FR3026735A1 - PROCESS FOR DESALTING SALT EFFLUENTS MICROBIOLOGICALLY. - Google Patents

Abstract

The invention relates to a method for desalting a salty medium comprising a biological treatment step with at least one desalting halophilic bacterium, said desalting halophilic bacterium having a growth rate of between 0.005 h and 0.5 h in said saline medium comprising between 1 g / L and 200 g / L of sodium chloride NaCl.

Description

Process for the desalination of salted effluents microbiologically. FIELD OF THE DISCLOSURE The field of the invention is that of the desalination of salty effluents.

More specifically, the invention relates to a biological desalination process of salty environments such as seawater, industrial effluents and brackish water. 2. Prior art Access to drinking water is a priority for many countries around the world, both for economic, ecological and public health reasons. An alternative to producing drinking water for these countries is the desalination of brackish water or seawater. Currently, methods for producing drinking water from salt water are based on: - either thermal evaporation processes, such as multi-stage flash evaporation or multi-effect evaporation; - Or on a reverse osmosis membrane process requiring upstream pretreatment of seawater (clarification and filtration of saltwater); - Or on an electrodialysis process requiring upstream pretreatment of seawater (clarification and filtration of salt water). It should be noted that for media with salinity greater than 6 g / L (0.1 M NaCl), the energy consumption of electrodialysis becomes significantly greater than that of reverse osmosis. These techniques are now well mastered but have the major disadvantage of being particularly expensive, particularly because of the large energy consumption they require for their implementation. To alleviate this problem, various development works are underway to lead to new sectors that consume less energy for the treatment of salt water. Some of these alternatives rely on the use of mechanisms of biological origin, and this with the aim of significantly reducing external energy supply.

The application WO-2010/124079-A discloses in particular a method for desalinating water via an electrochemical cell. The energy for the operation of the cell is provided by electron donor microorganisms. However, this hybrid process decoupling the production of an energy potential difference and an electrodialysis cell energetically powered by this first, is only the result of a juxtaposition of a biological process for generating electrical energy (battery bacteria) and electrodialysis, a proven technique for the separation of dissolved salts. Due to its intrinsic characteristics, electrodialysis is a technology of interest for removing dissolved salts of salt water at NaCl concentrations of less than 0.1 M. However, and as previously stated, for salinities higher than these values. electrodialysis becomes a much more energy-consuming process than reverse osmosis and therefore loses all economic interest. Another approach recently proposed, and still remaining at a conceptual stage, is to use genetically modified cyanobacterial strains to remove dissolved salts (J.M.Amezaga et al., Plant Physiology, 2014, 164 (4): 1661). More precisely, these strains of cyanobacteria use the energy of light to pump dissolved salts into the medium in which they evolve. Thus, the energy for the operation of the process comes from light, a source of energy universally available and inexpensive. However, many constraints limit the transposition of this process on an industrial scale. First, the use of genetically modified strains is expensive because of the very production of these strains. In addition, the authors identify numerous obstacles to industrial exploitation of their proposal and in particular the need for sufficient access to light for cyanobacteria in large industrial tanks. In addition, the step of recovery of bacteria remains problematic, the current separation techniques causing the destruction of cyanobacteria. Moreover, the installations to be used for the operation of this process are radically different from those generally used for the treatment of water. This means that existing water treatment facilities could not be recycled for the implementation of the process described in this publication, but ad-hoc desalination plants should be designed, manufactured and installed according to location and needs. . In industrial terms, such requirements are costly and burdensome.

Finally, the implementation of genetically modified microorganisms often poses a problem of acceptance by the populations, particularly in terms of safety in case of accidental release into the environment of these genetically modified microorganisms. Also, although different alternatives have been explored to make the conventional desalination processes completely energy-independent or at least limit this dependence, no satisfactory and industrially exploitable solution has yet been proposed. 3. OBJECTIVES OF THE INVENTION The object of the invention is notably to overcome these disadvantages of the prior art. More specifically, an object of the invention is to provide, in at least one embodiment, a method for reducing the salinity, and especially the chloride ion concentration, of salty media.

