GB2337992A

GB2337992A - Fluorophore/quencher labelled oligonucleotides

Info

Publication number: GB2337992A
Application number: GB9904241A
Authority: GB
Inventors: Neil James Gibson; Thomas Brown
Original assignee: Zeneca Ltd
Current assignee: Syngenta Ltd
Priority date: 1998-03-03
Filing date: 1999-02-25
Publication date: 1999-12-08
Anticipated expiration: 2019-02-25
Also published as: WO1999045017A1; GB9904241D0; GB9804355D0; GB2337992B

Abstract

An oligonucleotide, which may particularly be of "molecular beacons" type, has a methyl red acceptor attached to its 3' terminus (see formula (XV) below). A fluorophore may be attached to the 5' terminus so that the oligo may be used as an energy transfer reagent for DNA analysis. When used as a "molecular beacons" probe, the oligo is conveniently a DNA probe but may also comprise one or more 2-methyl RNA bases. The labelled oligo may be synthesised via a methyl red-CPG (controlled pore glass) intermediate and this as well as two other DMTO-protected intermediates are also claimed (formulae (XII), (XIII) and (XIV) - not shown).

Description

? '?__A t --- MIETHOD - 2337992 The present invention relates to improved

methods for the labelling of oligonucleotides.

in particular it relates to methyl red labelled oligonucleotides and to methyl red - controlled pore glass substrates for use in the labelling of oligonucleotides.

A variety of prior art methods are available for labelling ofigonucleotides. These include enzymatic methods wherein for example a terminal transferase is used to add a modified dNTP to the 3' terminus of an oligonucleotide. Such modified dNTP is then used to attach a label.

Alternatively a terminal nucleotide of an oligonucleotide is chemically modified to provide a functional moiety such as an amino or sulphydryl group for reaction with a group on the label to be attached.

There are many techniques for detecting specific nucleic acid sequences by the hybridisation of a labelled oligonucleotide probe of complementary sequence to the target sequence and then detecting the probe label. Many assays are in non- homogeneous format meaning that excess or unbound probe must be removed from the assay before the bound probe can be detected and quantfied. Such techniques include Southern blotting and the many enzyme linked immunosorbent assay (ELISA) based methods., The label can be a radionucleid, a hapten (e.g. digoxygenin,.dinitroi)henvl), affluhrophore (e.g. fluorescein, europium cryptate) or an enzyme (e.g. alkaline phosphatase, horseradish peroxidase).

More recently homogenous (no wash) assays have been developed for PCR product detection which are advantageous because they tend to be simpler to perform than non homogeneous assays, lend themselves to automation, remove the need to run gels and reduce the risk of cross-over contamination. Examples of homogeneous assays include fluorescence polarisation (EP-BI-0382433), intercalative fluorescence, TaqMan (US-A5487972 & US-A 52 10015) and Molecular Beacons (WO-95/13399). In the last two methods, donor and acceptor fluorophore/quencher species need to be attached to oligonucleotides. The need still exists for flu-ther labelled probes of these types and simpler ways of making thes,., ".', -, A number of fluorophore/quencher pairs are detailed m theji(cit= (Glazer et al,, Current Opinion in Biotechnology, 1997, 8, 94-102) and in catalogues siic as those from Molecular 1 Probes, Glen, and Applied Biosystems (ABI). For example, fluorescein derivatives such as 5carboxy fluorescein (FAM), tetrachlorofluorescein (TET) and hexachlorofluorescein (HEX) may be used in combination with tetramethylrhodamine (TAMRA).

We have now unexpectedly discovered that methyl red is a useful quencher in 5 fluorophore/quencher dual-labelled oligonucleotides.

Therefore in a first aspect of the invention we provide an energy transfer reagent for DNA analysis, the reagent comprising a fluorophore and methyl red acceptor.

The fluorophore donor is conveniently a fluorescein derivative, such as FAIA, HEX or TET.

The energy transfer reagent is preferably an olignucleotide, for example a probe or primer.

Oligonucleotides include synthetic single strands of nucleic acid and are of any convenient length for its intended purpose, for example up to about 200 or about 100 nucleotides in length, or such as up to 10, 20, 30, 40, 50 or 60 nucleotides in length. For probes, such as TaqMan probes, preferred oligonucleotides comprise about 20-30 nucleotides, such as about 20-25 nucleotides.

For primers, these preferably comprise about 25-35 nucleotides, such as about 30 nucleotides.

For Molecular Beacons probes (discussed in more detail hereinafter), these preferably comprise about 35-70 nucleotides, such as about 40-60 nucleotides. Convenient methods for oligonucleotide synthesis, such as those using an automated DNA synthesiser are well known in the art (Randolph et 9 Nucleic Acids Research, 1997, 25 14).

The fluorophore and methyl red quencher are preferably attached to the 5' and 3' terminii of the oligonucleotide probe respectively. Alternative attachment points may be envisaged, for example when devising a TaqMan probe but, in general and certainly for Molecular Beacons probes the 5' and 3' termini are the preferred points of attachment (Tyagi et al, Nature Biotechnology, 1996,14,303-308).

In a further aspect of the invention we provide, as a novel intermediate, an oligonucleotide comprising a methyl red quencher attached at the 3' terminus. The oligonucleotide is as defined earlier above. The oligonucleotide is preferably of the formula XV set out hereinafter and derivatives thereof C We prepared Molecular Beacons oligonucleotide probes comprising a fluorophore donor and a methyl red quencher. These probes perform well and form a preferred aspect of the present Invention.

