FR3013733A1 - METHOD AND KIT FOR DETERMINING THE SEX AND / OR THE GENETIC FOOTPRINT OF A SUBJECT - Google Patents

Abstract

The present invention relates to a method for characterizing a sample of human or chimpanzee DNA comprising a step of: -determining the alleles of at least 10 STR loci of the DNA sample, the loci being selected from the group M1 and or the group M2, in which: the group M1 consists of: DYS485, DYS588, DYS502, DYS461, DYS638, DYS643, DYS587, DYS575, DYS578, DYS632, DYS508, DYS640, DYS511, DYS577, DYS556, DYS517, DYS565 and DYS538 and M2 are: Y-GATA-A10, DYS570, DYS549, DYS460, DYS442, DYS510, DYS541, DYS576, DYS513, DYS458, DYS481, DYS612, DYS444 and DYS533.

Description

FIELD OF THE INVENTION: The present invention relates to a method and kit for characterizing a DNA sample of a human subject or chimpanzee for the purpose of determining the subject's sex and / or genetic imprint.

BACKGROUND OF THE INVENTION: A genetic profile corresponds to the specific combination of several markers making it possible to identify an individual by virtue of its DNA. There are essentially two main types of markers for establishing a genetic profile: Single Nucleotide Polymorphisms (SNPs), and Short Tandem Repeats (STRs). An SNP corresponds to the change from one base to another at a location in the DNA sequence, for example a change from A to C. It thus comes in the form of 2 alleles. SNPs are characterized by a low mutation rate (2.1 x 10-6 mutation / generation / loci) due to the low frequency with which these mutations occur. These are excellent phylogenetic tools that tell us about the phylo-geographical origin of an individual. On the other hand, they are not discriminating enough to inform us about the relations existing between closely related individuals. STRs are widely used in paternity research, rape and murder cases, and basic research to reconstruct the history of human settlement. They possess, a strong discriminating power, because of a high rate of mutation. These are tandem-repeated units (eg [CA] e) that mutate by gain or loss of a repetition, and come in the form of multiple states. Their mutation rate is higher or lower depending on their size, for example a CA6 will mutate less rapidly than a CA15. These differences in mutation rates observed according to the reasons explain the broad spectrum of mutation of these markers (1.38 x 10-6 and 6.54 x 10-2 mut / gen / locus) and their capacity to discriminate more or less related individuals. While the extreme mutability of some loci (> 10-3) is very useful for discriminating genetically close individuals (siblings), it does not provide robust information on the phylo-geographical origin of an individual (as it is possible to do with SNPs).

In addition, this hyper-mutability can induce a "mutational saturation" ie when a marker mutates too fast, the intermediate states of mutations are not always visible - this results in a poorly estimated mutation rate and derived statistical indicators, approximate and not robust.

Ideally, a complete tool should be available, consisting of markers with a low mutation rate, able to give "phylogenetic" information on individuals, and markers with a medium or high mutation rate, able to discriminate even related individuals. Technically speaking, mixing SNPs and STRs is not possible - even using next generation sequencing (NGS) technologies - which are relatively heavy to use routinely in a lambda laboratory.

In forensic and basic research, there is a flagship product to establish a male genetic profile: the AnnpFtSTRO Yfiler® a 17-mark STR multiplexer distributed by Applied Biosystems (life technologies). However, this product does not respond well to the expectations of the various targeted clients because it contains few markers with a high mutation rate, essential in forensics to discriminate very close genetic profiles, as well as molecular genealogy and basic research. Moreover, among the few markers with a high mutation rate that it contains, two of them (DYS385a and b) are duplicated and therefore unusable without a thorough knowledge of the molecular mechanisms involved in their mutation. The markers included in this kit, with very variable rates and discriminating power, do not allow correct large-scale exploratory studies (weakly related: evolutionary genetics on the continental scale), nor correct studies on a fine scale (eg strong related in molecular genealogy or forensic medicine). Finally, the intrinsic characteristics of 5 of the remaining markers, do not allow to consider modeling studies to provide reliable statistics on mutation rates. Two similar tools have been developed by public laboratories: 20-plex (Butler et al., 2002, Forensic Sci. Int) and 14-plex (Parkin et al., 2006, Forensic Sci. Int): these 2 multiplexes although published 10 and 6 years ago respectively, did not impose themselves in the scientific community because using these tools in a laboratory would require a heavy investment of time, expertise and finances to set up the protocol in a laboratory. The investment is all the less justified as 70% of the markers are already included in the AmpFfSTRO Yfiler®; there is therefore no real added value to use them. It should be noted that there is no equivalent of this type of tool for chimpanzees, whose management and conservation in parks and reserves, requires a sharp knowledge of genealogical relationships between individuals. SUMMARY OF THE INVENTION: The inventor has succeeded in designing a method for characterizing a DNA sample based on a set of genomic markers of the same type, which makes it possible to determine the high-resolution genetic fingerprint of a subject without presenting the aforementioned drawbacks. The set of markers according to the invention is usable not only on perfect DNAs, but also on medium-quality DNAs (old DNA or serum). Indeed, these markers make it possible to work on fragments of relatively short size. Thus, these markers can be amplified with sizes always less than 350bp. In addition, the markers according to the invention are reliable / simple, i.e. they can be used without a thorough knowledge of molecular structures. Indeed, there is no duplication, false allele, or complex structure to consider in the use of rates or mutation mechanisms associated with these markers.

A first aspect of the invention therefore relates to a method for characterizing a human or chimpanzee DNA sample comprising a step of: - determining the alleles of at least 10 STR loci of the DNA sample, loci being selected from the group M1 and / or the group M2, wherein: the group M1 consists of: DYS485, DYS588, DYS502, DYS461, DYS638, DYS643, DYS587, DYS575, DYS578, DYS632, DYS508, DYS640, DYS511, DYS577, DYS556, DYS517, DYS565 and DYS538 and the M2 group consists of: Y-GATA-A10, DYS570, DYS549, DYS460, DYS442, DYS510, DYS541, DYS576, DYS513, DYS458, DYS481, DYS612, DYS444 and DYS533. The present invention also relates to a kit comprising means for determining alleles of at least 10 STR loci, a sample of human or chimpanzee DNA, the loci being selected from the group M1 and / or the group M2, wherein: the group M1 consists of: DYS485, DYS588, DYS502, DYS461, DYS638, DYS643, DYS587, DYS575, DYS578, DYS632, DYS508, DYS640, DYS511, DYS577, DYS556, DYS517, DYS565 and DYS538 and the M2 group consists of: Y-GATA-A10, DYS570, DYS549, DYS460, DYS442, DYS510, DYS541, DYS576, DYS513, DYS458, DYS481, DYS612, DYS444 and DYS533.

DETAILED DESCRIPTION OF THE INVENTION Definitions The term "allele" refers to one of the different forms of a DNA sequence occupying the same locus. The term "locus" refers to a specific position on a chromosome. The term "STR" or "Short Tandem Repeat" or "tandem repeat sequences" or microsatellite refers to all sequences between 2 and 7 nucleotides that are repeated in tandem. The present invention relates to a method for characterizing a human or chimpanzee DNA sample comprising a step of: - determining the alleles of at least 10 STR loci of the DNA sample, the loci being chosen from the group M1 and / or the group M2, in which: the group M1 consists of: DYS485, DYS588, DYS502, DYS461, DYS638, DYS643, DYS587, DYS575, DYS578, DYS632, DYS508, DYS640, DYS511 , DYS577, DYS556, DYS517, DYS565 and DYS538 and the M2 group consists of: Y-GATA-A10, DYS570, DYS549, DYS460, DYS442, DYS510, DYS541, DYS576, DYS513, DYS458, DYS481, DYS612, DYS444 and DYS533 . The method according to the invention makes it possible to determine the genetic profile of a subject. This method has the advantage of being both usable for determining the genetic profile of a human and that of a chimpanzee. Typically, the alleles of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 loci can be determined. The choice of the number of loci depends on the desired use. Indeed, the STRs of the M1 group have a low to intermediate mutation rate. These markers allow discrimination of large-scale profiles, for example at the scale of continents or countries. As for the STRs of the M2 group, they have a high mutation rate. These markers allow discrimination of profiles on a smaller scale, for example at the scale of a region. If the method is used to discriminate unrelated individuals, 5 M1 and 5 markers of M2 may be used to characterize their genetic profiles. If the method is used to discriminate very closely related individuals, 10 markers in M1 and 10 in M2 could be used to characterize a DNA sample from each of these individuals. In a preferred embodiment, the alleles of the 32 loci are determined. The different loci are described in Table 1 below and ranked in ascending order of their mutation rate in humans. The molecular description of the STRs corresponding to these loci are given in Kayser et al. 2004 and Ballantyne et al. 2010. 35 GBD ID Grou pe Locus ID Tape Location Details of. Bayesian median mutation rate (Kayser chromosomal location details et al. (Retrotransposition, 2004) gene ...) DYS502 M1 Y3S60 Yq11.221 LINE1 L3,85E-04 NLGN4Y mRNA DYS575 M1 Y4S49 Yp11.2 Alu L 3.91 E -04 DYS588 M1 Y5C23 Yq11.221 Alu R 3,92E-04 DYS538 M1 Y4C32 Yq11.221 None 3,94E-04 retransposition DYS632 M1 BV005731 Yq11.221 Alu R 3,97E-04 DYS640 M1 Y4S38 Yq11.221 Alu L andLINE1 R 3,98E-04 DYS485 M1 Y3S1 Yq11.222 Alu R and LINE1 L 4,04E-04 DYS577 M1 Y4S54 Yq11.221 Alu R 4,11 E-04 DYS461 / M1 - Yq11.222 L1 The LINE family 9,89E -04 Y-GATA-A7.2 DYS578 M1 Y4S56 Yq11.223 Alu L, E ERV1 LIN 9.95E-04 R DYS638 M1 Y4S26 Yq11.221 Alu R 1.04E-03 DYS511 M1 Y4C114 Yq11.221 None 1.52E -03 (but close to another simple repetition) DYS556 M1 Y4C75 YQ11.223 LINE1 L and R 1.59E-03 DYS565 M1 Y4S18 Yq11.221 Alu L 2.09E-03 DYS587 M1 Y5C22 Yq11.221 None 2,62E -03 retransposition DYS508 M1 Y4C109 Yq11.221 None 3.03E-03 DYS517 M1 Y4C126 Yq11.221 None 3.21E-03 DYS643 M1 Y5C20 Yq11.221 LINE1 R 1,50E-03 Y-GATA-A10 M2 - Yq11.221 None 3,32E-03 DYS541 M2 Y4C36 YQ11.221 LINE1 R 3,92E-03 DYS549 M2 Y4C52 Yq11.222 LINE1 L and R 4,55E-03 DYS481 M2 Y3C59 Yp11.2 None 4,97E-03 DYS533 M2 Y4C215 Yq11.221 None 5.01 E-03 (close to another Y-STR) DYS444 M2 Y4C37 Yq11.221 Tigger2a DNA R5,45E-03 DYS510 M2 Y4C113 Yq11.221 None 5.99E-03 (but close to another single repetition) DYS513 M2 Y4C116 Yq11.221 none 6.09E-03 DYS460 / M2 - Yq11.222 (Li R family 6,22E-03 Y- GATA-A7.1 LINE) DYS458 M2 - Yp11.2 Alu L and R 8.36E-03 DYS442 M2 - Y11q21 LINE1 L and R 9.78E-03 DYS570 M2 Y4S4 Yp11.2 5'UTR gene 1.24E- 02 TBL1Y (coding for a protein) DYS576 M2 Y4S5 Yp11.2 Alu L 1.43E-02 DYS612 M2 Y3C22 Yq11.221 None 1,45E-02 Table 1 The markers according to the invention are male markers. Indeed, the loci are located on the Y chromosome, making it possible to generate a specifically male genetic profile. Obtaining an optimal male genetic profile is a real challenge in many fields not only in forensic medicine, since more than 97% of assaults are perpetrated by men but also in the context of paternity testing, genetic genealogy and history of settlement in order to trace the history of male lines of homo-sapiens.

The method for characterizing a DNA sample can be performed on a sample whose sex has not been determined beforehand. In this case, since this method is based on male markers, it will only give results if the sample comes from a male. Nevertheless, the presence of included sexing markers will make it possible to say whether this non-amplification is due to the presence of a female individual (amplified X marker only), or a highly degraded DNA (no marker is amplified). In a preferred embodiment, the DNA sample is a human DNA sample. The genetic profile of a human being, particularly a human being, is determined for example for forensic purposes as well as for research purposes for molecular genealogy and stand history studies. In another embodiment, the DNA sample is a chimpanzee DNA sample, particularly a male chimpanzee. For the chimpanzee, obtaining a genetic profile can be used in particular to determine the relationships of kinships of individuals in the wild and understand the social organization of this species. It can also optimize mating strategies, avoid inbreeding and ensure the good fate of the species when the chimpanzee is in semi-captivity or captivity. According to one embodiment, the method according to the invention comprises a step of providing a DNA sample. The DNA sample can come from different sources. Examples of sources of DNA, in particular genomic DNA, are blood, sperm, hair, body hair, tissue, saliva, urine, faeces and mixtures of biological fluids. The DNA sample may be fresh, old, dry or partially degraded.

Methods for preparing a DNA sample to determine alleles of STR loci are known. For example, such methods are described in Patel, P.I., et al. (1984) "Organization of the HPRT gene and related sequences in the human genome," Somat Cell Mol Genet 10: 483-493, and Gill, P., et al. (1985) Forensic Application of DNA Fingerprints, Nature 318: 577-579. From the DNA sample, the alleles of interest are determined.

Various methods of determining alleles of STR loci are known. Examples of such technologies include DNA sequencing or DNA amplification techniques such as PCR ("polymerase chain reaction" or "polymerization chain reaction"). These techniques can be used in combination with detection technologies such as electrophoresis, mass spectrometry, etc.

According to a preferred embodiment, the step of determining alleles comprises an amplification step such as PCR amplification. Loci alleles can be determined individually or simultaneously. Preferably, this amplification is performed simultaneously for several loci. This type of amplification is called multiplex amplification.

Multiplex amplification is a process for simultaneously amplifying several loci in a single reaction. These multiplex amplifications have been widely described in the literature (Duchenne Muscular Dystrophy (Chamberlain, JS, et al., 1988) "Deletion Screening of the Duchenne Muscular Dystrophy Loci via Multiplex DNA Amplification", Morral, N. and Estivill, X. ( 1992) "Multiplex PCR amplification of three STRs within the CFTR gene," Genomics 51: 1362- 1364); Kimpton, CP, et al. (1993) "Automated DNA profiling employing multiplex amplification of short tandem repeat loci," PCR Methods and Applications 3: 13-22, Hammond, Schumnn, JW et al (1994) "Development of Nonisotopic Multiplex Amplification Sets for Analysis of Polymorphic STR Loci," in "The Fourth International Symposium on Human Identification 1993," pp. 177-187 ). Multiplex amplifications are generally performed by PCR. This is called multiplex PCR. The amplification step may generally comprise one or more of the following steps: denaturation of the DNA so that it is in single-stranded form, addition of specific primer pairs for each of the STRs, a primer each pair being substantially complementary to a portion of the sequence in the sense strand and the other primer of each pair being substantially complementary to a different portion of the same sequence on the complementary antisense strand, -bridging of pairs of primers to their complementary sequence, the simultaneous elongation of the hybridized primers from the 3 'end of each primer to synthesize an extension product complementary to the hybridized strand with each primer, said elongation product, said elongation products, after separation of their complement serve as templates for the synthesis of one elongation product for the other primer of each pair, -the separation of the elo products ngation of matrices to produce single-stranded molecules, -the amplification of single-stranded molecules by repeating at least once the hybridization, elongation and separation steps.

