GB2352448A

GB2352448A - UNC-5 constructs and screening methods

Info

Publication number: GB2352448A
Application number: GB0013412A
Authority: GB
Inventors: Criekinge Wim Van; Ingele Roelens; Thierry Bogaert; Phillippe Verwaerde
Original assignee: Devgen NV
Current assignee: Devgen NV
Priority date: 1999-06-01
Filing date: 2000-06-01
Publication date: 2001-01-31
Anticipated expiration: 2020-06-01
Also published as: WO2000073328A2; WO2000073328A3; GB0013412D0; GB9912755D0; AU4926300A; GB2352448B

Abstract

Novel splice variants of human unc-5C cDNA are provided having the amino acid sequences set out in Fig.3 (unc-5Cb), Fig.5 (unc-5Cc) and Fig.7 (unc-5C8) as well as corresponding nucleotide sequences. Additionally provided are nucleotide and amino acid sequences corresponding to human unc-5H1 cDNA (as well as oligonucleotides derived therefrom), human mena homology gene (MHI) cDNA, neurexin II-alpha-b homologue cDNA, human "new gene 1" cDNA and human "new gene2" cDNA. Various screening methods and assays based on protein-protein interactions between the UNC-5 protein and a variety of different interacting proteins are also claimed.

Description

2352448 UNC-5 constructs and screening methods The present invention is

concerned with unc-5, a conserved animal gene family that encodes proteins implicated in directional cell behaviour. In particular, the invention is concerned with novel splice variants of the human unc-5C cDNA and a novel human unc-5HS1 cDNA sequence. In addition, assays are provided based on protein-protein interactions between the UNC-5 protein and a variety of different interacting proteins.

Unc-5 is a conserved animal gene family that encodes proteins implicated in directional cell behaviour. The unc-5 gene of the nematode worm Caenorhabditis elegans (C. elegans) is known to be involved in dorsal migration in contrast to unc-40 which is involved in ventral migrations (Hedgecock et al., Neuron Vol. 2; 61-85, 1990). Both the unc-5 and unc-40 genes are associated with the netrin unc-6, and all three genes play a dominant role in directional neuronal outgrowth.

The C. elegans unc-5 gene encodes a 919 amino acid transmembrane receptor with two immunoglobulin and two thrombospondin type I extracellular domains (Leung-Hagesteijn et al., Cell Vol. 71:289-299, 1992).

Ectopic overexpression of unc-5 in the C. elegans touch neurons resulted in dorsal steering of these, instead of the normal ventral elongation of these neurons (Hamelin et al., Nature, 364: 327-330, 1993) Several vertebrate homologues of unc-5 have been cloned including the Rattus norvegicus unc5H1 and unc5H2 (Leonardo et al., Nature Vol. 386: 833-838, 1997), a Mus musculus homologue designated rcm (Ackerman et al, Nature Vol. 386:838-842, 1997) and a human homologue unc5C (Ackerman et al., Genomics Vol.

52:205-208, 1998).

The intracellular part of the UNC-5 proteins contains a ZO-1 domain. Such domains are known to be involved in tight junction biology. Furthermore JNC-5 proteins contain a death domain. So far this is the only protein found in C. elegans that harbors such a death domain. Death domains are involved in the apoptotic process. In this process, caspases play an important role. The human UNC-40 homologue DCC, a protein also known involved in axonal outgrowth, is a caspase-3 substrate (Mehen et al., Nature 395:801-804, 1998).

The present inventors have identified three previously unknown variant unc-5C cDNAs. These variant cDNAs correspond to alternatively spliced unc is 5C transcripts.

Accordingly, in a first aspect provides a protein which comprises the amino acid sequence set forth in Figure 3, Figure 5 or Figure 7 or an amino acid sequence which differs from that shown in Figure 3, Figure 5 or Figure 7 only in conservative amino acid changes.

Also provided by the invention are nucleic acid sequences which encode the proteins of the invention.

Also provided by the invention are a nucleic acid comprising the sequences of nucleotides set forth in Figure 2, a nucleic acid comprising the sequences of nucleotides set forth in Figure 4 and a nucleic acid comprising the sequences of nucleotides set forth in Figure 6.

The splice variants of human unc-5C were cloned by PCR technology. Two primers were developed to amplify the intracellular part of the unc-5C. Human Brain cDNA was used for this purpose. Three new splice variants of human unc-5C were characterized. A schematic representation of these splice variants is given in Figure 82.

The first splice variant (designated unc-5Cb) has a deletion of an intron in the UP region. The nucleotide sequence of a partial unc-5Cb cDNA is set forth in Figure 2 and the corresponding amino acid sequence is set forth in Figure 3. The splice of this intron results in a UNC-5Cb protein which is considerably shorter than the previously known UNC-5C, as the coding frame is not maintained. This protein is truncated for the DD domain and for the major part of the UP domain.

The second splice variant (designated unc-SCc) is deleted by an intron in the ZO-1 region, also resulting in a shorterprotein than the previously known UNC-5C, as the coding frame is not maintained.

The nucleotide sequence of a partial UNC-5Cc cDNA is is set forth in Figure 4 and the corresponding amino acid sequence is shown in Figure 5. The resulting protein (UNC-5Cc) is truncated for the DD domain, the UP domain and a part of the ZO-1 domain.

The third splice variant (unc-5C8) is deleted by a small intron in the ZO-1 domain, but the coding frame is maintained. This results in a slightly smaller protein (UNC-5C8), wherein only the amino acid sequence coded 'by the spliced intron is truncated.

The nucleotide sequence of a partial UNC-5C8 cDNA is set forth in Figure 6 and the corresponding amino acid sequence is shown in Figure 7.

The presence of various splice variants of unc-5C in the human brain indicated that the activity of UNC-5C is tightly regulated.

The inventors have also identified a human unc-S cDNA which shares homology with the Rattus norvegicus unc-5H1 cDNA.

Accordingly, in a further- aspect the invention provides a nucleic acid molecule comprising the sequence of nucleotides set forth in Figure 8.

Whilst performing yeast two hybrid experiments to identify proteins which interact with the human UNC-5C protein the inventors identified a number of heretofore unknown human cDNAs which encode proteins which interact with human UNC-5C.

Accordingly, the invention further provides a nucleic acid comprising the sequence of nuclectides set forth in Figure 55A and a sequence of nucleotides complementary to the sequence of nucleotides set forth in Figure 55B, a nucleic acid comprising the sequence of nucleotides set forth in Figure 53A and a sequence of nucleotides complementary to the sequence of nucleotides set forth in Figure 53B, a nucleic acid comprising the sequence of nucleotides set forth in Figure 59A and a sequence of nucleotides complementary to the sequence of nucleotides set forth in Figure 59B and a nucleic acid comprising the sequence of nucleotides set forth in Figure 60A and a sequence of nucleotides complementary to the sequence of nucleotides set forth in Figure 60B.

The nucleic acid molecules according to the invention may, advantageously, be included in a suitable expression vector to express the proteins encoded therefrom in a suitable host. Incorporation of cloned DNA into a suitable expression vector for subsequent transformation of said cell and subsequent selection of the transformed cells is well known to those skilled in the art as provided in Sambrook et al. (1989), molecular cloning, a laboratory manual, Cold Spring Harbour Laboratory Press.

An expression vector according to the invention includes a vector having a nucleic acid according to the invention operably linked to regulatory sequences, such as promoter regions, that are capable of effecting expression of said DNA fragments. The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. Such vectors may be transformed into a suitable host cell to provide for expression of a protein according to the invention. Thus, in a further aspect, the invention provides a process for preparing proteins according to the invention which comprises cultivating a host cell, transformed or transfected with an expression vector as described above under conditions to provide for expression by the vector of a coding sequence encoding the protein, and recovering the expressed protein.

The vectors may be, for example, plasmid, virus or phage vectors provided with an' origin of replication, and optionally a promoter for the expression of said nucleotide and optionally a regulator of the promoter. The vectors may contain is one or more selectable markers, such as, for example, an antibiotic resistance.

Regulatory elements required for expression include promoter sequences to bind RNA polymerase and to direct an appropriate level of transcription initiation and also translation initiation sequences for ribosome binding. For example, a bacterial expression vector may include a promoter such as the lac promoter and for translation initiation the ShineDalgarno sequence and the start codon AUG. Similarly, a eukaryotic expression vector may include a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylation signal, the start codon AUG, and a termination codon for detachment of the ribosome. Such vectors may be obtained commercially or be assembled from the sequences described by methods well known in the art.

Nucleic acid molecules according to the invention may be inserted into the vectors described in an antisense orientation in order to provide for the production of antisense RNA. Antisense RNA or other antisense nucleic acids, including antisense peptide nucleic acid (PNA), may be produced by synthetic 6 means.

In accordance with the present invention, a defined nucleic acid includes not only the identical nucleic acid but also any minor base variations including in particular, substitutions in cases which result in a synonymous codon (a different codon specifying the same amino acid residue) due to the degenerate code in conservative, amino acid substitutions. The term "nucleic acid sequence" also includes the complementary sequence to any single stranded sequence given regarding'base variations.

The nucleic acid sequences according to the invention may be produced using recombinant or synthetic techniques, such as for example using PCR which generally involves making a pair of primers, which may be from approximately 10 to 50 nucleotides to a region of the gene which is desired to be cloned, bringing the primers into contact with cDNA, or genomic DNA from a human cell, performing a polymerase chain reaction under conditions which brings about amplification of the desired region, isolating the amplified region or fragment and recovering the amplified DNA. Generally, such techniques are well known in the art, such as described in Sambrook et al.

(Molecular Cloning: a Laboratory Manual, 1989).

The nucleic acids according to the invention may carry a revealing label. Suitable labels include radioisotopes such a S 32p or 15S, enzyme labels or other protein labels such as biotin or fluorescent markers. Such labels may be added to the nucleic acids or oligonucleot ides of the invention and may be detected using known techniques per se.

The protein according to the invention includes all possible amino acid variants encoded by the nucleic acid molecule according to the invention including a protein encoded by said molecule and having conservative amino acid changes. Proteins or polypeptides according to the invention further include variants of such sequences, including naturally occurring allelic variants which are substantially homologous to said proteins or polypeptides. In this context, substantial homology is regarded as a sequence which has at least 70%, preferably 80 or 90% and preferably 95% amino acid homology with the proteins or polypeptides encoded by the nucleic acid molecules according to the invention.

The protein according to the invention may be recombinant, synthetic or naturally occurring, but is preferably recombinant.

A further aspect of the invention provides a host cell or organism, transformed or transfected with an expression vector according to the invention. The host cell or organism may advantageously be used in a method of producing protein, which comprises recovering any expressed protein from the host or organism transformed or transfected with the expression vector.

According to a further aspect of the invention there is also provided a transgenic cell, tissue or organism comprising a transgene capable of expressing a protein according to the invention. The term "transgene capable of expressing" as used herein encompasses any suitable nucleic acid sequence which leads to expression of proteins having the same function and/or activity. The transgene, may include, for example, genomic nucleic acid isolated from human cells or synthetic nucleic acid, including DNA integrated into the genome or in an extrachromosomal state. Preferably, the transgene comprises the nucleic acid sequence encoding the proteins according to the invention as described herein, or a functional fragment of said nucleic acid. A functional fragment of said nucleic acid should be taken to mean a fragment of the gene comprising said nucleic acid coding for the proteins according to the invention or a functional equivalent, derivative or a non functional derivative such as a dominant negative mutant, or bioprecusor of said proteins.

The protein expressed by said transgenic cell, tissue or organism or a functional equivalent or bioprecusor of said protein also forms part of the present invention. Recombinant proteins may be recovered and purified from host cell cultures by methods known in the art, including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose, chromatography, hydrophobic interaction chromatography, affinity chromatography, is hydroxyapatite chromatography and lectin chromatography.

The protein of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the expressed protein may lack the initiating methionine 2S residue as a result of post -translat i onal cleavage.

Proteins which have been modified in this way are also included within the scope of the invention.

In a still further aspect the invention provides an antibody capable of specifically binding to a protein according to the invention. Preferably the antibody is capable of specifically binding to a protein comprising the sequence of amino acids set forth in Figure 3, Figure 5 or Figure 7. An antibody according to the invention may be raised according to 3S standard techniques well known to those skilled in the art by using the protein of the invention or a fragment or single epitope thereof as the challenging 9 antigen.

A furthe-r aspect of the invention comprises a nucleic acid capable of hybridising to the nucleic acids according to the invention, and preferably capable of hybridising to the sequence of nucleotides set forth in Figures 53A, 53B, 55A, 55B, 59A, 59B, 60A or 60B, under high stringency conditions. Conditions of stringency are well known to those skilled in the art.

Stringency of hybridisation as used herein refers to conditions under which polynucleic acids are stable. The stability of hybrids is refl ected in the melting temperature (Tm) of the hybrids. Tm can be approximated by the formula:

81.5'C+16.6(logj()[Na']+0.41 (%G&C)-600/1 wherein 1 is the length of the hybrids in nucleotides.

Tm decreases approximately by 1-1.5'C with every 1% decrease in sequence homology.

