FR2957090A1 - METHOD FOR EVALUATING THE IRRITANT POTENTIAL OF A TEST COMPOUND - Google Patents

Abstract

The invention relates to a method for evaluating the irritating potential of a test compound and to a kit for implementing said method.

Description

The present invention relates to a method for evaluating the irritating potential of a test compound and to a kit for carrying out said method.

The perfume, cosmetics and pharmacy industries must remain competitive and efficient and continue to offer new products on a regular basis, with the constraint of meeting the safety standards for humans and their environment attached to their use.

Irritation is a reversible inflammation of living tissue by chemical action at the site of contact. It is recognized by edema following an influx of fluids into the tissues, redness, heat and / or pain. In response to a chemical attack, epidermal keratinocytes and dermal fibroblasts are stimulated and will release into the skin cytokines IL1, TNF alpha, IL6, IL8, as well as mediators such as prostaglandins (PGE2) which will initiate the inflammatory response.

The deleterious effects caused by a chemical agent such as skin irritation is of major importance in dermatology and may prove to be a barrier to the placing on the market of new products.

The new European constraints now require the use of non-animal methods and it is therefore essential to develop alternative methods for determining whether a new composition or a new product is likely to pose a risk to the animal. man by its irritating properties.

From a histological point of view, sensitizing and irritating contact dermatitis are very similar. However, the clinical consequences are not similar and it is important to have reliable methodologies to distinguish them.

An original predictive approach is all the more necessary because currently no clear correlation has been demonstrated between a given molecular structure and its irritant and / or sensitizing power.

Current methods for predicting the irritant potential of a compound are on the one hand, based on the use of animals which is now prohibited, on the other hand are not quantitative and therefore do not allow to evaluate the irritating force of a molecule.

Manufacturers in the perfume and cosmetics industries are looking for methodologies to distinguish weak irritants from strong irritants, which would enable them to carry out marketing strategies for their products with much greater precision.

Surprisingly, the inventors have demonstrated that the response to the action of an irritating substance is directly on the skin without the intervention of immunocompetent cells, and that the degree of irritation of a molecule can be determined through the use of specific biomarkers of irritation.

The inventors have demonstrated that the epidermis is a sufficient model to demonstrate specific biomarkers of sensitization and / or irritation in humans and in mice, and that it is not necessary to add other cell types if the analysis of the identified genes is performed at a given time. The EPISKIN model can thus be the reference tissue for evaluating the sensitizing nature of a test component.

Thus, the present invention relates to a method for evaluating the irritating potential of a test compound, comprising the steps of: a) contacting a test compound with a biological sample; b) determining the level of expression of at least one gene selected from the group consisting of: 4.1 BBL (TNF superfamily member 9), COL7A1 (collagen, type VII, alpha 1), CTSD (cathepsin D), FDXR (ferredoxin reductase), GAA (glucosidase, alpha; acid), HAST (hyaluronan synthase 1) and RELT (Member 19 of the TNF superfamily receptor). Preferably, the method according to the present invention is an in vitro method.

Preferably, the method according to the present invention may further comprise a step c) of determining the irritating potential of a test compound.

Preferentially, said step c) may consist of a step of selecting said compound as having an irritating potential if the level of expression of said gene is greater than a threshold value.

Advantageously, said step c) makes it possible to evaluate the irritating force of said test compound.

As used herein, the term "biological sample" refers to any solid or liquid sample from a subject. Preferably, said biological sample is a skin sample.

In a particularly preferred manner, the skin sample is a skin sample reconstructed in vitro, such as for example the EpiSkin model (EPISKIN, Lyon France), EpiDermTM (MATEK Corporation, Ashland, MA) or SkinEthicTM RHE (SKINETHIC, Nice, France). ). Preferably, said skin sample reconstructed in vitro further comprises a keratin layer.

More preferably, the skin sample comprises only the epidermis and does not include the addition of other additional cell types, and still preferably no additional Langerhans cells.

The test compound may be a compound of varied nature, structure and origin, including a biological compound, a chemical compound, synthetic compound, etc. The test compound can be any product that is in an isolated form or in admixture with other products. The test compound can be defined in terms of structure and / or composition or be defined functionally. The test compound may, for example, be an isolated and structurally defined product, an isolated product of indefinite structure, a mixture of known and characterized products or a composition comprising one or more products. One or more compounds can thus be tested, in admixture or separately.

Such compositions may be, for example, samples of a cosmetic or dermatological product. Preferably, said test compound is suitable for use on the skin and can be used in a cosmetic or dermatological composition. By "irritating potential" is meant the risk for the test compound to cause reversible inflammation of living tissue by chemical action at the site of contact.

