GB2268745A - Humanised antibodies. - Google Patents
Humanised antibodies. Download PDFInfo
- Publication number
- GB2268745A GB2268745A GB9318912A GB9318912A GB2268745A GB 2268745 A GB2268745 A GB 2268745A GB 9318912 A GB9318912 A GB 9318912A GB 9318912 A GB9318912 A GB 9318912A GB 2268745 A GB2268745 A GB 2268745A
- Authority
- GB
- United Kingdom
- Prior art keywords
- cdr
- grafted
- residues
- donor
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
- C07K16/241—Tumor Necrosis Factors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2809—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2812—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD4
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2821—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against ICAM molecules, e.g. CD50, CD54, CD102
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/46—Hybrid immunoglobulins
- C07K16/461—Igs containing Ig-regions, -domains or -residues form different species
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/46—Hybrid immunoglobulins
- C07K16/461—Igs containing Ig-regions, -domains or -residues form different species
- C07K16/464—Igs containing CDR-residues from one specie grafted between FR-residues from another
- C07K16/465—Igs containing CDR-residues from one specie grafted between FR-residues from another with additional modified FR-residues
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Life Sciences & Earth Sciences (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
A CDR-grafted antibody heavy chain comprises a variable region domain having acceptor framework, and donor antigen binding, regions wherein the framework comprises donor residues at at least one of positions 6,23 and/or 24,48 and/or 49,71 and/or 73,75 and/or 76 and/or 78, and 88 and/or 91. A CDR-grafted antibody light chain comprises a variable region domain having acceptor framework, and donor antigen binding, regions wherein the framework comprises donor residues either at at least one of positions 1 and/or 3, and 46 and/or 47, or at at least one of positions 46,48,58 and 71. Composition of the CDR-grafted antibodies are of use in therapy and diagnosis.
Description
HUMANISED ANTIBODIES
Field of the Invention
The present invention relates to humanised antibody molecules, to processes for their production using recombinant DNA technology, and to their therapeutic uses.
The term "humanised antibody molecule" is used to describe a molecule having an antigen binding site derived from an immunoglobulin from a non-human species, and remaining immunoglobulin-derived parts of the molecule being derived from a human immunoglobulin. The antigen binding site typically comprises complementarity determining regions (CDRs) which determine the binding specificity of the antibody molecule and which are carried on appropriate framework regions in the variable domains. There are 3
CDRs (CDR1, CDR2 and CDR3) in each of the heavy and light chain variable domains.
In the description, reference is made to a number of publications by number. The publications are listed in numerical order at the end of the description.
Backaround of the Invention
Natural immunoglobulins have been known for many years, as have the various fragments thereof, such as the Fab, (Fab')2 and Fc fragments, which can be derived by enzymatic cleavage. Natural immunoglobulins comprise a generally Y-shaped molecule having an antigen-binding site towards the end of each upper arm. The remainder of the structure, and particularly the stem of the Y, mediates the effector functions associated with immunoglobulins.
Natural immunoglobulins have been used in assay, diagnosis and, to a more limited extent, therapy. However, such uses, especially in therapy, were hindered until recently by the polyclonal nature of natural immunoglobulins. A significant step towards the realisation of the potential of immunoglobulins as therapeutic agents was the discovery of procedures for the production of monoclonal antibodies (MAbs) of defined specificity (1).
However, most MAbs are produced by hybridomas which are fusions of rodent spleen cells with rodent myeloma cells. They are therefore essentially rodent proteins.
There are very few reports of the production of human MAbs.
Since most available MAbs are of rodent origin, they are naturally antigenic in humans and thus can give rise to an undesirable immune response termed the HAMA (Human Anti-Mouse Antibody) response. Therefore, the use of rodent NAbs as therapeutic agents in humans is inherently limited by the fact that the human subject will mount an immunological response to the MAb and will either remove it entirely or at least reduce its effectiveness. In practice, MAbs of rodent origin may not be used in patients for more than one or a few treatments as a EAMA response soon develops rendering the MAb ineffective as well as giving rise to undesirable reactions.For instance, OKT3 a mouse IgG2a/k MAb which recognises an antigen in the T-cell receptor-CD3 complex has been approved for use in many countries throughout the world as an immunosuppressant in the treatment of acute allograft rejection [Chatenoud et al (2) and Jeffers et al (3)). However, in view of the rodent nature of this and other such MAbs, a significant SAMA response which may include a major anti-idiotype component, may build up on use. Clearly, it would be highly desirable to diminish or abolish this undesirable EAMA response and thus enlarge the areas of use of these very useful antibodies.
Proposals have therefore been made to render non-human
MAbs less antigenic in humans. Such techniques can be generically termed "humanisation" techniques. These techniques typically involve the use of recombinant DNA technology to manipulate DNA sequences encoding the polypeptide chains of the antibody molecule.
Early methods for humanising MAbs involved production of chimeric antibodies in which an antigen binding site comprising the complete variable domains of one antibody is linked to constant domains derived from another antibody. Methods for carrying out such chimerisation procedures are described in EP0120694 (Celltech Limited),
EP0125023 (Genentech Inc. and City of Bope), EP-A-O 171496 (Res. Dev. Corp. Japan), EP-A-O 173 494 (Stanford
University), and WO 86/01533 (Celltech Limited).This latter Celltech application (WO 86/01533) discloses a process for preparing an antibody molecule having the variable domains from a mouse MAb and the constant domains from a human t > unoglobulin. Such humanioed chimeric antibodies, however, still contain a significant proportion of non-human amino acid sequence, i.e. the complete non-human variable domains, and thus may still elicit some LAMA response, particularly if administered over a prolonged period [Begent et al (ref. 4)).
In an alternative approach, described in P-A-0239400 (Winter), the complementarity determining regions (CDRs) of a mouse MAb have been grafted onto the framework regions of the variable domains of a human immunoglobulin by site directed mutagenesis using long oligonucleotides.
The present invention relates to humanised antibody molecules prepared according to this alternative approach, i.e. CDR-grafted humanised antibody molecules. Such
CDR-grafted humanised antibodies are much less likely to give rise to a EAMA response than humanised chimeric antibodies in view of the much lower proportion of non-human amino acid sequence which they contain.
The earliest work on humanising MAbs by CDR-grafting was carried out on MAbs recognising synthetic antigens, such as the NP or NIP antigens. However, examples in which a mouse NAb recognising lysozyme and a rat MAb recognising an antigen on human T-cells were humanised by CDR-grafting have been described by Verhoeyen et al (5) and Riechmann et al (6) respectively. The preparation of CDR-grafted antibody to the antigen on human T cells is also described in WO 89/07452 (Medical Research Council).
In Riechmann et al/Medical Research Council it was found that transfer of the CDR regions alone [as defined by
Kabat refs. (7) and (8)) was not sufficient to provide satisfactory antigen binding activity in the CDR-grafted product. Riechmann et al found that it was necessary to convert a serine residue at position 27 of the human sequence to the corresponding rat phenylalanine residue to obtain a CDR-grafted product having improved antigen binding activity. This residue at position 27 of the heavy chain is within the structural loop adjacent to
CDR1. A further construct which additionally contained a human serine to rat tyrosine change at position 30 of the heavy chain did not have a significantly altered binding activity over the humanised antibody with the serine to phenylalanine change at position 27 alone. These results indicate that changes to residues of the human sequence outside the CDR regions, in particular in the structural loop adjacent to CDR1, may be necessary to obtain effective antigen binding activity for CDR-grafted antibodies which recognise more complex antigens. Even so the binding affinity of the best CDR-grafted antibodies obtained was still significantly less than the original .
Very recently Queen et al (9) have described the preparation of a humanised antibody that binds to the interleukin 2 receptor, by combining the CDRs of a murine
MAb (anti-Tac) with human immunoglobulin framework and constant regions. The human framework regions were chosen to maximise homology with the anti-Tac MAb sequence. In addition computer modelling was used to identify framework amino acid residues which were likely to interact with the CDRs or antigen, and mouse amino acids were used at these positions in the humanised antibody.
In WO 90/07861 Queen et al propose four criteria for designing humanised immunoglobulins. The first criterion is to use as the human acceptor the framework from a particular human immunoglobulin that is unusually homologous to the non-human donor immunoglobulin to be humanised, or to use a consensus framework from many human antibodies. The second criterion is to use the donor amino acid rather than the acceptor if the human acceptor residue is unusual and the donor residue is typical for human sequences at a specific residue of the framework.
The third criterion is to use the donor framework amino acid residue rather than the acceptor at positions immediately adjacent to the CDRs. The fourth criterion is to use the donor amino acid residue at framework positions at which the amino acid is predicted to have a side chain atom within about 3 A of the CDRs in a three-dimensional immunoglobulin model and to be capable of interacting with the antigen or with the CDRs of the humanised immunoglobulin. It is proposed that criteria two, three or four may be applied in addition or alternatively to criterion one, and may be applied singly or in any combination.
WO 90/07861 describes in detail the preparation of a single CDR-grafted humanised antibody, a humanised antibody having specificity for the p55 Tac protein of the
IL-2 receptor. The combination of all four criteria, as above, were employed in designing this humanised antibody, the variable region frameworks of the human antibody Eu (7) being used as acceptor. In the resultant humanised antibody the donor CDRs were as defined by Kabat petal (7 and 8) and in addition the mouse donor residues were used in place of the human acceptor residues, at positions 27, 0, 48, 66, 67, 89, 91, 94, 103, 104, 105 and 107 in the heavy chain and at positions 48, 60 and 63 in the light chain, of the variable region frameworks.The humanised anti-Tac antibody obtained is reported to have an affinity for p55 of 3 x 109 M-1, about one-third of that of the murine MAb.
We have further investigated the preparation of CDRgrafted humanised antibody molecules and have identified a hierarchy of positions within the framework of the variable regions (i.e. outside both the Kabat CDRs and structural loops of the variable regions) at which the amino acid identities of the residues are important for obtaining CDR-grafted products with satisfactory binding affinity. This has enabled us to establish a protocol for obtaining satisfactory CDR-grafted products which may be applied very widely irrespective of the level of homology between the donor immunoglobulin and acceptor framework. The set of residues which we have identified as being of critical importance does not coincide with the residues identified by Queen et al (9).
Summary of the Invention
Accordingly, in a first aspect the invention provides a
CDR-grafted antibody heavy chain having a variable region domain comprising acceptor framework and donor antigen binding regions wherein the framework comprises donor residues at at least one of positions 6, 23 and/or 24, 48 and/or 49, 71 and/or 73, 75 and/or 76 and/or 78 and 88 and/ or 91.
In preferred embodiments, the heavy chain framework comprises donor residues at positions 23, 24, 49, 71, 73 and 78 or at positions 23, 24 and 49. The residues at positions 71, 73 and 78 of the heavy chain framework are preferably either all acceptor or all donor residues.
In particularly preferred embodiments the heavy chain framework additionally comprises donor residues at one, some or all of positions 6, 37, 48 and 94. Also it is particularly preferred that residues at positions of the heavy chain framework which are commonly conserved across species, i.e. positions 2, 4, 25, 36, 39, 47, 93, 103, 104, 106 and 107, if not conserved between donor and acceptor, additionally comprise donor residues. Most preferably the heavy chain framework additionally comprises donor residues at positions 2, 4, 6, 25, 36, 37, 39, 47, 48, 93, 94, 103, 104, 106 and 107.
In addition the heavy chain framework optionally comprises donor residues at one, some or all of positions: 1 and 3, 72 and 76, 69 (if 48 is different between donor and acceptor), 38 and 46 (if 48 is the donor residue), 80 and 20 (if 69 is the donor residue), 67, 82 and 18 (if 67 is the donor residue), 91, 88, and any one or more of 9, 11, 41, 87, 108, 110 and 112.
In the first and other aspects of the present invention reference is made to CDR-grafted antibody products comprising acceptor framework and donor antigen binding regions. It will be appreciated that the invention is widely applicable to the CDR-grafting of antibodies in general. Thus, the donor and acceptor antibodies may be derived from animals of the same species and even same antibody class or sub-class. More usually, however, the donor and acceptor antibodies are derived from animals of different species. Typically the donor antibody is a non-human antibody, such as a rodent MAb, and the acceptor antibody is a human antibody.
