FR3001228A1 - PROCESS FOR OBTAINING STABLE TRANSFORMANTS OF MICROALGUES OF THE GENUS CHLORELLA - Google Patents

Abstract

The present invention relates in particular to a process for obtaining a stable microalgae transformant of the Chlorella genus as well as expression vectors and microalgae of the Chlorella genus comprising said expression vectors.

Description

PROCESS FOR OBTAINING STABLE TRANSFORMANTS OF MICROALGUES OF THE CHLORELLA GENUS The industrial potentialities of microalgae in terms of applications related to energy, health, cosmetics, food and the environment are particularly important. Due in particular to the controversies related to first-generation biofuels, the technical-economic limits that hinder second-generation biofuels, the production of biofuels from microalgae has undergone significant global development over the last five years. Biogas is also another form of energy that can be derived from microalgae. The field of cosmetics aims to integrate more and more natural ingredients, including oils, pigments from microalgae.

The food industry, also incorporates molecules from microalgae, mainly dyes. Microalgae also offer interesting opportunities in the field of food supplements and nutraceuticals. Microalgae are widely used in animal feed, especially for fish fry food but also for fattening food.

Companies such as biotechnology or pharmaceuticals also need systems of production of molecules of interest that meet their requirements in terms of quality, quantity of molecules produced and profitability. This sector is booming. Since the late 1990s, more than 280 therapeutic recombinant proteins have been commercialized.

For several years, microalgae have been proposed as a system of production of interest molecules as an alternative to bacterial expression systems, in yeasts, insect cells or in plant cells. However, there are many technical constraints to such use of which one of the major points is the obtaining of stable transformants.

Among the various microsigues existing, those of the genus Chlorella are particularly interesting for the different industrial applications. Indeed, microalgae of the genus Chlorella can be grown on a large scale at low cost under different cultivation methods: autotrophy, mixotrophy or heterotrophy. Their culture can be carried out in conventional fermenters already present on industrial sites.

Advantageously, in heterotrophic culture, the carbon source may be a co-product of an industrial sector. It should be noted that microalgae of the genus Chlorella are among the microalgae with the best productivities. In addition, the composition of various microalgae algae of the genus Chlorella is particularly interesting for certain industrial applications: for example their high oil content makes it possible to use them advantageously to produce biofuels, and a high protein content allows their use in animal feed. In addition, microalgae of the genus Chlorella are of interest in producing recombinant proteins because of their eukaryotic characteristics, including their ability to perform posttranslational modifications such as N-glycosylation.

However, literature data (Chow et al., 1999, Rakkhumkaew et al., 2012) show transgenic instability in microalgae of the genus Chlorella, thus preventing their use on an industrial scale as a system for expressing molecules. interest. The objective of the present invention is therefore to have available a process for obtaining stable transformants of microalgae of the Chlorella genus, thus allowing their use as a production system of substances of interest at the industrial level. The inventors have surprisingly demonstrated that the presence of at least one endogenous nucleic acid sequence of the nuclear genome of a microalgae of the Chlorella genus in a transformation vector (in particular an expression vector), in particular two fragments of the gene sequence encoding the 18S rRNA, makes it possible to obtain particularly stable transformants of Chlorella microalgae, at least up to seventeen successive subcultures, after cryopreservation, in the presence or in the absence of selection agent.

Thus, according to a first aspect, the subject of the invention is a process for obtaining a stable microalgae transformant of the Chlorella genus comprising the following steps: (i) transformation of the nuclear genome of a microalgae of the Chlorella genus by a vector expression medium comprising: an expression cassette, in particular a heterologous one; and an endogenous nucleic acid sequence of the nuclear genome of said microalgae of the genus Chlorella and / or a stabilizing nucleic acid sequence having at least 80% identity, in particular at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, with said endogenous stabilizing nucleic acid sequence throughout the length of said sequence; said endogenous stabilizing nucleic acid sequence being from 10bp to 300kbp in length; and (ii) selecting a stable transformant. The method according to the invention has the following advantages in particular: It allows the production of molecules of interest in a system particularly adapted to industrial scale: high productivity, low costs, uses of industrial fermenters, possibility of different modes of cultivation ( in autotrophy, in mixotrophy or in heterotrophy), possibility of using co-product of industrial sector as carbon source in culture in heterotrophy; It allows the production of substances of interest in particular by modification of the metabolic pathways by genetic engineering. In particular, the method according to the invention thus allows the production of enzymes involved in the metabolism of lipids leading to the production and accumulation of specific lipids; It allows the production of recombinant molecules in a system with eukaryotic properties; Indeed, microalgae of the genus Chlorella have the ability to perform post-translational modifications such as Nglycosylation. In particular, the method according to the invention thus allows the production of glycosylated proteins, particularly of therapeutic interest, such as monoclonal antibodies, viral envelope proteins, and lysosomal enzymes. In order to allow a better understanding of the present invention, certain definitions are provided. Unless otherwise indicated, the other technical terms used in this application must be interpreted in their usual meaning.

For the purposes of the present invention, the term "transformant" means any organism, in particular a microalgae of the genus Chlorella, resulting from a genetic transformation. The term "stable microalgae transformant of the genus Chlorella" in the sense of the present invention is understood to mean a microalgae transformant of the genus Chlorella in which the presence of the transformation vector (in particular the expression vector according to the invention by which said microalgae of the genus Chlorella in the process for obtaining a stable transformant according to the invention) and / or a transgene optionally included in the transformation vector and / or the expression cassette possibly included in the transformation vector is detected after at least 4 successive transplants, in particular at least 10 successive transplants, more particularly at least 15 successive transplants and especially at least 17 successive transplants, in particular after culture of the transformant after cryopreservation and / or without a selection agent, in particular in autotrophy , mixotrophy or heterotrophy. The detection of the transformation vector and / or the transgene can be carried out according to any technique well known to those skilled in the art, such as by PCR (Polymerase Chain Reaction) using primers specific for the transformation vector and / or the transgene and / or expression cassette. For the purposes of the present invention, the term "transformation vector" is intended to mean any vector through which an organism is transformed, in particular a microalgae of the genus Chlorella. In particular, the transformation vector is the expression vector according to the invention by which said microalgae of the genus Chlorella is transformed in the process for obtaining a stable transformant according to the invention. For the purposes of the present invention, the term "transgene" means any nucleic acid molecule, in particular any gene, intended to be introduced into an organism, in particular a microalgae of the genus Chlorella. In particular, the transgene is a DNA sequence encoding a substance of interest and included in the heterologous expression cassette according to the invention. For the purpose of the present invention, the term "successive subculture" is intended to mean the removal of at least one microalgae of the Chlorella genus from an initial culture medium and culturing it in a culture medium that is identical to or different from the initial medium. In particular, successive subcultures can be carried out by subculturing the culture in a fresh medium every 2 to 3 weeks, at the same cell concentration or at a different cell concentration, in the same medium or in a culture medium different from the medium. initial. The term microalgae of the genus Chlorella "within the meaning of the present invention any microalgae belonging to the genus Chlorella. For example, microalgae of the genus Chlorella can be selected from the group consisting of Chlorella alternans (Chlorella autotrophica, Chlorella autotrophica var. , Chlorella beijerinckii (Parachlorella), Chlorella capsulata, Chlorella conductrix (Brandt) Beijerinck, Chlorella desiccata, Chlorella ellipsoidea, Chlorella emersonii, Chlorella emersonii var globosa, Chlorella fusca var vacuolata, Chlorella hainangensis (Heveochlorella), Chlorella kessleri (Parachlorella), Chlorella lobophora, Chlorella luteoviridis (Heterochlorella), Chlorella marina, Chlorella miniata, Chlorella minutissima, Chlorella mirabilis, Chlorella ovalis, Chlorella parasitica (Brandt) Beijerinck, Chlorella parva, Chlorella pringsheimii (Pseudochlorella), Chlorella protothecoides (auxenochlorel (a), Chlorella protothecoids var communis (auxenochlorel (a), Chlorella pyren oidosa, Chlorella pyrenoidosa (Pseudochlorella), Chlorella regularis var. minima, Chlorella reisiglii, Chlorella saccharophila, Chlorella saccharophila var. saccharophila, Chlorella saccharophila var. ellipoida, Chlorella satina, Chlorella sorokiniana, Chlorella spaerckii, Chlorella species, Chlorella sphaerica, Chlorella stigmatophora, Chlorella variabilis, Chlorella variegata Beijerinck, Chlorella viscosa, Chlorella vulgaris, Chlorella vulgaris fo. Tertia, Chlorella vulgaris fo. Viridis, Chlorella vulgaris Beijerinck, Chlorella xanthella Beijernick, Chlorella zofingiensis, especially Chlorella protothecoides and Chlorella sorokiniana, especially Chlorella protothecoides. For the purposes of the present invention, the term "transformation of the nuclear genome" is intended to mean any technique making it possible to introduce nucleic acid molecules into the nucleus of a receptor organism, in particular a microalgae of the genus Chlorella. Examples of techniques for transforming the nuclear genome of a microalgae of the genus Chlorella include electroporation (Maruyama et al., 1994), techniques using PEG (polyethylene glycol) (Jarvis and Brown, 1991). ), techniques using Agrobacterium (Cha et al., 2012), biolistics. Some of these techniques are illustrated in the examples of this application.

In particular, the step (i) of transforming the nuclear genome of a microalgae of the Chlorella genus is carried out by biolistics. During step (i) of transformation of the nuclear genome of a microalga of the Chlorella genus, the expression vector may be in circular or linear form. Prior to step (i) of transforming the nuclear genome of a microalgae of the genus Chlorella, the method according to the invention may comprise a step of preparing protoplasts of said microalgae of the genus Chlorella. Thus step (i) of transformation of the nuclear genome of a microalgae of the genus Chlorella can be carried out on intact cells or on protoplasts of a microalgae of the genus Chlorella. The step of preparing protoplasts of a microalgae of the Chlorella genus may be carried out according to any technique well known to those skilled in the art such as that described in the article by Lu et al., 2011. Step (ii) for selecting a stable transformant can be implemented, in particular by detecting the presence of the expression vector and / or the expression cassette in the transformant, after at least 4 successive subcultures, in particular at least 10 successive subcultures, more particularly at least 15 successive transplants and especially at least 17 successive transplants, especially after culture of the transformant after cryopreservation and / or without selection agent, especially in autotrophy, mixotrophy or heterotrophy. The detection of the presence of the expression vector and / or of the expression cassette in the transformant making it possible to validate the stability of the transformant can be done according to any techniques well known to those skilled in the art, such as by PCR (" Polymerase Chain Reaction ") using primers specific for the expression vector and / or the expression cassette. This detection of the expression vector and / or the expression cassette in the transformant is advantageously carried out after each subculture. By way of example, the step (ii) of selecting a stable microalgae transformant of the Chlorella genus can be carried out as follows: after 15 to 21 days of culture, the potentially transformed clones of microalgae of the genus Chlorella that develop on selection agar plates are transplanted a first time on a fresh medium supplemented with selection agent. The clones are then regularly transplanted on selection agar plates and from the third subculture, they are also placed in a liquid medium in the presence of selection agent. After 4 successive subcultures, the clones are both subcultured on media with and without a selection agent. After 5 rounds of subculture, the clones are placed in culture, in particular in heterotrophic conditions, with and without a selection agent. The monitoring of the detection of transformation vectors (expression vectors according to the invention) and / or transgenes (nucleic acid sequences of interest according to the invention) is carried out after each transplanting and this in order to define the stability detection of the transformation vectors (expression vectors according to the invention) and / or transgenes (nucleic acid sequences of interest according to the invention) in the genome of the transformed microalgae. The integration of the transformation vectors (expression vectors according to the invention) and / or transgenes (nucleic acid sequences of interest according to the invention) into the genome of microalgae of the genus Chlorella and the stability of the integration are verified by PCR amplification on the transformed clones obtained for the microalgae, subcultured in culture media with and without a selection agent, grown under standard culture conditions and in particular under heterotrophic conditions. According to a particular embodiment, the detection of the integration of the transformation vectors (expression vectors according to the invention) and / or transgenes (nucleic acid sequences of interest according to the invention) into the genome of the Microalgae of the Chlorella genus and the stability of the integration can be checked after cryopreservation: Thus, the transformed clones of microalgae of the Chlorella genus can be cryopreserved at -80 ° C .; in order to validate the stability of the integration of the transgenes (nucleic acid sequences of interest according to the invention) into the genome of the microalgae, PCR analyzes are carried out on cultures derived from cryopreserved clones for at least 2 months.

For the purposes of the present invention, the term "expression vector" is intended to mean any vector that makes it possible to express a molecule of nucleic acids in an organism, in particular a microalgae of the genus Chlorella. The expression vector may be viral such as bacteriophages or non-viral such as plasmids.

For the purposes of the present invention, the term "expression cassette" is intended to mean a fragment of nucleic acids, in particular DNA which can be inserted into a vector at specific restriction sites, said fragment comprising the sequences necessary for the expression of expression (enhancer (s), proneur (s), terminator (s), polyadenylation sequence ...) of a sequence of interest. The fragment and the restriction sites are designed to insure insertion of said fragment into a vector in a reading frame suitable for transcription and / or translation. In particular, said promoter of the expression cassette is not an endogenous promoter of said microalgae of the Chlorella genus transformed by the expression vector according to the invention. As examples of promoters that can be used in the expression vector according to the invention, mention may be made of the CaMV35S promoter, the ubiquitin promoter, the RBCS2 promoter, the nopaline synthase promoter and the chlorella virus promoters. , in particular the CaMV35S promoter and very particularly the CaMV35S promoter of sequence SEQ ID NO: 1. The term "heterologous expression cassette" in the sense of the present invention, an expression cassette comprising a nucleic acid sequence of interest coding a substance of interest, in particular of therapeutic interest. The substance of interest may be an RNA or a polypeptide of interest depending on the intended application. One of the applications of the present invention is to obtain microalgae of the Chlorella genus expressing enzymes by the process for obtaining a stable transformant according to the invention, said microalgae of the Chlorella genus being able to be used in biopulping operations, biobleaching or bioremediation. The enzymes used may be of heterologous origin, e.g. fungal or bacterial, or endogenous, leading in this case to their over-expression in the microalgae of the genus transformed Chlorella. These enzymes include oxidoreductases such as laccases (EC 1.10.3.2) or peroxidases (EC 1.11.1.7) with a broad spectrum of action against aromatic compounds and allowing their degradation in compounds of lower toxicity. In the present application, the microalgae of the genus Chlorella can be transformed by an expression vector according to the invention in which the heterologous expression cassette comprises a gene (nucleic acid sequence of interest) encoding an enzyme or at least 2 genes encoding substances of interest having a synergistic action, for example a laccase and a lignin peroxidase (LiP) or a laccase and a manganese peroxidase (MnP). The microalgae of the genus Chlorella thus obtained can be used advantageously in several industrial applications. A first application is the depollution of industrial effluents containing toxic aromatic compounds such as certain dyes used in the production of paper, textile and plastic, or polycyclic aromatic hydrocarbons (PAHs). The depollution of wastewater, in particular the degradation of the estogenous hormones such as estrone (E1), 17b-estradiol (E2), estriol (E3) and the synthetic hormone 17aethinyl estradiol (EE2) can also be carried out by microalgae of the genus Chlorella expressing laccase and / or peroxidase. A second application of said microalgae of the genus Chlorella is the depolymerization of lignin fibers to facilitate bleaching by chemical agents ("enhance bleaching by chlorine-like") and to reduce the energy required to obtain pulp (" paper nnill "). These methods are known by the respective names of biobleaching and biopulping.