Another objective of the invention is to implement, in at least one embodiment, such a method that consumes less energy than conventional methods such as evaporation, reverse osmosis and electrodialysis. The invention also aims to implement, in at least one embodiment, a method for reducing the content of dissolved salts, including chloride ions, salty environments while being safe for the environment. 4. Discussion of the Invention These and other objectives which will become apparent are achieved by a salty desalting process. According to the invention, the process comprises a biological treatment step with at least one desalting halophilic bacterium, said desalting halophilic bacterium having a growth rate of between 0.005 h and 0.5 h in said salt medium comprising between 1 g / L and 200 g / L sodium chloride NaCl. Thus, the invention is based on a completely new and original approach to exploit the ability of certain bacteria to survive and multiply in a medium comprising large amounts of chloride. The counter-ion of the chloride ions may be sodium Na + or potassium K. More precisely, the invention uses the capacity of certain bacteria, especially the halophilic bacteria, to carry dissolved salts, such as chloride, potassium or sodium ions, especially in the growth phase (cell division). The invention is therefore based on maintaining cell division so as to maximize the mechanism of ion transport across the cell membrane. In other words, the process according to the invention may comprise the steps of: - providing at least one desalting halophilic bacterium, and - cultivating said desalting halophilic bacterium at a growth rate of between 0.005 h and 0.5 h ' in said salt medium comprising between 1 g / l and 200 g / l of sodium chloride NaCl. "Desalination" means a co-elimination of Cl and Na + which results in a reduction of the sodium chloride concentration of at least 10%, preferably at least 20%, more preferably at least 20%. 25% relative to the initial sodium chloride concentration. The term "salty medium" means an effluent whose chloride ion concentration is at least 0.05 M. "Osmolyte" is understood to mean an organic molecule making it possible to combat osmotic stress. Examples of the osmolyte include small carbohydrates such as trehalose, sorbitol, inositol, glycerol and polyols; amino acids such as proline, glycine and methylamines such as glycine betaine. It should be noted that the terms "Bacteria (s)" and "bacteria (s)" are not interchangeable in this application. The term "Bacteria (s)" refers to the Bacteria kingdom, previously known as Eubacteria, in taxonomy. This term "Bacteria (s)" (Bacteria with first capital letter) may also be referred to as "bacteria (reign)" in the application. The term "bacterium (s)" refers to the bacterial cell and can therefore also be identified by the terms "strain", "biomass" or "cell".

Different modes of operation of the halophilic bacteria have been described (Aharon Oren et al., Microbial life at high concentrations: phylogenetic and metabolic diversity, Saline Systems, 2008 (4) 2- doi: 10.1186 / 1746-1448-4-2) . According to the author of this review, microorganisms mainly develop two strategies for surviving in a salty environment: - the first strategy involves the accumulation of Cl- ions and a counterion (K + or Na) in the cytoplasm ( referred to in the literature as "know-in strategy"); and the second involves maintaining the water in the cell through the accumulation of organic solutes that do not interfere with the metabolism of the bacteria (referred to in the literature as "osmotic solutes-in strategy"). More specifically, the first strategy ("know-in strategy") is that developed by extreme halophilic bacteria, such as Archaea Halobactericeae, which are present in particular ecological niches such as the Red Sea, Dead Sea, salt marshes, etc. These bacteria can only live at Cl- concentrations between 2.5 (146 g / L NaCl) and 5.2M (304 g / L NaCl), as defined by Donn Kushner (Di Kushner, Life in high). know and solute concentrations, Microbial Life in Extreme Environments, Academia Press, London, 1978: 317-368). These bacteria need Cl-, which they absorb into the cytoplasm, for their growth and multiplication. Some rhodopsins and halorhodopsins involved in the transport of Cl- ions of extreme halophilic bacteria are described in the scientific literature. In contrast, at present, the proteins involved in the transport of Cl ions in the cytoplasm of Halobacillus halophilus are not identified.

It is important to note that extreme halophilic bacteria are unable to survive in media in which the NaCl concentration is less than 2.5M. Therefore, these microorganisms can not be used to desalt effluents such as seawater whose NaCl concentration is less than 2.5 M. The second strategy ("osmotic solutes-in strategy") is the one by the halotolerant bacteria that can survive in media whose salt concentration is less than or equal to 0.5M NaCl, according to the definition of Donn Kushner (Di Kushner, Life in high knows and solute concentrations, Microbial Life in Extreme Environments, Academia Press, London, 1978: 317-368). These microorganisms synthesize osmolytes that allow them to balance the osmotic pressure on both sides of the cell membrane and prevent the loss of water by the cell. Several studies have demonstrated the transport and intracellular accumulation of chloride by halophilic bacteria. However, at present, no study has demonstrated an impact of these halophilic microorganisms on the external environment. In fact, the measured intracellular chloride concentration always remains lower than the chloride concentration of the external medium. And given the cell densities observed in these studies (109 cells / ml), only a few mg Cl per liter could be effectively desalinated by these bacteria. In other words, the reduction of the chloride concentration of the medium, thanks to its intracellular accumulation, is - in the studies described in the literature - negligible compared to the initial concentration. Thus, although these studies have made it possible to update the microbial function of chloride transport of certain microorganisms, the results obtained are not sufficient to make it an effective desalination process.