The nucleic acid capable of hybridising to nucleic acid molecules according to the invention will generally be at least 70%, preferably at least 80 or 90% and more preferably at least 95% homologous to the nucleotide sequences according to the invention.

The present invention also advantageously provides ol igonucleot ides consisting essentially of at least 10 consecutive nucleotides of a nucleic acid according to the invention and preferably from 10 to 50 consecutive nucleotides of a nucleic acid according to the invention, in particular a nucleic. acid comprising the sequence of nucleotides shown in Figures 53A, 53B, 55A, 55B, 59A, 59B, 60A or 60B.

These oligonucleotides may, advantageously be used as probes or primers to initiate replication, or the like. Oligonucleotides having a defined sequence may be produced according to techniques well known in the art, such as by recombinant or synthetic means. They may also be used in diagnostic kits or the like for detecting the presence of a nucleic acid according to the invention. These tests generally comprise contacting the probe with the sample under hybridising conditions and detecting for the presence of any duplex or triplex formation between the probe and any nucleic acid in the sample.

To address the functional role of UNC-5 within the cell the inventors used the yeast two hybrid method (Fields and Song, Nature 340:245, 1989), a method well known to molecular biologists, both to investigate the ability of UNC-5 to form dimers and to search for proteins that interact with the UNC-5 is protein. Using the two hybrid approach the inventors were able to demonstrate that UNC-5 is capable of forming homodimers and identified a number of proteins which interact with the intracellular domains of the C. elegans unc-5 or human UNC-5 proteins. These newly identified protein-protein interactions involving UNC may represent important events in cellular signalling, hence compounds which disrupt these interactions may potentially have useful pharmacological properties.

Accordingly, in a further aspect the invention provides a method of identifying compounds which are capable of inhibiting or enhancing the binding of an UNC-5 protein to an interacting protein previously identified as binding to the said UNC-5 protein, which method comprises:

providing a host cell containing a DNA construct comprising a reporter gene operatively linked to a promoter regulated by a transcription factor having a DNA binding domain and an activating domain; expressing in said host cell a first hybrid DNA sequence encoding a first fusion protein comprising an UNC-5 protein or a fragment thereof fused in-frame to either the DNA binding domain or the activating domain of the said transcription factor; expressing in said host cell a second hybrid DNA sequence encoding a second fusion protein comprising an interacting protein or a fragment thereof fused in-frame to either the DNA binding domain or the activating domain of the said transcription factor, such that when the first fusion protein comprises the'activation domain of the said transcription factor the second fusion protein comprises the DNA binding domain of the said transcription factor and when the first fusion protein comprises the DNA binding domain of the transcription factor the second fusion protein comprises the activation domain; contacting the host cell with a sample of the compound under test; and detecting any binding of the UNC-5 protein or fragment thereof to the interacting protein or fragment thereof by detecting the production of any reporter gene product in the said host cell.

The method of the invention is based upon the standard two hybrid assay well known in the art.

Preferably the host cell is a yeast cell. Protocols for performing a yeast two hybrid assay are well known in the art and are given in the Examples included herein.

As would be readily apparent to persons skilled in the art, the assay can be performed in either orientation. That is to say, the assay can be performed using an UNC-5 protein or a fragment thereof fused to the DNA binding domain of the transcription factor and the interacting protein or fragment thereof fused to the activation domain of the transcription factor or alternatively the assay can be performed using an UNC-5 protein or a fragment thereof fused to the activation domain of the transcription factor and the interacting protein or fragment thereof fused to the DNA binding domain of the transcription factor.

The above-described method based on the classical yeast two hybrid system can be used to screen f or compounds that inhibit or enhance the interaction between two proteins. In addition, other systems have been developed to screen for dissociation events, these methods are designated reverse hybrid methods. These systems make use of yeast strains in which the expression of interacting hybrid proteins increases the expression of a counter-selectable marker that is toxic under particular conditions. Under these conditions, dissociation of an interaction provides a selective advantage, thereby facilitating detection: A few growing yeast colonies in which hybrids fail to interact can be identified among millions of non-growing colonies expressing interacting proteins. Several reverse hybrid systems are known in the art.

The first reverse two-hybrid system utilizes a yeast strain, which is resistant to cycloheximide due to the presence of a mutant CYH2 gene. This strain also contains the wild-type CYH2 allele under the transcriptional control of the GALl promoter. Expression of the wild-type GAL4 protein is sufficient to restore growth sensitivity to cycloheximide. Growth sensitivity towards cycloheximide is also restored by the co-expression of the avian c-Rel protein and its IKB-a counterpart, p40, as GAL4 fusion proteins. Restoration of growth sensitivity towards cycloheximide requires the association of c-REL and p40 at the GALl promoter and correlates with the ability of the c-REL/p40 interaction to activate expression from the GALl promoter (Leanna and Hannink, 1996, NAR 24:3341-3347) Another reverse hybrid system makes use of the most widely used counter-selectable marker in yeast genetics, URA3, which encodes orotidine-S' -phosphate decarboxylase, an enzyme required for the biosynthesis of uracil. Yeast cells that contain wild-type URA3, either on a plasmid or integrated in the genome, grow on media lacking uracil (URA3+ phenotype). However, the URA3-encoded decarboxylase can also catalyze the conversion of a non-toxic analogue, 5-fluorooritic acid (FOA) into a toxic product, 5-fluoroacil (Boeke et al., 1984, Mol. Gen. Genet. 197:345-346)-. Hence mutations that prevent an interaction can be selected from large libraries of randomly mutated alleles.

Similarly, molecules that dissociate or prevent an is interaction could be selected from large libraries of peptides or compounds (Vidal et al., 1996, PNAS 93:10315-10320; Vidal et al., 1996, PNAS 93:10321-10326).

A third reversed yeast two hybrid is based on the use of GAL80 gene as relay gene. GAL80 encodes a protein that binds to and masks the activation domain of a transcriptional activator, such as GAL4. The reporter genes, which will provide the transcriptional read-out (i.e. HIS3 or LACZ), are dependent upon the functional GAL4 for expression. Only when the level of GAL80 masking protein is reduced by interfering with the two-hybrid interaction will Ga14 function as a transcriptional activator, providing a positive transcriptional read-out for molecules that inhibit the two-hybrid protein-protein interaction. An important feature of this reverse two-hybrid system is that the basal level and the half-time of the relay protein, GAL80, can be fine-tuned to provide maximum sensitivity (Powers and Erickson, 1996, W095/26400) The invention further provides a method of identifying compounds which are capable of inhibiting or enhancing the binding of an UNC-5 protein to an interacting protein previously identified as binding to the said UNC-5 protein, which method comprises:

providing a transgenic cell or organism expressing a first fusion protein comprising an UNC-5 protein or a fragment thereof fused in frame to a first genetically encoded fluorophore and a second fusion protein comprising an interacting protein or a fragment thereof fused in-frame to a second genetically encoded fluorophore, the first and second fluorophores being characterised in that the emission spectrum of one of the fluorophores overlaps with the absorption spectrum of the other fluorophore; measuring the amount of fluorescence emitted is from the fluorophore having an emission spectrum which overlaps with the absorption spectrum of the other fluorophore; exposing the transgenic cell or organism to a compound under test; and detecting any change in the amount of fluorescence emitted fluorescence emitted from the fluorophore having an emission spectrum which overlaps with the absorption spectrum of the other fluorophore.

2S This method uses fluorescence energy transfer or FRET, a technique well known in the art for the detection and quantitative measurement of a whole range of specific binding interactions in biological systems, to screen for compounds which modulate the binding of UNC-5 or a fragment thereof to an interacting protein. The general principles of FRET are as follows: one component of a binding pair is labelled with a first fluorophore (hereinafter referred to as the donor fluorophore) and a second component of the binding pair is labelled with a second fluorophore (hereinafter referred to as the acceptor fluorophore).

It is an essential feature of the FRET technique that the fluorescence emission spectrum of the donor fluorophore overlaps with the absorption spectrum of the acceptor fluorophore, such that when the two components of the binding pair bind to each other, bringing the donor and acceptor fluorophores into close proximity, a proportion of the fluorescent signal emitted by the donor fluorophore (following irradiation with incident radiation of a wavelength absorbed by the donor fluorophore) will be absorbed by the proximal acceptor fluorophore (a process known in the art as fluorescence energy transfer) with the result that a proportion of the fluorescent signal emitted by the donor fluorophore is quenched and, in some instances, that the acceptor fluorophore emits fluorescence. Fluorescence energy transfer will only occur when the donor and acceptor fluorophores are brought into close proximity by the specific binding reaction. Thus, in the presence of a compound which disrupts the specific binding, the amount of quenching is reduced resulting in an increase in the intensity of the fluorescent signal emitted by the donor fluorophore or a fall in the intensity of the signal emitted by the acceptor fluorophore).

The method of the invention is an in vivo FRET assay because it is performed in a transgenic host cell or organism. The transgenic cell can be any mammalian cell li.ne, the transgenic organism is preferably C. elegans.

The method of the invention uses genetically encoded donor and acceptor fluorophores which can be expressed as fusion proteins fused in frame to the UNC-5 protein and the interacting protein. This can be readily accomplished by transforming or transfecting the cell or organism with appropriate expression vectors arranged to express the fusion proteins.

In a preferred embodiment the genetically encoded donor and acceptor proteins are variant green fluorescent proteins which exhibit different fluorescent properties and which have suitably overlapping emission/ absorption spectra, such as EGFP (enhanced green fluorescent protein) and EBFP (enhanced blue fluorescent protein). As would be readily apparent to persons skilled in the art, the FRET assay can be performed in either orientation.

That is to say, the assay can be 'Carried out using UNC-5 fused to the donor fluorophore and the interacting protein fused to the acceptor fluorophore or using UNC-5 fused to the acceptor fluorophore and the interacting protein fused to the donor fluorophore.

The invention further provides a method of identifying compounds which are capable of inhibiting or enhancing the binding of an UNC-5 protein to an interacting protein previously identified as binding to the said UNC-5 protein, which method comprises:

providing a first reaction component comprising a first protein linked to a solid support containing a scintillant and a second reaction component comprising a second protein which has been radioactively labelled, wherein the first and second proteins are an UNC-5 protein or a fragment thereof and an interacting protein or a fragment thereof; bringing the first and second reaction components into contact in an aqueous solution in the presence of a compound under test; and detecting binding of the first protein to the second protein by detecting light emission from the scintillant.

The above method is based on the scintillation proximity assay (SPAT14) developed by Amersham and commonly used in automated high throughput screening. In order to perform this assay a first interacting protein (e.g. an UNC-5

protein) must be linked onto a bead containing a scintillant. Linking of the protein to the beads can be carried out in many different ways, including, for example, via biotin-streptavidin affinity binding. Streptavidin-SPA beads are commercially available from Amersham and the interacting protein can easily be biotinylated in vitro or expressed as a biotinylated fusion protein using techniques known in the art. The second interacting protein (e.g. a protein known to interact with UNC-5) is labelled with radioactivity. This can be achieved, for example, by synthesising the second interacting protein by in vitro translation and incorporating a tritiated precursor amino acid.

The SPA71 assay protocol is then as follows:

SPA beads linked to the first interacting protein are incubated for 30 minutes to one hour with a sample containing the radioactively labelled second interacting protein. Upon binding of the two interacting proteins, the radioactivity emitted by the labelled protein is brought into close proximity with the bead containing scintillant and therefore induces light emission from the scintillant. The free labelled protein in sample (non-bound) will not be held in sufficiently close proximity to the beads to induce light emission. Compounds which disrupt the binding of the first and second interacting proteins will cause a decrease in the amount of light emitted during the experiment.

As would be readily apparent to persons skilled in the art the assay can be carried out using UNC-5 linked to the solid support containing scintillant and a radioactively labelled interacting protein or using an interacting protein linked to the solid support containing scintillant and a radioactively labelled UNC-5.

coating the wells of a microtiter plate with UNC-5 protein or a fragment thereof; contacting the UNC-5 protein or fragment thereof with an aqueous solution comprising an interacting protein or a fragment thereof, said is interacting protein being labelled with a tag which is directly or indirectly detectable, and a compound under test; washing to remove the compound under test and any unbound tagged interacting protein; and detecting complexes of UNC-5 or a fragment thereof bound to the interacting protein or a fragment thereof by directly or indirectly detecting the presence of the tag.

This method of the invention uses an ELISA type approach to screen for compounds which disrupt binding between Unc-5 and a protein known to interact with UNC-5. In these experiments, the wells of a microtiter plate are coated with the UNC-5 protein or fragments thereof. A sample containing both the compound under test and a protein known to interact with UNC-5 (or a fragment of the protein which is still capable of binding to UNC-5) is then added to the wells and the plates are incubated to allow time for specific binding of UNC-5 to the interacting protein. The interacting protein (or fragment thereof) is labelled with a tag which is directly or indirectly detectable, typically a fluorescent molecule such as GFP, or a tag which is detectable by specific antibody binding, such as a His-tag or GST-tag. Many other tag molecules which are equally suitable for this purpose are known in the art and are available commercially. The wells are then washed to remove the compound and any interacting proteins which remain unbound. Any interacting protein which has become bound to UNC-5 is not removed by the washing step and can be detected via the directly or indirectly detectable tag. If the interacting protein is labelled with a GFP tag, then bound proteins are detected by measuring GFP fluorescence; if the interacting protein is labelled with a His-tag or a GST tag, bound proteins are is detected with immunological techniques, using an antibody of the appropriate specificity.