Another of the applications of the present invention is the production of microalgae of the Chlorella genus expressing as substances of interest, metal chelating proteins by the process for obtaining a stable transformant according to the invention, said microalgae of the genus Chlorella may be used in industrial effluent clearance operations. The chelating proteins may be of heterologous origin, e.g. fungal, bacterial, yeast, or endogenous, leading in this case to their overexpression in the microalgae of the genus Chlorella transformed. These proteins include cysteine-rich proteins such as metallothioneins and phytochelatines. The microalgae of the genus Chlorella thus obtained can be used advantageously in the depollution of industrial effluents containing heavy metals such as cadmium, copper, lead, mercury, arsenic, zinc, or nickel. Another of the applications of the present invention is the production of microalgae of the Chlorella genus expressing enzymes by the process for obtaining a stable transformant according to the invention, said microalgae of the Chlorella genus being able to be used in green chemistry applications. as the production of elemental chemical bricks used in the composition of polymers. The enzymes used may be of heterologous origin, e.g. fungal or bacterial, or endogenous, leading in this case to their over-expression in the microalgae of the genus transformed Chlorella. In the present application, the microalgae of the genus Chlorella can be transformed by an expression vector according to the invention in which the heterologous expression cassette comprises a gene (nucleic acid sequence of interest) coding an enzyme using as substrate an endogenous metabolite or at least 2 genes encoding substances of interest having a sequential action on this metabolite. The microalgae of the genus Chlorella thus obtained can be used advantageously in several industrial applications. A first application is the biotechnological production of biodegradable polyesters of the polyhydroxyalkanoate (PHA) type. Poly (3-hydroxybutyrate) (PHB) is a first example of PHA that can be obtained by means of microalgae of the genus Chlorella of the present invention expressing the heterologous enzymes acetyl-CoA acetyltransferase [EC 2.3.1.9], NADPH-dependent acetoacetyl -CoA reductase [EC 1.1.1.36] and Polyhydroxyalkanoate synthase [EC 2.3.1.-]. Poly (4-hydroxybutyrate) is a second example of PHA that can be obtained by microalgae of the genus Chlorella of the present invention expressing the heterologous enzymes succinate semialdehyde dehydrogenase [EC 1.2.1.76], 4-hydroxybutyrate dehydrogenase [EC 1.1. 1.61], 4-hydroxybutyryl-CoA transferase [EC 2.8.3.a] and Polyhydroxyalkanoate synthase [EC 2.3.1.-]. A second application concerning the production of elementary bricks used in the polymer composition is the synthesis of 2-hydroxyisobutyrate (2-HIBA). 2-HIBA can be advantageously obtained in the microalgae culture medium of the genus Chlorella of the present invention expressing the heterologous enzymes acetyl-CoA C-acetyltransferase [EC 2.3.1.9], NADPH-dependent acetoacetylCoA reductase [EC 1.1.1.36] and 2-hydroxyisobutyryl-CoA mutase [EC 5.4.99.-]. A third application concerning the production of elementary bricks used in the composition of polymers is the synthesis of Isoprene. Isoprene can be advantageously obtained by means of microalgae of the Chlorella genus of the present invention expressing the heterologous enzyme Isoprene synthase [EC 4.2.3.27]. Isoprene production can be enhanced by overexpression of endogenous enzymes of methyl-erythritol phosphate (MEP) metabolism, eg the enzyme 1-deoxy-D-xylulose-5-phosphate synthase [EC 2.2.1.7] and the 1-deoxy-D-xylulose-5-phosphate reductoisomerase enzyme [EC 1.1.1.267]. A fourth application concerning the production of elemental bricks used in the polymer composition is the synthesis of 1,3-propanediol (PDO). PDO can be advantageously obtained by means of microalgae of the genus Chlorella of the present invention expressing the heterologous enzymes glycerol dehydratase [EC 4.2.1.30] and 1,3-propanediol dehydrogenase [EC 1.1.1.202]. Another of the applications of the present invention is the production of microalgae of the Chlorella genus enriched in lipids by the process for obtaining a stable transformant according to the invention, said microalgae of the Chlorella genus being able to be used in the production of biodiesel. In the present application, the microalgae of the genus Chlorella can be transformed by an expression vector according to the invention in which the heterologous expression cassette comprises one or more genes (sequence (s) of nucleic acids of interest) encoding enzymes involved in the lipid pathway and more particularly in the synthesis of triglycerides. The enzymes of endogenous or exogenous origin for carrying out the application may be selected from the following list: pyruvate dehydrogenase [EC 1.2.4.1], acetyl-CoA carboxylase [EC 6.4.1.2], malonyl-CoA ACP transacylase [EC 2.3.1.39], Fatty acid synthases [EC 2.3.1.-], glycerol-3-phosphate dehydrogenase [EC 1.1.1.8], glycerol-3-phosphate acyl transferase [EC 2.3.1.15], phosphatidic acid phosphatase [EC 3.1 .3.4], diacylglycerol 0-acyltransferase [EC 2.3.1.20], phospholipid: diacylglycerol acyltransferase [EC 2.3.1.158].

Another of the applications of the present invention is the production of microalgae of the genus Chlorella whose production of dihydrogen is optimized by the process for obtaining a stable transformant according to the invention, said microalgae of the genus Chlorella being able to be used in the biohydrogen production as a source of energy. The production of dihydrogen by microalgae of the genus Chlorella can be increased by overexpression as substances of interest for enzymes of exogenous or endogenous origin such as ferredoxin hydrogenase [EC 1.12.7.2] and pyruvate: ferredoxin oxidoreductase [EC 1.2 .7.1]. Another of the applications of the present invention is the modification of microalgae of the genus Chlorella having an increased capacity for assimilation of carbon dioxide by the process for obtaining a stable transformant according to the invention, said microalgae of the genus Chlorella being able to be used in the capture of industrial carbon dioxide. Carbon monoxide uptake by microalgae of the genus Chlorella can be enhanced by overexpression as a substance of interest for carbonic anhydrase enzyme [EC 4.2.1.1] alone or accompanied by overexpression of a bicarbonate transporter. Another of the applications of the present invention is the production of lipid-enriched Chlorella microalgae having beneficial properties for human or animal health by the process for obtaining a stable transformant according to the invention, said microalgae of the genus Chlorella can be obtained by the expression as substances of interest of endogenous or exogenous enzymes involved in the synthesis of these lipids. A first example of lipid of biological interest is eicosapentaenoic acid (EPA), the accumulation of which can be promoted in microalgae of the Chlorella genus of the present invention by the expression alone or in combination of lipid metabolism enzymes as delta 6 desaturase [EC 1.14.19.3], fatty acid elongase 6 [EC 6.2.1.3] and delta 5 desaturase [EC 1.14.19.-]. A second example of lipid of biological interest is docosahexaenoic acid (DHA) from eicosapentaenoic acid. Accumulation of DHA may be promoted in microalgae of the genus Chlorella of the present invention by the expression alone or in combination as substances of interest for lipid metabolism enzymes as fatty acid elongase [EC 2.3.1.199] and delta 4 desaturase [EC 1.14.-.-]. Another of the applications of the present invention is the production of microalgae of the Chlorella genus producing sulphated exopolysaccharides having cosmetic applications by the process for obtaining a stable transformant according to the invention, said microalgae of the Chlorella genus being obtainable by the expression as substances of interest for endogenous or exogenous enzymes involved in the sulfation of polysaccharides such as sulfotransferases (EC 2.8.2.-) Another application of the present invention is the production of microalgae of the genus Chlorella expressing as substances of interest for recombinant allergens by the process for obtaining a stable transformant according to the invention, said allergens being able to be used after purification for the diagnosis or desensitization of allergy, examples of allergens that can be expressed in a native way or modified in microalgae of the genus Chlorella are go mite genes such as Der p 1 and Der p 2, animal allergens such as Fel d 1 of the cat or Can f 1 of the dog, hymenopteran venom allergens such as Api m 1 and Ves v 1, allergens from plant pollens such as Bet v 2 of birch or Dac g 1 of grass Dactyl, food allergens such as Ara h 1 of peanut. The recombinant allergens produced by the microalgae of the genus Chlorella genetically transformed by the process according to the invention can be accumulated in the cell or secreted in the culture medium when they present a signal peptide at their amino-terminal end. The recombinant allergens thus produced can be used as diagnostic tools making it possible to demonstrate the presence of antibodies directed against said allergens. These allergens can also be used for the desensitization of allergy by treatments performed by injectable subcutaneous or sublingual route. Another of the applications of the present invention is the production of microalgae of the Chlorella genus expressing as substances of interest for recombinant proteins by the process for obtaining a stable transformant according to the invention, said proteins being able to be used therapeutically or prophylactic in humans or animals. Thus, the polypeptide of interest may be an antibody, a viral envelope protein, a lysosomal enzyme, etc. Examples of recombinant proteins for therapeutic use are insulin for the treatment of diabetes, growth hormone. for the treatment of small children or antibodies or antibody fragments such as certolizumab used in the treatment of rheumatoid arthritis or ranibizumab used in the treatment of age-related oracular degeneration. Examples of recombinant proteins for prophylactic use are the HBsAg antigen used in the hepatitis B vaccine or capsid proteins of the papillomavirus used in the cervical cancer vaccine. The term "nucleic acid sequence stabilizer" in the sense of the present invention, any sequence for obtaining a stable transformant of a microalgae of the genus Chlorella. The stabilizing nucleic acid sequences can in particular be identified by the method for identifying stabilizing nucleic acid sequences according to the invention comprising the following steps: (i) obtaining a transformant by transformation of the nuclear genome of a microalgae of the genus Chlorella by an expression vector comprising: an expression cassette, in particular a heterologous one; and an endogenous nucleic acid sequence of the nuclear genome of said microalgae of the genus Chlorella; said endogenous nucleic acid sequence being from 10 pb to 300 kbp in length; and (ii) determining the stability of said transformant (for example by detecting the presence of said expression vector and / or said expression cassette according to the invention in the transformant after successive subcultures, in particular after at least 4, in particular at least 10, more particularly after at least 15 successive subcultures and especially after at least 17 successive subcultures); and in particular (iii) selecting said endogenous nucleic acid sequence to obtain a stable transformant. The term "endogenous sequence of the nuclear genome of a microalgae of the genus Chlorella" within the meaning of the present invention, a native sequence of the nuclear genome of a microalga of the genus Chlorella as opposed to the exogenous sequences of the nuclear genome of a microalgae of the like Chlorella. Said endogenous nucleic acid sequence of the nuclear genome of a microalgae of the genus Chlorella may be from 10 bp (base pairs) to 300 kbp (kilobase pairs) in length, in particular ranging from 10 bp to 150 kbp, more particularly ranging from 10 bp 100 kbp, more particularly ranging from 10 bp to 50 kbp, more particularly ranging from 10 bp to 20 kbp, more particularly ranging from 20 bp to 10 kbp, more particularly from 50 bp to 2 bpb. kpb and even more particularly ranging from 100 bp to 1 kbp, more particularly from 300 bp to 800 bp and even more particularly from 400 bp to 750 bp. Said endogenous stabilizing sequence may be a coding sequence. For the purpose of the present invention, the term "coding sequence" is intended to mean any sequence which is transcribed into RNA and translated into protein. In particular, said endogenous stabilizing sequence may be a gene or a gene fragment.

In particular, the said endogenous stabilizing sequence is a sequence coding for bosornal RNA. In particular, said endogenous stabilizing sequence is a sequence coding for ribosomal RNA selected from the group consisting of: the sequence of the gene encoding 18S rRNA; the sequence of the gene encoding the 28S rRNA; the sequence of the gene encoding 5.8S rRNA; and their fragments having a length of at least 10 bp, in particular of a length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp and even more especially ranging from 400 bp to 750 bp; particularly the sequence of the 18S rRNA encoding gene and its fragments having a length of at least 10 bp, in particular of a length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp and even more particularly from 400 bp to 750 bp.

In particular, said endogenous stabilizing sequence is the only endogenous sequence of said microalgae of the Chlorella genus included in said expression vector. Said expression vector may comprise one or more stabilizing nucleic acid sequences.

Said expression vector may comprise at least two, especially only two, stabilizing nucleic acid sequences selected from the group consisting of: an endogenous nucleic acid sequence endogenous to the nuclear genome of said microalgae of the genus Chlorella, said sequence of endogenous stabilizing nucleic acid being from 10 bp to 300 kbp in length; and - a stabilizing nucleic acid sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence throughout the length of said sequence; in particular, the two stabilizing nucleic acid sequences being endogenous sequences of the nuclear genome of said microalgae of the Chlorella genus and more particularly being the only endogenous sequences of said microalga of the Chlorella genus included in said expression vector. When said expression vector comprises at least two stabilizing nucleic acid sequences, said sequences may be identical or different, in particular different. When said expression vector comprises at least two endogenous stabilizing nucleic acid sequences, said sequences may be of the same chromosome, in particular of the same locus and very particularly of the same gene, and even more particularly may be successive fragments of the sequence of the same gene.