Preferably, said at least one gene is selected from the group consisting of: 4-10 1BBL, COL7A1, HAST and RELT.

The present invention is particularly suitable for the identification of a large number of compounds. This simple and efficient screening can be accomplished in a very short time. In particular, the described methods can be partially automated, thus enabling efficient and simultaneous screening of various and numerous compounds, either in the form of a mixture or in separate form.

Preferably, in the method according to the present invention, the level of expression of said gene is determined by measuring the level of expression of the polypeptide encoded by said gene or a fragment thereof, or by measuring the level of expression. mRNA of said gene or fragment thereof.

In a preferred embodiment, the level of expression of said at least one gene is performed by analyzing the expression of mRNA transcripts or mRNA precursors, such as native RNA, of said gene. Said assay can be performed by preparing the mRNA / cDNA of cells from a biological sample of a patient, and hybridizing the mRNA / cDNA with a reference polynucleotide. The mRNA / cDNA prepared can be used in a hybridization or amplification assay which includes, but is not limited to, Southern and Northen analyzes, polymerase chain reaction (PCR) assays, such as quantitative PCR ( Taqman) and the use of probes arrays such as GeneChip® DNA templates (AFFYMETRIX). Advantageously, the analysis of the expression level of transcribed mRNA of the said at least one gene involves a method of amplification of nucleic acids, such as, for example, RT-PCR (experimental embodiment described in US Pat. No. 4,683,202), the ligase chain reaction (BARANY, Proc Nat / Acad Sci USA, vol.88, p: 189-193, 1991), self sustained sequence replication (GUATELLI et al., Proc Natl Acad Sci USA, vol.87, p: 1874-1878). 1990), the transcriptional amplification system. (KWOH et al., Proc Natl Acad Sci USA, vol.86, p: 1173-1177, 1989), "Q-Beta Replicase" (LIZARDI et al., Biol Technology, vol.6, p: 1197, 1988), "rolling circle replication" (US Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by a step of detecting the amplified molecules by techniques well known in the art. skilled person. These detection modes are particularly useful for the detection of nucleic acid molecules in very small quantities. Thus, according to a preferred embodiment, the method according to the present invention comprises a further step of amplification of the mRNA or cDNA of said gene, of the sequence complementary thereto or of a fragment thereof. this.

As used herein, the amplification primers are defined as a pair of nucleic acid molecules that can match the 3 'and 5' regions of a gene, specifically (positive and negative strands, or conversely) and frame a short region of said gene. In general, the amplification primers have a length of 10 to 30 nucleotides and allow the amplification of a region of a length of between 50 and 200 nucleotides. Advantageously, the primers used in the context of the present invention are those listed in Table 1.

In another preferred embodiment, the determination of the level of expression of said at least one gene is performed by measuring the level of expression of the polypeptide encoded by said gene, or a fragment thereof. Said assay can be performed using an antibody (eg, a radiolabeled antibody, labeled with a chromophore, a fluorophore, or an enzyme), an antibody derivative (eg an antibody conjugated to a substrate or a protein or a ligand of a protein of a ligand / protein pair (eg, biotin-streptavidin)) or an antibody fragment (e.g., a single chain antibody, a hypervariable domain of an isolated antibody, etc.) that specifically binds to the polypeptide encoded by said gene. Said assays can be performed by many techniques within the abilities of those skilled in the art including, but not limited to, immunoassays based on the use of enzyme activity ("enzyme immunoassay" EIA), immunoassay based the use of radioactive isotopes (RIA), Western blot analysis and enzyme linked immunoabsorbent assay (ELISA).

For the purposes of the present invention, the term "polypeptide" means a sequence comprising at least two amino acids, and the terms "polypeptide", "peptide" and "protein" may be used interchangeably.

By "mRNA or cDNA fragment" is meant a sequence of at least 50 nucleic acids, for example at least 100 or 150 nucleic acids, preferably at least 200 nucleic acids. as an example of at least 250 or 350 nucleic acids, and particularly preferably a polypeptide of at least 400 nucleic acids.

By "fragment of the polypeptide" is meant a sequence of at least 50 amino acids, for example at least 100 or 150 amino acids, preferably at least 200 amino acids, for example at least 250 or 350 amino acids, and particularly preferably a polypeptide of at least 400 amino acids.

Preferably, the method according to the present invention further comprises a step of comparing the level of expression of said gene with a reference value.

This reference value can serve as a positive and / or negative control. Preferably, the step of comparing the level of expression of said gene with a reference value is carried out after step b).

