FR2960552A1

FR2960552A1 - Genotyping Legionella pneumophila comprises coamplifying variable-number-tandem-repeats loci in medium having L. pneumophila DNA sample, analyzing amplicon and assigning numerical multiple locus variable number tandem repeat analysis code

Info

Publication number: FR2960552A1
Application number: FR1054237A
Authority: FR
Inventors: Benoit Lebeau; Fabienne Loisy-Hamon; Daniel Sobral; Christine Pourcel
Original assignee: CENTRE EUROPEEN D'EXPERTISE ET DE RECHERCHE SUR LES AGENTS MICROBIENS - CEERAM; CT EUROP D EXPERTISE ET DE RECH SUR LES AGENTS MICROBIENS CEERAM; Centre National de la Recherche Scientifique CNRS
Current assignee: Centre Europeen dExpertise et de Recherche sur Les Agents Microbiens CEERAM
Priority date: 2010-06-01
Filing date: 2010-06-01
Publication date: 2011-12-02
Anticipated expiration: 2030-06-01
Also published as: FR2960552B1

Abstract

Method for genotyping Legionella pneumophilaby multiple-locus variable number tandem repeat analysis (MLVA) comprises: (i) carrying out a coamplification of at least ten variable-number-tandem-repeats (VNTR) loci by multiplex PCR in a reaction medium comprising a DNA sample of Legionella pneumophilato form many amplicons for each of the ten VNTR loci; (ii) analyzing the amplicons by capillary electrophoresis to obtain an electrophoretic profile of the sample; and (iii) assigning a numerical MLVA code to the electrophoretic profile. An independent claim is included for kit for genotyping Legionella pneumophilacomprising: the reaction medium containing at least eight labeled sense primers and at least eight antisense primers, forming at least eight pairs of sense/antisense primers to each of which represents a specific VNTR locus and different for each of the eight primer pairs, each of the eight sense primers hybridizing upstream of the respective locus and each of the eight anti-sense primers hybridizing downstream of its respective locus; amplification mix; and optionally a positive control and a false negative control, so validate the result and get rid of positive-false or negative-false.

Description

La présente invention concerne un procédé de typage automatisé et discriminant de Legionella pneumophila, Un autre but de la présente invention se rapporte à un kit pour la mise en oeuvre du procédé susmentionné. Legionella, bacille à Gram négatif, strictement aérobie, acapsulé et non sporulant, est l'agent étiologique de la Iégionellose, maladie respiratoire dont la forme la plus grave se traduit par une pneumopathie aigue parfois mortelle. Cette bactérie hydro-tellurique présente la particularité de coloniser aussi bien les eaux naturelles que les milieux hydriques artificiels comme les circuits des tours aéroréfrigérantes ou les réseaux d'eaux chaudes sanitaires. Bien que la bactérie soit souvent présente dans ce type d'écosystème, ce n'est qu'en 1977, suite à l'épidémie de Philadelphia de 1976, qu'elle a été caractérisée pour la première fois. Maladie à déclaration obligatoire depuis 1987 en France, la légionellose a été diagnostiquée chez 1244 patients en 2008, soit près de 5% des pneumopathies communautaires, avec un taux de létalité de 11%. The present invention relates to a method for automated and discriminating typing of Legionella pneumophila. Another object of the present invention relates to a kit for carrying out the aforementioned method. Legionella, a gram-negative, strictly aerobic, acapsulated and non-sporulating bacillus, is the etiologic agent of the illegionellosis, a respiratory disease whose most severe form results in acute and sometimes fatal pneumonitis. This hydro-telluric bacterium has the peculiarity of colonizing natural waters as well as artificial water environments such as circuits of cooling towers or networks of hot sanitary water. Although the bacterium is often present in this type of ecosystem, it was not until 1977, following the Philadelphia epidemic of 1976, that it was characterized for the first time. A notifiable disease since 1987 in France, legionellosis was diagnosed in 1244 patients in 2008, accounting for nearly 5% of community-acquired pneumonia, with a case-fatality rate of 11%.

La contamination a lieu par voie aérienne, suite à l'inhalation de fines particules d'eau contaminée aérosolisées et véhiculées par l'air. Les facteurs de risque sont liés à l'âge, au sexe (maladie plus fréquente chez les hommes), au tabagisme, à l'éthylisme, aux états d'immunodépression, à l'existence d'affections respiratoires chroniques ainsi qu'au mode de vie (séjours prolongés ou fréquents dans des lieux climatisés, dans des centres de soins...). Le genre Legionella compte 48 espèces mais l'espèce Legionella pneumophila est responsable à elle seule de plus de 98% des légionelloses. L'espèce L. pneumophila comprend trois sous-espèces (pneumophila, fraseri et pasculei) et quinze sérogroupes. Bien qu'aucun lien n'ait été démontré entre le sérogroupe et un historique génétique particulier, Legionella pneumophila subsp pneumophila sérogroupe 1 est incriminée dans plus de 95% des pneumopathies à Legionella. A l'inverse, d'autres espèces comme L. anisa, L. miedadei, L. dumoffii ou L. feeleii sont rarement pathogènes pour l'homme bien qu'elles soient fréquemment rencontrées dans les réseaux d'eau chaude. Contamination takes place by air, following the inhalation of fine particles of aerosolized and air-borne contaminated water. Risk factors are related to age, sex (more common in men), smoking, alcoholism, immunosuppression states, chronic respiratory conditions, and of life (prolonged or frequent stays in air-conditioned places, in health centers ...). The genus Legionella has 48 species, but Legionella pneumophila alone accounts for more than 98% of Legionella infections. L. pneumophila comprises three subspecies (pneumophila, fraseri and pasculei) and fifteen serogroups. Although no link has been demonstrated between the serogroup and a particular genetic history, Legionella pneumophila subsp pneumophila serogroup 1 is incriminated in more than 95% of Legionella pneumonia. Conversely, other species such as L. anisa, L. miedadei, L. dumoffii or L. feeleii are rarely pathogenic for humans although they are frequently found in hot water systems.

L'extraordinaire capacité d'adaptation développée par Legionella pneumophila ainsi que la multiplicité des milieux colonisés rendent difficile la compréhension d'apparition de foyers épidémiques de légionellose. Une enquête épidémiologique approfondie doit être entreprise afin d'identifier la source de la contamination et de suivre le pathogène incriminé. Pour répondre à ce besoin, il est nécessaire de savoir distinguer les différentes souches au sein de l'espèce considérée. The extraordinary adaptability developed by Legionella pneumophila and the multiplicity of colonized environments make it difficult to understand the occurrence of epidemic foci of Legionnaires' disease. A thorough epidemiological investigation should be undertaken to identify the source of the contamination and to track the pathogen. To meet this need, it is necessary to be able to distinguish the different strains within the species considered.

ETAT DE LA TECHNIQUE L'utilisation récente de techniques de typage moléculaire faisant appel aux méthodes d'empreintes génétiques (DNA fingerprinting) a augmenté considérablement la puissance des méthodes de typage bactérien qui, traditionnellement, se fondaient sur l'utilisation de marqueurs phénotypiques peu discriminants et à la reproductibilité médiocre. Avant l'ère du séquençage en masse des génomes bactériens, les techniques moléculaires de génotypage reposaient sur la détection par hybridation de séquences d'insertion (IS-RFLP : polymorphisme de longueur des fragments de restriction de séquence d'insertion), d'amplification PCR (amplification en chaîne par polymérase) au hasard (RAPD : Amplification au hasard d'ADN polymorphe, AFLP : polymorphisme de longueur de fragments amplifiés) ou de différences à des sites de restriction (PFGE). La PFGE ou Electrophorèse sur gel en champ pulsé repose sur l'analyse des profils de macrorestriction de l'ADN total par électrophorèse en champ pulsé. Le résultat est un profil de restriction définissant un pulsotype caractérisant l'isolat bactérien étudié. La PFGE demeure la technique de typage standard pour de nombreuses espèces bactériennes dont L. pneumophila. En effet, cette méthode présente un pouvoir de discrimination élevé estimé à plus de 96% pour cette bactérie. Cependant, la PFGE est en cours d'abandon dans les laboratoires de biologie moléculaire en raison de ses nombreux inconvénients techniques et pratiques : la technique est longue, couteuse et difficile à mettre en oeuvre. L'inconvénient majeur reste le manque de reproductibilité inter-laboratoire et le défaut évident de standardisation des résultats obtenus. Au cours de la dernière décennie, la disponibilité croissante des séquences génomiques complètes de nombreuses bactéries pathogènes a permis de développer de nouvelles techniques. L'une d'entres elles, le SBT «typage à base de séquences» est préconisée comme technique de typage de référence pour L. pneumophila par le Groupe de Travail Européen sur les Infections à Legionella (EWGLI). Cette méthode est basée sur le polymorphisme de séquences de plusieurs loci indépendants (généralement six ou sept) qui présentent des variations intra-spécifiques. Chaque locus d'intérêt est séquencé puis l'allèle identifié est associé à un caractère numérique. Ainsi, pour chaque souche, le profil allèlique représentant le génotype ou «séquence type» est défini par un code numérique. Le typage par SBT permet donc facilement l'échange des données produites dans différents laboratoires. Ces échanges sont facilités par l'existence d'une base publique pour les données de typage de L. pneumophila par SBT mise en place par l'EWGLI. STATE OF THE ART The recent use of molecular typing techniques using DNA fingerprinting methods has greatly increased the power of bacterial typing methods which, traditionally, were based on the use of phenotypic markers with low discrimination. and poor reproducibility. Prior to the era of mass sequencing of bacterial genomes, molecular genotyping techniques relied on the detection by hybridization of insertion sequences (IS-RFLP: insertion fragment length fragment length polymorphism), amplification Random PCR (Polymerase chain reaction) (RAPD: random amplification of polymorphic DNA, AFLP: amplified fragment length polymorphism) or restriction site differences (PFGE). PFGE or pulsed field gel electrophoresis is based on the analysis of macrorestriction profiles of total DNA by pulsed-field gel electrophoresis. The result is a restriction profile defining a pulsotype characterizing the bacterial isolate studied. PFGE remains the standard typing technique for many bacterial species, including L. pneumophila. Indeed, this method has a high discrimination power estimated at more than 96% for this bacterium. However, PFGE is being abandoned in molecular biology laboratories because of its many technical and practical drawbacks: the technique is long, expensive and difficult to implement. The major disadvantage remains the lack of inter-laboratory reproducibility and the obvious lack of standardization of the results obtained. In the last decade, the increasing availability of complete genomic sequences for many pathogenic bacteria has allowed new techniques to be developed. One of them, SBT "sequence-based typing" is recommended as a reference typing technique for L. pneumophila by the European Legionella Infections Working Group (EWGLI). This method is based on the sequence polymorphism of several independent loci (usually six or seven) that exhibit intraspecific variations. Each locus of interest is sequenced and then the identified allele is associated with a numeric character. Thus, for each strain, the allelic profile representing the genotype or "sequence" is defined by a numerical code. Typing by SBT therefore makes it easy to exchange data produced in different laboratories. These exchanges are facilitated by the existence of a public database for L. pneumophila typing data by SBT set up by EWGLI.

Dès 2005, Gaia et col. (J. Clin. Microbiol 2005, 43, pp 2047-2052) proposent un protocole de typage des isolats de Legionella pneumophila par SBT avec six loci. Cette technique s'avère reproductible et presque aussi discriminante que celles classiquement utilisées, notamment l'électrophorèse par champ pulsé. Cependant, l'indice de discrimination de ce protocole (0.926) reste en deçà des recommandations du groupe d'étude sur les marqueurs épidémiologiques (l'ESGEM) qui considère que, pour une technique de typage performante, testée sur une collection de référence, cet indice doit être supérieur à 0.95. Ainsi, en 2007, Ratzow et col. (J. Clin. Microbiol 2007,45, pp 1965-1968) préconisent l'ajout d'un septième locus au protocole initial afin de définir un protocole de typage par SBT à sept loci qui permet d'obtenir un indice de 0.961. Cependant, l'application en routine du typage par SBT dans les laboratoires de biologie moléculaire n'est pas encore envisageable. En effet, le typage d'un isolat comprend l'amplification et le séquençage de 7 fragments PCR (sens et anti-sens pour chaque locus étudié aboutissant à l'obtention de 14 séquences), cette méthode reste donc encore très couteuse, fastidieuse et longue (le résultat de typage SBT d'un isolat est assuré en 12 heures avec un séquenceur 4-capillaires). Récemment, un protocole MLVA ou « Analyse de plusieurs locus VNTR (Répétition en tandem polymorphe) » sur Legionella pneumophila décrivant l'analyse du polymorphisme de répétitions de huit loci VNTR a été publié (Pourcel et al., J. Clin. Microbiol.2003,41, pp 1819-1826 et Pourcel et al., J. Clin. Microbiol 2007, 45, pp 1190-1199). Les VNTRs sont des répétitions en tandem présentant un polymorphisme intra-espèce du nombre de répétitions justifiant ainsi leur utilisation comme marqueurs moléculaires. Les répétitions en tandem sont des séquences génomiques, présentes dans les régions codantes ou intergéniques, caractérisées par la répétition d'un motif nucléotidique élémentaire. Ces séquences sont également souvent appelées microsatellites lorsque le motif répété comprend moins de 9 paires de bases et minisatellite lorsque le motif répété comprend 9 paires de base et plus. Le génotypage par MLVA repose sur l'amplification par PCR de ces régions ciblées, dispersées sur le génome bactérien, à l'aide d'amorces spécifiques des régions flanquantes, et sur la détermination des tailles des amplicons par électrophorèse permettant d'évaluer le nombre de répétitions à un locus donné. Les motifs répétés peuvent compter de une à plus de cent paires de bases et la taille des amplicons varie de quelques dizaines à plus de mille nucléotides. La longueur des unités répétées étant connue, ces tailles reflètent le nombre de séquences répétées dans les régions amplifiées. Cette méthode d'empreintes génétiques augmente considérablement, pour certaines espèces, la puissance des méthodes de génotypage bactérien. Le résultat du typage est un code numérique incluant le nombre de motifs à chaque locus. Ce type de génotypes numériques, dont l'interprétation est facilitée, est parfaitement adapté aux études comparatives intra et inter laboratoire menées dans le cadre d'un suivi ou d'une enquête épidémiologique. Dans cette publication de Pourcel et coll. ( J. Clin. Microbiol 2007, 45, pp 1190-1199), le typage par MLVA est réalisé sur un panel d'une centaine de souches. La plupart des critères de performance relatifs à une excellente technique de typage ont été satisfaits : stabilité des marqueurs utilisés, typabilité excellente (supérieure à 98%), reproductibilité parfaite et pouvoir de discrimination élevé (similaire à celui du SBT à six loci). Dans cette étude, l'analyse des tailles des loci a été réalisée par électrophorèse sur gel d'agarose. Toutefois, il paraît difficile d'envisager d'entreprendre le typage systématique par MLVA des nouveaux isolats identifiés dans un contexte de suivi épidémiologique en utilisant le même support. En effet, le développement d'appareillages dédiés doit obligatoirement être envisagé pour ce procédé. As early as 2005, Gaia et al. (J. Clin Microbiol 2005, 43, pp 2047-2052) propose a protocol for typing Legionella pneumophila isolates by SBT with six loci. This technique proves reproducible and almost as discriminating as those conventionally used, in particular pulsed field electrophoresis. However, the discrimination index of this protocol (0.926) remains below the recommendations of the study group on epidemiological markers (ESGEM) which considers that, for a successful typing technique, tested on a reference collection, this index must be greater than 0.95. Thus, in 2007, Ratzow et al. (J. Clin Microbiol 2007, 45, pp 1965-1968) recommend the addition of a seventh locus to the initial protocol in order to define a seven-loci SBT typing protocol that makes it possible to obtain an index of 0.961. However, the routine application of SBT typing in molecular biology laboratories is not yet possible. Indeed, the typing of an isolate includes the amplification and sequencing of 7 PCR fragments (sense and antisense for each locus studied resulting in 14 sequences), so this method is still very expensive, tedious and long (the result of SBT typing of an isolate is ensured in 12 hours with a 4-capillary sequencer). Recently, an MLVA protocol or "Multiple Tandem Repetition VNTR Locus" Test on Legionella pneumophila describing the repeat polymorphism analysis of eight VNTR loci has been published (Pourcel et al., J. Clin Microbiol.2003). , 41, pp 1819-1826 and Pourcel et al., J. Clin Microbiol 2007, 45, pp 1190-1199). VNTRs are tandem repeats with an intra-species polymorphism of the number of repeats, thus justifying their use as molecular markers. Tandem repeats are genomic sequences, present in coding or intergenic regions, characterized by the repetition of an elementary nucleotide motif. These sequences are also often referred to as microsatellites when the repeating unit comprises less than 9 base pairs and minisatellite when the repeating unit comprises 9 base pairs and more. MLVA genotyping is based on the PCR amplification of these targeted regions, dispersed on the bacterial genome, using specific primers of the flanking regions, and on the size determination of the amplicons by electrophoresis to evaluate the number repetitions at a given locus. The repeating units may range from one to more than one hundred base pairs and the size of the amplicons ranges from a few tens to more than one thousand nucleotides. The length of the repeating units being known, these sizes reflect the number of repeated sequences in the amplified regions. This method of genetic fingerprinting considerably increases, for some species, the power of bacterial genotyping methods. The result of the typing is a numerical code including the number of patterns at each locus. This type of digital genotype, whose interpretation is facilitated, is perfectly adapted to intra and inter laboratory comparative studies carried out as part of a follow-up or epidemiological survey. In this publication by Pourcel et al. (J. Clin Microbiol 2007, 45, pp 1190-1199), MLVA typing is performed on a panel of about one hundred strains. Most of the performance criteria for an excellent typing technique were met: stability of the markers used, excellent typability (greater than 98%), perfect reproducibility and high discrimination (similar to that of the six-lobed SBT). In this study, loci size analysis was performed by agarose gel electrophoresis. However, it seems difficult to envisage MLVA systematic typing of new isolates identified in an epidemiological monitoring context using the same support. Indeed, the development of dedicated equipment must be considered for this process.