In addition we have found that methyl red may be conveniently attached to an oligonucleotide via a methyl red controlled pore glass (CPG) resin intermediate. CPG is used in oligonucleotide synthesis, however we have capit on its usefulness in a simple and elegant method. In a flu-ther aspect of the invention we provide methyl red - controlled pore glass of the formula)X wherein CPG represents controlled pore glass, n is an integer between 3 and 8, and DMTO represents a protecting group such as a dimethoxytrityl group.

H 1 1 (CH2W' N DMTO"-' n YP 0 N 0 11 N 0 0 H-N CPG 01 N (X11) The intermediate products H 1 1 DMTO-' (CH2),n -1r-P 0 N OH 11 N (Yill) 1 70317 /I- and H 1 (CH,)n-' N YP DWO 0 N 0 11 N 0 0 01 HO (XIV) wherein DWO is as defined above and n is an integer between 3 and 8 are novel and each represents a flirther aspect of the present invention.

In any of the above aspects of the invention, n is conveniently 3, 4, 5 or 6, preferably 3 or 4, more preferably 4.

In a ftuther aspect of the invention we provide a method for preparing a methyl red labelled oligonucleotide of the formula XV (as set out below), which method comprises cleaving a compound of the Formula X111 (as set out below) from the controlled pore glass. CPG represents controlled pore glass, n is an integer between 3 and 8, and DWO represents a protecting group such as a dimethoxytrityl group.

H 1 DMTO-"-' (CH2) N -1r-P 0 N 0 11 N 0 0 H-N CPG 61 (X11) Cleavage is preferably hydrolytic cleavage, for example using base.

Oligonudeatide,,, 0",-r, (CH2)-" N OH 11 N (xv) N (71 ne Molecular Beacons probes of this invention are conveniently DNA probes.

Alternatively they may comprise one or more 2-methyl RNA bases, indeed the whole probe may comprise 2-methyl RNA, all as claimed in our UK patent application no. 9715522.0 entitled "Assays", filed 20 July 1997, the contents of which are incorporated herein by reference.

The invention will now be illustrated but not limited by reference to the following Figures and Examples wherein:

Figure 1 shows Molecular Beacons probes comprising probe sequence, stem loop and linker sequences with fluorophore (F) and quencher (Q) attached, and indicates the fluorophore/quencher interaction. In A, the Beacon is not bound to a target sequence. The fluorophore and Beacon are in close proximity, the fluorphore is quenched by the Beacon. In B, the Beacon is bound to a target sequence. The fluorophore and Beacon are separated, the fluorophore is less efficiently quenchedL Figure 2 shows in outline how an oligonucleotide, methyl red and controlled pore glass are linked and how the methyl red labelled ofigonucleotide is cleaved from the controlled pore glass.

Figure 3 shows meltcurves of a Molecular Beacon in the absence and the presence of a matched and partially mismatched template. The Beacon and a 20-fold excess of a target oligonucleotide sequence were mixed in an appropriate buffer and placed in a well of a 96 well plate, then heated to 94'C in an Applied Biosystems 7700 cycling fluorimeter. The target may be entirely complementary to the Beacon, complementary to the loop portion of the Beacon, partially complementary to the loop portion (ie. contain mismatches) or be non-complementary.

At 94 OC the Beacon is dissociated from its target and is believed to have adopted a random coil conformation with the Beacon stretched out and yielding a relatively high fluorescence (see value at 90 OC on graph).

As the solution cools, the Beacon tends to close into its hairpin conformation and the fluorescence drops (see no-template curve on the chart). If however complementary target is present, at a certain temperature the Beacon begins to hybridise to the target, stretching it out again and the fluorescence rises again. The greater the complementarity between the Beacon and the target, the higher the temperature at which the Beacon binds. Eventually, as the solution 1 1. 1 continues cooling, the Beacon is thermodynamically more stable in its closed hairpin conformation than bound to the target and the fluorescence begins to drop again. Matched template: TCTCAAAGCiGCTTCTGATGTCCTACAMGAATCTAATW 5 Mismatched template: TCTCAAAGGGCTTCTGAMACTACAMGAATCTAATGG Beacon: GCGAGCGATrCAAATGTAGGACATCAGAAGCCCTGCTCGCT Thio linkage, underlined represents complementarity between templates and beacon.

Figure 4 shows the use of a methyl red labelled Beacon to detect the build up of a PCR product in real time during a PCR amplification. Full details are given in Example 2. The X-plot is PCR cycle number, the Y-plot is ARn being the ratio of fluorescence versus wavelength for the no template control and genomic (POS) template samples. In the Examples the following abbreviations are used:

DCM Dichloromethane HOBT DCC DMAP DEPEA EDC DMT TMSCI DNE DMTO Hydroxybenzotriazole dicyclohexylcarbde Dimethylarninopyridine diisopropylethylamine ethylene dichloride OR ethylcarbodiimide [or 1-(3dimethylaminopropyl)3-ethylcarbde hydrochloride] need to see context dimethoxytrityl trimethyl silyl chloride dimethylfarmamide dimethoxytdtyloxy 1 1 1 t (7 Example 1

Synthesis of Methyl Red CPG Resin HO" OH OH OH 0 (X) (M 1,2-Isopropylidenylhexanc-1,2,6-trioI fflQ 1,2,6-Trihydroxyhexane (100g, 746.3mmol) (compound X) was dissolved in dry acetone (800m.1), conc. HQ (1 7nil) was then added followed by anhydrous sodium sulphate (430g, 3613mmol) and the reaction was stirred overnight. Basic lead carbonate (280g, 360mmol) and sodium carbonate (4.16g, 50mmol) were added to the mixture which was again stirred overnight.

