GB2112395A

GB2112395A - Recombinant cloning vector

Info

Publication number: GB2112395A
Application number: GB08231598A
Authority: GB
Inventors: Andrew Easton; Paul Gavin Boseley; Patrick Slocombe; Derek Clissold Burke
Original assignee: Wellcome Foundation Ltd
Current assignee: Wellcome Foundation Ltd
Priority date: 1981-11-06
Filing date: 1982-11-05
Publication date: 1983-07-20
Also published as: GB2112395B; FR2516094A1; IT1149394B; IT8249433A0; DE3240960A1

Abstract

A recombinant cloning vector suitable for transformation of a host microorganism comprising a male- specific, single stranded DNA bacteriophage which has a double- stranded intracellular intermediate having inserted into its double stranded DNA a homologous promoter and, in correct orientation, a DNA sequence coding for a preselected, heterologous polypeptide, so that a host microorganism transformed by the cloning vector is capable of expressing the preselected, heterologous polypeptide in recoverable form is disclosed together with microorganisms transformed by said vectors and the use thereof in the production of said heterologous polypeptide. The preferred peptide is an interferon.

Description

SPECIFICATION Polypeptide expression by transformed host microorganism This invention relates to a method of obtaining enhanced polypeptide expression in a transformed host microorganism and to the recombinant cloning vector and transformed host employed in this method.

In the field of genetic engineering, it is well known to use recombinant DNA techniques to transform a host microorganism, e.g. a bacterium or yeast, by inserting into that host a recombinant cloning vector containing a DNA fragment which codes for a preselected polypeptide. In order to direct the host to express the sequence of that DNA fragment as a polypeptide, it is necessary to ensure that the inserted DNA can be transcribed and translated and also replicated within the host.

One method of achieving this so-called transformation involves the use of, as vector, a small circular piece of DNA which can replicate by itself. This is termed a plasmid and will usually consist of 3-10 x 103 base pairs coding for a few genes. A DNA sequence coding for a preselected polypeptide can be introduced into the plasmid by known techniques and the recombinant plasmid so produced transformed into the host. These plasmids are maintained in several copies, usually 20-30 per cell, inside the host by the host's own gene functions, and by suitable means the recombinant host can be induced to express the preselected polypeptide.

An alternative vector for use in transformation is a virus which will grow in the host, e.g. a bacteriophage in the case of a bacterial host. Bacteriophages, or phages as they are also known, normally have at least 10 genes of their own, compared with several thousand in a bacterium and a DNA sequence coding for a preselected polypeptide can similarly be introduced into the DNA of the phage. The bacterial host, which enables the DNA of the phage to be transcribed and translated, is therefore able to express the preselected polypeptide.

Various limitations in these methods have been found. In many cases, the yield of the preselected polypeptide is insufficiently high. This can result from several causes; in the case of transformation with viruses, the virus may kill at least some cells of the host thereby reducing the yield. For this reason, only so-called "temperate" viruses will usually be considered suitable. Alternatively, the host may produce a repressor to repress transcription of the genes in the recombinant vector in order to prevent the products of those genes from interfering with its own system, and it may not be possible to overcome the effects of this repressor adequately.

It has now been found in accordance with the present invention, that yields of a preselected polypeptide from a transformed host microorganism may be enhanced by the use of a particular type of bacteriophage as carrier in preparing the recombinant cloning vector. More specifically, the recombinant cloning vector is prepared from a male-specific, single-stranded DNA bacteriophage which has a double-stranded intracellular intermediate. Phages which fall within the scope of this definition are of the "M 13" type.

M13 phages are already known and have been used extensively in DNA sequencing techniques whereby a fragment of double-stranded DNA is inserted into a known position in the DNA of the phage which is then cloned in E.coli. The phages which "bud out" of the bacterium contain the single-stranded form of DNA and can be isolated. The DNA sequence of a single strand of the inserted fragment can then be determined by conventional techniques in which a restricted number of sequences complementary to the original strand of inserted DNA are produced and analysed on polyacrylamide gels (see Sanger, Nicklen and Coulson (1978) Proc.Nat.Acad.Sci. 74 5463-7).

Despite this known use for the Ml 3 phages, it has never been suggested that they could be used for the expression of a heterologous polypeptide in a host, e.g. a bacterium such as E.coli. These phages have a high copy number of 80-100 per cell, but this fact does not necessarily indicate an ability to achieve high expression of the genes in the Ml 3 DNA. While plasmids use most of their copies for transcription, phages have other functions and use some for transcription, some for replication.

