FR2994372A1 - COMPOSITION COMPRISING AT LEAST THREE DIFFERENT STRAINS OF L. SAKEI FOR THE CONSERVATION OF EDIBLE PRODUCTS - Google Patents

Abstract

The present invention relates to a composition comprising at least three different strains of L. sakei bacteria, and to its use for preserving edible products.

Description

The present invention relates to a composition comprising at least three different strains of Lactobacillus sakei (L. sakei) bacteria, and to its use for preserving edible products, preferably meat products, in particular beef and more beef carpaccio meat products are products that, without conservation treatment, degrade rapidly, at a rate that depends on: acidity of the product, ambient humidity, modified atmosphere, type and burden of bacteria, temperature ... Many food preservation treatments, and especially meat products, are known (fermentation, smoking, salting, drying, addition of preservatives, vacuum packaging ...). However, the use of preservatives is regulated. In addition, most of these treatments lead to a transformation of the fresh product (taste, color, texture). It is also known to use protective cultures for the purpose of bio-preservation, the desired effect then being to ensure the microbiological quality without organoleptic modification of the product, so as to preserve its fresh character. This implies the use of bacteria, harmless for human health, which will prevent the development of other undesirable bacterial species, without modifying the food matrix. While research for the development of good protective crops has been developing for several years, the major difficulty lies in the fact that competition between different bacterial species on complex food substrates results from a set of poorly understood mechanisms (Devlieghere et al., 2004). Some examples exist (in France: LLO lactic ferment for the conservation of shrimps, in the United States: BovamineMeatTm for the preservation of meat, in Europe HoldbacTM and SafePro RangeTM marketed by Danisco and Ch Hansen for the preservation of meat products). However, the existing products often target only one bacterial species (Listeria monocytogenes) and do not concern beef carpaccio. More particularly, with regard to meat products, meat intended to be eaten raw or undercooked (steaks tartar or chopped, carpaccio for example) or ready meals, are those that can present significant problems of contamination with an impact on the health of the consumer. Indeed, in the case of products consumed raw or undercooked, the pathogenic bacteria are not destroyed by cooking and in the case of cooked products, made sterile by their prior cooking, a subsequent contamination can be dangerous because in the absence of Competitive species, newly contaminating bacteria can grow to a high degree. It is therefore essentially on these types of products that research on protective cultures of meat products has developed (Bredholt et al., 2001, Vermeiren et al., 2004, Vold et al., 2000). It has been observed that the endogenous flora of meat, and in particular L. sakei, helps to prevent the development of pathogenic bacteria such as Escherichia col 0157: H7 in minced meat. Trials using anti-Listeria bacteriocin-producing strains have shown that they limit the development of Listeria on cooked meat products. However, the efficacy of bacteriocins in food matrices remains poorly controlled and the range of targets is limited to a few bacterial species. There is a very large diversity of L. sakei strains with genome sizes ranging from 1.8 Mb to 2.3 Mb. This wide diversity is grouped into about ten genetic classes within the species. Thus, the inventors have identified various genetic markers for characterizing L. sakei strains (international applications WO 2009/106491 and WO 2011/023675). Despite the knowledge of this diversity, it is currently impossible to know if there is an 'ideal' assemblage of strains that could most effectively combat the alteration of one or more altered species in a meat product, particularly Surprisingly, the inventors have developed a specific composition comprising 3 classes of L. sakei, well identified and traceable in the product, which makes it possible to fight against several bacterial species of food spoilage, in particular meat products, particularly raw or undercooked meat products, and particularly beef carpaccio and ground beef steak These different classes of L. sakei are identifiable by specific markers.