This was filtered, evaporated to dryness and sodium carbonate (4g, 48. 2mmol) was added to the residue before being distilled under reduced pressur 1 e (bp=1020C at 0. 5mmHg) to give the desired compound (IX) (93.06, 72%) as a colourless oil. Rf=0. 15 (25% EtOAc/toluene, anisaldehyde).

v.jcm'(nujol), 3420 (broad OHstr), 2995-2886 (aliphatic CHstr);8'H(300NU1z, CDC13) 1.33 (s, 3H, CH3 of isopropylidene), 1.39 (s, 3H, CH3 of isopropylidene), 1.40-1. 90 (m, 6H, CH2CH, CH2, CH2CH2OH), 2.03 (s, 114, OR), 3.50 (t, IR CH, J=6.914z), 3.62 (t, 2R CH20H, J=6.3Ht), 3.98 4. 10 (m, 2H, CH20); 813c (75.5Nfi-Iz, CDC13) 22.18 (CH2CH2OH), 25.86, 27. 07 (CH3 of isopropylidene), 32.73 (CH2),33.39 (CH2CH), 62.70 (CH2011), 69.57 (CH20), 76.16 (CH), 108.85 (CMe2); MS (ES) m/zlamti, 197 (MNa), 175 (MID, 157 (Nr-OH), 128 (MH-OH-2Me); Accurate FAB found 175.1334197 C9H1903 requires 175.133420.

1 1 1 t f OH 0 'I 0 (M 0 0 'I 0 (VIM 6-p-Toluenesulphonyl-1,2-isopropylidenylhexane-1,2,6-trioI The alcohol, compound IX (50.18g, 288mmol) was dissolved in freshly distilled pyridine (100ml) and cooled in a cold water bath and a solution of tosyl chloride (55.65g, 292mmol) in pyridine (1 50nil) was added dropwise. The reaction was allowed to warm to room temperature and stirring was continued for 1.5 hours after which time TLC showed the reaction to be near completion but some starting material still remained. Stirring was continued for a further 1 hour after which time TLC showed that no change had taken place. The mixture was filtered, evaporated to dryness and the residue dissolved in DCM. This was then washed (NaHC03), dried (Na2SOJ and evaporated to dryness to give compound VIU (99.8 1 g) as a pale yellow oil which was used immediately in the next reaction without purification. Rf==0.56 (25% EtOAc/toluene, molybdate). V..ICM' (nujol) 1214,1057 (S=Ostr)8'H(200NU-Iz, WC13) 1.30 (s, 3H, CH3of isopropylidene), 1.32 (s, 3H, CH3of isopropylidene), 1.35-1.75 (m, 6R CH2CR CH2, CH2CH20Ts), 2.45 (s, 3H, CH3 of OTs), 3.45-3.60 (m, I H, CB), 3.96-4.15 (m, 4H, CH20, CH2OTs), 7.32 (d, 2R CH of OTs, J=SHz), 7.75 (d, 2H, CH of OTs, J=8Hz); 813c (75.5MHz, C13C13) 21.93 (CH3of OTs), 23.33 (CH2CH2OTS), 25.86, 27. 10 (CH3of isopropylidene), 32.65 (CH2), 44.92 (CH2CH),69.47 (CH.OTs), 69.54 (CH20),75.96 (CH), 108.91 (CMe, 128.04,128.38 (C3of Ts), 129.18, 130.0 (C2of Ts), 138.00 (C4of Ts), 144.87 (C, of Ts); MS (ES') m/zlamu, 351 (MNa), 329 (NM, 271 (W-Me-CMe2); Accurate FAB found 328.134M60C,6H24SO, requires 328. 134449.

1 0 1 0---; 0 'I 0 1 G- (VIM 0 t- 0 n 0 I"j 0 1,2-Isopropylidenyl-6-phthalimido-1,2-dihydroxyhexane (VII) Potassium phthalimide (59.23g, 320mmol) was added to a solution of the tosylate, coompound VIII (95.5g, 29 1 mmol) in DW (40Onil). The reaction mixture was then heated at 750C with stirring for 4 hours after which time TLC showed the reaction to be complete. The mixture was then cooled overnight, evaporated to dryness, and co-evaporated with toluene. The residue was then separated between DCM and saturated Wk4 solution, dried (Na2S04)and evaporated to dryness. The residual oil was purified by column chromatography on silica gel eluting with hexane/ethyl acetate (L 1) to give compound VH (67.5 1 g, 77% overall) as a waxy white solid.

Rf=0. 5 5, (EtOAclhexane 9: 1, molybdate); vlcn:f '(nujol), 1717, 1679 (sym & asym C=Ostr); 8 1 (300MHz, WC13) 1.32 (s, 3H, CH3of isopropylidene), 1.39 (s, 3H, CH3of isopropylidene), 1.40 1.82 (m, 6H, CH2CH, CH2, CH2CH2Pht), 3.50 (ni 1H, CR), 3.70 (t, 2H, CH2Pht), 4.05 (m, 2H, CH20), 7.70 (m, 2H, CH of Pht), 7.85 (m, 2K CH of Pht); 813c (75.5MHZ, CDC13)23.31 (CH2CH2pht), 25.84, 27.08 (CH3of isopropylidene), 32.63 (CH2), 37.91 (CH2Pht), 44.90 (CH2CH), 69.52 (CH20), 75.94 (CH), 108.89 (CMe2),123.32 (C3, C4of Pht), 132.27 (Cl, C. of Pht), 134.04 (C2, C. of Pht), 168.54 (0-0 of Pht); M.S. (ES) m/z/amu, 326 (MNa), 304 (M"; M.S. (FAB) m/7Jamu 288(Nr-CH3), 272 (MS-2xCH3), 246 (MH-Oisopropylidene), 228 (MS 2xO-isopropylidene), 160 (Pht CH2), 148 (PhthalimideH).