In one embodiment, the amplification step comprises the addition of at least 10 pairs of primers adapted to amplify the STR loci according to the invention. In one embodiment, the amplification step comprises adding 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 , 27, 28, 29, 30, 31 or 32 pairs of primers adapted to amplify the STR loci according to the invention. In one embodiment, the primer pairs have the nucleic sequences selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO: 2 for the DYS485 locus, SEQ ID NO: 3 and SEQ ID NO: 4 for the locus DYS588, SEQ ID NO: 5 and SEQ ID NO: 6 for the locus DYS502, 'SEQ ID NO: 7 and SEQ ID NO: 8 for the locus DYS461, SEQ ID NO: 9 and SEQ ID NO: 10 for the locus DYS638, SEQ ID NO: 11 and SEQ ID NO: 12 for locus DYS643, SEQ ID NO: 13 and SEQ ID NO: 14 for locus DYS587, SEQ ID NO: 15 and SEQ ID NO: 16 for locus DYS575 , SEQ ID NO: 17 and SEQ ID NO: 18 for locus DYS578, SEQ ID NO: 19 and SEQ ID NO: 20 for locus DYS632, SEQ ID NO: 21 and SEQ ID NO: 22 for locus DYS508, SEQ ID NO: 23 and SEQ ID NO: 24 for the DYS640 locus, SEQ ID NO: 25 and SEQ ID NO: 26 for the DYS511 locus, SEQ ID NO: 27 and SEQ ID NO: 28 for the DYS577 locus, SEQ ID NO : 29 and SEQ ID NO: 30 for locus DYS556, SEQ ID NO: 31 and SEQ ID NO: 32 for locus DYS517, SEQ ID N O: 33 and SEQ ID NO: 34 for locus DYS565, SEQ ID NO: 35 and SEQ ID NO: 36 for locus DYS538, SEQ ID NO: 37 and SEQ ID NO: 38 for locus Y-GATA-A10 SEQ ID NO: 39 and SEQ ID NO: 40 for locus DYS570, SEQ ID NO: 41 and SEQ ID NO: 42 for locus DYS549, SEQ ID NO: 43 and SEQ ID NO: 44 for locus DYS460, SEQ ID NO : 45 and SEQ ID NO: 46 for locus DYS442 SEQ ID NO: 47 and SEQ ID NO: 48 for locus DYS510, SEQ ID NO: 49 and SEQ ID NO: 50 for locus DYS541, SEQ ID NO: 51 and SEQ ID NO: 52 for the DYS576 locus, SEQ ID NO: 53 and SEQ ID NO: 54 for the DYS513 locus, SEQ ID NO: 55 and SEQ ID NO: 56 for the DYS458 locus, SEQ ID NO: 57, and SEQ ID NO: 58 for locus DYS481 SEQ ID NO: 59 and SEQ ID NO: 60 for locus DYS612, SEQ ID NO: 61 and SEQ ID NO: 62 for locus DYS444 and SEQ ID NO: 63 and SEQ ID NO: 64 for the DYS533 locus. The sequences of the primers of the various embodiments of the invention in which the DNA sample is a sample of human DNA or chimpanzee are given in Table 2 below. Marker Primer Meaning Forward Sense Primer SEQ ID NO Sequence (5'-3 ') SEQ ID Sequence (5'-3') NO DYS485 1 catataacaaaattgaatgtgtactcc 2 agcctgggtgacaagagttatac DYS588 3 gaatgcagaaccctcaagga 4 agcctgggtgacagaaacac DYS502 5 cagcaagccaccataccata 6 tgtgcttttggagtttagag DYS461 / Y-GATA- A7.2 aatacataataaatgataggcagagga 7 8 9 gagagctgaataagttgtatcaggtaa DYS638 ttctaatttcagtgctttcaattttc 10 aggtgggtcatgaggtcagt DYS643 11 aagccatgcctggttaaactac 12 accaaacaccacccattcc DYS587 13 cttctttggaaagtagcatttcat 14 aaagtctgacaatgagaagggtttctaagttcagg DYS575 15 cagaggttccagtaagcttagatca 16 cattgatgggctttaggttga DYS578 17 gaggcggaactttcagtgag 18 cagaagtcccctgtgtttcaa DYS632 19 cacagtttcagtcttgcatgg 20 tctgggcaacagaaggagac DYS508 21 acaatggcaatcccaaattc 22 gaacaaataaggtgggatggat DYS640 23 ggaaaaaccatgagatcctgtc 24 aagcccgttcatattttaaagac DYS511 25 tggggtggatgtgtaggtaga 26 tctggttgtgccttagatttga DYS577 27 tttttctacgtgtgtatccactaacc 28 gtgtccccagccctgtta DYS556 29 tcaccaatgacattttacagca 30 ttggttagtgtaatgcatçca g DYS517 31 aactgaccagcaaaaatgttaaa 32 tgtctgagacctacaagattgc DYS565 33 ccaggaagcagtgttgcat 34 gcagttctctgcctgtatgg DYS538 35 ttggggaaaacagatggtgt 36 ccaaatacccatcataggaagaa Y-GATA- 37 cctgccatctctatttatcttgcatata ataaatggagatagtgggtggatt 38 Al 0 39 DYS570 tgtgacatcaaggttatgaaacg 40 ggtgaaaattattcagcatagtcaag DYS549 41 gaaaagaaaagtgtaagccaaacc 42 tttggtggcataagtggtaatg DYS460 43 atcctctgcctatcatttattatgtat 44 gaataccagaggaatctgacacc DYS442 45 tgcaaaatcacggaaccaa 46 caagccactgcaaatgtca DYS510 47 tttttcctcccttaccacaga 48 tctggagaagacagaacttgtca DYS541 49 catcattaattctatctgttcatccat 50 tggataaagaacacctttaagaagc DYS576 51 ccaagcaacatagcaagacct 52 aagcgtatttgtcttggctttt DYS513 53 tgttgtaaaaatgactactgtggtatg 54 ccacatcagcactattacttaactca DYS458 55 tgggtggtggaggttactgt 56 cccaaagttctggcattacaa DYS481 57 aggaatgtggctaacgctgt 58 accagaaggttgcaagactca DYS612 59 cccccatgccagtaagaata 60 tgagggaaggcaaaagaaaa DYS444 61 catagaatgaaaggtgtgaacca 62 tgccattcaaactcacgttg DYS533 63 attcatctaacatctttgtcatc Table 2 Note, however, that the DYS481 locus is absent in the chimpanzee, and that the DYS533 locus, although theoretically present on the assembled chimpanzee genome (XXX), could never be amplified in phase. test - so it is considered unamplified in M2. Therefore, in one embodiment, the DNA sample is a chimpanzee DNA sample and the primer pairs have the nucleic sequences selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO: 2 for the DYS485 locus, SEQ ID NO: 3 and SEQ ID NO: 4 for the DYS588 locus, SEQ ID NO: 5 and SEQ ID NO: 6 for the DYS502 locus, SEQ ID NO: 7 and SEQ ID NO: 8 for the locus DYS461, SEQ ID NO: 9 and SEQ ID NO: 10 for locus DYS638, SEQ ID NO: 11 and SEQ ID NO: 12 for locus DYS643, SEQ ID NO: 13 and SEQ ID NO: 14 for locus DYS587 , SEQ ID NO: 15 and SEQ ID NO: 16 for the DYS575 locus, SEQ ID NO: 17 and SEQ ID NO: 18 for the DYS578 locus, SEQ ID NO: 19 and SEQ ID NO: 20 for the DYS632 locus, SEQ ID NO: 21 and SEQ ID NO: 22 for locus DYS508, SEQ ID NO: 23 and SEQ ID NO: 24 for locus DYS640, SEQ ID NO: 25 and SEQ ID NO: 26 for locus DYS511, SEQ ID NO : 27 and SEQ ID NO: 28 for the DYS577 locus, SEQ ID NO: 29 and SEQ ID NO: 30 for the locus DYS556, SEQ ID NO: 31 and SEQ ID NO: 32 for locus DYS517, SEQ ID NO: 33 and SEQ ID NO: 34 for locus DYS565, SEQ ID NO: 35 and SEQ ID NO: 36 for locus DYS538 , SEQ ID NO: 37 and SEQ ID NO: 38 for the Y-GATA-A10 locus SEQ ID NO: 39 and SEQ ID NO: 40 for the DYS570 locus, SEQ ID NO: 41 and SEQ ID NO: 42 for the locus DYS549, SEQ ID NO: 43 and SEQ ID NO: 44 for the DYS460 locus, SEQ ID NO: 45 and SEQ ID NO: 46 for the DYS442 locus SEQ ID NO: 47 and SEQ ID NO: 48 for the DYS510 locus, SEQ ID NO: 49 and SEQ ID NO: 50 for locus DYS541, SEQ ID NO: 51 and SEQ ID NO: 52 for locus DYS576, SEQ ID NO: 53 and SEQ ID NO: 54 for locus DYS513, SEQ ID NO : 55 and SEQ ID NO: 56 for the DYS458 locus, SEQ ID NO: 59 and SEQ ID NO: 60 for the DYS612 locus and SEQ ID NO: 61 and SEQ ID NO: 62 for the DYS444 locus.

In some embodiments, the PCR extension products can be detected by fluorescent markers conjugated to the PCR amplification primers (see for example WO2009 / 059049). PCR products can also be detected by other techniques such as, for example, the staining of amplification products such as silver staining, radioisotopes, by chemiluminescence. Examples of fluorescent markers are FAM (5-carboxyfluorescein, fluorescent in blue), VIC® (fluorescent in green, available from Life Techologies), NEDTM (fluorescent in yellow available from Life Techologies) and PET® (fluorescent). in the red available from Life Techologies), TET (tetrachlorofluorescein, fluorescent in the green), and HEX (6-carboxy 2,4,7,4,7-hexachiorofluorescein, fluorescent in the yolk). In one embodiment, the method for characterizing a DNA sample comprises the step of determining the alleles of at least 15 STR loci selected from the M1 group.

M1 group STRs have a low to intermediate mutation rate. Their mutation rate is between 3.85x1ennut / locus / generation and 3.21x10-mmut / locus / generation (see Table 1). Due to their relatively low mutation rate, compared to the main existing markers such as those of the AmpFISTROYfiler, these markers allow a relatively divergent profile discrimination, i.e. that can be found on a large geographical scale, for example at the level of countries or continents. In one embodiment, the method for characterizing a DNA sample comprises the step of determining alleles of 15, 16, 17 or 18 STR loci selected from the M1 group.

In a preferred embodiment, the method for characterizing a DNA sample comprises the step of determining the alleles of the 18 STR loci of the M1 group.

In one embodiment, the method for characterizing a sample comprises the step of determining the alleles of at least 11 STR loci selected in the M2 group. The STRs of the M2 group have a high mutation rate. Their mutation rate is between 3.32x1emut / locus / generation and 1.45x1e2mut / locus / generation (see Table 1). Due to their high mutation rate, these markers allow discrimination of relatively similar profiles, i.e. that can be found on a small geographical scale, for example on the scale of a region. In one embodiment, the method for characterizing a DNA sample comprises the step of determining alleles of 11, 12, 13 or 14 STR loci selected in the M2 group. In another preferred embodiment, the method for characterizing a DNA sample comprises the step of determining the alleles of the 14 STR group M2 loci. In one embodiment, the method for characterizing a DNA sample comprises a step of determining the alleles of: at least 10 STR loci selected from the M1 group, and / or from at least 10 loci; STR selected in the M2 group. In a preferred embodiment, the loci whose alleles are determined are at least DYS485, DYS588, DYS461, DYS638, DYS643, DYS587, DYS517, DYS508, DYS511 and DYS565 for the M1 group and / or at least DYS570, DYS510, DYS541, DYS576, DYS458, DYS481, DYS612, DYS460, DYS442, DYS513 and DYS444 for the M2 group. More preferably, the loci whose alleles are determined are at least DYS485, DYS588, DYS461, DYS638, DYS643, DYS587, DYS517, DYS508, DYS511, DYS565, DYS578, DYS556 and DYS538 for the M1 group and / or at least DYS570, DYS510, DYS541, DYS576, DYS458, DYS481, DYS612, DYS460, DYS442, DYS513 and DYS444 for the M2 group. In one embodiment, the method for characterizing a DNA sample comprises a step of determining the alleles of: 10, 11, 12, 13, 14, 15, 16, 17 or 18 STR loci selected from the group M1 and / or 10, 11, 12, 13 or 14 STR loci selected from the group M2. In a preferred embodiment, the method for characterizing a DNA sample comprises a step of determining the alleles of the 18 M1 STR loci and the 14 M1 STR loci. The combination of the two sets M1 and M2 makes it possible to obtain highly informative genetic profiles, providing information as well on the links existing between individuals as little as strongly related.

It is also interesting to use all the M1 and M2 group loci in populations with low genetic diversity. For example, in chimpanzees, this species has undergone significant reductions in numbers, and its genetic diversity has greatly weakened. Therefore, the use of all markers will allow very useful maximum discrimination on this type of population with low genetic diversity. The method for characterizing a DNA sample can be performed on a sample whose sex has not been determined beforehand. In this case, since this method is based on male markers, it will only give results if the sample comes from a male. Preferably, the method for characterizing a DNA sample is used on a sample which is known to be from a male. According to one embodiment, the method for characterizing a DNA sample may further comprise a step of determining the sex of the subject from which the DNA sample originates.

Methods for determining the sex of a subject are known. Most of these methods rely on amplification of the amelogenin gene on X and Y (see Sullivan et al., 1993, Ensminger and Hoffman 2002). Such methods are commercially available through kits such as PowerPlex16 (Promega) and AnnpF / STR Identifiler (Life Technologies). Rarer, there are also sex determination methods based on the amplification of two distinct loci on the sex chromosomes (ie, DXS8378, DXS6803 on the X chromosome, and SRY on the Y chromosome). According to one embodiment, the step of determining the sex of a DNA sample which comprises a step of amplifying the SRY, UTY and UTX genes of the DNA sample. This method for determining the sex of a subject makes it possible, in addition to identifying the sex, to indirectly evaluate the degradation profile of the male DNA sample studied. Indeed, the 3 markers having sizes of 81 (SRY), 91 (UTY) and 120 (UTX) bp when the sample comes from a man or a chimpanzee, the decreasing amplification of these 3 markers informs us on the degree of fragmentation of the sample. This is particularly interesting when using this method of sex determination before determining the genetic profile of a subject further.

Thus, by proceeding in advance with this step, it is possible to quickly evaluate whether the sample is suitable for being analyzed or not.

In addition, sometimes the sexing of a sample prior to the determination of a genetic profile of an individual fails. Thus, some samples identified as female, are, in fact, male samples for which sexing has failed. Combining the determination of an individual's genetic profile with a sexing tool validates the sexing done prior to the determination of the genetic fingerprint. In one embodiment, the step of amplifying the SRY, UTY and UTX genes comprises the addition of primer pairs having the nucleic sequences: SEQ ID NO: 65 and SEQ ID NO: 66 for SRY, SEQ ID NO : 67 and SEQ ID NO: 68 for UTY and SEQ ID NO: 67 and SEQ ID NO: 69 for UTX. Marker Primer Meaning Sense Primer Amplified Length (bp) SEO Sequence (5'-3 ') SEQ ID NO Sequence (5'-3') ID NO SRY 65 gcgaaactcagagatcagcaag 66 tgtgcctcctggaagaatgg 81 UTY 67 cagtgttaccagccttaacag 68 ggcaggtctacttttgtagag 91 UTX 69 tctgtggactaggtttgtggt 120 The present invention also relates to a kit comprising means for determining the alleles of at least 10 STR loci of a sample of human or chimpanzee DNA, the loci being selected from the above. group M1 and / or the group M2, in which: the group M1 consists of: DYS485, DYS588, DYS502, DYS461, DYS638, DYS643, DYS587, DYS575, DYS578, DYS632, DYS508, DYS640, DYS511, DYS577, DYS556, DYS517 , DYS565 and DYS538 and the M2 group consists of: Y-GATA-A10, DYS570, DYS549, DYS460, DYS442, DYS510, DYS541, DYS576, DYS513, DYS458, DYS481, DYS612, DYS444 and DYS533. Typically, the kit comprises the means for determining the alleles of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 , 29, 30, 31 or 32 STR loci.

In a preferred embodiment, the kit comprises at least 10 pairs of primers adapted to amplify the STR loci, the loci being selected from the M1 group and / or the M2 group. Typically, the kit comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 pairs of primers.

In one embodiment, the DNA sample is a human or chimpanzee DNA sample and the at least 10 primer pairs have the nucleic sequences selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO: 2 for locus DYS485, SEQ ID NO: 3 and SEQ ID NO: 4 for locus DYS588, SEQ ID NO: 5 and SEQ ID NO: 6 for locus DYS502, SEQ ID NO: 7 and SEQ ID NO: 8 for locus DYS461, SEQ ID NO: 9 and SEQ ID NO: 10 for locus DYS638, SEQ ID NO: 11 and SEQ ID NO: 12 for locus DYS643, SEQ ID NO: 13 and SEQ ID NO: 14 for the locus DYS587, SEQ ID NO: 15 and SEQ ID NO: 16 for the locus DYS575, SEQ ID NO: 17 and SEQ ID NO: 18 for the locus DYS578, SEQ ID NO: 19 and SEQ ID NO: 20 for the locus DYS632, SEQ ID NO: 21 and SEQ ID NO: 22 for the DYS508 locus, SEQ ID NO: 23 and SEQ ID NO: 24 for the DYS640 locus, SEQ ID NO: 25 and SEQ ID NO: 26 for the DYS511 locus, SEQ ID NO: 27 and SEQ ID NO: 28 for the DYS577 locus, SEQ ID NO: 29 and SEQ ID NO: 30 for the DYS556 locus, SEQ ID NO: 31 and SEQ ID NO: 32 for the DYS517 locus, SEQ ID NO: 33 and SEQ ID NO: 34 for the DYS565 locus, SEQ ID NO: 35 and SEQ ID NO: 36 for the locus DYS538, SEQ ID NO: 37 and SEQ ID NO: 38 for the Y-GATA-A10 locus SEQ ID NO: 39 and SEQ ID NO: 40 for the DYS570 locus, SEQ ID NO: 41 and SEQ ID NO: 42 for the DYS549 locus, SEQ ID NO: 43 and SEQ ID NO: 44 for the DYS460 locus, SEQ ID NO: 45 and SEQ ID NO: 46 for the DYS442 locus SEQ ID NO: 47 and SEQ ID NO: 48 for the DYS510 locus , SEQ ID NO: 49 and SEQ ID NO: 50 for locus DYS541, SEQ ID NO: 51 and SEQ ID NO: 52 for locus DYS576, SEQ ID NO: 53 and SEQ ID NO: 54 for locus DYS513, SEQ ID NO: 55 and SEQ ID NO: 56 for locus DYS458, SEQ ID NO: 57 and SEQ ID NO: 58 for locus DYS481 SEQ ID NO: 59 and SEQ ID NO: 60 for locus DYS612, SEQ ID NO: 61 and SEQ ID NO: 62 for the DYS444 locus and SEQ ID NO: 63 and SEQ ID NO: 64 for the DYS533 locus.

