 317), consensus sites for protein kinase C (at residues 106-108,138-140, 558-560), and consensus sites for casein kinase II phosphorylation (at residues 231-234,355-

358,370-373, 446-449,462-465, 558-562). The channel is also likely to be glycosylated.

Example 2: Screening for substances which exhibit protein modulating activity Mammalian cells, such as HEK293, CHO, COS, BHK, 3T3 or HeLa cells, or Xenopus oocytes over-expressing a polypeptide of the invention together with another cyclic nucleotide gated ion channel subunit (CNG1, 2 or 3) are generated for use in the assay. 96 and 384 well plate, high throughput screens (HTS) are employed using fluorescence based calcium or sodium indicator molecules or voltage sensitive indicator molecules. In order to activate the CNG channel in whole cell assays the cells may also express an appropriate Gs-like G-protein coupled receptor. In theses assay, the G-protein coupled receptor is activated by extracellular addition of agonist in order to cause the increase in intracellular cAMP concentration (mediated via Gsprotein coupled adenylyl cyclase activation) required to activate the CNG channel.

Secondary screening involves electrophysiological assays utilising two electrodes, voltage clamp or patch clamp technology. In electrophysiology assays the CNG channel can be activated by direct application of cAMP or cGMP to inside-out patches excised from Xenopus oocytes or mammalian cells expressing the appropriate channel subunits. Tertiary screens involve the study of modulators in rat and mouse models of disease relevant to the target.

A brief screening assay protocol based on a calcium sensitive fluorescent dye is as follows. Mammalian cells stably over-expressing the polypeptide of the invention and optionally an additional pore-forming cation channel subunit protein and/or an auxiliary cation channel subunit protein plus an appropriate Gs-like Gprotein coupled receptor are cultured in 96 or 384 well plates. One T225cm 3 flask is sufficient for setting up ten 96 well plates with a volume of 1 soul cell culture medium in each well. These plates are set up the night before each assay run. The culture media is removed and 100/l1 of assay buffer (145mM sodium chloride, 5mM potassium chloride, 2mM calcium chloride, 0.8mM magnesium chloride, lOmM DGlucose, 50mM HEPES, pH 7.4, 3mM probenecid) is added. The cells are then loaded with the calcium sensitive dye of choice (e. g. Fluo-3) for 30 minutes. The test compounds are added to the wells and pre-incubated for a period of 10 minutes. The channel is activated indirectly through the activation of a co-expressed Gs-protein

coupled receptor. This receptor activation causes a increase in intracellular cAMP that in turn activates the cation channel. Modulation of the activity of a polypeptide of the invention results in either an increase or a decrease in the activity of the channel and the resulting change in intracellular calcium caused by calcium influx through the channel is detected by a change in the fluorescence of the calcium sensitive dye and measured directly in a Fluorescence Imaging Plate Reader, (FLIPR; Molecular Devices). Channel activity is monitored in the presence and absence of a test substance and modulation of channel activity by the test substance is compared in the presence and absence of the test substance to determine whether the test substance is an agonist or antagonist of the CNG channel subunit.

A typical electrophysiology protocol using electrophysiology in oocytes expressing HIPHUM 222 plus a CNG a-subunit (CNG1, 2 or 3) is as follows.

HIPHUM 222 plus the CNG a-subunit are expressed in Xenopus laevis oocytes either: i) by injection of plasmid DNA that allows the expression of the ion channel cDNA or gene by virtue of an upstream promoter (for example the CMV promoter), or preferably ii) by injection of in vitro transcribed, m'G (5') pp (5') GTP-capped, complementary RNA synthesised from the ion channel cDNA by virtue of an upstream Sp6, T3 or T7 promoter and Sp6, T3 or T7 RNA polymerase.

Typically, 20-50ng of plasmid DNA or cRNA is injected per oocyte and whole-cell currents are recorded using two-microelectrode voltage-clamp (Geneclamp amplifier, Axon instruments Inc.) 1 to 7 days post-injection. Typical microelectrodes have a resistance of 0. 5 to 2MQ and are filed with 3M KCI. In a typical experiment to analyse the constitutive activity of the CNG channel, inside-out patches from the oocytes are voltage-clamped at neutral membrane potential (OmV) in ND96 solution (96mM NaCl, 2mM KCI, ImM MgCl2, 1. 8mM CaCh, SmM HEPES; pH 7. 5 at 25 C ; superfused at 2ml per min. ) and depolarising or hyperpolarising voltage pulses are applied to generate the electrical driving force to cause the channels to conduct cations across the membrane. Calcium or sodium currents elicited by these depolarising or hyperpolarising voltage steps are recorded.