In the first and other aspects of the present invention, the donor antigen binding region typically comprises at least one CDR from the donor antibody. Usually the donor antigen binding region comprises at least two and preferably all three CDRs of each of the heavy chain and/or light chain variable regions. The CDRs may comprise the Kabat CDRs, the structural loop CDRs or a composite of the Kabat and structural loop CDRs and any combination of any of these. Preferably, the antigen binding regions of the CDR-grafted heavy chain variable domain comprise CDRs corresponding to the Kabat CDRs at
CDR2 (residues 50-65) and CDR3 (residues 95-100) and a composite of the Kabat and structural loop CDRs at CDR1 (residues 26-35).
The residue designations given above and elsewhere in the present application are numbered according to the Kabat numbering [refs. (7) and (8)3. Thus the residue designations do not always correspond directly with the linear numbering of the amino acid residues. The actual linear amino acid sequence may contain fewer or additional amino acids than in the strict Kabat numbering corresponding to a shortening of, or insertion into, a structural component, whether framework or CDR, of the basic variable domain structure. For example, the heavy chain variable region of the anti-Tac antibody described by Queen et al (9) contains a single amino acid insert (residue 52a) after residue 52 of CDR2 and a three amino acid insert (residues 82a, 82b and 82c) after framework residue 82, in the Kabat numbering.The correct Kabat numbering of residues may be determined for a given antibody by alignment at regions of homology of the sequence of the antibody with a "standard" Kabat numbered sequence.
The invention also provides in a second aspect a CDRgrafted antibody light chain having a variable region domain comprising acceptor framework and donor antigen binding regions wherein the framework comprises donor residues at at least one of positions 1 and/or 3 and 46 and/or 47. Preferably the CDR grafted light chain of the second aspect comprises donor residues at positions 46 and/or 47.
The invention also provides in a third aspect a
CDR-grafted antibody light chain having a variable region domain comprising acceptor framework and donor antigen binding regions wherein the framework comprises donor residues at at least one of positions 46, 48, 58 and 71.
In a preferred embodiment of the third aspect, the framework comprises donor residues at all of positions 46, 48, 58 and 71.
In particularly preferred embodiments of the second and third aspects, the framework additionally comprises donor residues at positions 36, 44, 47, 85 and 87. Similarly positions of the light chain framework which are commonly conserved across species, i.e. positions 2, 4, 6, 35, 49, 62, 64-69, 98, 99, 101 and 102, if not conserved between donor and acceptor, additionally comprise donor residues.
Most preferably the light chain framework additionally comprises donor residues at positions 2, 4, 6, 35, 36, 38, 44, 47, 49, 62, 64-69, 85, 87, 98, 99, 101 and 102.
In addition the framework of the second or third aspects optionally comprises donor residues at one, some or all of positions: 1 and 3, 63, 60 (if 60 and 54 are able to form at potential saltbridge), 70 (if 70 and 24 are able to form a potential saltbridge), 73 and 21 (if 47 is different between donor and acceptor), 37 and 45 (if 47 is different between donor and acceptor), and any one or more cf 10, 12, 40, 80, 103 and 105.
Preferably, the antigen binding regions of the CDR-grafted light chain variable domain comprise CDRs corresponding to the Kabat CDRs at CDR1 (residue 24-34), CDR2 (residues 50-56) and CDR3 (residues 89-97).
The invention further provides in a fourth aspect a
CDR-grafted antibody molecule comprising at least one
CDR-grafted heavy chain and at least one CDR-grafted light chain according to the first and second or first and third aspects of the invention.
The humanised antibody molecules and chains of the present invention may comprise: a complete antibody molecule, having full length heavy and light chains; a fragment thereof, such as a Fab, (Fab')2 or FV fragment; a light chain or heavy chain monomer or dimer; or a single chain antibody, e.g. a single chain FV in which heavy and light chain variable regions are joined by a peptide linker; or any other CDR-grafted molecule with the same specificity as the original donor antibody. Similarly the
CDR-grafted heavy and light chain variable region may be combined with other antibody domains as appropriate.
Also the heavy or light chains or humanised antibody molecules of the present invention may have attached to them an effector or reporter molecule. For instance, it may have a macrocycle, for chelating a heavy metal atom, or a toxin, such as ricin, attached to it by a covalent bridging structure. Alternatively, the procedures of recombinant DNA technology may be used to produce an immunoglobulin molecule in which the Fe fragment or CH3 domain of a complete immunoglobulin molecule has been replaced by, or has attached thereto by peptide linkage, a functional non-immunoglobulin protein, such as an enzyme or toxin molecule.
Any appropriate acceptor variable region framework sequences may be used having regard to class/type of the donor antibody from which the antigen binding regions are derived. Preferably, the type of acceptor framework used is of the same/similar class/type as the donor antibody.
Conveniently, the framework may be chosen to maximise/ optimise homology with the donor antibody sequence particularly at positions close or adjacent to the CDRs.
Bowever, a high level of homology between donor and acceptor sequences is not important for application of the present invention. The present invention identifies a hierarchy of framework residue positions at which donor residues may be important or desirable for obtaining a
CDR-grafted antibody product having satisfactory binding properties. The CDR-grafted products usually have binding affinities of at least 105 M-1, preferably at least about 108 M-1, or especially in the range 108-1012 M-1 In principle, the present invention is applicable to any combination of donor and acceptor antibodies irrespective of the level of homology between their sequences. A protocol for applying the invention to any particular donor-acceptor antibody pair is given hereinafter.Examples of human frameworks which may be used are KOL, NEWM, REI, EU, LAY and POM (refs. 4 and 5) and the like; for instance KOL and NFWM for the heavy chain and REI for the light chain and EU, LAY and POM for both the heavy chain and the light chain.
Also the constant region domains of the products of the invention may be selected having regard to the proposed function of the antibody in particular the effector functions which may be required. For example, the constant region domains may be human'IgA, IgE, IgG or IgM domains. In particular, IgG human constant region domains may be used, especially of the IgG1 and IgG3 isotypes, when the humanised antibody molecule is intended for therapeutic uses, and antibody effector functions are required. Alternatively, IgG2 and IgG4 isotopes may be used when the humanised antibody molecule is intended for therapeutic purposes and antibody effector functions are not required, e.g. for simple blocking of lymphokine activity.
However, the remainder of the antibody molecules need not comprise only protein sequences from immunoglobulins.
For instance, a gene may be constructed in which a DNA sequence encoding part of a human immunoglobulin chain is fused to a DNA sequence encoding the amino acid sequence of a functional polypeptide such as an effector or reporter molecule.
Preferably the CDR-grafted antibody heavy and light chain and antibody molecule products are produced by recombinant
DNA technology.
Thus in further aspects the invention also includes UNA sequences coding for the CDR-grafted heavy and light chains, cloning and expression vectors containing the DNA sequences, host cells transformed with the DNA sequences and processes for producing the CDR-grafted chains and antibody molecules comprising expressing the DNA sequences in the transformed host cells.
The general methods by which the vectors may be constructed, transfection methods and culture methods are well known per se and form no part of the invention. Such methods are shown, for instance, in references 10 and 11.
The DNA sequences which encode the donor amino acid sequence may be obtained by methods well known in the art. For example the donor coding sequences may be obtained by genomic cloning, or cDNA cloning from suitable hybridoma cell lines. Positive clones may be screened using appropriate probes for the heavy and light chain genes in question. Also PCR cloning may be used.
DNA coding for acceptor, e.g. human acceptor, sequences may be obtained in any appropriate way. For example DNA sequences coding for preferred human acceptor frameworks such as KOL, REI, EU and NEWM, are widely available to workers in the art.
The standard techniques of molecular biology may be used to prepare DNA sequences coding for the CDR-grafted products. Desired DNA sequences may be synthesised completely or in part using oligonucleotide synthesis techniques. Site-directed mutagenesis and polymerase chain reaction (PCR) techniques may be used as appropriate. For example oligonucleotide directed synthesis as described by Jones et al (ref. 20) may be used. Also oligonucleotide directed mutagenesis of a pre-exising variable region as, for example, described by
Verhoeyen et al (ref. 5) or Riechmann et al (ref. 6) may be used. Also enzymatic filling in of gapped oligonucleotides using T4 DNA polymerase as, for example, described by Queen et al (ref. 9) may be used.
Any suitable host cell/vector system may be used for expression of the DNA sequences coding for the CDR-grafted heavy and light chains. Bacterial e.g. E. coli, and other microbial systems may be used, in particular for expression of antibody fragments such as FAb and (Fab')2 fragments, and especially FV fragments and single chain antibody fragments e.g. single chain FVs. Eucaryotic e.g. mammalian host cell expression systems may be used for production of larger CDR-grafted antibody products, including complete antibody molecules. Suitable mammalian host cells include CHO cells and myeloma or hybridoma cell lines.
Thus, in a further aspect the present invention provides a process for producing a CDR-grafted antibody product comprising: (a) producing in an expression vector an operon having a
DNA sequence which encodes an antibody heavy chain
according to the first aspect of the invention; and/or (b) producing in an expression vector an operon having a
DNA sequence which encodes a complementary antibody
light chain according to the second or third aspect
of the invention; (c) transfecting a host cell with the or each vector; and (d) culturing the transfected cell line to produce the
CDR-grafted antibody product.
The CDRngrafted produced may comprise only heat er light chain derived polypeptide, in which case only a heavy chain or light chain polypeptide coding sequence is used to transfect the host cells.
For production of products comprising both heavy and light chains, the cell line may be transfected with two vectors, the first vector may contain an operon encoding a light chain-derived polypeptide and the second vector containing an operon encoding a heavy chain-derived polypeptide.
Preferably, the vectors are identical, except in so far as the coding sequences and selectable markers are concerned, so as to ensure as far as possible that each polypeptide chain is equally expressed. Alternatively, a single vector may be used, the vector including the sequences encoding both light chain- and heavy chain-derived polypeptides.
The DNA in the coding sequences for the light and heavy chains may comprise cDNA or genomic DNA or both.
However, it is preferred that the DNA sequence encoding the heavy or light chain comprises at least partially, genomic DNA, preferably a fusion of cDNA and genomic DNA.
The present invention is applicable to antibodies of any appropriate specificity. Advantageously, however, the invention may be applied to the humanisation of non-human antibodies which are used for in vivo therapy or diagnosis. Thus the antibodies may be site-specific antibodies such as tumour-specific or cell surfacespecific antibodies, suitable for use in in vivo therapy or diagnosis, e.g. tumour imaging. Examples of cell surface-specific antibodies are anti-T cell antibodies, such as anti-CD3, and CD4 and adhesion molecules, such as
CR3, ICAM and ELAM. The antibodies may have specificity for interleukins (including lymphokines, growth factors and stimulating factors), hormones and other biologically active compounds, and receptors for any of these.For example, the antibodies may have specificity for any of the following: Interferonsed, p, Y orb, IL1, IL2, IL3, or IL4, etc., TNF, GCSF, GMCSE, EPO, hGH, or insulin, etc.
The the present invention also includes therapeutic and diagnostic compositions comprising the CDR-grafted products of the invention and uses of such compositions in therapy and diagnosis.
Accordingly in a further aspect the invention provides a therapeutic cr diagnostic composition comprising a
CDR-grafted antibody heavy or light chain or molecule according to previous aspects of the invention in combination with a pharmaceutically acceptable carrier, diluent or excipient.
Accordingly also the invention provides a method of therapy or diagnosis comprising administering an effective amount of a CDR-grafted antibody heavy or light chain or molecule according to previous aspects of the invention to a human or animal subject.
A preferred protocol for obtaining CDR-grafted antibody heavy and light chains in accordance with the present invention is set out below together with the rationale by which we have derived this protocol. This protocol and rationale are given without prejudice to the generality of the invention as hereinbefore described and defined.
Protocol
It is first of all necessary to sequence the DNA coding for the heavy and light chain variable regions of the donor antibody, to determine their amino acid sequences.
It is also necessary to choose appropriate acceptor heavy and light chain variable regions, of known amino acid sequence. The CDR-grafted chain is then designed starting from the basis of the acceptor sequence. It will be appreciated that in some cases the dQç; and acceptor amino acid residues may be identical at a particular position and thus no change of acceptor framework residue is required.