1 c 0 N P /> 0 0 HO Q OH 0 (VII) (V0 6-Phthafimidohexanc-1,2-diol (VI) Compound V11 (65.85g, 217mmol) was dissolved in distilled THF (300m1) and concentrated HG (20m1) was added. The mixture was Stirred at room temperature for 4 hours after which time a white solid had precipitated out of solution and TLC indicated that the reaction was near completion. More HCl (1 Onil) was added and stirring was continued for a flu-ther 2 hours after which time TLC showed the reaction to be complete. The mixture was evaporated to dryness and co- evaporated with DCM and then dried in a vacuum desiccator overp2ofor 8 hours to gave compound VI (60.62g) as a white solid which was used in the next reaction without purification.

Rf=0.27, (EtOAclhex 9: 1, molybdate); v.,,/cm'(nujol), 1715, 1666 (sym & asym. C=Ostr);81H (300MHz, d.-DMSO) 1.10-1.85 (m, 7H, OH, CH2CH, CH2, CH2CH2Pht), 2. 10 (s, 1 H, OH), 3.25 (m, 2R CH2Pht) 3.36 (m, 1H, CR), 3.55 (m, 2H, CH20), 7.75 (m, 4H, CH of Pht); 8 1 3c (75.5MHz, d6-DMSO) 23.11 (CH2CH2Pht), 28.26 (CH2CH), 33.01 (CH2) 37.57 (CH2Pht), 66.00 (CH20),70.96 (Cn, 123.03 (C3, C4of Pht), 131.63 (C,, C6of Pht), 134. 41 (C2, C, of Pht), 167.98 (C=0 of Pht); M.S. (ES) m/zlamu, 286 (M+Na), 263 (M); Accurate FAB found 264.1235833C,4H,7NO4requires 264.123584.

O. -0 OH 6 (V1) 0 - N Q DWO OH 0 1) 1 d n 1-(4,41-Dimethoxytrityl)-6-phthalimidobexane-1,2-dioI (V) Compound VI (59. 37g, 226mmol) and DMAP (1.28g, 10.5mmol) were co-evaporated three times with fi-eshly distilled dry pyridine and then dissolved in pyridine (1 50m1). Dimethoxytrityl chloride (76.7g, 226.6mmol) was then added (a. small portion was added first, (-5g) and stirred for - 20 minutes and then the rest was added) followed by a finther volume of pyridine (50m1). The reaction was then stirred under argon at room temperature for 4 hours. After this time TLC showed the reaction to be complete. The mixture was filtered, reduced in volume and the residue was dissolved in DCM. The solution was washed (saturated sodium bicarbonate solution, then water), dried (Na2S04) and evaporated to dryness. The residue was co-evaporated several times with toluene and the residue was purified by column chromatography on pre- equilibrated silica gel (EtOAc/hexane/Et3N 1:4A05) eluting with ROAclhexane (M). This gave the product, compound V (86g, 68%) as a white foam after drying in a vacuum desiccator overp2o,; Rf=0.46 (hexane/ethyl acetate 1: 1, H2SO4/ROH), v..lcnfl(nujol) 3461 (br OHstr), 1710, 1607 (sym & asym C=Ostr); 81H (300MHz, WC13) 1.30-1.80 (n:l, 6R CH2CH, CH2, CH2CH2Pht), 2.25-2.55 (bs, I H, OR), 3.00-3.25 (m, I H, CR), 3.60-4.00 (s+m, I OH, CH3of DW, CH2ODMT, CH2Pht), 6.85 (d, 4H, CH of ArOMe), 7.15-7.50 (m, 9R CH of ArOMe, CH of Ph), 7.55- 7.85 (M, 2H, CH of Pht), 7.80-7.95 (m, 2H, CH of Pht); 813c (75.5MHz, WC13) 23.00 (CH2CH2Pht), 28.71 (CH2), 33.01 (CH2CH), 37.99 (CH2Pht), 55.37 (CH30Ar), 67.70 (CH2ODMT), 70.89 (CH), 86.22 (C(AroMe)2ph), 113.29 (C2of ArOMe), 123.33 (C3, C4of Pht), 126.96 (C4of Ph), 127.99 (C2 of Ph), 128.29 (C3of ArOMe), 130.19 (C3of Ph), 132.29 (Cl, C. of Pht), 134. 10 (C2, C, of Pht), 136.20 (C, of Ph), 145.00 (C, of ArOMe), 158.62 (C4 of ArOMe), 168.58 (C=0 of Pht); M.S.

(EI') m/i/amu 565 (W), 303 (DIM, 160 (PhtCH2).