In one embodiment, the DNA sample is a chimpanzee DNA sample and the at least 10 primer pairs have the nucleic sequences selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO: 2 for the DYS485 locus, SEQ ID NO: 3 and SEQ ID NO: 4 for the DYS588 locus, SEQ ID NO: 5 and SEQ ID NO: 6 for the DYS502 locus, SEQ ID NO: 7 and SEQ ID NO: 8 for locus DYS461, SEQ ID NO: 9 and SEQ ID NO: 10 for locus DYS638, SEQ ID NO: 11 and SEQ ID NO: 12 for locus DYS643, SEQ ID NO: 13 and SEQ ID NO: 14 for locus DYS587, SEQ ID NO: 15 and SEQ ID NO: 16 for the DYS575 locus, SEQ ID NO: 17 and SEQ ID NO: 18 for the DYS578 locus, SEQ ID NO: 19 and SEQ ID NO: 20 for the DYS632 locus, SEQ ID NO: 21 and SEQ ID NO: 22 for the DYS508 locus, SEQ ID NO: 23 and SEQ ID NO: 24 for the DYS640 locus, SEQ ID NO: 25 and SEQ ID NO: 26 for the DYS511 locus, SEQ ID NO: 27 and SEQ ID NO: 28 for the DYS577 locus, SEQ ID NO: 29 and SEQ ID NO: 30 for the ocus DYS556, SEQ ID NO: 31 and SEQ ID NO: 32 for the DYS517 locus, SEQ ID NO: 33 and SEQ ID NO: 34 for the DYS565 locus, SEQ ID NO: 35 and SEQ ID NO: 36 for the DYS538 locus , SEQ ID NO: 37 and SEQ ID NO: 38 for the Y-GATA-A10 locus SEQ ID NO: 39 and SEQ ID NO: 40 for the DYS570 locus, SEQ ID NO: 41 and SEQ ID NO: 42 for the locus DYS549, SEQ ID NO: 43 and SEQ ID NO: 44 hen locus DYS460, SEQ ID NO: 45 and SEQ ID NO: 46 for locus DYS442 SEQ ID NO: 47 and SEQ ID NO: 48 for locus DYS510, SEQ ID NO: 49 and SEQ ID NO: 50 for locus DYS541, SEQ ID NO: 51 and SEQ ID NO: 52 for locus DYS576, SEQ ID NO: 53 and SEQ ID NO: 54 for locus DYS513, SEQ ID NO: 55 and SEQ ID NO: 56 for the DYS458 locus, SEQ ID NO: 59 and SEQ ID NO: 60 for the DYS612 locus and SEQ ID NO: 61 and SEQ ID NO: 62 for the DYS444 locus.

SECTION M1 In one embodiment, the kit comprises means for determining the alleles of at least 15 STR loci selected from the M1 group.

In this embodiment, the kit comprises means for determining alleles of 15, 16, 17 or 18 loci selected from the group M1. In a preferred embodiment, the kit comprises means for determining the alleles of the 18 loci of the M1 group.

In a preferred embodiment, the kit comprises means for determining the alleles of at least the DYS485, DYS588, DYS461, DYS638, DYS643, DYS587, DYS517, DYS508, DYS511 and DYS565 loci, more preferably at least the loci. DYS485, DYS588, DYS461, DYS638, DYS643, DYS587, DYS517, DYS508, DYS511, DYS565, DYS578, DYS556 and DYS538. In a preferred embodiment, the kit comprises the primer pairs having the nucleic sequences: SEQ ID NO: 1 and SEQ ID NO: 2 for the DYS485 locus, SEQ ID NO: 3 and SEQ ID NO: 4 for the locus DYS588, SEQ ID NO: 5 and SEQ ID NO: 6 for the DYS502 locus, SEQ ID NO: 7 and SEQ ID NO: 8 for the DYS461 locus, SEQ ID NO: 9 and SEQ ID NO: 10 for the DYS638 locus, SEQ ID NO: 11 and SEQ ID NO: 12 for locus DYS643, SEQ ID NO: 13 and SEQ ID NO: 14 for locus DYS587, SEQ ID NO: 15 and SEQ ID NO: 16 for locus DYS575, SEQ ID NO: 17 and SEQ ID NO: 18 for the DYS578 locus, SEQ ID NO: 19 and SEQ ID NO: 20 for the DYS632 locus, SEQ ID NO: 21 and SEQ ID NO: 22 for the DYS508 locus, SEQ ID NO: _23 and SEQ ID NO: 24 for the DYS640 locus, SEQ ID NO: 25 and SEQ ID NO: 26 for the DYS511 locus, SEQ ID NO: 27 and SEQ ID NO: 28 for the DYS577 locus, SEQ ID NO: 29 and SEQ ID NO: 30 for the DYS556 locus, SEQ ID NO: 31 and SEQ ID NO: 32 for the DYS517 locus, SEQ ID NO: 33 and SEQ ID NO: 34 for the DYS565 locus and SEQ ID NO: 35 and SEQ ID NO: 36 for the DYS538 locus. These pairs of primers correspond to the primer pairs adapted to amplify the STR loci of the M1 group. They can be used for both a human DNA sample and a chimpanzee DNA sample. M1 group STRs have a low to intermediate mutation rate. These markers allow discrimination of relatively divergent profiles. SECTION M2 In one embodiment, the kit comprises means for determining the alleles of at least 11 STR loci selected in the M2 group. In this embodiment, the kit comprises means for determining alleles of 11, 12, 13 or 14 loci selected from the group M2. In another preferred embodiment, the kit comprises means for determining the alleles of the 14 loci of the M2 group.

In a preferred embodiment, the kit comprises means for determining the alleles of at least the DYS570, DYS510, DYS541, DYS576, DYS458, DYS481, DYS612, DYS460, DYS442, DYS513 and DYS444 loci. In a preferred embodiment, the DNA sample is a sample of human or chimpanzee DNA and the kit comprises primer pairs having the nucleic sequences: SEQ ID NO: 37 and SEQ ID NO: 38 for the Y-GATA-A10 locus SEQ ID NO: 39 and SEQ ID NO: 40 for locus DYS570, SEQ ID NO: 41 and SEQ ID NO: 42 for locus DYS549, SEQ ID NO: 43 and SEQ ID NO: 44 for the DYS460 locus, SEQ ID NO: 45 and SEQ ID NO: 46 for the DYS442 locus SEQ ID NO: 47 and SEQ ID NO: 48 for the DYS510 locus, SEQ ID NO: 49 and SEQ ID NO: 50 for the DYS541 locus , SEQ ID NO: 51 and SEQ ID NO: 52 for locus DYS576, SEQ ID NO: 53 and SEQ ID NO: 54 for locus DYS513, SEQ ID NO: 55 and SEQ ID NO: 56 for locus DYS458, SEQ ID NO: 57 and SEQ ID NO: 58 for locus DYS481 SEQ ID NO: 59 and SEQ ID NO: 60 for locus DYS612, SEQ ID NO: 61 and SEQ ID NO: 62 for locus DYS444 and SEQ ID NO: 63 and SEQ ID NO: 64 for the DYS533 locus. STRs in the M2 group have a high mutation rate. These markers allow discrimination of profiles on a smaller scale, for example at the scale of a region.

In another embodiment, the DNA sample is a chimpanzee DNA sample and the kit comprises the primer pairs having the nucleic sequences: SEQ ID NO: 37 and SEQ ID NO: 38 for the Y locus -GATA-A10 SEQ ID NO: 39 and SEQ ID NO: 40 for the DYS570 locus, SEQ ID NO: 41 and SEQ ID NO: 42 for the DYS549 locus, SEQ ID NO: 43 and SEQ ID NO: 44 for the locus DYS460, SEQ ID NO: 45 and SEQ ID NO: 46 for locus DYS442 SEQ ID NO: 47 and SEQ ID NO: 48 for locus DYS510, SEQ ID NO: 49 and SEQ ID NO: 50 for locus DYS541, SEQ ID NO: 51 and SEQ ID NO: 52 for locus DYS576, SEQ ID NO: 53 and SEQ ID NO: 54 for locus DYS513, SEQ ID NO: 55 and SEQ ID NO: 56 for locus DYS458, SEQ ID NO : 59 and SEQ ID NO: 60 for the DYS612 locus and SEQ ID NO: 61 and SEQ ID NO: 62 for the DYS444 locus.

SECTION M1 and M2 In one embodiment, the kit comprises means for determining the alleles: of at least 10 STR loci selected from the M1 group of at least 10 STR loci selected from the group M2. In this embodiment, the kit comprises means for determining the alleles: of 10, 11, 12, 13, 14, 15, 16, 17 or 18 STR loci selected from group M1 25 and - 10, 11, 12, 13 or 14 STR loci chosen in group M2. In a preferred embodiment, the kit comprises means for determining the 18 STR loci of the M1 group and the 14 STR loci of the M2 group. In a preferred embodiment, the DNA sample is a sample of human or chimpanzee DNA and the kit comprises primer pairs having the nucleic sequences: SEQ ID NO: 1 and SEQ ID NO: 2 for the locus DYS485, SEQ ID NO: 3 and SEQ ID NO: 4 for the locus DYS588, SEQ ID NO: 5 and SEQ ID NO: 6 for the locus DYS502, SEQ ID NO: 7 and SEQ ID NO: 8 for the locus DYS461, SEQ ID NO: 9 and SEQ ID NO: 10 for locus DYS638, SEQ ID NO: 11 and SEQ ID NO: 12 for locus DYS643, SEQ ID NO: 13 and SEQ ID NO: 14 for locus DYS587 , 40 SEQ ID NO: 15 and SEQ ID NO: 16 for the DYS575 locus, SEQ ID NO: 17 and SEQ ID NO: 18 for the DYS578 locus, and SEQ ID NO: 19 and SEQ ID NO: 20 for the DYS632 locus , SEQ ID NO: 21 and SEQ ID NO: 22 for locus DYS508, SEQ ID NO: 23 and SEQ ID NO: 24 for locus DYS640, SEQ ID NO: 25 and SEQ ID NO: 26 for locus DYS511, SEQ ID NO: 27 and SEQ ID NO: 28 for the DYS577 locus, SEQ ID NO: 29 and SEQ ID NO: 30 for the ocus DYS556, SEQ ID NO: 31 and SEQ ID NO: 32 for the DYS517 locus, SEQ ID NO: 33 and SEQ ID NO: 34 for the DYS565 locus, SEQ ID NO: 35 and SEQ ID NO: 36 for the DYS538 locus , SEQ ID NO: 37 and SEQ ID NO: 38 for the Y-GATA-A1 locus 0 SEQ ID NO: 39 and SEQ ID NO: 40 for the DYS570 locus, SEQ ID NO: 41 and SEQ ID NO: 42 for the locus DYS549, SEQ ID NO: 43 and SEQ ID NO: 44 for the DYS460 locus, 1'5 SEQ ID NO: 45 and SEQ ID NO: 46 for the DYS442 locus SEQ ID NO: 47 and SEQ ID NO: 48 for the locus DYS510, SEQ ID NO: 49 and SEQ ID NO: 50 for locus DYS541, SEQ ID NO: 51 and SEQ ID NO: 52 for locus DYS576, SEQ ID NO: 53 and SEQ ID NO: 54 for locus DYS513 , SEQ ID NO: 55 and SEQ ID NO: 56 for the DYS458 locus, SEQ ID NO: 57 and SEQ ID NO: 58 for the DYS481 locus SEQ ID NO: 59 and SEQ ID NO: 60 for the DYS612 locus, SEQ ID NO: 61 and SEQ ID NO: 62 for the DYS444 locus and SEQ ID NO: 63 and SEQ ID NO: 64 for the DYS533 locus. In another embodiment, the DNA sample is a chimpanzee DNA sample and the kit comprises the primer pairs having the nucleic sequences: SEQ ID NO: 1 and SEQ ID NO: 2 for the locus DYS485, SEQ ID NO: 3 and SEQ ID NO: 4 for the DYS588 locus, SEQ ID NO: 5 and SEQ ID NO: 6 for the DYS502 locus, SEQ ID NO: 7 and SEQ ID NO: 8 for the DYS461 locus , SEQ ID NO: 9 and SEQ ID NO: 10 for the DYS638 locus, SEQ ID NO: 11 and SEQ ID NO: 12 for the DYS643 locus, SEQ ID NO: 13 and SEQ ID NO: 14 for the DYS587 locus, 35 SEQ ID NO: 15 and SEQ ID NO: 16 for the DYS575 locus, SEQ ID NO: 17 and SEQ ID NO: 18 for the DYS578 locus, SEQ ID NO: 19 and SEQ ID NO: 20 for the DYS632 locus, SEQ ID NO: 21 and SEQ ID NO: 22 for locus DYS508, SEQ ID NO: 23 and SEQ ID NO: 24 for locus DYS640, 40 SEQ ID NO: 25 and SEQ ID NO: 26 for locus DYS511, SEQ ID NO : 27 and SEQ ID NO: 28 for the DYS577 locus, SEQ ID NO: 29 and SEQ ID NO: 30 for the DYS556, SE locus Q ID NO: 31 and SEQ ID NO: 32 for locus DYS517, SEQ ID NO: 33 and SEQ ID NO: 34 for locus DYS565, SEQ ID NO: 35 and SEQ ID NO: 36 for locus DYS538, SEQ ID NO: 37 and SEQ ID NO: 38 for the Y-GATA-A10 locus SEQ ID NO: 39 and SEQ ID NO: 40 for the DYS570 locus, SEQ ID NO: 41 and SEQ ID NO: 42 for the DYS549 locus, SEQ ID NO: 43 and SEQ ID NO: 44 for locus DYS460, SEQ ID NO: 45 and SEQ ID NO: 46 for locus DYS442 SEQ ID NO: 47 and SEQ ID NO: 48 for locus DYS510, SEQ ID NO: 49 and SEQ ID NO: 50 for locus DYS541, SEQ ID NO: 51 and SEQ ID NO: 52 for locus DYS576, SEQ ID NO: 53 and SEQ ID NO: 54 for locus DYS513, SEQ ID NO: 55 and SEQ ID NO: 56 for the DYS458 locus, SEQ ID NO: 59 and SEQ ID NO: 60 for the DYS612 locus and SEQ ID NO: 61 and SEQ ID NO: 62 for the DYS444 locus. In one embodiment, the kit further comprises gender determination means, wherein the gender determination means comprises SRY, UTY and UTX gene amplification means. In one embodiment, the SRY, UTY and UTX gene amplification means comprise the primer pairs having the nucleic sequences: SEQ ID NO: 65 and SEQ ID NO: 66 for SRY, SEQ ID NO: 67 and SEQ ID NO: 68 for UTY and SEQ ID NO: 67 and SEQ ID NO: 69 for UTX.

Sexing tool: The present invention also relates to a method for determining the sex of a DNA sample.

The first molecular tool developed in humans for the identification of sex is the test of amelogenin. This test relies on the use of a single pair of PCR primers capable of co-amplifying DNA fragments on both amelogenin genes of chromosomes X and Y, which in humans differ by 6 bp in intron 1. This size difference is usually resolved by capillary electrophoresis, revealing a single peak for females (XX) and a double peak for males (XY). This method is today the standard used for sex determination in forensics and population genetics; this test is included in 2 kits including PowerPlexl6 (Promega) and AmpF / STR Indentifiler (Life Technologies). Nevertheless, despite its long-term use, this sex typing trial is not entirely reliable. Many studies have reported an erroneous sex determination because the AMELY locus could not be amplified. Two causes are involved: a mutation in the binding site of the primer and / or the deletion of the locus, especially in Chinese populations. The AMELX / AMELY system has also been modified to perform sex determination in non-human primates. It has been successfully applied to primates closely related to humans but does not work on distant relatives such as orangutans or baboons. Due to the inability to generalize the use of amelogenin in non-human primates, several alternative methods have been developed. For most of them X and Y related fragments were included in addition to the AMELX / AMELY test. However, most of these typing methods have been based on human references and despite positive amplification in great apes because of their close relatives, they do not work in more distant primate species.