1. As a first step donor residues are substituted for
acceptor residues in the CDRs. For this purpose the
CDRs are preferably defined as follows:
Heavy chain - CDR1: residues 26-35
- CDR2: residues 50-65
- CDR3: residues 95-102
Light chain - CDR1: residues 24-34
- CDR2: residues 50-56
- CDR3: residues 89-97
The positions at which donor residues are to be
substituted for acceptor in the framework are then
chosen as follows, first of all with respect to the
heavy chain and subsequently with respect to the
light chain.
2. Heavy Chain 2.1 Choose donor residues at all of positions 23, 24, 49,
71, 73 and 78 of the heavy chain or all of positions
23, 24 and 49 (71, 73 and 78 are always either all
donor or all acceptor).
2.2 Check that the following have the same amino acid in
donor and acceptor sequences, and if not preferably
choose the donor: 2, 4, 6, 25, 36, 37, 39, 47, 48,
93, 94, 103, 104, 106 and 107.
2.3 To further optimise affinity consider choosing donor
residues at one, some or any of:
1. 1, 3
ii. ?2, 76
iii. If 48 is different between donor and acceptor
sequences, consider 69
iv. If at 48 the donor residue is chosen, consider
38 and 46
v. If at 69 the donor residue is chosen, consider 80 and then 20
vi. 67
vii.If at 67 the donor residue is chosen, consider
82 and then 1R viii . 91
ix. 88
x. 9, 11, 41, 87, 108, 110, 112 3. Liaht Chain 3.1 Choose donor at 46, 48, 58 and 71 3.2 Check that the following have the same amino acid in
donor and acceptor sequences, if not preferably
choose donor:
2, 4, 6, 35, 38, 44, 47, 49, 62, 64-69 inclusive, 85,
87, 98, 99, 101 and 102 3.3 To further optimise affinity consider choosing donor
residues at one, some or any of::
i. 1, 3
ii. 63
iii. 60, if 60 and 54 are able to form potential
saltbridge
iv. 70, if 70 and 24 are able to form potential
saltbridge
v. 73, and 21 if 47 is different between donor and
acceptor
vi. 37, and 45 if 47 is different between donor and
acceptor
vii. 10, 12, 40, 80, 103, 105
Rationale
In order to transfer the binding site of an antibody into a different acceptor framework, a number of factors need to be considered.
1. The extent of the CDRs, The CDRs (Complementary Determining Regions) were
defined by Wu and Kabat (refs. 4 and 5) on the
basis of an analysis of the variability of
different regions of antibody variable regions.
Three regions per domain were recognised. In
the light chain the sequences are 24-34, 50-56, 89-97 (numbering according to Kabat (ref. 4), Eu
Index) inclusive and in the heavy chain the
sequences are 31-35, 50-65 and 95-102 inclusive.
When antibody structures became available it
became apparent that these CDR regions
corresponded in the main to loop regions which
extended from the p barrel framework of the light
and heavy variable domains. For H1 there was a
discrepancy in that the loop was from 26 to 32
inclusive and for H2 the loop was 52 to 56and for L2 from 50 to 53. However, with the
exception of H1 the CDR regions encompassed the
loop regions and extended into the p strand
frameworks. In H1 residue 26 tends to be a
serine and 27 a phenylalanine or tyrosine,
residue 29 is á phenylalanine in most cases.
Residues 28 and 30 which are surface residues
exposed to solvent might be involved in
antigen-binding. A prudent definition of the H1
CDR therefore would include residues 26-35 to
include both the loop region and the
hypervariable residues 33-35.
It is of interest to note the example of
Riechmann et al (ref. 3), who used the residue
31-35 choice for CDR-Hi. In order to produce
efficient antigen binding, residue 25 also needed
to be recruited from the donor (rat) antibody.
2. Non-CDR residues which contribute to antigen
binding
By examination of available X-ray structures we
have identified a number of residues which may
have an effect on net antigen binding and which
can be demonstrated by experiment. These
residues can be sub-divided into a number of
groups.
2.1 Surface residues near CDR [all numbering as in
Kabat et al (ref. ?)).
2.1.1. Heavy Chain - Key residues are 23, 71 and 73.
Other residues which may contribute to a lesser
extent are 1, 3 and 76. Finally 25 is usually
conserved but the murine residue should be used
if there is a difference.
2.1.2 Light Chain - Many residues close to the CDRs,
e.g. 63, 65, 67 and 69 are conserved. If
conserved none of the surface residues in the
light chain are likely to have a major effect.
However, if the murine residue at these positions
is unusual, then it would be of benefit to
analyse the likely contribution more closely.
Other residues which may also contribute to
binding are 1 and 3, and also 60 and 70 if the
residues at these positions and at 54 and 24
respectively are potentially able to form a salt
bridge i.e. 60 1 54; 70 + 24.
2.2 Packing residues near the CDRs.
2.2.1. Beavy Chain - Key residues are 24, 49 and 78.
Other key residues would be 36 if not a
tryptophan, 94 if not an arginine, 104 and 106 if
not glycines and 107 if not a threonine.
Residues which may make a further contribution to
stable packing of the heavy chain and hence
improved affinity are 2, 4, 6, 38, 46, 67 and
69. 67 packs against the CDR residue 63 and
this pair could be either both mouse or both
human. Finally, residues which contribute to
packing in this region but from a longer range
are 18, 20, 80, 82 and 86. 82 packs against 67
and in turn 18 packs against 82. 80 packs
against 69 and in turn 20 packs against 80. 86
forms an H bond network with 38 and 46. Many of
the mouse-human differences appear minor e.g.
Leu-Ile, but could have an minor impact on
correct packing which could translate into
altered positioning of the CDRs.
2.2.2. Light Chain - Key residues are 48, 58 and 71.
Other key residues would be 6 if not glutamine,
35 if not tryptophan, 62 if not phenylalanine or
tryosine, 64, 66, 68, 99 and 101 if not glycines
and 102 if not a threonine. Residues which make
a further contribution are 2, 4, 37, 45 and 47.
Finally residues 73 and 21 and 19 may make long
distance packing contributions of a minor nature.
2.3. Residues at the variable domain interface between
heavy and light chains - In both the light and
heavy chains most of the non-CDR interface
residues are conserved. If a conserved residue
is replaced by a residue of different character,
e.g. size or charge, it should be considered for
retention as the murine residue.
2.3.1. Heavy Chain - Residues which need to be
considered are 37 if the residue is not a valine
but is of larger side chain volume or has a
charge or polarity. Other residues are 39 if
not a glutamine, 45 if not a leucine, 47 if not a
tryptophan, 91 if not a phenylalanine or
tyrosine, 93 if not an alanine and 103 if not a
tryptophan. Residue 89 is also at the interface
but is not in a position where the side chain
could be of great impact.
2.3.2. Light Chain - Residues which need to be
considered are 36, if not a tyrosine, 38 if not a
glutamine, 44 if not a proline, 46, 49 if not a
tyrosine, residue 85, residue 87 if not a
tyrosine and 98 if not a phenylalanine.
2.4. Variable-Constant region interface - The elbow
angle between variable and constant regions may
be affected by alterations in packing of key
residues in the variable region against the
constant region which may affect the position of
VL and VE with respect to one another.
Therefore it is worth noting the residues likely
to be in contact with the constant region. In
the heavy chain the surface residues potentially
in contact with the variable region are conserved
between mouse and human antibodies therefore the
variable region contact residues may influence
the V-C interaction. In the light chain the
amino acids found at a number of the constant
region contact points vary, and the V & C regions
are not in such close proximity as the heavy
chain. Therefore the influences of the light
chain V-C interface may be minor.
2.4.1. Heavy Chain - Contact residues are 7, 11, 41, 87,
108, 110, 112.
2.4.2. Light Chain - In the light chain potentially
contacting residues are 10, 12, 40, 80, 83, 103
and 105.
The above analysis coupled with our considerable practical experimental experience in the CDR-grafting of a number of different antibodies have lead us to the protocol given above.
The present invention is now described, by way of example only, with reference to the accompanying Figures 1 - 13.
Brief DescriDtion of the Figures
Figure 1 shows DNA and amino acid sequences of the OKT3
light chain;
Figure 2 shows DNA and amino acid sequences of the OKT3
heavy chain;
Figure 3 shows the alignment of the OKT3 light variable
region amino acid sequence with that of the
light variable region of the human antibody REI;
Figure 4 shows the alignment of the OKT3 heavy variable
region amino acid sequence with that of the
heavy variable region of the human antibody KOL;
Figure 5 shows the heavy variable region amino acid
sequences of OKT3, KOL and various
corresponding CDR grafts;
Figure 6 shows the light variable region amino acid
sequences of OKT3, REI and various
corresponding CDR grafts;;
Figure 7 shows a graph of binding assay results for
various grafted OKT3 antibodies'
Figure 8 shows a graph of blocking assay results for
various grafted OKT3 antibodies;
Figure 9 shows a similar graph of blocking assay results;
Figure 10 shows similar graphs for both binding assay and
blocking assay results;
Figure 11 shows further similar graphs for both binding
assay and blocking assay results;
Figure 12 shows a graph of competition assay results for
a minimally grafted OKT3 antibody compared with
the OKT3 murine reference standard, and
Figure 13 shows a similar graph of competition assay
results comparing a fully grafted OKT3 antibody
with the murine reference standard.
DETAILLED DESCRIPTION OF EMBODIMENTS OF THE INVENTION EXAHPLE 1 CDR-CRAFTING OF OKT3
MATERIAL AND METHODS 1. INCOMING CELLS Bybridoma cells producing antibody OKT3 were provided
by Ortho (seedlot 4882.1) and were grown up in
antibiotic free Dulbecco's Modified Eagles Medium
(DMEM) supplemented with glutamine and 5% foetal calf
serum and divided to provide both an overgrown
supernatant for evaluation and cells for extraction
of RNA. The overgrown supernatant was shown to
contain 250 ug/mL murine IgG2a/kappa antibody.The
supernatant was negative for murine lambda light
chain and IgG1, IgG2b; IgG3, IgA and IgM heavy
chain. 20mL of supernatant was assayed to confirm
that the antibody present was OKT3.
2. MOLECULAR BIOLOGY PROCEDURES
Basic molecular biology procedures were as described
in Maniatis et al (ref. 9) with, in some cases, minor
modifications. DNA sequencing was performed as
described in Sanger et al (ref. 11) and the Amersham
International Plc sequencing handbook. Site
directed mutagenesis was as described in Kramer et al
(ref. 12) and the Anglian Biotechnology Ltd.
handbook. COS cell expression and metabolic
labelling studies were as described in Whittle et al
(ref. 13) 3. RESEARCH ASSAYS 3.1. ASSEMBLY ASSAYS
Assembly assays were performed on supernatants
from transfected COS cells to determine the amount
of intact IgG present.
3.1.1. COS CELLS TRANSFECTED WITH MOUSE ORT3 GENES
The assembly assay for intact mouse IgG in COS
cell supernatants was an ELISA with the following
format:
96 well microtitre plates were coated with F(ab')2 goat anti-mouse IgG Fc. The plates were washed
in water and samples added for 1 hour at room
temperature. The plates were washed and F(ab')2 goat anti-mouse IgG F(ab')2 (HRPO conjugated) was
then added. Substrate was added to reveal the
reaction. UPClO, a mouse IgG2a myeloma, was used
as a standard.
3.1.2. COS AND CEO CELLS TRANSFECTED WITH CHIMERIC OR
CDR-GRAFTED OKT3 GENES
The assembly assay for chimeric or CDR-grafted
antibody in COS cell supernatants was an ELISA
with the following format:
96 well microtitre plates were-coated with F(ab')2 goat anti-human IgG Fc. The plates were washed
and samples added and incubated for 1 hour at room
temperature. The plates were washed and
monoclonal mouse anti-human kappa chain was added
for 1 hour at room temperature.
The plates were washed and F(ab')2 goat anti-mouse
IgG Pc (BRPO conjugated) was added. Enzyme
substrate was added to reveal the reaction.
Chimeric B72.3 (IgG4) (ref. 13) was used as a
standard. The use of a monoclonal anti-kappa
chain in this assay allows grafted antibodies to
be read from the chimeric standard.