DMTO--- OH 0 - N P 0 (V) DMTO''- NH2 OH OV) i 1 1-(4,41-Dimethoxytrityl)-&aminohexan-1,2-dioI (M Compound V (2.09g, 3. 7mmol) was co-evaporated several times with THF and dissolved in THF (20nA). Hydrazine monohydrate (0.41 g, 0.4mi, 8.3mmol) was added dropwise to the stirring solution and the reaction was stirred at room temperature under argon overnight The mixture was then filtered and evaporated to dryness and the residue was dissolved in DCK washed (saturated sodium bicarbonate solution), dried (N%SO.) and evaporated to dryness to give a white foam which was dried in a vacuum desiccator overp205 togive the product, compound W(L6g, 990/o). This was then used directly in the next reaction without farther purification. Rf=0. 13, TrOEI/ROAc/NE13(.q) 1:9: 1, anisaldehyde or ninhydrin.

DMTO---- "2 OH H 1 1 DMTO"-T--- N --(P OH 0 N 11 N 1 OV) (111) 0 N 1-(4,4'-Dimethoxytrityl)-6-(2"-(4"'-N,N-dimethylaminophenylazo)ben=mido)h exane-1,2diol (III) Compound IV (1.59g, 3.66mmol) was coevaporated three times with freshly distilled DCM and then dissolved in DCM (9ml). Anhydrous triethylamine (1 ml) was then added followed by methyl red (1.03g, 4.13mmol) 1-Hydroxybenzotdazole (0.77g, 5.7mmol) was then added followed by dicyclohexylearbodiimide (1.1 l g, 5Ammol) in DCM (I nil). The reaction was stirred under argon for three hours after which time TLC showed the reaction to be complete. The mixture was filtered, diluted with DCM, washed (sat.NaHC03(.)., 2M NaOH(.,,), dried (Na2SO,) and evaporated to dryness. The residual foam was purified by column chromatography on preequilibrated silica gel (DCM/Et3N) eluting with DCNI/ROAc 9:1 to give compound Ill (1 -12g, 45%) as a red foam. Rfdlil=0. 75, Rfm.,hRd=0.64, R:o,=baseline, EtOAc, Rfdlll=0643 1 r 1 I- 1 Rfm.,,,=0.55, Rf., w=baseline, DCM/ROAc, 1: 1, Rfe =0.86, Rfmw =b e, Rpd pd 111. aselin w=0.14, TrOH/WAc/N113(., L9: 1, compound Ill ran as an orange spot methyl red ran as a red spot Anisaldehyde or ninhydrin was used to detect compound IV. 81 H (300MHZ, WC13M95- 104 (m, 8H, CH2CR CH2CH2CH, CH2CH2NHCO, CH2NE1CO), 2.35 (bd, I H, OR), 3. 0 (s+m, 711, CH3of NMe, CB), 3.4 (m, 2H, CH2OWT), 3.7 (s, 611, CH3of DMI), 63-6.8 (2d, 6R CH of ArOMe, H3_), 7.05-7.4 (ni, 11 R CH of ArOMe, CH of Ph, H3-, H4), 7.65-7.75 (d+m, 3H, H2-, H5.), 8.3 (m, 1 H, H2), 9.1 (bt, 1 H, NB); 813c (75.5MHz, WC13) 23.41 (CH2CH2NHCO), 29.89 (CH2CH2CH), 33.23 (CH2CH), 34.13 (CH2NHCO), 40.42 (N(CH3)2), 55.37 (CH3of DMT), 67.71 (CH2ODMT), 70. 92 (CH), 86.22 (C(ArOMe)2Ph), 111.75 (C3_), 113.27 (C2of ArOMe), 116.07 10 (C5), 125.86 (Cl.), 126.97 (C2_), 127.99 (C2of Ph), 128.26 (C3of ArOMe), 129.67 (C2.),130.17 (C3of Ph), 131.53 (C3.), 131.70 (C4.), 136.15 (C, of Ph), 143.54 (C,-), 144.99 (C, of ArOMe), 153.24 (C4_), 158.62 (C4of ArOMe), 166.30 (C=O); M.S. (ES m/zlamu 709 (MNa), 687 (NM, 303 (DMT'); Accurate FAB found M3365908C42H4,N4NaO, requires 709. 336590.