La nécessité d'un développement d'une nouvelle méthode de typage moléculaire s'impose donc pour permettre la réalisation d'un typage bactérien de Legionella pneumophila discriminant à haut-débit, de routine et à moindre coût. The need for the development of a new molecular typing method is therefore necessary to allow the carrying out of a bacterial typing of Legionella pneumophila discriminant at high speed, routine and at a lower cost.

RESUME DE L'INVENTION SUMMARY OF THE INVENTION

La présente invention a pour but un nouveau procédé de génotypage de l'espère Legionella pneumophila par qui évite tout ou partie des inconvénients précités, et notamment qui permette un typage automatique, rapide, au pouvoir de discrimination élevé, reproductible et à haut-débit de Legionella pneumophila dans le cadre d'une application en typage de routine. The aim of the present invention is to provide a new method of genotyping the Legionella pneumophila that avoids all or some of the aforementioned drawbacks, and in particular that allows automatic, rapid typing with high discrimination, reproducible and high-throughput discrimination. Legionella pneumophila as part of a routine typing application.

A cet effet, l'invention a pour objet un procédé de génotypage de l'espère Legionella pneumophila par MLVA comprenant les étapes consistant à : (i) réaliser une co-amplification d'au moins huit loci VNTRs par PCR multiplexe dans un milieu réactionnel comprenant un échantillon d'ADN de Legionella pneumophila afin de former plusieurs amplicons pour chacun des huit loci VNTRs, (ii) analyser lesdits amplicons par électrophorèse capillaire afin d'obtenir un profil électrophorétique dudit échantillon, et (iii) attribuer un code numérique MLVA audit profil électrophorétique. La présente invention repose sur la technique de typage MLVA combinée à une PCR multiplexe apte à co-amplifier au moins huit loci VNTRs en une seule fois, en une seule étape. En effet, la présente invention représente le premier procédé de typage du pathogène Legionella pneumophila par une seule réaction de PCR, et est le seul procédé ayant dépassé le multiplexage de plus de huit VNTRs pour un typage par MLVA. Jusqu'à présent, il était possible de co-amplifier maximum quatre loci VNTRs mais pas au moins huit. Le procédé selon l'invention représente donc une réelle avancée technologique. Par définition, le terme de "PCR multiplexe" désigne une mise au point de la technique PCR autorisant l'amplification, en une seule réaction, de plusieurs segments d'ADN distincts. Le premier avantage de cette adaptation technique est la réduction du coût et la diminution du temps de réalisation et d'analyse des résultats. La réalisation d'une PCR multiplexe s'opposant à de nombreuses contraintes techniques. To this end, the subject of the invention is a method for genotyping Legionella pneumophila by MLVA, comprising the steps of: (i) co-amplifying at least eight VNTRs by multiplexed PCR in a reaction medium comprising a DNA sample of Legionella pneumophila to form a plurality of amplicons for each of the eight VNTRs, (ii) analyzing said amplicons by capillary electrophoresis to obtain an electrophoretic profile of said sample, and (iii) assigning a MLVA numerical code to said electrophoretic profile. The present invention is based on the MLVA typing technique combined with a multiplex PCR capable of co-amplifying at least eight VNTRs loci at one time, in a single step. Indeed, the present invention represents the first method of typing the pathogen Legionella pneumophila by a single PCR reaction, and is the only method that has gone beyond the multiplexing of more than eight VNTRs for MLVA typing. Until now, it was possible to co-amplify up to four VNTRs but not at least eight. The method according to the invention therefore represents a real technological advance. By definition, the term "multiplex PCR" refers to a development of the PCR technique allowing the amplification, in a single reaction, of several distinct DNA segments. The first advantage of this technical adaptation is the reduction of the cost and the reduction of the time of realization and analysis of the results. The realization of a multiplex PCR opposing many technical constraints.

Ainsi, un des intérêts du procédé de l'invention réside dans l'identification d'un produit PCR multiplexe, comme l'allèle de VNTRs connus. Il n'est pas judicieux d'analyser le résultat de la PCR multiplexe sous forme d'un profil de bandes, souvent peu reproductibles et dont la standardisation est hasardeuse. Le procédé selon l'invention a donc été conçu pour une application du typage avec analyse des fragments amplifiés par électrophorèse capillaire et validés sur les appareils de type Applied Biosystems Genetic Analyser 3100-Avant, 3130, 3130x1 et 3500. En outre, la technique MVLA employée avec la PCR multiplexe permet un typage précis de la souche identifiée et convient également parfaitement à des études comparatives fines entre souches bactériennes dans un délai très court (moins de quatre heures). Par conséquent, le présent demandeur a ainsi trouvé une méthode permettant un génotypage du pathogène Legionella pneumophila à un coût suffisamment réduit pour envisager sa large utilisation dans les laboratoires de microbiologie en test de premier rang. En particulier, le code numérique MLVA de l'étape (iii) est obtenu automatiquement par informatique. Thus, one of the advantages of the method of the invention lies in the identification of a multiplexed PCR product, such as the known VNTRs allele. It is not advisable to analyze the result of the multiplex PCR in the form of a profile of bands, often not very reproducible and whose standardization is risky. The method according to the invention was therefore designed for an application of typing with analysis of fragments amplified by capillary electrophoresis and validated on devices of the Applied Biosystems Genetic Analyzer 3100-Avant, 3130, 3130x1 and 3500 type. In addition, the MVLA technique used with multiplex PCR allows accurate typing of the strain identified and is also ideally suited for fine comparative studies between bacterial strains in a very short time (less than four hours). Therefore, the present applicant has thus found a method for genotyping the pathogen Legionella pneumophila at a cost sufficiently reduced to consider its wide use in microbiology laboratories in first rank test. In particular, the MLVA numerical code of step (iii) is obtained automatically by computer.

De préférence, le code numérique MLVA de l'étape (iii) est obtenu à partir de logiciel d'analyse de fragments ou de génotypage. Le profil électrophorétique obtenu peut être analysé avec plusieurs logiciels différents disponibles en libre accès (Peak Scanner, CLC Sequence Viewer®,...). Cependant, le traitement des données électrophorétiques ainsi que l'automatisation des résultats de typage sont possible par l'utilisation du logiciel Genemapper® (Applied Biosystems). En particulier, ce logiciel peut être associé à trois fichiers (figures 6 à 8) mis au point par le demandeur afin d'obtenir le code numérique MLVA automatiquement. Ces fichiers sont ainsi à importer sous GeneMapper®, qui décrivent les différents paramètres à ajuster et les données à interpréter afin qu'un utilisateur non initié puisse obtenir simplement le code MLVA de la souche typée avec pour chaque locus un indice indiquant le degré de confiance attribué à la valeur associée (nombre de motifs répétés pour le VNTR considéré). Ainsi, le fichier nommé «MLVA analysis.xml » (figure 6.1 à 6.5) permet le traitement des données analysées selon des critères définis et les fichiers nommés «MLVA management A.txt » (figure 7) et « MLVA management B.txt » (figure 8.1 à 8.2) compilent l'ensemble des données recueillies sur les différents allèles associés à chaque marqueur défini par une gamme de taille et de couleur. Ces fichiers sont décrits explicitement dans les figures 6.1 à 8.2. Par conséquent, le présent procédé présente l'avantage de permettre un typage automatique, rapide, au pouvoir de discrimination élevé, reproductible et à haut-débit de Legionella pneumophila dans le cadre d'une application en typage de routine. Or, au vu de l'état de la technique actuel, il n'était pas évident pour un homme du métier de mettre au point une technique permettant l'obtention de l'ensemble de ces avantages. Preferably, the MLVA digital code of step (iii) is obtained from fragment analysis or genotyping software. The electrophoretic profile obtained can be analyzed with several different software available in open access (Peak Scanner, CLC Sequence Viewer®, ...). However, the processing of electrophoretic data as well as the automation of typing results is possible through the use of Genemapper® software (Applied Biosystems). In particular, this software can be associated with three files (Figures 6 to 8) developed by the applicant to obtain the digital code MLVA automatically. These files are thus imported under GeneMapper®, which describe the various parameters to be adjusted and the data to be interpreted so that an uninitiated user can simply obtain the MLVA code of the typed strain with, for each locus, an index indicating the degree of confidence. assigned to the associated value (number of repeated reasons for the VNTR considered). Thus, the file named "MLVA analysis.xml" (figure 6.1 to 6.5) allows the processing of analyzed data according to defined criteria and the files named "MLVA management A.txt" (Figure 7) and "MLVA management B.txt" (Figure 8.1 to 8.2) compile all the data collected on the different alleles associated with each marker defined by a range of size and color. These files are described explicitly in Figures 6.1 to 8.2. Therefore, the present method has the advantage of allowing automatic, rapid typing at the high, reproducible and high-throughput discrimination of Legionella pneumophila in a routine typing application. However, in view of the current state of the art, it was not obvious for a person skilled in the art to develop a technique for obtaining all of these benefits.

Avantageusement, le milieu réactionnel de l'étape (i) comprend : au moins huit amorces sens marquées et au moins huit amorces anti-sens, formant au moins huit couples d'amorces senslanti-sens pour chacun desquels corresponde un locus VNTR spécifique et différent pour chacun des huit couples d'amorces, chacune des huit amorces sens s'hybridant en amont de son locus respectif et chacune des huit amorces anti-sens s'hybridant en aval de son locus respectif. Par définition les amorces sens et anti-sens sont des séquences oligonucléotidiques capables de s'hybrider de façon spécifique, grâce à la complémentarité des bases, respectivement sur le brin d'ADN anti-sens i.e. le brin non codant transcrit et sur le brin d'ADN sens i.e. le brin codant non transcrit. Selon une caractéristique de l'invention, les au moins huit amorces sens sont marquées par un fluorophore en 5'. Préférentiellement, le fluorophore est choisi parmi : 6-FAMTM, NEDTM, 10 PETTM ou VICTM (Applied Biosystems). Chacune des amorces sens est donc marquée avec un fluorophore défini par un spectre d'excitation unique et permet alors d'associer un VNTR donné à une gamme de couleur ou de motifs lors de la visualisation des profils électrophorétiques. De plus, les amorces sens et anti-sens ont été élaborées de telle sorte que 15 chaque VNTR soit associé à une gamme de taille connue. Ainsi, un plan de multiplexage calibré par les deux dimensions spectrale, assurée par le marquage des amplicons, et spatiale, garanti par le choix pertinent des amorces, permet d'identifier d'une manière unique chaque VNTR (voir le plan de multiplexage Figure 1). De manière préférée, le milieu réactionnel comprend en outre huit amorces 20 sens supplémentaires non marquées. En particulier, le ratio : amorces sens non marquées sur amorces anti-sens est de l'ordre de 2/3 et le ratio : amorces sens marquées sur amorces anti-sens est de l'ordre de 1/3. De manière avantageuse, les au moins huit couples d'amorces respectivement 25 anti-sens /sens des huit loci VNTRs sont choisis parmi : SEQ ID NO :1 /SEQ ID NO :2 ; SEQ ID NO :3/ SEQ ID NO :4 ; SEQ ID NO :5/ SEQ ID NO :6 ; SEQ ID NO :7/ SEQ ID NO :8 ; SEQ ID NO :9/ SEQ ID NO :10 ; SEQ ID NO :11/ SEQ ID NO :12 ; SEQ ID NO :13/ SEQ ID NO :14 ; SEQ ID NO :15/ SEQ ID NO :16; SEQ ID NO : 17/ SEQ ID NO :18; SEQ ID NO : 19/ SEQ ID NO :20; SEQ ID NO : 21/ 30 SEQ ID NO : 22; SEQ ID NO : 23/ SEQ ID NO : 24. Selon un mode de réalisation préféré, est réalisée à l'étape (i), une coamplification de dix loci VNTRs par PCR multiplexe. Advantageously, the reaction medium of step (i) comprises: at least eight sense-sense primers and at least eight antisense primers, forming at least eight pairs of senslanti-sense primers for each of which corresponds to a specific and different VNTR locus for each of the eight pairs of primers, each of the eight sense primers hybridizing upstream of its respective locus and each of the eight antisense primers hybridizing downstream of its respective locus. By definition, the sense and antisense primers are oligonucleotide sequences capable of hybridizing in a specific way, thanks to the complementarity of the bases, respectively on the antisense DNA strand ie the transcribed non-coding strand and on the strand of the DNA sense ie the non-transcribed coding strand. According to one characteristic of the invention, the at least eight sense primers are labeled with a 5 'fluorophore. Preferably, the fluorophore is chosen from: 6-FAMTM, NEDTM, PETTM or VICTM (Applied Biosystems). Each of the sense primers is therefore labeled with a fluorophore defined by a single excitation spectrum and then makes it possible to associate a given VNTR with a range of color or patterns during the visualization of the electrophoretic profiles. In addition, sense and antisense primers have been developed such that each VNTR is associated with a known size range. Thus, a multiplexing plan calibrated by the two spectral dimensions, ensured by the marking of the amplicons, and spatial, guaranteed by the relevant choice of the primers, makes it possible to uniquely identify each VNTR (see the multiplexing plan). ). Preferably, the reaction medium further comprises eight additional unlabeled sense primers. In particular, the ratio: sense primers not marked on antisense primers is of the order of 2/3 and the ratio: sense primers marked on antisense primers is of the order of 1/3. Advantageously, the at least eight pairs of antisense / forward primer pairs of the eight VNTRs are selected from: SEQ ID NO: 1 / SEQ ID NO: 2; SEQ ID NO: 3 / SEQ ID NO: 4; SEQ ID NO: 5 / SEQ ID NO: 6; SEQ ID NO: 7 / SEQ ID NO: 8; SEQ ID NO: 9 / SEQ ID NO: 10; SEQ ID NO: 11 / SEQ ID NO: 12; SEQ ID NO: 13 / SEQ ID NO: 14; SEQ ID NO: 15 / SEQ ID NO: 16; SEQ ID NO: 17 / SEQ ID NO: 18; SEQ ID NO: 19 / SEQ ID NO: 20; SEQ ID NO: 21/30 SEQ ID NO: 22; SEQ ID NO: 23 / SEQ ID NO: 24. According to a preferred embodiment, is carried out in step (i), a co-amplification of ten VNTRs loci by multiplex PCR.