A positive control can for example be performed by comparing the level of expression of said at least one gene in the presence of the test compound with the level of expression of said at least one gene in the presence of a compound known as an irritant. A negative control can be carried out in the absence of the test compound or in the presence of a compound known as non-sensitizing and non-irritating such as for example olive oil, glycerol, cetyl trimethylammonium bromide (CTAB) or dipropylene glycol.

In the context of the present invention, it will be concluded that a test compound has an irritating potential if overexpression of said gene is observed with respect to its level of expression in the absence of said test compound.

By "overexpression" is meant a significantly higher level of expression of said gene relative to its normal expression level. Preferably, overexpression means a level of expression in a biological sample which is greater than at least 20% of the normal level of expression of said gene, preferably greater than at least 50% of the normal level of expression of said gene, and particularly preferably at least 90% higher than the normal level of expression of said gene. The "level of expression in the absence of said test compound" or "normal level" is the level of expression of said gene in a control sample potentially corresponding to the biological sample of a patient not exhibiting irritation or, preferably, at the average level of expression of said gene in different control samples.

In addition, if it is concluded that a test compound is irritating, the determination of the level of expression of said at least one gene in the presence of the test compound will make it possible to evaluate the irritating force of the test compound.

Irritant force is defined as the degree of tissue inflammation at the site of contact. Thus, the greater the irritating force, the greater the degree of inflammation of the tissues at the site of contact. It is thus possible to perform a quantitative analysis of the irritating potential of a compound.

Examples of compounds known as irritants include sodium lauryl sulphate (SLS), octanoic acid, cholobenzene, lactic acid, bromobutane, methyl salicylate and butanol. Preferably, step b) of the method according to the present invention comprises determining the level of expression of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, and even more preferably at least 8 genes selected from the group consisting of: 4.1 BBL (member 9 of the superfamily 15 of TNF), COL7A1 (collagen, type VII, alpha 1), CTSD (cathepsin D), FDXR (ferredoxin reductase), GAA (glucosidase, alpha; acid), HAS 1 (hyaluronan synthase 1), RELT (Member 19 of the TNF superfamily receptor), IL-1A (interleukin 1, alpha) , IL-7R (Interleukin 7 receptor), IL-8 (Interleukin 8), JUN (oncogene jun), PLAUR (plasminogen activator, urokinase receptor) and TNF-A (tumor necrosis factor), preferably in the group consisting of: 4.1 BBL (member 9 of the TNF superfamily), COL7A1 (collagen, type VII, alpha 1), CTSD (cathepsin D), FDXR (ferredoxin reductase), GAA (glucosidase, alpha, acid), HAS1 ( hyaluronan synthase 1) and RELT (Member 19 of the TNF superfamily receptor). Thus, it can be concluded that a test compound has an irritating potential if overexpression of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, and even more preferably at least 8 genes selected from the group consisting of: 4.1 BBL (member 9 of the TNF superfamily), COL7A1 (collagen, type VII, alpha 1), CTSD (cathepsin D), FDXR (ferredoxin reductase), GAA (glucosidase, alpha; acid), HAS1 (hyaluronan synthase 1), RELT (Member 19 of the TNF superfamily receptor), IL-1A (interleukin 1, alpha), IL-7R (Receptor of interleukin 7), IL-8 (Interleukin 8), JUN (oncogene jun), PLAUR (activating plasminogen, urokinase receptor) and TNF-A (tumor necrosis factor) are observed in relation to their level of expression in 1 absence of said test compound. Preferably, step b) is carried out between 1 and 24 hours after step a), more preferably between 4 and 18 hours after step a), particularly preferably between 5 and 7 hours after step a) and preferably every 6 hours after step a). According to another aspect, the present invention relates to the use of at least one gene selected from the group consisting of: 4.1 BBL (member 9 of the TNF superfamily), COL7A1 (collagen, type VII, alpha 1) , CTSD (cathepsin D), FDXR (ferredoxin reductase), GAA (glucosidase, alpha; acid), HAS 1 (hyaluronan synthase 1) and RELT (Member 19 of the TNF superfamily receptor) for in vitro evaluation of potential irritant and / or the irritating force of a test compound.

The present invention also relates to a kit for implementing the method according to the present invention. Preferably, said kit will comprise at least one pair of primers allowing the amplification of at least one gene selected from the group consisting of 4.1 BBL (TNF superfamily member 9), COL7A1 (collagen, type VII, alpha 1), CTSD (cathepsin D), FDXR (ferredoxin reductase), GAA (glucosidase, alpha; acid), HAS1 (hyaluronan synthase 1) and RELT (Member 19 of the TNF superfamily of the receptor TNF). In a particularly preferred manner, said at least one pair of primer is chosen from Table 1.