Activation of the channel by addition of cAMP or cGMP to the intracellular side of the patched oocyte membrane can be assayed, using a similar protocol. Voltage-

protocols can be generated using pCLAMP8 software (Axon Instruments) and a P/N leak subtraction protocol is used throughout. In these experiments the effects of a test compound on current mediated by the channel is studied by inclusion of the compound in the extracellular buffer which is superfused across the oocyte.

A typical electrophysiology assay using mammalian cells expressing a polypeptide of the invention plus an appropriate CNG a-subunit is as follows.

Cells are grown on a glass coverslip, placed into a recording chamber (0. Sml volume) and superfused with an extracellular recording solution at 2 ml min-. Drugs are applied either via addition to the bath perfusate, or alternatively using a rapid perfusion system which consists of a series of reservoirs connected to a small microfil tube that is placed in close proximity to a voltage-clamped, inside-out cell membrane patch. Currents through the inside-out patch are recorded using an Axopatch 200B amplifier (Axon Instruments) or other voltage-clamp amplifier (e. g.

HEKA), using standard electrophysiological methods (Hamill et al., (1981) Pflugers Arch. 391: 85-100). Patch pipettes are fabricated from 1.5mm outside diameter borosilicate capillary glass (Clark Electromedical) using a micropipette puller (Sutter model P97), and fire polished (Narishige Microforge) to give final tip resistances of 2-4MQ. A silver/silver chloride pellet is used as the bath reference electrode and the potential difference between this and the recording electrode will be adjusted for zero current flow before seal formation. Cells are visualised using a Diaphot200 inverted microscope (Nikon) with modulation contrast optics at a final magnification ofx400.

High resistance seals (l-lOGQ) between pipette and the cell membranes are achieved by gentle suction and inside-out patches pulled off.

Cells are patch-clamped at neutral membrane potential (Om V) in an extracellular buffer containing 140mM NaCl, 4.7mM KCI, 1.2mM MgCl2, ImM CaCl2, 1 lmM glucose, 5mM HEPES (titrated with NaOH to pH 7.4 at 25OC) using

microelectrode pipettes containing 120mM CsF, 15mM NaCl, lOmM Cs-EGTA (ethylene glycol-bis (p-aminoethyl ester) N, N, N', N-tetra acetic acid, Cs salt), 10mM HEPES (titrated with CsOH to pH7. 25 at 25 C). Patch electrodes should have resistances of 2 to 6MQ when filled with the pipette-filling solution. In a typical experiment to analyse the constitutive activity of the CNG channel, depolarising or hyperpolarising voltage pulses are applied (from OmV) to generate the electrical driving force to cause the channels to conduct cations across the membrane.

Calcium or sodium currents elicited by these depolarising or hyperpolarising voltage steps are recorded. Activation of the CNG channel by cyclic nucleotides can be assayed by fast microperfusion of cAMP or cGMP over the intracellular side of the membrane patch.

Voltage command protocols are generated, and current records stored, via a Digidata 1200 analog/digital interface (Axon Instruments) controlled by microcomputer (Hewlett Packard Kayak XA) using pCLAMP8 Clampex software (Axon Instruments). Signals are prefiltered at 5kHz bandwidth and sampled at 20kHz. Capacitance transients and series resistance errors are compensated for (80- 85%) using the amplifier circuitry, and linear leakage currents subtracted using an on-line'P-4'procedure provided by the commercial software package.

Data are analysed using pCLAMP8/Clampfit (Axon Instruments), ORIGIN (MicroCal) and DAISI data handling and graphical presentation software packages.

Results can be presented as either arithmetic mean s. e mean or geometric mean with 95% confidence limits. Statistical comparisons are made using paired or unpaired Student's t-test and considered of significance when P < 0. 05.

Channel activity is monitored in the presence and absence of a test substance and modulation of channel activity by the test substance is compared in the presence and absence of the test substance to determine whether the test substance is an activator or inhibitor of the CNG channels containing the HIPHUM222 (human CNG5) subunit.