The inventors, on the contrary, propose to use at least one desalting halophilic bacterium as part of a desalination process for saline effluents under particular conditions. A condition for the implementation of the process is the fixing or the presence of a growth rate of between 0.005 h and 0.5 h 1. In fact, the inventors observed that the desalination of an effluent occurred in cell multiplication condition.

The imposition of a growth rate of these desalting halophilic bacteria in this range of value makes it possible to maintain said bacteria in a state of permanent multiplication. Thus, the desalination process is continuous and has no plateau phase. This characteristic is particularly interesting in the context of a desalting water treatment process on an industrial scale. It is also important to emphasize that said growth rate corresponds to a growth rate imposed when the process is continuous or an apparent growth rate when the process is done in batch mode (batch or fed-batch). Various techniques for controlling the growth rate of bacteria, via the residence time of the biomass in the reactor, are available to those skilled in the art. For example, it is possible to provide a biological reactor operated in CSTR (Continous Stirred Tank Reactor in English) or chemostat, ie a reactor in which the input rate is equal to the output flow. In this case, the growth rate is equal to the dilution rate D (expressed in h 1). The dilution ratio D is calculated according to the following formula: D = volume of the reactor (L) / flow rate (L / h) It is also possible to provide a reactor of the MBR (Membrane Biological Reactor) type in which a purging the tank with a fixed flow rate makes it possible to define the residence time of the cells and thus to control the cell density therein in order to stimulate the multiplication of the cells. The reactor for carrying out the process can be both free culture and fixed culture.

The growth rate of the fixed biomass can be controlled and imposed according to any method well known to those skilled in the art, and in particular the control of the thickness of the biofilm which can be regulated by the frequency of the washings, the imposition hydrodynamic constraints, the design of the biomass fixation support, etc. For the purposes of the invention, the said halophilic bacterium is capable of absorbing chloride for the proper functioning of its metabolism and its multiplication. Bacteria which are only capable of synthesizing osmolytes, and having no capacity for accumulation of chloride in their cytoplasm, are therefore not concerned by the process according to the invention. In other words, said at least one desalting halophilic bacterium for carrying out the process according to the invention is not a halotolerant bacterium. Indeed, as explained above, the halotolerant bacteria are of no use in a desalting process in that they are unable to absorb Cl- ions in their cytoplasm. Preferably, said at least one desalting halophilic bacterium can be fixed on a support in a tank for carrying out the process according to the invention. The fixing of the desalting halophilic bacteria on support makes it possible to recover the salt-engorged cells more simply and to facilitate the renewal of the biomass in the reactor. Advantageously, said desalting halophilic bacterium is not a genetically modified bacterium. In the current state, the production of genetically modified microorganisms is expensive, which is a brake for an industrial exploitation. In addition, the use of genetically modified microorganisms in a process involves heavy operating constraints. Indeed, it is necessary to confine these microorganisms in the process in order to avoid a negative impact on the environment.

Preferably, said at least one desalting halophilic bacterium is not photosynthetic. Photosynthetic bacteria are entirely dependent on light for their growth and metabolism. This characteristic involves many constraints in terms of civil engineering and process to ensure a sufficient amount of light to all the bacteria present in the reactor. If the condition of access to light is not respected, the process loses efficiency. In addition, the bacteria lacking light cease to multiply and die. In an advantageous embodiment, said process uses said desalting halophilic bacterium in the form of a single strain. In this embodiment, the reactor for carrying out the process according to the invention is inoculated with a single strain of a halophilic bacterium allowing desalination of the medium.

In another embodiment, said method uses a consortium comprising said at least one desalting halophilic bacterium. Preferably, said desalting halophilic bacterium is an aerobic bacterium. Preferably, said growth rate of said desalting halophilic bacterium is between 0.01 hl and 0.4 h 1. These particular growth rate values make it possible to keep said desalting halophilic bacterium in the exponential phase of growth, so that the cells are at their maximum capacity to eliminate NaCl. This characteristic makes it possible to optimize the performance of the process according to the invention, namely to maximize the specific desalination rate. More preferably, said growth rate of said desalting halophilic bacterium is set between 0.1 hr and 0.4 hr. These growth rate ranges showed a desalting efficiency of about 20-25% of the initial amount of NaCl. Advantageously, said desalting halophilic bacterium is heterotrophic. In a particularly advantageous embodiment, said desalting halophilic bacterium is a moderate halophilic bacterium. At present, there is no standardized and universally accepted definition of Moderate Halophilic Bacteria. For the purposes of the invention, the term "moderate desalting halophilic bacteria" means bacteria that are capable of dividing and growing at concentrations of Cl ranging from 0.05M to 3.5M, and which exhibit a mechanism for adapting to salinity. hybrid between the strategy developed by the osmotic solutes-in-strategy bacteria and the extreme halophile bacteria ("know-in strategy"). All moderate halophilic bacteria are not capable of desalination. More precisely, within the meaning of the invention, the moderate desalting halophilic bacteria are moderate halophilic bacteria which combine the two mechanisms of adaptation to chloride, namely: the synthesis of osmolytes in order to resist the osmotic pressure; and the cytoplasmic absorption and accumulation contained in the medium.