Dans ce mode de réalisation, le milieu réactionnel comprend les couples d'amorces respectivement anti-sens/sens suivants : SEQ ID NO :1 /SEQ ID NO :2 ; SEQ ID NO :3/ SEQ ID NO :4 ; SEQ ID NO :5/ SEQ ID NO :6 ; SEQ ID NO :7/ SEQ ID NO :8 ; SEQ ID NO :9/ SEQ ID NO :10 ; SEQ ID NO :11/ SEQ ID NO :12 ; SEQ ID NO :13/ SEQ ID NO :14 ; SEQ ID NO :15/ SEQ ID NO :16; SEQ ID NO : 17/ SEQ ID NO :18; SEQ ID NO : 19/ SEQ ID NO :20; SEQ ID NO : 21/ SEQ ID NO : 22; SEQ ID NO : 23/ SEQ ID NO : 24 La présente invention se rapporte également à un kit de génotypage de Legionella pneumophila pour la mise en oeuvre du procédé de génotypage décrit ci-10 dessus, comprenant : - un milieu réactionnel comportant au moins huit amorces sens marquées et au moins huit amorces anti-sens, formant au moins huit couples d'amorces sens/antisens pour chacun desquels corresponde un locus VNTR spécifique et différent pour chacun des huit couples d'amorces, chacune des huit amorces sens s'hybridant en 15 amont de son locus respectif et chacune des huit amorces anti-sens s'hybridant en aval de son locus respectif, - un mix d'amplification, comme celui fourni par Qiagen (multiplex mix PCR), - éventuellement un témoin positif comme l'ADN de la souche dite de 20 Philadelphie dont le génotype MLVA est connu et un faux témoin négatif comme l'ADN d'un isolat de l'espèce Legionella anisa, de manière à valider le résultat et s'affranchir de faux-positifs ou de faux-négatifs. De preference, les au moins huit couples d'amorces respectivement anti-sens /sens des huit loci VNTRs sont choisis parmi : SEQ ID NO :1 /SEQ ID NO :2 ; SEQ 25 ID NO :3/ SEQ ID NO :4 ; SEQ ID NO :5/ SEQ ID NO :6 ; SEQ ID NO :7/ SEQ ID NO :8 ; SEQ ID NO :9/ SEQ ID NO :10 ; SEQ ID NO :111 SEQ ID NO :12 ; SEQ ID NO :13/ SEQ ID NO :14 ; SEQ ID NO :15/ SEQ ID NO :16; SEQ ID NO : 17/ SEQ ID NO :18; SEQ ID NO : 19/ SEQ ID NO :20; SEQ ID NO : 21/ SEQ ID NO : 22; SEQ ID NO : 23/ SEQ ID NO : 24 30 Selon un mode de réalisation du kit, celui-ci comprend un premier milieu réactionnel comprenant les couples d'amorces respectivement anti-sens/sens suivants : SEQ ID NO :1 /SEQ ID NO :2 ; SEQ ID NO :3/ SEQ ID NO :4 ; SEQ ID NO :5/ SEQ ID NO :6 ; SEQ ID NO :7/ SEQ ID NO :8 ; SEQ ID NO :9/ SEQ ID NO :10 ; SEQ ID NO :111 SEQ ID NO :12 ; SEQ ID NO :13/ SEQ ID NO :14 ; SEQ ID NO :15/ SEQ ID NO :16; SEQ ID NO : 17/ SEQ ID NO :18; SEQ ID NO : 19/ SEQ ID NO :20; SEQ ID NO : 21/ SEQ ID NO : 22; SEQ ID NO : 23/ SEQ ID NO : 24 Les amorces utilisées présentent ainsi la triple particularité i) de garantir l'unicité d'un VNTR sur un profil électrophorétique par la caractérisation du vecteur taille/couleur, ii) de permettre leur association dans une seule réaction de PCR (la formation de structures en dimères ou hairpin entre les amorces a été recherchée) et iii) de s'hybrider au niveau de zones conservées chez l'espèce Legionella pneumophila. In this embodiment, the reaction medium comprises the following pairs of antisense / forward primers: SEQ ID NO: 1 / SEQ ID NO: 2; SEQ ID NO: 3 / SEQ ID NO: 4; SEQ ID NO: 5 / SEQ ID NO: 6; SEQ ID NO: 7 / SEQ ID NO: 8; SEQ ID NO: 9 / SEQ ID NO: 10; SEQ ID NO: 11 / SEQ ID NO: 12; SEQ ID NO: 13 / SEQ ID NO: 14; SEQ ID NO: 15 / SEQ ID NO: 16; SEQ ID NO: 17 / SEQ ID NO: 18; SEQ ID NO: 19 / SEQ ID NO: 20; SEQ ID NO: 21 / SEQ ID NO: 22; The present invention also relates to a genotyping kit for Legionella pneumophila for carrying out the genotyping method described above, comprising: a reaction medium comprising at least eight labeled sense primers and at least eight antisense primers, forming at least eight sense / antisense primer pairs for each of which corresponds to a specific and different VNTR locus for each of the eight primer pairs, each of the eight sense primers being hybridized upstream of its respective locus and each of the eight antisense primers hybridizing downstream of its respective locus, - an amplification mix, such as that provided by Qiagen (PCR multiplex mix), - optionally a positive control such as DNA of the so-called Philadelphia strain whose MLVA genotype is known and a false negative control such as the DNA of an isolate of the species Legionella anisa, so as to validate the result and overcome false-positives orfalse negatives. Preferably, the at least eight pairs of antisense / forward primers respectively of the eight VNTR loci are chosen from: SEQ ID NO: 1 / SEQ ID NO: 2; SEQ ID NO: 3 / SEQ ID NO: 4; SEQ ID NO: 5 / SEQ ID NO: 6; SEQ ID NO: 7 / SEQ ID NO: 8; SEQ ID NO: 9 / SEQ ID NO: 10; SEQ ID NO: 111 SEQ ID NO: 12; SEQ ID NO: 13 / SEQ ID NO: 14; SEQ ID NO: 15 / SEQ ID NO: 16; SEQ ID NO: 17 / SEQ ID NO: 18; SEQ ID NO: 19 / SEQ ID NO: 20; SEQ ID NO: 21 / SEQ ID NO: 22; SEQ ID NO: 23 / SEQ ID NO: 24 According to one embodiment of the kit, it comprises a first reaction medium comprising the pairs of primers respectively antisense / direction as follows: SEQ ID NO: 1 / SEQ ID NO: 2; SEQ ID NO: 3 / SEQ ID NO: 4; SEQ ID NO: 5 / SEQ ID NO: 6; SEQ ID NO: 7 / SEQ ID NO: 8; SEQ ID NO: 9 / SEQ ID NO: 10; SEQ ID NO: 111 SEQ ID NO: 12; SEQ ID NO: 13 / SEQ ID NO: 14; SEQ ID NO: 15 / SEQ ID NO: 16; SEQ ID NO: 17 / SEQ ID NO: 18; SEQ ID NO: 19 / SEQ ID NO: 20; SEQ ID NO: 21 / SEQ ID NO: 22; SEQ ID NO: 23 / SEQ ID NO: 24 The primers used thus have the triple peculiarity of i) guaranteeing the uniqueness of a VNTR on an electrophoretic profile by characterization of the size / color vector, ii) allowing their association in a single PCR reaction (the formation of dimer or hairpin structures between the primers was sought) and iii) to hybridize at the level of conserved zones in the species Legionella pneumophila.

DESCRIPTION DETAILLEE : DETAILED DESCRIPTION :

L'invention sera mieux comprise et d'autres buts, détails, caractéristiques et avantages de celle-ci apparaîtront plus clairement à la lecture de tests expérimentaux, en référence aux figures annexées dans lesquelles : - la Figure 1 représente le plan de multiplexage mis au point par le présent demandeur ; - la Figure 2.1-2.2 (2 pages) représente un dendrogramme réalisé selon l'UPGMA (méthode de groupe de paires hiérarchiques non pondérées avec l'agrégation (cluster) de l'analyse de la moyenne arithmétique) présentant l'agrégation des isolats de la collection EWGLI (98 isolats) par le protocole de typage selon l'invention (12 loci VNTRs) ; - la Figure 3.1-3.2 (2 pages) représente un dendrogramme réalisé selon l'UPGMA présentant l'agrégation des isolats de la collection EWGLI (98 isolats) par le protocole de typage selon Pourcel et col. (8 loci VNTRs par MVLA et sans PCR multiplexe) ; - les Figures 4a (2 pages) et 4b (2 pages) représentent les dendrogrammes réalisés selon I'UPGMA présentant l'agrégation des isolats de la collection EWGLI (98 isolats) par les protocoles de typage respectivement SBT6 et SBT7 (technique de l'art antérieure) ; - la Figure 5 représente trois Tableaux 9a, 9b et 9c correspondant aux résultats pour une analyse de reproductibilité ; - la Figure 6.1 à 6.5 (cette figure comporte 5 pages) représente le fichier d'analyse mis au point par le présent demandeur pour obtenir le code MVLA automatiquement, il s'agit d'un programme d'ordinateur qui permet le traitement des données analysées; - les figures 7 et 8.1 à 8.2 (2pages) sont des fichiers également mis au point par le présent demandeur qui compilent l'ensemble des données recueillies sur les différents allèles associés à chaque marqueur défini par une gamme de taille et de couleur. A) Détails expérimentaux The invention will be better understood and other objects, details, characteristics and advantages thereof will appear more clearly on reading experimental tests, with reference to the appended figures in which: - Figure 1 shows the multiplexing plan set to point by the present applicant; - Figure 2.1-2.2 (2 pages) represents a dendrogram made according to the UPGMA (unweighted hierarchical pair group method with the aggregation (cluster) of the arithmetic mean analysis) presenting the aggregation of the isolates of the EWGLI collection (98 isolates) by the typing protocol according to the invention (12 VNTR loci); - Figure 3.1-3.2 (2 pages) represents a UPGMA dendrogram showing the aggregation of isolates from the EWGLI collection (98 isolates) by the typing protocol according to Pourcel et al. (8 VNTRs by MVLA and without multiplex PCR); FIGS. 4a (2 pages) and 4b (2 pages) represent the dendrograms made according to the UPGMA showing the aggregation of the isolates of the EWGLI collection (98 isolates) by the typing protocols respectively SBT6 and SBT7 (technique of the prior art); FIG. 5 represents three Tables 9a, 9b and 9c corresponding to the results for a reproducibility analysis; - Figure 6.1 to 6.5 (this figure has 5 pages) represents the analysis file developed by the present applicant to obtain the MVLA code automatically, it is a computer program that allows the processing of data analyzed; - Figures 7 and 8.1 to 8.2 (2pages) are files also developed by the present applicant who compile all data collected on the different alleles associated with each marker defined by a range of size and color. A) Experimental Details

La section suivante décrit les matériels et méthodes utilisés pour le génotypage de Legionella pneumophila par le procédé de la présente invention. Elle 10 sera décomposée en quatre parties : 1) Choix et sélection des VNTRs, 2) Elaboration des amorces et construction du plan de multiplexage, 3) PCR multiplexe et analyse des fragments et 4) Obtention du code MLVA. The following section describes the materials and methods used for genotyping Legionella pneumophila by the method of the present invention. It will be broken down into four parts: 1) Choice and selection of the VNTRs, 2) Preparation of the primers and construction of the multiplexing plan, 3) multiplex PCR and fragment analysis and 4) Obtaining the MLVA code.

1) Choix et sélection des VNTRs 15 Trois génomes séquencés de Legionella pneumophila (Legionella pneumophila str. Lens, Legionella pneumophila str. Paris et Legionella pneumophila subsp. pneumophila str. Philadelphia 1) ont été comparés afin de mettre en évidence les séquences répétées présentant un polymorphisme de répétitions. Pour effectuer une recherche de VNTRs pour l'espèce L. pneumophila, la 20 procédure suivante a été utilisée : sur le site http:/Iwww.hpabionum.org.uk/VNTRUK/ le lien «intra-genus » de la section Polymomhic TRs pour Legionella a été activé. Les critères de sélection doivent être choisis de manière pertinente et peuvent être modulés après avoir coché la case « more criteria ». Les paramètres imposés sont la présence du VNTR pour les trois souches (locus number : 25 3), l'exclusion des microsatellites dont le motif répété est inférieur ou égal à 6pb (pattern size : >6) et la conservation des motifs répétés (match% : >70). Cette requête fait apparaître 55 résultats dont 8 doublons, 1 triplet et 1 sextuplet ; ce sont donc 40 VNTRs identifiés par cette requête. Le présent demandeur a procédé à la validation exhaustive des 30 loci restants en évaluant leur présence et leur polymorphisme sur 30 la collection EWGLI. La présente invention a donc fait l'objet au préalable de la recherche exhaustive de tous les VNTRs présents chez L. pneumophila. Un couple d'amorces a été élaboré pour l'amplification de chacune des 30 séquences répétées en utilisant le logiciel Primera. Finalement, le présent demandeur a conservé 8 VNTRs et 4 autres VNTRs supplémentaires de type microsatellite. 35 Ainsi, 26 VNTRs ont été exclus du protocole de typage en raison de leur faible5 polymorphisme (seulement deux allèles identifiés sur les 96 isolats testés). Dans la suite de la description, les tests ont été réalisés pour les 12 loci VNTRs, bien que le procédé de génotypage à partir de la co-amplication d'au moins 8 loci VNTRs, est également performant (voir Tableau 1 ci-dessous). En effet, huit loci VNTRs (les huit premiers dans le Tableau 1 ci-dessous) suffisent pour garantir des résultats satisfaisants. Taille du Taille Position théorique Nom Nombre de sur le Type de séquences motif répété de simplifié (Pb) répétitions l'amplicon génome présentant le VNTR (Pb) (kb) Lp323 1 45 8 494 3231 ORF hypothetical protein Lp3144 96 8 942 3144 ORF : interaptin Lp 1644 24 11 793 1644 ORF : coiled-coil protein Lp0913 21 4 128 913 Intergénique Lp2990 45 17 1043 2990 ORF hypothetical protein Lp2578 125 1 317 2578 ORF : dehydrogenase Lp2661 125 1 265 2661 ORF : endopeptidase Lp1428 18 3 205 1428 ORF : Tfp pilas protein Lp0857 8 3 264 857 ORF : biotine synthétase Lp3219 6 6 79 3219 ORF hypothetical protein Lp0029 6 4 198 29 ORF : méthyltransférase Lp2195 6 9 173 2195 ORF : hypothetical protein Tableau 1 : Caractéristiques des VNTRs utilisés dans la présente invention (Les caractéristiques associées à chaque VNTR sont propres à la souche Legionella 10 pneumophila str Philadelphia) 2) Elaboration des amorces et construction du plan de multiplexage Une fois les loci d'intérêt choisis, l'originalité développée par la présente invention résidait dans la capacité à co-amplifier les 12 VNTRs par PCR multiplexe. 15 Pour cela, la pertinence dans le choix des amorces est primordiale. Comme évoqué précédemment dans la description de l'invention, le choix de la séquence des amorces utilisées a été réalisé pour remplir trois objectifs : i) les amorces doivent assurer l'unicité d'identification d'un amplicon, issu de la 12-plex (multiplexe de 12 produits PCR), par la visualisation d'un plan de multiplexage. ii) les amorces doivent permettre la co-amplification efficace des 12 VNTRs iii) les amorces doivent être choisies au niveau de séquences conservées de diverses souches de l'espèce Legionella pneumophila afin que le protocole de typage présente une typabilité proche de 100%. 1) Choice and Selection of VNTRs Three sequenced genomes of Legionella pneumophila (Legionella pneumophila str.Legonella, Legionella pneumophila str.Paris and Legionella pneumophila subsp.lapidophila str.Philadelphia 1) were compared to highlight the repeated repetition polymorphism. To perform a VNTR search for the species L. pneumophila, the following procedure was used: on the website http://www.hpabionum.org.uk/VNTRUK/ the "intra-genus" link of the Polymomhic TRs section for Legionella has been activated. The selection criteria must be chosen in a relevant way and can be modulated after checking the "more criteria" box. The imposed parameters are the presence of the VNTR for the three strains (locus number: 25 3), the exclusion of microsatellites whose repeated pattern is less than or equal to 6pb (pattern size:> 6) and the conservation of repeated motifs (match %:> 70). This query shows 55 results including 8 doubloons, 1 triplet and 1 sextuplet; it is therefore 40 VNTRs identified by this request. The present applicant has completed the exhaustive validation of the remaining 30 loci by evaluating their presence and polymorphism on the EWGLI collection. The present invention was therefore the subject of prior exhaustive search of all the VNTRs present in L. pneumophila. A pair of primers was developed for amplification of each of the repeats using Primera software. Finally, the present applicant has retained 8 VNTRs and 4 other additional microsatellite VNTRs. Thus, 26 VNTRs were excluded from the typing protocol because of their low polymorphism (only two alleles identified from the 96 isolates tested). In the remainder of the description, the tests were carried out for the 12 VNTR loci, although the genotyping method based on the co-amplification of at least 8 VNTR loci is also efficient (see Table 1 below). . Indeed, eight VNTRs loci (the first eight in Table 1 below) are sufficient to guarantee satisfactory results. Size of Size Theoretical Position Name Number of on Sequence Type repeating pattern of simplified (Pb) repeats amplicon genome with VNTR (Pb) (kb) Lp323 1 45 8 494 3231 ORF hypothetical protein Lp3144 96 8 942 3144 ORF: Interpand Lp 1644 24 11 793 1644 ORF: coiled-coil protein Lp0913 21 4 128 913 Intergenic Lp2990 45 17 1043 2990 ORF hypothetical protein Lp2578 125 1 317 2578 ORF: dehydrogenase Lp2661 125 1 265 2661 ORF: endopeptidase Lp1428 18 3 205 1428 ORF: Tfp pilas protein Lp0857 8 3264 857 ORF: biotin synthetase Lp3219 6 6 79 3219 ORF hypothetical protein Lp0029 6 4 198 29 ORF: methyltransferase Lp2195 6 9 173 2195 ORF: hypothetical protein Table 1: Characteristics of the VNTRs used in the present invention (The characteristics associated with each VNTR are specific to the strain Legionella 10 pneumophila str Philadelphia) 2) Preparation of primers and construction of the multiplexing plan Once the loci of interest chosen The originality developed by the present invention resides in the ability to co-amplify the 12 VNTRs by multiplex PCR. For this, the relevance in the choice of primers is paramount. As mentioned previously in the description of the invention, the choice of the sequence of the primers used has been made to fulfill three objectives: i) the primers must ensure the uniqueness of identification of an amplicon, resulting from the 12-plex (multiplexed of 12 PCR products), by the visualization of a multiplexing plan. ii) the primers must allow the effective co-amplification of the 12 VNTRs iii) the primers must be chosen at the level of conserved sequences of various strains of the species Legionella pneumophila so that the typing protocol has a typicity close to 100%.