Thus, the present invention relates to a composition comprising at least three different strains of L. sakei bacteria, wherein: said first strain of L. sakei bacteria comprises in its genome the following sequence: SEQ ID NO: 35 or a sequence having at least 95% identity therewith, - said second strain of L. sakei bacteria comprises in its genome the following sequence: SEQ ID NO: 21 or a sequence having at least 95% identity with that said third strain of L. sakei bacteria comprises in its genome the following sequence: SEQ ID NO: 26 or a sequence having at least 95% identity therewith. Preferably, said first strain of L. sakei bacteria comprises in its genome the following sequences: SEQ ID NO: 42 and SEQ ID NO: 35 or a sequence having at least 95% identity therewith, preferably said first strain of L. sakei bacteria comprises in its genome the following sequences: SEQ ID NO: 2 or a sequence having at least 95% identity therewith, SEQ ID NO: 34 or a sequence exhibiting at least 95% identity therewith, - SEQ ID NO: 42, and - SEQ ID NO: 35 or a sequence having at least 95% identity therewith; preferably, said first strain of L. sakei bacteria comprises in its genome the following sequences: SEQ ID NO: 2 or a sequence having at least 95% identity therewith; SEQ ID NO: 4 or a sequence presenting at least 95% identity therewith, - SEQ ID NO: 6 or a sequence having at least 95% identity therewith, - SEQ ID NO: 7 or a sequence having at least 95% identity identity therewith, - SEQ ID NO: 8 or a sequence having at least 95% identity therewith, - SEQ ID NO: 9 or a sequence having at least 95% identity therewith, SEQ ID NO: 10 or a sequence having at least 95% identity therewith; SEQ ID NO: 13 or a sequence having at least 95% identity therewith; SEQ ID NO: 15 or a sequence having at least 95% identity therewith, - SEQ ID NO: 19 or a sequence having at least 95% identity therewith, - SEQ ID NO: 32 or a sequence with at least 95% identity therewith, - SEQ ID NO: 34 or a sequence having at least 95% identity therewith, - SEQ ID NO: 42, - SEQ ID NO: 35 or sequence having at least 95% identity therewith, - SEQ ID NO: 36 or a sequence having at least 95% identity therewith, - SEQ ID NO: 38 or a sequence having at least 95% identity with it, and particularly preferably, said strain is the strain deposited with the CNCM (National Collection of Cultures of Microorganisms; Pasteur Institute, 28 rue 30 of Dr. Roux, F-75724 Paris CEDEX 15) November 19, 2010 under number CNCM 1-4396. Preferably, said second strain of L. sakei bacteria comprises in its genome the following sequences: SEQ ID NO: 21 or a sequence having at least 95% identity therewith, and 5-SEQ. ID NO: 40 or a sequence having at least 95% identity therewith; preferably, said second strain of L. sakei bacteria comprises in its genome the following sequences: SEQ ID NO: 16 or a sequence having at least 95% identity therewith, SEQ ID NO: 17 or a sequence having at least 95% identity therewith, - SEQ ID NO: 21 or a sequence having at least 95% identity therewith, and 15 - SEQ ID NO: 40 or a sequence exhibiting at least 95% identity with this one; preferably said second strain of L. sakei bacteria comprises in its genome the following sequences: SEQ ID NO: 4 or a sequence having at least 95% identity therewith, SEQ ID NO: 8 or a sequence having at least 95% identity therewith, - SEQ ID NO: 9 or a sequence having at least 95% identity therewith, - SEQ ID NO: 11 or a sequence having at least 95% identity with it, - SEQ ID NO: 12 or a sequence having at least 95% identity therewith, - SEQ ID NO: 16 or a sequence having at least 95% identity with it. ci, - SEQ ID NO: 17 or a sequence having at least 95% identity therewith, - SEQ ID NO: 20 or a sequence having at least 95% identity therewith, - SEQ ID NO Or a sequence having at least 95% identity therewith, - SEQ ID NO: 36 or a sequence having at least 95% identity therewith, - SEQ ID NO: 38 or a seq. uence having at least 95% identity therewith, and - SEQ ID NO: 40 or a sequence having at least 95% identity therewith, preferably said strain further comprises one, preferably 2 , 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and more preferably 7, 8, 9, 10, 11, 12 sequences selected from the group consisting of the sequences: SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 24, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 37, SEQ ID NO: 41 and or a sequence having at least 95% identity therewith respectively, and particularly preferably, said strain is the strain deposited with the CNCM on November 19, 2010 under number CNCM 1-4393.

Preferably, said third strain of L. sakei bacteria comprises in its genome the following sequences: SEQ ID NO: 23 or a sequence having at least 95% identity therewith, and SEQ ID NO: 26 or sequence having at least 95% identity therewith, preferably said third strain of L. sakei bacteria comprises in its genome at least the following sequences: SEQ ID NO: 22 or a sequence exhibiting at least 95% of identity therewith, - SEQ ID NO: 23 or a sequence having at least 95% identity therewith, and - SEQ ID NO: 26 or a sequence having at least 95% identity therewith preferably, said third strain of L. sakei bacteria comprises in its genome at least the following sequences: SEQ ID NO: 7 or a sequence having at least 95% identity therewith, SEQ ID NO: 13 or a sequence having at least 95% identity therewith, - SEQ ID NO: 15 or a seq. uence having at least 95% identity therewith, - SEQ ID NO: 20 or a sequence having at least 95% identity therewith, - SEQ ID NO: 22 or a sequence having at least 95% identity with it, - SEQ ID NO: 23 or a sequence having at least 95% identity therewith, SEQ ID NO: 26 or a sequence having at least 95% identity therewith and preferably said strain further comprises one, preferably 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 and more preferably 5, 6, 7, 8, 9 of the sequences selected from the group consisting of: SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, and SEQ ID NO: 41 or a sequence having at least 95% identity therewith, and particularly preferably, said penny. che is the strain deposited with the CNCM on November 19, 2010 under number CNCM 1-4394. Thus, preferably, the composition according to the present invention comprises: a first strain of L. sakei bacteria comprising in its genome the following sequences: SEQ ID NO: 42, and SEQ ID NO: 35 or a sequence presenting at least 95% of identity with it, - a second strain of L. sakei bacteria comprising in its genome the following sequences: SEQ ID NO: 17 or a sequence having at least 95% identity therewith, and SEQ ID NO: 40 or a sequence having at least 95% identity therewith; a third strain of L. sakei bacteria comprising in its genome the following sequences: SEQ ID NO: 23 or a sequence having at least 95% identity therewith, and SEQ ID NO: 26 or a sequence presenting at least 95% identity with it.