In addition to the AMELX / AMELY trials, a recent study identified the UTX / UTY locus as a better candidate system for a universal primate sexing marker by comparing genomic data from several mammals. This sex test gives positive results on baboons and orangutans. However, it presents a risk of error due to the large structural variations existing on the Y chromosome and the associated probability of zero amplification of the Y allele. When a Y target locus can not be amplified, this may lead to poor identification of sex. The present invention also relates to a method for determining the sex of a DNA sample which comprises a step of amplifying the SRY, UTY and UTX genes of the DNA sample. Amplification of UTX only in the absence of SRY and UTY indicates that the DNA sample is from a female subject. Amplification of the 3 markers, UTY, SRY and UTX indicates that the DNA sample is from a male subject. The amplification of 2 markers, UTY, and UTX, in the absence of SRY, indicates that the DNA sample is from a male subject, but that there is a mutation at the hybridization site of SRY primers, or a deletion of this gene, not allowing its amplification (frequent case which is often specific population). The amplification of 2 markers, SRY, and UTX, in the absence of UTY, indicates that the DNA sample is from a male subject, but that there is a mutation at the hybridization site. UTY primers, or a deletion of this gene, does not allow its amplification (frequent case which is often specific population).

The method of typing sex according to the invention is applicable to prevent misidentification of sex. In addition, it is easily applicable for a broad spectrum of DNA quality.

This method for determining the sex of a subject makes it possible, in addition to identifying the sex, to indirectly evaluate the degradation profile of the male DNA sample studied. Indeed, the 3 markers having respective sizes of 81 (SRY), 91 (UTY) and 120 (UTX) bp for the human and chimpanzee sexing tool and 91 (UTY), 120 (UTX) and 165 (SRY) ) for the all primate sexing tool, the decreasing amplification (if any) of these 3 markers tells us about the degree of fragmentation of the sample. This is particularly interesting when using this method of sex determination before determining the genetic profile of a subject further.

Thus, by proceeding in advance with this step, it is possible to quickly evaluate whether the sample is suitable for being analyzed or not. In a preferred embodiment, the amplification step of the SRY, UTY, and UTX genes is the amplification of 80 to 250 base pair fragments of a SRY, UTX, and UTY exon. Since exons are coding parts, they are more likely to remain conserved over time in the same species but also between species. The amplified fragment may in particular be between 80 and 250 base pairs, 80 and 200 base pairs or 80 and 150 base pairs. The present invention also relates to a kit for determining the sex of a DNA sample in which the sex determination means comprises SRY, UTY and UTX gene amplification means. All Primate Sexing Tool: According to one embodiment of this method, the DNA sample is a DNA sample belonging to the order of primates. The DNA sample may for example come from a human (Homo sapiens), Pan sp., Gorilla sp., Pongo sp. Hylobates sp., Cercopithecus sp., Erythrocebus patas, Cercocebus torquatus, Mandrillus sphinx, Lophocebus albigena, Papio sp., Macaca sp., Alouatta caraya, 40 Sa'frniri sciureus, Cebus apella, Aotus trivirgatus, Callithrix jacchus, Hapalemur sp., Eulemur sp., Microcebus sp., Lepilemur sp., Avahi sp., Propithecus sp., Lemur sp., Indri indri.

In particular, the DNA sample can come from Homo sapiens, Pan troglodytes troglodytes Pan Panchus, Gorilla gorilla, Pongo pygmaeus pygmaeus, Hylobates lar, Cercopithecus cephus, Cercopithecus nictitans, Erythrocebus patas, Cercocebus torquatus, Mandrillus sphinx, Lophocebus albigena, Macaca mulatta, Macaca sylvanus, Alouatta caraya, Aotus trivirgatus, Sirmiri sciureus, Cebus apella, Callithrix jacchus, Lepilemur dorsalis, Lepilemur sahamalazensis, Lepilemur ankaranensis, Lepilemur mittermeieri, Lepilemur ruficaudatus, Lepilemur aeeclis, Microcebus murinus, Hapalemur griseus ranomafanensis, Hapalemur griseus meridionalis, Hapalemur griseus occidentalis, Hapalemur griseus griseus, Hapalemur aureus, Hapalemur simus, Eulemur macaco macaco, Eulemur macaco flavifrons, Lemur catta, Propithecus diadem ma edwardsi, Propithecus tattersalli, Propithecus verreauxi coquerelli, Propithecus verreauxi verreauxi, Propithecus verreauxi deckeni, Propithecus diademma diademma, Avahi laniger, A vahi occidentalis, Avahi cleesei, indri indri. In one embodiment, the step of amplifying the SRY, UTY and UTX genes is the amplification of 100 to 250 base pair fragments of an exon of SRY, UTX and UTY. In one embodiment, the step of amplifying the genes comprises adding primer pairs having the nucleic sequences: SEQ ID NO: 70 and SEQ ID NO: 66 for SRY, SEQ ID NO: 67 and SEQ ID NO: 68 for UTY and SEQ ID NO: 67 and SEQ ID NO: 69 for UTX.

The sequences of the primers of the various preferred embodiments of the sex determination method are given in Table 4 below. Marker Primer Meaning Forward Sense Primer Amplified Length (bp) SEQ ID Sequence (5'-3 ') SEQ ID Sequence (5'-3') NO NO SRY 70 agtgaagcgacccatgaacg 66 tgtgcctcctggaagaatgg 165 UTY 67 cagtgttaccagccttaacag 68 ggcaggtctacttttgtagag 91 UTX 69 tctgtggactaggtttgtggt 120 Table 4 In one embodiment, the kit is a kit for determining the sex of a primate DNA sample and the SRY, UTY and UTX gene amplification means comprise the primer pairs having the nucleic sequences: SEQ ID NO: 70 and SEQ ID NO: 66 for SRY, SEQ ID NO: 67 and SEQ ID NO: 68 for UTY and SEQ ID NO: 67 and SEQ ID NO: 69 for UTX.

Typically, the primers hybridize under stringent conditions. For example, for primers of 15 to 25 bp, stringent conditions are a temperature of 55 ° C in buffer or 51 ° C in this same buffer for prosimian samples. The buffer may for example be composed of Multiplex PCR Master mix 2X comprising optimized concentrations (it is they who say it!) Of HotStarTaq® Plus DNA Polymerase, MgCl2, and dNTPs Mix (dATP, dCTP, dGTP, dTTP ultrapure quality ) and Multiplex PCR Plus Buffer (contains 6 mM MgCl2, pH 8.7), Q-solution 5X, CoralLoad Dye 10X, RNase-free water ultra-pure quality, PCR-grade as in the kit QIAGEN Multiplex PCR Plus Kit (ref: 206152) ).

Human sexing tool and chimpanzees: According to one embodiment of this method, the DNA sample is a sample of human DNA or chimpanzee.

According to one embodiment of this method for determining the sex of a DNA sample, the DNA sample is from a human or a chimpanzee and the gene amplification step includes adding primer pairs selected from the group consisting of: - for SRY: -a primer meaning between 15 and 25 base pairs hybridizing between bases 2,655,350 and 2,655,400, preferably between bases 2,655,365 and 2 655,395, more preferably between bases 2,655,369 and 2,655,390 of the negative strand of the human Y chromosome and a 15 to 25 base pair antisense primer hybridizing between bases 2655,295 and 2,655,340. preferably between bases 2655 300 and 2655325, more preferably between bases 2655 304 and 2655323 of the positive strand of the human Y chromosome, a sense primer between 15 and 25 base pairs hybridizing between the bases 26,202,990 and 26,203,035, preferably between bases 26,202,995 and 26,203,030, more preferably between the bases of the chimpanzee Y chromosome positive strand and an antisense primer between 15 and 25 base pairs hybridizing between the bases 206 203 055 and 26 203 105 preferably between the bases 26 203 055 and 26203023 060 and 26,203,095, more preferably between bases 26,203,069 and 26,203,088 of the negative strand of the chimpanzee Y chromosome, for UTX: -a primer meaning between 15 and 25 base pairs hybridizing between the bases Nos. 44,929,400 and 44,929,450, preferably between bases 44,929,415 and 44,929,440, more preferably between bases 44,929,417 and 44,929,437 of the positive strand of the human chromosome X and an antisense primer between 15 and 25 base pairs hybridizing between bases 44 929 505 and 44 929 555, preferably between bases 44 929 515 and 44 929 550, more preferably between bases 44 929 521 and 44 929 541 of the negative strand of human X-chromosome, a primer meaning between 15 and 25 base pairs hybridizing between the bases 45 534 530 and 45 534 580, preferably between bases 45 534 535 and 45 534 570, more preferably between bases 45 534 544 and 45 534 564 of the positive strand of chimpanzee chromosome X and an anti-primer between 15 and 25 base pairs hybridizing between the bases 45 534 630 and 45 534 800, preferably between the bases 45 534 535 and 45 534 575, more preferably between the bases 45 534 648 and 45 534 668 the negative strand of the chimpanzee X chromosome; and for UTY: a primer between 15 and 25 base pairs hybridizing between bases 447,590 and 447,645, preferably between bases 447,600 and 15,447. 635, more preferably between bases 447,608 and 15,447,628 of the negative strand of the human Y chromosome and a 15- to 25-base pair antisense primer hybridizing between bases 447,520 and 15,447. 560, preferably between the bases 447 530 and 44 44 7 550, more preferably between the bases 44 7,533 and 15,447,553 of the positive strand of the human Y chromosome-a sense primer between 15 and 25 base pairs hybridizing between bases 860, 260 and 860 310, preferably between bases 860 270 and 20 860 300 more preferably between bases of the chimpanzee Y chromosome negative strand and a 15 to 25 base pair antisense primer hybridizing between bases 860,185 and 20,860,235. preferably between bases 860 195 and 20 860 225, more preferably between bases 860 200 and 20 860 220 of the positive strand of chimpanzee Y chromosome.

Typically, the primers hybridize under stringent conditions. For example, for primers of 15 to 25 bp, stringent conditions are a temperature of 55 ° C in buffer or 51 ° C in this same buffer for prosimian samples. The buffer may for example be composed of Multiplex PCR Master mix 2X comprising optimized concentrations (it is they who say it!) Of HotStarTaq® Plus DNA Polymerase, MgCl2, and dNTPs Mix (dATP, dCTP, dGTP, dTTP ultrapure quality ) and Multiplex PCR Plus Buffer (contains 6 mM MgCl2, pH 8.7), Q-solution 5X, CoralLoad Dye 10X, RNase-free water ultra-pure quality, PCR-grade as in the kit QIAGEN Multiplex PCR Plus Kit (ref: 206152) ).

In one embodiment, the step of amplifying the genes comprises adding primer pairs having the nucleic sequences: SEQ ID NO: 70 and SEQ ID NO: 66 for SRY, SEQ ID NO: 67 and SEQ ID NO: 68 for UTY and SEQ ID NO: 67 and SEQ ID NO: 69 for UTX. SEQ ID NO: 65 and SEQ ID NO: 66 for SRY, SEQ ID NO: 67 and SEQ ID NO: 68 for UTY and SEQ ID NO: 67 and SEQ ID NO: 69 for UTX. In a preferred embodiment, the gene amplification step comprises the addition of 25 primer pairs having the nucleic sequences: SEQ ID NO: 65 and SEQ ID NO: 66 for SRY, SEQ ID NO: 67 and SEQ ID NO: 68 for UTY and SEQ ID NO: 67 and SEQ ID NO: 69 for UTX. The sequences of the primers of this preferred embodiment are given in Table 5 below. Marker Primer Meaning Sense Primer Amplified Length (bp) SEO Sequence (5'-3 ') SEQ ID NO Sequence (5'-3') ID NO SRY 65 gcgaaactcagagatcagcaag 66 tgtgcctcctggaagaatgg 81 UTY 67 cagtgttaccagccttaacag 68 ggcaggtctacttttgtagag 91 UTX 69 tctgtggactaggtttgtggt 120 OR Table 5 This last embodiment of the sex typing method is only applicable to a limited number of primates but it allows to use very small size amplicons (between 80 and 120 bp) and therefore to work on DNA is highly degraded. The invention will be illustrated by the following figures and examples. However, by way of illustration, these examples and figures should not be interpreted as limiting the scope of the present invention. FIGURES FIG. 1 shows a comparison between the mutability and the discriminating power of the existing multiplexes and those of the invention (CombYplex). Figure 2 shows an example of a human profile obtained from multiplex M1. For each of the profiles, the horizontal axis represents the size of the DNA fragments: on the left the small sizes, on the right the larger sizes. Each peak corresponds to a STR marker. Each line corresponds to a fluorochrome. The gray bar above each peak is named after the marker below, and its length reflects the spectrum of all expected alleles (polymorphism). The place of each potentially amplified allele is represented as a gray bar. Figure 3 shows an example of a human profile obtained from the multiplex M2 combined with a sexing tool. The reading codes are the same as before. Figure 4 shows an example of a chimpanzee profile obtained from the multiplex M1. The reading codes are the same as before. Figure 5 shows an example of a chimpanzee profile obtained from the multiplex M2 combined with a sexing tool. The read codes are the same as before. FIG. 6 represents an example of a male profile with a UTY peak, a UTX peak and an SRY peak (profile A). Figure 7 shows an example of a male profile with a UTY peak, a UTX peak but no SRY peak (Profile B). Figure 8 shows an example of a male profile with a UTX peak and an SRY peak but no SRY peak (C profile). FIG. 9 represents an example of a female profile with only a UTX peak (profile D). EXAMPLES EXAMPLE 1: Determination of the genetic profile of a subject Development of reference sequences An exhaustive list of STR markers of the human Y chromosome was established on the basis of the publications available on this subject (Goedbloed et al., 2009; 2007, Ballantyne et al., 2010, Vermeulen and others 2009, Maybruck et al, 2009, Hanson et al 2012, Kayser et al., 2004) and completed with work using the ncbi databanks, ucsc, together From this list, a study was conducted to gather all the information relating to each listed marker, which could provide information on their discriminant potential (molecular structure, mutation rate, localization in the genome, evidence of duplication , etc.). This same information was collected for the chimpanzee and the markers absent in this species, or which were not suitable for the chimpanzee, were eliminated.