Aucune hiérarchie ou chronologie n'est établie entre ces objectifs pour effectuer le choix des amorces. L'ensemble de ces paramètres est à prendre en compte et les trois critères de décision s'imbriquent. Cependant, par souci de clarté, chacun d'entre eux sera détaillé indépendamment. i) Le typage de la collection EWGLI, représentative de la diversité des souches cliniques, et de plus de 200 isolats issus de l'environnement donne une estimation de la gamme d'allèle pour chaque VNTR. Il est ainsi raisonnable de disposer et d'arranger les gammes d'allèles afin d'établir un plan de multiplexage. Ce plan, illustré par un schéma en 2D (spatiale et spectrale), représente l'agencement des différents amplicons issus du 12-plex. La première dimension est imposée par l'attribution d'un des 4 fluorophores suivant: 6-FAMTM, NEDTM, PETTM, VICTM. La présente invention étant développée sur les plateformes d'analyse Applied Biosystems Genetic Analyser 3100-Avant, 3130, 3130x1 et 3500, les fluorophores sont choisis chez Applied Biosystems. La seconde dimension est définie par une gamme de taille propre à chaque VNTR. Le croisement de ces deux dimensions permet d'attribuer une position spectrale et spatiale unique pour chaque VNTR. Pour une couleur donnée, chaque gamme de taille est séparée par au moins la taille d'une unité répétée. De plus, les amorces des VNTRs de type microsatellite sont systématiquement choisies de telle sorte que les amplicons soient de petite taille. No hierarchy or chronology is established between these objectives to make the choice of primers. All of these parameters must be taken into account and the three decision criteria overlap. However, for the sake of clarity, each of them will be detailed independently. i) Typing of the EWGLI collection, representative of the diversity of clinical strains, and more than 200 isolates from the environment provides an estimate of the range of allele for each VNTR. It is thus reasonable to arrange and arrange the ranges of alleles in order to establish a multiplexing plan. This plane, illustrated by a 2D diagram (spatial and spectral), represents the arrangement of the different amplicons from 12-plex. The first dimension is imposed by the attribution of one of the following 4 fluorophores: 6-FAMTM, NEDTM, PETTM, VICTM. The present invention being developed on the Applied Biosystems Genetic Analyzer 3100-Avant, 3130, 3130x1 and 3500 analysis platforms, the fluorophores are selected from Applied Biosystems. The second dimension is defined by a size range specific to each VNTR. The crossing of these two dimensions makes it possible to assign a unique spectral and spatial position for each VNTR. For a given color, each size range is separated by at least the size of a repeated unit. In addition, the microsatellite VNTR primers are systematically chosen so that the amplicons are small.

Après avoir considéré l'ensemble de ces paramètres, un plan de multiplexage a été construit comme illustré par la Figure L After considering all these parameters, a multiplexing plan was constructed as shown in Figure L

ii) Une fois la configuration spatiale des VNTRs connue, des zones génomiques au sein desquelles les amorces peuvent être élaborées sont définies. CIassiquement, les séquences des amorces doivent répondre à plusieurs critères : séquence comprise entre 18pb et 25pb, %GC compris entre 40 et 60, ne comprenant pas plus de 4 répétitions mononucléotidiques. Ensuite, d'autres exigences sont spécifiques à la réalisation de la PCR multiplexe. Ainsi, afin que les 12 produits puissent être coamplifiés, de manière efficace et homogène, en utilisant un même protocole PCR et a fortiori une même température d'hybridation, les amorces doivent présenter une température de désappariement (Tm) semblable. Le présent demandeur a empiriquement imposé une différence maximale de 8°C entre les différents Tm. De plus, la co-amplification exigeant le rassemblement de tous les réactifs dans une seule réaction, il est primordial que les amorces restent neutres entre elles i.e. qu'elles ne donnent pas d'hybridation croisée. La probabilité de formation de structures en dimères par les amorces a été testée par le logiciel Autodimer. Après importation d'un fichier fasta comprenant l'ensemble des séquences à valider, ce logiciel indique si des couples sont susceptibles de se former. Enfin, une queue nucléotidique de 7pb est ajoutée en position 5' de chaque amorce anti-sens afin de faciliter l'adénylation des produits PCR. En effet, l'ajout partiel d'une adénine en 3' des amplicons par la Taq polymérase entraine une difficulté d'analyse des profils électrophorétiques ; on appelle cet artefact le «pic +A ». L'étape finale du choix des amorces est la démonstration de leur spécificité. Chaque séquence est donc soumise à l'algorithme BLAST et recherchée dans tous les génomes séquencés. iii) Une des caractéristiques principales d'une bonne technique de typage est la typabilité i.e. la capacité à attribuer un génotype à tous les isolats typés. Autrement dit, l'amplification des 12 VNTRs doit être possible pour l'ensemble de l'espèce Legionella pneumophila et un code MLVA complet (composé de 12 valeurs) doit être attribué. Classiquement une technique de typage dont la typabilité est supérieure à 97% est considérée comme excellente. Deux raisons peuvent provoquer l'absence d'amplification : l'absence du VNTR et la non hybridation des amorces. Concernant la présence des VNTRs pour l'ensemble des souches séquencées, celle-ci est imposée par la modification d'un critère (locus number) dans la base de données « VNTR locus database » (cf 2)i)). Seuls 4 génomes de Legionella pneumophila sont séquencés ; il est donc impossible de prédire la conservation d'une séquence génétique pour l'ensemble de l'espèce. Cependant, la comparaison de ces génomes permet d'identifier des zones conservées et de designer les amorces au niveau de celles-ci. ii) Once the spatial configuration of the VNTRs is known, genomic areas within which the primers can be developed are defined. Conventionally, the sequences of the primers must satisfy several criteria: a sequence of between 18 pb and 25 pb,% GC between 40 and 60, comprising not more than 4 single nucleotide repeats. Then, other requirements are specific to carrying out the multiplex PCR. Thus, so that the 12 products can be coamplified, efficiently and homogeneously, using the same PCR protocol and a fortiori the same hybridization temperature, the primers must have a similar mismatch temperature (Tm). The present applicant has empirically imposed a maximum difference of 8 ° C between the different Tm. In addition, the co-amplification requiring the gathering of all the reagents in a single reaction, it is essential that the primers remain neutral to each other ie they do not give cross hybridization. The probability of formation of dimer structures by the primers was tested by the Autodimer software. After importing a fasta file including all the sequences to validate, this software indicates if couples are likely to form. Finally, a 7pb nucleotide tail is added at the 5 'position of each antisense primer to facilitate adenylation of the PCR products. In fact, the partial addition of a 3 'adenine to the amplicons by the Taq polymerase causes a difficulty of analysis of the electrophoretic profiles; this artifact is called the "peak + A". The final step in the choice of primers is the demonstration of their specificity. Each sequence is therefore subjected to the BLAST algorithm and searched in all sequenced genomes. iii) One of the main characteristics of a good typing technique is the typability i.e. the ability to assign a genotype to all typed isolates. In other words, the amplification of the 12 VNTRs must be possible for the whole species Legionella pneumophila and a complete MLVA code (composed of 12 values) must be assigned. Typically a typing technique whose typability is greater than 97% is considered excellent. Two reasons can cause the absence of amplification: the absence of the VNTR and the non-hybridization of the primers. Concerning the presence of the VNTRs for all the sequenced strains, this one is imposed by the modification of a criterion (locus number) in the database "VNTR locus database" (cf 2) i)). Only 4 genomes of Legionella pneumophila are sequenced; it is therefore impossible to predict the conservation of a genetic sequence for the entire species. However, the comparison of these genomes makes it possible to identify conserved areas and to designate the primers at their level.

Les amorces utilisées pour la présente invention répondant aux trois critères et iii) sont décrites dans le Tableau 2 ci-après. Nom SEQ ID NO Type d'amorce Séquence simplifié (Le fluorophore utilisé du VN1 R est indiqué entre amplifié parenthèses) Lp3231 SEQ ID NO: 1 Anti-sens non marquée GCATATGACAAAGCCTTGGC SEQ ID NO: 2 Sens non marquée TGAATTTCTCCCTCTTGCTTG SEQ ID NO: 2 Sens marquée (NED) NED-TGAA'ITTCTCCCTCTTGCT'TG Lp3144 SEQ ID NO: 3 Anti-sens non marquée TGATGGTCTCAATGGTTCCG SEQ ID NO: 4 Sens non marquée GGACAAACAACCAATGAAGC SEQ ID NO: 4 Sens marquée (VIC) V1C-GGACAAACAACCAATGAAGC Lp1644 SEQ ID NO: 5 Anti-sens non marquée GCATCGGACTGAGCAAAGTA SEQ ID NO: 6 Sens non marquée CTCACCAGGATGCTTTGTCG SEQ ID NO: 6 Sens marquée (NED) NED-CTCACCAGGATGCTTTGTCG Lp0913 SEQ ID NO: 7 Anti-sens non marquée TCCAGAGGCTCTGGATTATC SEQ ID NO: 8 Sens non marquée GAACTATCAGAAGGAGGCGA SEQ ID NO: 8 Sens marquée (VIC) VIC-GAACTATCAGAAGGAGGCGA Lp2990 SEQ ID NO: 9 Anti-sens non marquée ATCGCCTAATTGCCGCCTA SEQ ID NO: 10 Sens non marquée CCTCGCAAGCCTATGTGG SEQ ID NO: 10 Sens marquée (6FAM) FAM-CCTCGCAAGCCTATGTGG Lp2578 SEQ ID NO: I l Anti-sens non marquée CGAGGAAATCTTCTTCAGCC SEQ ID NO: 12 Sens non marquée GACACCACAGCAGTTTGAAC SEQ ID NO: 12 Sens marquée (VIC) VIC-GACACCACAGCAGTTTGAAC Lp2661 SEQ ID NO: 13 Anti-sens non marquée ATGCAGGATGTTTGCGCATG SEQ ID NO: 14 Sens non marquée AAGGAATAAGGCGCAGCAC SEQ ID NO: 14 Sens marquée (6FAM) FAM-AAGGAATAAGGCGCAGCAC LpI428 SEQ ID NO: 15 Anti-sens non marquée TATCAACCTCATCATCCCTG SEQ ID NO: 16 Sens non marquée GAATCTGAAACAGTTGAGGATG SEQ ID NO: 16 Sens marquée (PET) PET-GAATCTGAAACAGTTGAGGATG Lp0857 SEQ ID NO: 17 Anti-sens non marquée GGATTGCCTTGGGCATTAAT SEQ ID NO: 18 Sens non marquée CCTATCAACAGATGACGCTT SEQ ID NO: 18 Sens marquée (NED) NED-CCTATCAACAGATGACGCTT Lp3219 SEQ ID NO: 19 Anti-sens non marquée CCAACTCCTCAACGCAACAA SEQ ID NO: 20 Sens non marquée CTTGACGAAGTAGGTGTGGG SEQ ID NO: 20 Sens marquée (PET) PET-CTTGACGAAGTAGGTGTGGG I.p0029 SEQ ID NO: 21 Anti-sens non marquée TTACCCAAGCCCTTATTGCG SEQ ID NO: 22 Sens non marquée TAGATCTCTTGCCGAGCTTC SEQ ID NO: 22 Sens marquée (6FAM) FAM-TAGATCTCTTGCCGAGCTTC Lp2195 SEQ ID NO: 23 Anti-sens non marquée TTATGCGAGAGTTTCATGA SEQ ID NO: 24 Sens non marquée GCTACTGCAGCAACATCC SEQ ID NO: 24 Sens marquée (NED) NED-GCTACTGCAGCAACATCC Tableau 2 : Caractéristiques des amorces utilisées dans la présente invention 3) PCR multiplexe et analyse des fragments Une seule réaction de PCR permet le typage d'un isolat de Legionella pneumophila. Deux constituants participent à cette réaction : un rnix d'amplification et un mix d'amorces. The primers used for the present invention meeting all three criteria and iii) are described in Table 2 below. Name SEQ ID NO Type of primer Simplified sequence (The fluorophore used for VN1 R is indicated between amplified parentheses) Lp3231 SEQ ID NO: 1 Unmarked antisense GCATATGACAAAGCCTTGGC SEQ ID NO: 2 Unmarked direction TGAATTTCTCCCTCTTGCTTG SEQ ID NO: 2 Direction NED-TGAA'ITTCTCCCTCTTGCT'TG L3144 SEQ ID NO: 3 Unmarked antisense TGATGGTCTCAATGGTTCCG SEQ ID NO: 4 Unmarked direction GGACAAACAACCAATGAAGC SEQ ID NO: 4 Marked sense (VIC) V1C-GGACAAACAACCAATGAAGC Lp1644 SEQ ID NO: 5 Unlabeled antisense GCATCGGACTGAGCAAAGTA SEQ ID NO: 6 Unmarked direction CTCACCAGGATGCTTTGTCG SEQ ID NO: 6 Marked sense (NED) NED-CTCACCAGGATGCTTTGTCG Lp0913 SEQ ID NO: 7 Unmarked antisense TCCAGAGGCTCTGGATTATC SEQ ID NO: 8 Unmarked direction GAACTATCAGAAGGAGGCGA SEQ ID NO: 8 Marked Sense (VIC) VIC-GAACTATCAGAAGGAGGCGA Lp2990 SEQ ID NO: 9 Unmarked Antisense ATCGCCTAATTGCCGCCTA SEQ ID NO: 10 Unmarked Sense CCTCGCAAGCCTATGTGG SEQ ID NO: 10 Marked Sense (6FAM) FAM-CCTCGCAAGCCTATGTGG Lp 2578 SEQ ID NO: I l Unmarked antisense CGAGGAAATCTTCTTCAGCC SEQ ID NO: 12 Unmarked direction GACACCACAGCAGTTTGAAC SEQ ID NO: 12 Marked sense (VIC) VIC-GACACCACAGCAGTTTGAAC Lp2661 SEQ ID NO: 13 Unmarked antisense ATGCAGGATGTTTGCGCATG SEQ ID NO : 14 Untagged Sense AAGGAATAAGGCGCAGCAC SEQ ID NO: 14 Marked Sense (6FAM) FAM-AAGGAATAAGGCGCAGCAC LpI428 SEQ ID NO: 15 Unmarked Anti-sense TATCAACCTCATCATCCCTG SEQ ID NO: 16 Unmarked Direction GAATCTGAAACAGTTGAGGATG SEQ ID NO: 16 Marked Sense (PET) PET-GAATCTGAAACAGTTGAGGATG Lp0857 SEQ ID NO: 17 Unmarked antisense GGATTGCCTTGGGCATTAAT SEQ ID NO: 18 Unmarked direction CCTATCAACAGATGACGCTT SEQ ID NO: 18 NED-labeled sense NED-CCTATCAACAGATGACGCTT Lp3219 SEQ ID NO: 19 Unmarked antisense CCAACTCCTCAACGCAACAA SEQ ID NO: 20 Untagged Sense CTTGACGAAGTAGGTGTGGG SEQ ID NO: 20 Marked Sense (PET) PET-CTTGACGAAGTAGGTGTGGG I.p0029 SEQ ID NO: 21 Untagged Anti-sense TTACCCAAGCCCTTATTGCG SEQ ID NO: 22 Untagged Sense TAGATCTCTTGCCGA GCTTC SEQ ID NO: 22 Marked Sense (6FAM) FAM-TAGATCTCTTGCCGAGCTTC Lp2195 SEQ ID NO: 23 Unmarked Anti-sense TTATGCGAGAGTTTCATGA SEQ ID NO: 24 Unmarked Sense GCTACTGCAGCAACATCC SEQ ID NO: 24 Marked Sense (NED) NED-GCTACTGCAGCAACATCC Table 2 Characteristics of the primers used in the present invention 3) Multiplex PCR and Fragment Analysis A single PCR reaction allows the typing of an isolate of Legionella pneumophila. Two components participate in this reaction: an amplification rnix and a primer mix.