In a particularly preferred manner, the composition according to the present invention comprises: a first strain of L. sakei bacteria comprising in its genome the following sequences: SEQ ID NO: 2 or a sequence having at least 95% identity with it or SEQ ID NO: 34 or a sequence having at least 95% identity therewith, - SEQ ID NO: 42, and - SEQ ID NO: 35 or a sequence having at least 95% identity with this, a second strain of L. sakei bacteria comprising in its genome the following sequences: SEQ ID NO: 16 or a sequence having at least 95% identity therewith, SEQ ID NO: 17 or a sequence having at least 95% identity therewith, - SEQ ID NO: 21 or a sequence having at least 95% identity therewith, and - SEQ ID NO: 40 or a sequence exhibiting at least 95% identity with this one; and a third strain of L. sakei bacteria comprising in its genome the following sequences: SEQ ID NO: 22 or a sequence having at least 95% identity therewith; SEQ ID NO: 23 or a sequence presenting at least 95% identity therewith, and - SEQ ID NO: 26 or a sequence having at least 95% identity therewith. In a particularly preferred manner, the composition according to the present invention comprises: a first strain of L. sakei bacteria comprising in its genome the following sequences: SEQ ID NO: 2 or a sequence having at least 95% identity with it ci, - SEQ ID NO: 4 or a sequence having at least 95% identity therewith, - SEQ ID NO: 6 or a sequence having at least 95% identity therewith, - SEQ ID NO Or a sequence having at least 95% identity therewith, - SEQ ID NO: 8 or a sequence having at least 95% identity therewith, - SEQ ID NO: 9 or a sequence having at least 95% identity therewith, - SEQ ID NO: 10 or a sequence having at least 95% identity therewith, - SEQ ID NO: 13 or a sequence having at least 95% identity identity therewith, - SEQ ID NO: 15 or a sequence having at least 95% identity therewith, - SEQ ID NO: 19 or a sequence showing with at least 95% identity therewith, - SEQ ID NO: 32 or a sequence having at least 95% identity therewith, - SEQ ID NO: 34 or a sequence having at least 95% identity with identity with it, - SEQ ID NO: 42, - SEQ ID NO: 35 or a sequence having at least 95% identity therewith, - SEQ ID NO: 36 or a sequence having at least 95% identity with it, - SEQ ID NO: 38 or a sequence having at least 95% identity therewith, and - a second strain of L. sakei bacteria comprising in its genome the following sequences: - SEQ ID NO: 4 or a sequence having at least 95% identity therewith, - SEQ ID NO: 8 or a sequence having at least 95% identity therewith, - SEQ ID NO: 9 or a sequence having at least 95% identity therewith, - SEQ ID NO: 11 or a sequence having at least 95% identity therewith, - SEQ ID NO: 12 or a sequence having at least 95% identi with it, - SEQ ID NO: 16 or a sequence having at least 95% identity therewith, - SEQ ID NO: 17 or a sequence having at least 95% identity therewith, - SEQ ID NO: 20 or a sequence having at least 95% identity therewith, - SEQ ID NO: 21 or a sequence having at least 95% identity therewith, - SEQ ID NO: 36 or a sequence having at least 95% identity therewith, - SEQ ID NO: 38 or a sequence having at least 95% identity therewith, - SEQ ID NO: 40 or a sequence exhibiting at least 95% identity therewith, preferably said strain further comprising one, preferably, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, And still more preferably 7, 8, 9, 10, 11, 12 sequences selected from the group consisting of: SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 24, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 37, SEQ ID NO: 41 and or a sequence having at least 95% identity therewith respectively, and - a third strain of L. sakei bacteria comprising in its genome at least the following sequences: SEQ ID NO: 22 or a sequence having at least 95% identity therewith; SEQ ID NO: 23 or a sequence having at least 95% identity with that ci, and - SEQ ID NO: 26 or a sequence having at least 95% identity therewith, preferably said third strain of L. sakei bacteria comprising in its genome at least the following sequences: SEQ ID NO Or a sequence having at least 95% identity therewith, - SEQ ID NO: 13 or a sequence having at least 95% identity therewith, - SEQ ID NO: 15 or a sequence having at least 95% identity therewith, - SEQ ID NO: 20 or a sequence having at least 95% identity therewith, - SEQ ID NO: 22 o a sequence having at least 95% identity therewith, - SEQ ID NO: 23 or a sequence having at least 95% identity therewith, - SEQ ID NO: 26 or a sequence exhibiting at least 95% identity therewith, and preferably said strain further comprises one, preferably, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17 or 18 and even more preferentially 5, 6, 7, 8, 9 of the sequences selected from the group consisting of the sequences: SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO : 12, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 36 , SEQ ID NO: 37, SEQ ID NO: 38, and SEQ ID NO: 41 or a sequence having at least 95% identity therewith respectively.

Preferably, the present invention relates to a composition as defined above comprising at least a fourth strain of L. sakei bacteria, different from the other strains defined above.

Preferably, said fourth strain of L. sakei bacteria comprises in its genome at least the sequence SEQ ID NO: 39 or a sequence having at least 95% identity therewith. In a preferred embodiment, the fourth strain comprises in its genome at least the following sequences: - SEQ ID NO: 4 or a sequence having at least 95% identity therewith, - SEQ ID NO: 6 or a sequence having at least 95% identity therewith, - SEQ ID NO: 7 or a sequence having at least 95% identity therewith, - SEQ ID NO: 8 or a sequence having at least 95% identity with it, - SEQ ID NO: 9 or a sequence having at least 95% identity therewith, - SEQ ID NO: 15 or a sequence having at least 95% identity with it. ci, - SEQ ID NO: 31 or a sequence having at least 95% identity therewith, - SEQ ID NO: 36 or a sequence having at least 95% identity therewith, - SEQ ID NO Or a sequence having at least 95% identity therewith, and preferably said strain further comprises one, preferably, 1, 2, 3, 4, 5 and more preferably 1 or 2 of the sequences selected from the group consisting of the sequences: SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 38 or a sequence exhibiting at least 95% of identity with these respectively, and particularly preferably, said strain is the strain deposited with the CNCM on November 19, 2010 under number CNCM I-4395. Preferably, said composition is a food composition. For the purposes of the present invention, the term "food composition" means a composition that can be incorporated into a food product, that is to say a composition that is suitable for consumption. The term "ready for consumption", a product assimilable by individual, preferably a human, in all safety, that is to say, is not likely to cause a pathology in the short term.

Preferably, said composition is formulated so as to guarantee the viability of said at least three strains, preferably at least four strains.

For the purposes of the present invention, the nucleotide sequences used as markers for L.sakei strains according to the present invention preferably correspond to a nucleotide sequence having at least 95%, 96%, 97%, 98%, 99% identity. with the sequences defined above.