Compounds which disrupt the binding of UNC-5 to the interacting protein will result in more of the protein remaining unbound, hence less protein will be detected after the washing step.

exposing a cell or organism expressing UNC-S and overexpressing nucleic acid encoding an interacting protein to the compound under test; and screening for reversion of the overexpression phenotype of the cell or organism to wild-type.

over-expression of genes encoding for proteins which interact with UNC-5 in a cell line or in C.

elegans results in an over-expression phenotype.

Assays to select for compounds that inhibit the interaction of UNC-5 and its interacting proteins can therefore be performed in cell lines or C. elegans by exposing cells or worms exhibiting an over-expression phenotype to the compound under test and screening for a Ireduction' of the over-expression phenotype (i.e. screening for a reversion to wild- type).

Over-expression of proteins which interact with unc-5 in C. elegans typically results i n neuronal outgrowth phenotypes, distal tip cell outgrowth phenotypes, and other aberrant outgrowth of various tissues and cells. These phenotypes can be easily monitored by expressing reporter genes, such as fluorescent proteins in these cells. Reduction of the phenotype induced by the over-expression can then be monitored by visual inspection.

Simple assays have been developed to screen for compounds which cause reversion of the over-expression phenotype in cell lines. As Unc-5 receives signals from the netrins, over-expression of proteins which interact with unc-5 typically causes phenotypic changes in neuronal outgrowth and cell movement. Accordingly, the step of screening for reduction of the over- expression phenotype can be performed using a laminin assay, a netrin response assay and assays using agarose concentration gradients, a boyden chamber or stratified layers (see Gundersen, R. W., Dev. Biol., 1987, 121(2): 423-431; Klostermann, S. and Bonhoeffer, F., 1996, 4: 237-252). In general, these methods are based upon providing attractants or repellants for axonal guidance in a controlled manner. The way the cells react to these attractants and repellants forms the basis of the assay. In the Boyden chamber (upper and lower chambers separated by a filter barrier) one typically cultivates cells in the upper chamber and measures how the cells grow through the filter. The agarose approach allows the establishment of gradients to which the cells react by forming specific patterns.

The above-listed methods are all based upon novel interactions between an UNC-5 protein and proteins shown to physically interact with the UNC-5 protein. In preferred embodiments, the UNC-5 protein is a C. elegans UNC-5 protein or a human UNC-5 protein. Preferably the human UNC-5 protein is UNC-5C or any of the UNC-5C splice variants identified hereinbefore or UNC-5HS1.

The methods of the invention can also be carried out using fragments of the UNC-5 protein which retain the ability to bind to the interacting protein.

Preferably the fragment comprises the intracellular portion of the protein. Various sub-domains of the intracellular portion of the protein or combinations thereof can also be used.

As used herein the term "interacting protein" encompasses any protein which has been demonstrated to interact with an UNC-5 protein. The interacting protein can be a second UNC-5 protein as the examples included herein demonstrate the ability of UNC-5 to form homodimers. The interacting protein can also be a protein identified as interacting with UNC-5 in a yeast two hybrid experiment. A list of proteins identified as interacting with C. elegans UNC-5 or human UNC-5 in a yeast two hybrid experiment is given in the Example 4, below. Any of these proteins, or fragments thereof which retain a functional UNC-5 binding site, can be used in the methods of the inv-ention in combination with the appropriate UNC-5 protein or a fragment thereof.

As would be readily apparent to persons skilled in the art, the UNC-5 signalling pathway is highly conserved across species. Hence it is to be expected that for every interacting protein identified in the yeast two hybrid experiments described in the Examples given herein a homologous interacting protein will be found in other species. For example, for every interacting protein found in C. elegans to interact with the C. elegans unc-5 protein it is expected that a homologous interacting protein will be found in humans and will interact with a human UNC-5 protein, and vice versa for interacting proteins first identified in humans. Accordingly, it is within the scope of the invention to perform the methods described above with "homologous combinations" of UNC proteins and interacting proteins and even with cross-species combinations e.g. C. elegans unc-5 and a human interacting proteins, human UNC-5 and a human homologue of an interacting protein identified in C.

elegans; C. elegans unc-5 and a human homologue of an interacting protein identified in C. elegans; C.

elegans unc-5 and a human interacting protein etc.

Lists of homologues of the C. elegans and human interacting proteins identified in the yeast two hybrid study are given in the Examples included herein.

In a still further aspect the invention provides a method of identifying compounds which reduce or inhibit the lethal phenotype associated with the expression of the UNC-5 death domain in yeast, which method comprises:

exposing a yeast cell containing an expression vector comprising nucleic acid encoding an UNC-5 protein or a fragment thereof comprising the death domain to a compound under test; allowing the yeast cells to grow in the presence of the compound; and screening for a reduction or inhibition of the lethal phenotype associated with the expression of the UNC-5 death domain in yeast.

The UNC-5 protein used in the method of the invention is preferably a C. elegans UNC-5 protein or a human UNC-5 protein. Preferably the human UNC-S protein is UNC-5C or any of the UNC- SC splice variants identified hereinbefore or UNC-5HS1.

In a still further aspect the invention provides a method of identifying suppressers of the lethal phenotype associated with the expression of the UNC-5 death domain in yeast, which method comprises:

transfecting yeast cells containing an expression vector comprising nucleic acid encoding an UNC-5 protein or a fragment thereof comprising the death domain with a cDNA library cloned in a yeast expression vector; allowing the transfected yeast cells to grow for one or more cell divisions; and screening for reduction or inhibition of the lethal phenotype associated with the expression of the UNC-5 deat h domain in yeast.

optionally, the method further comprises the steps of:

identifying a transfected yeast cell exhibiting a reduction or inhibition of the lethal phenotype associated with the expression of the UNC-5 death domain in yeast; and isolating the cDNA clone(s) present in the transfected yeast cell which is/are responsible for conferring reduction or inhibition of the lethal phenotype.

Again, the UNC-5 protein is preferably a C.

elegans UNC-5 protein or a human UNC-5 protein.

Preferably the human UNC-5 protein is UNC-5C or any of the UNC-5C splice variants identified hereinbefore or UNC-5HSI. The cDNA library is preferably a C. elegans cDNA library or a human cDNA library. 5 The invention will be further understood with reference to the following experimental examples, together with the accompanying Figures in which:

Figure 1 shows a sequence alignment of the -known human unc-5C cDNA sequence and the three novel alternative splice variants of unc-5C. The region of alignment corresponds to the portion of the cDNA which encodes the intracellular domains of unc-SC.

Figure 2 shows the nucleotide sequence of a part of the human unc-5Cb cDNA which encodes the intracellular region of the protein.

Figure 3 shows the amino acid sequence of the intracellular part of the human unc-5Cb protein encoded by the nucleotide sequence of Figure 2.

Figure 4 shows the nucleotide sequence of a part of the human unc-SCc cDNA which encodes the intracellular region of the protein.

Figure 5 shows the amino acid sequence of the intracellular part of the human unc-5Cc protein encoded by the nucleotide sequence of Figure 4.

Figure 6 shows the nucleotide sequence of a part of the human unc-5C8 cDNA which encodes the intracellular region of the protein.

Figure 7 shows the amino acid sequence of the intracellular part of the human unc-SC8 protein encoded by the nucleotide sequence of Figure 6.

Figure 8 shows the nucleotide sequence of the fragment of the human unc-5H1 cDNA cloned by PCR in Example 2.

Figure 9 shows predicted amino acid sequences for the human unc-5Hl protein.

Figure 10 shows the nucleotide sequence of the C. elegans spectrin Pchain/Fodrin cDNA.

Figure 11 shows the amino acid sequence of the C. elegans spectrin Pchain/Fodrin protein. 15 Figure 12 shows the nucleotide sequence of the fragment of the C. elegans spectrin P-chain/Fodrin cDNA cloned in pC1025.

Figure 13 shows the amino acid sequence of the polypeptide encoded by the cDNA fragment shown in Figure 12.

Figure 14 shows the nucleotide sequence of the C.

elegans APR-1 cDNA.

Figure 15 shows the amino acid sequence of the C. elegans APR-l protein.

Figure 16 shows the nucleotide sequence of a fragment of the C. elegans APR-l cDNA cloned in pC1028.

Figure 17 shows the amino acid sequence of the polypeptide encoded by the cDNA fragment shown in Figure 16.

Figure 18 shows the nucleotide sequence of the C.

elegans unc-14 cDNA.

Figure 19 shows the amino acid sequence of the C.

elegans unc-14 protein.

Figure 20 shows the nucleotide sequence of the fragment of the C. elegans unc-14 cDNA cloned in pC1034. 10 Figure 21 shows the amino acid sequence of the polypeptide encoded by the cDNA fragment shown in Figure 20.

is Figure 22 shows the nucleotide sequence of the C. elegans MA10.1 cDNA. Figure 23 shows the amino acid sequence of the C. elegans MA10.1 protein. 20 Figure 24 shows the nucleotide sequence of the fragment of the C. elegans F11A10.1 cDNA cloned in pGC1021. 25 Figure 25 shows the amino acid sequence of the polypeptide encoded by the cDNA fragment shown in Figure 24. Figure 26 shows the nucleotide sequence of the 30 C.elegans C15E6.1 cDNA.

Figure 27 shows the amino acid sequence of the C.elegans C15E6.1 protein.

Figure 28 shows the nucleotide sequence of the fragment of the C.elegans C15E6.1 cDNA cloned in pGC1026.

Figure 29 shows the amino acid sequence of the polypeptide encoded by the cDNA fragment shown in Figure 28.

Figure 30 shows the nucleotide sequence of the C. elegans D1081.7 cDNA.

Figure 31 shows the amino acid sequence of the C. elegans D1081.7 protein. 10 Figure 32 shows the nucleotide sequence of 'the fragment of the C. elegans 1081.7 cDNA cloned in pGC1027.

Figure 33 shows the amino acid sequence of the polypeptide encoded by the cDNA fragment shown in Figure 32.

Figure 34 shows the nucleotide sequence of the B0238.9 cDNA.

Figure 35 shows the amino acid sequence of the B0238.9 protein.

Figure 36 shows the nucleotide sequence of the fragment of the B0238.9 cDNA cloned in pGC1023.

Figure 37 shows the amino acid sequence of the polypeptide encoded by the cDNA fragment shown in Figure 36.

Figure 38 shows the nucleotide sequence of the ZC404.8 cDNA.

Figure 39 shows the amino acid sequence of the ZC404.8 protein.

Figure 40 shows the nucleotide sequence of the ZC404.8 cDNA cloned in pGC1033.

Figure 41 shows the amino acid sequence of the polypeptide encoded by the cDNA fragment shown in Figure 40.

Figure 42 shows the nucleotide sequence of the fragment of the ykl7a3 cDNA cloned in pGC1023.

Figure 43 shows the amino acid sequence of the polypeptide encoded by the cDNA fragment shown in Figure 42.

Figure 44 shows the nucleotide sequence of the F41HIO.3 cDNA.

Figure 45 shows the amino acid sequence of the F41H10.3 protein.

Figure 46 shows the nucleotide sequence of the fragment od the F41H10.3 cDNA cloned in pGC1020.

Figure 47 shows the amino acid sequence of the polypeptide encoded by the cDNA fragment shown in Figure 46.

Figure 48 shows the nucleotide sequence of the human i -beta- 1, 3 -Nacetylaminylt rans f erase cDNA.

Figure 49 shows the amino acid sequence of the human i-beta-1, 3-Nacetylaminyltransf erase protein.

Figure 50 shows partial nucleotide sequences for the fragment of the human i-beta-1,3-N- acetylaminyltransf erase cDNA cloned in pYMP5 A) forward sequence (coding strand) B) reverse sequence (non-coding strand).

Figure 51 shows a partial amino acid sequence for the polypeptide encoded by the fragment of the i-beta-1,3 N-acetylaminyltransf erase cDNA cloned in pYMPS.

Figure 52 shows an alignment between a fragment of the protein encoded by the cDNA fragment cloned in pYMP6 and the rat neurexim II-alpha-b cDNA. 10 Figure 53 shows partial nucleotide sequences for the human cDNA fragment cloned in pYMP6 A) forward sequence (coding strand) B) reverse sequence (noncoding strand). 15 Figure 54 shows an alignment between a fragment of the protein encoded by the cDNA fragment cloned in pYMP17 and the mouse mena protein.

Figure 55 shows partial nucleotide sequences for the human cDNA fragment cloned in pYMP17 A) forward sequence (coding strand) B) reverse sequence (noncoding strand) 2S Figure S6 shows the nucleotide sequence of the human alpha-2- macroglobulin cDNA.