These two mechanisms can either be triggered successively, depending on the concentration of chloride ions in the medium, or occur simultaneously. Moderate desalting halophilic bacteria have the advantage of being able to treat waters whose NaCl concentration is less than or equal to 3.5M, which is not the case for extreme halophiles. In addition, unlike the extreme halophiles, the moderate desalting halophilic bacteria can further reduce the concentration of NaCl since they can grow at NaCI levels as low as 0.05M.

In an interesting variant, said desalting halophilic bacterium is an extreme halophilic bacterium. The use of such extreme halophilic bacteria is interesting when it comes to desalination of media whose salinity is greater than 2.5M NaCl, such as seawater particularly rich in salt such as the Dead Sea or industrial effluents. salty. In this case, the process may comprise a first desalination step with at least one extreme halophilic bacterium and then a second desalination step with at least one moderate desalting halophilic bacterium. Advantageously, said desalting halophilic bacterium expresses at least one of the markers chosen from the group comprising glycine, betaine, glutamine, proline, the ectoin operon (SEQ-ID1) and the ectoin B gene (SEQ-ID2 ); preferably, from the group comprising proline and / or ectoin. The sequences of the sequence listing were prepared using the NCBI database whose update date is July 6, 2014. Advantageously, said desalting halophilic bacterium expresses at least one of the markers chosen from the group comprising the glycine, betaine, glutamine, proline, the ectoin operon (SEQ-ID1), the ectoin B gene (SEQ-ID2) or a marker having a degree of homology of 80%, preferably 85 %, even more preferably 90%, more preferably 95%, even more preferably 99% therewith.

A "homologous sequence" or "sequence homology" between two nucleotide sequences is determined by the linear comparison of the nucleotide sequences by the Basic Local Alignment Search Tool (BLAST), a microbial blastn algorithm available on the NCBI site: (http: fiblast.ncbi.nlm.nih.gov/Blast.cgi? PAGE_TYPE = BlastSearch & BLAST_SPEC = Microbi alGenomes).

The parameters chosen for this analysis are as follows: - database (database): Microbes, representative genomes only; - program optimization: blastn (Highly similar sequences); - short queries = automatic parameters for the input sequence (automatically adjust parameters for input sequence); - threshold (expect treshold) = 10; - sequence length (word size) = 28; - max match in a query range = 0; For the scoring parameters, the parameters are fixed by default (match / mismatch scores = 2-3, gap costs = existence: 5, extension: 2). Finally, no filter is applied. Since the parameters are in English on the site, the exact names of the parameters are indicated in parentheses. The v3 or v4 hypervariable regions of 16S ribosomal RNA (rRNA) are markers conventionally used for the classification and identification of microorganisms, these regions being extremely specific from one strain to another. Different databases link the sequence of the v3 or v4 region of the 16S rRNA to a particular strain. One example is the EzTaxon database (http://www.ezbiocloud.net/eztaxon). The search for this region makes it possible to quantify a given strain in a natural sample. The inventors have noticed that the presence of these markers in the genome of the bacteria tested makes it possible to distinguish the moderate desalting halophilic bacteria, within the meaning of the invention, from extreme halophilic bacteria which are not capable of both types of adaptation. Advantageously, said desalting halophilic bacterium is capable of accumulating Cl- in its cytoplasm. By accumulating the chloride in their cytoplasm, the desalting halophilic bacteria within the meaning of the invention make it possible to reduce the concentration of NaCl in the water to be desalinated. Advantageously, said desalting halophilic bacterium is chosen from the group comprising Halobacillus halophilus, Bacillus hwajinpoensis, Bacillus mojavensis, Bacillus pumilus, Oceanobacillus iheyensis, Virgibacillus dokdonensis, Salimicrobium salexigens, Salimicrobium halo philum, Salimicrobium flavidum and combinations thereof. The inventors have selected these bacteria because they correspond to the criteria of the halophilic desalting bacteria moderate within the meaning of the invention. In fact, these bacteria are capable of producing osmolytes that enable them to withstand the osmotic pressure generated by a low concentration of NaCl in the medium of between 0 and 0.5M, as well as to pump the Cl ions into their cytoplasm. Preferably, said desalting halophilic bacterium is Halobacillus halophilus. The inventors have found that this strain was effective in desalting salty environments. More exactly, this bacterium is able to reduce the concentration of chloride and sodium ions in the culture medium. The strain Halobacillus halophilus can be obtained, according to the Budapest Treaty, from the German DSMZ collection (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Leibniz Institute, lnhoffenstrasse 7B, 38124 Braunschweig, Germany) under the accession number DSM-2266. The strain Bacillus hwajinpoensis can be obtained, according to the Budapest Treaty, from the German DSMZ collection under accession number DSM-16206. The strain Bacillus mojavensis can be obtained, according to the Budapest Treaty, from the German DSMZ collection under the accession number DSM-9205. The Bacillus pumilus strain can be obtained, according to the Budapest Treaty, from the German DSMZ collection. under accession number DSM-27. The strain Virgibacillus dokdonensis can be obtained, according to the Budapest Treaty, from the German DSMZ collection under accession number DSM-16826.