Accordingly, the copy number of a phage cannot be regarded as an indication of the number of copies available for useful transcription.

Ml 3 phages are always infectious and not temperate, hence they cannot be regulated and would apparently be insufficiently controllable for use as a recombinant cloning vector. Furthermore, the double-stranded form of Ml 3 (which is an intermediate in the production of new, infective singlestranded phages and is the form necessary for transcription) was thought to be a transient form, and this did not suggest the possibility of achieving high levels of useful transcription.

Surprisingly, it has been found in accordance with this invention that recombinant cloning vectors prepared from Ml 3 phages can in some instances be induced to produce at least 1 0-fold higher yields of polypeptides than the prior art techniques. Accordingly, the present invention provides a malespecific, single-stranded DNA bacteriophage which has a double-stranded intracellular intermediate, for use in expression of a preselected, heterologous polypeptide in recoverable form in a host microorganism. (The term "heterologous" is used to indicate that the polypeptide is not one which would normally be made by the host microorganism).

The present invention also provides a recombinant cloning vector suitable for transformation of a host microorganism, comprising a male-specific, single-stranded DNA bacteriophage which has a double-stranded intracellular intermediate having inserted into its double-stranded DNA, a homologous promoter and, in correct orientation, a DNA sequence coding for a preselected, heterologous polypeptide, so that a host microorganism transformed by the bacteriophage is capable of expressing the preselected, heterologous polypeptide in recoverable form. (The term "homologous" is used to indicate that the promoter is one which is normally also possessed, and is certainly recognised, by the host microorganism). Particular examples of such a vector are W1 4 and W8 described in Example 1 which follows.

The homologous promoter is introduced into the M13 DNA to provide a means of initiating transcription of the DNA sequence coding for the preselected polypeptide. In general, especially when the host is E.coli, this is preferably the lac promoter. The promoter is the site at which RNA polymerase binds to commence transcription. In a preferred embodiment, the promoter is present in conjunction with a operator which is the site which binds repressors formed by the host. By the use of an appropriate inducer to free the operator as described hereinafter, the expression of the preselected polypeptide can be controlled, and will not then occur constitutively as is the case when only the promoter is present.The ability to control expression in this way is most desirable since otherwise the host microorganism could accumulate large quantities of a polypeptide for which it has no use and this could lead to rejection of the bacteriophage cloning vector from the host.

In Example 1 which follows, a sequence, including inter alia the lac promoter and operator regions, was inserted into the intergenic region between genes IV and II of the M13 DNA. It is preferred, in accordance with this invention, to insert the promoter or promoter/operator system into the intergenic region of the phage DNA so as not to disrupt any of the phage's own genes which could disrupt phage function and possibly replication.

The sequence of DNA coding for the preselected polypeptide is desirably a gene or DNA sequence existing in nature. The gene or DNA sequence may be obtained from an appropriate cell source in accordance with conventional techniques. These may involve isolating the gene or DNA sequence directly by restriction enzyme treatment of the genome, followed by cloning. The technique of direct isolation of the gene or DNA sequence can be used where that gene or DNA sequence includes no introns, as is the case with genes coding for interferon.Alternatively, especially where the appropriate gene or DNA sequence does include introns which would need to be excised, the techniques may involve isolating messenger RNA (mRNA) from the cell source, copying the genetic information in this mRNA into a single strand of complementary DNA (cDNA) by the use of reverse transcriptase, destroying the mRNA template and using a DNA polymerase to form a second strand of DNA against this first strand. The two strands of DNA at this point are contiguous, being linked by a single-stranded region of DNA. This single-stranded region is then digested using a nuclease to produce the doublestranded DNA. In Example 1 which follows, the gene sequence was cloned into a plasmid. This is not an essential step, but is helpful to identify the gene.

In an alternative method, it is unnecessary to isolate a gene or DNA sequence from nature. Thus, it is possible to build up a sequence of synthetic DNA coding for the preselected polypeptide and insert this into the phage DNA at an appropriate point. Whichever of these methods is used, it is desirable that the DNA sequence will have a high proportion of codons which are preferred by the host for expression of the particular amino acids.

The promoter region and DNA sequence coding for the preselected polypeptide can be inserted into the phage DNA either separately or at the same time. Such insertions can be achieved by insertion of the DNA sequence, using a ligase, into the phage DNA, itself cleaved by a restriction endonuclease.