In particular, when said expression vector comprises at least two endogenous stabilizing nucleic acid sequences, said sequences may be ribosomal RNA coding sequences chosen from the group consisting of: the sequence of the gene coding for the 18S rRNA ; the sequence of the gene encoding the 28S rRNA; and the sequence of the gene encoding 5.8S rRNA; their fragments having a length of at least 10 bp, in particular of a length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp, and even more especially ranging from 400 bp to 750 bp; particularly the sequence of the 18S rRNA encoding gene and its fragments having a length of at least 10 bp, in particular of a length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp and even more particularly from 400 bp to 750 bp. In particular, said endogenous stabilizing sequences are fragments of the sequence of the 18S rRNA gene, in particular said fragments being of length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from from 50 bp to 1000 bp and even more particularly from 400 bp to 750 bp; in particular, said fragments being different and even more particularly the fragments corresponding to two successive fragments of the 18S rRNA gene sequence, preferably said fragments being the only two endogenous sequences of said Chlorella microalga included in said vector. expression. In particular, said endogenous stabilizing sequences are fragments of the sequence of the gene coding for 28S rRNA, in particular said fragments being of length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from from 50 bp to 1000 bp and even more particularly from 400 bp to 750 bp; in particular, said fragments being different and even more particularly the fragments corresponding to two successive fragments of the sequence of the gene encoding the 28S rRNA, preferentially said fragments being the only two endogenous sequences of said microalgae of the genus Chlorella included in said vector of expression. In particular, when said microalgae of the Chlorella genus is Chlorella protothecoids, said endogenous stabilizing sequence may be the sequence of the gene coding for the 18S rRNA, in particular of sequence SEQ ID NO: 12 or a fragment of the sequence of the gene coding for rRNA. 18S, in particular of sequence SEQ ID NO: 12, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 13, the fragment of sequence SEQ ID NO: 14. In particular, when said microalgae of Chlorella genus is Chlorella protothecoids, said endogenous stabilizing sequence may be the sequence of the gene coding for 28S rRNA, in particular of sequence SEQ ID NO: 42 or a fragment of the gene sequence coding for 28S rRNA, in particular of SEQ sequence ID NO: 42, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 43, the fragment of sequence SEQ ID NO: 44. In particular, when said microal Of the genus Chlorella is Chlorella protothecoids, said endogenous stabilizing sequence may be the gene sequence encoding 5.8S rRNA, in particular of SEQ ID NO: 45 or a fragment of the gene sequence encoding 5.8S rRNA. , in particular of sequence SEQ ID NO: 45. In particular, when said microalga of the Chlorella genus is Chlorella protothecoids, said endogenous stabilizing sequence may be chosen from the group consisting of: the sequence SEQ ID NO: 13, the sequence SEQ ID NO: 14, the sequence SEQ ID NO: 43, the sequence SEQ ID NO: 44, the sequence SEQ ID NO: 45, in particular in the group consisting of the sequence SEQ ID NO: 13 and the sequence SEQ ID NO: 14 In particular, when said microalgae of the genus Chlorella is Chlorella protothecoids, the expression vector may comprise at least two endogenous stabilizing sequences, said endogenous stabilizing sequences being chosen from the consis group. both in: the sequence SEQ ID NO: 13, the sequence SEQ ID NO: 14, the sequence SEQ ID NO: 43, the sequence SEQ ID NO: 44, the sequence SEQ ID NO: 45, more particularly, said endogenous stabilizing sequences being the only endogenous sequences of said microalga Chlorella protothecoids included in said expression vector.

In particular, when said microalgae of the genus Chlorella is Chlorella sorokiniana, said endogenous stabilizing sequence may be the sequence of the gene coding for the 18S rRNA, in particular of sequence SEQ ID NO: 15 or of sequence SEQ ID NO: 18 or a fragment of the sequence of the gene coding for 18S rRNA, in particular of sequence SEQ ID NO: 15 or of sequence SEQ ID NO: 18, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 16, the fragment of sequence SEQ ID NO: 17, the fragment of sequence SEQ ID NO: 19, the fragment of sequence SEQ ID NO: 20. In particular, when said microalgae of the genus Chlorella is Chlorella sorokiniana, the expression vector may comprise at least minus two endogenous stabilizing sequences, said endogenous stabilizing sequences being chosen from the group consisting of: the sequence SEQ ID NO: 16, the sequence SEQ ID NO: 17, the sequence SEQ ID NO: 19, the sequence SEQ ID NO: 20, in particular, said endogenous stabilizing sequences being the only endogenous sequences of said microalga Chlorella sorokiniana included in said expression vector.

In particular, when said microalgae of the genus Chlorella is Chlorella minutissima, said endogenous stabilizing sequence may be the sequence of the gene coding for 18S rRNA, in particular of sequence SEQ ID NO: 21 or a fragment of the sequence of the gene coding for rRNA. 18S, in particular of sequence SEQ ID NO: 21, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 22, the fragment of sequence SEQ ID NO: 23. In particular, when said microalgae of Chlorella genus is Chlorella minutissima, the expression vector may comprise at least two endogenous stabilizing sequences, said endogenous stabilizing sequences being selected from the group consisting of: the sequence SEQ ID NO: 22, the sequence SEQ ID NO: 23, especially said endogenous stabilizing sequences being the only endogenous sequences of said microalga Chlorella minutissima included in said vector of expr ession.

In particular, when said microalgae of the genus Chlorella is Chlorella zofingiensis, said endogenous stabilizing sequence may be the sequence of the gene coding for the 18S rRNA, in particular of sequence SEQ ID NO: 24 or a fragment of the sequence of the gene coding for rRNA. 18S, in particular of sequence SEQ ID NO: 24, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 25, the fragment of sequence SEQ ID NO: 26. In particular, when said microalgae of Chlorella genus is Chlorella zofingiensis, the expression vector may comprise at least two endogenous stabilizing sequences, said endogenous stabilizing sequences being selected from the group consisting of: sequence SEQ ID NO: 25, sequence SEQ ID NO: 26, especially , said endogenous stabilizing sequences being the only endogenous sequences of the said microalgae Chlorella zofingiensis included in the said vector of e xpression. In particular, when said microalgae of the Chlorella genus is Chlorella autotrophica, said endogenous stabilizing sequence may be the sequence of the gene coding for the 18S rRNA, in particular of sequence SEQ ID NO: 27 or a fragment of the sequence of the gene coding for rRNA. 18S, in particular of sequence SEQ ID NO: 27, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 28, the fragment of sequence SEQ ID NO: 29. In particular, when said microalgae of Chlorella genus is Chlorella autotrophica, the expression vector may comprise at least two endogenous stabilizing sequences, said endogenous stabilizing sequences being selected from the group consisting of: the sequence SEQ ID NO: 28, the sequence SEQ ID NO: 29, especially , said endogenous stabilizing sequences being the only endogenous sequences of the said microalgae Chlorella autotrophica included in the said vector of e xpression. In particular, when said microalgae of the Chlorella genus is Chlorella vulgaris, said endogenous stabilizing sequence may be the sequence of the gene coding for the 18S rRNA, in particular of sequence SEQ ID NO: 30 or a fragment of the sequence of the gene coding for rRNA. 18S, in particular of sequence SEQ ID NO: 30, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 31, the fragment of sequence SEQ ID NO: 32. In particular, when said microalgae of Chlorella genus is Chlorella vulgaris, the expression vector may comprise at least two endogenous stabilizing sequences, said endogenous stabilizing sequences being selected from the group consisting of: the sequence SEQ ID NO: 31, the sequence SEQ ID NO: 32, especially said endogenous stabilizing sequences being the only endogenous sequences of said microalga Chlorella vulgaris included in said expression vector.

In particular, when said microalgae of the genus Chlorella is Chlorella protothecoids, said endogenous stabilizing sequence may be the sequence of the gene encoding the protein dee8 (degreening protein), in particular of sequence SEQ ID NO: 33 or a fragment of the gene sequence coding the dee8 protein, in particular of sequence SEQ ID NO: 33, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 34, the fragment of sequence SEQ ID NO: 35. said microalgae of the genus Chlorella is Chlorella protothecoids, said endogenous stabilizing sequence may be the sequence of the gene coding for glutamine synthetase, in particular of sequence SEQ ID NO: 36 or a fragment of the sequence of the gene coding for glutamine synthetase, in particular of sequence SEQ ID NO: 36, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 37, the fragment of sequence SEQ ID NO: 38. In particular, when said microalgae of the genus Chlorella is Chlorella protothecoids, said endogenous stabilizing sequence may be the sequence of the gene coding for an ammonium transporter, in particular of sequence SEQ ID NO: 39 or a fragment of the gene sequence coding for an ammonium transporter, in particular of sequence SEQ ID NO: 39, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 40, the fragment of sequence SEQ ID NO In the expression vector, said stabilizing sequence may be located upstream or downstream of the expression cassette, in particular upstream or downstream of said nucleic acid sequence of interest. In particular, when said expression vector comprises at least two stabilizing nucleic acid sequences, said sequences can be located on either side of the expression cassette, in particular on either side of said sequence of expression. nucleic acids of interest. The percentages of identity to which reference is made in the context of the disclosure of the present invention are determined on the basis of an overall alignment of the sequences to be compared, that is to say on an alignment of the sequences taken in their completeness over their entire length using for example the algorithm of Needleman and Wunsch (1970). This sequence comparison can be performed for example using the needle software using the parameter - Gap open "equal to 10.0, the parameter - Gap Extend" equal to 0.5 and a matrix - Blosum 62 ". For example, needle is available on the ebi.ac.uk world wide website under the name - Align ". Said process for obtaining a stable transformant according to the invention may further comprise the following steps: (iii) isolating said stable transformant; and (iv) culturing said stable transformant. The step (iii) of isolating said stable transformant can be carried out according to any technique well known to a person skilled in the art, such as by clonal selection on agar.

The step (iv) of culturing said transformant can be carried out according to any technique well known to those skilled in the art and adapted to said microalga, autotrophy, heterotrophy or in mixotrophy. Some of these culture techniques are illustrated in the examples of this application.

According to a particular embodiment of the method for obtaining a stable transformant according to the invention, said expression vector is the vector deposited on December 20, 2012 at the CCAP ("Culture Collection of Algae and Protozoa"; algae and protozoa culture ") under registration number CCAP 211/122. This vector corresponds to the plasmid named pAlg-CHAst-aphVIII in the examples. This vector is in particular composed of an expression cassette comprising the aphVIII sequence coding for a selection agent placed under the control of the promoter sequence CaMV35S (SEQ ID NO: 1) and the terminator nos (SEQ ID NO: 4), as well as the nucleic acid sequences stabilizing SEQ ID N: 13 and SEQ ID N: 14 of the nuclear genome of the microalgae of the genus Chlorella protothecoids. It also has a bacterial origin of replication as well as the kanamycin resistance gene for the selection of recombinant bacterial clones. The present application also relates to a method for producing a substance of interest comprising the implementation of the method for obtaining a stable transformant according to the invention, wherein said expression cassette is a heterologous expression cassette. comprising a DNA sequence encoding said substance of interest. The particular embodiments are as described above. In particular, said process for producing a substance of interest according to the invention comprises culturing said stable transformant under conditions allowing the expression of the substance of interest. Said method may further comprise a step of recovering said substance of interest, for example by purification. The present application also relates to an expression vector deposited on December 20, 2012 at the CCAP under the registration number CCAP 211/122. The present application also relates to an expression vector comprising: an expression cassette, in particular a heterologous cassette; and an endogenous nucleic acid sequence of the nuclear genome of a microalgae of the genus Chlorella and / or a nucleic acid stabilizer sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length said sequence; said endogenous stabilizing nucleic acid sequence being of a length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp and even more particularly ranging from 400 bp to 750 pb; said endogenous stabilizing nucleic acid sequence being a sequence encoding ribosomal RNA, in particular the sequence of the gene encoding 18S rRNA or a fragment thereof. The particular embodiments are as described above.

In particular, said expression vector according to the invention may comprise: an expression cassette, in particular a heterologous cassette; and an endogenous nucleic acid sequence of the nuclear genome of a microalgae of the genus Chlorella and / or a nucleic acid stabilizer sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length said sequence; said endogenous stabilizing nucleic acid sequence being SEQ ID NO: 13; and an endogenous nucleic acid sequence of the nuclear genome of a microalgae of the genus Chlorella and / or a nucleic acid stabilizer sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length said sequence; said endogenous stabilizing nucleic acid sequence being SEQ ID NO: 14. The particular embodiments are as described above. Said expression vectors according to the invention can be used in the processes according to the invention as described above. The present application also relates to a microalgae, in particular of the genus Chlorella, comprising at least one expression vector according to the invention, in particular the vector deposited on December 20, 2012 at the CCAP under the registration number CCAP 211/122. In particular, the present application concerns the microalgae Chlorella protothecoids deposited on December 20, 2012 at the CCAP under the registration number CCAP 211/122.

Other advantages and features of the invention will become apparent from the following examples. These examples are given for illustrative and not limiting. Figure 1 represents transformation vectors of microalgae of the genus Chlorella. The selection gene is placed under the control of the CaMV35S promoter and the terminator of nopaline synthase. Sequences 1 and 2 of the nuclear genome of a microalgae of the genus Chlorella were cloned into the pAlg-CHAst vector. Figure 2 represents the detection of nucleic acid sequences of interest (transgenes) nptII (Figure 2A), aphVII (Figure 2B) and aphVIII (Figure 2C) in microalgae Chlorella sorokiniana and Chlorella protothecoids transformed. PCR amplifications were performed on liquid cultures of microalgae transformed with each of the nucleic acid sequences of interest (transgenes) using primer pairs AG013 / AG084, AN362 / 363 and AN322 / AN323. M: size marker; T-: water control; T +: vector control; wt: wild type line. Figure 3 depicts the detection of the nucleic acid sequence of interest (transgene) aphVIII in the transformed Chlorella protothecoid microalgae. The PCR amplifications were performed on liquid Chlorella cultures transformed after 3, 7, 9 and 14 successive subcultures under standard culture conditions, in heterotrophy, and with and without selection pressure. M: size marker; T-: water control; T +: vector control; wt: wild type line; R3, R7, R9, R14: number of successive subcultures; (+/-): with and without selection pressure.

FIG. 4 represents the results of PCR amplifications of the nucleic acid sequence of interest (transgene) aphVIII carried out on 3 transformed clones of the microalga Chlorella protothecoids. The transformed clones were cryopreserved over a period of 2 months. The PCR amplifications were carried out on cultures having undergone 4 successive subcultures carried out in standard medium supplemented with selection agent after the cryopreservation exit. M: size marker; T-: water control; T +: vector control; wt: wild type line. Figure 5 shows a schematic of the pAlg-CHAst-aphVII vector in linear form for the stable genetic transformation of the microalga Chlorella protothecoids. The bars symbolize the PCR amplifications performed on the transformed microalgae in order to show the integration of the entire vector and integrate into the genome of the microalgae. FIG. 6 represents the results of PCR amplifications carried out on 3 transformed microalgae clones belonging to the genus Chlorella protothecoids (after 14 successive subcultures in standard medium supplemented with selection agent). M: size marker; T-: water control; T-: buffer control; T +: vector control; wt: wild type line; Amplification 1: primers AN322 / AN323; Amplification 2; primers 367/368; amplification 3: primers 369/370; Amplification 4a: primers 433/434; Amplification 4b: primers 371/372. Figure 7 shows the profiles of total glycosylated proteins in microalgae of the genus Chlorella. Protein extracts of microalgae were separated on SDS-PAGE gel and transferred to nitrocellulose membrane. Glycoproteins were detected by affinodetection using concanavalin A lectin coupled with peroxidase. M: size marker; Cp: Chlorella protothecoids; Cv: Chlorella vulgaris; Cs: Chlorella sorokiniana; T +: sample of glycoproteins.

EXAMPLES I. Materials and Methods 1.1 Method of cultivating microalgae of the Chlorella genus in autotrophy Chlorella microalgae strains were obtained from the UTEX, CCMP, SAG and CCAP libraries. The microalgae Chlorella sorokiniana (UTEX1663, UTEX1230), protothecoids (CCAP211 / 7A; CCAP211 / 8D), autotrophica (CCMP243), vulgaris (CCAP211 / 11B; SAG280), zofingiensis (CCAP211 / 14; UTEX32), Chlorella minutissima (UTEX2219) were have been made axenic and clonal. Microalgae of the Chlorella genus were cultured at 22 ° C. under continuous illumination (280-350 pmol photonsan-2.s-1), in a culture medium composed of sterilized tap water at 0.22 pm and enriched. with the Conway 1X nutrient medium (supplemented with 0.5 g / L tryptone or KNO3 at 1.5 g / L depending on the species) and in the BG11 commercial medium (C3061, Sigma). For volumes greater than 50m1, specifically from 1 to 300 liters, the cultures were aerated with a 2% air / CO2 mixture.