By nucleotide sequence having at least 95% identity, preferably at least 96%, 97%, 98%, 99% identity with a sequence, it is meant to designate polynucleotides having, relative to the reference polynucleotide, certain modifications. as in particular a deletion, a truncation, an elongation, a chimeric fusion and / or a substitution, in particular punctual. It is preferably sequences encoding the same amino acid sequences as the reference sequence, this linked to the degeneracy of the genetic code, or complementary sequences which are capable of hybridizing specifically with the reference nucleotide sequences, preferably under conditions of high stringency.

Hybridization under high stringency conditions means that the temperature and ionic strength conditions are chosen such that they allow the maintenance of hybridization between two complementary DNA fragments. The percentages of identity to which reference is made in the context of the disclosure of the present invention are determined on the basis of an overall alignment of the sequences to be compared, that is to say on an alignment of the sequences taken in their completeness, using for example the algorithm of NEEDLEMAN and WUNSCH (J. Mol Biol 48, 443-453, 1970). This sequence comparison can be performed for example using the needle software using the parameter "Gap open" equal to 10.0, the parameter "Gap Extend" equal to 0.5, and a matrix "Blosum 62". For example, needle is available on the ebi.ac.uk world wide website under the name "Align". In a particularly preferred manner, the composition as defined above comprises at least one, preferably two, preferably three, and still more preferably four L. sakei strains selected from the group consisting of: the strains deposited with the CNCM on November 19 2010 under the following numbers: CNCM 1-4393, CNCM 1-4394, CNCM I-4395 and CNCM 1-4396.

Thus, preferably, the composition as defined above comprises at least the four L. sakei strains deposited with the CNCM under the following numbers: CNCM 1-4393, CNCM 1-4394, CNCM 1-4395 and CNCM 1-4396 .

In a particular embodiment, the composition as defined above does not comprise other L. sakei strains than the four strains as defined above. Preferably, the composition according to the present invention may comprise other preserving agents chosen from the group comprising: marinades, such as marinades made from red wine or soya, essential oils and bacteriocins. Preferably, the composition according to the present invention comprises the at least four strains at equivalent concentrations.

Preferably, said strains are present at concentrations allowing the desired reduction of target flores in the edible product. Preferably, each of said strains is present in the composition at a concentration of between 103 and 108 cfu / ml, preferably at a concentration of between 104 and 107 cfu / ml, particularly preferably at a concentration of between 105 and 106 cfu. / ml. Another aspect of the present invention relates to a method for preparing the composition according to the present invention comprising a step of culturing at least three strains, preferably at least four strains of L. sakei as defined above. before in a food composition. Preferably, said at least three strains, preferably at least four strains of L. sakei are introduced at equivalent concentrations.

Preferably, the at least three strains, preferably at least four strains of L. sakei are introduced at a concentration of between 103 and 108 cfu / ml of food composition, preferably at a concentration of between 10 4 and 10 6 cfu / ml of food composition, particularly preferably at a concentration of between 105 and 106 cfu / ml of food composition. Another aspect of the present invention relates to the use of a composition as defined above for preserving an edible product, preferably a meat product, in particular beef and more Particularly preferably beef carpaccio or ground beef and particularly preferably beef carpaccio. Preferably, the meat product is raw or undercooked. The ground beef may for example be intended to be consumed as beef tartar. The composition according to the present invention makes it possible to preserve the edible product by inhibiting the growth of certain microorganisms capable of generating an alteration of said edible product, particularly at during storage of the product.

The measurement of the alteration can be evaluated by the difference of the concentration of said microorganisms between the initial time and the final storage time, and can then be expressed in 4Logio CFU / g of edible product between the final time and the initial time. The alteration of the edible product can in certain cases generate a pathological response in an individual. By way of example of microorganisms capable of generating an alteration of the edible product, mention may be made, for example, of the Enterobacteria of the Serratia group (Serratia, Hafnia, Obesumbacterium, Rahnella), the Leuconostocs of the mesenteroides group (mesenteroides-carnosum-gasicomitatum-gelidum) , Pseudomonas selected from the species P. fragi, P. putida and P. fluorescens, and some species more specifically such as Hafnia alvei, Brochothrix thermosphacta and Weisseila viridescens The alteration is a phenomenon related to the growth of altered species and the amount of population affected by these species during storage.

For the purposes of the present invention, the term "carpaccio" means thin slices, preferably between 0.1 mm and 1 mm thick, of a raw edible product. Another aspect of the present invention relates to a method of preserving an edible product as defined above comprising a step of contacting said edible product with a composition as defined above. Preferably, said contacting step is performed before the step of packaging said edible product.

Preferably, the contacting step is carried out by soaking said edible product in a composition as defined above. Preferably, said edible product is soaked in the composition as defined above for 1 to 30 seconds, preferably 2 to 10 seconds more preferably 4 to 6 seconds and particularly preferably for 5 seconds. Alternatively, the contacting step is carried out by spraying the composition according to the present invention on said edible product.

For the purposes of the present invention, the term "spray" means the vaporization of said composition on said edible product. Alternatively, the contacting step is carried out by mixing the composition according to the present invention, preferably in freeze-dried form, with said edible product.

Preferably, the contacting step carried out by mixing the composition according to the present invention, preferably in freeze-dried form, with said edible product is carried out when said edible product is ground beef.

Preferably, the contacting step is performed after the step of slicing or chopping the edible product, preferably meat. In a particularly preferred manner, the contacting step is carried out less than 1 hour, preferably less than 30 minutes, less than 15 minutes, less than 10 minutes, less than 5 minutes and preferably less than 1 minute after step of slicing or chopping the edible product, preferably meat. Preferably, the contacting step is followed by a step of evacuation or of putting under protective atmosphere (such as an atmosphere comprising nitrogen, carbon dioxide, and oxygen) of said product edible. In a particularly preferred manner, the evacuation step is carried out less than 1 hour, preferably less than 30 minutes, less than 15 minutes, less than 10 minutes, less than 5 minutes and preferably less than 1 minute after contacting step.