The DNA sequence can be cleaved to produce blunt ends which are ligated as described in Example 1 which follows, or cleaved to produce cohesive, or "sticky", ends which act as sites for insertion using T4 ligase. Alternatively, it is possible to extend one or both DNA strands by a certain number of bases which are complementary to the same number of bases introduced into the cleaved phage DNA and then to insert this modified DNA sequence into the modified phage DNA.

The preselected polypeptide for which the DNA sequence codes will suitably be a complete protein, a particular example of which is interferon (as defined hereinafter). There are three types of interferon (IFN) known: (r(lymphoblastoid or from leucocytes), from fibroblasts) and y(from cells in the immune system). The specific Examples which follow describe the production of interferon-r2 which represents a component of the lymphoblastoid interferon, contains 1 65 amino acids and has a molecular weight of about 20,000. Other types and components of interferon may be prepared in accordance with the present invention, as well as other proteins and polypeptides.

In order to produce the preselected polypeptide, the recombinant cloning vector of the present invention must be transformed into a host. The host will generally be a bacterium, notably male E.coli, and should desirably be such that it does not break down the preselected polypeptide or can be prevented from so doing. The host should also desirably be able to grow well despite the phage infection and the fact that it may be producing large amounts of material for which it has no use. (The DNA sequence inserted into the DNA of the Ml 3 carrier will code for a polypeptide which is heterologous to, i.e. not normally produced by, the host microorganism which is being transformed, while the promoter or promoter/operator system will be homologous to the host). The techniques for achieving infection of a host to effect transformation are well-known in the art.

A further embodiment of the present invention is thus a method of transforming a host microorganism, especially E.coli, to render it capable of expressing a heterologous polypeptide, by infecting that host with a recombinant cloning vector of the present invention. The host microorganism thus transformed which can express the preselected heterologous polypeptide in recoverable form also represents an embodiment of the present invention. A particular example of a transformed host microorganism is E.coliJM103 (W14) as described in Example 2 which follows. The transformed host microorganism will generally be provided in a culture system containing a synthetic nutrient culture medium for the host.

After infection, it may be necessary to induce the transformed host microorganism to manufacture the preselected polypeptide coded for in the recombinant cloning vector, especially where an operator has been introduced in conjunction with the promoter. This will normally be achieved by adding an appropriate inducer, i.e. a substance which deactivates any repressor protein formed by the host, thereby freeing the operator and permitting RNA polymerase to bind to the promoter and commence transcription. The appropriate inducer to use will depend on the chosen promoter/operator system inserted in the phage DNA.Preferably the DNA sequence will be inserted downstream of a lac promoter and operator; transcription of this DNA sequence can then be achieved by adding a substance which will free the lac operator and start the transcription of the ,B-galactosidase sequence. Such an inducer is I PTG (isopropyl- 1 -thio-P-D-galactopyra noside).

Preferably, there will be a stop signal at the 3'-end of the sequence coding for the preselected polypeptide, so that the product produced by translation of the mRNA may comprise the desired polypeptide having, for example, some of the P-galactosidase amino acids attached at the 5'-end only. If desired, this amino acid sequence can then be cleaved to leave merely the preselected polypeptide.

Preferably, the polypeptide product will contain as few amino acids which do not belong to the preselected polypeptide as possible. It is particularly desirable to insert the DNA sequence coding for the preselected polypeptide with only three bases separating it from the start sequence. These three bases will be adenine-uracil-guanine (AUG) which code for methionine.

The product may be removed from the host by lysing the host and then isolating the desired material, e.g. by centrifugation. This can then be purified by conventional techniques, e.g. by immunochromatography.

Accordingly, a further embodiment of the present invention is a process for producing a preselected heterologous polypeptide by expression of a recombinant cloning vector, which process comprises culturing a host microorganism into which the recombinant cloning vector of the present invention has been transformed; if necessary, inducing production of the heterologous polypeptide, and isolating the heterologous polypeptide produced.

The heterologous polypeptide produced by the above process also forms an embodiment of the present invention. As indicated above, the polypeptide product may contain superfluous amino acids which are desirably cleaved and the preselected polypeptide (protein) is preferably an interferon. (For the purposes of this specification, "an interferon" is to be understood as "a protein which exerts virus nonspecific, antiviral activity at least in homologous cells through cellular metabolic processes involving synthesis of both RNA and protein", which is the definition accepted by the committee assembled under the sponsorship of the National Institute of Allergy and Infectious Diseases and the World Health Organisation -- U.S. National Centre on Interferon to devise a system for the orderly nomenclature of interferons).