The microalgae were also cultured on agar media consisting of sterile filtered tap water at 0.22 [Inn and enriched with Conway 1X nutrient medium, and in commercial medium BG11 (C3061, Sigma), supplemented with 1% d agarose. The culture concentration was calculated on Mallassez counting cells (using the Algenics Algae Finder software) after fixing the microalgae with a Lugol solution. 1.2 Method of cultivation of microalgae of the Chlorella genus in heterotrophy Chlorella microalgae capable of growing on medium supplemented with carbon source and in the absence of light were placed in the standard culture medium enriched with 10 g / l of glucose. The cultures were placed at 22 ° C and in the dark. The culture on agar medium was carried out in Petri dishes by adding 1% agarose. 1.3 Cryopreservation of microalgae of the Chlorella genus Microalgae were cultured in the standard culture medium until the stationary phase of growth. They were pelleted by centrifugation at 2000 g for 5 min and taken up in the culture medium at the rate of 100 million cells per milliliter with the addition of cryoprotectants at the rate of: 5% MeO0-1, 5% DMSO, 9% DMSO, 10 % DMSO, according to the strains. The cryopreserved microalgae were stored at -80 ° C. 1.4 Preparation of the vectors for the genetic transformation of Chlorella The pAlg-CHA vector (FIG. 1) for the genetic transformation of microalgae of the Chlorella genus is composed of an expression cassette comprising the sequence coding for a selection agent placed under the control of the CaMV35S promoter sequence of cauliflower mosaic virus, and the nos terminator of the nopaline synthase gene. It was carried out by cloning the promoter sequence CaMV35S (SEQ ID NO: 1) in the vector pCR2.1 (Invitrogen). The terminator sequence nos (SEQ ID NO: 4) was cloned downstream of the promoter sequence. The genes nptII (SEQ ID NO: 6), aphVIII (SEQ ID NO: 5) and aphVII (SEQ ID NO: 7), coding respectively the antibiotic resistance conferring enzymes G418, paromomycin and hygromycin, were inserted into the cassette. expression. The scheme of the transformation vectors is shown in Figure 1. The pAlg-CHA vector also has a bacterial origin of replication as well as the ampicillin resistance gene for the selection of recombinant bacterial clones. The vector pAlg-CHAst (FIG. 1) allowing the stabilization of the genetic transformation of microalgae of the Chlorella genus is composed of an expression cassette comprising the sequence coding for a selection agent placed under the control of the CaMV35S promoter sequence and the terminator nos, as well as two DNA sequences of the nuclear genome of the microalgae of the genus Chlorella.

The DNA fragments of the nuclear genome 1 and 2 of the microalgae of the genus Chlorella were amplified using specific primers defined following a bioinformatic analysis performed on different microalgae. They were then successively cloned into the transformation vector. The final step was to clone the selection cassette containing the selection genes nptII, aphVII and aphVIII, which respectively encode G418, hygromycin and paromomycin resistance conferring enzymes. The pAlg-CHAst vector also has an origin of bacterial replication as well as the kanamycin resistance gene for the selection of recombinant bacterial clones. 1.5 Microalgae Transformation The microalgae of the genus Chlorella have been transformed by different methods whose main steps are described below. 1.5.1 Transformation of microalgae of the Chlorella genus by particle bombardment The genetic transformation of Chlorella was carried out by particle bombardment using the modified BIORAD PDS-1000 / He (Thomas et al., 2001). Chlorella cultures in exponential growth phase were concentrated by centrifugation (10 minutes, 2150g, 20 ° C), diluted in sterile water, and agar plated at 108 cells per agar. Microcarriers are gold particles (diameter 0.6 μm). They were prepared according to the supplier's protocol (BIORAD). Precipitation of the DNA was carried out by a solution containing 1.25 M CaCl 2 and 20 mM spermidine, with a ratio of 1.25 μg of DNA to 0.75 mg of gold particles per shot. The rupture discs used range from 900 to 1350 psi. The vacuum is achieved at 30 Hg.

The microalgae were incubated for 24 hours before transplanting onto agars supplemented with selection agent. They were then kept at 22 ° C. under constant lighting. After 1 to 2 weeks of culture, the potentially transformed clones that developed were transplanted onto agar plates and then into liquid medium supplemented with selection agent. 1.5.2 Transformation of Microalgae of the Chlorella Genus by the Electroporation Technique The transformation by electroporation consists of subjecting the microalgae to an electric field. It causes the formation of transient pores in the plasma membrane by altering its polarity, allowing the penetration of DNA into the cell to fit into the nuclear genome. Two devices were used. The MicroPulser (Biorad) is an electroporator to obtain a range of intensity of electric fields from 200V to 3000V (0.5 to 30kVolts / cnn). The GenePulser MXcell (Biorad) is a 96-well plate electroporator that can be used to vary many parameters such as pulse type (exponential waves or square waves), voltage, capacitance as well as time and pulse number for waves square.

The cells in the exponential growth phase were pelleted by centrifugation at 2000 g for 5 minutes, washed in 5 ml of electroporation buffer (0.08 M KCl buffer, 0.01 M CaCl 2, 0.2 M Hepes, 0.2 M Mannitol, 0 Sorbitol , 2M) and then resuspended at 108 cells per mL in buffer cooled to 4 ° C. Plasmid DNA and carrier DNA (calf thymus DNA, Sigma) were respectively added at the final concentration of 10 μg / ml and 25 μg / ml. The solution was gently mixed by pipetting and incubated for 5 to 10 minutes on ice. Two hundred microliters of solution containing the cells and the DNA were transferred to each electroporation vessel and subjected to electroporation pulse (0.5 to 30 kVolts / cm) for 1 ms (1 to 3 pulses). The vats were then incubated on ice for 5 to 10 minutes then the cells were resuspended in 3 ml of culture medium without antibiotic and incubated for 24 hours under standard culture conditions. After 24 hours, the cells are centrifuged, washed with 100 μl of culture medium, and plated on selective agar medium or cultured flask (5 ml) in the presence of selection agent. 1.5.3 Transformation of microalgae of the genus Chlorella by the PEG technique Cell permeabilization was performed by stirring in the presence of PEG (PEG 4000 (20% i, 4000M, Sigma) and PEG 6000 (15% i, 6000M, Sigma )) at different final concentrations (3.5%, 10%, 15% and 20%), with or without glass beads (0.45-0.52 mm diameter, Sigma). The size of the beads, the stirring time, the molecular weight of the PEG as well as its concentration were parameters to be optimized for efficient transformation of each microalga. The cells, in the exponential growth phase, were pelleted by centrifugation at 2000 g for 5 minutes. The pellet was washed with culture medium and the cells resuspended in medium at 15 × 10 6 cells per ml. A solution containing 300 mg of autoclaved glass beads, 10 μg of vector DNA (1 μg / μl) and PEG 4000 or PEG 6000 at different concentrations, was added to the cell suspension for a final volume of 1 μl, in a tube of conical centrifugation of 1.5 mL. The solution was mixed briefly by inversion of the tube, stirred at 2400 rpm on a 'Signature Pulsing Vortex Mixer' (VWR) shaker at variable times (from 30 seconds to 2 minutes). After decantation of the glass beads, the supernatant was transferred to 10nnL culture tubes and the cells grown in 4mL culture medium overnight under low light. After 24 hours, the cells were pelleted by centrifugation, taken up in 100 ml of culture medium and completely spread on agaric selection medium. 1.5.4 Protoplast transformation of microalgae of the Chlorella genus by the PEG technique One hundred million cells were previously treated to make protoplasts. These cells are centrifuged at 2000g for 5 min and washed in a medium solution containing 0.6M Sorbitol / Mannitol to remove the digestion solution and wall components. The cells were taken up in 0.2 ml of a 0.6 M Sorbitol / Mannitol solution containing 50 nm CaCl 2 and transferred to a 1.5 nm centrifuge tube. 10 μl of plasmid DNA at lpg / μL and 10 μl of 2.5 μg / μL calf thymus DNA (Sigma) were added. After 15 minutes incubation at room temperature, 400 μl of PNC solution (20% PEG, 0.4 ml NaCl and 25 mM CaCl 2) was added to the cell suspension and the mixture was stirred gently for 30 minutes at room temperature. 300mg of glass beads were added after the PNC solution. The cell suspension was then stirred at 2400 rpm on a Signature Pulsing Vortex Mixer (VWR) for 15 seconds, the supernatant was then transferred to a new 1.5 ml tube, shaken gently for 30 minutes, then 0.6 ml. Recovery medium (culture medium supplemented with 0.6M Mannitol / Sorbitol, 1% glucose, 1% yeast extract and 1% tryptone) was added. The cells were incubated in the dark for 12 h at 22 ° C to regenerate their cell wall. All of the cells were then screened on agar medium or liquid supplemented with the appropriate selection agent. 1.5.5 Transformation of microalgae of the genus Chlorella by Agrobacterium tumefaciens The bacterial strain used is the strain LBA4404 of Agrobacterium tumefaciens (Invitrogen). The vectors used are the plasmid pBi121 (GenBank: AF485783.1) and the plasmid pCambia2300 (GenBank: AF234315.1). Agrobacterium tumefaciens is a bacterium that naturally has the ability to transmit and integrate part of its DNA into the genome of plants. This particular biological feature has been diverted to allow the genetic transformation of plants. Plasmid vectors have been developed by insertion of specific sequences recognized by the biological machinery of the bacterium on either side of the sequence to be integrated into the genome. The bacteria will be able to integrate the DNA of interest into the genome of the host cell. The microalgae transformation protocol comprises the following steps: -Transformation of agrobacteria with the vectors of interest and preparation of recombinant bacterial cultures -Preparation of Chlorella cells in the exponential phase of growth -Coculture of agrobacteria with microalgae on agar medium and in liquid medium -Lavages of Chlorella cells and cultured on selection medium. 1.6 Extraction of Genomic DNA from Chlorella Microalgae The cells were pelleted by centrifugation (2150g, 15 minutes, 4 ° C). The microalgae were incubated overnight at 4 ° C in 4 mL of 1X TE-NaCl buffer (0.1M Tris-HCl, 0.05M EDTA, 0.1M NaCl, pH8). 1% SDS, 1% Sarkosyl and 0.4 mg / ml proteinase K were then added to the sample followed by incubation at 40 ° C for 90 minutes. A first phenol-chloroform-isoamyl alcohol extraction was carried out to extract an aqueous phase comprising the nucleic acids. The RNAs contained in the sample were removed by one hour of incubation at 60 ° C in the presence of RNase (1 μg / ml). A second phenol-chloroform extraction was performed, followed by ethanol precipitation. The resulting pellet was air-dried and solubilized in 200 μl of ultrapure water. Quantitation of the DNA was performed spectrophotometrically (260 nm) and analyzed by agarose gel electrophoresis. 1.7 Polymerase chain reaction (PCR) analyzes The screenings of recombinant bacterial clones as well as the PCR amplifications carried out on purified DNAs were carried out using the following conditions. The PCR reaction was performed in a final volume of 50 μL composed of 1 × PCR buffer, 0.2 μM of each dNTP, 5 μM of each primer, 20 μg of template DNA and 1.25 μl of Taq DNA polymerase (Taq DNA polymerase, Roche ). Thirty PCR cycles were performed for the amplification of the template DNA. The initial denaturation was carried out at 94 ° C for 5 min. Each subsequent cycle consists of a denaturation step at 94 ° C (1 min), a primer hybridization step at 55 ° C (1 min), and an elongation step at 72 ° C (1 min). The samples obtained after the PCR reaction were checked on agarose gel (1%) stained with ethidium bromide.

Colony PCR amplification screenings of the transformed Chlorella microalgae are carried out using the kit - REDExtract-N-Amp ™ Plant PCR Kit (Sigma). 1.8 Southern blot The genomic DNA of microalgae of the wild-type and transformed Chlorella genus are digested overnight at 37 ° C. using the restriction enzyme EcoR1. The samples are then deposited on 0.8% agarose gel and the lambda size HindIII marker (D9780, Sigma). The migration is carried out for 3 to 4 hours at 130 volts and at 4 ° C. in a 1X TAE solution. The digested DNAs are monitored under UV at 254 nm after labeling with ethidium bromide.

The gel is then incubated twice for 5 minutes in a depurination solution (0.25M HCl) with stirring and then rinsed with UP water. The gel is then incubated in a denaturation solution (0.5M NaOH, 1.5M NaCl) for 15 minutes, rinsed with UP water, and finally incubated in the neutralization solution (1M Tris-HCl, 1.5M NaCl pH 7.4), twice 15 minutes.

The nucleic acids are transferred by capillarity for 4 hours onto a nylon membrane (RPN303B, GE Healthcare) using a solution of SSC20X. The DNA is then covalently attached by treating the membrane with UV (254 nm) for 2 minutes.

The membrane is incubated in the prehybridization solution (SSC6X, 0.1% SDS, Denhart's 5X solution, carrier DNA 100pg / nnL) at 65 ° C. for 1 hour, then it is placed overnight in contact with the solution. hybridization mixture containing 10Ong of the previously denatured labeled probe for 10 minutes at 100 ° C. The nucleic probe is labeled with the Psoralen-Biotin BrightStar kit (AM1480, Ambion).

The membrane is then washed for 30 minutes at 65 ° C. in a bath of the SSC6X solution, twice for 30 minutes in the SSC2X solution, 0.1% SDS, and 15 minutes in the SSC0.2X solution, 0.1% SDS. . Rinsing is performed in a 1X TBS solution for 5 minutes and the membrane is saturated in a solution of TBS, 3% BSA for 2 hours. Hybridization is carried out using a solution of 1X TBS, 0.05% Tween 20 containing streptavidin coupled to peroxidase (52438, Sigma) diluted to 1 / 10,000 ° C. After 6 washes of 5 minutes in a solution of 1X TBS, 0.05% Tween 20, and a rinse in 1X TBS, the revelation is performed using an ECL Revealing Kit (RPN2109, GE Healthcare) 1.9 Detection of the activity of the gus gene Chlorella microalgae cells in the exponential growth phase are recovered by centrifugation (10 minutes, 2150 g, 20 ° C.) and then washed with a PBS buffer The enzymatic reaction solution is composed of 93mM Na2HPO4, 68mM NaH2PO4, 10nnM EDTA pH8, 0.1% Triton X100, and 1nnM X-Gluc A volume of 501iL of the reaction solution is added to the cell pellet The cells are taken up and the tubes are incubated overnight at 37 ° C. cells are then observed by light microscopy to visualize the blue color in the 1.10 Detection of the eGFP Fluorescent Protein The study of the cellular localization of the eGFP protein by epi-fluorescence microscopy is carried out on wild-type and transformed Chlorella cells. Fluorescence of the eGFP protein and chlorophyll are visualized using 488nm excitation filters, and emission filters of 500-520 and 625-720nn, respectively. 1.11 Extraction of Total Proteins from Microalgae of the Chlorella Genes Chlorella microalgae cells at the end of the exponential growth phase were recovered by centrifugation (10 minutes, 2150 g, 20 ° C.). The cell pellets were resuspended in cell lysis buffer (0.15 M Tris-HCl pH8, 15% sucrose, 0.5% SDS, 1nnM PMSF, 1% Protease Inhibitor Cocktail (SIGMA)).