Figure 57 shows the amino acid sequence of the human alpha-2macroglobulin protein. 30 Figure 58 shows a partial nucleotide sequence for the fragment of the human alpha-2-macroglobulin cDNA cloned in pYMP30 (reverse primer, non-coding strand).

Figure 59 shows partial nucleotide sequences of the fragment of human cDNA cloned in pYMP11 A) forward sequence (coding strand) B) reverse sequence (non- coding strand).

Figure 60 shows partial nucleotide sequences of the fragment of human cDNA cloned in pYMP12 A) forward sequence (coding strand) B) reverse sequence (non coding strand).

Figure 61 shows the amino acid sequence of the mouse APC-2 cDNA.

Figure 62 shows the nucleotide sequence of a C.

elegans I -beta- 1, 3 -N-acetylaminyl trans f erase cDNA (F22F7.6).

Figure 63 shows the amino acid sequence of a C.

elegans I -beta- 1, 3 -N-acetylaminyl trans f erase protein (F22F7.6).

Figure 64 shows the nucleotide sequences of the C.

elegans alpha-2-macroglobulin cDNAs ZK337.1b and ZK337.1a.

Figure 65 shows the amino acid sequence of the C.

elegans alpha-2-macroglobulin proteins ZK337.lb and ZK337.1a.

Figure 66 shows a multiple alignment of unc-SH1 genes.

ym97dl2 is an EST clone containing a fragment of the unc-5HS1 cDNA, 3D is a fragment of the unc-5HS1 cDNA cloned by PCR in Example 2.

Figure 67 shows cDNA and amino acid sequences for the C. elegans I -beta1, 3-N-acetylaminyltrans f erase homologue C18C1.3. 35 Figure 68 shows cDNA and amino acid sequences for the C. elegans I -beta - 1, 3 -Nacetylaminyltrans f erase homologue K09C8.4.

Figure 69 shows the amino acid sequence for the C.

elegans I-beta-1, 3-N-acetylaminyltransf erase homologue F21H7.10.

Figure 70 shows cDNA and amino acid sequences for the C. elegans I -beta1, 3-N-acetylaminyltrans f erase homologue C54C8.2.

Figure 71 shows cDNA and amino acid sequences for the C. elegans I -beta1, 3-N-acetylaminylt rans f erase homologue F56H6.6.

Figure 72 shows cDNA and amino acid sequences for the C. elegans I-beta-1, 3-N-acetylaminyltransf erase homologue TlSD6.4.

Figure 73 provides definitions of the various domains of the unc-5 protein. The intracellular part is defined as:- MPP+ZO-1+UP+ DD.

Figure 74 shows the complete nucleotide sequence of pGC1037.

Figure 75 shows the complete nucleotide sequence of pGC1003.

Figure 76 shows the amino acid sequence of C. elegans unc-40.

Figure 77 shows the nucleotide sequence of C. elegans unc-40.

Figure 78 shows the amino acid sequence of human unc40.

Figure 79 shows the nucleotide sequence of human unc40.

Figure 80 is a representation of the vector pGC1037. 5 Figure 81 is a representation of the vector pGC1003.

Figure 92 is a summary diagram of the human unc-5C splice variants.

Figure 83 summarises the cloning of the human unc-SC variants Figure 84 summarises the cloning of the human unc-SHS1 variants.

Example 1

Cloning of the human unc-SC splice- variants.

Splice variants of human unc-5C were cloned, primary with RACE technology.

A 5' RACE was performed using the 5' PACE System for Rapid Amplification of cDNA Ends, Version 2.0 (GibcoBRL, Merelbeke, Belgium), according the instructions supplied by the manufacturer or with minor modifications thereof. The primers were based on the unc-5 EST ym97dl2. The first strand cDNA synthesis was performed with primer: GSP1=oGC75: CGTAGCAGGCACTGGCCTCC PCR of dC-tailed cDNA: was performed with the genespecific primer: GSP2=oGC76: GCACTGGCCTCCAGCTGGCAGTAG and the RACE anchor primer supplied with the 5' RACE system. The PCR Program was:

Step 1 94'C, 2 min Step 2 94'C, 30 sec Step 3 60'C, 30 sec Step 4 72'C, 2 min Repeat steps 2 to 4 for 35 cycles Step 5 72'C, 7 min Step 6 40C A nested PCR was performed with gene-specific primer:

GSP3=oGC77: AGTAGAGGTGGGAGGGCGCCTCCTCGCCCAG and 51 PACE anchor primer The PCR program was:

Step 1 92'C, 2 min Step 2 92'C, 1 min Step 3 68'C, 2 min Repeat steps 2 and 3 for 35 cycles Step 4 72'C, 7 min Step 5 40C The resulting RACE products were visualised by electrophoresis on agarose gels, the bands excised and purified with Jetsorb (Genomed, Germany). The RACE products were ligated into plasmids pAS2 and pGEX-5X-3 with T4 DNA ligase (Amersham pharmacia biotech, NJ, USA), or into a TA cloning vector (Invitrogen, Groningen, the Netherlands). Plasmid DNA was purified prior to sequencing using the Qiagen plasmid purification system (Westburg, Leusden, The Netherlands).

Example 2

Clonincr of a new human unc-5 gene.

Human Brain Poly A+ RNA was obtained from Clontech, California, USA and first strand cDNA synthesis performed with the Ready To Go T-Primed First-Strand Kit ((Amersham pharmacia biotech, NJ, USA).

Primers were:

for PCR1:

oGC56: CCGGAATTCCATATGTTAATACTGCCCTTCTGCTGCTAA oGC66: GCGATCTCTGTAGTTGTGGCCTTG PCR program was:

Step 1 94'C, 1 min Step 2 53'C, 30 sec Step 3 72'C, 2 min Repeat steps 1 to 3 40 times Step 4 72'C, 7 min Step 5 40C for PCR2 oGC63: GGGAATTCCATATGTTGTTTGTGTATCGGAAGAATCATC oGC64: ACGCGTCGACTTAATACTGCCCTTCTGCTGCTAAGGAC oGC65: CCGGAATTCCTTGTTTGTGTATCGGAAGAATCATC PCR program was:

Step 1 940C, 5 min Step 2 92'C, 30 sec Step 3 55'C, 30 sec Step 4 72'C, 2 min Repeat steps 2 to 4 for 25 cycles Step 5 72'C, 7 min Step 6 40C The resulting PCR products we ' re isolated, cloned and analysed as described in Example 1.

Figure 8 shows the sequence of a PCR product isolated using the above PCR strategy. This PCR product was designated clone 3D. Figure 66 shows an alignment between the Rattus norvegicus unc-5Hl cDNA sequence, the sequence of EST ym97dl2, the sequence of clone 3D and the sequences of several other PCR products amplified using the above PCR strategy (1G, lJrc and 2Brc).

- 35 Example 3

Cloning of two of the fragments of UNC-5 for the dimerization experiment.

A PCR amplification was performed with following primers:

UNCSF: GGT GGT CAT ATG GCC ATG GAG TGC TGT AAA CGT GGC AAT TCA AAA AAG UNC5R: GGC TGC AGG TCG ACG CCC CGG GGC TTA TGG GGA CAC AAT TTG TGG Using the cDNA library used in the yeast two hybrid experiment (Example 4) as template.

is PCR program was:

Step 1 940C, 1 min Step 2 530C, 30 sec Step 3 72'C, 2 min Repeat steps 1 to 3 for 25 cycles Step 4 720C, 7 min Step 5 40C The resulting PCR products were isolated and cloned in frame as Ncol/Sall fragments in the vectors pAS2 and pGAD424 supplied by Clontech (Palo Alto, California, USA).

Example 4

Yeast two Hybrid Experiments To address the functional role of unc-5 the inventors used the yeast two hybrid method (Fields and

Song, Nature 340:245, 1989), a method well known to molecular biologists, to search for the proteins that interact with the UNC-5 protein.

The two hybrid method is based on a pair of fusion proteins. The first fusion protein comprises a first of two interacting proteins fused to the transcriptional activation domain of a bipartite yeast transcription factor; the second fusion protein comprises the second of two interacting proteins fused to the DNA binding domain of the bipartite yeast transcription factor. The principle of the method is that if the two domains of the bipartite transcription factor are physically brought together by binding of the first and second interacting proteins then the resulting complex will be able to' activate transcription from a promoter which contains a target binding site for the transcription factor. The two hybrid assay is commonly used to study protein-protein is interactions between two known proteins. It can also be used to screen a library of proteins to identify proteins which interact with a given protein. Both of these uses of the two hybrid system are well known to those skilled in the art.

In the present invention, the yeast two hybrid assay was used to identify proteins which interact with C. elegans UNC-3 or human UNC-5 as follows: the intracellular part of UNC-5 or parts thereof were cloned in fusion with the DNA-binding domain of the yeast transcription factor GAL4. A cDNA library was cloned into a vector containing the transcriptional activation domain of GAL4. The fusion proteins were then independently expressed together in yeast containing a reporter gene under the transcriptional control of a promoter containing GAL 4 binding sites (typically GAL1 lacZ or GALl-HIS3) Methods (A) Construction of the C. elegans library and standard yeast two-hybrid experiments.

Construction of C. elegans cDNA libraries, and yeast two hybrid experiments with C. elegans cDNA were performed as described by Elledge et al., Proc. Natl. Acad. Sci., 1991, 88:1731-1735, or using the Matchmaker' maker system supplied by Clontech, California, USA according to the protocol supplied by the manufacturer, or by minor modifications of the above-described methods.

(B) A mating yeast two hybrid experiment.

Mating yeast two hybrid experiments were performed using plasmid pGC1037 (a plasmid,map of pGC1037 is shown in Figure 80 and the complete sequence of the plasmid is given in Figure 74) as bait, and a pre-transformed Human Brain MATCHMAKER is cDNA library (Clontech, California, USA) according to the protocol supplied by the manufacture, or with minor modifications thereof.

In brief summary, the steps of the method are as follows:Inoculate 1 colony containing the bait plasmid into an overnight culture; Mate the bait culture and the library culture (24 h); Plate library mating mixtures; Incubate for at least 8 days; Streak big colonies onto SD-3 + SmM AT- plates Nylon Membrane); Stain yeast on Nylon membrane; Prepare yeast DNA from the positives; Perform restriction digest, if digest is successful perform backtransformation, using positive and negative controls; Transform positives into MC1061 cells; Prepare bacterial DNA using Qiagen Plasmid Mini Purification kit, according to the standard Qiagen protocol; and Perform DNA sequencing. All positives obtained in the yeast two hybrid screen were assayed for the

specificity of the interaction (against empty vector and irrelevant proteins) using the two hybrid system.

(C) Double-stranded RNA inhibition-RNAi cloning isolation and inlection.

Double stranded RNA for RNA inhibition experiments was prepared according to the MEGAscript protocol (Ambion, UK). RNA isolated using this protocol was purified away from contaminant- s using the RNeasy system from Qiagen (Westburg, the Netherlands) following the instructions for RNA clean-up supplied by the manufacturer. RNA was injected into the nematodes using standard procedures (Methods in Cell biology, Vol 48, Academic Press, 1995) Results (A) Auto-activation and dimerization experiments.

In a first series of experiments, the ability of the intracellular domain of C. elegans unc-5 or parts thereof to dimerize or to cause auto-activation was tested. Several plasmids were constructed harboring the intracellular domains of unc-5 and parts thereof.

Various domains of unc-5, including the membrane proximal part (MMP), the zonula occludens homology domain (ZO-1), the unknown part (UP) and the Death domain (DD) and were cloned in the vectors pAS2 and pGAD424 (Matchmaker, Clontech, CA, USA). The resulting vectors are summarized in Table 1.

Several constructs containing the death domain were found to be either toxic or auto-activating.

Furthermore, by performing homo-dimerization experiments, it was found that the intracellular domain of UNC-5C is capable of forming a homo-dimer.

Further experiments led to the conclusion that the

ZO-l/UP region is probably responsible for the homo- dimerization. Membrane located signal receptors often form homo- or hetero-dimers prior to intracellular signal transduction. Accordingly, it is postulated that dimer formation in UNC-5 could be a critical event in signalling. Based on a knowledge of this dimerization it is possible to develop assays to screen for compounds which disrupt dimer formation and to identify unc-5 mutants which are unable to dimerize.

The present inventors have found that in humans UNC-5 proteins may be encoded by at least three genes, the homologous genes unc-SC, unc-SHS1, unc-SHS2. As UNC-5 is an important receptor involved in a vast amount of biological processes, it is considered that more functional homologous genes or unc-5 genes may present in the Homo sapiens genome. In addition, the expression of the unc-5 gene does not result in the production of a single transcript. The expression of unc-5C locus can result in the production at least 4 isoforms as a result of alternative splicing events.

It is possible that the other unc-5 genes will also express splice variants, which may encode different protein isoforms. Any of these unc-5 isoforms may form dimers, analogous to the homo-dimerisation found for C. elegans unc-5. Accordingly, assays can also be developed to screen for chemical substances that alter the dimerization of human unc-5 proteins. Compounds identified using such an assay may have pharmacologically useful properties.