SEQ 10 NO : 1 AAAAAGAGAAAAGTTGAAAGATTGGGGACCATAAAACACATGGAATGGT TGGTAGGATCAGGCACTAGAAGTCACAAGAAGGATATGAGGACAAAAG CACCATAGGATGGCCCCTATCACACTACCTATGAGAAGGGTGTGATGG GGGAAGGCGTATGTGGAGGTAGATAAGGGTAGGAAGTAGGTTACAAAA ATAGAGCTCACTTCTCATGTGAGAGGCATCTCTTTGTCCCTGGAGAATA GTTTAGCACCTGACATAGATAAGCCATTCAGTAATAGTTGTTAAATAAAT AAATAGTGAGGCCCAAATAGAATTTGCAAAGATAAAACAGAGTGTTTGAT CCTACACTAAAACTGAGGTCTTCTGACCCAGAGGACACCTATGTAGCTC AGTTGCTGTGGAAAGAGGGGAGGAGGAAAACAGAGACAAGACTCAGGC TTCCCTCTGAGGCATGCACCCCCACCTTCTCCAGGGATCTCATTAGAGG TGTTTAGCTGGGCAGGTGTAAGCCCAGGCCCTGGGAGACAGGGCAGA GTGCTAGAGCTAGACTGTCTCCACCCCTTCAGTAGCGCTAGCTCTGGTT GTGTTGCTAAGAGCCCCAAAGACAAAGAAGTCACAGCAGAAGCCCAAC AGCAGCCTCCTTCAGGCAGTCAGGCACTAGTGCCCAACTCCAGAAGTC CCCTACAGGCAGAGAGGGTGTGGACATCTCACACCCCAGCACCAGACC ACAGAACCATGAGCCAGGACACCAAAGTGAAGACAACAGAGTCCAGTC CCCCAGCCCCATCCAAGGCCAGGAAGTTGCTGCCTGTCCTGGACCCAT CTGGGGATTACTACTACTGGTGGCTGAACACAATGGTCTTCCCAGTCAT GTATAACCTCATCATCCTCGTGTGCAGAGCCTGCTTCCCCGACTTGCAG CACGGTTATCTGGTGGCCTGGTTGGTGCTGGACTACACGAGTGACCTG CTATACCTACTAGACATGGTGGTGCGCTTCCACACAGGATTCTTGGAAC AGGGCATCCTGGTGGTGGACAAGGGTAGGATCTCGAGTCGCTACGTTC GCACCTGGAGTTTCTTCTTGGACCTGGCTTCCCTGATGCCCACAGATGT GGTCTACGTGCGGCTGGGCCCGCACACACCCACCCTGAGGCTGAACC GCTTTCTCCGCGCGCCCCGCCTCTTCGAGGCCTTCGACCGCACAGAGA CCCGCACAGCTTACCCAAATGCCTTTCGCATTGCCAAGCTGATGCTTTA CATTTTTGTCGTCATCCATTGGAACAGCTGCCTATACTTTGCCCTATCCC GGTACCTGGGCTTCGGGCGTGACGCATGGGTGTACCCGGACCCCGCG CAGCCTGGCTTTGAGCGCCTGCGGCGCCAGTACCTCTATAGCTTTTACT TCTCCACGCTGATACTGACTACAGTGGGCGATACACCGCCGCCAGCCA GGGAAGAAGAGTACCTCTTCATGGTGGGCGACTTCCTGCTGGCCGTCA TGGGTTTCGCCACCATCATGGGTAGCATGAGCTCTGTCATCTACAACAT GAACACTGCAGATGCGGCTTTCTACCCAGATCATGCACTGGTGAAGAAG TACATGAAGCTGCAGCACGTCAACCGCAAGCTGGAGCGGCGAGTTATT GACTGGTATCAGCACCTGCAGATCAACAAGAAGATGACCAACGAGGTA GCCATCTTACAGCACTTGCCTGAGCGGCTGCGGGCAGAAGTGGCTGTG TCTGTGCACCTGTCCACTCTGAGCCGGGTGCAGATCTTTCAGAACTGTG AGGCCAGCCTGCTGGAGGAGCTGGTGCTGAAGCTGCAGCCCCAGACC TACTCACCAGGTGAATATGTATGCCGCAAAGGAGACATTGGCCAAGAGA TGTACATCATCCGAGAGGGTCAACTGGCCGTGGTGGCAGATGATGGTA TCACACAGTATGCTGTGCTCGGTGCAGGGCTCTACTTTGGGGAGATCA GCATCATCAACATCAAAGGGAACATGTCTGGGAACCGCCGCACAGCCA ACATCAAGAGCCTAGGTTATTCAGACCTATTCTGCCTGAGCAAGGAGGA CCTGCGGGAGGTGCTGAGCGAGTATCCACAAGCACAGACCATCATGGA GGAGAAAGGACGTGAGATCCTGCTGAAAATGAACAAGTTGGACGTGAA TGCTGAGGCAGCTGAGATCGCCCTGCAGGAGGCCACAGAGTCCCGGC TACGAGGCCTAGACCAGCAGCTGGATGATCTACAGACCAAGTTTGCTC GCCTCCTGGCTGAGCTGGAGTCCAGCGCACTTAAGATTGCTTACCGCA