Finally, the present invention relates to an edible product comprising a composition as defined above. Preferably, said edible product is chosen from meat products, in particular from a raw or slightly cooked meat product. Preferably, said meat product, in particular said raw or undercooked meat product, is a beef meat, more particularly beef carpaccio or ground beef and, in a particularly preferred manner, beef carpaccio. Ground beef may, for example, be intended to be consumed. As a beef tartar, preferably each of said strains is present in said edible product at a concentration of between 102 and 107 cfu / g of edible product, preferably at a concentration of between 102 and 106 cfu / g of edible product, particularly preferably at a concentration between 104 and 105 cfu / g of edible product. Preferably, said edible product comprises a total concentration of strains of the composition of between 102 and 109 cfu / g of edible product, preferably between 102 and 104 cfu / g and 108 cfu / g of edible product after contacting with the composition according to the present invention. Preferably, said edible product comprises a total concentration of strains of the composition of between 104 cfu / g and 108 cfu / g of edible product, preferably of between 105 cfu / g and 107 cfu / g of edible product at the cut-off date. of consumption. DESCRIPTION OF THE FIGURES FIG. 1 represents an example of Ct / CFU correspondence in which it is observed that the q-PCR data are linear and correlated with the amount of bacteria in a range of from 102 to 107 CFU / g of carpaccio. The figure also shows an example where according to the primer used, it is possible to quantify either the Hafnia alvei species, or more generally the bacterial group (Serrana) to which H. alvei is related. Each round corresponds to an experimental data, the data give a straight line.

The accuracy of 0.1 Log10 and the margin of error of 0.3 Log10 of the data obtained by q-PCR are generally lower than those known for bacterial counts carried out on culture media. Figure 2 shows the result of quantifications of different species (genera / groups). Each round gives the growth in ALogio (Logic) at Ti4j0 '' after storage under vacuum and at 8 ° C, including shock at 22 ° C for 24 hours at day 7 - Logic) at To) different species / groups / genres. Each round corresponds to an experiment (a batch of commercial carpaccio). (SER: Serratia group, HAL: Hafnia alvei species, BTH: Brochothrix thermosphacta species, WVI: Weisella viridescens species, LME: Leuconostoc genus (4 species), PSD: genus (3 species) Pseudomonas, LSA: Lactobacillus sake1 species). There is great variability from one batch to another: the Serratia group, for example, can develop, during the 14 days, from about 1.5 to about 4 Logic) for example with a median value of 2.69 Logic). Figure 3 shows the effects of the different components of the composition on the growth of the target species. These effects are measured by comparing the growth totals of the different target species or cumulative growth equivalent (CGE) (five different cumulative measurements). This CGE value is schematized in the form of circles of different colors according to the type of comparison made (the scale is expressed in IALog10 CFU / g of meat and is measured at T14 days for the various samples (see description of storage conditions in the table). legend figure 2) The median value obtained from the different batches (IALog10 CFU / g) is indicated by a number adjacent to a horizontal dash.The values of control N ° 1 (6 batches without addition of composition) can be compared with those obtained with the same batches treated with the composition of the invention with 4 strains (black circles) and with the compositions of the invention with 3 strains (gray circles, 3 lots only) The codes of the compositions of the invention with 3 strains are: A = CNCM strains I-4395, CNCM 1-4393, CNCM 1-4394, B = CNCM strains 1-4396, CNCM I4393, CNCM 1-4394, C = Strains CNCM 1-4396, CNCM I-4395 , CNCM 1-4393 and D = Strains CNCM 1-4396, CNCM I-4395, CNCM 1-43 94.

Control # 2 values (6 other lots without addition of composition) can be compared with those obtained with the same batches treated with other 4-strain compositions used during the screening process ie 3 series (denoted PPB1 to PPB3) of 7 compositions.

FIG. 4 schematizes the quantification at 14 days of the strains of the composition of the invention by q-PCR on the DNA extracted from carpaccios using primers specific for five markers. The katA marker is specific for the L. sakei species (present in all the strains, that is to say those of the composition but also those of the flora of L. sakei naturally present on the meat). The markers SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 21 and SEQ ID NO: 26 are each specific for only one of the 4 strains of the composition.

Figures 5 to 7 relate to the definition of the classes of strains in relation to the strains of the composition according to the present invention and as a function of the molecular imprint.

FIG. 6 defines classes of strains with respect to the strains of the composition of the invention and as a function of the molecular imprint with 52 markers of 4 other close strains. Figures 6 and 7 show a comparison of the molecular fingerprints between the composition of the invention with 4 strains and the other 21 compositions with 4 strains with 4 or 7 specific markers. Examples 1) Protocol for forced tampering of Beef Carpaccio The experiments were carried out on carpaccios bought on the market, and therefore naturally contaminated. a- quantification of altered bacteria naturally present in carpaccio Certain genera or species of altered bacteria were systematically present and easily quantifiable. They were therefore quantified without the need for additional addition to carpaccio (Enterobacteria of the Serratia group (including Hafnia alvei) (SER), Leuconostocs (mesenteroids-carnosum-gasicomitatum-gelidum) and Pseudomonas (fragi-putida-fluorescens) (PSD)) . b- quantification of the altering bacteria after voluntary seeding of the carpaccio On the other hand, other kinds or species of altered bacteria could be present but more difficult to quantify, or developing little, or at very variable rates. These were quantified both as natural contaminants and after voluntary seeding (Hafnia alvei, CIP57.31 strain (HAL) Brochothrix thermosphacta, INRA strain 160 * 7 (BTH), Weisseila viridescens, strain CIP102810 A voluntary inoculation protocol therefore had to be developed where a bacterial suspension of known load (in CFU / ml of suspension) was used to seed carpaccios by soaking / draining and then the load of carpaccios was measured (in CFU / g of carpaccio). abacus was used where the initial concentration of the bacterial suspension used to soak the carpaccios was sufficient to deduce the load of the carpaccio inoculated voluntarily.An alteration protocol was developed which allowed a measurable development of the different species: after inoculation by the test samples, the samples were packaged under vacuum and then placed 7 days at 8 ° C, 24 hours at 22 ° C and in 6 days at 8 ° C. 2) Quantitative measurements of the different genera / groups / bacterial species Quantitative measurements of the different genera / groups / bacterial species are generally carried out by spreading on media of more or less selective cultures.