3.2. ASSAY FOR ANTIGEN BINDING ACTIVITY
Material from COS cell supernatants was assayed
for OKT3 antigen binding activity onto CD3
positive cells in a direct assay. The procedure
was as follows:
HUT 78 cells (human T cell line, CD3 positive)
were maintained in culture. Monolayers of BUT 78
cells were prepared onto 96 well ELISA plates
using poly-L-lysine and glutaraldehyde. Samples
were added to the monolayers for 1 hour at room
temperature.
The plates were washed gently using PBS. F(ab')2
goat anti-human IgG Pc (HRPO conjugated) or F(ab')2 goat anti-mouse IgG Fc (HRPO conjugated) was added
as appropriate for humanised or mouse samples.
Substrate was added to reveal the reaction.
The negative control for the cell-based assay was
chimeric B72.3. The positive control was mouse
Orthomune OKT3 or chimeric OKT3, when available.
This cell-based assay was difficult to perform,
and an alternative assay was developed for
CDR-grafted OKT3 which was more sensitive and
easier to carry out.
In this system CDR-grafted OKT3 produced by COS
cells was tested for its ability to bind to the
CD3-positive HPB-ALL (human peripheral blood acute
lymphocytic leukemia) cell line. It was also
tested for its ability to block the binding of
murine OKT3 to these cells. Binding was measured
by the following procedure: HPB-ALL cells were
harvested from tissue culture. Cells were
incubated at 40C for 1 hour with various dilutions
of test antibody, positive control antibody1 or
negative control antibody. The cells
were washed once and incubated at 40C for 1 hour
with an FITC-labelled goat anti-human IgG (Fc
specific, mouse absorbed). The cells were washed
twice and analysed by cytofluorography. Chimeric ORT3 was used as a positive control for direct
binding.Cells incubated with mock- transfected
COS cell supernatant, followed by the FITC-labelled
goat anti-human IgG, provided the negative control.
To test the ability of CDR-grafted OKT3 to block
murine OKT3 binding, the SPB-ALL cells were
incubated at 40C for 1 hour with various dilutions
of test antibody or control antibody. A fixed
saturating amount of FITC OKT3 was added The
samples were incubated for 1 hour at 49C, washed
twice and analysed by cytofluorography.
FITC-labelled OKT3 was used as S > positive control to determine maximum binding. Unlabelled murine
OKT3 served as a reference standard for
blocking. Negative controls were unstained cells
with or without mock-transfected cell supernatant.
The ability of the CDR-grafted OKT3 light chain to
bind CD3-positive cells and block the binding of
murine OKT3 was initially tested in combination
with the chimeric OKT3 heavy chain. The chimeric
OKT3 heavy chain is composed of the murine OKT3
variable region and the human IgG4 constant
region. The chimeric heavy chain gene is
expressed in the same expression vector used for
the CDR-grafted genes. The CDR-grafted light
chain expression vector and the chimeric heavy
chain expression vector were co-transfected into
COS cells. The fully chimeric OKT3 antibody
(chimeric light chain and chimeric heavy chain)
was found to be fully capable of binding to CD3
positive cells and blocking the binding of murine
ORT3 to these cells.
3.3 DETERMINATION OF RELATIVE BINDING AFFINITY
The relative binding affinities of CDR-grafted anti-CD3 monoclonal antibodies were determined by competition binding (ref. 6) using the BPB-ALL human T cell line as a source of CD3 antigen, and fluorescein-conjugated murine OKT3 (Fl-OKT3) of known binding affinity as a tracer antibody. The binding affinity of F1-OKT3 tracer antibody was determined by a direct binding assay in which increasing amounts of Pl-OKT3 were incubated with
EPB-ALL (5x105) in PBS with 5% foetal calf serum for 60 min. at 40C. Cells were washed, and the fluorescence intensity was determined on a FACScan flow cytometer calibrated with quantitative microbead standards (Flow Cytometry Standards,
Research Triangle Park, NC).Fluorescence intensity per antibody molecule (F/P ratio) was determined by using microbeads which have a predetermined number of mouse IgG antibody binding sites (Simply Cellular beads, Flow Cytometry
Standards). F/P equals the fluorescence intensity of beads saturated with Fl-OKT3 divided by the number of binding sites per bead. The amount of bound and free F1-OKT3 was calculated from the mean fluorescence intensity per cell, and the ratio of bound/free was plotted against the number of moles of antibody bound. A linear fit was used to determine the affinity of binding (absolute value of the slope).
For competitive binding, increasing amounts of competitor antibody were added to a sub-saturating dose of F1-OKT3 and incubated with 5x105 HPB-A1L in 200 ml of PBS with 5% foetal calf serum, for 60 min at 40C. The fluorescence intensities of the cells were measured on a FACScan flow cytometer calibrated with quantitative microbead standards.
The concentrations of bound and free F1-OKT3 were calculated. The affinities of competing anti
bodies were calculated from the equation [X)-[OKT3) = (1/Kx) - (1/Ka), where Ka is the
affinity of murine OKT3, Kx is the affinity of
competitor X, [ ) is the concentration of
competitor antibody at which bound/free binding is
R/2, and R is the maximal bound/free binding.
4. cDNA LIBRARY CONSTRUCTION 4.1. mRNA PREPARATION AND cDNA SYNTHESIS
OKT3 producing cells were grown as described above
and 1.2 x 109 cells harvested and mRNA extracted
using the guanidinium/LiC1 extraction procedure.
cDNA was prepared by priming from Oligo-dT to
generate full length cDNA. The cDNA was
methylated and EcoRl linkers added for cloning.
4.2. LIBRARY CONSTRUCTION
The cDNA library was ligated to pSP65 vector DNA
which had been EcoR1 cut and the 5' phosphate
groups removed by calf intestinal phosphatase (EcoRi/CIP). The ligation was used to transform
high transformation efficiency Escherichia coli
(E.coli) BB101. A cDNA library was prepared.
3600 colonies were screened for the light chain
and 10000 colonies were screened for the heavy
chain.
5. SCREENING E.coli colonies positive for either heavy or light
chain probes were identified by oligonucleotide
screening using the oligonucleotides:
5' TCCAGATGTTAACTGCTCAC for the light chain, which
is complementary to a sequence in the mouse kappa
constant region, and 5' CAGGGGCCAGTGGATGGATAGAC
for the heavy chain which is complementary to a
sequence in the mouse IgG2a constant CHi domain
region. 12 light chain and 9 heavy chain clones
were identified and taken for second round
screening. Positive clones from the second round
of screening were grown up and DNA prepared. The
sizes of the gene inserts were estimated by gel
electrophoresis and inserts of a size capable of
containing a full length cDNA were subcloned into
M13 for DNA sequencing.
6. DNA SEQUENCING
Clones representing four size classes for both
heavy and light chains were obtained in M13. DNA
sequence for the 5' untranslated regions, signal
sequences, variable regions and 3' untranslated
regions of full length cDNAs [Figures 1(a) and 2(a)) were obtained and the corresponding amino
acid sequences predicted [(Figures l(b) and 2(b)). In Figure 1(a) the untranslated DNA
regions are shown in uppercase, and in both
Figures 1 and 2 the signal sequences are
underlined.
7. CONSTRUCTION OF cDNA EXPRESSION VECTORS
Celltech expression vectors are based on the
plasmid pEE6hCMV (ref. 14). A polylinker for the
insertion of genes to be expressed has been
introduced after the major immediate early
promoter/enhancer of the human Cytomegalovirus
(hCMV). Marker genes for selection of the
plasmid in transfected eukaryotic cells can be
inserted as BamH1 cassettes in the unique Bath1 site of pEE6 hCMV; for instance, the neo marker
to provide pEE6 hCMV neo. It is usual practice
to insert the neo and gpt markers prior to
insertion of the gene of interest, whereas the GS
marker is inserted last because of the presence of
internal EcoRl sites in the cassette.
The selectable markers are expressed from the SV40
late promoter which also provides an origin of
replication so that the vectors can be used for
expression in the COS cell transient expression
system.
The mouse sequences were excised from the M13
based vectors described above as EcoRl fragments
and cloned into either pEE6-hCMV-neo for the heavy
chain and into EE6-hCMV-gpt for the light chain to
yield vectors pJA136 and pJA135 respectively.
8. EXPRESSION OF cDNAS IN COS CELLS
Plasmids pJA135 and pJA136 were co-transfected
into COS cells and supernatant from the transient
expression experiment was shown to contain
assembled antibody which bound to T-cell enriched
lymphocytes. Metabolic labelling experiments
using 35S methionine showed expression and
assembly of heavy and light chains.
9. CONSTRUCTION OF CHIMERIC GENES
Construction of chimeric genes followed a
previously described strategy [Whittle et al (ref.
13)). A restriction site near the 3' end of the
variable domain sequence is identified and used to
attach an oligonucleotide adapter coding for the
remainder of the mouse variable region and a
suitable restriction site for attachment to the
constant region of choice.
9.1. LIGHT CHAIN GENE CONSTRUCTION
The mouse light chain cDNA sequence contains an
Aval site near the 3' end of the variable region
[Fig. 1(a)). The majority of the sequence of the
variable region was isolated as a 396 bp.
EcoR1-Aval fragment. An oligonucleotide adapter
was designed to replace the remainder of the 3'
region of the variable region from the
and to include the 5' residues of the human
constant region up to and including a unique Narl site which had been previously engineered into the
constant region.
A Bindlll site was introduced to act as a marker
for insertion of the linker.
The linker was ligated to the VL fragment and the
413 bp EcoRi-Nari adapted fragment was purified
from the ligation mixture.
The constant region was isolated as an Narl-BamH1 fragment from an M13 clone NW361 and was ligated
with the variable region DNA into an EcoRl;Bamil/ClP pSP65 treated vector in a three
way reaction to yield plasmid JA143. Clones were
isolated after transformation into E.coli and the
linker and junction sequences were confirmed by
the presence of the Hindill site and by DNA
sequencing.
9.2 LIGHT CHAIN GENE CONSTRUCTION - VERSION 2
The construction of the first chimeric light chain
gene produces a fusion of mouse and human amino
acid sequences at the variable-constant region
junction. In the case of the OKT3 light chain
the amino acids at the chimera junction are: ..,.....Leu-Glu-Ile-Asn-Argl -/Thr-Val-Ala -Ala VARIABLE CONSTANT
This arrangement of sequence introduces a
potential site for Asparagine (Asn) linked
(N-linked) glycosylation at the V-C junction.
Therefore, a second version of the chimeric light
chain oligonucleotide adapter was designed in
which the threonine (Thr), the first amino acid of
the human constant region, was replaced with the
equivalent amino acid from the mouse constant
region, Alanine (Ala).
An internal Hindlll site was not included in this
adapter, to differentiate the two chimeric light
chain genes.
The variable region fragment was isolated as a 376
bp EcoR1-Aval fragment. The oligonucleotide
linker was ligated to Narl cut pNW361 and then the
adapted 396bp constant region was isolated after
recutting the modified pNW361 with Eco1. The
variable region fragment and the modified constant
region fragment were ligated directly into
EcoR1/C1P treated pEE6hCMVneo to yield pJA137.
Initially all clones examined had the insert in
the incorrect orientation. Therefore, the insert
was re-isolated and recloned to turn the insert
round and yield plasmid pJA141. Several clones
with the insert in the correct orientation were
obtained and the adapter sequence of one was
confirmed by DNA sequencing 9.3. HEAVY CHAIN GENE CONSTRUCTION 9.3.1. CHOICE OF HEAVY CHAIN GENE ISOTYPE
The constant region isotype chosen for the heavy
chain was human IgG4.
9.3.2. GENE CONSTRUCTION
The heavy chain cDNA sequence showed a Banl site
near the 3' end of the variable region [Fig. 2(a)].
The majority of the sequence of the variable
region was isolated as a 426bp. EcoR1/C1P/Banl
fragment. An oligonucleotide adapter was
designated to replace the remainder of the 3'
region of the variable region from the Bani site
up to and including a unique BindIII site which
had been previously engineered into the first two
amino acids of the constant region.