The strain Salimicrobium salexigens can be obtained, in accordance with the Budapest Treaty, from the German DSMZ collection under accession number DSM-22782. The strain Salimicrobium halophilum can be obtained from the German DSMZ collection under accession number DSM-4771, in accordance with the Budapest Treaty. The strain Oceanobacillus iheyensis can be obtained, in accordance with the Budapest Treaty, from the German DSMZ Collection under accession number DSM-14371.

The strain Salimicrobium flayidum can be obtained, according to the Budapest Treaty, from the Korean collection KCTC (Korea Collection for Type Culture, Korea Research Institute of Bioscience and Biotechnology, 125 Gwahak-ro, Yuseong-gu, Daejep, 305- 806 South Korea) under accession number KTCT 13260. Preferably, said saline medium has a sodium chloride NaCl concentration of between 20 g / L and 100 g / L. Interestingly, said salty medium is selected from seawater, brackish water, industrial saline effluents. The invention further relates to the use of at least one halophilic bacterium for the desalination of a salty medium. Such use may comprise the steps of: - providing at least one desalting halophilic bacterium, and - cultivating said desalting halophilic bacterium at a growth rate of between 0.005 hr and 0.5 hr in said salt medium comprising between 1 g / L and 200 g / L sodium chloride NaCl. Preferably, the use according to the invention does not include genetically modified bacteria or photosynthetic bacteria. In one embodiment, said desalting halophilic bacterium in the use according to the invention is in the form of a single strain. In another embodiment, said desalting halophilic bacterium in the use according to the invention is in the form of an inoculum comprising said moderate desalting bacterium Advantageously, said growth rate of said desalting halophilic bacterium in the use according to the invention is between 0.01 h 1 and 0.4 h 1. Thus, the invention comprises the use of desalting halophilic bacteria in their growth phase for the desalination of salty effluents. Salty environments include seawater, salty industrial effluents and brackish water. In a first variant of the use according to the invention, said bacterium is a moderate desalting halophilic bacterium. In another variant of the use according to the invention, said bacterium is an extreme halophilic bacterium. Advantageously, in the use according to the invention, said desalting halophilic bacterium expresses at least one of the group consisting of glycine, betaine, glutamine, proline, ectoin, or their combination; preferably, from the group comprising proline and / or ectoin. Even more advantageously, said desalting halophilic bacterium in the use according to the invention is further capable of accumulating Cl- in its cytoplasm. Preferably, said desalting halophilic bacterium is selected from the group consisting of Halobacillus halophilus, Bacillus hwajinpoensis, Bacillus mojayensis, Bacillus pumilus, Oceanobacillus iheyensis, Virgibacillus dokdonensis, Salimicrobium salexigens, Salimicrobium, Halophilum, Salimicrobium flayidum and combinations thereof. More preferably, said desulfating halophilic bacterium in use according to the invention is Halobacillus halophilus. Preferably, said salt medium in the use according to the invention has a sodium chloride NaCl concentration of between 20 g / l and 100 g / l. 5. List of Figures Other features and advantages of the invention will appear more clearly on reading the following description of a preferred embodiment, given as a simple illustrative and nonlimiting example, and the accompanying drawings. of which: FIG. 1 is a graph showing a growth-cell density versus time curve for the strain Halobacillus halophilus, this curve makes it possible to estimate the growth rate of Halobacillus halophilus; FIG. 2 is a graph illustrating the evolution of the growth rate (estimated as for FIG. 1) as a function of the initial NaCl concentration for the strain Halobacillus halophilus; FIG. 3 shows (A) a graph comparing the evolution of the concentration of chloride and sodium ions (in g / L) and of biomass (optical density given by the absorbance at 600 nm) as a function of time for a first Halobacillus halophilus strain and (B) the comparison of the dynamics of Cl and Na + concentrations in Mol / L; FIG. 4 is a graph illustrating the comparative evolution of the concentration of chloride and sodium ions and of biomass as a function of time for a second test Halobacillus halophilus. 6. DESCRIPTION OF AN EMBODIMENT OF THE INVENTION The invention is based on the use of at least one desalting halophilic bacterium capable of accumulating chloride in its cytoplasm for the desalination of salty media and their maintenance in a state of permanent multiplication, preferably exponential, inducing a forced elimination of the chloride and sodium ions of the external medium. Preferably, said halophilic bacterium is a moderate desalting halophilic bacterium. For the purposes of the invention, the moderate desalting halophilic bacteria are capable of multiplying in saline media comprising between 0.05 and 3.5M NaCl. More precisely, the moderate desalting halophilic bacteria within the meaning of the invention are capable of adapting to a saline environment according to the two known adaptation mechanisms, namely: the synthesis of osmolytes makes it possible to resist the osmotic pressure, and the absorption and accumulation of Cl chloride ions in their cytoplasm. These two mechanisms can either occur one after the other, depending on the concentration of chloride ions in the medium, or be triggered concomitantly. 6.1. Determination of the Desalting Characteristics of Moderate Halophilic Bacteria The method for determining the desalting character of a moderate halophilic bacterium comprises two components, which will be detailed in the description that follows: (1) choice of the strain: either choice of a specific strain known to have a mechanism of accumulation of Cl-, either by screening (isolation) from a natural inoculum (via the use of a genetic marker), (2) demonstration of the co-elimination ability of chloride ions and sodium from a supernatant of culture centre. 6.1.1 Choice of a strain of halophilic bacterium suitable for carrying out the method according to the invention 6.1.1.1 Growth test as a function of the salinity of the medium for a determined strain. The first part of the method consists in evaluating the capacity of the strain to grow in saline medium and the dependence of its growth on the presence of CL This dependence is an indicator of halophilic and non-halotolerant bacteria. The strain is cultured for 18 to 24 hours, at a temperature between 20 ° C and 30 ° C and a pH of between 6 and 8, in a flask shaken at 150 rpm at the temperature and pH allowing optimal growth. Optimum growth temperatures and pH are dependent on each strain tested. However, when the strain is obtained from a collection, this information is available. In the opposite case, it is easy to determine the optimum values by making quick tests readily available to those skilled in the art. Briefly, it is a question of culturing small determined quantities of bacteria at different temperatures in the range 20 ° C and 30 ° C and at different pHs between 6 and 8. It is sufficient to proceed to a count of bacteria 24h or 48h afterwards to determine which pH and temperature conditions allow maximum growth.