A protocol for establishing these measurements by real-time quantitative PCR (q-PCR) has been developed. It required the development (including the specificity and efficacy test) of primers that allow the measurement of species / genera / bacterial groups from the bacterial DNA extracted from carpaccios. Once the efficacy and specificity of the primers tested, standard ranges were made to have the correspondence Ct (q-PCR data on the DNA extracted from the carpaccios) / CFU (experimental data corresponding to the number of bacteria inoculated on the standard carpaccios) (for example, quantification of Hafnia alvei CIP57.31 by qPCR, see Figure 1). The following primers were used: - for Serratia QSF01-HAL-F: TAACTTGGGAACTGCATTTGAAACTGGTC (SEQ ID NO: 43) QSF01-HAL-R: CGCCACTGGTGTTCCTCCAGATC (SEQ ID NO: 44) - for Hafnia alvei QSF02-HAL-F: ATTGGCAATTGGCGCTGAAGAAGGT ( SEQ ID NO: 45) QSF02-HAL-R: GCTCAGCCATATCAGCTGGGATC (SEQ ID NO: 46) - for Brochothrix thermosphacta: QSF01-BTH-F: ACGAACGGATAAAGAGCTTGCTCTTTTG (SEQ ID NO: 47) QSF01-BTH-R: CGAAACCGTCTTTCACTTGAACATCTTAT (SEQ ID NO: 48) QSF03-BTH-F: GGACCAGAGGTTATCGAAACATTAACTG (SEQ ID NO: 49) QSF03-BTH-R: TAATACCAGCAGCAGGAATTGCTT (SEQ ID NO: 50) - for Weisella viridescens QSF01-WVI-F: TTGCTCAGATATGACGATGGACATTGCA (SEQ ID NO: 51) QSF01-WVI-R: GACCATCTCTTAGTGATAGCAAGACCAT (SEQ ID NO: 52) - for Pseudomonas QSF01-PSD-F: GGTCTTCGGATTGTAAAGCACTTTAAGTTG (SEQ ID NO: 53) QSF01-PSD-R: GTAGTTAGCCGGTGCTTATTCTGTCG (SEQ ID NO: 54) - for Leuconostoc QSF01-LCN2-F: GTGAAAGCCCGGAGCTCAACTC (SEQ ID NO: 55) QSF01-LCN2-R: CTGGTGTTCTTCCACATATCTACGCATTC (SEQ ID NO: 56) - p Lactobacillus sakei QI1101-LSA-F: CTGGCTATCCCGATACATACC (SEQ ID NO: 57) QI1101-LSA-R: GCATATCTTGGCTACGGGCA (SEQ ID NO: 58) QI1107-LSA-F: ATCTAGTAGACTCTGAATTTAAGGT (SEQ ID NO: 59) QI1107-LSA-R: TTAACCGCTTCTAACACCTTTTGA (SEQ ID NO: 60) QI1115-LSA-F: CTCTACCTCTGAAATGTCCAAG (SEQ ID NO: 61) QI1115-LSA-R: TTTAGAGGTCTTCACCATTGTTG (SEQ ID NO: 62) QI \ 1116-LSA-F: ATTTATTCCAGCCAGCGTTTC (SEQ ID NO: 63) QI \ 1116-LSA-R: TGTGGAAAACATTCATGTACCG (SEQ ID NO: 64) QI \ 1121-LSA-F: AATTGGGTGCCTGCCGCG (SEQ ID NO: 65) IQ 1121-LSA-R: GAATAAGAGCGCGAATACGG (SEQ ID NO: 66) 3) Growth of altered carpaccio species Figure 2 shows that the experimental domain is of great variability as the growth of each species varies by one lot from Carpaccio to another. The nature of the microbial ecosystem (qualitative and quantitative) naturally present on the food is one of the major factors that influences this variability. On a set of several lots it is possible to identify growth trends for each species: eg high growth of about 3.5 Mogi () CFU / g for Hafnia alvei or low of about 0.5 Mogi () CFU / g for Weisseilla viridescens. This notion of global tendency will also be used in the measure of effectiveness of the composition. 4) Measurement of the Barrier Effect of the Compositions and the Relative Influence of Each of the Strains in the Compositions The effect of a composition can be measured directly by measuring the Mogi () CFU / g between T14 days and To for altered species. It appears that the quality of the assembly of the strains is important to fight against the alteration and that it is not enough to use a single strain of Lactobacillus sakei or to assemble at random several strains to obtain a barrier effect. 5) Verification of the Effectiveness of the Composition According to the Invention Against Alteration The concept of the most or least effective composition is defined by the minimum or maximum value obtained by cumulating all the values of Alog10 CFU / g for the altering bacteria. This arbitrary measure makes it possible to estimate the effect of a composition on all the species of alteration. Thus, an active composition against Brochothrix thermosphacta may be less active against Leuconostocs. Table 1 below shows the overall effectiveness of the composition according to the invention compared to the effectiveness of the other 21 compositions of L. sakei and control without addition of composition. The results are expressed in Mogi () CFU / g for the target species.