(B) Other receptor dimerizations.

It has been suggested that, in addition to UNC-6, UNC-129 also signals to the UNC-5 receptor (Colavita et al., Science 261:706-709). UNC-6 is also known to signal to UNC-40(DCC). UNC-129 belongs to the TGF-P superfamily. TGF-P receptors, including DAF-1 and DAF-4, do not affect axonal guidance. Although new TGF-P receptors may be found that are involved in axonal guidance, it is more likely that the UNC-129 molecule is able to interact with TSP type I domains, which are present in UNC-5. Such interaction between TGF-P molecules and TSP Type I domains has been shown previously (Schultz- Cherry et al., 1994, J. Biol. Chem. 269, 26775). Furthermore UNC-129 is also involved in the UNC-40 pathway.

Recent studies have provided support for the idea that the UNC-5 receptor induces switching of UNC-40 from attraction to repulsion (Mehlen et al.,, Nature 395:801-804, 1998). This suggests a linkage of Unc-5 to oncology since Unc-40 is related to vertebrate DCC (deleted in colorectal cancer), which is a candidate is tumour-suppressor gene, and encodes a receptor for netrin-1 (UNC-6). The reversal from attraction towards repulsion in growth cone steering with the two receptors UNC-5 and UNC-40 can be explained by hetero- dimerization between UNC-5 and UNC-40. Such switching of function has also been observed in other biological processes. The UNC-40/UNC-5 interaction may function analogously to the Bax/Bcl-2 interaction involved in apoptosis. Bax can be considered as the protein that protects against apoptosis but the relative titre of both Bax and Bcl-2 in a cell may be important in the decision of cell death.

Given that UNC-5 is capable of forming homodimers, it is postulated that UNC-5 is also capable of forming heterodimers with UNC-40. The UNC5/UNC-40 heterodimers may act as a functional receptor for UNC-6 and UNC129. Assays to isolate compounds that influence the interaction between UNC-5 and UNC-40, both enhancing and inhibiting this interaction have therefore been developed. These assays are analogous to the assays as described to isolate compounds that influence the formation of the UNC-5 dimers and the assays for compounds that influence the interaction of UNC-5 with its other interacting proteins (see below).

_(C) C. elecfans UNC-5 interactinq iproteins The intracellular part of UNC-5 containing the domains MPP, ZO-1 and UP cloned in vector pGC1003 (a plasmid map of pGC1003 is given in Figure 81 and the complete sequence of the plasmid is given in Figure 75) was used as 'bait' in a yeast two hybrid experiment screening against a C. elegans cDNA library. These experiments resulted in the identification of ten genes, including three known genes and seven genes with heretofore unknown function, encoding proteins which specifically interact with the intracellular part of UNC-5.

Details of the UNC-5 interacting proteins identified during the two hybrid screen are given below. In most cases, the results of double-stranded RNA inhibition experiments (RNAi) designed to inhibit expression of the interacting protein are also given. Where appropriate, details of human homologues of the interacting protein are also.given and any known disease associations are discussed.

25.1) Spectrin -chain / Fodrin P-chain (pC1025) A first series of hits resulted in the identification of plasmid pC1025 which contains a fragment of a cDNA encoding the C. elegans spectrin P-chain/Fodrin. The spectrin P-chain protein is encoded by the gene K11C4.3, located on chromosome IV.

The full length cDNA and amino acid sequences of spectrin -chain/Fodrin are shown in Figures 10 and 11, respectively. The nucleotide sequence of the fragment of the spectrin P-chain cDNA which is cloned as an insert in plasmid pC1025 is given in Figure 12, the corresponding amino acid sequence is given in Figure 13.

RNAi experiments using a double-stranded RNA corresponding to the cDNA fragment cloned in pC1025 revealed that inhibition of the expression of the native spectrin P-chain in C. elegans worms causes the following phenotype: no embryonal lethality, normal canals, normal elongation, growth retardation and growth arrest at Ll and L2, nearly no movement but touch reflex is observed. The phenotype is 100% penetrant, and the larvea are short and wrinkled.

These RNAi phenotypes and the corresponding knock-out phenotype can be used as the basis of a compound screen in C. elegans to identify chemical substances that modulate the activity of the spectrin P-chain protein.

is Human Fodrin (genbank accession number 2493434) contains an extra C-terminal PDZ domain that is not present in spectrin (genbank accession number 134798).

The human f odrin seems to be more homologous to the C.

elegans protein. This is in agreement with the finding that unc-5 is also expressed in the brain of vertebrates.

* The interaction between UNC-5 and fodrin could be a critical event in a cell signalling, hence compounds which modulate the interaction between UNC-5 and fodrin, particularly the interaction between human UNC-5 and human fodrin, may potentially have pharmacological activity. Assays can also be developed to screen for genetic mutations that inhibit the interaction needed for proper signal transduction.

Compounds which enhance or inhibit the interaction of UNC-5 with fodrin and spectrin P-chain may be useful in the development of pharmaceutical preparations for the treatment of Crohn's disease, Sjogren's syndrome, secretion related diseasesf diseases related to neutophil and platelet activation, and long-term potential in neurons, Alzheimer's disease, proliferative diseases such as carcinomas, neoplasia, and more specifically, shwannomas, meningiomas, ependymonas, squamous cell carcinomas, malignant melanomas and lung carcinomas, spherocytosis, pyropoikilocytosis, Duchenne muscular dystrophy and various neurological disorders.

2) A.PR-1 (pC1028) A second plasmid isolated in the yeast two hybrid screen, pC1028, contained a fragment of a cDNA encoding APR-1.

The nucleotide sequence of the full length APR-1 cDNA is shown in Figure 14 and the amino acid sequence of the APR-1 protein encoded by this cDNA is shown in Figure 15. The nucleotide sequence of the fragment of the APR1 cloned in pC1028 is shown in Figure 16, with the corresponding amino acid sequence shown in Figure 17.

RNAi experiments using a double-stranded RNA corresponding to the fragment cloned in pC1028 demonstrated that inhibition of APR-1 expression in C. elegans results in the following phenotype: more than 95% embryonic lethality, in 25% of cases this was due to the overproduction of pharyngeal tissue and lack of endoderm, and premature division of the E daughters (Rocheleau et al., Cell 90:707-716, 1997). Escapers (worms that survive) have abnormal gut cells. These RNAi phenotypes and the corresponding knock-out phenotype can be used as the basis of a compound screen in C. elegans to identify chemical entities that modulate the activity of APC (see below), and hence the unc-5 pathway.

Further yeast two hybrid experiments were performed in order to more precisely determine the position of the APR binding regions in UNC5, using the UNC5 domains MPP, ZO-1, UP and combinations thereof.

APR-1 seemed to associate with two distinct regions in UNCS. First, APR-l appears to bind to the MPP domain.

Secondly, APR-l appears to binding to the ZO-1/UP domain. APR-1 seems to bind less to the ZO-1 and UP domains when they are present alone and not in combination. A similar experiment was carried out using the C. elegans UNC-5 protein, and domains of human APC and analogous results were obtained. It is concluded that APC is capable of binding to two distinct regions of UNC-5, the MPP and the ZO-l/UP domains.

The interaction between UNC-5 and APC/APR-1 could be a critical event in cellular signalling and hence compounds which modulate this interaction, particularly compounds which modulate an interaction between human UNC-5 and human APC, may potentially have pharmacological activity. Furthermore genetic mutations, and splice variants can be identified that inhibit the interaction, needed for proper signal transduction. Compounds which enhance or inhibit the interaction of UNC-5 with APR/APC may be useful in the development of pharmaceutical agents for the treatment of neurological diseases and colorectal cancers such as adenomatous polyposis coli.

3) UNC-14 (RC1034) A third plasmid identified during the yeast two hybrid screen using C. elegans UNC-5 as bait (pC1034) was found to contain a fragment of the UNC-14 cDNA.

The nucleotide sequence of the full length UNC-14 cDNA is shown in Figure 18, the amino acid sequence of the protein encoded by this cDNA is given in Figure 19. The nucleotide sequence of the fragment of the UNC-14 cDNA cloned as an insert in pC1034 is shown in Figure 20, with the corresponding amino acid sequence of the polypeptide encoded by this fragment shown in Figure 21.

- 45 C. elegans worms mutated in unc-14 are observed to be very sluggish, almost paralysed, small, dumpyish, with a tendency to coil and show some egg retention. This phenotype can be used as the basis of a compound screen in C. elegans to identify chemical entities that modulate the activity of UNC-14.

Furthermore, C. elegans worms mutated in the unc-14 gene were shown to have abnormal axonal elongation and axonal structures. The unc-14 gene encodes a protein of 665 amino acids, and is co-expressed with the unc-51 gene in the c(E11 bodies and axons of almost all neurons including DD/VD and hermaphrodite-specific neurons. The results of yeast two-hybrid experiments suggested that a central region of UNC-14 binds to the carboxy-terminal region of UNC-51, and that the UNC-51 carboxy-terminal region oligomerized (Ogura et al., Genes Dev. 11:1801-1811, 1997).

Mutations in the unc-51 gene, isolated from mutants of Caenorhabditis elegans exhibiting abnormal axonal extension and growth, encodes a novel serine/threonine kinase (K. Ogura, et al., 1994, Genes Dev. 8: 23892400).

25.4) F11A10.1 (RGC1021) A fourth plasmid isolated during the yeast two hybrid screen, pGC1021, was found to contain a fragment of cDNA corresponding to the C. elegans gene designated F11A10.1.

The nucleotide sequence of the full length F11A10.1 cDNA is shown in Figure 22, with the amino acid sequence of the protein encoded by this cDNA shown in Figure 23. The nucleotide sequence of the fragment of the F11A10.1 cDNA cloned in pGC1021 is shown in Figure 24, the amino acid sequence of the protein fragment encoded by this fragment of the cDNA is shown in Figure 25.

To date, no function is as yet known for FllA1O. 1. RNAi experiments using a double-stranded RNA corresponding to the insert of pGC1021 showed that inhibition of MA10. 1 expression in C. elegans results in worms which are weakly constipated. In C.

elegans, constipation has been associated with neuronal dysfunction (Thomas, Genetics 124:855-872, 1990). Furthermore and remarkably inhibition of FllA1O.l expression causes migration defects in the distal tip cell, similar to those observed in unc-5 mutants and unc-14/unc-51 double mutants. These RNAi phenotypes and the corresponding knock-out phenotypes can be used as the basis of a compound screen in C.

elegans to identify chemical entities that modulate the activity of FllAlO.l.

The interaction between UNC-5 and FllAlO.l could be a critical event in cellular signalling and hence compounds which modulate this interaction may potentially have pharmacological activity.

Furthermore, genetic mutations, and splice variants can be identified that inhibit the interaction, needed for proper signal transduction. Compounds which enhance or inhibit the interaction of UNC-5 with MAN. 1 may be of use in the development of pharmaceutical compositions useful in the treatment of neurological disorders, tumours such as Kaposi's Sarcoma, immunological disorders and diseases related to vesicle fusion, proteolysis, peroxisomal and mitochondrial biogenesis, and transcription.

5) ClSE6.1/2 (PGC1026) A fifth plasmid identified during the yeast two hybrid experiment, pGC1026, was found to contain a fragment of a cDNA encoding the C15E6.1 protein.

The nucleotide sequence of the full length C15E6.1/2 cDNA is shown in Figure 26, with the amino acid sequence of the protein encoded by this cDNA shown in Figure 27. The nucleotide sequence of the fragment of the C15E6.1/2 cDNA cloned in pGC1026 is shown in Figure 28, the amino acid sequence of the protein fragment encoded by this fragment of the cDNA is shown in Figure 29.

RNAi experiments using a double-stranded RNA corresponding to the insert of pGC1026 did not result in any clear visual phenotype.

The identification of C15E6.1/2 as an UNC-5 interacting protein indicates that UNC-5 might be a band 4.1 binding protein and may- share homology with other band 4.1 binding proteins such as CD44, glycophrin C, and paranodin.

By using the band 4. 1 signature to search a database of C.elegans genes, F07A11.1 on chromosome II was identified as encoding a band 4.1 protein.

The interaction between UNC-5 and C15E6.1/2 could be a critical event in cellular signalling and hence compounds which modulate this interaction may potentially have pharmacological activity. Furthermore genetic mutations, and splice variants can be identified that inhibit the interaction, needed for proper signal transduction. Compounds which enhance or inhibit the interaction of UNC-5 with C15E6.1/2 may be useful in the development of pharmaceutical preparations for the treatment of diseases related to axonal signalling, synaptic vesicle exocytosis, cell adhesion, cytoskeleton associated proteins, cell morphology, cell growth, allergic inflammatory processes and rheumatoid arthritis.

6) D1081.7 (PGC1027) A sixth plasmid identified during the two hybrid screen was found to contain a fragment of cDNA corresponding to the C. elegans gene designated D1081.7.