The present invention will now be further described with reference to the following Examples.

EXAMPLE 1 A recombinant cloning vector was produced by the following method: mRNA was obtained from Sendai virus-induced Namalwa cells (Namalwa cells being a lymphoblastoid cell line formed by transforming leucocytes with Epstein Barr virus and having ATCC deposit No. CRL 1432, deposited 7th July 1978), and this mRNA was enriched for interferon mRNA. A fraction of this enriched mRNA was used to produce cDNA, which itself was used to form a doublestranded DNA sequence by conventional techniques. This DNA sequence was then cloned into the Bam Hl site in the tetracycline gene of the plasmid pAT 1 53 and transformed into a restrictionless E.coli.

strain HB101.

The interferon-x2 gene sequence, identified in clone N5H8, was cut out using the restriction enzyme Msp-1, purified by agarose gel electrophoresis and labelled with a(32P)dCTP and cold dGTP using the Klenow fragment of DNA-polymerase 1. The resulting radioactive fragment had blunt ends and was then partially digested with restriction enzyme Pvu-ll. (The fragment was known to contain two Pvu II restriction sites, one at nucleotides + 42 to + 46 in the signal sequence and the other at + 344 to + 349 in the coding sequence, and digestion was such as to ensure only one cleavage per molecule).

The products were separated by agarose gel electrophoresis and the larger fragment produced by the digestion, having a Pvu-ll site at the 5' end and an Msp-1 site at the 3' end, was isolated.

The bacteriophage used in this Example was Ml 3 mp 7, an Ml 3 phage into which had been inserted the Hind II fragment isolated from E.coli. The Hind II fragment consists of lac promoter, lac operator, and part of the lac-Z gene (which codes for the so-called o-peptide having 145 amino acids) and, inserted into the lac-Z DNA, a 42 base-pair Eco RI fragment containing several single cloning sites (Bam HI, Sal I, Pst l,Acc I and Hinc II). The Hind II fragment was inserted in the intergenic region between genes IV and II by the use of restriction enzyme Bsul to cleave the phage DNA and a ligase to effect the insertion.

The DNA of bacteriophage Ml 3 mp7 was cleaved with restriction enzyme Hinc II which cleaves the inserted lac-Z gene fragment, and the new DNA sequence coding for interferon produced as described above was inserted into the opening by blunt end ligation using T4 DNA ligase. Self ligation of the new DNA sequence was prevented by treatment with bacterial alkaline phosphatase.

Plaques produced by the bacteriophage were then probed with the cloned IFN-a2 DNA fragment (produced as indicated above and radioactively labelled), and 18 positive clones identified, i.e. clones having a lac gene interrupted by a sequence coding for IFN-α2. DNA from 8 of these isolates was sequenced at the 3' end to determine orientation, and two transformants, designated W8 and W14 were shown to contain the new DNA sequence in correct orientation. Sequencing at the 5' end showed the inserted DNA to be in phase with the lac gene fragment of Ml 3 mp7.

W14 was found to have inserted a sequence coding for the 165 amino acids of mature interferon α2 and, at the end coding for the N-terminal of the interferon, an additional sequence coding for 19 amino acids. Of these 19 amino acids, 11 belong to M13 mp7 p-galactosidase and 8 are amino acids forming part of the IFN-a2 membrane transport signal sequence.

The following diagrams illustrate: (I) the section of the Ml 3 mp 7 DNA which includes the cloning sites ; (II) the amino acids coded for around the Hinc II cloning site in the M13 mp 7 DNA ; (III) part of the leader sequence of interferon-α2 coding for amino acids S1 to S23 which are cleaved in mammalian cells ; and (IV) part of the recombinant sequence. the first 32 bases being derived from (II) by Hinc II cleavage and the subsequent bases being derived from (III) by Pvu-II cleavage.

Lac Z gene transcription

ATGACCATGATTACGAATTCCCCGGATCCGTCCTGCAAGTCAAGTTGCTCTGTGGGC TGT MetThrMetlleThrAsnSerProAspProSerCysLysSerSerCysSerValGly Cys (IV) S1 S10 S19 EXAMPLE 2 In this Example, E.coli K 1 2 (JM 103) was used as host. This E.coli has the following mutations: A lacpro, thi, strA, endA, sbc B15, hsc R4, sup E, F'tra D36, pro AB, lac 1, ZM15 and is K12 restrictionless but modification plus.