The culture medium used must contain at least one carbon source, a phosphorus source and a nitrogen source. MB (Marine Browth), NB (Nutrient Browth) media or any culture medium for bacteria comprising peptone or a yeast extract are suitable for carrying out the method. Preferably, these media comprise the sources of C, P and N in excess, so that the growth of the strains depends solely on the concentration of chloride ions in the medium. To do this, different concentrations of NaCl are tested on bacteria from the same culture. The bacteria are thus exposed to a NaCl concentration range varying between 0.05M and 3.5M. The tests are carried out in parallel, in triplicate. About 0.5 to 2% by volume of bacteria are inoculated into the vial. Every 1 to 2 hours, a culture sample of each flask is taken. The optical density at 600 nm is measured by spectrophotometer (Spectrophotometer WPA Biowave II UV / Visible) in order to be able to determine a growth curve in the medium and thus calculate the growth rate of the strain for the conditions tested. The growth curve is related to time. The variation of the growth rate obtained as a function of the NaCl concentration makes it possible to determine the chloride dependence of the strain. 6.1.1.2 Search for genetic markers. The expression of certain genes to detect microorganisms capable of synthesizing osmolytes in response to the presence of chloride ions in the medium, the presence of these markers in bacteria capable of growing and developing in hyper-saline media is a potential indicator of a mixed strategy of osmotic pressure regulation. To search for a genetic marker, a sample of a culture of the selected strain (eg Halobacillus halophilus) or a natural inoculum from a hyper-saline medium is taken. The metagenomic DNA is recovered according to any technique well known to those skilled in the art. For example, the FastDANTM Spin Kit For Soil (MP Biomedicals) protocol can be used to extract metagenomic DNA. The metagenomic DNAs are analyzed by quantitative PCR in real time. In the case of a selected bacterial strain, quantification is performed by real-time quantitative PCR on the 16S rRNA gene (V3 and / or V4 regions). For example, in the case of Halobacillus halophilus, it is possible to use a real-time quantitative PCR protocol that specifically amplifies a fraction of the V3 and V4 regions of the Halobacillus halophilus 16S rRNA gene (SEQ ID 3). . In the case of a natural sample, the marker used is the ectoin operon. Nevertheless, any other genetic marker previously described and specifically involved in the regulation of osmotic pressure may be used. Quantitation of the ectoin marker is performed by quantitative PCR in real time. This real-time quantitative PCR protocol on ectB gene (one of the ectoin operon genes) makes it possible to specifically amplify the ectB gene without distinction of bacterial species.