Le mix d'amplification utilisé est le QIAGEN Multiplex PCR 2X Kit fourni par Qiagen. Le mix d'amorces est constitué d'oligonucléotides marqués et non marqués obtenus chez Applied Biosystems et d'eau PPi. L'amplification d'un VNTR nécessite la combinaison de 3 amorces : une amorce anti-sens, une amorce sens et une amorce sens marquée par un fluorophore (les séquences des amorces sens marquées et non-marquées sont identiques). L'équimolarité entre les amorces sens et anti-sens est assurée par l'établissement d'un ratio entre la concentration des amorces sens et de celle de l'amorce anti-sens. Dans la présente invention, les ratios imposés sont : [amorces sens non marquées] 1 [amorces anti-sens] est de l'ordre de 2/3 et le ratio : [amorces sens marquées] / [amorces anti-sens] est de l'ordre de 113, d'où [amorce anti-sens] = [amorce sens marquée] + [amorce sens non marquée]. Chacun des 12 triplets d'amorces utilisés pour l'amplification du VNTR associé est élaboré selon les ratios précédents lors de ce mode de réalisation. Les concentrations finales nécessaires de chaque triplet ont été ajustées afin de permettre l'homogénéité d'intensité des pics lors de l'analyse des profils électrophorétiques. La concentration finale de l'amorce anti-sens, suffisante pour connaître les concentrations finales, est indiquée dans le Tableau 3 ci-dessous. Nom simplifié du VNTR Concentration finale en amorce anti-sens (en ItM) amplifié Lp1428, Lp3231 0.6 Lp0029, Lp0857 0.4 Lp0913, Lp1644, Lp2195, 0 2 Lp2990,Lp3144 Lp2578, Lp2661, Lp3219 0.1 Tableau 3 : Concentration finale utilisée en amorce anti-sens A titre d'exemple, un mix d'amorces pour 100 réactions, i.e. 100 typages, 25 respectant les conditions ci dessus est décrit dans le Tableau 4 ci-dessous. 16 Tableau 4 : Constitution d'un mix d'amorces pour 100 réactions de tvpage Un volume d'eau de 685 µL doit être ajouté Nom du VNTR Nom de l'amorce Volume d'amorce (à 20µM) à prélever (en µL) Lp1428R, Lp3231R 45 Lp1428,Lp3231 Lp1428F,Lp3231F 30 Lp1428F-PET, Lp3231F-NED 15 Lp0029R, Lp0857R 30 Lp0029, Lp0857 Lp0029F,Lp0857F 20 Lp0029F-FAM, Lp0857F-NED 10 Lp0913R,Lp1644R,Lp2195R,Lp2990R,Lp3144R 15 Lp0913, Lp1644, Lp2195, Lp2990, LpO913F, Lp1644F, Lp2195F, Lp2990F, Lp3144F 10 Lp3144 Lp0913F-VIC, Lp 1644F-NED, Lp2195F-NED 5 Lp2990E-FAM, Lp3144F-VIC Lp2578, Lp2661, Lp2578R, Lp2661R, Lp3219R 7.5 Lp3219 Lp2578F,Lp2661F,Lp3219F 5 Lp2578F-VIC, Lp2661F-FAM, Lp3219F-PET 2,5 Le volume réactionnel est de 15µL dont 5.5µL de mix d'amorces, 7.5µL du mix QIAGEN Multiplex PCR 2X et 2 µL d'ADN bactérien (concentré à 2ng/µL). L'utilisation du kit d'extraction DNeasy Blood & Tissue de Qiagen convient pour la mise en oeuvre du procédé. 10 Le mélange réactionnel est ensuite soumis à une réaction de PCR dont le protocole original est indiqué sur le Tableau 5 ci-dessous. Puis, 7.5µL du produit PCR est purifié sur colonnes selon la technologie DyeEx de Qiagen. Enfin, la préparation d'un mélange constitué de 21,tL de produit PCR purifié, de 7.75µL d'HiDi formamide (Applied Biosystems) et de 0.25µL de GS1200LIZ (Applied 15 Biosystems) permet l'analyse des fragments par électrophorèse capillaire sur les plateformes Applied Biosystems Genetic Analyser 3100-Avant, 3130, 3130x1 et 3500. Le protocole d'électrophorèse capillaire est décrit sur le Tableau 6 ci-dessous. The amplification mix used is the QIAGEN Multiplex PCR 2X Kit provided by Qiagen. The primer mix consists of labeled and unlabeled oligonucleotides obtained from Applied Biosystems and PPi water. Amplification of a VNTR requires the combination of 3 primers: an antisense primer, a sense primer and a fluorophore-labeled sense primer (the sequences of the labeled and non-labeled sense primers are identical). The equimolarity between the sense and antisense primers is ensured by establishing a ratio between the concentration of the sense primers and that of the antisense primer. In the present invention, the imposed ratios are: [non-labeled sense primers] 1 [antisense primers] is of the order of 2/3 and the ratio: [sense sense primers] / [antisense primers] is the order of 113, hence [antisense primer] = [marked sense primer] + [unmarked sense primer]. Each of the 12 triplets of primers used for the amplification of the associated VNTR is developed according to the previous ratios in this embodiment. The final required concentrations of each triplet were adjusted to allow peak intensity homogeneity when analyzing electrophoretic profiles. The final concentration of the antisense primer, sufficient for the final concentrations, is shown in Table 3 below. Simplified name of the VNTR Final concentration in anti-sense primer (in ItM) amplified Lp1428, Lp3231 0.6 Lp0029, Lp0857 0.4 Lp0913, Lp1644, Lp2195, 0 2 Lp2990, Lp3144 Lp2578, Lp2661, Lp3219 0.1 Table 3: Final concentration used in anti-priming By way of example, a primer mix for 100 reactions, ie 100 typings, complying with the above conditions is described in Table 4 below. Table 4: Creation of a primer mix for 100 tvpage reactions A volume of 685 μL of water must be added Name of the VNTR Name of the primer Volume of primer (at 20 μM) to be taken (in μL) Lp1428R, Lp3231R 45 Lp1428, Lp3231 Lp1428F, Lp3231F Lp1428F-PET, Lp3231F-NED Lp0029R, Lp0857R Lp0029, Lp0857 Lp0029F, Lp0857F Lp0029F-FAM, Lp0857F-NED Lp0913R, Lp1644R, Lp2195R, Lp2990R, Lp3144R Lp0913, ## STR1 ## Lp2661F, Lp3219F 5 Lp2578F-VIC, Lp2661F-FAM, Lp3219F-PET 2,5 The reaction volume is 15μL including 5.5μL of primer mix, 7.5μL of QIAGEN Multiplex PCR 2X mix and 2 μL of bacterial DNA (concentrated at 2ng / μL). The use of the Qiagen DNeasy Blood & Tissue extraction kit is suitable for the implementation of the process. The reaction mixture is then subjected to a PCR reaction whose original protocol is shown in Table 5 below. Then, 7.5μL of the PCR product is purified on columns according to Qiagen's DyeEx technology. Finally, the preparation of a mixture consisting of 21 .mu.l of purified PCR product, 7.75 .mu.l of HiDi formamide (Applied Biosystems) and 0.25 .mu.l of GS1200LIZ (Applied Biosystems) allows the analysis of the fragments by capillary electrophoresis on Applied Biosystems Genetic Analyzer 3100-Avant, 3130, 3130x1 and 3500 platforms. The capillary electrophoresis protocol is described in Table 6 below.

Etape Etape 2 Etape 3 Etape 1 15 cycles 15 fois 4 1 fois 1 fois Temps 15 min 30 sec 60 sec 70 30 sec 60 sec 70 sec 10 min sec (+5 sec/cycle) Tempé 95 °C 95°C 82°C 72°C 95°C 64°C 72°C 72°C rature (-1.2°C/cycle) Tableau 5 : Caractéristiques du protocole PCR utilisé Caractéristiques Valeurs utilisées Run température 60°C Polymer fill volume 5020 Current stability 5µA Pre mn voltage 15kV Pre mn time 180sec Injection voltage 1.6kV Injection time 10sec Number of steps 40 Voltage step interval 15sec Data delay time 80sec Run voltage 12kV Run time 6200sec Tableau 6 : Caractéristiques du protocole d'électrophorèse capillaire utilisé (°C : degré Celsius, , uA : micro ampère, kV : kilo volt, sec : seconde) 4) Obtention du code MLVA L'analyse du profil électrophorétique s'effectue par le logiciel GeneMapper® qui interprète les données brutes et attribue une taille à chaque amplicon marqué par un fluorophore. Le présent demandeur a développé trois fichiers, issus de GeneMappere, nécessaires à l'attribution du code MLVA. Le fichier nommé « MLVA analysis » permet le traitement des données analysées selon des critères définis. Les fichiers nommés « MLVA management A» et « MLVA management B» rassemblent l'ensemble des données recueillies sur les différents allèles associés à chaque marqueur défini par une gamme de taille et de couleur. Ces fichiers sont illustrés en Figure 6. L'export du « Report manager » sous forme d'un fichier .txt donne l'attribution d'une valeur numérique, reflet du nombre de répétitions, pour chaque marqueur VNTR. Cette valeur est associée à un indice de qualité indiquant le degré de confiance que l'utilisateur peut attribuer à ce résultat. Arbitrairement, un indice supérieur à 0.5 est considéré comme valide. EXEMPLES Exemple 1 : Cet exemple illustre l'amplicon obtenu par amplification du VNTR Lp3231 avec les 10 amorces SEQ ID NO: 1 et SEQ ID NO: 2 pour la souche Legionella pneumophila subsp. pneumophila str. Philadelphia 1 (SEQ ID NO: 25) 5' TGAATTTCTCCCTCTTGCTTGTCATTTTTTTTATTTTGAACTTTATTCTGTT 15 GTGCCTTATTTTGCTTGTCCTGATTTTGCTGATCCTGGTTCTGCTGATCTTT GTTTTGCTTGTCCTGATTTTGCTGATCCTGGTTCTGTTGATCTTTGTTTTGC TTGTCCTGATTTTGTTGATCCTGGTTCTGCTGATTTTTGTTCTGCTTGTCCT GATTTTGCTTGTCCTGGTTCTGTTGATCTTTGTTTTGCTTGTCCTGATTTTG CTGATCCTGGTTCCGTTGATCTTTGTTTTGCTTGTCCTGATTTTGCTGATCC 20 TGGTTCTGTTGATCTTTGTTTTGCTTGTCCTGATTTTGTTGATCCTGGTTCT GTTGATCCTTATCCTGCTGATTCTGGCTTTTTTTCTTTTCTTTATCTTTCTTC AACAATTCACTGATTAATTTTCGATTATATAAAGCATCCTGATTATTTGGA TTAAATGCCAAGGCTTTGTCATATGC 3'5 Exemple 2 : Cet exemple illustre l'amplicon obtenu par amplification du VNTR Lp3144 avec les amorces SEQ ID NO: 3 et SEQ ID NO: 4 pour la souche Legionella pneumophila subsp. pneumophila str. Philadelphia 1 (SEQ ID NO: 26) 5' GGACAAACAACCAATGAAGCAAAAGCACTTATTGAGCAATTACGTTTAA TTTCAAATCAACCACTAAAGAACGAAGACATAAACTCTATTAAAGAAGA TTTATCTACTCTTGCCAATCAAATCCAATCCCTTGTGTCTGAATTAAATCA ATTACCTTTGCCTAATCTGTCCGGTGAAAAAATTGATCCTCCATTGGAAA AACAGGAAATAGCAGTAGATAAAACAATCCCTCTTACTGTGGAATTGAT GCACCCTGCCCAAGTAATTCAGATAGGCAATGATTCTCCCATAGAAAAAC AGCAGCTAGACAATGAGGAAGAAACGCCGGTTGTTCTGGAATCATTACG CCCCCGTCCAGTCATTCATAAGGAATCTGAATCTATCACCCAAAAACTGC AAGTAGACAATGGACAAGAAATGCCGGTTGTTCTGGATTCAACATGCAC TCCTCAAGCCATTCATAAGGAACTTGAATCTACCACTGAAAAACTGCAAG TAGACAATGGACACGAAATACCGGTTGTTCTCGAGTCAACACGCTCTCCT CAAATCATTCATACTGAGTCTGAATCTGTTGGTAAAAAACAGCATGTAGA AGTAGAGCAAGAGATACCAGTCACACTGGAATTAATACGACCCTCTTCTA TGGTTGAAAAGGATTCCGTGGCTACTGTAGAAAAACAGCAAGTAACTGA GAGACAGGAAACACCAATCGTCCTTGAATCAACACGACTCTCTCCTATGG TTCAGAAAGACACTGGGCTTTCTGGCGAAAAGCAACATAAAGAGATAGA ACAAGAAATATCTGTCGTTACGGAATTAACACCCCACACCCAAGTGGTTC GGCAAGGCTCTGAGTCCAGTTTAGAACAACAAGTACCCAACGGACAAGA AACACTGGCTGTTGTCAAATCAAGCCCATCGGAACCATTGAGACCATCA 3' Step Step 2 Step 3 Step 1 15 cycles 15 times 4 1 time once Time 15 min 30 sec 60 sec 70 30 sec 60 sec 70 sec 10 min dry (+5 sec / cycle) Temp 95 ° C 95 ° C 82 ° C 72 ° C 95 ° C 64 ° C 72 ° C 72 ° C (-1.2 ° C / cycle) Table 5: Characteristics of the PCR protocol used Characteristics Values used Run temperature 60 ° C Polymer fill volume 5020 Current stability 5μA Pre mn voltage 15kV Injection time timeout 10sec Number of steps 40 Voltage step interval 15sec Time delay 80sec Runtime voltage 12kV Runtime 6200sec Table 6: Characteristics of the capillary electrophoresis protocol used (° C: degree Celsius,, uA : micro ampere, kV: kilo volt, sec: second) 4) Obtaining the MLVA code The analysis of the electrophoretic profile is carried out by the GeneMapper® software which interprets the raw data and assigns a size to each amplicon marked by a fluorophore. The present applicant has developed three files, from GeneMappere, needed to assign the MLVA code. The file named "MLVA analysis" allows the processing of analyzed data according to defined criteria. The files named "MLVA management A" and "MLVA management B" gather all the data collected on the different alleles associated with each marker defined by a range of size and color. These files are illustrated in Figure 6. The "Report Manager" export as a .txt file gives the assignment of a numerical value, reflecting the number of repetitions, for each VNTR marker. This value is associated with a quality index indicating the degree of confidence that the user can attribute to this result. Arbitrarily, an index greater than 0.5 is considered valid. EXAMPLES Example 1 This example illustrates the amplicon obtained by amplification of the Lp3231 VNTR with the primers SEQ ID NO: 1 and SEQ ID NO: 2 for the strain Legionella pneumophila subsp. pneumophila str. Philadelphia 1 (SEQ ID NO: 25) 5 'TGAATTTCTCCCTCTTGCTTGTCATTTTTTTTATTTTGAACTTTATTCTGTT 15 GTGCCTTATTTTGCTTGTCCTGATTTTGCTGATCCTGGTTCTGCTGATCTTT GTTTTGCTTGTCCTGATTTTGCTGATCCTGGTTCTGTTGATCTTTGTTTTGC TTGTCCTGATTTTGTTGATCCTGGTTCTGCTGATTTTTGTTCTGCTTGTCCT GATTTTGCTTGTCCTGGTTCTGTTGATCTTTGTTTTGCTTGTCCTGATTTTG CTGATCCTGGTTCCGTTGATCTTTGTTTTGCTTGTCCTGATTTTGCTGATCC 20 TGGTTCTGTTGATCTTTGTTTTGCTTGTCCTGATTTTGTTGATCCTGGTTCT GTTGATCCTTATCCTGCTGATTCTGGCTTTTTTTCTTTTCTTTATCTTTCTTC AACAATTCACTGATTAATTTTCGATTATATAAAGCATCCTGATTATTTGGA TTAAATGCCAAGGCTTTGTCATATGC 3'5 Example 2: This example illustrates the amplicon obtained by amplification of the VNTR Lp3144 with primers SEQ ID NO: 3 and SEQ ID NO: 4 for the strain Legionella pneumophila subsp. pneumophila str. Philadelphia 1 (SEQ ID NO: 26) 5 'GGACAAACAACCAATGAAGCAAAAGCACTTATTGAGCAATTACGTTTAA TTTCAAATCAACCACTAAAGAACGAAGACATAAACTCTATTAAAGAAGA TTTATCTACTCTTGCCAATCAAATCCAATCCCTTGTGTCTGAATTAAATCA ATTACCTTTGCCTAATCTGTCCGGTGAAAAAATTGATCCTCCATTGGAAA AACAGGAAATAGCAGTAGATAAAACAATCCCTCTTACTGTGGAATTGAT GCACCCTGCCCAAGTAATTCAGATAGGCAATGATTCTCCCATAGAAAAAC AGCAGCTAGACAATGAGGAAGAAACGCCGGTTGTTCTGGAATCATTACG CCCCCGTCCAGTCATTCATAAGGAATCTGAATCTATCACCCAAAAACTGC AAGTAGACAATGGACAAGAAATGCCGGTTGTTCTGGATTCAACATGCAC TCCTCAAGCCATTCATAAGGAACTTGAATCTACCACTGAAAAACTGCAAG TAGACAATGGACACGAAATACCGGTTGTTCTCGAGTCAACACGCTCTCCT CAAATCATTCATACTGAGTCTGAATCTGTTGGTAAAAAACAGCATGTAGA AGTAGAGCAAGAGATACCAGTCACACTGGAATTAATACGACCCTCTTCTA TGGTTGAAAAGGATTCCGTGGCTACTGTAGAAAAACAGCAAGTAACTGA GAGACAGGAAACACCAATCGTCCTTGAATCAACACGACTCTCTCCTATGG TTCAGAAAGACACTGGGCTTTCTGGCGAAAAGCAACATAAAGAGATAGA ACAAGAAATATCTGTCGTTACGGAATTAACACCCCACACCCAAGTGGTTC GGCAAGGCTCTGAGTCCAGTTTAGAACAACAAGTACCCAACGGACAAGA AACACTGGCTGTTGTCAAATCAAGCCCATCGGAACCATTGAGACCATCA 3'