H_1rp 1 DMTO,,^N OH H 1 DWO N "P 0 0 0 N 11 N - 1 0 / N \ (111) 0 HO 0 N 11 N 01 1-(4,4'-Dimethoxytrityl)-2-suceinyl-6-(2"-(4"'-NV-ethylaminophenylazo)benzamido)hexanc-1,2-dio1 (11) Compound Ill (1.09g, 1.56mmol) was co-evaporated three times with anhydrous pyridine and then dissolved in pyridine (5ml). DMAP (5Orng, 0.4 1 mmol) was then added followed by succinic anhydride (0.46g, 4.6mmol). The on was then under argon overnight at room temperature. The mixture was separated between DCM and sat KCk.), dried (Na2SO4) and evaporated to dryness. The residue was purified by column chromatography on pre-equilibrated silica gel (DCM/NEt3) eluting with DCM/Me01-1 9: 1. This gave compound II (0.68g, 57%) as an 1 c orange/red foam.8'H(300MHz, MC13) 1.10-1.35 (t+m, 13H, CH2CH2CH, CH2CH2NH, CH3 of NEt3, J=7.9Hz), 1.40-1.7 (m, 4H, CH2CH, CH2CH2NW0), 23-2.7 (M, 4H, CH2C02 jJ, CH2C02CH), 2.9 (q, 6H, CH2of NEt3, J=7.9Hz), 3.0 (s+m, 7R CH3of NMe, CH), 3.35 (n3,21j, CH2ODMT), 3.7 (s, 6H, CH3of DMI), 5.0 (bt, 1H, NH of hNEt3), 6.65-6.75 (rn, 6H, CHof ArOMe, H3_), 7.05-7.45 (m, 11 H, CH of ArOMe, CH of Ph, H,, H3.), 7.7 (m, 311, H2-, Hr), 8.25 (m, 1H, H2), 9.05 (bt, 1H, NB); d13c (75.5MHz, CDC10.76 (CH3 ofNEt3),22. 93 (CH2CH2NHCO), 29.74 (CH2CH2CH), 30.81 (CH2CH) 31.25 (CH2NHCO), 40.16 (CH2C02H, CH2C02CH), 40.41 (N(CH3)2), 45.26 (CH2of NEt3), 55.34 (CH3of DMI), 64.78 (CH2ODMT), 72.80 (CH), 85.84 (C(ArOMePh), 111.82 (C3_), 113.20 (C2of ArOMe) 116.07 (Cr), 125.86 (C,.), 126.82 (C2_), 127.91 (C2of Ph), 128.26 (C3of AroMe), 129.59 (Cr), 130.14 (C3of Ph), 131.48 (C3.), 131.72 (C,.), 136.21 (C, of Ph), 143.45 (C,-), 145.02 (C, of ArOMe), 153.32 (C4_), 158.57 (C. of ArOMe), 166.39 (NHC=O), 173.09 (C02CH), 177.06WO2H); M.S. (ES) m/zlamu 809 (M-Na), 787 (M-H), 507 (a-DMT), 463 (M'ENa-DMT-NMe2), 303 (DMT).

Hyp DWO 0 0 0 H 0 N 11 N 01 N DMTO"'-r-'- N 0 N 11 0 1 0 0 H-N \ CPG (1) N 01 N 1-0-(4,4'-Dimethoxytrityl)-6-(2"-(41"-NV-dimethlaminophenylazo) hexyl-2-0- suceinyl CPG resin (I). All glassware was intially soaked in 5% TMSCI0CM solution for --k hour and then rinsed with 20 acetone, water and finally acetone. The resin (2.01 g) was washed with a solution of 1 % diisopropylethylamine in DCM and then dried (in a sintered fi=el at the water purnp) to liberate the free amine.

1 1 1 As- Compound III (0.404g, 0.5 1 mmol) was dissolved in the minimum of 1 % diisopropylethylamine in DMF solution and dimethylaminopropyl-3ethylurbde hydrochloride (0.054g, 0.26mmol) was added. The resin (2g) was added to the solution and enough 1 % diisopropylethylamine in DW solution was added to cover the solid so that it could 5 be shaken gently intermittently for 2 hours. After this time the resin filtered, washed with 1 % diisopropylethylamine in DCM solution and dried in the sinter ftmel. More Compound IH (0.47g, 0.598mmol) was dissolved in the minimurn of 1% DIPEA in DW and EDC (0.053g, 0.28mmol) was added. The partially functionalised resin was then added and reaction shaken as before for a flu-ther 2 hours. A sample of the resin was removed, filtered and washed (1% DIPEA/DCM) and a sample (9.9mg) of this was dissolved in HCI/EtOH (12 v:v) solution to a volume of 25mI and shaken for -5 minutes. The absorbance of ln-d of the orange solution was measured at 495run and the loading was calculated as shown:absorbance for I ml = 0.7549 absorbance for 25mI = 0.7549 x 25ral = 18.8725 1 pmol of DMT= 71.7 abs for 25mI at 495mn 18.8725 71.7 = 0.263pmol for 0.0099g of resin loading 0.263 10.0099 = 27pmolg of DMI' The resin was filtered and washed with 1% diisopropylethylamine in DCM solution three times. This was then soaked in cap A/cap B (L1) for 1 hour, then washed with 1% diisopropylethylarnine in DCM solution and finally ether. The resin was dried to give Compound 1 (1.85g). The resin was then tested for DMT' loading as before. Weight of sample = 6. Img absorbance for lmI = 0.4787 loading = 27pmolg-' of DMT' This was then used in 0.2pmol scale probe synthesis with each column containing - 15mg of resin.

k 1 H H 1 1 _Irp WTO N -1rp Oligonudeotide".,,,,N 0 0 N OH 0 N 11 11 0 N N 0 H-N \ 0) CPG 01 / N \ (xl) 01 / N \ Example 2

Use of Mtthyl red - controlled Rgre glass to label Molecular Beacons oligonucleotide probes lle Molecular Beacons technique uses oligonucleotide probes with two labels and three sequence domains (see Figure I). Reading from the 5' end, the first domain is a series of nucleotides non-complementary to the DNA sequence to be detected but capable of base pairing with a complementary nueleotide sequence at the probe's 3' end in order to form a stem loop. The 5' end of the probe is labelled with one of the components of a quencher- fluorophore, pair. 7he second domain is an oligonucleotide sequence complementary to the DNA sequence to be detected and capable of hybridising to this target to form a double helix. The third domain is a series of nucleotides non-complementary to the DNA sequence to be detected but capable of base pairing with the complementary nucleotides at the probe's 5' end in order to form the stem loop.

The 3' end of the probe is labelled with the second of the components of the quencherfluorophore, pair.