Enterobacteri Pseudomonadac Leuconostocs Hafnia alvei Brochothrix aceae eae (mesenteroides / ca thermospha (Serratia / Haf (fragi / putida / fluenosum) cta nia) orescens) Control no 2.07 ± 1.16 2.18 ± 0.58 3.17 ± 0.83 4.01 ± 0.46 1.77 ± 0.66 treated Composition of the inventionb 022 ± 0'68 0.13 ± 0.53 1.18 ± 0.46 2.91 ± 0.63 0.29 ± 0.47 Other 1.57 ± 0.99 0.43 ± 0.63 1.30 ± 0.32 3.98 ± 0.48 0.66 ± 0.92 compositions Table 1 a Control = 12 untreated Carpaccio samples with a natural population of L. sakei b Composition of the invention = 6 samples of Carpaccio treated with the composition of the present invention Other compositions = 21 samples of Carpaccio treated with 21 different cocktails of 4 strains of L. sakei Table 1 shows, considering the median values, that: the 21 compositions tested showed variable effects but that the median of the effects of these compositions decreased with respect to the average e observed in the absence of any composition; the composition according to the invention is more efficient than the most effective compositions among the other compositions tested. These results remain true if we consider the medians with respect to the screening step and compared to the controls (without composition). The composition according to the present invention virtually abolishes the growth of Brochothrix thermosphacta, very seriously limits that of Pseudomonas and limits that of Hafnia alvei and Serratia. FIG. 3 shows a clear overall decrease of the CGE between the control without composition (median on 6 lots of 13.8) and the control with the composition according to the present invention (median on 6 lots of 4.3). This composition is therefore more effective than the best of the other compositions tested. The results on 3 batches of the different combinations with 3 strains of the composition according to the invention show that these combinations are in average more effective than all the other combinations with 4 strains used during the screening step. A greater response amplitude is also observed with certain 3-strain combinations than with the 4-strain composition. Finally, the stability of the effects on the CGE seems more robust for the composition with 4 strains than the combinations with 3 strains among the 4. 6) Identification of the composition according to the invention The composition according to the invention has a unique molecular imprint, to select molecular markers specific to each of the strains of the composition. Precise quantification of the strains of the composition according to the present invention within a meat product such as Carpaccio is therefore possible. The katA marker (SEQ ID NO: 1), specific for the L. sakei species (present in all strains, ie those of the composition according to the present invention but also those of the naturally occurring L. sakei flora on meat) was used as a positive control. The sequence markers SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 21 and SEQ ID NO: 26 are each specific for only one of the 4 strains composing the composition according to the present invention. Figure 4 shows that: - at day 14 (T14), without addition of composition (left column) the population of L. sakei is of the order of about 103-104 CFU / g and is higher up to values of the order of approximately 5.105-106 CFU / g when at least one of the strains of the composition has been inoculated - the inoculated L. sakei strains develop, without however reaching levels likely to be altering (the max value reached with the composition of the invention is 6.3 Logio, and 6.6 Logic) to 7.1 Logic) CFU / g with mixtures with 1, 2 or 3 strains, values which are not considered as altering the use of the katA marker makes it possible to detect a larger overall population of L. sakei as soon as at least one strain of the composition is added (approximately 6 Logic) CFU / g with addition of strains against approximately 4 Logic) CFU / g without addition). the strains have each developed in a similar manner either in the composition according to the invention, for the strains alone or in the combinations of three or two of the four strains of the composition. - Ti4jou, each strain of the composition is well quantifiable thanks to its specific marker (in the combinations to one, two or three strains it is easy to identify each of the strains that was inoculated (about 5.5-7 Logio CFU / against approximately 3 to 4 Logic) CFU / g of background corresponding to the endogenous population of L. sakei). - the composition is therefore identifiable and quantifiable.

Claims (11)