The linker was ligated to the VH fragment and the
EcoR1-Hindlll adapted fragment was purified from
the ligation mixture.
The variable region was ligated to the constant
region by cutting pJA91 with EcoR1 and Hindlil removing the intron fragment and replacing it with
the VH to yield pJA142. Clones were isolated
after transformation into E.coli JH101 and the
linker. and junction sequences were confirmed by
DNA sequencing; (N.B. The Hindill site is lost
on cloning)-.
10. CONSTRUCTION OF CHIMERIC EXPRESSION VECTORS 10.1. neo AND gpt VECTORS
The chimeric light chain (version 1) was removed
-from pJA143 as an EcoRl fragment and cloned into
EcoR1/C1P treated pEE6hCMVneo expression vector to
yield pJA145. Clones with the insert in the
correct orientation were identified by restriction
mapping.
The chimeric light chain (version 2) was
constructed as described above.
The chimeric heavy chain gene was isolated from pJA142 as a 2.5Kbp EcoR1/BanBl fragment and cloned
into the EcoR1/Bc11/C1P treated vector fragment of
a derivative of pEE6hCMVgpt to yield plasmid
pJA144.
10.2. GS SEPARATE VECTORS
GS versions of pJA141 and pJA144 were constructed
by replacing the neo and gpt cassettes by a BamHl/Sall/C1P treatment of the plasmids,
isolation of the vector fragment and ligation to a
GS-containing fragment from the plasmid pRO49 to
yield the light chain vector pJA179 and the heavy
chain vector pJA180.
10.3. GS SINGLE VECTOR CONSTRUCTION
Single vector constructions containing the cL
(chimeric light), cE (chimeric heavy) and GS genes
on one plasmid in the order cL-cB-GS, or cB-cL-GS and with transcription of the genes being head to
tail e.g. cL > cH > GS were constructed. These
plasmids were made by treating pJA179 or pJA180
with BamE11/C1P and ligating in a Bglll/Bindlll hCMV promoter cassette along with either the Bindlll/BamBl fragment from pJAl4l into pJA180 to
give the cH-cL-GS plasmid pJA182 or the Hindlll/BamH1 fragment from pJA144 into pJA179 to
give the cL-cH-GS plasmid pJA181.
11. EXPRESSION OF CHIMERIC GENES 11.1. EXPRESSION IN COS CELLS The chimeric antibody plasmid pJA145 (cL) and pJA144 (cE) were co-transfected into COS cells and
supernatant from the transient expression
experiment was shown to contain assembled antibody
which bound to the HUT 78 human T-cell line.
Metabolic labelling experiments using 35S
methionine showed expression and assembly of heavy
and light chains. However the light chain
mobility seen on reduced gels suggested that the
potential glycosylation site was being
glycosylated. Expression in COS cells in the
presence of tunicamycin showed a reduction in size
of the light chain to that shown for control
chimeric antibodies and the OKT3 mouse light
chain. Therefore JA141 was constructed and
expressed. In this case the light chain did not
show an aberrant mobility or a size shift in the
presence or absence of tunicamycin. This second
version of the chimeric light chain, when
expressed in association with chimeric heavy (cH)
chain, produced antibody which showed good binding
to HUT 78 cells. In both cases antigen binding
was equivalent to that of the mouse antibody.
11.2 EXPRESSION IN CHINESE HAMSTER OVARY (CEO) CELLS
Stable cell lines have been prepared from plasmids
PJA141/pJA144 and from pJA179/pJA180, pJA181 and pJA182 by transfection into CHO cells.
12. CDR-GRAFTING
The approach taken was to try to introduce
sufficient mouse residues into a human variable
region framework to generate antigen binding
activity comparable to the mouse and chimeric
antibodies.
12.1. VARIABLE REGION ANALYSIS
From an examination of a small database of
structures of-antibodies and antigen-antibody
complexes it is clear that only a small number of
antibody residues make direct contact with
antigen. Other residues may contribute to
antigen binding by positioning the contact
residues in favourable configurations and also by
inducing a stable packing of the individual
variable domains and stable interaction of the
light and heavy chain variable domains.
The residues chosen for transfer can be identified
in a number of ways:
(a) By examination of antibody X-ray crystal
structures the antigen binding surface can
be predominantly located on a series of
loops, three per domain, which extend from
the B-barrel framework.
(b) By analysis of antibody variable domain
sequences regions of hypervariability
[termed the Complementarity Determining
Regions (CDRs) by Wu and Kabat (ref.-5)]
can be identified. In the most but not
all cases these CDRs correspond to, but
extend a short way beyond, the loop regions
noted above.
(c) Residues not identified by (a) and (b) may
contribute to antigen binding directly or
indirectly by affecting antigen binding
site topology, or by inducing a stable
packing of the individual variable domains
and stabilising the inter-variable domain
interaction. These residues may be
identified either by superimposing the
sequences for a given antibody on a known
structure and looking at key residues for
their contribution, or by sequence
alignment analysis and noting idiosyncratic" residues followed by
examination of their structural location
and likely effects.
12.1.1. LIGHT CHAIN Figure 3 shows an alignment of sequences for the human framework region RE1 and the OKT3 light
variable region. The structural loops (LOOP) and
CDRs (KABAT) believed to correspond to the antigen
binding region are marked. Also marked are a
number of other residues which may also contribute
to antigen binding as described in 13.1(c).
Above the sequence in Figure 3 the residue type
indicates the spatial location of each residue
side chain, derived by examination of resolved
structures from X-ray crystallography analysis.
The key to this residue type designation is as
follows:
N - near to CDR (From X-ray Structures)
P - Packing B - Buried Non-Packing
S - Surface E - Exposed
I - Interface * - Interface
- Packing/Part Exposed ? - Non-CDR Residues which may require to be left as Mouse sequence.
Residues underlined in Figure 3 are amino acids.
RE1 was chosen as the human framework because the
light chain is a kappa chain and the kappa
variable regions show higher homology with the
mouse sequences than a lambda light variable
region, e.g. KOL (see below). REl was chosen in
preference to another kappa light chain because
the X-ray structure of the light chain has been
determined so that a structural examination of
individual residues could be made.
12.1.2. HEAVY CHAIN
Similarly Figure 4 shows an alignment of sequences
for the human framework region KOL and the OKT3
heavy variable region. The structural loops and
CDRs believed to correspond to the antigen binding
region are marked. Also marked are a number of
other residues which may also contribute to
antigen binding as described in 12.1(c). The
residue type key and other indicators used in
Figure 4 are the same as those used in Figure 3.
KOL was chosen as the heavy chain framework
because the X-ray structure has been determined to
a better resolution than, for example, NEWM and
also the sequence alignment of OKT3 heavy variable
region showed a slightly better homology to KOL
than to NEW.
12.2. DESIGN OF VARIABLE GENES
The variable region domains were designed with
mouse variable region optimal codon usage
[Grantham and Perrin (ref. 15)) and used the B72.3 signal sequences [Whittle et al (ref. 13)). The
sequences were designed to be attached to the
constant region in the same way as for the
chimeric genes described above. Some constructs
contained the "Kozak consensus sequence" [Kozak
(ref. 16)) directly linked to the 5' of the signal
sequence in the gene. This sequence motif is
believed to have a beneficial role in translation
initiation in eukaryotes.
12.3. GENE CONSTRUCTION
To build the variable regions, various strategies
are available. The sequence may be assembled by
using oligonucleotides in a manner similar to
Jones et al (ref. 17) or by simultaneously
replacing all of the CDRs or loop regions by
oligonucleotide directed site specific mutagenesis
in a manner similar to Verhoeyen et al (ref. 2).
Both strategies were used and a list of
constructions is set out in Tables 1 and 2 and
Figures 4 and 5. It was noted in several cases
that the mutagenesis approach led to deletions and
rearrangements in the gene being remodelled, while
the success of the assembly approach was very
sensitive to the quality of the oligonucleotides.
13. CONSTRUCTION OF EXPRESSION VECTORS
Genes were isolated from M13 or SP65 based
intermediate vectors and cloned into pEE6hCMVneo
for the light chains and pEE6hCMVgpt for the heavy
chains in a manner similar to that for the
chimeric genes as described above.
TABLE 1 CDR-GRAFTED CEHE CONSTRUCTS
ODE MOUSE SEQUENCE HETHOD OF KOZAK
CONTENT CONSTRUCTION SEQUENCE + LIGHT CHAIN All HUMAN FRAHEWORK RE1 121 26-32. 50-56, 91-96 inclusive SDM and gene assembly + n.d.
121A 26-32, 50.56, 91-96 inclusive Partial gene assembly n.d. +
+1, 3, 46, 47 121B 26-32, 50-56, 91-96 inclusive Partial gene assembly n.d. +
+ 46, 47 221 24-24. 50-56. 91-96 inclusive Partial gene assembly + + 221A 24-34, 50-56, 91-96 inclusive Partial gene assembly + +
+1, 3, 46, 47 221B 24-34, 50-56, 91-96 inclusive Partial gene assembly + + 01, 3 221C 24-34, 50-56, 91-96 inclusive Partial gene assembly + +
HEAVY CHAIN ALL HUMAN HUMAN FRAMEWORK KOL 121 26-32, 50-56, 95-1003 inclusive Gene assembly n.d. + 131 26-32, 50-58, 95-100B inclusive Gene assembly n.d. + 141 26-32, 50-65, 95-1008 inclusive Partial gene assembly + n.d.
321 26-35, 50-56, 95-100B inclusive Partial gene assembly + n.d.
331 26-35, 50-58, 95-100B inclusive Partial gene assembly +
Gene assembly S 341 26-35, 50-65, 95-100B inclusive SDM +
Partial gene assembly + 341A 26-35. 50-65, 95-100B inclusive Gene assembly n.d. +
+6, 23, 24, 48, 49, 71, 73, 76,
78, 88, 91 (+63 - human) 341B 26-35, 50-65, 95-1003 inclusive Gene assembly n.d. +
+ 48, 49, 71, 73, 76, 78, 88, 91
(+63 + human) KEY n.d. not done
SDM Site directed mutagenesis
Gene assembly Variable region assembled entirely from oligonucleotides
Partial gene Variable region assembled by combination of restriction
assembly fragments either from other genes originally created by SD?.
and gene assembly or by oligonucleotide assembly of part of
the variable region and reconstruction with restriction
fragments from other genes originally created by SDM and gene
assembly 14. EXPRESSION OF CDR-GRAFTED GENES 14.1. PRODUCTION OF ANTIBODY CONSISTING OF GRAFTED LIGHT
(gL) CHAINS WITH MOUSE HEAVY (mH) OR CHIMERIC HEAVY (cH) CHAINS
All gL chains, in association with mE or cH produced reasonable amounts of antibody.
Insertion of the Kozak consensus sequence at a
position 5' to the ATG (kgL constructs) however,
led to a 2-5 fold improvement in net expression.
Over an extended series of experiments expression
levels were raised from approximately 200ng/ml to
approximately 500 ng/ml for kgL/cH or kgL/mE combinations.
When direct binding to antigen on RUT 78 cells was
measured, a construct designed to include mouse
sequence based on loop length (gL121) did not lead
to active antibody in association with mH or cE.
A construct designed to include mouse sequence
based on Kabat CDRs (gL221) demonstrated some weak
binding in association with mH or cH. However,
when framework residues 1, 3, 46, 47 were changed
from the human to the murine OKT3 equivalents
based on the arguments outlined in Section 12.1
antigen binding was demonstrated when both of the
new constructs, which were termed 121A and 221A
were co-expressed with cH. When the effects of
these residues were examined in more detail, it
appears that residues 1 and 3 are not major
contributing residues as the product of the gL221B
gene shows little detectable binding activity in
association with cE. The light chain product of
gL221C, in which mouse sequences are present at 46
and 47, shows good binding activity in association
with cEI.
14.2 PRODUCTION OF ANTIBODY CONSISTING OF GRAFTED HEAVY (gH) CHAINS WITH MOUSE LIGHT (mL) OR CHIMERIC
LIGHT (cL) CHAINS
Expression of the gH genes proved to be more
difficult to achieve than for gL. First,
inclusion of the Kozak sequence appeared to have
no marked effect on expression of gH genes.