Cell lysis was performed by sonication (amplitude 30%, pulse 2 seconds) for 30 minutes at 4 ° C. using the Vibracell 750watt apparatus. The resulting cell lysates were centrifuged (60 minutes, 15000g, 4 ° C) to remove cell debris and the supernatants corresponding to soluble total protein extracts were recovered. 1.12 Detection of the eGFP Fluorescent Protein by Immunoblotting Protein samples from the wild-type and transformed strains of the Chlorella microalgae are separated on a 12% SDS-PAGE gel. The proteins are transferred to nitrocellulose membrane (RPN303D, GE Healthcare) and stained with Rouge Ponceau to control the transfer efficiency. The nitrocellulose membrane is saturated for 2 hours in a solution of TBS containing 5% milk. Immunodetection was performed using horseradish peroxidase-conjugated anti-GFP antibody (Santa Cruz, sc-9996-HRP) diluted 1: 2000 in TBS, 0.05% Tween 20, containing 1 % milk for 2 hours at room temperature. The membrane is then washed with 0.05% TBS-Tween (6 times 5 minutes at room temperature) followed by a final wash with TBS (5 minutes at room temperature). Detection is performed by the chemiluminescence method (RPN2109, GE Healthcare). 1.13 Detection of monoclonal antibodies by immunoblotting The culture supernatants of the wild-type and transformed strains of the microalgae of the genus Chlorella are deposited on a 12% SDS-PAGE gel. The proteins are transferred to nitrocellulose membrane (RPN303D, GE Healthcare) and stained with Rouge Ponceau to control the transfer efficiency. The nitrocellulose membrane is saturated for 2 hours in a solution of TBS containing 5% milk.

The immunodetection is carried out using horseradish peroxidase-conjugated anti-human IgG antibody (Sigma, A6029-HRP) diluted 1: 2000 in TBS, 0.05% Tween 20, containing 1% of milk for 2 hours at room temperature. The membrane is then washed with 0.05% TBS-Tween (6 times 5 minutes at room temperature) followed by a final wash with TBS (5 minutes at room temperature). Detection is performed by the chemiluminescence method (RPN2109, GE Healthcare). 1.14 Detection of Glycoproteins Using the Concanavalin A Lectin Protein samples of Chlorella microalgae were separated on a 12% SDS-PAGE gel. The separated proteins were transferred to nitrocellulose membrane (RPN303D, GE Healthcare) and stained with Ponceau Rouge to control the transfer efficiency. The nitrocellulose membrane was saturated for 5 minutes in 2% TBS Tween20 solution. The affinodetection was carried out using horseradish peroxidase conjugated Concanavalin A lectin (Sigma, L6397) diluted 1: 2000 in TBS, 0.05% Tween 20, 1nnM CaCl 2, 1nnM MgCl 2, 1nnM MnCl 2. for 2 hours at room temperature. The membrane was washed with 0.05% TBS-Tween (6 times 5 minutes at room temperature), followed by a final wash with TBS (5 minutes at room temperature). Detection was performed by the chemiluminescent method (RPN2109, GE Healthcare). 1.15 Listing of specific primers of fragments 1 and 2 of genomic microalgae DNAs Chlorella - Table 1 Microalgae Gene Fragment 1 Fragment 2 Chlorella protothecoids (CCAP211 / 8D) 185 rRNA AN336: AN338: 5'-AAGAATTCAACCTGGTTGATCCTGCC-3 '5'-AACTCGAGTTCATTCAATGACACCACC- AN337: AN339: 5'-5'-TTGGATCCTTGATCCTTCTGCAGGTTC-3 'TTGGATCCCTCGAGACAGCAAAGCCCAGGAGC3' Chlorella sorokinianaARNr (UTEX 1663) 185 AV53: AV55: 5'-AAGAATTCAACTGCTTTATACTGTG-3 '5'-AACTCGAGAACTTACCAGGTCCAGAC-3' AV54: 5'-AV56: TTGGATCCCTCGAGACTGCAGCAACTTAAATA-3 '5'-TTGGATCCTCTCCTTCTCTAGGTGG-3' Chlorella sorokinianaARNr (UTEX 1230) 185 AV57: AV59: 5'-AAGAATTCCCATGCATGTCTAAGTAT-3 '5'-AACTCGAGGGGATCGGCGGATGTTTC-3' AV58: AV60: 5'-5'-TTGGATCCGGTGGGAGGGTTTAATG-3 ' TTGGATCCCTCGAGAACAGCGCCGACTCCGAG3 'Chlorella RNA 185 AV61: AV63: minutissima (UTEX 5'-AAGAATTCGACTCTGGCCTATCTTG-3' 5'-AACTCGAGGGGAAAACTTACCAGGTC-3 '2219) AV62: 5'-AV64: TTGGATCCCTCGAGAATAAAGAAAGCACTTAG-3' 5'-TTGGATCCTCTCTAGGTGGGAGGGTT-3 'Chl orella 185 rRNA AV65: AV67: zofingiensis (CCAP 5'-AAGAATTCGCATGTCTAAGTATAAAC-3 '5'-AACTCGAGAGGCTGAAACTTAAAGG-3' 211/51) AV66: AV68: 5'-TTGGATCCCTCGAGGTGCACACCGAAACGGC-3 '5'-TTGGATCCCTTCCTCTAGGTGGGAGG-3` Chlorella autotrophica (CCMP243 ) 185 AV69 RNA: AV71: 5'-AAGAATTCTATATAAACTGCTTTATAC-3 '5'-AACTCGAGTGCCGACTAGGGATCGGC-3' AV70: 5'-AV72: TTGGATCCCTCGAGTTTACTCAAAGTAACAGC-3 '5'-TTGGATCCGGAGGTTATGAACTTCTC-3' Chlorella vulgarisARN 185 AV73: AV75: (5AG280) 5 -AAGAATTCTTGTATAAACTGCTTTATAC-3 '5'-AACTCGAGGAAATCAAAGTTTTTGGG-3' AV74: AV76: 5'-TTGGATCCCTCGAGAGCCCGTCCCCGGCAAC-3 '5'-TTGGATCCGGGGTTTAATGAACTTC-3' Chlorella protothecoids (CCAP211 / 8D) rRNA 285 AV77: AV79: 5'-AAGAATTCTAACGGCGAGCGAACCG-3 5'-AACTCGAGCTAAGGCGCCCAACTGCG-3 'AV78: 5'-AV80: TTGGATCCCTCGAGTTCACCATCTTTCGGGTC-3' 5'-TTGGATCCATTTTGCCGAC-3 'Chlorella protothecoids (CCAP211 / 8D) degreenfng Protein Dee 8 AV81: AV83: 5'-AAGAATTCAGGTCAGCTCAACTGCC-3' 5 '-AACTCGAGGGGAGGACCACAGGTGTATC3' AV82: AV84: 5'-5'-TT GGATCCTCAGGGTTTGCACTGG -3 'TTGGATCCCTCGAGGCTCACGGTATCAACAAGG- 3'Chlorella protothecoides (GCAP211 / 8D) Glutamine synthetase AV85: AV87: 5'-AAGAATTCAACCGGTTCAAGGACC -3' 5'-AACTCGAGACGGTGCTGGACGCGCG -3 'AV86: AV88: 5'-TTGTCGACCTCGAGAACCGTCGTAGTTCCAG- 3'TTGTCGACTAGAGCAGCCGCGGTTGG 5'- Chlorella Protothecoids (CCAP211 / 8D) Ammonium Carrier AV89: AV91: 5'-AAGAATTCACACGGACATCAATGCC-3 '5'-AACTCGAGACACCACCGTGGCCGCC-3' AV90: 5'-AV92: TTGGATCCCTCGAGTGGGCGACCTGGCTCGG-3 '5'-TTGGATCCGTCACCTCATGCGGGTAG-3' II . Results 11.1 Example 1: Transformation of microalgae of the genus Chlorella 11.1.1 Culture of microalgae The microalgae Chlorella sorokiniana (UTEX1663) and Chlorella protothecoids (CCAP211 / 8D) were cultivated in a medium composed of tap water supplemented with a nutrient solution of Conway 1X and tryptone at 0.5g / L, or KNO3 at 1.5g / L according to the microalgae. Cell count was performed by Malassez cell counting using the Algenics Algae Finder software. 11.1.2 Realization of the pALG-CHA expression vectors The pAlg-CHA vector for the genetic transformation of microalgae of the Chlorella genus is composed of an expression cassette comprising the sequence coding for a selection agent placed under the control of the sequence cauliflower mosaic virus CaMV35S promoter and the nopaline synthase gene terminator (Figure 1). The CaMV35 promoter sequence (SEQ ID NO: 1) and the Tnos sequence (SEQ ID NO: 4) were amplified from a synthetic vector respectively using the AV35 primer pairs (5 '-AAGAATTCCATGGAGTCAAAGATTC -3 ') / AV36 (5'-TTGAATTCGTCCCCCGTGTTCTCTC-3') and AV38 (5'-AAGAGCTCGAATTTCCCCGATCGTTC-3 ') / AV39 (5'-TTTCATGACCGATCTAGTAACATAG-3'). These primers also made it possible to insert the EcoRI site at 5 'and 3' of the promoter, and the SacI and BspHI sites at 5 'and 3' of the terminator. Each of the sequences was then cloned into the vector pCR2.1 (Invitrogen). The coding sequence nptII (SEQ ID NO: 6) of the G418 resistance gene was amplified from the vector pCR2.1 (Invitrogen) using primers AV43 (5'-AAG GATCCATGATTGAACAAGATG G -3 ') and AV44 (5'-TTGAGCTCTCAGAAGAACTCGTCAAG -3 ') for inserting BamHI restriction sites at 5' and Sacl at 3 '. The sequence was then cloned into the Chlorella pAlg-CHA-nptII transformation vector between the CaMV35S regulatory sequences and the terminator. The aphVII coding sequence (SEQ ID NO: 7) was amplified from the pChlamy vector (Invitrogen) using the specific primers AV45 (5'-AAGGATCCATGACACAAGAATCCCTG-3 ') and AV46 (5'-TTGGATCCTTATCAGGCGCCGGGGG-3' ) which made it possible to insert the cleavage site for the BamHI restriction enzyme 5 'and 3' of the sequence. It was then cloned into the Chlorella pAlg-CHA-aphVII transformation vector between the CaMV35S regulatory sequences and the terminator.

The aphVIII coding sequence (SEQ ID NO: 5) was amplified from a synthetic vector using the AV41 (5'-AAGGATCCATGGACGATGCGTTGCG3 ') and AV42 (5'-TTGAGCTCTCAGAAGAACTCGTCCAAC-3) specific primers. which made it possible to insert the cleavage sites for the BamHI 5 'and SacI enzymes at 3' of the sequence. This sequence was then cloned into the Chlorella pAlg-CHA-aphVill transformation vector between the CaMV35S regulatory sequences and the terminator. 11.1.3 Genetic transformation of Chlorella microalgae Chlorella microalgae were transformed by particle bombardment technique and by electroporation, PEG, Agrobacterium tumefaciens, intact cells and protoplasts (Lu et al., 2011). .

The genetic transformation of Chlorella microalgae was carried out by particle bombardment using the modified BIORAD PDS-1000 / He (Thomas et al., 2001). Chlorella cultures in the exponential growth phase were concentrated by centrifugation (10 minutes, 2150 g, 20 ° C.), diluted in sterile water, and spread on agar (at a rate of 108 cells per agar). Precipitation of the DNA was carried out by a solution containing 1.25M CaCl2 and 20nnM spermidine, with a ratio of 1.25pg of DNA per 0.75mg of microcarriers. The transformation was carried out with firing pressures ranging from 900 to 1350psi. The genetic transformation of Chlorella microalgae was also performed by electroporation using two devices, MicroPulser (Biorad) and GenePulser MXcell (Biorad). The microalgae in the exponential growth phase were pelleted by centrifugation at 2000 g for 5 minutes, washed in 5 ml of electroporation buffer (0.08 M KCl buffer, 0.01 M CaCl 2, 0.2 M Hepes, 0.2 M Mannitol, 0 Sorbitol , 2M) and then resuspended at 108 cells per mL in buffer cooled to 4 ° C. They were then placed in cuvettes with gaps of 1 to 4 mm, and in a 96-well plate. The pAlg-CHA-nptll, pAlg-CHA-aphVii, pAlg-CHA-aphVIII and carrier DNA vectors were added to 10pg / nnL and 25pg / mL, respectively. Microalgae in solution were then subjected to electrical pulses of 1nns, up to 18kVolts / cnn. The microalgae Chlorella sorokiniana was transformed using the pAlg-CHAnptll vector, and Chlorella protothecoids using the pAlg-CHA-aphVii and pAlg-CHAaphVIII vectors. Microalgae that underwent particle bombardment transformation and electroporation were incubated for 24 hours under constant illumination and at 22 ° C. The cells were then centrifuged, washed with the culture medium, and plated at 15.106 cells per agar, on agar media containing 50 ng / L of G418, 50 ng / L of paromomycin or 400 mg / L of hygromycin. 11.1.4 Selection of transformed microalgae After 15 to 21 days of culture, the potentially transformed clones of the microalgae Chlorella sorokiniana and protothecoids which developed on the selection agar plates were transplanted a first time on a fresh medium supplemented with a selection agent. (50nng / L G418, 50nng / L paromomycin or 400mg / L hygronnycin). The clones were then subcultured every 15 days on agars supplemented with selection agent. 11.1.5 Detection of transgenes in the Chlorella microalgae The transformants obtained on the selection agar plates were subcultured in culture media with a selection agent and cultured under standard culture conditions. The analyzes were carried out on the Chlorella clones which developed after 1, 2, 3 and 4 successive subcultures. Insertion of the heterologous nptII, aphVII, and aphVIII resistance sequences to the selection agents, G418, hygromycin, and paromomycin in the Chlorella microalgae genome was verified by PCR assays. Figure 2 shows the results of PCR amplification screening of specific sequences of the nptII, aphVII, and aphVIII genes obtained for transformed Chlorella clones. The amplifications performed on the control tubes as well as on the untransformed strains are negative. The PCR amplifications carried out on the pAlg-CHA-nptll, pAlg-CHA-aphVII and pAlg-CHA-aphVIII vectors gave respectively bands at the expected sizes of 311bp, 480bp and 405bp. The presence of the nptII transgene in the transformed Chlorella sorokiniana microalgae was verified using primers AG013 (5'-TAGCCGGATCAAGCGTATGCAG-3 ') and AG084 (5'-ACAGACAATCGGCTGCTCTGATG-3'). The clones obtained have an amplification at the expected size of 311bp (FIG. 2A). This result, confirmed on the clones after 2 to 3 subcultures on fresh media supplemented with selection agent, validated the insertion of the transgene into the genome of Chlorella sorokiniana. The presence of the aphVII and aphVIII transgenes in the transformed Chlorella-protothecoid microalgae was verified using the primer pairs AN362 / AN363 (5'-ATTGATTCGGATGATTCC-3 '/ 5'-ATCCGGCTCATCACCAG-3') and AN322 / AN323 (5'-TTGTGAGTGGGTTGTTGTGG-3 '/ 5'-AAGTCGACGCTCCCTTCAGC-3'). The clones obtained have an amplification at the expected size of 480bp for aphVII and 405bp for aphVIII (FIGS. 2B and 2C). Detection of transgenes in microalgae was carried out after 2 to 3 successive subcultures on fresh media supplemented with selection agents, which validated the insertion of the transgenes into the microalgae genome. The transformants were monitored by detection of the nptll, aphVII and aphVIII transgenes by PCR amplifications carried out on the transformed clones after successive subcultures of the cultures. The detection of transgenes was negative for all the clones transformed after 3 to 4 successive subcultures. The analyzes were repeated on a larger number of clones obtained after transformation of the Chlorella microalgae using the nptll, aphVII and aphVIII genes. The PCR amplifications carried out on cultures derived from transformed clones give negative results, regardless of the transgene, after 3 to 4 successive subcultures. The detection of transgenes has not been possible for the few microalgae that have retained the capacity to grow in the presence of the selection agent. 11.1.6 Conclusion The genetic transformation of the Chlorella sorokinana and Chlorella protothecoid microalgae by the nptll, aphVII and aphVIII resistance genes made it possible to obtain transformed clones in which we could demonstrate the presence of the transgene.