In the absence of the nucleic acid target for the beacon it forms a stem loop structure which enforces the close spatial proximity of the two components of the quencher-fluorophore pair so that the fluorescence of the fluorophore is substantially quenched. In the presence of the nucleic acid target the complementary region of the beacon binds and enforces the separation of the two components of the quencher-fluorophore pair so that the fluorescence of the fluorophore is increased (see Figure 1). Detection of the increase -in fluorescence permits the inference that the target nucleic acid sequence is present in solution which has led to probe hybridisation. This j t C hybridisation can be monitored during amplification of the appropriate target sequence by the PCR by detecting the increase in fluorescence. It therefore forms a basis for real-time, sequence specific detection of PCR amplification.

The preparation of a Molecular Beacon requires that an oligonucleotide sequence be labelled at both the Yand Yterminal residues with dye molecules, one of which is a fluorophore and second of which is an efficient quencher of the fluorophore.

Probe purity is an important issue. If the quencher is not added to 100% of the fluorescently labelled oligos then unquenchable beacons will be prepared. These must be removed from the fully labelled beacons or they will give rise to high fluorescent backgrounds.

Post-labelling a Molecular Beacon is also difficult because the 3' terminus, where labelling is to occur, is sterically hindered by being part of a double helix due to the introduction of a stem loop into the probe. This is observed to greatly inhibit the labelling reaction reducing yields of beacon and making the purification of complete beacon very important if backgrounds are to be minimised.

We have used derivatised controlled pore glass (CPG) to introduce labels to the 3' terminus of DNA without needing to post-label. An amino alkyl group is bound to the glass and then reacted with succinic anhydride to give a primary carboxylic acid. A ctional alkyl compound is condensed with the carboxylic acid to form an aliphatic ester. The alkyl compound has a protected hydroxyl group from which the DNA is synthesised and the third fimcfional group is attached to the label (see Figure 2). When the DNA has been synthesised the CPG is treated with base to hydrolyse the aliphatic ester and the oligo linked to the 3' label is released.

We amplified human genomic DNA (SOng) using the following: PCR primers (5'-3') CGC TOA TGA ATG TOA AAA ATC TAA and AGA AGT TCC AGA TAT TGC CWCTT; dATP, dCTP, dGTP & c TTP (10OgM each), 1OmM TRIS buffer/pH 8.3,1.2mM magnesium chloride, 50mM potassium chloride, Amplitaq Gold (2 units enzyme in 50gI mix). A parallel mixture mmus the human genomic DNA was used as a no-template control (NTC). As Molecular Beacon we used GCGAGCGATTCAAATGTAGGACATCAGAAGCCCTGCTCGCT (wherein represents a thio linkage with a fluorophore and methyl red quencher, at 200 nanomolar concentration. As an invariant internal standard we used X-Rhodamine (ROX) at 60 nanomolar concentr-ation.

25gl of each solution (ie. +/- genomic DNA) was placed in a PCR tube, covered with a clear plastic cap and placed in a cycling fluorimeter (Applied Biosystems 7700). With reference to Figure 4, as PCR product accumulated in the +genomic DNA sample, the Beacon was able to hybridise to its complementary sequence in the PCR product. With increased PCR cycle number, quenching decreased and fluorescence increased.

Example 3 10 Sypthesis of Methyl Red CPG Resin DWO 0 DWO NH2 PM) 0 N HO 0 N 11 N NMe- PM1) XVI (4.27g) 8.Ommol) was co-evaporated three times with DCM and then dissolved in DCM (21 gl). The solution was stirred and anhydrous triethylarnine (2.1 gl, 1 Smmol) was added.

This was followed by methyl red (2.43g, 9mmol), HOBT (1.59g, 11.8mmol) and DCC (2.51g, 12.2mmol) and a further volume of DCM (8.4m1). The reaction was Stirred under argon overnight.

Thin Layer Chromatography (TLQ showed the reaction to be complete. The mixture was filtered and the filtrate washed with aq. NaHC03 (twice), dried (Na2S04) and evaporated to 20 dryness.

4 1 It was purified by column chromatography on silica gel (Hex/ROAC/NEt3, LE0.2).

Impurities at Rf 0.49 and XVII came off together. Lower impurities separated off with small amount of XVII.

It was further purified on pre-equilibrated silica gel (Hex/EtOAc/Et3N, 1: L0.2) eluting with Hex/EtOAc, 1: 1. This gave XVII (1.56g, 25%) as a red/orange foam.

Upper RF RF lower Rf imp RF XVI1 Mtthl Red. unp rities Solvent 0.89 0.79 0.85 - DChWe011, 9:1 - 0.96 0.71 0.86 WM/Me0H/R3N,A:1 0.83 0.76 baseline 0.08 ROAc/NEt3, 9:1 0.90 0.81 0.04 - ROAc/DCM/R3N,:9A 0.93 0.83 0.13 streak to 0. 17 ROAclDCM/R3N,:9A - baseline 0.03 DCM streaked 0.83 0.83 0.19 WMINEt3,9A 0.49 0.28 baseline streaktoo.18 Hex/ROAc/NEt3, L1:0 0.49 0.21 0.24 streak to 0. 16 Hex/ROAc, 1: 1 1 1 (7 0 0 HO 0 N 11 N NN1e, 0 H 1 YP HO 0 N 11 N 01 I^ 0 HO'll.y 0 XVH (1.53g, 1.95mmol) was co-evaporated three times (15gi) with anhydrous pyridine and then dissolved in pyridine (10m.1). DMAP (50mg, 0.1lmmol) was added followed by succinic anhydride (0.32g, 3.2gmol). The reaction was stirred under argon at room temperature.