A ranking of markers according to their mutation rates, molecular structure, quality of flanking regions, and others, has been achieved. The markers selected were divided into 2 multiplexes: M1, comprising markers having a mean mutation rate (see Table 6A and 6B), and M2, including markers having a high mutation rate (see Table 7A and 7B). 30 GBD ID Locus ID (Kayser Location of Location Details SNP Duplications Database of Number of copies based on Number of copies (Kayser et al., 2004) Complexity of et al., The band (retrotransposition, dbSNP> 1000 variant bases genomic: positional information amplicon 2004) chromosomal gene ...) (item) chromosomal structural change in Y (UCSC) (Kayser et al., 2004) DYS502 Y3S60 Yq11.221 LINE1 L No SNPs No Variant Step single genomic single copy complex NLGN4Y mRNA duplication DYS575 Y4S49 Yp11.2 Alu L No SNP No Pas of simple genomic variant single copy simple duplication DYS588 Y5C23 Yq11.221 Alu R No SNP No Pas of simple genomic variant simple copy complex duplication DYS538 Y4C32 Yq11.221 no retransposition rs3049738 No Single genomic variant single copy complex duplication DYS632 BV005731 Yq11.221 Alu R rs112755533 No Single genomic variant single simple copy rs60182015 plication DYS640 Y4S38 Yq11.221 Alu L and LINE1 R No SNP No Steps of genomic variant simple simple copy simple duplication DYS485 Y3S1 Yq11.222 Alu R and LINE1 L rs73626958 No CNV chrY single copy simple single duplication 31588 DYS577 Y4S54 Yq11. 221 Alu R No SNP No Pas of simple genomic variant simple copy complex duplication DYS461 / - Yq11.222 L1 L family LINE No SNP No Pas of simple genomic variant simple copy Simple Y-GATA- duplication 31 A7.2 DYS578 Y4S56 Yq11.223 Alu L, LINE ERV1 R No SNP No CNV chrY simple single copy Simple duplication 31588 DYS638 Y4S26 Yq11.221 Alu R 1 SNP in a Single genomic variant Single copy flanking duplication DYS511 Y4C114 Yq11 .221 None (but next to another simple repetition) rs2566502 rs1239021 rs34911488 rs58587911 No Single genomic variant single copy Simple duplication DYS556 Y4C75 Yq11.223 LINE1 L and R rs34768548 No CNV chrY single cop ie simple Single duplication 31588 DYS565 Y4S18 Yq11.221 Alu L No SNP No Pas of simple genomic variant single copy Simple duplication DYS587 Y5C22 Yq11.221 no retransposition rs7892960 No Pas of simple genomic variant simple copy Complex and 2 SNP in duplication flanking regions DYS508 Y4C109 Yq11.221 none rs59873111 No Single Genomic Variant single copy Simple duplication DYS517 Y4C126 Yq11.221 none No SNP No Single Genomic Variant Simple duplication Complex duplication DYS643 Y5C20 Yq11.221 LINE1 R No SNPs No single genomic variant simple copy Simple duplication of aids 32 GBD ID Type of repetition Bayesian median mutation rate Bayesian credibility interval Gains / Total Total 95% Mut. Meioses DYS502 3 3,85E-04 1.43 x10 "5-2.05x10-3 0/0 0 1 792 DYS575 4 3.91E-04 1.47 x10-5-2.09x10-3 0/0 0 1 764 DYS588 5 3.92E -04 1.47 x10-5-2.10x103 0/0 0 1 747 DYS538 4 3.94E-04 1.47 x10-5-2.10x103 0/0 0 1 765 DYS632 4 3.97E-04 1.47 x105-2.13x10-3 0 / 0 0 1 745 DYS640 4 3.98E-04 1.41 x10-5-2.16x103 0/0 0 1 716 DYS485 3 4.04E-04 1.53 x10-5-2.13x103 0/0 0 1 730 DYS577 4 4.11E -04 1.51 x10-5-2.19x10-3 0/0 0 1 691 33 DYS461 / 4 9.89E-04 1.40 x10-4-3.29x10-3 0/1 1 1 695 Y-GATA-A7.2 DYS578 4 9.95E-04 1.43 x104-3.30x103 1/0 1 1 686 DYS638 4 1.04E-03 1.47 x10-4-3.45x103 1/0 1 1 617 DYS511 4 1.52E-03 3.51 x10-4-4.11x103 1/1 2 1 760 DYS556 4 1.59E-03 3.70 x10-4-4.30x10-3 1/1 2 1 683 DYS565 4 2.09E-03 6.20 x104-4.95x10-3 1/2 3 1 757 DYS587 5 2.62E-03 9.16 x104-5.75x10-3 2/2 4 1 782 DYS508 4 3.03E-03 1.05 x10-3-6.63x10-3 2/2 4 1 544 DYS517 4 3.21E-03 1.25 x10 " 3-6.62x103 3/2 5 1 766 DYS643 5 1.50E-03 3.49 x10 "4-4.05x10" 3 2/0 2 1 773 Table 6B 34 GBD ID Locus ID Position of - Location Details SNP Duplications Genomic Variant Database: Structural Variation Number of copies Amount of Amplicon Complexity (Kayser band (retrotransposition, dbSNP> 1000 bases from the copies (Kayser et al. et al. 2004) chromosic gene ...) (item) information on the (Kayser and 2004) position al. 2004) chromosome Y (UCSC) Y-GATA-A10 - Yq11.221 no rs10551136 No Step simple single copy Complex rs34876041 duplication variant genomic DYS541 Y4C36 Yq11.221 LINE1 R rs72289870 No Step simple simple copy Complex rs149616794 duplication variant rs13303915 genomic DYS549 Y4C52 Yq11.222 LINE1 L and R rs72132766 No CNV chrY simple single copy Simple rs35436436 duplication 31588 DYS481 Y3C59 Yp11.2 no rs34406695 No Steps simple single copy Simple duplication variant genomic DYS533 Y4C215 Yq11.221 no rs72167351 rs10546066 rs59597498 rs72017788 No Simple Single Copy Simple (near another Y-STR) Genomic Variant Replication 35 DYS444 Y4C37 Yq11.221 Tigger2a DNA R rs78310168 No Single Simple Copy Steps Complex rs3052654 genomic variant duplication DYS510 Y4C113 Yq11.221 none (but near No SNP Pas de pas simple simple copy Complex other simple repetition) duplication variant genomic DYS513 Y4C116 Yq11 .221- no rs35947421 No Single Simple Copy Steps Complex rs35984406 duplication variant rs34990939 genomic DYS460 / - Yq11.222 (L1 R family LINE) rs72164979 No Steps simple single copy Simple Y-GATA- duplication variant A7.1 genomic DYS458 Yp11.2 Alu L and R No SNP No CNV chrY single copy - - duplication 4180 but variants reported STRbase and YHRD DYS442 - Y1 -iti21 LINE1 L and R rs34353940 Pas de Pas simple copy - - duplication variant genomic DYS570 Y4S4 Yp11.2 5'UTR of the TBL1Y gene No SNP No Pas simple simple copy (coding for protein variant duplication) genomic DYS576 Y4S5 Yp11.2 Alu L No SNP No Pas simple simple copy Simple duplication variant genomic 36 No steps of DYS612 Y3C22 Yq11.221 none No SNP duplication variant single copy simple Genomic complex Table 7A 37 GBD ID Type of repeat Median Bayesian mutation rate Bayesian 95% credibility gap Gains / Total T otal. Mut losses. Meioses Y-GATA-A10 4 3.32E-03 1.25 x10-3-6.80x103 3/2 5 1 713 DYS541 4 3.92E-03 1.65 x10 "3-7.68x10-3 2/4 6 1 700 DYS549 4 4 , 55E-03 2.05 x10-3-8.58x10-3 1/6 7 1 684 DYS481 3 4.97E-03 2.36 x10-3-9.03x10-3 3/5 8 1 744 DYS533 4 5.01E-03 2.39 x1OE3 -9.11x10-3 4/4 8 1 730 DYS444 4 5,45E-03 2.68 x10-3-9.65x103 3/6 9 1 775 DYS510 4 5.99E-03 3.09 x10-3-1.03E-02 4 / 6 10 1 779 38 DYS513 4 6.09E-03 3.14 x10-3-1.05E-02 6/4 10 1 751! DYS460 / 4 6.22E-03 3.19 x10-3-1.07E-02 2/8 10 1 717 Y-GATA-A7.1 DYS458 4 8.36E-03 4.80 x10-3-1.34E-02 7/7 14 1 756 DYS442 4 9.78E-03 5.59 x10-3-1.57E-02 2/12 14 1 497 DYS570 4 1.24E-02 7.52 x10-3-1.91 E-02 8/9 17 1 426 DYS576 4 1.43E-02 9.41 x10-3-2.07E-02 12/12 24 1 727 DYS612 3 1, 45E-02 9.61 x10-3-2.09E-02 11/14 Table 7B Design of the multiplex primers The theoretical scheme of the 2 multiplexes was carried out by organizing the markers per line (1 line = 1 fluorochrome) in according to their sizes in order to ensure a good distribution of the mar on the fixed size range (from 80 to 350 bp). Alignment of about 500 bp sequences around the human-chimpanzee marker was performed for each marker. A pair of primers capable of amplifying the STR marker for both species, and for a given (near) size, was selected. The primers were modified until the designated theoretical pattern was reached / obtained, and in the case where this was not possible, the theoretical scheme was modified until satisfied. For each marker, an amplification was carried out using the cold primers for a male and a female individual, for the man and the chimpanzee, to see if a band of the expected size was obtained, and especially if this one was unique in order to avoid a-specificities and duplications that would not have been reported or detected until then. The primers were remodified until they reached satisfaction.

Once all the markers were independently tested, they were multiplexed per line (ie fluorochorm) to detect potential interactions. The markers were then labeled labeled ('hot'), and again amplification was performed using warm primers for a male and a female individual, for both humans and chimpanzees, to see if we were getting a band at the expected size, and especially if it was unique to avoid a-specificities and duplications. The primers were remodified until they reached satisfaction. Final multiplexing was performed, including all markers and the concentrations were adjusted to a balanced multiplex. The same operation was repeated for the second multiplex. In parallel, each marker was sequenced in order to establish a correspondence between size of the amplicon by genotyping and the actual number of repetitions corresponding to this size. Table 8A below summarizes information on the 18 markers of the M1 multiplex for human samples.

Table 8B below summarizes the information on the 18 markers of the multiplex M1 for chimpanzee samples. Table 9A below summarizes information on the 14 markers of the 2nd multiplex M2 and for the sex markers (SRY, UTY and UTX) for human samples. Table 9B below summarizes information on the 14 markers of the 2nd multiplex M2 and for the sex markers (SRY, UTY and UTX) for chimpanzee samples. 41 Marker ochr Me Fluor DNA human control (fx) Derived from literature only Sequence (5'-3 ') Tm [lig ° Sequence (5'-3') Tm pie Allele (nb Size Allelic range (nb repeating units) Range of size (C) (° C) repeated ampliconic amplicon units) (bp) expected (bp) DYS485 FAM catataacaaaattgaatgtgtactcc SEQ ID NO: 1 57.3 0.5 agcctgggtgacaagagttatac SEQ ID NO: 2 58.7 0.5 16 121 12 -22 109-139 DYS588 FAM gaatgcagaaccctcaagga SEQ ID NO: 3 60.2 0.18 agcctgggtgacagaaacac SEQ ID NO: 4 60.2 0.18 12 151 9-16 136-171 DYS502 FAM cagcaagccaccataccata SEQ ID NO: 5 59.6 0.25 tgtgcttttggagtttgag SEQ ID NO: 6 58.9 0.25 8 206 6-9 200-209 DYS461 FAM aatacataataaatgataggcagagga SEQ ID NO: 7 57.9 0.6 gag agctgaataagttgtatcaggtaa SEQ ID NO: 8 58.6 0.6 11 257 8-13 245-265 DYS638 FAM ttctaatttcagtgctttcaattttc SEQ ID NO: 9 59.3 1,2 aggtgggtcatgaggtcagt SEQ ID NO: 10 59,4 1,2 11 312 8-13 300-320 DYS643 VIC aagccatgcctggttaaactac SEQ ID NO: 11 59.6 0.1 SEQ ACCAAACACCACCCATCC ID NO: 12 60.5 0.1 10 136 8-13 126-151 DYS587 VIC cttctttggaaagtagcatttcat SEQ ID NO: 13 58 1 0.8 aaagtctgacaatgagaagggtttctaagttcagg SEQ ID NO: 14 68.9 0.8 11 198 8-16 183- 223, DYS575 VIC cagaggttccagtaagcttagatca SEQ ID NO: 15 60.3 0.3 cattgatgggctttaggttga SEQ ID NO: 16 59.9 0.3 10 263 8-12 255-271 DYS578 VIC gaggcggaactttcagtgag SEQ ID NO: 17 60.0 0.5 cagaagtcccctgtgtttcaa SEQ ID NO: 18 60.1 0.5 9 313 7-10 305-317 DYS632 NED cacagtttcagtcttgcatgg SEQ ID NO: 19 59.3. tctgggcaacagaaggagac SEQ ID NO: 20 60.4 0.09 9 107 8-10 103-111 0309 DYS508 NED acaatggcaatcccaaattc SEQ ID NO: 21 59.6 0.4 gaacaaataaggtgggatggat SEQ ID NO: 22 59.1 0.4 11 174 8-15 162-190 DYS640 NED ggaaaaaccatgagatcctgtc SEQ ID NO: 23 59.8 0.2 aagcccgttcatattttaaagac SEQ ID NO: 24 57.9 0.2 11 258 9-13 250-266 DYS511 NED tggggtggatgtgtaggtaga SEQ ID NO: 25 60, ## STR1 ## DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS SEQ ID NO: 29 31 57.9 0.5 tgtctgagacctacaagattgc SEQ ID NO: 32 57.1 0.5 13 219 10-18 207-239 DYS565 PET ccaggaagcagtgttgcat SEQ ID NO: 33 59.8 0.3 gcagttctctgcctgtatgg SEQ ID NO: 34 58.5 0.3 12 290 9-14 278-298 DYS538 PET ttggggaaaacagatggtgt SEQ ID NO: 35 60.2 1.7 ccaaatacccatcataggaagaa SEQ ID NO: 36 59.2 1.7 10 343 9-13 339-355 Table 8A: Information on the 18 markers of the Multiplex M1 for human samples. Marker Fluorochrome Chimpanzee DNA Deduced from contro literature (301) only Sequence (5'-3 ') Tm [lig Sequence (5'-3') Tm (° C) [IIM] Allele (in size Range allelic (nb repetitive units ) Range of (° C) nb amplicon units repeated (bp) ampliconic expected (bp) DYS485 FAM catataacaaaattgaatgtgtactcc 57.3 0.5 agcctgggtgacaagagttatac 58.7 0.5 14 115 8-15 97-118 fn fn fn r ## EQU1 ## L9 PZ: ON CII 03S Z'O 8'69 £ Z: ON al 03S oi6pore6u6wooeeeeu56 CI3N OP9SACI ou6uuenuereop.633obee PZZ-POZ t1.-6 Z1Z 11. P'O 1'69 ZZ: ON al 03S P'O 9 1.Z: ON al 03S CI3N 80SSACI 1e661e666156eemeeoue6e L01-96 1.1.-8 E0 I- 0l 60'0 P'09 OZ: ON al 03S 60'0 £ to 69 61-: ON al 03S 661eo6uoiuuuflepe0 CEN ZE9SAC1 oe6E66ue6uouu36661.q. 600-L6Z 01-L SOC 6 S`0 1'09 81-: ON al 03S 9`0 0'09 L I.: ON 0103S 6e516.eoluoue66o56e6 0IA 8LSSACI Bequel000eue6eo 89Z-P9Z 8-L 179Z L C'0 6 91: ON 0103S C1166q113666enuo to 0 £ 09 SI. : ON al 03S eow6ullo5eeeoon.66u6eo 01A 9LSSACI 961-9171- 91-9 1-91- 6 8`0 6'89 FT. : ON GI 03S 8`0 1 -'89 El-: ON 0103S le0uluo6Beee66mono 0IA L89SAC1 66uon6eeptu666eube6leeoe6leuee 901.-1-6 9-E 1-6 £ 1.'0 9'09 Z I.: ON CII 03S oone000mo2oeuepoe VO 9 69 II: ON CII 03S 01A £ P9SAC1 oeeeuoo @ e2 plepew 910-00E ZI - 8 80E 01 Z` l. P'69 01.: ON al 03S 16e3166e61eo1656166e Z`1. E'69 6: ON 0103S IA1Vd 8 £ 9SAC1 oaueeouioui6i6eouiee1ou 99Z - £ 9Z Z1.-6 L9Z 0 I-9'0 9'89 8: ON CII 03S 9'0 6`L9 L: ON CII 03S lltid Z'LV -V1VO-A / 1.9tSAG eu166eole16116equeloe6e6e66e6eo66eie61eeeleeTeOelee 0 £ 3-91Z P1.-6 LZZ £ 1. Sn 6'89 9: ON al3S 6u60m6e66uno6161 ge0 9'69 g: ON al 03S 11Vd ZOSSAC1 emooemOoeOO6eeo6eo C81.-891. 91.-Z I-EL I- £ 1. ## STR1 ## 8 0.15 gtgtccccagccctgtta SEQ ID NO: 28 59.5 0.15 8 91 6-11 83-103 DYS556 PET tcaccaatgacattttacagca SEQ ID NO: 29 59.1 0.6 ttggttagtgtaatgcatccag SEQ ID NO: 30 57.7 0.6 4 136 4-5 136-140 DYS517 PET aactgaccagcaaaaatgttaaa SEQ ID NO: 31 57.9 0.5 tgtctgagacctacaagattgc SEQ ID NO: 32 57.1 0.5 11 182 10-18 178-210 DYS565 PET ccaggaagcagtgttgcat SEQ ID NO: 33 59.8 0.3 gcagttctctgcctgtatgg SEQ ID NO: 34 58.5 0.36 266 5-9 262-278 DYS538 PET ttggggaaaacagatggtgt SEQ ID NO: 35 60.2 1.7 ccaaatacccatcataggaagaa SEQ ID NO: 36 59.2 1 , 7 6 327 5-8 323-335 Table 8B: Information on the 18 markers of the M1 Multiplex for chimpanzee samples. Marker Fluorochrome human DNA control Deduced from the literature only fx) Sequence (5'-3 ') Tm [O] ° Sequence (5'-3') Allele (nb Size Range Range of (cC) amplicon allelic units repeated size) ( bp) (nb ampliconic units expected (bp) repeated) SRY FAM gcgaaactcagagatcagcaag SEQ ID NO: 65 60.1 0.08 tgtgcctcctggaagaatgg SEQ ID NO: 66 61.9 0.08 81 UTY FAM cagtgttaccagccttaacag SEQ ID NO: 67 53.7 0.2 ggcaggtctacttttgtagag SEQ ID NO: 68 52 0.1 91 UTX FAM tctgtggactaggtttgtggt SEQ ID NO: 69 55.6 0.11 120 45 Y-GATA-Al0 FAM cctgccatctctatttatcttgcatata SEQ ID NO: 37 61.9 0.26 ataaatggagatagtgggtggatt SEQ ID NO: 38 59.1 0.26 13 163 9-16 147-175 DYS570 FAM tgtgacatcaaggttatgaaacg SEQ ID NO: 39 59.9 0.29 ggtgaaaattattcagcatagtcaag SEQ ID NO: 40 59.5 0.29 18 229 14-24 213 -253 DYS549 FAM gaaaagaaaagtgtaagccaaacc SEQ ID NO: 41 59.6 0.95 tttggtggcataagtggtaatg SEQ ID NO: 42 59.8 0.95 12 299 9-15 287-311 DYS460 VIC atcctctgcctatcatttattatgtat SEQ ID NO: 43 57.1 0 , 4 gaataccagaggaatctgacacc SEQ ID NO: 44 59.0 0.4 12 113 8-13 97-117 DYS442 VIC tgcaaaatcacggaaccaa SEQ ID NO: 45 61 0.15 caagccactgcaaatgtca SEQ ID NO: 46 59.4 0.15 12 181 9- 16 169-197 DYS510 VIC tifttcctccataccacag SEQ ID NO: 47 58.7 0.48 tctggagaagacagaacttgtca SEQ ID NO: 48 59.1 0.48 11 250 9-15 242-266 DYS541 VIC catcattaattctatctgttcatccat SEQ ID NO: 49 58.8 0.45 tggataaagaacacctttaagaagc SEQ ID NO: 50 59.3 0.45 12 318 10-15 310-330 DYS576 NED ccaagcaacatagcaagacct SEQ ID NO: 51 59.4 0.13 aagcgtatttgtcttggctttt SEQ ID NO: 52 59.4 0.13 19 123 13-22 99-135 DYS513 NED tgttgtaaaaatgactactgtggtatg SEQ ID NO: 53 58.6 0.22 ccacatcagcactattacttaactca SEQ ID NO: 54 58.9 0.22 12 306 9-15 294-318 DYS458 NED tgggtggtggaggttactgt SEQ ID NO: 55 60 , 3 0.12 cccaaagttctggcattacaa SEQ ID NO: 56 60.0 0.12 18 205 11-24 177-229 DYS481 PET aggaatgtggctaacgctgt SEQ ID NO: 57 59.8 0.2 ACCAGAGGTTGCAAGACTCA SEQ ID NO: 58 59.9 0, 2 22 122 18-32 110-152 DYS612 PET cccccatgccagtaagaata SEQ ID NO: 59 59.8 1.25 tg ag gg aaggcaaaagaaaa SEQ ID NO: 60 59.8 1.25 26 208 19-31 187-223 DYS444 PET catagaatgaaaggtgtgaacca SEQ ID NO: 61 59.0 0.45 tgccattcaaactcacgttg SEQ ID NO : 62 60.7 0.45 12 265 9-16 253-281 46 Table 9A: Information on the 14 markers of the M2 multiplex and for SRY, UTY and UTX for human samples. Fluorochrome marker Ref. Chimpanzee Deduced from literature NC_00024.9 (UCSC) only Sequence (5'-3 ') Tm (° C) [1.1M] ° Sequence (5'-3') Tm (° C) [pM] ° Allele (nb Size Range Range of units amplicon allelic size repeated) (bp) (nb ampliconic units expected (bp) repeated) SRY FAM gcgaaactcagagatcagcaag SEQ ID NO: 65 60.1 0.08 tgtgcctcctggaagaatgg SEQ ID NO: 66 61.9 0.08 81 UTY FAM cagtgttaccagccttaacag SEQ ID NO: 67 53.7 0.2 ggcaggtctacttttgtagag SEQ ID NO: 68 52 0.1 91 UTX FAM tctgtggactaggtttgtggt SEQ ID NO: 69 55.6 0.11 120 YLGATA-A10 FAM cctgccatctctatttatcttgcatata SEQ ID NO: 37 61.9 0.26 ataaatggagatagtgggtggatt SEQ ID NO: 38 59.1 0.26 4 130 NA NA DYS570 FAM tgtgacatcaaggttatgaaacg SEQ ID NO: 39 59.8 0.29 ggtgaaaattattcagcatagtcaag SEQ ID NO: 40 60.5 0.29 4 176 4 176 DYS549 FAM gaaaagaaaagtgtaagccaaacc SEQ ID NO: 41 59.6 0.95 tttggtggcataagtggtaatg SEQ ID NO: 42 59.8 0.95 8 283 NA NA DYS460 VIC atcctctgcctatcatttattatgt 'SEQ ID NO: 43 57.1 0.4 gaataccagaggaatctgaca cc SEQ ID NO: 44 59.0 0.4 10 105 NA NA DYS442 VIC tgcaaaatcacggaaccaa 59.7 0.15 caagccactgcaaatgtca 60.1 0.15 11 189 NA NA attcatctaacatctttgtcatctacc SEQ ID NO: 63 ttaacttgcctattgcatcc 0.95 SEQ ID NO: DYS533 PET 58.2 347 9-14 335-355 59.2 0.95 12 47 SEQ ID NO: 45 SEQ ID NO: 46 DYS510 VIC tttttcctcccttaccacaga SEQ ID NO: 47 58.7 0.48 tctggagaagacagaacttgtca SEQ ID NO: 48 59.1 0.48 11 236 9-11 -228-236 DYS541 VIC catcattaattctatctgttcatccat SEQ ID NO: 49 58.8 0.45 tggataaagaacacctttaagaagc SEQ ID NO: 50 59.3 0.45 11 354 10-11 350-354 DYS576 NED ccaagcaacatagcaagacct SEQ ID NO: 51 59.4 0.13 aagcgtatttgtcttggctttt SEQ ID NO: 52 59.4 0.13 3 73 3 73 DYS513 NED tgttgtaaaaatgactactgtggtatg SEQ ID NO: 53 59.4 0.22 ccacatcagcactattacttaactca SEQ ID NO: 54 SEQ ID NO .: 55 60.3 0.12 cccaaagttctggcattacaa SEQ ID NO: 56 60.0 0.12 2525 25 NA NA DYS481 PET aggaatgtggctaacgctgt SEQ ID NO: 60.9 0.22 25 351 NA NA DYS458 NED tg g gtggtgg aggttactgt 57 59.8 0.2 accagaaggttgcaagactca SEQ ID NO: 58 59.9 0.2 - - - - DYS612 PET cccccatgccagtaagaata SEQ ID NO: 59 59.8 1.25 tg ag gg aagg caaaag aaaa SEQ ID NO: 60 59.8 1.25 21 209 7-26 182 -223 DYS444 PET catag aatgaaaggtgtg aacca SEQ ID NO: 61 59.0 0.45 tgccattcaaactcacgttg SEQ ID NO: 62 60.7 0.45 14 262 NA NA DYS533 PET attcatctaacatctttgtcatctacc SEQ ID NO: 63 58.2 0.95 ttaacttgcctttttgcatcc SEQ ID NO: 64 59.2 0.95 - - - - ... Table 9B: Information on the 14 markers of the M2 multiplex for samples of chimpanzees for non-isonia The test of the M1 and M2 multiplexes on men and chimpanzees: choice of samples to maximize the observed genetic variability. A sample panel of 13 men and 11 chimpanzees were tested. They were genotyped with the 2 multiplexes in order to obtain an idea of the genetic variability detected (Le.alleles) for the M1 and M2 multiplexes, for the men and the chimpanzees. Men come from different countries and are therefore likely to have very different genetic profiles - this should allow for maximum genetic variability and an idea of the expected range of alleles. Chimpanzees come from various zoos and collections, to avoid the effects of consanguinity, and in the same way, to maximize our chances of getting different profiles.