The detection of transgenes in the genome of microalgae has been confirmed on 2 to 3 successive subcultures on selection media. In contrast to some clones that retained the ability to grow on selection agent during subcultures, we noted a loss of growth on the selection media of the majority of transformed Chlorella clones.

The PCR analyzes carried out over successive generations on the transformed clones, have demonstrated the loss of the detection of transgenes in the cultures of all the microalgae, whatever the selection agent used. The genetic transformation of Chlorella was carried out using the following transformation technologies: particle bombardment, electroporation, PEG, Agrobacterium tumefaciens, intact cells and protoplasts. The detection of transformants has been validated for each of the transformation techniques. On the other hand, the detection of the transgenes was lost in all cases after 3 to 4 successive transplants of the transformants on selection medium. The detection of transgenes in microalgae transformed on several successive transplants has demonstrated an integration of the transgene into the genome of Chlorella sorokiniana and Chlorella protothecoids. The work carried out also made it possible to highlight a problem of stability of the transgene integration in microalgae of the genus Chlorella. 11.2 Example 2: Stable transformation of microalgae of the genus Chlorella 11.2.1 Microalgae culture The microalgae Chlorella protothecoids (CCAP211 / 8D) was cultured in a medium composed of tap water supplemented with a nutrient solution of Conway 1X and with tryptone at 0.5g / L. The cultures were placed at 22 ° C under constant light. The culture in heterotrophy was carried out in the standard medium to which 10 g / l of glucose was added. The cultures were placed in the dark and at 22 ° C. Cell count was performed by Malassez cell counting using the Algenics Algae Finder software. 11.2.2 Realization of the expression vector pALG-CHAst-aphVIII The vector pAlg-CHAst-aphVIII of genetic transformation of microalgae of the genus Chlorella is composed of an expression cassette comprising the aphVIII sequence encoding the selection agent paromomycin , placed under the control of CaMV35S promoter sequence of cauliflower mosaic virus and nos terminator of the nopaline synthase gene (Figure 1). Two genomic DNA sequences of Chlorella protothecoids were cloned into the vector. Genomic DNA sequences 1 and 2 correspond to two 750 bp fragments of 18S rRNA. The primers AN58 (5'-ACCTGGTTGATCCTGCCAGT-3 ') and AN59 (5'-GATCCTTCTGCAGGTTCACCTAC-3') making it possible to amplify the 18S rRNA sequence of Chlorella protothecoids were defined after a bioinformatic analysis of the sequences available in the databases. Once sequenced, we were able to define the primers to amplify the two fragments of interest.

Both sequences were amplified on the genomic DNA of the microalgae Chlorella protothecoids using primers AN336 / AN337 (5'-AAGAATTCAACCTG GTTGATCCTG CC -3 '/ 5'-TTG GATCCCTCGAGACAG CAAAG CCCAG GAG C-3') and AN338 / AN339 (5'-AACTCGAGTTCATTCAATGACACCACC -3 '/ 5'-TTGGATCCTTGATCCTTCTGCAGGTTC-3').

Fragment 1 was cloned using the EcoRI and BamHI sites inserted by PCR into the pAlg-CHAst vector. This vector is derived from the pCambia2300 commercial vector in which the p35S-nptII-T35S transformants selection cassette was removed by digestion with the enzyme Asel. The XhoI site was also inserted 3 'of the sequence, upstream of the BamHI site, in order to carry out the cloning sequence. The genomic DNA fragment 2 was also cloned into the pAlg-CHAst vector using the XhoI and BamHI sites inserted during the PCR. The CaMV35S-aphVIII-Tnos selection cassette was amplified by PCR from the pAlg-CHA-aphVIII vector to be finally cloned into the pAlg-CHAst vector in XhoI after insertion of the 5 'and 3' sites using primers AV37 (5'-AACTCGAGCATGGAGTCAAAGATTC-3 ') and AV40 (5'-TTCTCGAGCCGATCTAGTAACATAG-3'). FIG. 1 schematizes the map of the vector pAlg-CHAst-aphVIII. 11.2.3 Genetic transformation of the Chlorella microalgae The genetic transformation of the microalgae Chlorella protothecoids was carried out by particle bombardment using the modified BIORAD PDS-1000 / He (Thomas et al (2001)). Chlorella cultures in the exponential growth phase were concentrated by centrifugation (10 minutes, 2150 g, 20 ° C.), diluted in sterile water, and spread on agar (at a rate of 108 cells per agar). Precipitation of the DNA was carried out by a solution containing 1.25M CaCl2 and 20nnM spermidine, with a ratio of 1.25pg of DNA per 0.75mg of microcarriers. The transformation was carried out with firing pressures ranging from 900 to 1350psi. The microalgae Chlorella protothecoids was transformed using the pAlg-CHAst-aphVIII vector in circular form and in linear form (NheI digestion).

The microalgae that underwent transformation by particle bombardment were incubated for 24 hours under constant illumination and at 22 ° C. The cells were then centrifuged, washed with the culture medium, and plated at 15.106 cells per agar, on agar media containing 50 ng / l of paromomycin. 11.2.4 Selection of transformed microalgae After 15 to 21 days of culture, the potentially transformed clones of the Chlorella protothecoid microalgae that developed on the selection agar plates were subcultured once on a fresh medium supplemented with selection agent (50 ng / ml). L paromomycin). The clones were then transplanted every 10 to 15 days on selection agar plates and from the third subculture, they were also placed in liquid medium in the presence of selection agent. After 4 successive subcultures, the clones were both subcultured on media with and without a selection agent. After 5 rounds of subculture, the clones were placed in culture under heterotrophic conditions with and without selection agent. The monitoring of transgene detection was carried out after each transplanting and this in order to define the stability of the detection of transgenes in the genome of transformed microalgae. 11.2.5 Stability of Transgene Detection in Chlorella Microalgae Integration of the transgene into the Chlorella microalgae genome and stability of integration were verified by PCR amplification on transformed microalgae clones, transplanted into media of culture with and without selection agent, grown under standard culture conditions and in heterotrophic conditions. 11.2.6 Stable insertion of the transgene into the Chlorella genome The Chlorella microalgae were subcultured 17 times in the standard culture medium in the presence or absence of the paromomycin selection antibiotic. The maintenance of the transformed clones analyzed here represents 8 months of culture. Chlorella microalgae transformed were also placed in culture in heterotrophic condition by adding glucose in the culture medium at a rate of 10 g / L, over a period of 3 months, in the presence and absence of selection agent.

The stability of the detection of the transgene in the genome of the transformed chlorella was verified by PCR amplification using primers AN322 (5'-TTGTGAGTGGGTTGTTGTGG-3 ') and AN323 (5'-AAGTCGACGCTCCCTTCAGC-3') specific for the sequence. coding aphVIII (Figure 3). The PCR amplifications carried out on the clones transformed after 3, 9 and 14 successive subcultures, with and without a selection agent, show a constant detection at 405bp corresponding to the transgene. Detection of transgenes was validated on cultures after 17 successive transplants (Data not shown). These results demonstrate the stability of transgene integration in the genome of the microalga of industrial interest Chlorella protothecoids. 11.2.7 Stability of transgene detection after cryopreservation of transformed microalgae The transformed clones of the microalgae Chlorella protothecoids were cryopreserved at -80 ° C. In order to validate the stability of the integration of transgenes into the genome of the microalgae, PCR analyzes were carried out on cultures after 4 successive subcultures, derived from cryopreserved clones for 2 months. FIG. 4 shows the detection of the transgene in all the analyzed clones thus demonstrating the stability of the integration of the transgenes after a passage in cryopreservation. 11.2.8 Stable insertion of the entire vector randomly into the Chlorella genome The stable insertion of the vector pALG-CHAst-aphVIII was verified in the microalgae Chlorella transformed and regularly subcultured in the standard culture medium in the presence of selection antibiotic paromomycin. Detection of the selection gene and the rest of the vector in the genome of the transformed chlorella was carried out by PCR amplification using different pairs of primers specific for the sequence of the vector. FIG. 5 schematizes the PCR amplifications carried out on the entire pAlg-CHAst-aphVIII transformation vector. Amplification 1 corresponds to the demonstration of the presence of the transgene aphVIII in transformed microalgae Chlorella. The PCR amplifications carried out using primers AN322 (5'-TTGTGAGTGGGTTGTTGTGG-3 ') and AN323 (5'-AAGTCGACGCTCCCTTCAGC-3') specific for the transgene aphVIII are shown in FIG. 6. The amplifications obtained for the 3 clones of Chlorella microalgae transformed with the vector pAlg-CHAst-aphVill allowed to obtain a band at the expected size of 405bp, also visible for the amplification performed on the control vector. No amplification was obtained for the untransformed microalgae. This result shows that the microalgae have incorporated the aphVIII transgene which confers resistance to paromomycin. Amplifications 2 and 3 correspond to the demonstration of the presence of the sequences of two genes present in the pAlg-CHAst-aphVIII vector in the transformed Chlorella microalgae. The PCR amplifications carried out using the primer pairs AN367 (5'-AACGCATGAAGGTTATCG-3 ') / AN368 (5'-AAGAATGGGCAGCTCGTACC-3') and AN369 (5'-ACAAAGATGTTGCTGTCTCC-3 ') / AN370 (5' -AGTATGAAGATGAACAAAGC -3 'respectively specific for the genes 1 and 2 present on the pAlg-CHAst-aphVIII vector and on either side of the aphVIII transgene, are shown in FIG. 6. The amplifications carried out on the non-transformed microalgae do not have not yielded results. For the 3 clones of the transformed Chlorella microalgae, amplifications at the expected sizes, respectively 292 and 497bp, were obtained, also visible for the amplifications carried out on the pAlg-CHAst-aphVIII vector. This result shows that the microalgae have stably incorporated the entire transformation vector.

Amplifications 4a and 4b correspond to the demonstration of the presence of the selection cassette between fragments 1 and 2 in the transformation vector in transformed Chlorella microalgae. The PCR amplifications carried out using the primer pairs AN433 (5'-TTTAATGTACTGAATTAACG -3 ') / AN434 (5'-TAATAATTAACATGTAATGC-3') and AN371 (5'-TCACAACCGGGATACCGACC-3 ') / AN372 (5' -ATCGGTGCGGGCCTCTTCG-3 ') respectively make it possible to amplify the 5' and 3 'portions of the aphVIII expression cassette of the pAlg-CHAst-aphVIII vectors, including sequences 1 and 2 of the Chlorella genome (FIG. 5). The results obtained, presented in FIG. 6, show that no amplification has been obtained for the non-transformed microalgae. On the other hand, for the 3 clones of the microalgae Chlorella transformed, amplifications to the expected sizes, respectively 1103 and 1519bp, were obtained, also visible for the amplifications carried out on the control vector. This result shows that the aphVIII expression cassette was randomly inserted into the microalgae genome.

In addition, this result, coupled with those obtained previously, show that the microalgae have stably and randomly incorporated the entire vector pAlgCHAst-aphVIII integrally. These results, validated on the clones transformed with plasmid DNA in circular and linear form, confirm that the integration into the genome was performed randomly. 11.2.8 Conclusion The genetic transformation of the microalgae Chlorella protothecoids using the pAlg-CHAst-aphVIII vector has made it possible to obtain transformed lines of the microalgae. The detection of the transgene carried out on cultures after successive subcultures, cultures with and without a selection agent, cultures placed in autotrophy and heterotrophy, and in cultures that have undergone cryopreservation, validates that the integration of the transgene is stable. Detection by PCR amplification of the different parts of the pAlg-CHAst-aphVIII vector in the genome of transformed microalgae showed that insertion into the genome had occurred by random insertion.

In contrast to the transformation results obtained in Example 1 which showed instability of the integration of the transgenes, the use of the 18S rRNA genomic sequences in the transformation vector made it possible to stabilize the random integration of the transgenes into the genome of the transgenes. microalgae of the genus Chlorella. Thus, we have developed a method which has made it possible to remove the biology lock identified in Example 1, and which makes it possible to stably transform microalgae of the genus Chlorella by random insertion of the transgene. 11.3 Example 3: Stable genetic transformation of chlorella microalgae 11.3.1 Strains of Chlorella Microalgae are Chlorella sorokianiana (UTEX1663, UTEX1230), Chlorella vulgaris (CCAP211 / 11B, SAG280), Chlorella autotrophica CCMP243, Chlorella protothecoids (CCAP211 / 7A , CCAP211 / 8D), Chlorella zofingiensis (CCAP211 / 14, UTEX32), and Chlorella minutissima (UTEX2219). 11.3.2 Culture of microalgae Chlorella microalgae are cultivated in a medium composed of tap water supplemented with a nutrient solution of Conway 1X, tryptone at 0.5g / L or KNO3 at 1.5g / L according to the microalgae, and in the commercial medium BG11 (C3061, Sigma). The cultures are placed at 22 ° C. under constant light. The culture in heterotrophy is carried out in the standard medium to which 10 g / l of glucose are added. The cultures are placed at 22 ° C in the dark.

The cell count is performed by counting on a Malassez cell using the Algenics Algae Finder software. 11.3.3 Realization of the expression vectors The base of the vector used for the genetic transformation of Chlorella microalgae is the pAlg-CHAst-aphVIII vector used in Example 2. The 18S rRNA sequences of each of the microalgae were amplified at the same time. aids primers AN58 (ACCTGGTTGATCCTGCCAGT) and AN59 (GATCCTTCTGCAGGTTCACCTAC). Once sequenced, the primers for amplifying two specific fragments for each microalgae were defined (Table 1).