Example of qPCR with Halobacillus halophilus: Briefly, in the case of Halobacillus halophilus, the qPCR protocol is as follows. The Halobacillus halophilus mRNA is extracted from a cell suspension according to any method well known to those skilled in the art. MRNA is then retro-transcribed to cDNA by any method well known to those skilled in the art. Various extraction kits (for example the RNeasy0 micro kit from Qiagen, United States of America) and retro-transcription (for example the Qiagen QuantiTectO Reverse Transcription kit) are available to those skilled in the art with protocols adapted to the populations. bacterial. A reaction mixture for qPCR is prepared as follows (final volume = 20 III): 10 μl of 2X SsoFast ™ Evagreen Supermix premix (Biorad, USA), 2 μl of Halobacillus halophilus cDNA at a concentration between 5 and 10 ng / ml, 4 μl of 475F sense primer targeting the 16S rRNA gene of Halobacillus halophilus; and 4 μl of 673R antisense primer targeting the 16S rRNA gene of Halobacillus halo philus.

The 475F and 673R primers were designed with the NCB Primer Blast software (National Center for Biotechnology Information, United States of America: http://www.ncbi.nlm.nih.gov/tools/primer-blasta). Characteristics of the primers are summarized in Table 1 below: Table 1 Sense Primer 475F Sense Primer 673R Sequence (5 'to 3') ACAAGTACCGTGCGAACAGA TCCCCAGTTTCCAATGACCC Size (in nucleotides) 20 Position on the rRNA gene 475 673 16S (SEQ -ID 3) Melting temperature Ti, 59.61 59.59 (° C)% GC 50 55 The qPCR cycle applied is as follows: 1 denaturation cycle at 98 ° C. for 30 seconds, 40 amplification cycles at 95 ° C. for 10 seconds, 63 ° C. for 20 seconds and then a melting curve between 65 ° C. and 95 ° C. is carried out to ensure the specificity of the amplification The thermocycler used is the CFX 96 Real Time System CT1000Tm (Biorad, USA) Trials are performed in triplicate For better accuracy, the raw results are then normalized according to the reference method used to calculate the amount of initial DNA, during a quantitative PCR. Briefly, the results of each well are normalized and then linearized as follows: Cp housekeeping gene - Cp 16S rRNA gene = ACp, 16S rRNA gene / household gene = 2 ACp the Cp being the number of amplification cycles before detection of the fluorescent signal by the device. Validation of this qPCR protocol was performed using known amounts of Halobacillus halophilus 16S rRNA plasmid to establish a standard curve, with plasmid amounts ranging from 2.52 x 10 2 to 2.5 x 10 x 10 8 copies of the plasmid. 16S rRNA of Halobacillus halophilus. Each point is made in 5 replicates to increase the accuracy of the validation. A regression curve plotting on the abscissa the logarithm of the amount of starting plasmid and on the ordinate the Cp is plotted at the end of the qPCR. The slope is calculated and the linear regression coefficient r2 calculated. The results obtained give a r2 = 0.9992. The linear model was then validated using the Fisher-Snedecor test and demonstrated that the p value is greater than 0.05, which validates the qPCR protocol. 6.1.2 Determination of the desalting capacity The chloride concentration of the culture medium is measured regularly throughout the culture to measure its decrease in the medium. Observing such decay demonstrates the ability of a bacterium to absorb and accumulate chloride in its cytoplasm. The measurement of the chloride concentration can be made according to any method well known to those skilled in the art such as ion chromatography, rapid detection kits such as kit LCK 311 (Hach-Lange). An optical density value OD (absorbance measurement at 600 nm) greater than 4 units is necessary for this step. This test thus makes it possible to detect the strains actually capable of eliminating chloride ions from the supernatant. Taking into account the results of points 6.1.1 to 6.1.3, it is possible to identify the strains meeting the conditions for the implementation of the method, namely: having a need for C1 to ensure their growth, and / or being able to grow in hyper-saline media by being able to synthesize osmolytes; and further being effectively capable of removing chloride ions from the supernatant of a culture medium. 6.2. Example of an embodiment of the method according to the invention: evolution of the growth rate of the strain Halobacillus halophilus as a function of salinity. The strain Halobacillus halophilus was cultured at different concentrations of chloride. The cell concentration was monitored by taking samples and measuring the optical density at 600 nm by spectrophotometer. The growth curve for one of the tested conditions is presented in Figure 1. This curve makes it possible to deduce the growth rate observed. For each condition tested, a similar curve was inferred and the growth rate estimated. The variation of the observed growth rate as a function of the imposed NaCl concentration is presented in FIG.