TLC showed the reaction to be complete. The mixture was diluted with DCM and washed with potassium chloride KCl(aq) (twice), dried (Na2S04) and evaporated to dryness. The residue was dissolved in the minimum of DCM and purified by column chromatography on preequilibrated silica gel (EtOAc/Et3N). The upper impurities eluting with EtOAc and the desired product XVII eluting with ROAc/Me0H 8:2 to give XVI[I (1. 1 8g, 68.4%) as a red/orange foam- Dried in a vacuum desicator over P205.

RF Impup:ty RF XVHI Solvent 0.91 0.61 WM/Me0H 9:1 0.81 0.45 EtOAc 0.86 0.70 Et0Ac/N1e0H 9:1 1 1 c, 0"" 0 H 0 1 --rPa HO-' 0 0 mm-O- resin 0 0 0 N 0 VP 11 EDC 0 N N ill 11 N 0 All glassware was soaked in 5% TMSCUDCM solution for -Y2 hour then washed 01 Y^ (acetone, water, acetone).

The resin (1.07g) was washed with 1% DIPEA/DCM solution, then dried in a sintered ftmel. Compound (XVH) (0.21g, 0.24mmol) was dissolved in the minimum of 1% DIPEAMCM solution and EDC (23mg, 0. 12mmol) was added. This was followed by the resin and enough 1 % DIPEAMCM solution was added to just cover the resin. The mixture was shaken intermittently for 2 hours after which time a sample was removed and washed (1 % DIPEAMCM) several times. A portion of the sample (10.1mg) was suspended in R01-11HG (2:3 v:v) (25m1) and the absorbance of I ul of the red solution at 495mm was measured to determine the resin loading- Therefore Therefore Therefore Weight of sample = 10.1mg. Absorbance for l mI = 0.9317 at 495nm. Absorbance for 25mI = 23.2925. I gmol of DMT+ = 71.7 abs for 25mI at 495nm. 23.2925m.7 = 0.3251pmol for 10. 1 mg of resin. loading = 0.32510. 0101 = 32gmol/g.

1 1 1 C The resin was filtered and washed (1 % DIPEA/DCM) several times. This was then soaked in cap A, cap B (1: 1, 50mi) for 20 minutes, and then washed (1 % DIPEADCM (x5)) and then diethyl ether (x3). The resin was then dried in the sintered funnel for -1 hour and tested for loading as before: A portion of the resin (3. 1 mg) was suspended in ROH/HG (2:3 v:v) (25m1) and the absorbance of I mI of the red solution at 495mm was measured.

Weight of resin = 0.003 1 g.

Absorbance for lmI =- 0.2449 at 495ntn_ Therefore Absorbance for 25nil = 6.1225.

1 gmol of DMT+ = 71.7 abs for 25mI at 495run 6.1225171.7 = 0.0854 gmol for 0.003 1 g.

Therefore Loading of resin = 0.085410.0031 = 27.5gmollg.

Obtained (1.0 l g).

SEQUENCE LISTING <l10> ZENECA Ltd <l20> METHOD <l30> NGAP/PHM70317 <140> 10 <14l> <l50> 9804355.7 <15l> 1998-03-03 <160> 5 <170> PatentIn Ver. 2.1 <210> 1 <21l> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:PCR Primer <400> 1 cgctgatgaa tgtgaaaaat ctaa <210> 2 <21l> 24 <212> DNA <213> Artificial Sequence 35 <220> <223> Description of Artificial Sequence:PCR Primer <400> 2 agaagttcca gatattgcct gctt <210> 3 <21l> 41 <212> DNA <213> Artificial Sequence 24 24 L r, - 1 - ' X- c 1--k <220> <223> Description of Artificial Sequence:Molecular Beacon Probe <400> 3 gcgagcgatt caaatgtagg acatcagaag ccctgctcgc t <210> 4 <21l> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Matched

Template <400> 4 tctcaaaggg cttctgatgt cctacatttg aatctaatgg <210> 5 <21l> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Mismatched

Template <400> 5 tctcaaaggg cttctgattt actacatttg aatctaatgg 41 1,

Claims

CLAIMS:

1. An energy transfer reagent for DNA analysis, the reagent comprising a fluorophore and methyl red acceptor.

2. A reagent as claimed in claim 1 comprising an oligonucleotide of up to 200 nucleotides.

3. A reagent as claimed in claim 2 wherein the fluorophore and methyl red acceptor are attached to the 5' and 3' terminii of the ofigonucleotide.

4. An oligonucleotide comprising a methyl red acceptor attached to its 3' terminus.

5. A method for producing a methyl red labelled oligonucleotide of the formula XV which method comprises cleaving a compound of the formula XIII from the controlled pore glass: (CPG) Hyp 1 DMTO-'^ (CH,)nI-A 0 N 0 11 0 N 0 H-N CPG H 1 0,^y (CH -"' 2)n 0 N 11 Obgonudeotide OH 1 (xv) 0 N N 01 N (X11) 1 t v&P

6. Methyl red -controlled pore glass of the formula XII DWO""Y (CH2)n"' N 0 N 11 N 0 0 0 H-N \ CPG

7. A compound of the formula XIII.

DMTO--' OH 01 N H 1 1 (CH2)n I- N VP 0 N 11 N (X111) 01 n 1.:1

8.

A compound of the formula MV.

H 1 DWO (CH,)n" N -1rp 0 N 0 11 0 0 HO (XIV) N 01

9.

A Molecular Beacons probe comprising a reagent as claimed in any one of claims 2-4.

10. A probe as claimed in claim 9 and comprising one or more 2-methyl RNA bases.