The genomic DNA sequences 1 and 2 corresponding to the two fragments of the 18S rRNA of each of the microalgae of the genus Chlorella, were amplified using the primers described in Table 1. The sites for the restriction enzymes EcoRI and XhoI / BamHI were respectively inserted 5 'and 3' of fragment 1. The XhoI and BamHI sites were respectively inserted at 5 'and at 3' of fragment 2. Each of the fragments as well as the selection cassette CaMV35S-aphVIII -Tnos, were cloned into the pAlg-CHAst-aphVIII vector of Chlorella transformation as described in Example 2. 11.3.4 Genetic transformation of the Chlorella microalgae The genetic transformation of Chlorella microalgae is carried out by particle bombardment. using the modified BIORAD PDS-1000 / He device (Thomas et al (2001)).

Chlorella cultures in exponential growth phase are concentrated by centrifugation (10 minutes, 2150 g, 20 ° C), diluted in sterile water, and spread on agar (at a rate of 108 cells per agar). Precipitation of the DNA is carried out by a solution containing 1.25M CaCl2 and 20nnM spermidine, with a ratio of 1.25pg of DNA per 0.75mg of microcarriers. The transformation is carried out with firing pressures ranging from 900 to 1350psi. Chlorella microalgae are transformed using the vector pAlgCHAst-aphVIII possessing the homologous genomic DNA fragments, in circular form and in linear form. Microalgae that undergo transformation by particle bombardment are incubated for 24 hours under constant lighting and at 22 ° C. The cells are then centrifuged, washed with the culture medium, and plated at 15.106 cells per agar, on agar media containing 50 ng / l of paromomycin. 11.3.5 Selection of transformed microalgae After 15 to 21 days of culture, clones potentially transformed Chlorella microalgae that develop on the selection agar are transplanted a first time on a fresh medium supplemented with selection agent (50nng / L of paromomycin ). The clones are then regularly transplanted on selection agar plates and from the third subculture, they are also placed in a liquid medium in the presence of selection agent. After 4 successive subcultures, the clones are both subcultured on media with and without a selection agent. After 5 rounds of subculture, the clones are placed in culture under heterotrophic conditions with and without a selection agent. The monitoring of the detection of transgenes is carried out after each transplanting and this in order to define the stability of the detection of transgenes in the genome of transformed microalgae. 11.3.6 Stability of transgene detection in Chlorella microalgae The integration of the transgene into the microalgae genome of the Chlorella genus and the stability of the integration are verified by PCR amplification on the transformed clones obtained for the microalgae, subcultured in culture media with and without selection agent, grown under standard culture conditions and in heterotrophic conditions. 11.3.7 Stable insertion of the transgene into the Chlorella genome Chlorella microalgae are subcultured 15 times in the standard culture medium in the presence or absence of the paromomycin selection antibiotic.

Chlorella microalgae transformed are also placed in culture under heterotrophic conditions by adding glucose to the culture medium at a rate of 10 g / L, in the presence and absence of selection agent.

The stability of the detection of the transgene in the genome of the transformed chlorella is verified by PCR amplification using primers AN322 (5'-TTGTGAGTGGGTTGTTGTGG-3 ') and AN323 (5'-AAGTCGACGCTCCCTTCAGC-3') specific for the coding sequence aphVIII. 11.3.8 Stability of transgene detection after cryopreservation of transformed microalgae The transformed clones of Chlorella microalgae are cryopreserved at 80 ° C. In order to validate the stability of the transgene integration in the genome of the microalgae, PCR analyzes are carried out on cultures derived from cryopreserved clones for 2 months. 11.3.9 Stable insertion of the entire vector randomly into the microalgae genome Chlorella The stable insertion of the vector pALG-CHAst-aphVIII is verified in the microalgae Chlorella transformed and regularly subcultured in the standard culture medium in the presence of antibiotic selection paromomycin. The detection of the selection gene and the rest of the vector in the genome of the transformed chlorella is carried out by PCR amplification using different primer pairs specific for the vector sequence. FIG. 5 schematizes the PCR amplifications carried out on the entire pAlg-CHAst-aphVIII transformation vector. Amplification 1 corresponds to the demonstration of the presence of the transgene aphVIII in transformed microalgae Chlorella. The PCR amplifications are carried out using primers AN322 (5'-TTGTGAGTGGGTTGTTGTGG-3 ') and AN323 (5'-AAGTCGACGCTCCCTTCAGC-3') specific for the transgene aphVIII. Amplifications 2 and 3 correspond to the demonstration of the presence of the sequences of 2 genes present in the pAlg-CHAst-aphVill vector in the transformed Chlorella microalgae. PCR amplifications are performed using primer pairs AN367 (5'-AACGCATGAAGGTTATCG-3 ') / AN368 (5'-AAGAATGGGCAGCTCGTACC-3') and AN369 (5'-ACAAAGATGTTGCTGTCTCC-3 ') / AN370 ( 5 '-AGTATGAAGATGAACAAAGC-3') respectively specific for genes 1 and 2 present on the pAlg-CHAst-aphVIII vector and on both sides of the aphVIII transgene (FIG. 5). Amplifications 4a and 4b correspond to the demonstration of the presence of the selection cassette between fragments 1 and 2 in the transformation vector in the transformed Chlorella microalgae. The PCR amplifications are carried out using primer pairs AN433 (5'-TTTAATGTACTGAATTAACG-3 ') / AN434 (5'-TAATAATTAACATGTAATGC-3') and AN371 (5'-TCACAACCGGGATACCGACC-3 ') / AN372 (5'- ATCGGTGCGGGCCTCTTCG-3 ') respectively make it possible to amplify the 5' and 3 'portions of the aphVIII expression cassette of the pAlg-CHAst-aphVIII vectors, including the 40 sequences 1 and 2 of the Chlorella genome (FIG. 5) . 11.4 Example 4: Stable genetic transformation of Chlorella protothecoids using vectors having different sequences homologous to the genomic DNA of the microalgae 11.4.1 Culture of microalgae The microalgae Chlorella protothecoids (CCAP211 / 8D) was cultured in a compound medium tap water supplemented with a nutrient solution of Conway 1X and tryptone at 0.5g / L. The cultures were placed at 22 ° C under constant light. The culture in heterotrophy was carried out in the standard medium to which 10 g / l of glucose was added. The cultures were placed in the dark and at 22 ° C. Cell count was performed by Malassez cell counting using the Algenics Algae Finder software. 11.4.2 Use of the selection genes nptll and aphVII for stable transformation of microalgae Chlorella protothecoids. Realization of the pAlg-CHAst-nptll and pAlg-CHAst-aphVII Vectors The CaMV35S-nptII-Tnos and pCaMV35S-aphVII-Tnos selection cassettes were amplified from the pAlg-CHA vectors using the AV37 primers (5'- AACTC GAG CATG GAGTCAAAGATTC -3 ') and AV40 (5'-TTCTC GAG CC GATCTAGTAACATAG -3'). They were then cloned in place of the CaMV35S-aphVIII-Tnos cassette into the pAlg-CHAst-aphVill vector using XhoI sites inserted at 5 'and 3' sequences during PCR amplification. 11.4.3 Use of 18S rRNA genomic fragment 1 for the stable transformation of Chlorella protothecoid microalgae. The objective is to demonstrate that the presence of a single fragment, or 2 identical fragments, homologous to endogenous sequences allows the stabilization of the random integration of transgenes into the Chlorella protothecoid genome. Realization of Fragnnent1-aphVIII construct and Fragment 1-aphVIll-Fragment 1 Chlorella 18S rRNA fragment protothecoids was amplified from genomic DNA of the microalgae using primers AN336 (5'-AAGAATTCAACCTG GTTGATC CTG CC -3 ') and AN337 (5'-TTGGATCCCTCGAGACAGCAAAGCCCAGGAGC-3'). It was then cloned using the EcoRI and BamHI sites inserted by PCR into the pAlgCHAst-F1 vector from the pCambia2300 commercial vector in which the p35S-nptll-T35S transformants selection cassette was removed by enzyme digestion. Asel restriction. The pAlgCHAst-F1-aphV111 vector was produced by cloning the CaMV35S-aphVIII-Tnos selection cassette into the vector pAlgCHAst-F1 into XhoI after insertion of the 5 'and 3' sites by PCR using the primers. AV37 (5'-AACTCGAGCATGGAGTCAAAGATTC-3 ') and AV40 (5'-TTCTCGAGCCGATCTAGTAACATAG-3').

The vector pAlgCHAst-F1-aphVIII-F1 was made by cloning a second fragment 1 of the 18S rRNA of Chlorella protothecoids in the vector pAlgCHAst-F1-aphVIII downstream of the selection cassette. Fragment 1 was recovered by digestion of the donor vector with HindIII-EcoRV enzymes, and cloned into the vector pALgCHAst-F1-aphVIII digested with HindIII and PvuII enzymes. 11.4.4 Use of different genomic DNA fragments for the stable transformation of microalgae Chlorella protothecoids The objective is to demonstrate that the origin and size of the genomic sequences present in the vector pALG-CHAst-aphVIII are not directly responsible for stabilization of the genetic transformation of Chlorella protothecoids, but that the stabilization of transgene integration is due to the strategy implemented to include DNA sequences homologous to genomic DNA of the microalgae in the vector. This strategy makes it possible to stabilize the random insertion of transgenes into the genome of Chlorella microalgae. Analyzes carried out in databases coupled with bioinformatics analyzes made it possible to characterize genome sequences of the microalgae Chlorella protothecoids. The PCR amplifications carried out on the genomic DNA and the sequencing of the amplicons obtained made it possible, in particular, to identify the sequences of the genes coding for the 28S rRNAs, the glutamine synthetase, the ammonium transporter and a protein involved in the degreening process. The constructs for the stable genetic transformation of Chlorella protothecoids are made using specific sequences of these 4 genes, amplified from the genomic DNA of the microalgae using the pairs of primers defined after the sequencing of the genes. and described in Table 1. The base of the vector used for the genetic transformation of microalgae Chlorella is the vector pAlg-CHAst-aphVIII used in Example 2. The sequence of fragments 1 and 2 of 18S rRNA were replaced by the specific fragments of the genes mentioned above. Two 750 pb fragments are amplified for the 28S rRNA (SEQ ID N: 43 and SEQ ID NO: 44) and are cloned into the transformation vector using the EcoRI, BamHI, and XhoI sites inserted at 5 ' and 3 'of the sequence during the PCR. Two 450 bp fragments are amplified for the gene encoding a degreening protein (SEQ ID NO: 34 and SEQ ID NO: 35) and are cloned into the transformation vector using the EcoRI, BamHI, and XhoI sites. inserted 5 'and 3' of the sequence during the PCR. Two 550 bp fragments are amplified for the gene encoding glutamine synthetase (SEQ ID N: 37 and SEQ ID N: 38) and are cloned into the transformation vector using the EcoRI, SalI, and XhoI sites inserted into the transformation vector. 5 'and 3' of the sequence during the PCR. Two 750-bp fragments are amplified for the gene encoding an ammonium transporter (SEQ ID N: 40 and SEQ ID N: 41) and are cloned into the transformation vector using the inserted EcoRI, BamHI, and XhoI sites. 5 'and 3' of the sequence during the PCR. The last vector made consists of associating DNA fragments remote from the genome of the microalgae Chlorella protothecoids. It is carried out by cloning fragment 1 of the glutamine synthetase gene and fragment 2 of the ammonium transporter gene whose loci are located on different scaffolds. 11.4.5 Genetic transformation of the Chlorella microalgae The genetic transformation of Chlorella microalgae is carried out by particle bombardment using the modified BIORAD PDS-1000 / He (Thomas et al., 2001). Chlorella cultures in exponential growth phase are concentrated by centrifugation (10 minutes, 2150 g, 20 ° C), diluted in sterile water, and spread on agar (at a rate of 108 cells per agar). Precipitation of the DNA is carried out by a solution containing 1.25M CaCl2 and 20nnM spermidine, with a ratio of 1.25pg DNA to 0.75mg nnicrocarriers. The transformation is carried out with firing pressures ranging from 900 to 1350psi. Chlorella microalgae are transformed using the vector pAlgCHAst-aphVIII possessing the homologous genonic DNA fragments, in circular form and in linear form. Microalgae that undergo transformation by particle bombardment are incubated for 24 hours under constant lighting and at 22 ° C. The cells are then centrifuged, washed with the culture medium, and plated at 15.106 cells per agar, on agar media containing 50 ng / l of paromomycin. 11.4.6 Selection of the transformed microalgae After 15 to 21 days of culture, the potentially transformed clones of Chlorella microalgae that develop on the selection agar plates are subcultured once on a fresh medium supplemented with selection agent (50nng / L of paromomycin ). The clones are then regularly transplanted on selection agar plates and from the third subculture, they are also placed in a liquid medium in the presence of selection agent. After 4 successive subcultures, the clones are both subcultured on media with and without a selection agent. After 5 rounds of subculture, the clones are placed in culture under heterotrophic conditions with and without a selection agent. The monitoring of the detection of transgenes is carried out after each transplanting and this in order to define the stability of the detection of transgenes in the genome of transformed microalgae. 11.4.7 Stability of transgene detection in Chlorella microalgae The integration of the transgene into the microalgae genome of the Chlorella genus and the stability of the integration are verified by PCR amplification on the transformed clones obtained for the microalgae, subcultured in culture media with and without selection agent, grown under standard culture conditions and in heterotrophic conditions. 11.4.8 Stable insertion of the transgene into the Chlorella genome Chlorella microalgae are subcultured 15 times in the standard culture medium in the presence or absence of the paromomycin selection antibiotic.

Chlorella microalgae transformed are also placed in culture under heterotrophic conditions by adding glucose to the culture medium at a rate of 10 g / L, in the presence and absence of selection agent. The stability of the detection of the transgene in the genome of the transformed chlorella is verified by PCR amplification using primers AN322 (5'15 TTGTGAGTGGGTTGTTGTGG-3 ') and AN323 (5'-AAGTCGACGCTCCCTTCAGC-3') specific for the coding sequence aphVIII. 11.4.9 Stability of transgene detection after cryopreservation of transformed microalgae The transformed clones of microalgae of the genus Chlorella are cryopreserved at -80 ° C. In order to validate the stability of the integration of transgenes into the microalgae genome, PCR assays are performed on cultures derived from cryopreserved clones for 2 months. 11.4.10 Stable insertion of the entire vector randomly into the microalgae genome Chlorella The stable insertion of the pALG-CHAst-aphVIII vector is verified in the transformed Chlorella microalgae and regularly transplanted into the standard culture medium in the presence of antibiotic selection paromomycin. Detection of the selection gene and the rest of the vector in the genome of the transformed chlorella is carried out by PCR amplification using different primer pairs specific for the sequence of the vector. FIG. 5 schematizes the PCR amplifications carried out on the entire pAlg-CHAst-aphVIII transformation vector. Amplification 1 corresponds to the demonstration of the presence of the transgene aphVIII in the transformed Chlorella microalgae. The PCR amplifications are carried out using primers AN322 (5'-TTGTGAGTGGGTTGTTGTGG-3 ') and AN323 (5'-AAGTCGACGCTCCCTTCAGC-3') specific for the transgene aphVIII.