Results: The degree of polymorphism (variability) of the markers included in the 2 multiplexes was estimated for the panel. The results are given in Table 10 for M1, in Table 11 for M2 and in Table 12 for the sexing tool. It is observed that the number of alleles and the variance is in agreement with the mutation rates predicted for M1 and M2, ie a larger variance for M2 (high mutation rate) than for Ml. Discriminant capacity of CombYplex compared to AmplYfiler: Individuals same surnames: Descriptive statistics: The following formulas were used: (1) discriminant capacity = no. of individuals / no. different haplotypes observed; (2) gene diversity (h), equivalent to the expected frequency of heterozygous frequencies with autosomal diploid loci was calculated as (n / (n-1)) - (1-Ep?), Where pi = frequency of allele to the ith. 49 M1 DYS485 DYS588 DYS502 DYS461 DYS638 DYS643 DYS587 DYS575 DYS578 Samples Allele Size Allele Size Allele Size Allele Size Allele Size Allele Size Allele Size Allele Size Allele Size Hu m_FX 16 121,56 12 151,22 8,206,23 11,257.67 11,312 , 5 10 136.35 11 198 10 263.88 9 313.79 Hum_20FT 16 121.65 13 156.31 8 206.26 11 257.64 9 304.39 11 141.46 11 198.05 10 263.84 8 309.61 Hum_21PF 16 121.57 12 151.26 8 206.25 10 253.69 11 312.48 10 136.4 12 203.01 10 263.9 8 309.61 Hum_28IT 18 127.69 15 166.37 8 206.27 12 261.59 11 312.49 10 136.39 14 212.9 10 263.83 7 305.57 Hum_29AH 16 121.71 13 156.29 9 206.24 10 253.71 11 312.5 9 131 , 43 11 198.01 10 263.87 8 309.65 Hum_310L 16 121.55 12 151.18 8 206.19 11 257.68 11 312.5 10 136.36 11 198.01 10 263.87 9 313, 71 Hum_34AHB 15 118.58 12 151.25 8 206.24 11 257.62 11 312.44 11 141.58 15 218.03 10 263.86 6 309.61 Hum_35JN 16 121.68 13 156.25 8 206 25 11 257.64 9 304.34 9 131.35 11 198.04 10 263.8 8 309.61 Hum_38ME 16 121.58 18 181.44 8 206.26 10 253.69 9 304.39 11 141.46 11 198.13 10 263.85 8 309.61 Hum_39TB 13 112.51 13 156.37 8 206.3 11 257.77 12 316 , 7 12 146.72 11 198.12 10 263.93 8 309.58 Hum_40EH 17 124.61 12 151.27 8 206.29 11 257.71 11 312.54 10 136.38 11 198.12 10 263, 86 9 313.71 Hum_43PF 14 115.63 13 156.34 8 206.3 11 257.7 11 312.46 12 146.61 11 198.03 10 263.89 8 309.55 Hum_45AMB 16 121.67 13 156, 36 '8 206.25 12 261.62 11 312.54 12 146.67 16 222.87 10 263.82 8 309.63 Hum_Cesar 16 121.78 13 156.08 8 206.27 11 257.59 11 312, 46 12 146.8 11 198.02 10 263.73 8 309.67 Chimp_103 14 115.66 13 173.92 13 227.35 10 257.61 10 308.6 3 91.2 9 161.12 7 264.66 9 305.08 Chimp_211 14 115.55 13 173.96 13 227.34 10 257.7 10 308.7 3 91.19 9 161.14 7 264.74 10 309.21 Chimp_253 14 115.6 13 173.93 13,227.41 11,261.61 10,308.65 3 91.14 9,161.21 7,264.75 9,305.06 Chimp_273 15,118.64 12,168.77 13,227.39 11,261.61 10,308.69 3 91.18 9 161.07 7 264.7 10 309.13 Chimp_295 14 115.62 13 173.99 13 227.37 10 257.62 10 308.7 3 91.18 9,161.14 7,264.68 9,305.09 Chimp_301 14,115.62 13,173.96 12,224.42 11,261.62 10,308.69 3 91,19 9,161.14 7,264.7 10,309.12 Chimp_367 13 112.49 13 173.94 13 227.33 10 257.68 10 308.61 3 91.18 9 161.15 7 264.71 9 305.07 Chimp_61A 14 115.62 13 173.99 12 224.31 10 257.64 10 308.65 3 91.27 9 161.06 7 264.65 9 305.13 Chimp_Sg229 14 115.62 13 173.94 13 227.33 10 257.68 10 308.65 3 91.15 9 161 , 15 7 264.65 9 305.07 Chimp_Sg369 14 115.63 13 173.94 13 227.32 10 257.75 10 308.67 3 91.19 9 161.15 7 264.78 10 309.17 Chimp_SgC1 15 118 , 64 15 184.3 13 227.39 11 261.6 10 308.59 3 91.21 9 161.13 7 264.72 9 305.02 Chimp_202 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 50 (female) Nb alleles Ho 6 4 1 3 3 4 5 1 3 Range 13-18 12-18 (8) 10-12 9-12 9-12 11-16 (10) 7-9 allelic Nb alleles Chz 3 3 2 2 1 1 1 1 2 Range 13-15 13-15 12-13 10-11 (10) (3) (9) (7) 9-10 allelic 51 M1 DYS632 DYS508 DYS640 DYS511 DYS577 DYS556 DYS517 DYS565 DYS538 Samples Allele Size Allele Size Allele Size Allele Size All Size Allele Size Allele Size Allele Size Allele Size Hum_FX 9 107.53 11 174.67 11 258.38 10 308.66 9 103.35 11 168.36 13 219.11 12 290.16 10 343.69 Hum_20FT 8 103 , 44 12 178.73 11 258.43 10 308.67 9 103.28 10 164.36 12 215.2 11 286.25 9 339.72 Hum_21PF 9 107.57 11 174.7 11 258.43 10 308, 67 9 103.28 11 168.34 16 230.56 13 293.99 10 343.73 Hum_28IT 8 103.45 11 174.72 12 262.31 11 312.63 9 103.37 10 164.42 15 226.61 12 290.06 9 339.72 Hum_29AH 8 103.47 11 174.74 12 262.29 9 304.63 9 103.31 11 168.28 12 215.17 11 286.19 10 343.71 Hum_310L 9 107.56 11 174.69 12 262.29 10 308.66 9 103.33 10 164.39 226.7 12 290.12 10 343.71 Hum_34AHB 9 107.6 12 178.83 11 258.39 10 308.62 8 99.22 12 172.28 15 226.66 12 290.05 10 343.68 Hum 35JN 8 103.5 12 178.83 12 262.32 9 304.61 9 103.35 11 168.31 16 230.39 11 286.15 10 343.64 Hum_38ME 8 103.44 11 174.66 12 262.25 9 304.75 9 103.36 10 164.4 13 219.18 11 286.33 9 339.72 Hum_39TB 8 103.41 10 170.59 11 258.42 10 308.71 9 103.33 10 164.39 13 219.18 11 286.3 10 343.76 Hum_40EH 9 107.52 11 174.74 11 258.43 10 308.7 9 103.29 10 164.47 14 223.02 12 290.16 10 343.76 Hum_43PF 8 103.42 11 174.7 12 262.28 9 304.71 9 103.34 10 164.43 14 222.96 11 286.28 10 343.71 Hum_45AMB 8 103.48 11 174.79 11 258.42 11 312 , 69 9 103.32 11 168.36 16 230.6 11 286.33 11 347.71 Hum_Cesar 8 103.51 12 178.98 11 258.42 10 308.56 9 103.43 11 168.27 12 215, 9 11 285.99 10 343.69 Chimp_103 10 103.27 11 212.03 6 262.29 9 316.52 8 90.88 4 136.8 11 182.24 6 266.52 6 327.79 Chimp_211 10 103, 22 10 207.97 6 262.26 9 316.59 8 90.95 4 136.82 14 193.89 6 266.57 6 327.79 Chimp_253 11 107.38 10 207.97 6 262.27 10 320.73 8 90.9 4 136.82 12 186.13 6 266.65 6 327.77 Chimp_273 10 103.27 10 207.96 6 262.28 9 316.62 8 90.94 4 136.79 11 182.29 6 266.53 6 327.77 Chimp_295 10 103.21 11 212 6 262.34 9 316.59 8 90.94 4 136.83 11 182.28 6 266.57 6 327.77 Chimp_301 10 103.24 12 216, 13 6 262.28 10 320.74 8 90.95 4 136.8 10 178.42 6 266.62 6 327.77 Chimp_367 10 103.26 11 212.06 6 26 2.21 11 324.86 6 90.86 4 136.82 11 182.29 6 266.62 6 327.86 Chimp_61A 11 107.4 10 207.98 6 262.33 7 308.51 8 90.95 4 136 , 78 13 189.94 6 266.54 6 327.7 Chimp_Sg229 10 103.26 11 212.04 6 262.29 9 316.62 8 90.91 4 136.79 11 182.3 6 266.56 6 327, 74 Chimp_Sg369 10 103.26 10 208.02 6 262.36 9 316.62 8 90.94 4 136.82 14 193.94 6 266.7 6 327.76 Chimp_SgC1 11 107.38 9 203.92 6 262, 32 8 312.48 8 90.9 4 136.76 13 189.95 6 266.6 6 327.82 Chimp_202 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 52 (female / control) Nb alleles Ho 2 3 2 3 2 3 5 3 3 Allelic range 8-9 10-12 11-12 (9-11) 8-9 10-12 12-16 11-13 9-11 Nb alleles Chz 2 4 1 5 1 1 5 1 1 Allelic range 10-11 9-12 (6) (7-11) (8) (4) 11-14 (6) (6) Table 10 M2 Y_GATA_A10 DYS570 DYS549 DYS460 DYS442 Samples Allele Size Allele Size Allele Size Allele Size Allele Size Hum_FX 13 163.55 18 229.95 12 299.49 12 113.52 12 181.39 Hum_20FT 12 159.45 15 217.57 12 299.49 10 105.19 11 177.4 Hum_21PF 14 167 , 59 20 238.12 12 299.56 11 109.41 13 185.44 Hum_281T 12 159.45 18 229.93 12 299.56 10 105.18 13 185.48 Hum_29AH 13 163.56 18 229.88 13 303.43 10 105.23 11 177.4 Hum_310L 13 163.6 17 225.85 13 303.47 10 105.28 12 181.45 Hum_34AHB 13 163.53 16 221.7 12 299.49 11 109.39 13 185.44 Hum_35JN 12 159.46 '18 229.83 13 303, 47 10 105.29 11 177.27 Hum_38ME 12 159.46 16 221.77 12 299.42 11 109.42 11 177.36 Hum_39TB 13 163.52 18 229.84 12 299.63 11 109.29 12 181 41 Hum_40EH 12 159.44 17 225.8 12 299.63 11 109.33 12 181.42 Hum_43PF 12 159.36 19 233.99 12 299.7 11 109.36 12 181.49 Hum_45AMB 12 159.44 22 246 , 47 11 295.64 11 109.34 12 181.42 Hum_César 13 163.63 18 229.95 13 303.46 10 105.17 1761 181.43 Chimp_103 4 130.85 4 176.18 8 283.6 10 105 , 08 11 189.51 Chimp_211 4 130.8 4 176.06 10 291.54 10 105.05 11 189.48 Chimp_253 4 130.79 4 176.11 8 283.53 9 100.82 11 189.53 Chimp_273 4 130,75 4,176,16 8,283.55 11,109,15 11,189.47 Chimp_295 4,130.83 4,176,17 8,283.56 10,105.01 11,189.54 Chimp_367 4,130.84 4,176.19 9 287.58 10 104.98 11 189.47 Ch imp_61A 4 130.84 4 176.11 8 283.61 11 109.18 10 185.5 Chimp_Sg229 4 130.73 4 176.18 8 283.62 10 105.03 11 189.51 Chimp_Sg369 4 130.82 4 176, 19 10 291.66 10 104.99 11 189.55 Chimp_SgC1 4 130.85 4 176.19 8 283.59 11 109.13 12 193.61 Chimp_202 ° 0 0 0 0 0 0 0 0 0 (female / control) Nb alleles Ho 3 7 3 3 3 Allelic range 12-14 15-22 11-13 10-12 11-13 Nb alleles Chz 1 1 2 3 3 Allelic range (4) (4), 8-10 9-11 10- 12 54 M2 DYS510 DYS541 DYS576 DYS458 DYS513 DYS481 DYS612 DYS444 DYS533 Samples Allele Size Allele Size Allele Size Allele Size Allele Size Allele Size Allele Size Allele Size Allele Size Hum_FX 11 250,07 12 318,17 19 123,6 18,205,06 12,306 , 37 22 122.76 26 208.39 12 265.52 12 347.68 Hum_20FT 11 250.15 11 314 17 116.01 16 197.55 13 310.36 19 113.84 26 208.38 12 265.59 11 343.7 Hum_21PF 13 258.09 12 318.15 18 119.85 15 193.74 12 306.29 23 125.7 25 205.33 14 273.63 12 347.74 Hu m_28IT 11 250.15 13 322.24 15 108.19 15 193.79 13 310.36 22 122.77 27 211.41 12 265.59 12 347.74 H um_29AH 12 254.09 11 314 18 119.85 18.2 207.01 12 306.3 26 134.69 25 205.26 12 265.6 12 347.75 Hum_310L 11 250 , 15 12 318.2 19 123.65 16 197.5 12 306.31 22 122.81 24 202.26 12 265.62 12 347.7 Hum_34AHB 10 246.05 12 318.2 16 112.1 16 197, 49 12 306.31 26 134.65 25 205.34 13 269.59 11 343.67 Hum_35JN 12 254.04 12 318.12 17 116.01 16.2 199.32 11 302.24 25 131.7 29 217.6 12 265.61 11 343.67 Hum_38ME 12 254.08 12 318.2 18 119.77 16 197.44 13 310.36 23 125.74 25 205.32 12 265.57 13 351.81 Hu m_39TB 11 250, 15 13 322.26 16 112.14 15 193.8 12 306.25 26 134.66 23 199.15 13 269.66 11 343.66 Hum_40EH 11 250.23 12 318.13 18 119.92 17 201.54 13,310.29 22,122.73 25,205.23 12,265.62 12,347.67 Hu m43PF 11,250.23 11,313.92 16,112.21 15,193.77 11,302.28 27,137.65 28,214.47 13 269.69 11 343.69 Hum_45AMB 11 250.23 10 309.91 18 119.92 17 201.47 12 306.3 26 134.67 26 208.34 12 265.64 11 343.7 H u m_Cesar 11 250 , 14 11 314 18 119.85 15 193.68 13 310.32 22 122.72 26 208.33 12 265.65 12 347.69 Chimp_103 11 236.96 11 354.82 3 73.36 25 275.3 25 351.36 NA NA 21 209.38 14 262.73 NA NA Chimp_211 10 232.99 12 358.88 3 73.26 26 279.02 25 351.42 NA NA 23 215.62 13 258.67 NA NA Chp_253 10 232.96 11.2 356.85 3 73.23 27 282.79 24 347.33 NA NA 22 212.49 13 258 , 7 NA NA NA NA Chimp_273 9 229.07 10 350.68 3 73.32 24.1 272.37 23 343.18 NA NA 20 206.29 13 258.72 Chimp_295 11 236.93 11 354.86 3 73.4 25,275.67 NA NA NA NA NA NA Chimp_367 10 232.93 11 354.82 3 73.35 26 279.17 24 347.3 NA NA 20 206 , 34 13 258.81 Chimp_61A 10 233.01 11 354.82 3 73.27 27 282.93 23 343.24 NA NA 23 215.56 12 254.83 Chimp_Sg229 11 236.96 11 354.77 3 73.43 25 275.35 25 351.29 NA NA 21 209.35 14 262.75 NA Chimp_Sg369 10 232.91 12 358.87 3 73.37 26 279.24 25 351.36 NA NA 23 215.54 13 258.74 NA NA Chimp_SgC1 11 236.96 10 350.68 3 73.45 26 279,16 23 343.16 NA NA 22 212.46 14 262.66 NA NA Chimp_202 o 0 0 0 0 0 0 0 0 0 NA NA 0 0 0 0 NA NA (female / control) Nb alleles H o 4 4 5 5 3 6 7 3 2 Allelic range 10-12 10-13 15-19 15-18 11-13 19-27 23-29 12-14 55 Nb alleles Chz 3 4 1 4 227 NA 4 123-14 NA 9-11 10-12 (3) 3 20-23 23-25 Table 11 M2 SRY UTX UTY Samples Allele Size Allele Size Allele Size Hum_FX 1 81.56 1 120.61 1 91.36 Hum_20FT 1 81.57 1 120 , 61 1 91.4 Hum_21PF 1 81.67 1 120.62 1 91.44 Hum_28IT 1 81.57 1 120.61 1 91.4 Hum_29AH 1 81.56 1 120.62 1 91.36 Hum_310L 1 81.63 1 120.68 1 91.43 Hum_34AHB 1 81.57 1 120.61 1 91.45 Hum_35JN 1 81.56 1 120.61 1 91.4 Hum_38ME 1 81.54 1 120.6 1 91.38 Hum_39TB 1 81 , 58 1 120.62 1 91.42 Hum_40EH 1 81.67 1 120.62 1 91.38 Hum_43PF 1 81.6 1 120.62 1 91.43 Hum_45AMB 1 81.6 1 120.63 1 91.4 Hum_Cesar 1 81.64 1 120.61 1 91.45 Chimp_103 1 81.59 1 120.7 1 91.34 Chimp_211 1 81.57 1 120.62 1 91.28 Chimp_253 1 81.56 1 120.61 1 91, 36 Chimp_273 1 81.68 1 120.63 1 91.35 Chimp_295 1 81.6 1 120.71 1 91.31 Chimp_367 1 81.59 1 120.7 1 91.3 Chimp_61A 1 81.59 1 120.7 1 91.34 Chimp_Sg229 1 81.59 1 120.63 1 91.34 Chimp_Sg369 1 81.59 1 120.62 1 91.3 Chimp_SgC1 1 81.67 1 120.62 1 91.39 Chimp_202_Fem 0 0 1 120.7 0 0 Nb alleles Ho 1 1 1 Nb alleles Chz 1 1 1 Table 12 These tables summarize the set of genetic variations (also called alleles) observed in individuals, and for each marker. We quickly see that each marker has several alleles in humans and a little less in chimpanzees - a result perfectly compatible with the demographic history of these 2 species. These results, which relate only to 13 and 11 individuals, are already proving more effective than what has been published so far in chimpanzees. It is therefore very revealing of the power of discrimination of this tool. The CombYplex assembly that includes the M1 and M2 multiplexes shows very good reproducibility and robustness, both in humans and chimpanzees. It allows to amplify 30/31 markers with sizes always lower than 350 bp, it allows to make the old or average quality DNA, as tested on individuals dating from the 16th century.