Expression appears to be slightly improved but not
to the same degree as seen for the grafted light
chain.
Also, it proved difficult to demonstrate
production of expected quantities of material when
the loop choice (amino acid 26-32) for CDR1 is
used, e.g. gEl21, 131, 141 and no conclusions can
be drawn about these constructs.
Moreover, co-expression of the gH341 gene with cL
or mL has been variable and has tended to produce
lower amounts of antibody than the cE/cL or mH/mL
combinations. The alterations to gH341 to
produce gH341A and gE341B lead to improved levels
of expression.
This may be due either to a general increase in
the fraction of mouse sequence in the variable
region, or to the alteration at position 63 where
the residue is returned to the human amino acid
Valine (Val) from Phenylalanine (Phe) to avoid
possible internal packing problems with the rest
of the human framework. This arrangement also
occurs in gH331 and gH321.
When gH321 or gH331 were expressed in association
with cL, antibody was produced but antibody
binding activity was not detected.
When the more conservative gH341 gene was used
antigen binding could be detected in association
with cL or mL, but the activity was only
marginally above the background level.
When further mouse residues were substituted based
on the arguments in 12.1, antigen binding could be
clearly demonstrated for the antibody produced
when kgH341A and kgE341B were expressed in
association with cL.
14.3 PRODUCTION OF FULLY CDR-GRAFTED ANTIBODY
The kgL221A gene was co-expressed with kgH341, kgH341A or kgH341B. For the combination kg8221A/kgH341 very little material was produced
in a normal COS cell expression.
For the combinations kgL22lA/kg8341A or kgH221A/kgE341B amounts of antibody similar to
gL/cH was produced.
In several experiments no antigen binding activity
could be detected with kgE221A/gE341 or kgH22lA/kgE341 combinations, although expression
levels were very low.
Antigen binding was detected when kgL221A/kgB341A or kgH221A/kgH341B combinations were expressed.
In the case of the antibody produced from the kgL221A/kg8341A combination the antigen binding
was very similar to that of the chimeric antibody.
An analysis of the above results is given below.
15. DISCUSSION OF CDR-GRAFTING RESULTS
In the design of the fully humanised antibody the
aim was to transfer the minimum number of mouse
amino acids that would confer antigen binding onto
a human antibody framework.
15.1. LIGHT CHAIN 15.1.1. EXTENT OF THE CDRs
For the light chain the regions defining the loops
known from structural studies of other antibodies
to contain the antigen contacting residues, and
those hypervariable sequences defined by Kabat et
al (refs. 4 and 5) as Complementarity Determining
Regions (CDRs) are equivalent for CDR2. For CDR1
the hypervariable region extends from residues
24-34 inclusive while the structural loop extends
from 26-32 inclusive. In the case of OKT3 there
is only one amino acid difference between the two
options, at amino acid 24, where the mouse
sequence is a serine and the human framework RE1
has glutamine. For CDR3 the loop extends from
residues 91-96 inclusive while the Kabat
hypervariability extends from residues 89-97
inclusive. For OKT3 amino acids 89, 90 and 97
are the same between OKT3 and RE1 (Fig. 3).When
constructs based on the loop choice for CDR1 (gL121) and the Kabat choice (gL221) were made and
co-expressed with mE or cH no evidence for antigen
binding activity could be found for gL121, but
trace activity could be detected for the gL221,
suggesting that a single extra mouse residue in
the grafted variable region could have some
detectable effect. Both gene constructs were
reasonably well expressed in the transient
expression system.
15.1.2. FRAMEWORK RESIDUES
The remaining framework residues were then further
examined, in particular amino acids known from
X-ray analysis of other antibodies to be close to
the CDRs and also those amino acids which in OKT3
showed differences from the consensus framework
for the mouse subgroup (subgroup VI) to which OKT3
shows most homology. Four positions 1, 3, 46 and
47 were identified and their possible contribution
was examined by substituting the mouse amino acid
for the human amino acid at each position.
Therefore gL221A (gL221 + D1Q, Q3V, L46R, L47W,
see Figure 3 and Table 1) was made, cloned in
EE6hCMVneo and co-expressed with cB (pJA144). The
resultant antibody was well expressed and showed
good binding activity. When the related genes gL221B (gL221 + D1Q, Q3V) and gL221C (gL221 +
L46R, L47W) were made and similarly tested, while
both genes produced antibody when co-expressed
with cH, only the gL221C/cE combination showed
good antigen binding. When the gLl2lA (gL121 +
D1Q, Q3V, L46R, L47W) gene was made and
co-expressed with cE, antibody was produced which
also bound to antigen.
15.2. HEAVY CHAIN 15.2.1. EXTENT OF THE CDRs
For the heavy chain the loop and hypervariability
analyses agree only in CDR3. For CDR1 the loop
region extends from residues 26-32 inclusive
whereas the Kabat CDR extends from residues 31-35
inclusive. For CDR2 the loop region is from
50-58 inclusive while the hypervariable region
covers amino acids 50-65 inclusive. Therefore
humanised heavy chains were constructed using the
framework from antibody KOL and with various
combinations of these CDR choices, including a
shorter choice for CDR2 of 50-56 inclusive as
there was some uncertainty as to the definition of
the end point for the CDR2 loop around residues 56
to 58. The genes were co-expressed with mL or cL
initially. In the case of the gH genes with loop
choices for CDR1 e.g. go121, go131, gEl41 very
little antibody was produced in the culture
supernatants. As no free light chain was
detected it was presumed that the antibody was
being made and assembled inside the cell but that
the heavy chain was aberrant in some way, possibly
incorrectly folded, and therefore the antibody was
being degraded internally. In some experiments
trace amounts of antibody could be detected in 35S
labelling studies.
As no net antibody was produced, analysis of these
constructs was not pursued further.
When, however, a combination of the loop choice
and the Kabat choice for CDR1 was tested (mouse
amino acids 26-35 inclusive) and in which residues
31 (Ser to Arg), 33 (Ala to Thr), and 35 (Tyr to siS) were changed from the human residues to the
mouse residue and compared to the first series,
antibody was produced for go321, kgH331 and kgH341
when co-expressed with cL. Expression was
generally low and could not be markedly improved
by the insertion of the Kozak consensus sequence
5' to the ATG of the signal sequence of the gene,
as distinct from the case of the gL genes where
such insertion led to a 2-5 fold increase in net
antibody production. However, only in the case
of gH341/mL or kgE341/cL could marginal antigen
binding activity be demonstrated.When the age341 gene was co-expressed with kgL221A, the net
yield of antibody was too low to give a signal
above the background level in the antigen binding
assay.
15.2.2. FRAMEWORK RESIDUES
As in the case of the light chain the heavy chain
frameworks were re-examined. Possibly because of
the lower initial homology between the mouse and
human heavy variable domains compared to the light
chains, more amino acid positions proved to be of
interest. Two genes kgE341A and kgH341B were
constructed, with 11 or 8 human residues
respectively substituted by mouse residues
compared to go341, and with the CDR2 residue 63
returned to the human amino acid potentially to
improve domain packing. Both showed antigen
binding when combined with cL or kgL22lA, the kgE341A gene with all 11 changes appearing to be
the superior choice.
15.3 INTERIM CONCLUSIONS
It has been demonstrated, therefore, for OKT3 that
to transfer antigen binding ability to the
humanised antibody, mouse residues outside the CDR
regions defined by the Kabat hypervariability or
structural loop choices are required for both the
light and heavy chains. Fewer extra residues are
needed for the light chain, possibly due to the
higher initial homology between the mouse and
human kappa variable regions.
Of the changes seven (1 and 3 from the light chain
and 6, 23, 71, 73 and 76 from the heavy chain) are
predicted from a knowledge of other antibody
structures to be either partly exposed or on the
antibody surface. It has been shown here that
residues 1 and 3 in the light chain are not
absolutely required to be the mouse sequence; and
for the heavy chain the gH341B heavy chain in
combination with the 221A light chain generated
only weak binding activity. Therefore the
presence of the 6, 23 and 24 changes are important
to maintain a binding affinity similar to that of
the murine antibody. It was important,
therefore, to further study the individual
contribution of othe other 8 mouse residues of the
kgH341A gene compared to kgH341.
16. FURTHER CDR-GRAFTING EXPERIMENTS
Additional CDR-grafted heavy chain genes were
prepared substantially as described above. With
reference to Table 2 the further heavy chain genes
were based upon the gh341 (plasmid pJA178) and gH341A (plasmid pJA185) with either mouse OKT3 or human KOL residues at 6, 23, 24, 48, 49, .63, 71, 73, 76, 78, 88 and 91, as indicated. The CDRgrafted light chain genes used in these further experiments were gL221, gL221A, gL221B and gL221C as described above.
TABLE 2
OKT3 HEAVY CHAIN CDR GRAFTS 1. gH341 and derivatives
RES NUM 6 23 24 48 49 63 71 73 76 78 88 91
OKT3vh O K A I G F T K S A A Y gH341 E S S V A F R N N L G F JA178 gH34lA O K A I G V T K S A A Y JA185 gH341E O K A I G V T K S A C C JA198 gH341* O K A I G V T K N A G F JA207 gH341* O K A I C V R N N A C F JA209 gH341D O K A I G V T K N L C F JA197 gH341* O K A I G V R N N L G F JA199 gH341C 9 K A V A F R N N L C F JA184 gH341* O S A I G V T K S A A Y JA203 gH341* E S A I G V T K S A A Y JA205 gH341B E S S I C V T K S A A Y JA183 gH341* g S A I C V T K S A G F JA204 gun341* E S A I G V T K S A G F JA206 gH341* O S A I c V T K N A C F JA208 YOL - S S V A R N N L C F OKT3 LIGHT CHAIN CDR GRAFTS 2. gL221 and derivatives
RES NUM 1 3 46 47
OKT3v1 Q V R W
GL221 D Q L L DA221 gL221A Q V R W DA22lA gL22lB Q V L L DA221B
GL221C D Q R W DA221C
RE1 D Q L L
MURINE RESIDUES ARE UNDERLINED
The CDR-grafted heavy and light chain genes were co-expressed in COS cells either with one another in various combinations but also with the corresponding murine and chimeric heavy and light chain genes substantially as described above. The resultant antibody products were then assayed in binding and blocking assays with HPB-AU cells as described above.
The results of the assays for various grafted heavy chains co-expressed with the gL221C light chain are given in
Figures 7 and 8 (for the JA184, JA185, JA197 and JA198 constructs - see Table 2), in Figure 9 (for the JA183,
JA184, JA185 and JA197 constructs) in Figure 10 (for the chimeric, JA185, JA199, JA204, JA205, JA207, JA208 and
JA209 constructs) and in Figure 11 (for the JA1B3, JA184, JA185, JA198, JA203, JA205 and JA206 constructs).
The basic grafted product without any human to murine changes in the variable frameworks, i.e. gL221 co-expressed with gh341 (JA178), and also the "fully grafted" product, having most human to murine changes in the grafted heavy chain framework, i.e. gL221C co-expressed with gh341A (JA185), were assayed for relative binding affinity in a competition assay against murine OKT3 reference standard, using EPB-ALL cells. The assay used was as described above in section 3.3. The results obtained are given in Figure 12 for the basic grafted product and in Figure 13 for the fully grafted product. These results indicate that the basic grafted product has neglibible binding ability as compared with the OKT3 murine reference standard; whereas the "fully grafted" product has a binding ability very similar to that of the OKT3 murine reference standard.
The binding and blocking assay results indicate the following:
The JA198 and JA207 constructs appear to have the best binding characteristics and similar binding abilities, both substantially the same as the chimeric and fully grafted gH341A products. This indicates that positions 88 and 91 and position 76 are not highly critical for maintaining the OKT3 binding ability; whereas at least some of positions 6, 23, 24, 48, 49, 71, 73 and 78 are more important.
This is borne out by the finding that the JA209 and JA199, although of similar binding ability to one another, are of lower binding ability than the JA198 and JA207 constructs. This indicates the importance of having mouse residues at positions 71, 73 and 78, which are either completely or partially human in the JA199 and
JA209 constructs respectively.
Moreover, on comparing the results obtained for the JA205 and JA183 constructs it is seen that there is a decrease in binding going from the JA205 to the JA183 constructs.