TTGAACGGCTGGAGTGGCAGACTCGAGAGTGGCCAATGCCCGAGGAC CTGGCTGAGGCTGATGACGAGGGTGAGCCTGAGGAGGGAACTTCCAAA GATGAAGAGGGCAGGGCCAGCCAGGAGGGACCCCCAGGTCCAGAGTG ACCCCATCCCCATCCCCAGGATTCCCACCTCCTAGTGAATCCAGAGTTG TAGTAAAGCCTAACTGCTGCAACTCTGTCAAAAAAAAAAAAAAAAAAAA

SEQ 10 NO : 2 METSerGlnAspThrLysValLysThrThrGluSerSerProProAlaProSerLysAlaArgLy sLeuLeuProValLeuAspProSerGlyAspTyrTyrTyrTrpTrpLeuAsnThrMETValPhe ProVa ! METTyrAsnLeuHelleLeuValCysArgAlaCysPheProAspLeuGlnHisGlyTy rLeuValAlaTrpLeuValLeuAspTyrThrSerAspLeuLeuTyrLeuLeuAspMETValVal ArgPheHisThrGlyPheLeuGluGlnGlylleLeuValValAspLysGlyArg) teSerSerArgT yrVa ! ArgThrTrpSerPhePheLeuAspLeuA) aSerLeuMETProThrAspVa) Va ! TyrVa lArgLeuGlyProHisThrProThrLeuArgLeuAsnArgPheLeuArgAlaProArgLeuPhe GtuA) aPheAspArgThrG) uThrArgThrA ! aTyrProAsnA) aPheArg ! ieA) aLysLeuME TLeuTyrilePheValVallleHisTrpAsnSerCysLeuTyrPheAlaLeuSerArgTyrLeuGly PheGfyArgAspA) aTrpVa) TyrProAspProAtaGfnProGtyPheG) uArgLeuArgArgG ! nTyrLeuTyrSerPheTyrPheSerThrLeuf ! eLeuThrThrVa) GtyAspThrProProProAt aArgGluGluGluTyrLeuPheMETValGlyAspPheLeuLeuAlaValMETGIyPheAlaT hrt ! eMETGlySerMETSerSerVahieTyrAsnMETAsnThrAlaAspAlaAlaPheTyrPro AspHisAlaLeuValLysLysTyrMETLysLeuGinHisValAsnArgLysLeuGluArgArgV a) !leAspTrpTyrGlnHisLeuGI n) teAsnLysLysMETThrAsnG ! uValAlalleLeuGfnHis LeuProGluArgLeuArgAlaGluValAlaValSerValHisLeuSerThrLeuSerArgValG ! nl lePheGlnAsnCysGluAlaSerLeuLeuGluGluLeuValLeuLysLeuGlnProGtnThrTyr SerProGlyGluTyrValCysArgLysGlyAspileGlyGlnGluMETTyrtlelleArgGluGlyGI nLeuAiaVaiVa) A ! aAspAspGfy ! ! eThrG) nTyrA) aVa ! LeuG ! yA) aG) yLeuTyrPheG ! y Glu IleSerllelleAsnlleLysGlyAsnMETSerGlyAsnArgArg ThrAlaAsn IleLysSerLe uGtyTyrSerAspLeuPheCysLeuSerLysG) uAspLeuArgGtuVa) LeuSerG) uTyrPro GinAlaGinThrlleMETGIuGluLysGlyArgGlulieLeuLeuLysMETAsnLysLeuAspV alAsnAlaGluAlaAlaGluNeAlaLeuGlnGluAlaThrGluSerArgLeuArgGlyLeuAspGI nGlnLeuAspAspLeuGtnThrLysPheAlaArgLeuLeuAlaGluLeuGluSerSerAlaLeu Lys T yrArglleGluArgLeuGlu T rpGln ThrArgGlu T rpProMETProGluAspLeu A ! aGtuAiaAspAspG < uG) yGtuProGiuG ! uG) yThrSerLysAspG) uGiuG ! yArgA) aSer GlnGluGlyProProGlyProGluSTP