EXAMPLE 2: Sexing Tool Materials and Methods Samples of human and non-human primates. A panel of 177 DNA samples was used, including 116 human samples, and 61 non-human primate samples from 45 different species. Human samples were obtained from healthy volunteers and samples of non-human primates came from a collection. A list of these samples, including the taxonomic group, the common name of the species, and my previously obtained sex information is given in Table 13. The DNA samples used were extracted from different substrates including saliva, serum , whole blood, tissue and a cell culture. 58 Group Genus and Species Common Name Type Gender Gender Taxonomic / Sample Order Specimen Reported Genetic Homo sapiens Human Saliva 1 Male Male Homo sapiens Human Serum 2 Male Male Homo sapiens Human Saliva 3 Female Female Homo sapiens Human Serum 4 Female Female 1, Pan troglodyte troglodytes Chimpanzee of Central Africa Sang 5 Male Male Pan troglodytes troglodytes Chimpanzee of Central Africa Serum 6 Male Male Pan troglodytes troglodytes Chimpanzee of Central Africa Blood 7 Female Female Pan troglodytes troglodytes Chimpanzee of Central Africa Serum 8 Female Female 2 Pan paniscus Bonobo Serum 9 Male Male 3 Gorilla Gorilla Western Gorilla Blood 10 Male Male Gorilla Gorilla Western Gorilla Blood 11 Female Female Gorilla sp. Gorilla Serum 12 Male Male 4 Pongo pygmaeus pygmaeus Orangutan from Borneo Serum 13 Male Male Pongo sp. Orangutan Blood 14 Male Male Pongo sp. Orangutan Blood 15 Female Female Hylobates lar Gibbon with white hands Blood 16 Male Male Hylobates lar Gibbon with white hands Serum 17 Male Male Hylobatesilar Gibbon with white hands Blood 18 Female Female Hylobates! sp. Gibbon Serum 19 Female Female 6 Cercopithecus cephus Guenon with mustache Serum 20 Female? Female 7 Cercopithecus nictitans Rattle Serum 21 Male Male 8 Erythrocebus blades Monkey red Serum 22 Female? Female 9 Cercocebus torquatus Mangabey crowned Serum 23 Male Male Mandrillus sphinx Mandrill Serum 24 Male Male 11 Lophocebus albigena Mangabey with white cheeks Serum 25 Female Female 12 Papio sp. Baboon Blood 26 Female Female 59 Papio sp. Blood Baboon 27 Male Male 13 Macaca mulatta Rhesus Macaque Blood 28 Male Male Macaca sylvanus Berber Macaque Blood 29 Female Female 14 Macaca sylvanus Berber Macaque Blood 30 Male Male Alouatta caraya Monkey Black Howler Serum 31 Male Male Alouatta caraya Monkey Black Howler Unknown Male 16 Aotus trivirgatus Aotus Serum 32 Male Male 17 Saïmiri sciureus Common Sucker Serum 33 Male? Male Saïmiri sciureus Common Sucker Serum 34 Male? Male Saimiri sciureus Common Sucker Serum 35 Male? Male 18 Cebus apella Apelle Serum 36 Female Female Cebus apella Apelle Serum 37 Male Male 19 Callithrix jacchus White-breasted marmot Serum 38 Male Male Lepilemur dorsalis Gray-backed Lepilemur Cloth (in alcohol) 39 Unknown Male Lepilemur dorsalis Gray-backed Lepilemur Cell culture 40 Unknown Male 21 Lepilemur sahamalazensis Sahamalaza's Lepilemur Cell Culture 41 Unknown Female 22 Lepilemur ankaranensis Lepilemur ankaranensis Blood 42 Unknown Male Lepilemur ankaranensis Lepilemur ankaranensis Dry Tissue 43 Unknown Male 23 Lepilemur mittermeieri Lepilemur mittermeieri Blood 44 Female Female 24 Lepilemur ruficaudatus Red-tailed Lepilemur Blood 45 Male Male Lepilemur aeeclis Antafia's Epilemur Blood 46 Male Male 26 Microcebus murinus Cute Microcèbe Dry Cloth 47 Female Female 27 Hapalemurgriseus ranomafanensis Gray Hapalemur Dry Cloth 48 Unknown Female 28 Hapalemurgriseus meridionalis Hapalémur Southern Gray Bamboo Dry Fabric 49 Unknown Female 29 Hapalemurgriseus occidentalis Western Hapalemur gray Dry Cloth 50 Male Male Hapalemur aureus Golden Hapalemur Dry Cloth 51 Unknown Female 31 Hapalemur simus Large Hapalemur Dry Cloth 52 Female Female Hapalemur simus Large Hapalemur Dry Cloth 53 Male Male 60 Hapalemur simus Large Hapalemur Dry Cloth 54 Female Female 32 Hapalemur griseus griseus Hapalemur gray Dry cloth 55 Female Female 33 Eulemur macaco macaco Black lemur na 56 Unknown Male Eulemur macaco macaco Black lemur na 57 Unknown Male Eulemur macaco macaco Black lemur Serum 58 Unknown Male 34 Eulemur macaco flavifrons Lemur with turquoise eyes Dry cloth 59 Unknown Male Eulemur macaco flavifrons Turquoise eyed lemur Dry tissue 60 Unknown Male Lemur catta Lemur catta Serum 61 Unknown Male 36 Propithecus diademma edwardsi Milne-Edwards skewed dry cloth 62 Unknown Female 37 Propithecus tattersalli Tattersall sifaka Dry cloth 63 Female Female 38 Propithecus verreauxi coquerelli Coquerel's Sifaka Cell Culture 64 Male Male 39 Propithecus verreauxi verreauxi Verreaux's Sifaka Dry Tissue 65 Male Male Propithecus verreauxi deckeni Verreaux's Tenet Deckeni Dry Tissue 66 Female Female 41 Propithecus diadema diadema Crowned Sphinx Blood 67 Female Female 42 Avahi laniger Woolly Avahi 68 Male Male Avahi Laniger Woolly Avahi Dry Cloth 69 Female Female 43 Avahi occidentalis Western Avahi Blood 70 Male Male Avahi occidentalis Western Avahi Blood 71 Female Female 44 Avahi cleesei Avahi of John Cleese Cell Culture 72 Female Female Avahi Cleesei Avahi of John Cleese Dry Tissue 73 Unknown Male Indri indri Indri Cell culture 74 Unknown Male Table 13 DNA extraction The DNA extraction process depends on the type of sample. The DNA was extracted from: - (i) whole blood using the QiaAmp Mini Blood Kit mini kit (Qiagen), - (ii) serum using the mini-kit i-Genomic DNA Blood mini kit ( Euromedex) - (iii) saliva using the 0G-300 Oragene DNA Self-Collection Kit (DNA Genotek), - (iv) cell culture using the Blood & Cell Culture DNA mini kit (Qiagen), according to the manufacturer's instructions for each of the kits used.

The quantity and quality of the extracted DNA was estimated using a NanoDrop spectrophotometer. PCR Primer Design PCR primers for amplification of the SRY fragment have been previously published (Fiore et al., 2005). PCR primers for co-amplification of UTX and UTY homologous regions were designed from conserved UTX / UTY regions. Sequences available in libraries for different primate species were aligned using BioEdit v.7.0.5.3. Regions conserved for each gene were used for primer design using Primer3 software v.0.4 .0 in order to allow the co-amplification of UTX and UTY fragments of relatively small size, from sample probably comprising degraded DNA. 5'-labeled sense primers with a fluorescent FAM fluorochrome (InVitrogen) were used to allow detection by capillary electrophoresis. The sequences of the primers and the sizes of the amplicons are shown in Table 6.