Exemple 3 : Cet exemple illustre l'amplicon obtenu par amplification du VNTR Lp1644 avec les 30 amorces SEQ ID NO: 5 et SEQ ID NO: 6 pour la souche Legionella pneumophila subsp. pneumophila str. Philadelphia 1 (SEQ ID NO: 27) 5' CTCACCAGGATGCTTTGTCGTTTGCAACTTTTTTTGGCGCTGAGTATTTTG 35 CTAAAACTTTTGCTACACAAGAACTTATACCTGTAATTAAAGAGGCAATT CAGCATCAAAATCAAGATTTGCTTACATCTGTTATTGAAAATCATATAGA AAAACAACATCTCAATGACTATCCTAAGACTCCCGATGGCATTAAAAAA CTATTGAAGTCGTTTCAAGGGATTGTCTATAAACCATTGGTTATGGAATT CTCAGGCCCAAGTGCCGTCTCATCATCTTGGGTGGAAGCTATATCTGGAA GATCCATCCCGAGAAATTTTGAATATTTAGCTGAACCTATGTCTCAACCA TTACGAGTTTTACAGCATTATGCCTGTGTATCTGGAAAAGCTAATTTTTCT TCTGATAACATTCCTAAATGGTGTGAACTTCAGTCTGACGTAGAAAAACG ACAACAACAAAGAGAAGATGGACTTTCCTGGCTTCCTGATGCTCAAGAG AAGCTTAAGAGGGAAGGGCAGCAAGCCAAACTTGAGGAAGAGCAACGA ATCAAACTTGAGGAAGAGCAACGAATCAAACTTGAGGAAGAGCAACGA ATCAAACTTGAGGAAGAGCAACGAATCAAACTTGAGGAAGAACAACGA ATCAAACTTGAGGAAGAACAACGAATCAAACTTGAGGAAGAACAACGA ATCAAACTTGAGGAAGAACAACGAATCAAACTTGAGGAAGAGCAACGA ATCAAACTTGAGGAAGAGCACAAAAGCAAAAAATACTTTGCTCAGTCCG ATGC 3' Exemple 4 : Cet exemple illustre l'amplicon obtenu par amplification du VNTR Lp0913 avec les amorces SEQ ID NO: 7 et SEQ ID NO: 8 pour la souche Legionella pneumophila subsp. pneumophila sir. Philadelphia I (SEQ ID NO: 28) 5' GAACTATCAGAAGGAGGCGATACTTTGAATACAACTGAAATACCAGAAC AGCCAATTGAGTATCCAGAGGAGCCATCAGAGTACCCTGAACAACCTTT GGAGTACCCTGATAATCCAGAGCCTCTGGA 3' Exemple 5 : Cet exemple illustre l'amplicon obtenu par amplification du VNTR Lp2990 avec les amorces SEQ ID NO: 9 et SEQ ID NO: 10 pour la souche Legionella pneumophila subsp. pneumophila str. Philadelphia 1 (SEQ ID NO: 29) 5' CCTCGCAAGCCTATGTGGACAGCAAGGTATCTGAACTAAAAAATGAATT AACCAACAAAATCAACAGTATCCCCTCTGGACCTCAAGGACCTCAAGGA CCTAGAGGAGATAAAGGCGAGGCTGGCCCTAAAGGAGACCAAGGAGAG GCAGGGCCGCAGGGATTACCCGGACCTAAAGGAGACCGAGGGGAAGCA GGGCCGCAGGGATTACCCGGACCTAAAGGAGACCAAGGGGAGGCAGGA CCGCAGGGATTATCAGGCCCTAAAGGAGACCAAGGGGAAGCAGGACCGC AGGGATTACCCGGACCTAAAGGAGACCAAGGGGAAGCAGGACCGCAGG GATTACCCGGACCTAAAGGAGACCAAGGGGAGGCAGGACCGCAGGGATT ACCCGGACCTAAAGGAGACCAAGGGGAGGCAGGACCGCAGGGATTACC AGGCCCTAAAGGAGACCGAGGGGAAGCAGGACCGCAGGGATTACCTGGT CCAAAAGGTGACAGAGGAGAGGCAGGACCTCAGGGATTACCTGGTCCAA AAGGTGACAGAGGAGAGGCAGGACCTCAGGGATTACCCGGACCGAAAG GAGACAAAGGGGAGGCAGGACCTCAGGGATTACCTGGTCCAAAAGGTGA CAGAGGAGAGGCAGGACCTCAGGGATTACCTGGACCGAAAGGAGACAA AGGGGAGGCAGGACCTCAGGGATTACCCGGACCGAAAGGAGACCGAGG GGAGGCAGGACCGCAGGGATTACCAGGCCCTAAAGGAGACCGAGGGGA AGCAGGATCTCAGGGATTACCTGGTCCAAAAGGTGACAAAGGAGAAGCA GGGCCGCAGGGATTACCAGGCCCTAAAGGAGACAAAGGAGAAACAGGA GCAGTAGGTCCACAAGGTATGCCAGGACCTAAAGGCGAAGCAGGAGATG ACGGCCAAGGTGTGCCTGCAGGTGGTGAAACGGGTCAAGTCCTTGCCAA ATCAAATGACCTCGATTTCAATACCATGTGGGTTGATCCGGCAAATTCCG GCATTAGGCGGCAATTAGGCGAT 3' Example 3: This example illustrates the amplicon obtained by amplification of the Lp1644 VNTR with the primers SEQ ID NO: 5 and SEQ ID NO: 6 for the strain Legionella pneumophila subsp. pneumophila str. Philadelphia 1 (SEQ ID NO: 27) 5 'CTCACCAGGATGCTTTGTCGTTTGCAACTTTTTTTGGCGCTGAGTATTTTG 35 CTAAAACTTTTGCTACACAAGAACTTATACCTGTAATTAAAGAGGCAATT CAGCATCAAAATCAAGATTTGCTTACATCTGTTATTGAAAATCATATAGA AAAACAACATCTCAATGACTATCCTAAGACTCCCGATGGCATTAAAAAA CTATTGAAGTCGTTTCAAGGGATTGTCTATAAACCATTGGTTATGGAATT CTCAGGCCCAAGTGCCGTCTCATCATCTTGGGTGGAAGCTATATCTGGAA GATCCATCCCGAGAAATTTTGAATATTTAGCTGAACCTATGTCTCAACCA TTACGAGTTTTACAGCATTATGCCTGTGTATCTGGAAAAGCTAATTTTTCT TCTGATAACATTCCTAAATGGTGTGAACTTCAGTCTGACGTAGAAAAACG ACAACAACAAAGAGAAGATGGACTTTCCTGGCTTCCTGATGCTCAAGAG AAGCTTAAGAGGGAAGGGCAGCAAGCCAAACTTGAGGAAGAGCAACGA ATCAAACTTGAGGAAGAGCAACGAATCAAACTTGAGGAAGAGCAACGA ATCAAACTTGAGGAAGAGCAACGAATCAAACTTGAGGAAGAACAACGA ATCAAACTTGAGGAAGAACAACGAATCAAACTTGAGGAAGAACAACGA ATCAAACTTGAGGAAGAACAACGAATCAAACTTGAGGAAGAGCAACGA ATCAAACTTGAGGAAGAGCACAAAAGCAAAAAATACTTTGCTCAGTCCG ATGC 3' Example 4: This example illustrates the amplicon obtained by amplification of the VNTR Lp0913 with primers SEQ ID NO: 7 and SEQ ID NO: 8 for the Legio strain nella pneumophila subsp. pneumophila sir. Philadelphia I (SEQ ID NO: 28) 5 'GAACTATCAGAAGGAGGCGATACTTTGAATACAACTGAAATACCAGAAC AGCCAATTGAGTATCCAGAGGAGCCATCAGAGTACCCTGAACAACCTTT GGAGTACCCTGATAATCCAGAGCCTCTGGA 3' Example 5: This example illustrates the amplicon obtained by amplification of VNTR Lp2990 with the primers SEQ ID NO: 9 and SEQ ID NO: 10 for the strain Legionella pneumophila subsp. pneumophila str. Philadelphia 1 (SEQ ID NO: 29) 5 'CCTCGCAAGCCTATGTGGACAGCAAGGTATCTGAACTAAAAAATGAATT AACCAACAAAATCAACAGTATCCCCTCTGGACCTCAAGGACCTCAAGGA CCTAGAGGAGATAAAGGCGAGGCTGGCCCTAAAGGAGACCAAGGAGAG GCAGGGCCGCAGGGATTACCCGGACCTAAAGGAGACCGAGGGGAAGCA GGGCCGCAGGGATTACCCGGACCTAAAGGAGACCAAGGGGAGGCAGGA CCGCAGGGATTATCAGGCCCTAAAGGAGACCAAGGGGAAGCAGGACCGC AGGGATTACCCGGACCTAAAGGAGACCAAGGGGAAGCAGGACCGCAGG GATTACCCGGACCTAAAGGAGACCAAGGGGAGGCAGGACCGCAGGGATT ACCCGGACCTAAAGGAGACCAAGGGGAGGCAGGACCGCAGGGATTACC AGGCCCTAAAGGAGACCGAGGGGAAGCAGGACCGCAGGGATTACCTGGT CCAAAAGGTGACAGAGGAGAGGCAGGACCTCAGGGATTACCTGGTCCAA AAGGTGACAGAGGAGAGGCAGGACCTCAGGGATTACCCGGACCGAAAG GAGACAAAGGGGAGGCAGGACCTCAGGGATTACCTGGTCCAAAAGGTGA CAGAGGAGAGGCAGGACCTCAGGGATTACCTGGACCGAAAGGAGACAA AGGGGAGGCAGGACCTCAGGGATTACCCGGACCGAAAGGAGACCGAGG GGAGGCAGGACCGCAGGGATTACCAGGCCCTAAAGGAGACCGAGGGGA AGCAGGATCTCAGGGATTACCTGGTCCAAAAGGTGACAAAGGAGAAGCA GGGCCGCAGGGATTACCAGGCCCTAAAGGAGACAAAGGAGAAACAGGA GCAGTAGGTCCACAAGGTATGCCAGGACCTAAAGGCGAAGCAGGAGATG ACGGCCAAGGTGTGCCTGCAGGTGGT GAAACGGGTCAAGTCCTTGCCAA ATCAAATGACCTCGATTTCAATACCATGTGGGTTGATCCGGCAAATTCCG GCATTAGGCGGCAATTAGGCGAT 3 '