The nuclectide sequence of the full length D1081.7 cDNA is shown in Figure 30, the amino acid sequence of the protein encoded by this cDNA is given in Figure 31. The nucleotide sequence of the fragment of the D1081.7 cDNA cloned as an insert in pGC1027 is shown in Figure 32, with the corresponding amino acid sequence of the polypeptide encoded by this fragment shown in Figure 33.

RNAi experiments performed using double stranded RNA corresponding to the insert in pGC1027 appeared not to result in any clear visual phenotype.

All genes so far found in C.'elegans have human homologues. It is therefore expected that D1081.7 will also have vertebrate, including human, homologues. These homologues can be cloned using standard technologies.

The interaction between UNC-5 and D1081.1 could be a critical event in cellular signalling and hence compounds which modulate this interaction may potentially have pharmacological activity and thus be of use in the development of pharmaceutical compositions. Furthermore genetic mutations, and splice variants may be identified that inhibit the interaction needed for proper signal transduction.

7) B0238.9 (RGC1032) A seventh plasmid identified during the two hybrid screen was found to contain a fragment of cDNA corresponding to the C. elegans gene designated B0238.9.

The nucleotide sequence of the full length B0238.9 cDNA is shown in Figure 34, the amino acid sequence of the protein encoded by this cDNA is given in Figure 35. The nucleotide sequence of the fragment of the B0238. 9 cDNA cloned as an insert in pGC1032 is shown in Figure 36, with the corresponding amino acid sequence of the polypeptide encoded by this fragment shown in Figure 37.

49 - B0238. 9 is located in the chromosomal region where seu-2 is also located. The seu-2 was identified in suppressor screens of ectopically expressed unc-5 and is considered to be involved in the unc-5 pathway (Colavita and Culotti, Dev. Biol. 194:72-85, 1998). As a gene has now been isolated that interacts with unc-5, it is high probable that B0238. 9 is the same as seu-2. Mutations in seu-2 appeared not to have any visual phenotype, as was also observed in RNAi experiments using a double stranded RNA corresponding to a fragment of B0238.9. The finding thatSEU-2 is a suppressor and a binding partner to UNC-5 validates the importance of this interaction. Other known suppressors of ectopic unc-5 growth cone steering are is unc-6, unc-40, unc-34, unc-44, unc-129, seu-1, seu-2, and seu-3. Mutations in some of these genes show axonal guidance defects, unlike seu-2.

Homology searches in the EST database with B0238.9 revealed the presence of at least two human ESTs with significant homology. The ESTs so found, nz77bO6 and yu53gOl, can be used as basis to clone the full length cDNA encoding the human homologue of B0238.9.

The interaction between UNC-5 and B0238.9 could be a critical event in cellular signalling and hence compounds which modulate this- interaction may potentially have pharmacological activity and thus may be useful in the development of pharmaceutical compositions. Furthermore genetic mutations, and splice variants may be identified that inhibit the interaction, needed for proper signal transduction.

8) ZC404.8 (pGC1033) An eighth plasmid identified during the two hybrid screen was found to contain a fragment of a cDNA corresponding to the C. elegans gene designated ZC404.8.

The nucleotide sequence of the full length ZC404.8 cDNA is shown in Figure 38, the amino acid sequence of the protein encoded by this cDNA is given in Figure 39. The nucleotide sequence of the fragment of the ZC404.8 cDNA cloned as an insert in pGC1033 is shown in Figure 40, with the corresponding amino acid sequence of the polypeptide encoded by this fragment shown in Figure 41.

RNAi experiments using a double stranded RNA corresponding to a fragment of this gene resulted in an embryonic lethal phenotype. The worms showed no elongation and only very little muscle activity, the hypodermis is clearly abnormal.

Homology searches in the EST database with ZC404.8.9 revealed the presence of at least three human ESTs with significant homology. The ESTs thus identified, qe69hO3, zx6ldO4, and zd35elO, can be used as basis to clone the full length cDNAs.

The interaction between UNC-5 and ZC404.8 could be a critical event in cellular signalling and hence compounds which modulate this interaction may potentially have pharmacological activity and thus be useful in the development of pharmaceutical preparations. Furthermore genetic mutations, and splice variants may be identified that inhibit the interaction, needed for proper signal transduction.

9) vkl7a3 (RGC1023) A ninth plasmid identified during the yeast two hybrid experiment was found to contain a fragment of cDNA corresponding to the C. elegans gene designated ykl7a3.

The nucleotide sequence of the fragment of the ykl7a3 cDNA cloned as an insert in pGC1023 is shown in Figure 42, with the corresponding amino acid sequence of the polypeptide encoded by this fragment shown in Figure 43.

- 51 RNAi experiments using a double stranded RNA corresponding to a fragment of ykl7a3 resulted in the following phenotypes in C. elegans: Very slow growth, and the larvae get typical darker spots as they get older. Inhibition of ykl7a3 expression in some non wild-type genetic backgrounds leads to defective moulting, where the worm cannot escape from the old cuticle and therefore shrinks and stays in the L4 stage. The defective moulting phenotype is also observed when ykl7a3 expression is inhibited on a wild-type genetic background, although thelphenotype is less prominent. Worms which escape the defective moulting phenotype show defects in vulva development, either lacking a vulva altogether or having a vulva which is non-functional.

Homology searches in the Genbank database with ykl7a3 revealed the presence of at least one human homologue of this gene, designated KIAA0187.

The interaction between UNC-5 and ykl7a3 (KIAA0187) could be a critical event in cellular signalling and hence compounds which modulate this interaction may potentially have pharmacological activity. Furthermore genetic mutations, and splice variants may be identified that inhibit the interaction, needed for proper signal transduction.

Compounds which enhance or inhibit the interaction of UNC-5 with ykl7a3 may be of use in the development of pharmaceutical compositions for the treatment of CADASIL, artheriohepatic dysplasia, Alzheimer's disease, neoplasia such as T-cell acute lymphoblastic leukemia and certain cancers, such as pancreatic cancer and colon cancer.

10) F41H10.3 (pGC1020) A tenth plasmid identified using the yeast two hybrid experiment was found to contain a fragment of a cDNA corresponding to the C. elegans gene designated F41H10. 3.

The nucleotide sequence of the full length F41H10.3 cDNA is shown in Figure 44, the amino acid sequence of the protein encoded by this cDNA is given in Figure 45. The nucleotide sequence of the fragment of the F41H10.3 cDNA cloned as an insert in pGC1020 is shown in Figure 46, with the corresponding amino acid sequence of the polypeptide encoded by this fragment shown in Figure 47. F41H10.3 harbors a ATP/GTP binding domain.

Worms resulting from RNAi experiments -using a double stranded RNA corresponding to a fragment of F41H10.3 did not exhibit a clear visual phenotype.

All genes so far found in C. elegans have human homologues. It is therefore expected that F41H10.3 will also have vertebrate, including human, homologues. These homologues can be cloned using standard technologies well known to persons skilled in the art.

The interaction between UNC-5 and F41H10.3 could be a critical event in signalling and compounds which modulate this interaction may potentially have pharmacological activity and thus be useful in the development of pharmaceutical preparations.

Furthermore genetic mutations, and splice variants may be identified that inhibit the interaction, needed for proper signal transduction.

(D) Human UNC-5 interactincr proteins.

The intracellular part of the human UNC-5 protein (human UNC-5HS1) containing the domains ZO-1, UP and DD cloned in vector pGC1037 (see above) was used as bait' in a yeast two hybrid experiment screening against a pretransformed human brain Matchmaker cDNA library (Clontech, Palo Alto, California USA) using the mating screen approach described above. These experiments resulted in the identification of six genes encoding proteins which interact with UNC-5, including two known genes and four heretofore unknown genes.

All proteins found in this yeast two hybrid screen with the human UNC-5 were different to the proteins found in the screen with the C. elegans UNC-5. There are at least two reasons for this variation in the isolated proteins. First, the screens are not saturated, which means that not all possible interacting proteins have been isolated, neither in the screen with the C. elegans UNC-5 nor in" the screen with the human UNC-5. Secondly, different intracellular fragments have been used in the screens. In the C. elegans UNC-5 screen, the intracellular domains MPP, ZO-1 and UP were used as bait, whereas in the human UNC-5 screen, the intracellular domains ZO-1, UP and DD were used as bait. Proteins with specific interaction patterns will not be isolated if the necessary interacting domain is missing, or if the optimal combination of domains is missing. This has been shown in the C. elegans UNC-5 interaction with APR. APR interacts clearly with the MPP domain and the domain combination ZO-1,UP, but interacts less efficiently to with domain combination MPP, ZO-1, although the MPP domain is present. APR binds efficiently to the domain combination MPP, ZO-1, UP.

The human UNC-5 interacting proteins identified during the two hybrid screen are listed below. In each case, any known disease associations are discussed and genes/cDNAs encoding homologous C. elegans proteins are listed.

1) i -beta- 1, 3 -N- acetylaminyltansferase (RYMP5).

A first plasmid identified during the yeast two hybrid experiment was found to contain a fragment of the cDNA encoding i- beta-1, 3-N-acetylaminyltansf erase.

The nucleotide sequence of the full length i -beta - 1, 3 -N-acetylaminyltans f erase cDNA is shown in Figure 48, the amino acid sequence of the protein encoded by this cDNA is given in Figure 49. The partial nucleotide sequences of the fragment of the i-beta-1, 3-N-acetylaminyltansf erase cDNA cloned as an insert in pYMP5 are shown in Figure 50, with the corresponding amino acid sequence of the polypeptide encoded by these partial sequences shown in Figure 51.

C. elegans has at least seven putative homologues of i-beta-1, 3-N-acetylaminyltansf erase, designated F22F7.6, C18G1.3, K09C8.4, F21H7.10, C54C8.2, F56H6.6 and T15D6.4. cDNA and/or amino acid sequences for each of these putative homologues are given herein.

Amino acid and nucleotide sequences for these homologues are given inFigures 62 to 72.

The interaction between UNC-5 and beta- 1, 3 -N-acetylglucosaminyltrans f erase could be a critical event in signalling and hence compounds which modulate this interaction may potentially have pharmacological activity. Furthermore genetic mutations, and splice variants may be identified that inhibit the interaction, needed for proper signal transduction. Compounds which modulate the interaction of UNC-5 with beta- 1, 3-N-acetylglucosaminyltransf erase may be useful in the development of pharmaceutical preparations for the treatment of synaptic cleft dysfunctions, vesicle transport dysfunctions, inflamation, various tumours and more particular in tumour cell adhesion, migration and invasion, such as pancreas cancer, squamous cell cancer, human breast cancer, thyroid neoplasms, colorectal carcinomas.

2) new crone with slight homolocry to neurexin Il-alpha-b (NHII) (pYN26) A second plasmid identified during the yeast two hybrid experiment was found to contain a fragment of a cDNA corresponding to a new gene with slight homology to neurexin II-alpha-b. The new gene was designated NHII.

Partial nucleotide sequences for the fragment of cDNA cloned as an insert in pYMP6 are shown in Figure 53A (coding strand sequenced from one end of the insert of pYMP6 sequenced with forward primer)and and Figure 53B (non-coding strand sequenced from one end of pYMP6 with reverse primer). The plasmid pYMP6 was deposited in the Belgian Co-ordinated Collections of Microorganisms (BCCM), Universiteit Gent, K. L.

Ledeganckstraat 35, B-9000, Gent,' Belgium on 21 May 1999 under accession number LMBP 3932. The cDNA insert (approximately 1800bp) can easily be excised from this plasmid by digestion with the restriction enzymes EcoRI and XhoI. Alternatively the cDNA insert sequence can be amplified by PCR using primers corresponding to the sequences for the ends of the insert given in Figures 53A and 53B.

The interaction between UNC-5 and the new gene with homology to neurexin II-alpha-b could be a critical event in signalling and hence compounds which modulate this interaction may potentially have pharmacological activity.

3) New Gene with Mena homology (MHI) (PYMP17) A third plasmid identified during the yeast two hybrid experiment was found to contain a fragment of a cDNA encoding a protein sharing slight homology with the human mena protein. The new gene was designated MHI.

Partial nucleotide sequences of the fragment of cDNA cloned as an insert in pYMP17 are shown in Figure 55A, (coding strand sequenced from one end of the insert of pYMP sequenced with forward primer)and Figure 55B (non-coding strand sequenced from one end of pYMP with reverse primer). An alignment between the amino acid sequence encoded by the insert of pYMP17 and the mouse mena protein is shown in Figure 54. The plasmid pYMP17 was deposited in the Belgian Co-ordinated Collections of Microorganisms (BCCM), Universiteit Gent, K. L. Ledeganckstraat 35, B-9000, Gent, Belgium on 21 May 1999 under accession number LMBP 3935. The cDNA insert (approximately 1000bp) can easily be excised from this plasmid by digestion with the restriction enzymes EcoRI and XhoI. Alternatively the cDNA insert sequence can be amplified by PCR using primers corresponding to the sequences for the ends of the insert given in Figures 55A and 55B.