Marker Passing primer Unsense primer Amplified length (bp) SEQ ID NO Sequence (5'-3 ') SEQ ID NO Sequence (5'-3') SRY 70 agtgaagcgacccatgaacg 66 tgtgcctcctggaagaatgg 165 UTY 67 cagtgttaccagccttaacag 68 ggcaggtctacttttgtagag 91 UTX 69 tctgtggactaggtttgtggt 120 Sequence (5'-3 ') of primers sense Conc. Sequence (5'-3 ') of Conc. PCR antisense primers Size of PCR (pM) (pM) amplicon (bp) Test primers UTXUTY_F1 (FAM-) 1 0.4 UTX_R1 0.2 120 CAGTGTTACCAGCCTTAACAG 5'TCTGTGGACTAGGTTTGTGGT 3 '0.2 91 (SEQ ID NO 67) (SEQ ID NO 69 ) UTY_R1 5'GGCAGGTCTACTTTTGTAGAG 3 '(SEQ ID NO. 68) SRY_F1 (FAM-) 2 0.2 SRY_R1 0.2 165 5' AGTGAAGCGACCCATGAACG 3 '5' TGTGCCTCCTGGAAGAATGG 3 '(SEQ ID NO: 70) (SEQ ID NO. 66) Table 6 Multiplex PCR Amplification UTX, UTY and / or SRY regions were simultaneously amplified in a final volume of 12.5 μl consisting of 1X of PCR B buffer (Fisher Bioblock), 1.5mM MgCl 2, 200 μM of each dNTP, 0.2 to 0.4 μM primers, 1U of Taq DNA polymerase (Fisher Bioblock) and 15 to 25 μg of DNA sample. The concentrations of the primers for each primer are given in Table 6. The PCR cycle conditions are a first denaturation step at 94 ° C for 5 min followed by 40 denaturation cycles at 94 ° C for 30 s, hybridization to 55 ° C for 30s and an elongation at 72 ° C for 30s with a final elongation step at 72 ° C for 5min. It is important to note the hybridization temperature was decreased to 51 ° C for prosimian samples. Electrophoresis Detection The PCR products were first visually assayed by agarose gel electrophoresis (140V, 40min) on 2% agarose gels using SYBR Safe staining (Invitrogen). For sample preparation for capillary electrophoresis detection, 1 μl of 100-fold diluted PCR products were then mixed with 0.2 μl of GeneScan-600LIZ internal standard and 8.8 μl Hi-Di formamide. After denaturation at 95 ° C for 5 min, the samples were separated on an ABI 3730 Genetic Analyzer using POP-7. The data was analyzed using GeneMapper software. 4.0. UTX sequencing, UTY and SRY were amplified separately using the primer pairs in Table 6, as previously described. Each PCR product was sequenced in two reactions using the sense and antisense PCR primers. The sequencing reaction was performed with a Big Dye Terminator v3.1 sequencing kit (Applied Biosystems). The PCR products were separated on an ABI 3730 Genetic Analyzer (Applied Biosysems). The sequences were analyzed and assembled using the Sequence Scanner v1.0 software (Applied Biosystems) and the BioEdit Sequence Alignment Editor. Results Multiplex PCRs developed including both UTX / UTY and SRY primers allow for sex determination for each DNA sample tested. The results are given in Table 7. Female Male Profile F -Profile A Profile B Profile C Hominidae Homo sapiens 2 2 0 0 Pan sp. 2 3 0 0 Gorilla sp. 1 2 0 0 Pongo sp. 1 2 0 0 Hylobatidae Hylobates sp. 2 2 0 0 Cercopithecidae Cercopithecus sp. 1 1 0 0 Erythrocebus patas 1 0 0 0 Cercocebus torquatus 0 1 0 0 Mandrillus sphinx 0 1 0 0 Lophocebus albigena 1 0 0 0 Papio sp. 1 1 0 0 Macaca sp. 1 2 0 0 Atelidae Alouatta 0 1 0 0 caraya Cebidae Saïmiri 0 0 0 3 jacchus sciureus Cebus apella 1 0 0 1 Aotus trivirgatus 0 1 0 0 Callithrix 0 1 0 0 Lemuridae Hapalemur sp. 6 7 0 0 Eulemur sp. 0 3 0 1 Lepilemuridae Lepilemur sp. 2 4 2 0 Indriidae Avahi sp. 3 1 1 0 Propithecus sp. Table 7 Female samples were identified by a single signal corresponding to 125 bp specific UTX fragments (F profile, Figure 9). On the contrary, three different profiles were observed for male samples as illustrated in Figures 6 to 8. In fact, the male samples were identified either by three signals, which corresponded to the specific fragment of X and the two specific fragments of Y (Profile A) or occasionally by two signals which corresponded to the specific fragment of X and only to one of the two fragments of the Y chromosome that is to say either SRY (C profile) or UTY (B profile). The results obtained for each sample are given in Table 5. A typical male profile (Profile A) with both SRY and UTY fragments was observed for most samples. The six samples that did not have UTY fragments but clearly showed a specific SRY signal belong to the New World monkey species (Saïmri sciureus (n = 3) and Cebus' apella (n = 1)) and to both species. Prosimians (Indri Indri (n = 1) and Eulemur macaco flavifrons (n = 1)) The five samples that did not show a SRY fragment but showed a specific signal of clear UTY belonged to the old world monkey species (Lophocebus). albigena) and four species of prosimians.

For the 54 samples tested whose sex was already known, the sex determined with the new test was always consistent with the morphological sex. In order to investigate whether a failure of amplification of the UTY or SRY locus was due to a mutation in the primer binding site or a deletion of new UTRY and SRY primer sets were designed. Amplifications with the second sets of primers were successful for all samples and the resulting amplicon sequencing revealed that the inability to amplify the locus with the first set of primers was due to mutations in the binding of the primers. Thus, the newly developed method unambiguously allows the genus of all tested samples to be determined even in the presence of a mutation in the primer region. The first and main advantage of this method is that it combines two UTX / UTY and SRY independent sexing tests in an assay for exact sex determination. Indeed, 11 male specimens that did not have UTY or SRY fragments that would previously have been considered female samples based on the UTXTTUY or SRY alone locus analysis were identified as males by this approach. This shows the need for a sex determination test that includes at least 2 Y markers for primates, thereby preventing misidentification of sex due to high structural polymorphism on the Y chromosome or mutation at the binding site. the primer. By using two Y-specific fragments, the negative effect of a mutation on the primer binding site or a deletion on an amplification can be minimized since a mutation and / or deletion on both loci is unlikely to occur. The second advantage of this method is its wide spectrum of application in primates. Indeed, it works on all species tested especially through the work on the design of primers. The same method works on all the species tested, but a slight optimization by reducing the hybridization temperature is preferable for sexing the distant prosimic species. This method is accessible to molecular biology laboratories with basic equipment since the size difference between the three possible amplification products is large enough to be discerned by simple agarose gel electrophoresis and an automatic sequencer is not necessary. Finally, the small size of the amplification products (<200bp) makes them useful for identifying the sex of potentially degraded samples such as serum samples and also non-invasive samples such as hair or faeces. REFERENCES During this application, various references describe the state of the art of the invention. The descriptions of these references are hereby incorporated by reference in the present description. Butler JM, Schoske R, Vallone PM, Kline TM, Redd AJ, Hammer MF. A novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci Int. 2002 Sep 10; 129 (1): 10-24. Parkin EJ, Kraayenbrink T, Opgenort JR, Van Driem GL, Tuladhar NM, Knijff P, Jobling MA. Diversity of 26-locus Y-STR haplotypes in Nepalese population sample: isolation and drift in the Himalayas.Forensic Sci Int. 2007 Mar 2; 166 (2-3): 176-81. Epub 2006 Jun 15.

Patel, P.I., et al. (1984) "Organization of the HPRT gene and related sequences in the human genome," Somat Cell Mol Genet 10: 483-493, and Gill, P., et al. (1985) Forensic Application of DNA Fingerprints, Nature 318: 577-579. Chamberlain JS, Gibbs RA, Ranier JE, Nguyen PN, Caskey CT. Nucleic Acids Res. 1988 Dec 9; 16 (23): 11141-56. Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Morral N, Estivill X. Multiplex PCR amplification of three microsatellites within the CFTR gene. Genomics. 1992 Aug; 13 (4): 1362-4. Ensminger AL, Hoffman SM. Sex identification is useful in great apes. Am J Primatol. 2002 Feb; 56 (2): 129-34.

Kimpton CP, Gill P, Walton A, Urquhart A, Millican ES, Adams M. Automated DNA profiling employing multiplex amplification of short tandem repeat loci. PCR Methods Appl. 1993 Aug; 3 (1): 13-22. Hammond; Schumm, J.W. et al. (1994) "Development of nonisotopic multiplex amplification sets for polymorphic analysis of STR loci," in "The Fourth International Symposium on Human Identification 1993," pp. 177-187 Goedbloed M, Vermeulen M, Fang RN, Lembring M, Wollstein A, Ballantyne K, Lao O, Brauer S, Krüger C, Roewer L, Lessig R, Ploski R, Dobosz T, Henke L, Henke J, Furtado MR , Kayser M. Comprehensive mutation analysis of 17 Y-chromosomal short tandem repeat polymorphisms included in the AmpFISTR Yfiler PCR amplification kit. Int J Legal Med. 2009 Nov; 123 (6): 471- Hanson EK, Ballantyne J. An ultra-high discrimination Y chromosome short tandem repeat multiplex DNA typing system. PLoS One. 2007 Aug 1; 2 (8): e688. Ballantyne KN, Goedbloed M, Fang R, Schaap O, Lao O, Wollstein A, Choi Y, van Duijn K, Vermeulen M, Brauer S, Decorte R, Poetsch M, von Wurmb-Schwark N, Knijff P, Labuda D, Vezina H, Knoblauch H, Lessig R, Roewer L, Ploski R, Dobosz T, Henke L, Henke J, Furtado MR, Kayser M. Mutability of Y-chromosomal microsatellites: rates, characteristics, molecular bases, and forensic implications. Am J Hum Genet. 2010 Sep 10; 87 (3): 341-53. doi: 10.1016 / j.ajhg.2010.08.006. Vermeulen M, Wollstein A, van der Gaag K, Lao O, Xue Y, Wang Q, Roewer L, Knoblauch H, Tyler-Smith C, Knijff P, Kayser M. Improving global and regional resolution of male lineage differentiation by simple single -copy Y-chromosomal short tandem repeat polymorphisms. Forensic Sci Int Genet. 2009 Sep; 3 (4): 205-13. doi: 10.1016 / j.fsigen.2009.01.009. Epub 2009 Feb 23. Maybruck JL, Hanson E, Ballantyne J, Budowle B, Fuerst PA. A comparative analysis of two different sets of Y-chromosome short tandem repeats (Y-STRs) has a common population panel. Forensic Sci Int Genet. 2009 Dec; 4 (1): 11-20. doi: 10.1016 / j.fsigen.2009.03.004. Epub 2009 May 17.

Hanson E, Maybruck JL, Ballantyne J, Fuerst PA. Performance evaluation and optimization of multiplex PCRs for the highly discriminating OSU 10-locus set Y-STRs. J Forensic Sci.

2012 Jan; 57 (1): 52-9. doi: 10.1111 / j.1556-4029.2011.01910.x. Epub 2011 Sep 21. Kayser M, Kittler R, Erler A, Hedman M, Lee AC, Mohyuddin A, Mehdi SQ, Rosser Z, Stoneking M, Jobling MA, Sajantila A, Tyler-Smith C. A comprehensive survey of human Y- chromosomal microsatellites. Am J Hum Genet.

2004 Jun; 74 (6): 1183-97. SULLIVAN KM, MANNUCCI A, KIMPTON CP, GILL A rapid and quantitative dna sex test: Fluorescence-based analysis of x-y homologous gene amelogenin. Biotechnology. 1993 Oct; 15 (4): 636-8, 640-1.

Claims (13)

REVENDICATIONS1. A method for characterizing a sample of human or chimpanzee DNA comprising a step of: -determining the alleles of at least 10 STR loci of the DNA sample, the loci being selected from the group M1 and / or the group M2, in which: the group M1 consists of: DYS485, DYS588, DYS502, DYS461, DYS638, DYS643, DYS587, DYS575, DYS578, DYS632, DYS508, DYS640, DYS511, DYS577, DYS556, DYS517, DYS565 and DYS538 and -the group M2 consists of: Y-GATA-A10, DYS570, DYS549, DYS460, DYS442, DYS510, DYS541, DYS576, DYS513, DYS458, DYS481, DYS612, DYS444 and DYS533. A method for characterizing a DNA sample according to claim 1 comprising the step of determining alleles of at least 15 STR loci selected from the M1 group. A method for characterizing a DNA sample according to claim 1 comprising the step of determining alleles of at least 11 STR loci selected from the M2 group. A method for characterizing a DNA sample according to claim 1 comprising determining alleles of at least 10 STR loci selected from the M1 group and at least 10 STR loci selected from the M2 group. . 5. A method for characterizing a DNA sample according to any one of claims 1 to 4 comprising a sex determining step wherein the sex determination comprises the step of amplifying the SRY, UTY and UTX genes of the present invention. DNA sample. A method for characterizing a DNA sample according to claim 5 wherein the step of amplifying the SRY, UTY and UTX genes comprises adding primer pairs having the nucleic sequences: SEQ ID NO: 65 and SEQ ID NO: 66 for SRY, SEQ ID NO: 67 and SEQ ID NO: 68 for UTY and SEQ ID NO: 67 and SEQ ID NO: 69 for UTX. 40 3 0 13 73 3 69 A kit comprising means for determining the alleles of at least 10 STR loci of a human or chimpanzee DNA sample, the loci being selected from the group M1 and / or the group M2, wherein: the group M1 consists of: DYS485, DYS588, DYS502, DYS461, DYS638, DYS643, DYS587, DYS575, DYS578, DYS632, DYS508, DYS640, DYS511, DYS577, DYS556, DYS517, DYS565 and DYS538 and the M2 group consists of: Y-GATA-A10, DYS570, DYS549, DYS460, DYS442, DYS510, DYS541, DYS576, DYS513, DYS458, DYS481, DYS612, DYS444 and DYS533. The kit of claim 7 comprising at least 10 primer pairs adapted to amplify STR loci and wherein the primer pairs have nucleic sequences selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO: 2 for the DYS485 locus, SEQ ID NO: 3 and SEQ ID NO: 4 for the DYS588 locus, SEQ ID NO: 5 and SEQ ID NO: 6 for the DYS502 locus, SEQ ID NO: 7 and SEQ ID NO. : 8 for locus DYS461, SEQ ID NO: 9 and SEQ ID NO: 10 for locus DYS638, SEQ ID NO: 11 and SEQ ID NO: 12 for locus DYS643, SEQ ID NO: 13 and SEQ ID NO: 14 for the DYS587 locus, SEQ ID NO: 15 and SEQ ID NO: 16 for the DYS575 locus, SEQ ID NO: 17 and SEQ ID NO: 18 for the DYS578 locus, SEQ ID NO: 19 and SEQ ID NO: 20 for the locus DYS632, SEQ ID NO: 21 and SEQ ID NO: 22 for the DYS508 locus, SEQ ID NO: 23 and SEQ ID NO: 24 for the DYS640 locus, SEQ ID NO: 25 and SEQ ID NO: 26 for the DYS511 locus , SEQ ID NO: 27 and SEQ ID NO: 28 for the DYS577 locus, SEQ ID NO: 29 and SEQ ID NO: 30 for locus DYS556, SEQ ID NO: 31 and SEQ ID NO: 32 for locus DYS517, SEQ ID NO: 33 and SEQ ID NO: 34 for locus DYS565, SEQ ID NO: 35 and SEQ ID NO: 36 for locus DYS538, SEQ ID NO: 37 and SEQ ID NO: 38 for locus Y-GATA-A10 SEQ ID NO: 39 and SEQ ID NO: 40 for locus DYS570, SEQ ID NO: 41 and SEQ ID NO: 42 for the DYS549 locus, SEQ ID NO: 43 and SEQ ID NO: 44 for the DYS460 locus, 3 0 13 73 3 70 SEQ ID NO: 45 and SEQ ID NO: 46 for the DYS442 locus SEQ ID NO : 47 and SEQ ID NO: 48 for the DYS510 locus, SEQ ID NO: 49 and SEQ ID NO: 50 for the DYS541 locus, SEQ ID NO: 51 and SEQ ID NO: 52 for the DYS576 locus, 5 SEQ ID NO: 53 and SEQ ID NO: 54 for locus DYS513, SEQ ID NO: 55 and SEQ ID NO: 56 for locus DYS458, SEQ ID NO: 57 and SEQ ID NO: 58 for locus DYS481 SEQ ID NO: 59 and SEQ ID NO: 60 for the DYS612 locus, SEQ ID NO: 61 and SEQ ID NO: 62 for the DYS444 locus and 10 SEQ ID NO: 63 and SEQ ID NO: 64 for the DYS533 locus. Kit according to claims 7 or 8 comprising means for determining the alleles of at least 15 STR loci selected from the group M1. 15 Kit according to claims 7 or 8 comprising means for determining the alleles of at least 11 STR loci selected from the group M2. Kit according to any one of claims 7 to 10 comprising means for determining the alleles of at least 10 STR loci selected from the M1 group and at least 10 STR loci selected from the group M2. 25 A kit according to any one of claims 7 to 11 including sex determination means, wherein the sex determining means comprises means for amplifying the SRY, UTY and UTX genes. The kit of claim 12 wherein the SRY, UTY and UTX gene amplification means comprises primer pairs having the nucleic acid sequences: SEQ ID NO: 65 and SEQ ID NO: 66 for SRY, SEQ ID NO : 67 and SEQ ID NO: 68 for UTY and SEQ ID NO: 67 and SEQ ID NO: 69 for UTX.