Exemple 6 : Cet exemple illustre l'amplicon obtenu par amplification du VNTR Lp2578 avec les amorces SEQ ID NO: I l et SEQ ID NO: 12 pour la souche Legionella pneumophila subsp. pneumophila sir. Philadelphie 1 (SEQ ID NO: 30) 5' GACACCACAGCAGTTTGAACATAATCACTCTAAAACAAATCCTATACGGC ATTGCCTGCAAACAGTCGGATTTGAGTACAGGTTGAGAAAATAAACAGA GTAAAAAAGCGGCGTGTACATTAAAGTACATGAGCATTTTTTAGAATGTT TTTTTCTCAAGATGCGCCAAATACGGCCGTTTGCTAAGAATTACATTGAT TTAATTGACGAATAGATCTATAACTTCTTCCAAAATTATTGCAAGAGGAG CTTAAAAATGATGTCTGTTGACAATATTAAAAATGATAACCAGGTTTTGG CTGAAGAAGATTTCCTCG 3' Example 6 This example illustrates the amplicon obtained by amplification of the VNTR Lp2578 with the primers SEQ ID NO: 11 and SEQ ID NO: 12 for the strain Legionella pneumophila subsp. pneumophila sir. Philadelphia 1 (SEQ ID NO: 30) 5 'GACACCACAGCAGTTTGAACATAATCACTCTAAAACAAATCCTATACGGC ATTGCCTGCAAACAGTCGGATTTGAGTACAGGTTGAGAAAATAAACAGA GTAAAAAAGCGGCGTGTACATTAAAGTACATGAGCATTTTTTAGAATGTT TTTTTCTCAAGATGCGCCAAATACGGCCGTTTGCTAAGAATTACATTGAT TTAATTGACGAATAGATCTATAACTTCTTCCAAAATTATTGCAAGAGGAG CTTAAAAATGATGTCTGTTGACAATATTAAAAATGATAACCAGGTTTTGG CTGAAGAAGATTTCCTCG 3'

Exemple 7 : Cet exemple illustre l'amplicon obtenu par amplification du VNTR Lp2661 avec les 35 amorces SEQ ID NO: 13 et SEQ ID NO: 14 pour la souche Legionella pneumophila subsp. pneumophila str, Philadelphia 1 (SEQ ID NO: 31) 5'AAGGAATAAGGCGCAGCACCTATTAATGCACAAGCAAAGATGCGCCGA AGTCACCTACCCTTGAACGCCCATATTCGAGTGCAAATTGCCAGATCATT GCGACTAAAAAAGCGGAGTGTATAGATGAGTACATGAGCATTTTTTAGA GCAATGATCTGGCAAGATGCGCCGAAGACGGGCGTTCAAGCGAGGGGCC AACGAGGTTTGACTATAACCCCCAACCCCCCATCAATCTCCCCCCGCATC ATGCGCAAACATCCTGCAT 3' Example 7 This example illustrates the amplicon obtained by amplification of Lp2661 VNTR with the primers SEQ ID NO: 13 and SEQ ID NO: 14 for the strain Legionella pneumophila subsp. pneumophila str, Philadelphia 1 (SEQ ID NO: 31) 5'AAGGAATAAGGCGCAGCACCTATTAATGCACAAGCAAAGATGCGCCGA AGTCACCTACCCTTGAACGCCCATATTCGAGTGCAAATTGCCAGATCATT GCGACTAAAAAAGCGGAGTGTATAGATGAGTACATGAGCATTTTTTAGA GCAATGATCTGGCAAGATGCGCCGAAGACGGGCGTTCAAGCGAGGGGCC AACGAGGTTTGACTATAACCCCCAACCCCCCATCAATCTCCCCCCGCATC ATGCGCAAACATCCTGCAT 3 '

Exemple 8 : Cet exemple illustre 1'amplicon obtenu par amplification du VNTR Lp1428 avec les amorces SEQ ID NO: 15 et SEQ ID NO: 16 pour la souche Legionella pneurophila subsp. pneumophlia sir. Philadelphia 1 (SEQ ID NO: 32) 5' GAATCTGAAACAGTTGAGGATGTGACATATCTTGGAAGTACAGAACAGT TAAGAGCAAAAGAATATACAGAATTAGAATCAGAAGTTCAGACTAAACC AGAGGCCCAGGCTGAGCCAGAAGTTCAGGCTGGAGAAAATCAAATTATG TTTGAGCCCGTTATGGAACCTGAGCAATTCGATGTTAACAGGGATGATGA GGTTGATA 3'20 Exemple 9 : Cet exemple illustre l'amplicon obtenu par amplification du VNTR Lp0857 avec les amorces SEQ ID NO: 17 et SEQ ID NO: 1$ pour la souche Legionella pneumophila subsp. pneumophila sir. Philadelphia 1 (SEQ ID NO: 33) 5' CCTATCAACAGATGACGCTTTATTAGATTGAAAAATGAACATTAACCTTG ATTTTGTACATGTTGCGTGAAAAGCGATTATAGAATAAAGTGAAGTTATT AAAATATTAGATTTGAAATTTTACTCTAAAACTTCCTTTTTG FAAAAACC CTATTCAAAATTACTTAGGGCAAGTGATGTATCACCCGAAGAGAGTTCAT GCTTATTTCCAAATTCATCTTCCAGAATCAGTTGGCCAAACGAATTAATG CCCAAGGCAATCC 3' Example 8: This example illustrates the amplicon obtained by amplification of the Lp1428 VNTR with the primers SEQ ID NO: 15 and SEQ ID NO: 16 for the strain Legionella pneurophila subsp. pneumophilia sir. Philadelphia 1 (SEQ ID NO: 32) 5 'GAATCTGAAACAGTTGAGGATGTGACATATCTTGGAAGTACAGAACAGT TAAGAGCAAAAGAATATACAGAATTAGAATCAGAAGTTCAGACTAAACC AGAGGCCCAGGCTGAGCCAGAAGTTCAGGCTGGAGAAAATCAAATTATG TTTGAGCCCGTTATGGAACCTGAGCAATTCGATGTTAACAGGGATGATGA GGTTGATA 3'20 EXAMPLE 9 This example illustrates the amplicon obtained by amplification of the VNTR Lp0857 with primers SEQ ID NO: 17 and SEQ ID NO: $ 1 the strain Legionella pneumophila subsp. pneumophila sir. Philadelphia 1 (SEQ ID NO: 33) 5 'CCTATCAACAGATGACGCTTTATTAGATTGAAAAATGAACATTAACCTTG ATTTTGTACATGTTGCGTGAAAAGCGATTATAGAATAAAGTGAAGTTATT AAAATATTAGATTTGAAATTTTACTCTAAAACTTCCTTTTTG FAAAAACC CTATTCAAAATTACTTAGGGCAAGTGATGTATCACCCGAAGAGAGTTCAT GCTTATTTCCAAATTCATCTTCCAGAATCAGTTGGCCAAACGAATTAATG CCCAAGGCAATCC 3'

Exemple 10 : Cet exemple illustre l'amplicon obtenu par amplification du VNTR Lp3219 avec les amorces SEQ ID NO: 19 et SEQ ID NO: 20 pour la souche Legionella pneumophila subsp. pneumophila sir. Philadelphia 1 (SEQ ID NO: 34) 5' CTTGACGAAGTAGGTGTGGGGGTAGTACTACTAGAACTGGAACTCGAAC TGG AATTGGATTGTTGCGTTGAGGAGTTGG 3' Example 10: This example illustrates the amplicon obtained by amplification of VNTR Lp3219 with the primers SEQ ID NO: 19 and SEQ ID NO: 20 for the strain Legionella pneumophila subsp. pneumophila sir. Philadelphia 1 (SEQ ID NO: 34) 5 'CTTGACGAAGTAGGTGTGGGGGTAGTACTACTAGAACTGGAACTCGAAC TGG AATTGGATTGTTGCGTTGAGGAGTTGG 3'

Exemple I 1 : Cet exemple illustre l'amplicon obtenu par amplification du VNTR Lp0029 avec les 25 amorces SEQ ID NO: 21 et SEQ ID NO: 22 pour la souche Legionella pneumophila subsp. pneumophila str. Philadelphia 1 (SEQ ID NO: 35) 5' TAGATCTCTTGCCGAGCTTCCCTTTCATAAGCGTGAAGCTCGACTCTCTTT 30 AAGATTTGGATTTTGTTTTGGTTTTGCTTATTTCTTCAGTATTTACTTCTTC GTTCCCGTAAATTTGTTCTCTCAGGGAATTCATTAGTCCTGCCATAAAGA ACAATTCCGCTGTTAAATACAAAGGCGCAATAAGGGCTTGGGTAA 3' Exemple 12 : Cet exemple illustre l'amplicon obtenu par amplification du VNTR Lp2195 avec les amorces SEQ ID NO: 23 et SEQ ID NO: 24 pour la souche Legionella pneumophila subsp. pneumophila str. Philadelphia 1 (SEQ ID NO: 36) 5' GCTACTGCAGCAACATCCATAATAGTGCGTAAATATTGAGCTCGAATAGG TCCCCCAACCCAAACAAAATGTATTTTGGATGGTAGCGTACGGAGCTCAT ATTCAGATTTAGAATCGCTATCAGATTCAGAATCACTTTCATATTCAGAA TCGCTCATGAAACTCTCGCATAA 3' B) Test de génotypage Le groupe d'étude sur les marqueurs épidémiologiques (l'ESGEM) a défini plusieurs critères permettant de définir la performance d'une méthode de typage. Une méthode fiable doit reposer sur des marqueurs stables et identifiables sur les isolats typés. L'analyse des résultats de typage doit permettre une bonne discrimination entre les isolats tout en conservant une signification épidémiologique dans un contexte donné. Enfin, et de manière inhérente aux aspects expérimentaux, la technique considérée doit être reproductible afin d'envisager une future standardisation et automatisation. Cette méthode de typage doit être validée sur un panel de souches dont les caractéristiques doivent être connues. Ces souches doivent avoir été typées par d'autres méthodes afin de démontrer l'amélioration technologique. Les critères de performance établis ont été validés pour la technique de typage décrite par la présente invention. Cette validation a été réalisée sur une collection de référence établie par l'EWGLI. Cette collection de 98 isolats, typés par SBT et par anticorps monoclonaux, est composée de trois panels. Le panel dit de discrimination comprend 74 isolats cliniques non reliés épidémiologiquement. Le panel dit de concordance épidémiologique comprend 16 isolats dont le lien épidémiologique a été démontré. Enfin, le panel dit de stabilité est représenté par cinq variants de la même souche obtenus par repiquage successifs.35 1) Diversité des souches et indice de discrimination Example I 1: This example illustrates the amplicon obtained by amplification of the VNTR Lp0029 with the primers SEQ ID NO: 21 and SEQ ID NO: 22 for the strain Legionella pneumophila subsp. pneumophila str. Philadelphia 1 (SEQ ID NO: 35) 5 'TAGATCTCTTGCCGAGCTTCCCTTTCATAAGCGTGAAGCTCGACTCTCTTT 30 AAGATTTGGATTTTGTTTTGGTTTTGCTTATTTCTTCAGTATTTACTTCTTC GTTCCCGTAAATTTGTTCTCTCAGGGAATTCATTAGTCCTGCCATAAAGA ACAATTCCGCTGTTAAATACAAAGGCGCAATAAGGGCTTGGGTAA 3' EXAMPLE 12 This example illustrates the amplicon obtained by amplification of the VNTR Lp2195 with primers SEQ ID NO: 23 and SEQ ID NO: 24 for the strain Legionella pneumophila subsp. pneumophila str. Philadelphia 1 (SEQ ID NO: 36) 5 'GCTACTGCAGCAACATCCATAATAGTGCGTAAATATTGAGCTCGAATAGG TCCCCCAACCCAAACAAAATGTATTTTGGATGGTAGCGTACGGAGCTCAT ATTCAGATTTAGAATCGCTATCAGATTCAGAATCACTTTCATATTCAGAA TCGCTCATGAAACTCTCGCATAA 3' B) Genotyping Test The study group on epidemiological markers (the ESGEM) identified several criteria for determining the performance of a method of typing. A reliable method must be based on stable and identifiable markers on the typed isolates. The analysis of typing results should allow good discrimination between isolates while retaining epidemiological significance in a given context. Finally, and inherently experimental aspects, the technique must be reproducible to consider future standardization and automation. This typing method must be validated on a panel of strains whose characteristics must be known. These strains must have been typed by other methods to demonstrate technological improvement. The established performance criteria have been validated for the typing technique described by the present invention. This validation was carried out on a reference collection established by the EWGLI. This collection of 98 isolates, typed by SBT and monoclonal antibodies, is composed of three panels. The so-called discrimination panel includes 74 clinically unrelated epidemiologic isolates. The epidemiological concordance panel includes 16 isolates whose epidemiological link has been demonstrated. Finally, the so-called stability panel is represented by five variants of the same strain obtained by successive subcultures.35 1) Diversity of strains and discrimination index

Le traitement des résultats antérieurs de typage par MLVA (selon Pourcel et al.) et SBT (autre technique de l'art antérieur) a été réalisé par import des données numériques issues respectivement de Pourcel et al. et Ratzow et al. dans le logiciel bionumerics v.6.0 (Applied Maths). Les résultats de typage développé dans la présente invention sont traités par le logiciel bionumerics v.6.0 (Applied Maths) à partir des données exportées de GeneMapper® v.4.1 (Applied Biosystems). The treatment of the previous typing results by MLVA (according to Pourcel et al.) And SBT (another technique of the prior art) was performed by importing the digital data respectively from Pourcel et al. and Ratzow et al. in the software bionumerics v.6.0 (Applied Maths). The typing results developed in the present invention are processed by the bionumerics v.6.0 software (Applied Maths) from the exported data of GeneMapper® v.4.1 (Applied Biosystems).

L'agrégation ou clustering a été obtenu par la méthode l'UPGMA selon le coefficient « categorical » (Figures 2, 3 et 4). Les motifs ont été imposés par un seuil « cut-off » de 60% sur l'agrégation ou « clustering » des données issues du typage décrit par la présente invention (appelée dans la suite de la description MLVAl2_DS). Ces mêmes motifs ont été conservés pour les agrégations des données SBT à 7 loci (SBT7), à 6 loci (SBT6) et pour le MLVA décrit par Pourcel et col. (appelé ci-après MLVA8_CP) afin de visualiser la corrélation entre les différents protocoles. Cette concordance entre les différents résultats de comparaison peut mathématiquement être évaluée par un indice dit de congruence calculé selon le coefficient de corrélation de Pearson. Aggregation or clustering was obtained by the UPGMA method according to the "categorical" coefficient (Figures 2, 3 and 4). The reasons were imposed by a "cut-off" threshold of 60% on the aggregation or "clustering" of the data resulting from the typing described by the present invention (hereinafter referred to as MLVA12_DS). These same motifs were retained for the aggregations of SBT data at 7 loci (SBT7), at 6 loci (SBT6) and for the MLVA described by Pourcel et al. (hereinafter MLVA8_CP) to visualize the correlation between the different protocols. This concordance between the different comparison results can mathematically be evaluated by a congruence index calculated according to the Pearson correlation coefficient.