An overnight culture of E.coli K 12 (JM 103) was subcultured and grown in YT broth (5 g/l NaCI, 5 g bacto yeast extract and 8 g bacto tryptone) at 370C till it roughly reached mid-log phase (about 108 bacteria/ml, OD590 = 0.8). 1 0 ml of these bacteria were then infected with the recombinant cloning vector W14 (see Example 1) at a multiplicity of infection of 1 00 pfu/cell for 5 minutes at 300C before transfer to 1 litre of pre-warmed YT broth at 37"C.

After 2 hours growth with gentle shaking, an inducer of the lac operon, lPTG, was added in a concentration of 0.5 mM.

After a further 1 21 2 hours growth, the cells were harvested and resuspended in 20 ml of lysis buffer (50 mM Tris-CI pH 8.0 and 30 mM NaCI) containing 1 mg/ml lysozyme.

The bacteria were lysed after 30 minutes on ice by three freeze-thaw cycles. An S--l 00 (i.e.

material remaining in the supernatant after spinning at 100,000 g) was then isolated by centrifugation in an SW40 rotor.

The material, which was produced in yields up to 2 x 109 units/litre, was finally purified by immunochromatography on a Sepharose column to which was bound the IgG from NK2 (NK2 being a hybrid myeloma cell line secreting mouse monoclunal antibodies to lymphoblastoid interferon, see Secher and Burke, Nature 285 446-450), though any other appropriate material capable of undergoing an immune reaction with interferon a2 would be suitable. The retained interferon was eluted with pH 2 buffer.

The product thus purified behaved in the same way as interferon in that it showed the expected antiviral activity on heterologous cells (see below) and was recognised in an immunoradiometric assay as efficiently as interferon produced by Namalwa cells. Also, as expected, the product was neutralised by a polyclonal antibody against interferon-a. Electrophoresis of the product in a 1025% polyacrylamide gradient gel revealed the presence of a single stained band which contained all the interferon anti-viral activity.

The process of this Example was repeated using recombinant cloning vector W8 in place of W14.

In tests on heterologous cells, interferon produced by W8 and W14 showed the same pattern of activity as interferon produced by Namaiwa cells. The cells tested were: human trisomic cells, bovine EBTR cells, human diploid cells and mouse L cells and for the interferon from each of the three sources, this order represents the order of decending activity. (Human trisomic cells are trisomic in respect of chromosome 21 which includes the interferon receptor so that the relatively high activity found in these cells was to be expected).

The transformed host micro-organism E.coll JM 1 03 (W14) has been deposited with the National Collection of Industrial Bacteria (N.C.I.B.) at the Torry Research Station, Aberdeen, Scotland on 12th November 1981 and has been given the accession no. 11704.

Claims

1. A recombinant cloning vector suitable for transformation of a host microorganism comprising a male-specific, single stranded DNA bacteriophage which has a double-stranded intracellular intermediate having inserted into its double-stranded DNA a homologous promoter and, in correct orientation, a DNA sequence coding for a preselected, heterologous polypeptide, so that a host microorganism transformed by the cloning vector is capable of expressing the preselected, heterologous polypeptide in recoverable form.

2. A recombinant cloning vector as claimed in claim 1 wherein the homologous promoter is a lac promoter.

3. A recombinant cloning vector as claimed in claim 1 or claim 2 wherein the promoter is present in conjunction with an operator.

4. A recombinant cloning vector as claimed in any one of claims 1 to 3 wherein the preselected, heterologous polypeptide is an interferon.

5. A recombinant cloning vector as claimed in any one of claims 1 to 4 wherein the preselected heterologous polypeptide is an a-interferon.

6. A recombinant cloning vector as claimed in claim 5 wherein the interferon is interferon (r2.

7. A recombinant cloning vector as claimed in any one of claims 1 to 6 wherein the bacteriophage isM13mp7.

8. The recombinant cloning vector W14.

9. A microorganism transformed by a cloning vector as defined in any one of claims 1 to 8.

10. A microorganism as claimed in claim 9 which microorganism is an E.coli.

11. A microorganism as claimed in claim 10 which microorganism is E.coliJM103 (W14).

1 2. A method for the production of a preselected heterologous polypeptide by expression of a recombinant cloning vector which comprises culturing a host microorganism as defined in any one of claims 9 to 11, if necessary inducing production of the polypeptide and isolating the so-produced polypeptide.

1 3. A male-specific, single stranded DNA bacteriophage which has a double-stranded intracellular intermediate, for use in expression of a preselected, heterologous polypeptide in recoverable form in a host microorganism.