This indicates the importance of retaining a mouse residue at position 23, the only position changed between JA205 and JA183.
These and other results lead us to the conclusion that of the 11 mouse framework residues used in the gE341A (JA185) construct, it is important to retain mouse residues at all of positions 6, 23, 24, 48 and 49, and possibly for maximum binding affinity at 71, 73 and 78.
Similar Experiments were carried out to CDR-graft a number of the rodent antibodies including antibodies having specificity for CD4 (OKT4), ICAM-1 (R6-5), TAG72 (so2.3), and TNFet(61E71, 101.4, hTNFl, hTNF2 and hTNF3).
ExAMPLE 2
CDR-GRAFTING OF A MURINE ANTI-CD4 T CELL
RECEPTOR ANTIBODY, OKT4A
Anti OKT4A CDR-grafted heavy and light chain genes were prepared, expressed and tested substantially as described above in Example 1 for CDR-grafted OKT3. The CDR grafting of OKT4A is described in detail in Ortho patent application PCT/GB 90 of even date herewith entitled "Humanised Antibodies". The disclosure of this
Ortho patent application PCT/GB 90 ....... is incorporated herein by reference. A number of
CDR-grafted OKT4 antibodies have been prepared.
Presently the CDR-grafted OKT4A of choice is the combination of the grafted light chain LCDR2 and the grafted heavy chain HCDR10.
THE LIGHT CHAIN
The human acceptor framework used for the grafted light chains was RE1. The preferred LCDR2 light chain has human to mouse changes at positions 33, 34, 38, 49 and 89 in addition to the structural loop CDRs. Of these changed positions, positions 33, 34 and 89 fall within the preferred extended CDRs of the present invention (positions 33 and 34 in CDR1 and position 89 in CDR3).
The human to murine changes at positions 38 and 49 corresponds to positions at which the amino acid residues are preferably donor murine amino acid residues in accordance with the present invention.
A comparison of the amino acid sequences of the donor murine light chain variable domain and the RE1 human acceptor light chain variable further reveals that the murine and human residues are identical at all of positions 46, 48 and 71 and at all of positions 2, 4, 6, 35, 36, 44, 47, 62, 64-69, 85, 87, 98, 99 and 101 and 102.
However the amino acid residue at position 58 in LCDR2 is the human REl framework residue not the mouse OKT4 residue as would be preferred in accordance with the present invention.
THE HEAVY CHAIN
The human acceptor framework used for the grafted heavy chains was KOL.
The preferred CDR graft HCDR10 heavy chain has human to mouse changes at positions 24, 35, 57, 58, 60, 88 and 91 in addition to the structural loop CDRs.
Of these positions, positions 35 (CDR1) and positions 57, 58 and 60 (CDR2) fall within the preferred extended CDRs of the present invention. Also the human to mouse change at position 24 corresponds to a position at which the amino acid residue is a donor murine residue in accordance with the present invention. Moreover, the human to mouse changes at positions 88 and 91 correspond to positions at which the amino acid residues are optionally donor murine residues.
Moreover, a comparison of the murine OKT4A and human .KOL heavy chain variable amino acid sequences reveals that the murine and human residues are identical at all of positions 23, 49, 71, 73 and 78 and at all of positions 2, 4, 6, 25, 36, 37, 39, 47, 48, 93, 94, 103, 104, 106 and 107.
Thus the OKT4A CDR-grafted heavy chain HCDR10 corresponds to a particularly preferred embodiment according to the present invention.
EXAMPLE 3
CDR-GRAFTING OF AN ANTI-MUCIN SPECIFIC MURINE
ANTIBODY, B72.3
The cloning of the genes coding for the anti-mucin specific murine monoclonal antibody B72.3 and the preparation of B72.3 mouse-human chimeric antibodies has been described previously (ref. 13 and WO 89/01783).
CDR-grafted versions of B72.3 were prepared as follows.
(a) B72.3 Light Chain
CDR-grafting of this light chain was accomplished
by direct transfer of the murine CDRs into the
framework of the human light chain RE1.
The regions transferred were:
CDR Number Residues
1 24-34
2 50-56
3 90-96
The activity of the resulting grafted light chain
was assessed by co-expression in COS cells, of
genes for the combinations:
B72.3 cH/B72.3 cL
and B72.3 cH/B72.3 gL
Supernatants were assayed for antibody
concentration and for the ability to bind to
microtitre plates coated with mucin. The
results obtained indicated that, in combination
with the B72.3 cH chain, B72.3 cL and B72.3 gL
had similar binding properties.
Comparison of the murine B72.3 and REI light chain amino acid sequences reveals that the residues are identical at positions 46, 58 and 71 but are different at position 48.
Thus changing the human residue to the donor mouse residue at position 48 may further improve the binding characteristics of the CDR-grafted light chain, (B72.3 gL) in accordance with the present invention.
(b) B72.3 heavy chain
i. Choice of framework
At the outset it was necessary to make a
choice of human framework. Simply put,
the question was as follows: Was it
necessary to use the framework regions from
an antibody whose crystal structure was
known or could the choice be made on some
other criteria?
For B72.3 heavy chain, it was reasoned
that, while knowledge of structure was
important, transfer of the CDRs from mouse
to human frameworks might be facilitated if
the overall homology between the donor and
receptor frameworks was maximised.
Comparison of the B72.3 heavy chain
sequence with those in Kabat (ref. 4) for
human heavy chains showed clearly that
B72.3 had poor homology for KOL and NEWM (for which crystal structures are
available) but was very homologous to the
heavy chain for EU.
On this basis, EU was chosen for the
CDR-grafting and the following residues
transferred as CDRs.
CDR Number Residues
1 27-36
2 50-63
3 93-102
Also it was noticed that the FR4 region of
EU was unlike that of any other human (or
mouse) antibody. Consequently, in the
grafted heavy chain genes this was also
changed to produce a "consensus* human
sequence. (Preliminary experiments showed
that grafted heavy chain genes containing
the EU FR4 sequence expressed very poorly
in transient expression systems.) ii. Results with qrafted heavy chain genes
Expression of grafted heavy chain genes
containing all human framework regions with
either gL or cL genes produced a grafted
antibody with little ability to bind to
mucin. The grafted antibody had about 1%
the activity of the chimeric antibody.
In these experiments, however, it was noted
that the activity of the grafted antibody
could be increased too 10% of B72.3 by
exposure to pHs of 2-3.5.
This observation provided a clue as to how
the activity of the grafted antibody could
be improved without acid treatment. It
was postulated that acid exposure brought
about the protonation of an acidic residue
(pKa of aspartic acid = 3.86 and of
glutamine acid = 4.25) which in turn caused
a change in structure of the CDR loops, or
allowed better access of antigen.
From comparison of the sequences of B72.3
(ref. 13) and EU (refs. 4 and 5), it was
clear that, in going from the mouse to
human frameworks, only two positions had
been changed in such a way that acidic
residues had been introduced. These
positions are at residues 73 and 81, where
K to E and Q to E changes had been made,
respectively.
Which of these positions might be important
was determined by examining the crystal
structure of the KOL antibody. In KOL
heavy chain, position 81 is far removed
from either of the CDR loops.
Position 73, however, is close to both CDRs
1 and 3 of the heavy chain and, in this
position it was possible to envisage that a
K to E change in this region could have a
detrimental effect on antigen binding.
iii. Framework chances in B72.3 gH gene
On the basis of the above analysis, E73 was
mutated to a iysine (K). It was found
that this change had a dramatic effect on
the ability of the grafted Ab to bind to
mucin. Further the ability of the grafted
B72.3 produced by the mutated gH/gL
combination to bind to mucin was similar to
that of the B72.3 chimeric antibody.
iv. Other framework changes In the course of the above experiments,
other changes were made in the heavy chain
framework regions. Within the accuracy of
the assays used, none of the changes,
either alone or together, appeared
beneficial.
v. Other
All assays used measured the ability of the
grafted Ab to bind to mucin and, as a whole,
indicated that the single framework change
at position 73 is sufficient to generate an
antibody with similar binding properties to
B72.3.
Comparison of the B72.3 murine and EU heavy chain sequences reveals that the mouse and human residues are identical at positions 23, 24, 71 and 78.
Thus the mutated CDR-grafted B72.3 heavy chain corresponds to a preferred embodiment of the present invention.
EXAMPLE 4
CDR-GRAFTING OF A MURINE ANTI-ICAM-1 MONOCLONAL ANTIBODY
A murine antibody, R6-5-D6 (EP 0314863) having specificity for Intercellular Adhesion Molecule 1 (ICAM-1) was
CDR-grafted substantially as described above in previous examples. This work is described in greater detail in co-pending application, British Patent Application No.
9009549.8, the disclosure of which is incorporated herein by reference.
The human EU framework was used as the acceptor framework for both heavy and light chains. The CDR-grafted antibody currently of choice is provided by co-expression of grafted light chain gL221A and grafted heavy chain gH34lD which has a binding affinity for ICAM 1 of about 75% of that of the corresponding mouse-human chimeric antibody.
LIGHT CHAIN gL221A has murine CDRs at positions 24-34 (CDR1), 50-56 (CDR2) and 89-97 (CDR3). In addition several framework residues are also the murine amino acid. These residues were chosen after consideration of the possible contribution of these residues to domain packing and stability of the conformation of the antigen binding region. The residues which have been retained as mouse are at positions 2, 3, 48 (?), 60, 84, 85 and 87.
Comparison of the murine anti-ICAM 1 and human EU light chain amino acid sequences reveals that the murine and human residues are identical at positions 46, 58 and 71.
HEAVY CHAIN g8341D has murine CDRs at positions 26-35 (CDR1), 50-56 (cDR2) and94-100B (CDR3). In addition murine residues were used in gH341D at positions 24, 48, 69, 71, 73, 80, 88 and 91. Comparison of the murine anti-ICAM 1 and human EU heavy chain amino acid sequences are identical at positions 23, 49 and 78.
EXAHPLE 5
CDR-Grafting of murine anti-TNFa antibodies
A number of murine anti-TNFa monoclonal antibodies were
CDR-grafted substantially as described above in previous examples. These antibodies include the murine monoclonal antibodies designated 61 E71, hTNFI, hTNF3 and 101.4 A brief summary of the CDR-grafting of each of these antibodies is given below.
61E71
A similar analysis as described above (Example 1, Section 12.1.) was done for 61E71 and for the heavy chain 10 residues were identified at 23, 24, 48, 49, 68, 69, 71, 73, 75 and 88 as residues to potentially retain as murine. The human frameworks chosen for CDR-grafting of this antibody, and the hTNF3 and 101.4 antibodies were REl for the light chain and KOL for the heavy chain.
Three genes were built, the first of which contained 23, 24, 48, 49, 71 and 73 [gH341(6)] as murine residues. The second gene also had 75 and 88 as murine residues [gH341(8)) while the third gene additionally had 68, 69, 75 and 88 as murine residues [g341(10)). Each was co-expressed with gL221, the minimum grafted light chain (CDRs only). The gL221/gH341(6) and gL221/gE341(8) antibodies both bound as well to TNF as murine 61E71.
The gL221/gH341(10) antibody did not express and this combination was not taken further.
Subsequently the gL221/gH341(6) antibody was assessed in an L929 cell competition assay in which the antibody competes against the TNF receptor on L929 cells for binding to TNF in solution. In this assay the gL221/gE341(6) antibody was approximately 10% as active as murine 61E71.
hTNF1 hTNFl is a monoclonal antibody which recognises an epitope on human TNF- . The EU human framework was used for
CDR-grafting of both the heavy and light variable domains.
Beavy Chain
In the CDR-grafted heavy chain (ghTNF1) mouse CDRs were used at positions 26-35 (CDR1), 50-65 (CDR2) and 95-102 (CDR3). Mouse residues were also used in the frameworks at positions 48, 67, 69, 71, 73, 76, 89, 91, 94 and 108.
Comparison of the TNF1 mouse and EU human heavy chain residues reveals that these are identical at positions 23, 24, 29 and 78.
Light Chain
In the CDR-grafted light chain (gLhTNF1) mouse CDRs wre used at positions 24-34 (CDR1), 50-56 (CDR2) and 89-S7 (CDR3). In addition mouse residues were used in the frameworks at positions 3, 42, 48, 49, 83, 106 and 108.