Amplifications 2 and 3 correspond to the demonstration of the presence of the sequences of 2 genes present in the pAlg-CHAst-aphVill vector in the transformed Chlorella microalgae. The PCR amplifications are carried out using the primer pairs AN367 (5'-AACGCATGAAGGTTATCG-3 ') / AN368 (5'-AAGAATGGGCAGCTCGTACC-3') and AN369 (5'-ACAAAGATGTTGCTGTCTCC-3 ') / AN370 (5'-AACGCATGAAGGTTATCG-3'). '-AGTATGAAGATGAACAAAGC-3' respectively specific for genes 1 and 2 present on the pAlg-CHAst-aphVIII vector and on both sides of the aphVIII transgene (FIG. 5). Amplifications 4a and 4b correspond to the demonstration of the presence of the selection cassette between fragments 1 and 2 in the transformation vector in transformed Chlorella microalgae. PCR amplifications are performed using primer pairs AN433 (5'-TTTAATGTACTGAATTAACG-3 ') / AN434 (5'-TAATAATTAACATGTAATGC-3') and AN371 (5'-TCACAACCGGGATACCGACC-3 ') / AN372 (5'-TTTAATTAACATGTAATGC-3'). ATCGGTGCGGGCCTCTTCG-3 ') respectively make it possible to amplify the 5' and 3 'portions of the aphVIII expression cassette of the pAlg-CHAst-aphVIII vectors, including sequences 1 and 2 of the Chlorella genome (FIG. 5). 11.5 Example 5: Production of Molecules of Industrial Interest in Chlorella 11.5.1 Strains of Chlorella Microalgae are Chlorella sorokianiana UTEX1663, Chlorella vulgaris SAG280 and SAG211.11b, Chlorella autotrophica CCMP243, Chlorella NC64A SAG211.6, Chlorella protothecoides CCAP211 / 8D and SAG211.7C, Chlorella Kessleri SAG27.87, Chlorella ellipsoids SAG2141. 11.5.2 Culture of microalgae Chlorella microalgae were grown in a medium composed of tap water supplemented with a nutrient solution of Conway 1X, tryptone at 0.5g / L or KNO3 at 1.5g / L depending on the microalgae , and in the commercial medium BG11 (C3061, Sigma). The cultures were placed at 22 ° C under constant light. The culture in heterotrophy was carried out in the standard medium to which 10 g / l of glucose was added. The cultures were placed in the dark and at 22 ° C. The cell count is performed by counting on a Malassez cell using the Algenics Algae Finder software. 11.5.3 Chlorella microalgae glycoprotein detection Chlorella microalgae protein samples were separated on a 12% SDS-PAGE gel and transferred to a nitrocellulose membrane (RPN303D, GE Healthcare). After saturation of the nitrocellulose membrane for 5 minutes in 2% TBS Tween20 solution, the glycoproteins were detected by affinodetection using horseradish peroxidase conjugated Concanavalin A lectin (Sigma, L6397). Figure 7 shows the results obtained for different microalgae of the genus Chlorella. Chlorella microalgae have profiles in which glycoproteins have been detected. These microalgae thus have the ability to produce mature glycosylated proteins. Because of their high industrial potential and their ability to perform post-translational modifications such as N-glycosylation, Chlorella microalgae are very good candidates as expression systems for the production of glycosylated proteins of therapeutic interest. such as monoclonal antibodies, viral envelope proteins, or lysosomal enzymes. 11.5.4 Production of marker proteins in the microalga Chlorella protothecoids The regulatory sequences of viral origin A3R (SEQ ID No.) and A208R (SEQ ID No.), were synthesized with the addition of the EcoRI site at 5 'and 3' of each of the sequences. These promoters were then cloned into the pAlg-CHA vector in place of the CaMV35S promoter. The genes coding for the reporter proteins eGFP (SEQ ID NO: 8) and GUS (SEQ ID NO: 9) were respectively amplified from the pPT-eGFP vectors (Zaslavskaia et al., 2000) and pBi121 (GenBank: AF485783) using the AV49 primer pairs (5'-AAG GATC CATGGAGG AG CAAG GGC GAG -3 ') / AV50 (5'-TTGAG CTCTTACTTGTACAG CTCG TC -3') and AV51 (5'-AAGGATCCATGTTACGTCCTGTAGAAAC -3 ') / AV52 (5' - TTGAGCTCTCATTGTTTGCCTCCCTG-3 '). The coding sequences were then cloned into the pAlg-CHA vector under the control of the A3R promoter for the gus gene, and A208R for the egfp gene. The expression cassettes pA3R-gus-Tnos and pA208R-egfp-Tnos were amplified using primers AV47 (5'-GCTCCTGGTCGAACATGG-3 ') or AV48 (5'-GAGTCAACATATGGGGGG-3') and AV40 ( 5 '-TTCTCGAGCCGATCTAGTAACATAG-3') before being cloned into free ends in the vector pAlg-CHAst-aphVill. The cloning site of the expression cassettes is downstream of fragment 2 of the 18S rRNA. 11.5.5 Production of Therapeutic Glycoproteins in the Microalgae Chlorella Protothecoids Sequences of the heavy and light chains of the monoclonal antibody of therapeutic interest Rituximab (SEQ ID NO: 10, SEQ ID NO: 11) were synthesized. The BamHI and SacI sites were respectively inserted at 5 'and 3' of each of the sequences. The heavy chain was cloned into the vector pAlg-CHA-gus instead of the sequence gus downstream of the viral promoter A3R. The light chain was cloned into the pAlgCHA-egfp vector in place of the egfp sequence downstream of the A208R viral promoter. The expression cassettes pA3R-ChLrtx-Tnos and pA208R-Ch (rtx-Tnos were amplified using the primers AV47 (5'-GCTCCTGGTCGAACATGG-3 ') or AV48 (5'40 GAGTCAACATATGGGGGG-3') and AV40 (5'-TTCTCGAGCCGATCTAGTAACATAG-3 ') before being blunt ended in the vector pAlg-CHAst-aphVill The cloning sites of the expression cassettes are upstream of the fragment 1 and downstream of the fragment 2 of the 18S rRNA 11.5.6 Genetic transformation of the Chlorella microalgae The genetic transformation of the microalgae Chlorella protothecoides is carried out by particle bombardment using the modified BIORAD PDS-1000 / He (Thomas et al., 2001). Chlorella cultures in exponential growth phase are concentrated by centrifugation (10 minutes, 2150g, 20 ° C), diluted in sterile water, and spread on agar (at a rate of 108 cells per agar). the DNA is made by a solution containing 1.25M CaCl2 and 20nnM sperm idine, with a ratio of 1.25pg of DNA to 0.75mg of microcarriers. The transformation is carried out with firing pressures ranging from 900 to 1350psi. The Chlorella protothecoides microalgae is transformed using the pAlg-CHAst-aphVIII vector in circular form and in linear form. The microalgae that underwent transformation by particle bombardment were incubated for 24 hours under constant illumination and at 22 ° C. The cells were then centrifuged, washed with the culture medium, and plated at 15.106 cells per agar, on agar media containing 50 ng / l of paromomycin. 11.5.7 Selection of transformed microalgae After 15 to 21 days of culture, clones potentially transformed Chlorella microalgae that develop on the selection agar are transplanted a first time on a fresh medium supplemented with selection agent (50nng / L of paromomycin ). The clones are then regularly transplanted on selection agar plates and from the third subculture, they are also placed in a liquid medium in the presence of selection agent. After 4 successive subcultures, the clones are both subcultured on media with and without a selection agent. After 5 rounds of subculture, the clones are placed in culture under heterotrophic conditions with and without a selection agent. The monitoring of the detection of transgenes is carried out after each transplanting and this in order to define the stability of the detection of transgenes in the genome of transformed microalgae. 11.5.8 Detection of reporter proteins in Chlorella protothecoides transformants Chlorella protothecoides microalgae clones transformed with the GUS protein coding sequence are cultured under standard culture conditions. The cells in the exponential growth phase are recovered by centrifugation (10 minutes, 2150 g, 20 ° C.) and then incubated in the GUS reaction buffer. The observation of the specific blue staining of the expression of the gus gene is carried out after 24 hours using a photonic microscope.

Clones of the Chlorella protothecoides microalgae transformed with the coding sequence for the eGFP fluorescent protein are cultured under standard culture conditions. The cells in the exponential phase of growth are recovered by centrifugation (10 minutes, 2150 g, 20 ° C.) and then observed using an epichlorofusion microscope. Wild type cells and cells expressing the eGFP protein of the microalgae Chlorella protothecoides are lysed. Protein extracts are analyzed by immunoblotting using an anti-eGFP antibody (Santa Cruz, sc-9996-HRP). 11.5.9 Detection of Rituximab Antibody in Chlorella Protothecoides Transformants Culture supernatants of wild-type strains transformed with the heavy and light chain coding sequences of the commercial Rituximab antibody are recovered by centrifugation. (10 minutes, 2150g, 20 ° C) growth phase exponential culture. The detection of the recombinant antibody secreted in the culture medium of the transformed microalgae is carried out using the antihuman IgG antibody (Sigma, A6029-HRP).

BIBLIOGRAPHIC REFERENCES Cha T.S., Yee W. and A. Aziz (2012). "Assessment of factors affecting Agrobacteriummediated genetic transformation of the unicellular green alga, Chlorella vulgaris." World Journal of Microbiology and Biotechnology 28 (4): 1771-1779. Chow K.C. and Tung W.L. (1999). "Electrotransformation of Chlorella vulgaris." Plant Cell Reports 18: 778-780. Jarvis E.E. and Brown L.M. (1991). "Transient expression of firefly luciferase in protoplasts of the green alga Chlorella ellipsoidea." Current Genetics 19 (4): 317-321.

Lu Y., Kong R. and Hu L. (2011). "Preparation of Protoplasts from Chlorella Protothecoids." World Journal of Microbiology and Biotechnology 28 (4): 1827-1830. Maruyama M., Horakova I., Honda H., Xing X.H., Shiragami N. and Unno H. (1994). "Introduction of foreign DNA into Chlorella saccharophila by electroporation." Biotechnology Techniques 8 (11): 821-826.

Needleman S.B. and Wunsch C.D. (1970). "A general method applicable to the search for similarities in the amino acid sequence of two proteins." Journal of Molecular Biology 48 (3): 443-453. Rakkhumkaew N., Kawasaki T., Fujie M. and Yamada T. (2012). "Prolonged synthesis of hyaluronan by Chlorella cells infected with chloroviruses." Journal of Bioscience and Bioengineering [Epub ahead of print]. Thomas J.L., Bardou J., The Hosts J., Mauchamp B., and Chavancy G. (2001). "A helium burst biolistic device adapted to penetrate fragile insect tissues". Journal of Insect Science. Zaslavskaia L., Casey Lippmeier J., Kroth P., Grossman A. and Apt E. (2000). "Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes." Journal of Phycology 36: 379-386.

Claims (16)

REVENDICATIONS1. A process for obtaining a stable microalgae transformant of the Chlorella genus comprising the following steps: (i) transformation of the nuclear genome of a microalga of the Chlorella genus with an expression vector comprising: an expression cassette, in particular a heterologous cassette ; and an endogenous nucleic acid sequence of the nuclear genome of said microalgae of the genus Chlorella and / or a stabilizing nucleic acid sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length of the genome. said sequence; said endogenous stabilizing nucleic acid sequence being from 10 bp to 300 kbp in length; and (ii) selecting a stable transformant. The method of claim 1, wherein said endogenous nucleic acid sequence is a coding sequence, particularly a coding sequence of ribosomal RNA. The method of claim 2 wherein said endogenous stabilizing nucleic acid sequence is a coding sequence of ribosomal RNA selected from the group consisting of: the sequence of the 18S rRNA gene; the sequence of the gene encoding 28S rRNA; the sequence of the gene encoding 5.8S rRNA; and their fragments of at least 10 bp in length. The method of any one of claims 1 to 3, wherein said endogenous stabilizing nucleic acid sequence is the only endogenous sequence of said microalgae of the genus Chlorella included in said expression vector. The method according to any one of claims 1 to 3, wherein said vector comprises two stabilizing nucleic acid sequences selected from the group consisting of: an endogenous nucleic acid sequence endogenous to the nuclear gerontoma of said microalgae of the genus Chlorella, said endogenous stabilizing nucleic acid sequence being from 10 bp to 300 kbp in length; and a stabilizing nucleic acid sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence throughout the length of said sequence. The method according to claim 5, wherein the two stabilizing nucleic acid sequences are endogenous sequences of the nuclear genome of said microalgae of the genus Chlorella and are the only endogenous sequences of said microalgae of the genus Chlorella included in said expression vector . The method according to any one of claims 3 to 6, wherein said endogenous stabilizing nucleic acid sequence (s) is (are) a fragment of the sequence of the gene encoding the 18S rRNA, said fragment being of a length ranging from 300 bp to 800 bp, in particular from 400 bp to 750 bp. The method according to any one of claims 1 to 7, wherein said microalgae of the genus Chlorella is selected from the group consisting of Chlorella protothecoids and Chlorella sorokiniana, in particular Chlorella protothecoids. The method according to claim 7, wherein said Chlorella microalgae is Chlorella protothecoids and said endogenous stabilizing nucleic acid sequence (s) is (are) selected from group consisting of: the sequence SEQ ID NO: 13, the sequence SEQ ID NO: 14, the sequence SEQ ID NO: 43, the sequence SEQ ID NO: 44, the sequence SEQ ID NO: 45, in particular in the group consisting of in the sequence SEQ ID NO: 13 and the sequence SEQ ID NO: 14. The method of claim 1, wherein said Chlorella microalgae is Chlorella protothecoids and said expression vector is as defined in any one of claims 13 to 15. The method of any one of claims 1 to 10, said method further comprising the steps of: (iii) isolating said stable transformant; and (iv) culturing said stable transformant. A process for producing a substance of interest comprising carrying out the method of any one of claims 1 to 11, wherein said expression cassette is a heterologous expression cassette comprising a DNA sequence encoding said substance of interest. 13. Vector filed December 20, 2012 at CCAP under registration number CCAP 211/122. An expression vector comprising: an expression cassette; and an endogenous nucleic acid sequence of the nuclear genome of a microalgae of the genus Chlorella and / or a nucleic acid stabilizer sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length said sequence; said endogenous stabilizing nucleic acid sequence being from 10 bp to 10 kbp in length and being a ribosome RNA coding sequence in particular the 18S rRNA gene sequence or a fragment thereof. The expression vector of claim 14 comprising: an expression cassette; and an endogenous nucleic acid sequence of the nuclear genome of a microalgae of the genus Chlorella and / or a nucleic acid stabilizer sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length said sequence; said endogenous stabilizing nucleic acid sequence being SEQ ID NO: 13; and an endogenous nucleic acid sequence of the nuclear genome of a microalgae of the genus Chlorella and / or a nucleic acid stabilizer sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length said sequence; said endogenous stabilizing nucleic acid sequence being SEQ ID NO: 14. 16. Microalga of the genus Chlorella comprising at least one vector as defined according to any one of claims 13 to 15.