Claims

CLAIMS 1. An isolated cyclic nucleotide gated ion channel polypeptide comprising (i) the amino acid sequence of SEQ ID NO: 2 or (ii) a variant thereof which is capable of binding to other CNG channel subunites to form a cyclic nucleotide gated ion channel or (iii) a fragment of (i) or (ii) which is capable of binding to other CNG channel subunits to form a cyclic nucleotide gated ion channel.
2. A polypeptide according to claim 1 wherein the variant (ii) has at least 95% identity to the amino acid sequence of SEQ ID NO: 2.
3. A polynucleotide encoding a polypeptide according to claim 1 or 2.
4. A polynucleotide according to claim 3 which is a cDNA sequence.
5. A polynucleotide encoding a cyclic nucleotide gated ion channel polypeptide which is capable of binding to other CNG channel subunits to form a cyclic nucleotide gated ion channel which polynucleotide comprises: (a) the nucleic acid sequence of SEQ ID NO: 1 and/or a sequence complementary thereto; (b) a sequence which hybridises under stringent conditions to a sequence as defined in (a); (c) a sequence that is degenerate as a result of the genetic code to a sequence as defined in (a) or (b); or (d) a sequence having at least 95% identity to a sequence as defined in (a), (b) or (c).
6. An expression vector comprising a polynucleotide according to any one of claims 3 to 5.
7. A host cell comprising an expression vector according to claim 6.
8. An antibody specific for a polypeptide according to claim 1 or 2.
9. A method for the identification of a substance that modulates cyclic nucleotide gated ion channel activity and/or expression, which method comprises: (i) contacting a test substance and either a cyclic nucleotide gated ion channel comprising a polypeptide according to claim 1 or 2, or a polynucleotide according to any one of claims 3 to 5, or an expression vector according to claim 6 or a host cell according to claim 7, and

<Desc/Clms Page number 31>

(ii) determining the effect of the test substance on the activity of said channel, or the expression of the said polypeptide or the polypeptide encoded by said polynucleotide, thereby to determine whether the test substance modulates cyclic nucleotide gated ion channel activity and/or Hiphum 222 expression.
10. A method according to claim 9 wherein the polypeptide is expressed in a cell.
11. A method according to claim 10 wherein the cell further expresses a subunit from cyclic nucleotide channels 1,2 or 3.
12. A method according to claim 11 wherein step (ii) comprises monitoring any cyclic nucleotide gated ion channel activity.
13. A method according to claim 11 wherein step (ii) comprises monitoring any interaction between the said polypeptide with the said subunit from cyclic nucleotide channels 1,2 or 3.
14. A substance which modulates cyclic nucleotide gated ion channel activity and which is identifiable by a method according to any one of claims 9 to 13.
15. A method of treating a subject having a disorder that is responsive to cyclic nucleotide gated ion channel modulation, which method comprises administering to said subject an effective amount of a substance according to claim 14.
16. A method according to claim 15 wherein the disorder is selected from a respiratory disease selected from COPD, Asthma, cough, Actute Bronchitis, Acute Respiratory Failure in COPD, Adult respiratory distress syndrome, cystic fibrosis or Emphysema.
17. Use of a substance as defined in claim 14 in the manufacture of a medicament for treatment or prophylaxis of a disorder that is responsive to stimulation or modulation of cyclic nucleotide gated ion channel activity.
18. A use according to claim 17 wherein the disorder is selected from a respiratory disease selected from COPD, Asthma, cough, Actute Bronchitis, Acute Respiratory Failure in COPD, Adult respiratory distress syndrome, cystic fibrosis or Emphysema.
19. A method of producing a polypeptide according to claim 1 or 2, which

<Desc/Clms Page number 32>

method comprises maintaining a host cell as defined in claim 7 under conditions suitable for obtaining expression of the polypeptide and isolating the said polypeptide.