Comparison of the hTNF1 mouse and EU human light chain residues reveals that these are identical at positions 46, 58 and 71.
The grafted hTNF1 heavy chain was co-expressed with the chimeric light chain and the binding ability of the product compared with that of the chimeric light chain/chimeric heavy chain product in a TNF binding assay.
The grafted heavy chain product appeared to have binding ability for TNF slightly better than the fully chimeric product.
Similarly, a grafted heavy chain/grafted light chain product was co-expressed and compared with the fully chimeric product and found to have closely similar binding properties to the latter product.
hTNF3 hTNF3 recognises an epitope on human qNFw . The sequence of hTNF3 shows only 21 differences compared to 61E71 in the light and heavy chain variable regions, 10 in the light chain (2 in the CDRs at positions 50, 96 and 8 in the framework at 1, 19, 40, 45, 46, 76, 103 and 106) and 11 in the heavy chain (3 in the CDR regions at positions 52, 60 and 95 and 8 in the framework at 1, 10, 38, 40, 67, 73, 87 and 105). The light and heavy chains of-the 61E71 and hTNF3 chimeric antibodies can be exchanged without loss of activity in the direct binding assay. However 61E71 is an order of magnitude less able to compete with the TNF receptor on L929 cells for TNF-a compared to hTNF3.Based on the 61E71 CDR grafting data gL221 and gH341(+23, 24, 48, 49 71 and 73 as mouse) genes have been built for hTNF3 and tested and the resultant grafted antibody binds well to TNF-a, but competes very poorly in the L929 assay. It is possible that in this case also the framework residues identified for OKT3 programme may improve the competitive binding ability of this antibody.
101.4 101.4 is a further murine monoclonal antibody able to recognise human TNF-a. The heavy chain of this antibody shows good homology to KOL and so the CDR-grafting has been based on RE1 for the light chain and KOL for the heavy chain. Several grafted heavy chain genes have been constructed with conservative choices for the CDR's (go341) and which have one or a small number of non-CDR residues at positions 73, 78 or 77-79 inclusive, as the mouse amino acids. These have been co-expressed with cL or gL221.In all cases binding to TNF equivalent to the chimeric antibody is seen and when co-expressed with cL the resultant antibodies are able to compete well in the
L929 assay. Bowever, with gL221 the resultant antibodies are at least an order of magnitude less able to compete for TNF against the TNF receptoron L929 cells.
Mouse residues at other positions in the heavy chain, for example, at 23 and 24 together or at 76 have been demonstrated to provide no improvement to the competitive ability of the grafted antibody in the L929 assay.
A number of other antibodies including antibodies having specificity for interleukins e.g. IL1 and cancer markers such as carcinoembryonic antigen (CEA) e.g. the monoclonal antibody ASB7 (ref. 21), have been successfully
CDR-grafted according to the present invention.
It will be appreciated that the foregoing examples are given by way of illustration only and are not intended to limit the scope of the claimed invention. Changes and modifications may be made to the methods described whilst still falling within the spirit and scope of the invention.
References 1. Kohler & Milstein, Nature, 265, 295-497, 1975.
2. Chatenoud et al, (1986), J. Immunol. 137, 830-838.
3. Jeffers et al, (1986), Transplantation, 41, 572-578.
4. Begent et al, Br. J. Cancer 62: 487 (1990).
5. Verhoeyen et al, Science, 239, 1534-1536, 1988.
6. Riechmann et al, Nature, 332, 323-324, 1988.
7. Kabat, E.A., Wu, T.T., Reid-Miller, M., Perry, H.M.,
Gottesman, K.S., 1987, in Sequences of Proteins of
Immunological Interest, US Department of Health and
Human Services, NINE, USA.
8. Wu, T.T., and Kabat, E.A., 1970, J. Exp. Med. 132
211-250.
9. Queen et al, (1989), Proc. Natl. Acad. Sci. USA, 86,
10029-10033 and WO 90/07861 10. Maniatis et al, Molecular Cloning, Cold Spring
Harbor, New York, 1989.
11. Primrose and Old, Principles of Gene Manipulation,
Blackwell, Oxford, 1980.
12. Sanger, F., Nicklen, S., Coulson, A.R., 1977, Proc.
Natl. Acad. Sci. USA, 74 5463 13. Kramer, W., Drutsa, V., Jansen, B.-W., Kramer, B.,
Plugfelder, M., Fritz, H.-J., 1984, Nucl. Acids Res.
12, 9441 14. Whittle, N., Adair, J., Lloyd, J.C., Jenkins, E.,
Devine, J., Schlom, J., Raubitshek, A., Colcher, D.,
Bodmer, M., 1987, Protein Engineering 1, 499.
15. Sikder, S.S., Akolkar, P.N., Kaledas, P.M., Morrison,
S.L., Kabat, E.A., 1985, J. Immunol. 135, 4215.
16. Wallick, S.C., Kabat, E.A., Morrison, S.L., 1988,
J. Exp. Med. 168, 1099 17. Bebbington, C.R., Published Internaticnal Patent
Application WO 89/01036.
18. Granthan and Perrin 1986, Immunology Today 7, 160.
19. Kozak, M., 1987, J. Mol. Biol. 196, 947.
20. Jones, T.P., Dear, P.B., Foote, J., Neuberger, M.S.,
Winter, G., 1986, Nature, 321, 522 21. Harwood et al, Br. J. Cancer, 54, 75-82 (1986).
Claims (23)
1. A CDR-grafted antibody heavy chain having a variable
region domain comprising acceptor framework and donor
antigen binding regions wherein the framework
comprises donor residues at at least one of positions
6, 23 and/or 24, 48 and/or 49, 71 and/or 73, 75
and/or 76 and/or 78 and 88 and/or 91.
2. A CDR-grafted heavy chain according to Claim 1
comprising donor residues at positions 23, 24, 49,
71, 73 and 78, or at positions 23, 24 and 49.
3. A CDR-grafted heavy chain according to Claim 2
comprising donor residues at positions 2, 4, 6, 25,
36, 37, 39, 47, 48, 93, 94, 103, 104, 106 and 107.
4. A CDR-grafted heavy chain according to Claim 2 or 3,
comprising donor residues at one, some or all of
positions:
1 and 3,
69 (if 48 is different between donor and acceptor);
38 and 46 (if 48 is the donor residue),
67,
82 and 18 (if 67 is the donor residue),
91, and
any one or more of 9, 11, 41, 87, 108, 110 and 112.
5. A CDR-grafted heavy chain according to any of the
preceding comprising donor CDRs at positions 26-35,
50-65 and 95-100.
6. A CDR-grafted antibody light chain having a variable
region domain comprising acceptor framework and donor
antigen binding regions wherein the framework
comprises donor residues at at least one of positions
1 and/or 3 and 46 and/or 47.
7. A CDR-grafted light chain according to Claim 6
comprising donor residues at positions 46 and 47.
8. A CDR-grafted antibody light chain having a Variable
region domain comprising acceptor framework and donor
antigen binding regions wherein the framework
comprises donor residues at at least one of positions
46, 48, 58 and 71.
9. A CDR-grafted light chain according to Claim 8
comprising donor residues at positions 46, 48, 58 and
71.
10. A CDR-grafted light chain according to Claim 8 or 9,
comprising donor residues at positions 2, 4, 6, 35,
36, 38, 44, 47, 49, 62, 64-69, 85, 87, 98, 99, 101
and 102.
11. A CDR-grafted light chain according to Claim 9 or 10,
comprising donor residues at one, some or all of
positions:
1 and 3,
63,
60 (if 60 and 54 are able to form a potential
saltbridge),
70 (if 70 and 24 are able to form a potential
saltbridge),
73 and 21 (if 47 is different between donor and
acceptor),
37 and 45 (if 47 if different between donor and
acceptor), and
any one or more of 10, 12, 40, 83, 103 and 105.
12. A CDR-grafted light chain according to any one of
Claims 6-11, comprising donor CDRs at positions
24-34, 50-56 and 89-97.
13. A CDR-grafted antibody molecule comprising at least
one CDR-grafted heavy chain according to any one of
Claims 1-5 and at least one CDR-grafted light chain
according to any one of Claims 6-12.
14. A CDR-grafted antibody molecule according to Claim
13, which is a site-specific antibody molecule.
15. A CDR-grafted antibody molecule according to Claim 13
which has specificity for an interleukin, hormone or
other biologically active compound or a receptor
therefor.
16. A CDR-grafted antibody heavy or light chain or
molecule according to any one of the preceding claims
comprising human acceptor residues and non-human
donor residues.
17. A DNA sequence which codes for a CDR-grafted heavy
chain according to Claim 1 or a CDR-grafted light
chain according to Claim 6 or Claim 8.
18. A cloning or expression vector containing a DNA
sequence according to Claim 17.
19. A host cell transformed with a DNA sequence according
to Claim 17.
20. A process for the production of a CDR-grafted
antibody sequence according to Claim 17 in a
transformed host cell.
21. A process for producing a CDR-grafted antibody
product comprising:
(a) producing in an expression vector an operon
having a DNA sequence which encodes an antibody
heavy chain according to Claim 1;
and/or
(b) producing in an expression vector an operon
having a DNA sequence which encodes a
complementary antibody light chain according to
Claim 6 or Claim 3; (c) transfecting a host cell with the or each vector;
and
(d) culturing the transfected cell line to produce
the CDR-grafted antibody product.
22. A therapeutic or diagnostic composition comprising a
CDR-grafted antibody heavy chain according to Claim
1, or a CDR-grafted light chain according to Claim 6
or Claim 8, or a CDR-grafted antibody molecule
according to Claim 13 in combination with a
pharmaceutically acceptable carrier, diluent or
excipient.
23. A method of therapy or diagnosis comprising
administering an effective amount of a CDR-grafted
heavy chain according to Claim 1, or a CDR-grafted
light chain according to Claim 6 or Claim 8, or a
CDR-grafted antibody molecule according to Claim 13
to a human or animal subject.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB9318912A GB2268745B (en) | 1989-12-21 | 1993-09-13 | Heavy and light chains having a variable domain comprising acceptor framework residues and donor antigen binding residues |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB898928874A GB8928874D0 (en) | 1989-12-21 | 1989-12-21 | Humanised antibodies |
GB9117612A GB2246570B (en) | 1989-12-21 | 1991-08-15 | Antibody molecules having a variable domain comprising acceptor framework residues and donor antigen binding residues |
GB9318912A GB2268745B (en) | 1989-12-21 | 1993-09-13 | Heavy and light chains having a variable domain comprising acceptor framework residues and donor antigen binding residues |
Publications (3)
Publication Number | Publication Date |
---|---|
GB9318912D0 GB9318912D0 (en) | 1993-10-27 |
GB2268745A true GB2268745A (en) | 1994-01-19 |
GB2268745B GB2268745B (en) | 1994-05-11 |
Family
ID=26296405
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
GB9318912A Expired - Lifetime GB2268745B (en) | 1989-12-21 | 1993-09-13 | Heavy and light chains having a variable domain comprising acceptor framework residues and donor antigen binding residues |
Country Status (1)
Country | Link |
---|---|
GB (1) | GB2268745B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7022500B1 (en) | 1988-12-28 | 2006-04-04 | Protein Design Labs, Inc. | Humanized immunoglobulins |
-
1993
- 1993-09-13 GB GB9318912A patent/GB2268745B/en not_active Expired - Lifetime
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7022500B1 (en) | 1988-12-28 | 2006-04-04 | Protein Design Labs, Inc. | Humanized immunoglobulins |
Also Published As
Publication number | Publication date |
---|---|
GB2268745B (en) | 1994-05-11 |
GB9318912D0 (en) | 1993-10-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
USRE48787E1 (en) | Humanised antibodies | |
EP0460167B1 (en) | Humanised antibodies | |
US6750325B1 (en) | CD3 specific recombinant antibody | |
CA2129219C (en) | Humanised antibodies | |
GB2268745A (en) | Humanised antibodies. |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
773H | Revocation action is not pursued (sect. 73(2)/1977) | ||
PE20 | Patent expired after termination of 20 years |
Expiry date: 20101220 |