These results demonstrate that the strain Halobacillus halophilus is able to multiply in the presence of salt. Moreover, this bacterium seems to need salt to multiply, increasing concentrations in Cl favoring its own growth. These observations are supported by the calculation of the growth rate p1, expressed in h I-, as a function of the Cl concentration in the culture medium (see FIG. 2). As can be seen in this figure, the higher the concentration of Cl, the higher the growth rate of the bacteria. The strain Halobacillus halophilus therefore fulfills the criteria of a moderate halophilic bacterium within the meaning of the invention. 6.3. Desalination tests using the Halobacillus halophilus strain Two desalination tests were conducted using the Halobacillus halophilus strain. The results of each of the tests are shown in Figures 3A, 3B and 4. Briefly, the cells are cultured in MB medium comprising 43 g / L (Figure 3), 38 g / L (Figure 4) of NaCl. The tests were carried out in a flask, at 30 ° C., with stirring at 150 rpm. The growth rates p calculated for each test are respectively 0.37 h 'for the first test (FIG. 3) and 0.19 h' for the second test (see FIG. 4). Several observations can be made. The first observation is that the decrease in Cl concentration is concomitant with the exponential growth phase (see Figures 3 and 4). The second observation is that the co-elimination of Cl and Na + ions is observed (see Figure 3). The third observation that can be made is that the cells release the chloride ions in the medium when they reach the plateau phase of their growth curve (see Figure 3). This phenomenon is probably due to cell lysis of bacteria. Another explanation could be that a new equilibrium on both sides of the bacterial membrane is set up in the stationary phase. Indeed, the bacteria accumulating Cl for growth purposes, it is possible that it stops accumulating when they stop growing.

A fourth fact is that the percentage of ion reduction measured is about 10% for the second test (see Figure 4) and 22% for the first test (Figure 3). This difference can be explained by the observed difference in growth rate between the two trials. In conclusion, greater desalting efficiency is achieved when the cells are in an exponential growth phase. A high growth rate ensures greater desalination efficiency.

Claims (15)

REVENDICATIONS1. A process for desalting a salty medium comprising a biological treatment step with at least one desalting halophilic bacterium, said desalting halophilic bacterium having a growth rate of between 0.005 hl and 0.5 hl in said saline medium comprising between 1 g / l and 200 g / L sodium chloride NaCl. 2. The method of claim 1 wherein said desalting halophilic bacterium is not a photosynthetic bacterium. The process of claim 1 or 2 wherein said process utilizes said desalting halophilic bacterium as a single strain. 4. Method according to one of claims 1 or 2 wherein said process uses a consortium comprising said at least one desalting halophilic bacterium. 5. Method according to one of the preceding claims wherein said desalting halophilic bacterium is aerobic. 6. Method according to one of the preceding claims wherein said growth rate of said desalting halophilic bacterium is between 0.01 h 'and 0.4 h l. 7. Method according to one of the preceding claims wherein said desalting halophilic bacterium is heterotrophic. 8. The method according to one of the preceding claims wherein said desalting halophilic bacterium is a moderate halophilic bacterium. 9. Method according to one of the preceding claims wherein said desalting halophilic bacterium is an extreme halophilic bacterium. 10. Method according to one of the preceding claims wherein said desalting halophilic bacterium expresses at least one of the markers selected from the group consisting of glycine, betaine, glutamine, proline, the ectoin operon (SEQ-ID1), the ectoin B gene (SEQ-ID2),; preferably, from the group comprising proline and / or the ectoin operon. 11. Method according to one of the preceding claims wherein said desalting halophilic bacterium is capable of accumulating Cl- in its cytoplasm. 12. Method according to one of the preceding claims wherein said desalting halophilic bacterium is selected from the group comprising Halobacillus halo philus, Bacillus hwajinpoensis, Bacillus mojayensis, Bacillus pumilus, Oceanobacillus iheyensis, Virgibacillus dokdonensis, Salimicrobium salexigens, Salimicrobium halo philum, Salimicrobium flayidum and their combinations. 13. The method of claim 12 wherein said desalting halophilic bacterium is Halobacillus halo philus. 14. Method according to one of the preceding claims wherein said saline medium has a NaCl sodium chloride concentration of between 20 g / L and 100 g / L. 15. Method according to one of the preceding claims wherein said salty medium is selected from seawater, brackish water, industrial saline effluents.