C. elegans has at least one protein with homology to the new Mena homologue (MHI), encoded by the gene designated Y5DD4.Contig2OO. The C. elegans gene, is unc-34 (which maps with Y50D4) is known to suppress the axonal guidance defects induced by ectopic expression of the Netrin receptor UNC-5 (Colavita, A.

et al., Dev.Biol., 194:72-85, 1998.).

The interaction between UNC-5 and mena, members of this mena superfamily, unc-34, and Y50D4.contig2OO, could be a critical event in signalling and hence compounds which modulate these interactions may potentially have pharmacological activity and thus may be useful in the development of pharmaceutical compositions.

4) Alpha-2 macroglobulin (pYMP30) A fourth plasmid identified during the yeast two hybrid experiment was found to contain a fragment of the human alpha-2 macroglobulin cDNA.

The nucleotide sequence of the full length alpha 2 macroglobulin cDNA is shown in Figure 56, the amino acid sequence of the protein encoded by this cDNA is given in Figure 57. A partial nucleotide sequence for the fragment of the alpha-2 macroglobulin cDNA cloned as an insert in pYMP30 is shown in Figure 58.

C. elegans has at least one homologue of alpha-2 macroglobulin, designated ZK337. 1, of which two splice variants designated ZK337. la. and ZK337. lb are known to exist.

The interaction between UNC-5 and alpha-2 macroglobulin could be a critical event in signalling and hence compounds which modulate this interaction may potentially have pharmacological activity.

Compounds which enhance or inhibit the interaction of UNC-5 with alpha-2 macroglobulin could be useful in the development of pharmaceutical substances.

5) New gene 1 (pYMP11) A fifth plasmid identified during the yeast two hybrid experiment was found to contain a fragment of is cDNA with no homology to any known human cDNA.

Partial nucleotide sequences for the fragment of cDNA cloned as an insert in pYMP11 are shown in Figure 59A (coding strand sequenced from one end of the insert of pYMP sequenced with forward primer)and Figure 59B (non-coding strand sequenced from one end of pYMP with reverse primer). The plasmid pYMP11 was deposited in the Belgian Co-ordinated Collections of Microorganisms (BCCM), Universiteit Gent, K. L.

Ledeganckstraat 35, B-9000, Gent, Belgium on 21 May 1999 under accession number LMBP 3933. The cDNA insert (approximately 2300bp) can easily be excised from this plasmid by digestion with the restriction enzymes EcoRI and XhoI. Alternatively the cDNA insert sequence can be amplified by PCR using primers corresponding to the sequences for the ends of the insert given in Figures 59A and 59B.

The interaction between UNC-5 and the protein encoded by the insert of pYMP11 could be a critical event in signalling and hence compounds which modulate this interaction may potentially have pharmacological activity and thus could be useful in the development of pharmaceutical substances.

6) New crene 2 (PYMP12) A sixth plasmid identified during the yeast two hybrid experiment was found to contain a fragment of cDNA with no homology to any known human cDNA.

Partial nucleotide sequences for the fragment of cDNA cloned as an insert in pYMP12 are shown in Figure 60A (coding strand sequenced from one end of the insert of pYMP sequenced with forward primer)and Figure 60B(non-coding strand sequenced from one end of pYMP with reverse primer) The plasmid pYMP12 was deposited in the Belgian Co-ordinated Collections of Microorganisms (BCCM), Universiteit Gent, K. L.

Ledeganckstraat 35, B-9000, Gent, Belgium on 21 May is 1999 under accession number LMBP 3934. The cDNA insert (approximately 2000bp) can easily be excised from this plasmid by digestion with the restriction enzymes EcoRI and XhoI. Alternatively the cDNA insert sequence can be amplified by PCR using primers corresponding to the sequences for the ends of the insert given in Figures 60A and 60B.

The interaction between UNC-5 and the protein encoded by the insert of pYMP12 could be a critical event in signalling and hence compounds which modulate this interaction may potentially have pharmacological activity and thus could be useful in the development of pharmaceutical substances.

ACCESSION NUMBERS:

Human beta-fodrin cDNA-GenBank S65762 Human beta-fodrin protein- swi ssprot Q01082 Human APC-1 cDNA-GenBank M74088 Human APC-1 protein-swissprot P25054 Human unc-14 cDNA (KIAA0375)-GenBank AB002373 Human unc-14 protein (KIAA0375)-BAA20830 Human ykl7a3 cDNA (KIAA0187)-GenBank D80009 Human ykl7a3 protein (KIAA0187)-SPTREMBL:Ql4692 Example 5

Yeast two hybrid com-oound screens' Interactions of proteins leads to expression of a reporter protein P-galactosidase in a yeast two hybrid assay. An assay has been developed that is usable in 96 or 384 well plates or microtiter plates with another number of wells. This assay is suitable for high throughput compound screening. Optimal performance of the assay is dependent upon at least two important parameters:

lysis of yeast cells and the choice of the P-galactosidase substrate.

The basic protocol for an assay in 96 or 384 well plates is as follows:

A yeast strain containing the Escherichia coli lacZ gene under the control of the yeast Ga14 promoter is grown overnight (with shaking at 230-270 rpm) then diluted with YPD medium to an OD600 of 0.2. Diluted cultures are grown for an additional 3-5 hr until mid-log phase. Yeast cells are then transferred to either 96- or 384-well plates (100 pl/well or 25 pl/well, respectively). Alternatively, cells can be cultured in the microtiter plates, eliminating the need for a pipetting step.

The yeast cells are then either lysed by freeze and thaw method (liquid N2 to freeze, 370C water bath to thaw) or by use of a Lysis buffer (e.g.: 1% Lithium dodecyl sulphate, 100 mM EDTA and 10 mM Tris-HC1 pH 8. 0). Non-lysed cells also give a signal, although the variability is increased if the cells are not lysed.

Yeast cells can also be permeabilized with various reagents such as isopropanol (15 %).

The substrate sensitivity must be optimised for efficient detection in a screening process.

Fluorescein di galactoside (FDG) is a typical low cost fluorescent reagent for the detection of P-galactosidase; it can be used for screening, although autofluorescent compounds can induce a non desirable background leading to false positives.

Alternative substrates are available that become luminescent upon P-galactosidase cleavage, thereby eliminating background problems. An example of such a is substrate Galacton-Staro from Tropix. Typically about lpM substrate is added and the plates are incubated at room temperature for 60 minutes. Fluorescence (for FDG) is then measured at 530 nm. It is typically possible to detect as low as 100 cells per well.

As an alternative to the use of P-galactosidase, secreted alkaline phosphatase can be used as a reporter gene. The use of secreted alkaline phosphatase gives equivalent sensitivity to P galactosidase with the advantage that there is no need to lyse the cells. Fluorescent substrates for alkaline phosphatase are available commercially from Sigma Aldrich (Bornem, Belgium) or Molecular Probes (Eugene, OR, USA).

The test compound can be added at various stages of the above procedure. Generally, the compound is added on the plates onto which the yeast are plated.

However, the compound can also be added during the second incubation in order to overcome toxicity ptoblems. As a control, it is important to check whether the compound slows down the growth of the yeast. This can be done using turbidity measurements.

Example 6

Detection of in vivo protein-protein interactions usincr fluorescence energy transfer (FRET).

An in vivo FRET assay can be conveniently performed using two different mutants of GFP which absorb and emit light at different wavelengths and which have suitably overlapping emission/absorption spectra, such as EGFP (enhanced green fluorescent protein) and EBFP (enhanced blue fluorescent protein) When two such variant GFPs are brought into close proximity, within a few nanometer distance-, fluorescence energy transfer (FRET) can be detected.

Such transfer is characterized by a reduction of fluorescence intensity of the donor fluorophore (EBFP) is and re-emission of fluorescence at the acceptor fluorophore (EGFP) wavelengths. Therefore if each fluorophore is fused to a protein domain known to bind to the other the protein-protein interaction can be monitored in vivo using FRET.

In a typical example, the APC binding domain of UNC-5 cloned in fusion with EBFP, whereas APC is cloned in fusion with EGFP in expression vectors suitable for use in the chosen host cell line or organism. When both fusion proteins are expressed in a cell line or in C. elegans it is possible to monitor and quantify their in vivo interaction by irradiating the cells/worms with light at 488nm. When the donor and acceptor fluorophore are brought into close proximity by binding of the two fusion proteins fluorescent energy transfer results in a measurable decreased in fluorescence from the fluorescence donor at a wavelength within the emission spectrum of the donor. In simple terms, what is measured is a quenching phenomenon since light emitted by the donor fluorophore is trapped by the acceptor fluorophore.

NB- The experiment could also be performed by measuring fluorescence from the acceptor fluorophore but this is often less sensitive.

Plasmid vectors containing both EGFP and EBFP are commercially available from Clontech (Palo Alto, California, USA). Information on the use of these vectors is also supplied by the manufacturer.

Example 7 Genetic and complementation. screens in yeast.

UNC-5 expression in yeast cells results -in a lethal phenotype, mainly because of the expression of a death domain. This observation was most clearly seen in the experiments with C. elegans UNC-5. Accordingly, assays can be developed to screen for compounds, interacting proteins and suppressors which alter the activity of UNC-5, particularly the activity of the death domain of UNC-5. These assays are analogous to those described by Xu and Reed (Mol. Cell 1998, 1:33746).

(A) Compound screens.

Yeast cells are transfected with a plasmid encoding the C. elegans or human unc-5 (including the death domain), such as the vectors described in the yeast two hybrid experiments. The transfected yeast cells are then placed in the wells of micotiter plates, and are exposed to the compounds under test. Compounds which reduce or inhibit the lethal phenotype of the yeast cells transfected with unc-5 are scored as hits. Such compounds will typically suppress the unc-5 lethal phenotype by interacting with UNC-5 itself, or with UNC-5 interacting proteins, or with proteins in the UNC-5 pathway, or with proteins in parallel pathways. The selected compounds can be used in the development of pharmaceutical preparations.

(B) Suppressor screens.

Yeast cells are transfected with a plasmid encoding the C. elegans or human unc-S (including the death domain), such as the vectors described in the yeast two hybrid experiments. Furthermore, the yeast cells are transfected with a library expressing C. elegans or human cDNA, such as the libraries described in the yeast two hybrid experiments. The transfected yeast cells are placed in the wells of micotiter plates, and allowed to grow further. This allows selection cDNAs, and hence genes aind proteins, that reduce or inhibit the lethal phenotype of the yeast cells transfected with the death domain of unc-5. Such proteins will interact with UNC-5, or with UNC-S is interacting proteins, or with proteins in the UNC-5 pathway, or with proteins in parallel pathways to cause suppression of the unc-S lethal phenotype. The selected cDNAs genes and proteins can be used in the development of pharmaceutical preparations or in the development of assays to select for compounds that enhance their function or expression.

Example 8

2S Cloning of a C. elecTans gene startina f rom a C. elecTans insert.

If a fragment of a given gene or cDNA is known then further fragments of the corresponding full length gene and/or cDNA can be constructed can often be found using in silico techniques such as AceDB (see http:\\www.sanger. ac.uk), or searching of the EST database. The full cDNA can be cloned using standard technology such as 5'/31 RACE or SL1/2 RT-PCR on worm total RNA and colony hybridization. An analogous strategy is followed to clone a full length gene and/or cDNA for vertebrate and hence Human DNA.

Example 9 Cloning of C. elegans gene startincr from a human insert.

A full length C. elegans gene can be cloned starting from a human sequence. Using in silico techniques, a homologue or an EST can be found. Standard molecular biology techniques can then be used to clone the full length C. elegans gene. If no homologous sequence can be found by simple database searching, it may be necessary to perform species hopping. An analogous strategy is-followed to clone a full length gene and/or cDNA for vertebrate and hence Human DNA, starting from a C. elegans DNA sequence.

Table 1 pGAD424 + < + + full length unc-5 nd nd nd nd nd nd nd not (1006) blue UP + DD (1000) nd blue nd I nd nd nd blue nd auto-activation MPP (1001) nd nd nd nd nd nd nd nd MPP + ZO- I (1002) not blue nd nd nd nd nd nd nd MPP + ZO-1 +UP not blue not not nd not not not (1003) blue blue blue blue blue ZO-1 (1007) nd nd nd nd nd nd not nd blue UP (1004) nd nnd nd nd nd not nd nd blue ZO- I + UP (1005) not blue nd nd nd nd nd nd empty pAS2 not blue nd nd nd nd nd nd nd CIq un _t IMLO

Claims

Claims:

1. A protein comprising the sequence of amino acids set forth in Figure 3 or a sequence of amino acids which differs from that set forth in Figure 3 only in conservative amino acid changes.

2. A nucleic acid comprising a sequence of nucleotides which encodes the protein claimed in claim 1.

3. A nucleic acid comprising the sequence of nucleotides set forth in Figure 2 or a fragment thereof.

4. An expression vector comprising the nucleic acid of claim 2 or claim 3.

5. A host cell or organism transformed or transfected with the expression vector of claim 4.

6. An antibody which is capable of specifically binding to the protein claimed in claim 1 or an epitope thereof.

7. A protein comprising the sequence of amino acids set f orth in Figure 5 or a sequence of amino acids which differs from that set forth in Figure 5 only in conservative amino acid changes.