Les protocoles MLVAl2_DS et MLVA8_CP sont très congruents (conservation des motifs) (Figure 3) et l'indice de congruence élevé (83.8%). Il est intéressant de remarquer qu'un gain de congruence a été réalisé avec le SBT7 entre le MLVAl2 DS et le MLVA8CP respectivement de 46.5% à 64.3%. Cependant, pour la collection testée, la comparaison entre les protocoles de typage par MLVA et par SBT montrent quelques anomalies phylogénétiques révélées par une répartition désordonnée des motifs (Figure 4) et un indice de congruence médiocre (64.3%). En effet, bien que certains grands groupes soient bien conservés d'autres ne sont pas ancrés phylogénétiquement. Ces différences peuvent s'expliquer par une différence d'évolution des marqueurs MLVA et SBT et par l'impact des transferts horizontaux de gènes. Le calcul des indices de discrimination (D) a été déterminé, selon l'indice de Simpson, sur les 74 isolats appartenant au panel de discrimination. Les indices de discrimination de MLVAl2_DS, MLVA8_CP, SBT7 et SBT6 sont respectivement de 0.959, 0.920, 0.961 et 0.926 (Tableau 7 ci-dessous). Seuls les protocoles MLVAl2_DS et SBT7, dont les pouvoirs discriminant sont sensiblement les mêmes, satisfont aux recommandations de l'ESGEM (D>0.95). Il est intéressant de remarquer que les 12 VNTRs utilisés présentent des indices de discrimination très différents (Tableau 7). Certains marqueurs comme Lp0029, Lp0857 ou Lp0913 sont faiblement discriminant permettant ainsi d'enraciner l'arbre et de consolider certains groupes phylogénétiques ; d'autres comme Lp1428, Lp1644 ou Lp2990 sont davantage discriminants et assurent la distinction génotypique d'isolats appartenant à de grandes familles. Nom du VNTR Nombre Indice de Intervalle de confiance d'allèles discrimination de D à 95% (D) Lp0029 2 0.5054 [0.4928,0.5179] Lp0857 4 0.2710 [0.1389,0.4031 ] Lp0913 2 0.2936 [0.1788,0.4084] Lp 1428 18 0.8845 [0.8439,0.9251 ] Lp 1644 10 0.7790 [0.7152,0.8428] Lp2195 6 0.5391 [0.4512,0.6269] Lp2578 6 0.7020 [0.6196,0.7844] Lp2661 4 0.6649 [0.6203,0.7096] Lp2990 13 0.8430 [0.7851,0.9009] Lp3144 2 0.5054 [0.4928,0.5179] Lp3219 11 0.8275 [0.7683,0.8867] Lp3231 6 0.6501 [0.5821,0.7181] Protocole de Nombre de Indice de Intervalle de confiance typage génotypes discrimination de D à 95% MLVAl2_DS 41 0.9585 [0.9315,0.9856] Tableau 7 : Diversité du panel de discrimination (74 isolats) et indices de discrimination du protocole MLVAl2_DS et des VNTRs utilisés 2) Concordance épidémiologique Le panel de concordance épidémiologique comprend 16 souches réparties en 6 groupes composés d'isolats dont le lien épidémiologique a été établi. Chacun de ces groupes contient des isolats qui présentent le même profil génotypique unique selon le protocole décrit dans la présente invention (Figure 2). La technologie développée montre le degré maximal de concordance épidémiologique permettant son utilisation dans des contextes épidémiques précis. 3) Stabilité The MLVAl2_DS and MLVA8_CP protocols are very congruent (pattern conservation) (Figure 3) and the high congruence index (83.8%). It is interesting to note that a congruence gain was achieved with the SBT7 between the MLVAl2 DS and the MLVA8CP respectively from 46.5% to 64.3%. However, for the tested collection, the comparison between the MLVA and SBT typing protocols shows some phylogenetic abnormalities revealed by a disordered pattern distribution (Figure 4) and a poor congruency index (64.3%). Indeed, although some large groups are well conserved others are not phylogenetically anchored. These differences can be explained by a difference in the evolution of MLVA and SBT markers and by the impact of horizontal gene transfer. The calculation of the discrimination indices (D) was determined, according to Simpson's index, on the 74 isolates belonging to the discrimination panel. The discrimination indices of MLVA12_DS, MLVA8_CP, SBT7 and SBT6 are respectively 0.959, 0.920, 0.961 and 0.926 (Table 7 below). Only the MLVAl2_DS and SBT7 protocols, whose discriminant powers are essentially the same, satisfy the recommendations of the ESGEM (D> 0.95). It is interesting to note that the 12 VNTRs used have very different discrimination indices (Table 7). Some markers such as Lp0029, Lp0857 or Lp0913 are weakly discriminating thus allowing to root the tree and to consolidate certain phylogenetic groups; others such as Lp1428, Lp1644 or Lp2990 are more discriminating and ensure the genotypic distinction of isolates belonging to large families. VNTR name Number Confidence interval index of alleles D-discrimination at 95% (D) Lp0029 2 0.5054 [0.4928,0.5179] Lp0857 4 0.2710 [0.1389,0.4031] Lp0913 2 0.2936 [0.1788.0.4084] Lp 1428 18 0.8845 [ 0.8490 [0.7152.0.8428] Lp 1644 10 0.7790 [0.7152.0.8428] Lp2195 6 0.5391 [0.4512.0.6269] Lp2578 6 0.7020 [0.6196.0.7844] Lp2661 4 0.6649 [0.6203.0.7096] Lp2990 13 0.8430 [0.7851.0.9009] Lp3144 0.5054 [0.4928] , 0.5179] Lp3219 11 0.8275 [0.7683,0.8867] Lp3231 6 0.6501 [0.5821,0.7181] Confidence Interval Index Number Protocol typing genotype 95% D discrimination MLVAl2_DS 41 0.9585 [0.9315,0.9856] Table 7: Panel Diversity of discrimination (74 isolates) and discrimination indices of MLVA12_DS and VNTRs used 2) Epidemiological concordance The epidemiological concordance panel comprises 16 strains divided into 6 groups composed of isolates whose epidemiological link has been established. Each of these groups contains isolates that have the same unique genotypic profile according to the protocol described in the present invention (Figure 2). The technology developed shows the maximum degree of epidemiological concordance allowing its use in specific epidemic contexts. 3) Stability

Le panel de stabilité est constitué de 5 variants de la souche Corby. Ces variants ont le même génotype par le MLVAI2_DS prouvant ainsi la stabilité de cette méthode (Figure 2a). Ce panel prouve également que les structures génomiques de type VNTRs, de par leur stabilité, sont d'excellents marqueurs épidémiologiques. The stability panel consists of 5 variants of the Corby strain. These variants have the same genotype by the MLVAI2_DS proving the stability of this method (Figure 2a). This panel also proves that genomic structures of the VNTRs type, by their stability, are excellent epidemiological markers.

4) Typabilité Le typage a été réalisé sur 98 isolats avec 12 VNTRs, 1176 données devraient donc avoir été produites. Or, 18 données n'ont pas pu être obtenues et sont indiquées par un 0 dans l'arbre (Figure 2). Le MLVAI2 DS présente donc une typabilité de 98.5%, valeur très satisfaisante pour une méthode de typage (Tableau 8a ci-dessous). 4) Typing Typing was performed on 98 isolates with 12 VNTRs, so 1176 data should have been produced. However, 18 data could not be obtained and are indicated by a 0 in the tree (Figure 2). The MLVAI2 DS therefore has a typicity of 98.5%, a very satisfactory value for a typing method (Table 8a below).

Cependant, 3 isolats (Eu1060, Eu1040, Eu1047) concentrent la majorité de ces données manquantes ; si on exclut ces 3 isolats, le typabilité du MLVA 12_DS est de 99.6% (Tableau 8b ci-dessous). However, 3 isolates (Eu1060, Eu1040, Eu1047) concentrate the majority of these missing data; if these 3 isolates are excluded, the typicity of the MLVA 12_DS is 99.6% (Table 8b below).

Nom du Nombre de Typabilité VNTR données (en%) manquantes Lp0029 2 98 Lp0857 0 100 Lp0913 0 100 Lp1428 0 100 Lp1644 3 97 Lp2195 1 99 Lp2578 1 99 Lp2661 4 96 Lp2990 5 95 Lp3144 2 98 Lp3219 0 100 Lp3231 0 100 Protocole de Nombre de Typabilité typage données °) (en%) MLVAl2_DS 18 98.5 Tableau 8a : Typabilité du protocole MLVAl2 DS et des VNTRs utilisés sur la collection EWGLI (98 isolats) Nom du Nombre de Typabilité VNTR données °} manquantes (en~O Lp0029 0 100 Lp0857 0 100 Lp0913 0 100 Lp1428 0 100 Lp1644 0 100 Lp2195 1 99 Lp2578 1 99 Lp2661 0 100 Lp2990 3 97 Lp3144 0 100 Lp3219 0 100 Lp3231 0 100 Protocole de Nombre de Typabilité typage données (en% } manquantes MLVAl2_DS 5 99.6 Tableau 8b : Typabilité du protocole MLVAI2 DS et des VNTRs utilisés sur la collection EWGLI sauf Eu1040, Eul047 et Eu1060 (95 isolats) 5) Reproductibilité Les 98 isolats ont été typés deux fois et ont montré un même profil génotypique. Afin de valider cette reproductibilité, un plan expérimental précis a été mis en place. Ainsi, les trois souches de référence Lens (Eul 160), Paris (Eul 146) et Philadelphie (NCTC11192) ont été typées huit fois de manière indépendante. Les tailles observées de chaque locus pour les huit essais sont recensées sur les Tableaux 9a, 9b et 9c représentés en Figure 5. Un intervalle de confiance à 95% a été calculé selon un test de Student avec le coefficient de Student t(0.95 ; 8). Toutes les valeurs sont comprises dans leur intervalle de confiance respectif ; le typage décrit dans la présente invention est donc reproductible. Name of the Number of Typecapability VNTR data (in%) missing Lp0029 2 98 Lp0857 0 100 Lp0913 0 100 Lp1428 0 100 Lp1644 3 97 Lp2195 1 99 Lp2578 1 99 Lp2661 4 96 Lp2990 5 95 Lp3144 2 98 Lp3219 0 100 Lp3231 0 100 Number of typing data typing °) (in%) MLVAl2_DS 18 98.5 Table 8a: Typability of the MLVAl2 DS protocol and the VNTRs used on the EWGLI collection (98 isolates) Name of the number of VNTR characterization missing data (in ~ O Lp0029 0 100 Lp0857 0 100 Lp0913 0 100 Lp1428 0 100 Lp1644 0 100 Lp2195 1 99 Lp2578 1 99 Lp2661 0 100 Lp2990 3 97 Lp3144 0 100 Lp3219 0 100 Lp3231 0 100 Typing Number Protocol typing data (% missing) MLVAl2_DS 5 99.6 Table 8b: Typability of the MLVAI2 DS protocol and the VNTRs used on the EWGLI collection except Eu1040, Eul047 and Eu1060 (95 isolates) 5) Reproducibility The 98 isolates were typed twice and showed the same genotypic profile In order to validate this reproducibility, an expe plan Accurate rimental has been put in place. Thus, the three reference strains Lens (Eul 160), Paris (Eul 146) and Philadelphia (NCTC11192) have been typed eight times independently. The observed sizes of each locus for the eight trials are listed in Tables 9a, 9b and 9c shown in Figure 5. A 95% confidence interval was calculated according to a Student's t-test with the Student t coefficient (0.95; ). All values are within their respective confidence intervals; the typing described in the present invention is therefore reproducible.

Bien que l'invention ait été décrite en liaison avec un mode de réalisation particulier, il est bien évident qu'elle n'y est nullement limitée et qu'elle comprend tous les équivalents techniques des moyens décrits ainsi que leurs combinaisons si celles-ci entrent dans le cadre de l'invention. Although the invention has been described in connection with a particular embodiment, it is obvious that it is not limited thereto and that it comprises all the technical equivalents of the means described and their combinations if they are within the scope of the invention.

Claims

REVENDICATIONS1. A method of genotyping the Legionella pneumophila species by MLVA comprising the steps of: (i) co-amplifying at least eight VNTRs by multiplex PCR in a reaction medium comprising a DNA sample of Legionella pneumophila in order to forming a plurality of amplicons for each of the eight VNTRs, (ii) analyzing said amplicons by capillary electrophoresis to obtain an electrophoretic profile of said sample, and (iii) assigning a MLVA numerical code to said electrophoretic profile.

2. Genotyping method according to claim 1, wherein the MLVA numerical code of step (iii) is obtained automatically by computer, preferably from fragment analysis or genotyping software.

3. Genotyping method according to one of the preceding claims, wherein the reaction medium of step (i) comprises: at least eight sense sense primers and at least eight antisense primers, forming at least eight pairs of primers sense / antisense for each of which corresponds to a specific and different VNTR locus for each of the eight pairs of primers, each of the eight sense primers hybridizing upstream of its respective locus and each of the eight antisense primers hybridizing in downstream of its respective locus.

The genotyping method according to claim 3, wherein the at least eight sense primers are labeled with a 5 'fluorophore.

5. Genotyping method according to one of the preceding claims, wherein the at least eight primer pairs respectively antisense / direction of the eight loci VNTRs are selected from: SEQ ID NO: 1 / SEQ ID NO: 2; SEQ ID NO: 3 / SEQ ID NO: 4; SEQ ID NO: 5 / SEQ ID NO: 6; SEQ ID NO: 7 / SEQ ID NO: 8; SEQ ID NO: 9 / SEQ ID NO: 10; SEQ ID NO: 11 / SEQ ID NO: 12; SEQ ID NO: 131 SEQ ID NO: 14; SEQ ID NO: 15 / SEQ ID NO: 16; SEQ ID NO: 17 / SEQ ID NO: 18; SEQ ID NO: 191 SEQ ID NO: 20; SEQ ID NO: 21 / SEQ ID NO: 22; SEQ ID NO: 23 / SEQ ID NO: 24

6. Genotyping method according to one of the preceding claims, wherein is carried out in step (i), a co-amplification of twelve VNTRs loci by multiplex PCR.

7. A method of genotyping according to claim 6, wherein the reaction medium comprises the following pairs of primers respectively antisense / sense: SEQ ID NO: 1 ISEQ ID NO: 2; SEQ ID NO: 3 / SEQ ID NO: 4; SEQ ID NO: 51 SEQ ID NO: 6; SEQ ID NO: 7 / SEQ ID NO: 8; SEQ ID NO: 91 SEQ ID NO: IO; SEQ ID NO: III SEQ ID NO: 12; SEQ ID NO: 13 / SEQ ID NO: 14; SEQ ID NO: 151 SEQ ID NO: 16; SEQ ID NO: 171 SEQ ID NO: 18; SEQ ID NO: 191 SEQ ID NO: 20; SEQ ID NO: 211 SEQ ID NO: 22; SEQ ID NO: 231 SEQ ID NO: 24

8. Legionella pneumophila genotyping kit for carrying out the genotyping method according to one of claims 1 to 7, comprising: a reaction medium comprising at least eight sense-sense primers and at least eight antisense primers, forming at least eight pairs of sensant primers for each of which corresponds to a specific and different VNTR locus for each of the eight pairs of primers, each of the eight sense primers hybridizing upstream of its respective locus and each of the eight antisense primers; hybridizing downstream of its respective locus, - an amplification mix, - optionally a positive control and a false negative control, so as to validate the result and get rid of false positives or false negatives.

The genotyping kit according to claim 8, wherein the at least eight pairs of antisense / forward primers respectively of the eight VNTRs are selected from: SEQ ID NO: 1 / SEQ ID NO: 2; SEQ ID NO: 3 / SEQ ID NO: 4; SEQ ID NO: 51 SEQ ID NO: 6; SEQ ID NO: 7 / SEQ ID NO: 8; SEQ ID NO: 9 / SEQ ID NO: 10; SEQ ID NO: 111 SEQ ID NO: 12; SEQ ID NO: 13 / SEQ ID NO: 14; SEQ ID NO: 151 SEQ ID NO: 16; SEQ ID NO: 17 / SEQ ID NO: 18; SEQ ID NO: 19 / SEQ ID NO: 20; SEQ ID NO: 211 SEQ ID NO: 22; SEQ ID NO: 231 SEQ ID NO: 24.

10, genotyping kit according to one of claims 8 to 9, comprising a reaction medium which comprises the pairs of primers respectively antisense / direction as follows: SEQ ID NO: 1 1SEQ ID NO: 2; SEQ ID NO: 31 SEQ ID NO: 4; SEQ ID NO: 51 SEQ ID NO: 6; SEQ ID NO: 71 SEQ ID NO: 8; SEQ ID NO: 9 / SEQ ID NO: 10; SEQ ID NO: III SEQ ID NO: 12; SEQ ID NO: 131 SEQ ID NO: 14; SEQ ID NO: 151 SEQ ID NO: 16; SEQ ID NO: 17 / SEQ ID NO: 18; SEQ ID NO: 191 SEQ ID NO: 20; SEQ ID NO: 211 SEQ ID NO: 22; SEQ ID NO: 231 SEQ ID NO: 24.