REVENDICATIONS1. A composition comprising at least three different strains of L. sakei bacteria, wherein: said first strain of L. sakei bacteria comprises in its genome the following sequence: SEQ ID NO: 35 or a sequence having at least 95% identity with it, - said second strain of bacteria L. sakei comprises in its genome the following sequence: - SEQ ID NO: 21 or a sequence having at least 95% identity therewith, - said third strain of bacteria L. sakei comprises in its genome the following sequence: SEQ ID NO: 26 or a sequence having at least 95% identity therewith. 2. Composition according to claim 1, wherein said first strain of L. sakei bacteria comprises in its genome the following sequences: SEQ ID NO: 42, and SEQ ID NO: 35 or a sequence exhibiting at least 95% of identity with it, preferably said first strain of bacteria L. sakei comprises in its genome the following sequences: - SEQ ID NO: 2 or a sequence having at least 95% identity therewith, - SEQ ID NO Or a sequence having at least 95% identity therewith, - SEQ ID NO: 42, and - SEQ ID NO: 35 or a sequence having at least 95% identity therewith; said first strain of L. sakei bacteria comprises in its genome the following sequences: SEQ ID NO: 2 or a sequence having at least 95% identity therewith, SEQ ID NO: 4 or a sequence exhibiting at least 95% identity with it, - SEQ ID NO: 6 or a sequence having at least 95% identity. with it, - SEQ ID NO: 7 or a sequence having at least 95% identity therewith, - SEQ ID NO: 8 or a sequence having at least 95% identity therewith, SEQ ID NO: 9 or a sequence having at least 95% identity therewith, SEQ ID NO: 10 or a sequence having at least 95% identity therewith, SEQ ID NO: 13 or a sequence having at least 95% identity therewith, - SEQ ID NO: 15 or a sequence having at least 95% identity therewith, - SEQ ID NO: 19 or a sequence exhibiting at least 95% identity therewith, - SEQ ID NO: 32 or a sequence having at least 95% identity therewith, - SEQ ID NO: 34 or a sequence having at least 95% identity with this, - SEQ ID NO: 42, - SEQ ID NO: 35 or a sequence having at least 95% identity therewith, - SEQ ID NO: 36 or a sequence having at least 95% identity with this, and SEQ ID NO: 38 or a accordingly having at least 95% identity therewith. 3. Composition according to claim 1 or 2, wherein said second strain of L. sakei bacteria comprises in its genome the following sequences: SEQ ID NO: 21 or a sequence having at least 95% identity therewith, and SEQ ID NO: 40 or a sequence having at least 95% identity therewith; preferably, said second strain of L. sakei bacteria comprises in its genome the following sequences: SEQ ID NO: 16 or a sequence having at least 95% identity therewith; SEQ ID NO: 17 or a sequence having at least 95% identity therewith, - SEQ ID NO: 21 or a sequence having at least 95% identity therewith, and - SEQ ID NO: 40 or a sequence having at least 95% identity with it; preferably, said second strain of L. sakei bacteria comprises in its genome the following sequences: SEQ ID NO: 4 or a sequence having at least 95% identity therewith; SEQ ID NO: 8 or a sequence presenting at least 95% identity therewith; - SEQ ID NO: 9 or a sequence having at least 95% identity therewith; - SEQ ID NO: 11 or a sequence having at least 95% identity; identity therewith, - SEQ ID NO: 12 or a sequence having at least 95% identity therewith, - SEQ ID NO: 16 or a sequence having at least 95% identity therewith, SEQ ID NO: 17 or a sequence having at least 95% identity therewith; SEQ ID NO: 20 or a sequence having at least 95% identity therewith; SEQ ID NO: 21 or a sequence having at least 95% identity therewith, - SEQ ID NO: 36 or a sequence having at least 95% identity therewith, - SEQ ID NO: 38 or a sequence p with at least 95% identity therewith, - SEQ ID NO: 40 or a sequence having at least 95% identity therewith, preferably said strain further comprises one, preferably, 2, 3 , 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and more preferably 7, 8, 9, 10, 11, 12 sequences selected from the group consisting of the sequences: SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 24, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 37, and SEQ ID NO: 41 or a sequence having at least 95% identity therewith respectively. 4. Composition according to any one of claims 1 to 3, wherein said third strain of L. sakei bacteria comprises in its genome the following sequences: SEQ ID NO: 23 or a sequence having at least 95% identity with and, - SEQ ID NO: 26 or a sequence having at least 95% identity therewith, preferably said third strain of L. sakei bacteria comprises in its genome at least the following sequences: SEQ ID NO: 22 or a sequence having at least 95% identity therewith, - SEQ ID NO: 23 or a sequence having at least 95% identity therewith, and - SEQ ID NO: 26 or sequence having at least 95% identity therewith, preferably said third strain of L. sakei bacteria comprises in its genome at least the following sequences: SEQ ID NO: 7 or a sequence exhibiting at least 95% of identity therewith, - SEQ ID NO: 13 or a sequence presenting at least 95% identity therewith, - SEQ ID NO: 15 or a sequence having at least 95% identity therewith, - SEQ ID NO: 20 or a sequence having at least 95% identity with it, - SEQ ID NO: 22 or a sequence having at least 95% identity therewith, - SEQ ID NO: 23 or a sequence having at least 95% identity therewith, SEQ ID NO: 26 or a sequence having at least 95% identity therewith, and preferably said strain further comprises one, preferably, 2, 3, 4, 5, 6, 7, 8, 9, 10 , 11, 12, 13, 14 or 15 and even more preferentially 5, 6, 7, 8, 9 of the sequences selected from the group consisting of the sequences: SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9 , SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, and SEQ ID NO: 41 or a sequence having at least 95% identity therewith nt. 5. Composition according to any one of claims 1 to 4, further comprising at least a fourth strain of L. sakei different from said first, second and third strains as defined in any one of claims 1 to 4. The composition according to claim 5, wherein said fourth strain of L. sakei bacteria comprises in its genome at least the sequence SEQ ID NO: 39 or a sequence having at least 95% identity therewith. 7. Composition according to any one of claims 5 or 6, wherein said fourth strain comprises in its genome at least the following sequences: - SEQ ID NO: 4 or a sequence having at least 95% identity with it - SEQ ID NO: 6 or a sequence having at least 95% identity therewith, - SEQ ID NO: 7 or a sequence having at least 95% identity therewith, - SEQ ID NO: 8 or a sequence having at least 95% identity therewith, - SEQ ID NO: 9 or a sequence having at least 95% identity therewith, - SEQ ID NO: 15 or a sequence presenting at least minus 95% identity therewith, - SEQ ID NO: 31 or a sequence having at least 95% identity therewith, - SEQ ID NO: 36 or a sequence having at least 95% identity with it, - SEQ ID NO: 39 or a sequence having at least 95% identity therewith, and preferably said strain further comprises one, preferably e, 1, 2, 3, 4, 5 and even more preferably 1 or 2 of the sequences selected from the group consisting of the sequences: SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 19, SEQ ID NO: 32 and SEQ ID NO: 38 or a sequence having at least 95% identity therewith respectively. 8. Composition according to any one of the preceding claims, comprising at least the four L. sakei strains deposited with the CNCM under the following numbers: CNCM 1-4393, CNCM 1-4394, CNCM 1-4395 and CNCM 1- 4396. 9. Use of a composition as defined in any one of claims 1 to 8, for the preservation of an edible product, preferably a meat product, in particular beef and more particularly the carpaccio of beef or ground beef and particularly preferably beef carpaccio 10. A method of preserving an edible product comprising a step of contacting said edible product with a composition as defined according to any one of claims 1 to 8. An edible product comprising a composition as defined according to any one of claims 1 to 8.