8. A nucleic acid comprising a sequence of nucleotides which encodes the protein claimed in claim 7.

9. A nucleic acid comprising the sequence of nucleotides set forth in Figure 4 or a fragment thereof.

10. An expression vector comprising the nucleic acid of claim 8 or claim 9.

11. A host cell or organism transformed or transfected with the expression vector of claim 10.

12. An antibody which is capable of specifically binding to the protein claimed in claim 7 or an epitope thereof. 10

13. A protein comprising the sequence. of amino acids set forth in Figure 7 or a sequence of amino acids which differs from that set forth in Figure 7 only in conservative amino acid changes. 15

14. A nucleic acid comprising a sequence of nucleotides which encodes the protein claimed in claim 13.

15. A nucleic acid comprising the sequence of nucleotides set forth in Figure 6 or a fragment thereof.

16. An expression vector comprising the nucleic acid of claim 13 or claim 14.

17. A host cell or organism transformed or transfected with the expression vector of claim 16.

18. An antibody which is capable of specifically binding to the protein claimed in claim 13 or an epitope thereof.

19. A method of identifying compounds which are capable of inhibiting or enhancing the binding of an UNC-5 protein to an interacting protein previously identified as binding to the said UNC-5 protein, which method comprises:

providing a host cell containing a DNA construct comprising a reporter gene operatively linked to a promoter regulated by a transcription factor having a DNA binding domain and an activating domain; expressing in said host cell a first hybrid DNA sequence encoding a first fusion protein comprising an UNC-5 protein or a fragment thereof fused in-frame to either the DNA binding domain or the activating domain of the said transcription factor; expressing in said host cell a second hybrid DNA sequence encoding a second fusion protein comprising an interacting protein or a fragment thereof fused in-frame to either the DNA binding domain or the activating domain of the said transcription factor, such that when the first fusion protein comprises the activation domain of the said transcription factor the second fusion protein comprises the DNA binding domain of the said transcription factor and when the first fusion protein comprises the DNA" binding domain of the transcription factor the second fusion 2S protein comprises the activation domain; contacting the host cell with a sample of the compound under test; and detecting any binding of the UNC-5 protein or fragment thereof to the interacting protein or fragment thereof by detecting the production of any reporter gene product in the said host cell.

20. A method of identifying compounds which are capable of inhibiting or enhancing the binding of an UNC-5 protein to an interacting protein previously identified as binding to the said UNC-5 protein, which method comprises:

providing a transgenic cell or organism expressing a first fusion protein comprising an UNC-5 protein or a fragment thereof fused in frame to a first genetically encoded fluorophore and a second fusion protein comprising an interacting protein or a fragment thereof fused in-frame to a second genetically encoded fluorophore, the first and second fluorophores being characterised in that the emission spectrum of one of the fluorophores overlaps with the absorption spectrum of the other fluorophore; measuring the amount of fluorescence emitted from the fluorophore having an emission spectrum which overlaps with the absorption spectrum of the other fluorophore; exposing the transgenic cell or organism to a compound under test; and detecting any change in the amount of fluorescence emitted fluorescence emitted from the fluorophore having an emission spectrum which overlaps with the absorption spectrum of the other fluorophore.

21. A method of identifying compounds which are capable of inhibiting or enhancing the binding of an UNC-5 protein to an interacting protein previously identified as binding to the said UNC-5 protein, which method comprises:

providing a first reaction component comprising a first protein linked to a solid support containing a scintillant. and a second reaction component comprising a second protein which has been radioactively labelled, wherein the first and second proteins are an UNC-5 protein or a fragment thereof and an interacting protein or a fragment thereof; bringing the first and second reaction components into contact in an aqueous solution in the presence of a compound under test; and detecting binding of the first protein to the second protein by detecting light emission from the scintillant.

22. A method of identifying compounds which are capable of inhibiting or enhancing the binding of an UNC-5 protein to an interacting protein previously identified as binding to the said UNC-5 protein, which method comprises:

coating the wells of a microtiter plate with UNC-5 protein or a fragment thereof; contacting the UNC-5 protein or fragment thereof with an aqueous solution comprising an interacting protein or a fragment thereof, said interacting protein being labelled with a tag which is directly or indirectly detectable, and a compound under test; washing to remove the compound under test and any unbound tagged interacting protein; and detecting complexes of UNC-5 or a fragment thereof bound to the interacting protein or'a fragment thereof by directly or indirectly detecting the presence of the tag.

23. A method of identifying compounds which are capable of inhibiting or enhancing the binding of an UNC-5 protein to an interacting protein previously identified as binding to the said UNC-5 protein, which method comprises:

exposing a cell or organism expressing UNC-5 and overexpressing nucleic acid encoding an interacting protein to the compound under test; and screening for reversion of the overexpression phenotype of the cell or organism to wild-type.

24. A method as claimed in claim 23 wherein the organism is a nematode worm.

25. A method as claimed in claim 24 wherein the nematode worm is C. elegans.

26. A method as claimed in claim 23 wherein the cell is a mammalian cell line.

27. A method as claimed in any one of claims 23 to 26 wherein the cell or organism further expresses a reporter gene encoding a reporter protein.

28. A method as claimed in claim 27 wherein the reporter protein is a fluorescent protein or a luminescent protein.

29. A method as claimed in any one of claims 19 to 28 wherein the UNC-5 protein is a C. elegans UNC-5 protein.

30. A method as claimed in any one of claims 19 to 28 wherein the UNC-5 protein is a human UNC-5 protein.

31. A method as claimed in claim 30 wherein the human UNC-5 protein is UNC-5C or a protein as claimed in any one of claims 1, 7, 13 or 71.

32. A method as claimed in any one of claims 29 to 31 wherein the interacting protein is a C. elegans UNC-5 protein or a fragment thereof.

33. A method as claimed in any one of claims 29 to 31 wherein the interacting protein is C. elegans UNC-40.

34. A method as claimed in any one of claims 29 to 31 wherein the interacting protein is human UNC-40.

35. A method as claimed in claim 34 wherein the UNC-40 protein comprises the sequence of amino acids set forth in Figure 78.

36. A method as claimed in any one of claims 29 to 31 wherein the interacting protein is a -C. elegans spectrin P- chain/fodrin protein.

37. A method as claimed in claim 36 wherein the spectrin P-chain/fodrin protein comprises the sequence of amino acids set forth in Figure 11.

38. A method as claimed in any one of claims 29 to 31 wherein the interacting protein is C. elegans APR-1.

39. A method as claimed in claim 38 wherein the C. elegans APR-l protein comprises the sequence of amino acids set forth in Figure 15. 25

40. A method as claimed in any one of claims 29 to 31 wherein the interacting protein is C. elegans UNC-14.

41. A method as claimed in claim 40 wherein the C. elegans UNC-14 protein comprises the sequence of amino acids set forth in Figure 19.

42. A method as claimed in any one of claims 29 to 31 wherein the interacting protein comprises the sequence of amino acids set forth in Figure 23.

43. A method as claimed in any one of claims 29 to 31 wherein the interacting protein comprises the sequence of amino acids set forth in Figure 27.

44. A method as claimed in any one of claims 29 to 31 wherein the interacting protein comprises the sequence of nucleotides set forth in Figure 31.

45. A method as claimed in any one of claims 29 to 31 wherein the interacting protein comprises the sequence of amino acids set forth in Figure. 35.

46. A method as claimed in any one of claims 29 to 31 wherein the interacting protein comprises the is sequence of amino acids set forth in Figure 39.

47. A method as claimed in any one of claims 29 to 31 wherein the interacting protein comprises the sequence of amino acids set forth in Figure 43.

48. A method as claimed in any one of claims 29 to 31 wherein the interacting protein comprises the sequence of amino acids set forth in Figure 45.

49. A method as claimed in any one of claims 29 to 31 wherein the interacting protein is a human UNC-5 protein.

50. A method as claimed in claim 49 wherein the human UNC-5 protein is UNC-5C or a protein as claimed in any one of claims 1, 7, 13 or 71.

51. A method as claimed in any one of claims 29 to 31 wherein the interacting protein is human i-beta 1,3-N-acetylaminyltransferase.

52. A method as claimed in claim 51 wherein the 73 - human i-beta-1, 3-N-acetylaminyltransf erase comprises the sequence of amino acids set forth in Figure 49.

53. A method as claimed in any one of claims 29 to 31 wherein the interacting protein comprises a protein encoded by the nucleic acid of claim 72 or claim 73.

54. A method as claimed in any one of claims 29 to 31 wherein the interacting protein comprises a protein encoded by the nucleic acid of claim 74 or claim 75.

55. A method as claimed in any one of claims 29 is to 31 wherein the interacting protein is human alpha-2 macroglobulin.

56. A method as claimed in claim 55 wherein the alpha-2 macroglobulin comprises the sequence of amino acids set forth in Figure 57.

57. A method as claimed in any one of claims 29 to 31 wherein the interacting protein comprises a protein encoded by the nucleic acid of claim 76 or claim 77.

58. A method as claimed in any one of claims 29 to 31 wherein the interacting protein comprises a protein encoded by the nucleic acid of claim 78 or claim 79.

59. A method of identifying compounds which reduce or inhibit the lethal phenotype associated with the expression of the UNC-5 death domain in yeast, which method comprises:

60. A method as claimed in claim 59 wherein the UNC-5 protein is a C. elegans UNC--5 protein.

61. A method as claimed in claim 59 wherein the UNC-5 protein is a human UNC-5 protein.

62. A method as claimed in claim 61 wherein the human UNC-5 protein is a protein as claimed in any one of claims 1, 7 or 13 or 71.

63. A method of identifying suppressers of the lethal phenotype associated with the expression of the UNC-5 death domain in yeast, which method comprises:

transfecting yeast cells containing an expression vector comprising nucleic acid encoding an UNC-5 protein or a fragment thereof comprising the death domain with a cDNA library cloned in a yeast expression vector; allowing the transfected yeast cells to grow for one or more cell divisions; and screening for reduction or inhibition of the lethal phenotype associated with the expression of the UNC-5 death domain in yeast.

64. A method as claimed in claim 63, which method further comprises the steps of:

identifying a transfected yeast cell exhibiting a reduction or inhibition of the - lethal phenotype associated with the expression of the UNC-5 death domain in yeast; and isolating the cDNA clone (s) present in the transfected yeast cell which is/are responsible for conferring reduction or inhibition of the lethal phenotype.

65. A method as claimed in claim 63 or claim 64 wherein the UNC-5 protein is a C. elegans UNC-5 protein.

66. A method as claimed in claim 63 or claim 64 wherein the UNC-5 protein is a human UNC-5 protein.

67. A method as claimed in claim 66 wherein the human UNC-5 protein is a protein as claimed in any one of claims 1, 7, 13 or 71.

68. A method as claimed in claim 65 wherein the cDNA library is a C. elegans cDNA library.

69. A method as claimed in claim 66 or claim 67 wherein the cDNA library is a human cDNA library.

70. A nucleic acid comprising the sequence of nucleotides set forth in Figure 8.

71. A protein comprising a sequence of amino acids encoded by the nucleic acid molecule of claim 8.

72. A nucleic acid comprising the sequence of nucleotides set forth in Figure 55A and a sequence of nucleotides complementary to the sequence of nucleotides set forth in Figure 55B.

73. A nucleic acid as claimed in claim 72 which is obtainable by restriction enzyme digestion of the plasmid pYMP17 with the restriction enzymes EcoRI and XhoI.

74. A nucleic acid comprising the sequence of nucleotides set forth in Figure 53A and a sequence of nucleotides complementary to the sequence of nucleotides set forth in Figure 53B.

75. A nucleic acid as claimed in claim 74 which is obtainable by restriction enzyme digestion of the plasmid pYMP6 with the restriction enzymes EcoRI and XhoI.

76. A nucleic acid comprising the sequence of nucleotides set forth in Figure 59A and a sequence of nucleotides complementary to the sequence of nucleotides set forth in Figure 59B.

77. A nucleic acid as claimed in claim 76 which is obtainable by restriction enzyme digestion of the plasmid pYMP11 with the restriction enzymes EcoRI and XhoI.

78. A nucleic acid comprising the sequence of nucleotides set forth in Figure 60A and a sequence of nucleotides complementary to the sequence of nucleotides set forth in Figure 60B.

79. A nucleic acid as claimed in claim 78 which is obtainable by restriction enzyme digestion of the plasmid pYMP12 with the restriction enzymes EcoRI and XhoI.

80. A nucleic acid probe which is capable of hybridizing to the nucleic acid of claim 70 under conditions of high stringency.

81. An oligonucleotide comprising a sequence of 10 or more consecutive nucleotides of the sequence of nucleotides set forth in Figure 8.

82. An antisense nucleic acid which is capable of hybridizing to the sequence of nucleotides set forth in Figure 8 under conditions of high stringency.

83. An expression vector comprising the nucleic acid of claim 70.

84. A host cell or organism transformed or transfected with the expression vector of claim 83.

85. An antibody which is capable of specifically binding to the protein claimed in claim 71.