Examples 1) Demonstration of biomarkers according to the Skinethic protocol 2957090 lo The skins, 1.07 cm 2, were purchased from EPISKIN. The different substances were applied either in liquid form (34l at different concentrations) or in solid form (341 PBS or olive oil + 30μg or less to evaluate different concentrations of powder) on the skins. After a 15 minute incubation at room temperature the skins were washed with PBS (25 ml) and incubated for 3 h, 6 h or 18 h at 37 ° C in a CO2 incubator. After incubation the skins were removed with a punch and separated from the collagen support. They were then directly placed in a solution of "Tri Reagent" (Ambion) (1 ml) and immediately mechanically dissociated.

Preparation of the cDNA The tissues were placed in a solution of "Tri Reagent" (Ambion) and milled mechanically. The RNA was prepared according to the protocol described by the manufacturer with isopropanol precipitation. For the preparation of the cDNA, the total RNAs are treated with a DNAse to remove contaminating genomic DNAs. For the treatment, 1 to 5 μg of total RNA are used with RNAse free DNAse RNAsin (1 μl) and random primers (3 μg). Superscipt III RT (1.5 μl at 200U / μl) is then added. The cDNAs are then tested by RT-PCR.

Quantitative PCR Real-time quantitative PCR was performed using SYBR Green technology from LC480 devices from Roche. The primers were designed to cover the intron-exon junctions to prevent possible traces of amplification of genomic DNA. The amplification gives amplicons between 100 and 150 bp. All primer pairs were qualified by restriction enzyme digestion and analyzed by electrophoresis. The PCR was carried out in 10 .mu.l using Roche's Sybr green 2X mix PCR PCR mix in PCR plates from Roche. The expression of the target genes was measured after normalization of the RNA by four housekeeping genes, and the values are expressed using the CT method, and expressed in terms of additional expression rate with respect to a theoretical zero (user Bulletin No. 2, Applied Biosystems, December 1997).

Results

For this analysis, a 15 min application followed by a 6 hour wash and post incubation before biopsy collection and gene transcription analysis were performed. The results are shown in Table 1. 11 12 Abbreviation Gene name English name Access number Forward primer Antisense primer 4.1 BBL Tumor necrosis superfamily superfamily NM 003811.3 CAGGGCATGTTTGCGCAGCTG AGCTCCTTCGTGTCCTCTTTGT TNF factor (ligand) - GT (SEQ ID NO: 13) (SEQ ID NO: 14) superfamily, member 9 COL7A1 collagen, type VII, alpha 1 collagen, type NM 000094.3 ACTGACCGAGTACCAAGTGAC GCTGTGGTATTCTGGATGGTCAG VII, alpha 1 - TGT (SEQ ID NO: 1) T (SEQ ID NO: 2 CTSD cathepsin D cathepsin D NM 001168903.1 TCCCGAGGTGCTCAAGAACTA AAGCGATGTCCAGCAGTTTGCAG CAT (SEQ ID NO: 3) T (SEQ ID NO: 4) FDXR ferredoxin reductase ferredoxin XM_001492615.2 TTTGTGCCAGAGAACGGACAT ACTGAATCATCTCCCGAAGCTCCT reductase CAC (SEQ ID NO: 5) (SEQ ID NO: 6) ) GAA glucosidase, alpha; glucosidase acid, NM_001079804.1 AGAACCTGAGCTCCTCTGAAA TCTCAGTCTCCATCATCACGTCCA alpha; acid TGG (SEQ ID NO: 7) (SEQ ID NO: 8) HAS1 hyaluronan synthase 1 hyaluronan NM 001523.2 GCGATACTGGGTAGCCTTCAA TGTACCAG GC CTCAAGAAACTG C synthase 1 TGT (SEQ ID NO: 9) T (SEQ ID NO: 10) RELT Member 19 of tumor necrosis NM 152222.1 AGATCACCATCTTGTCTGTGG ACCTCAGACACCATTGAACTTGTC superfamily of TNF factor receptor GCA (SEQ ID NO: 11) (SEQ ID NO: 12) superfamily receptor, member 19-like IL-1A interleukin 1, alpha interleukin 1, NM_000575.3 TAGTAGCAACCAACGGGAAG TGCTCAGGAAGCTAAAAGGTGC alpha GT (SEQ ID NO: 15) (SEQ ID NO: 16) IL-7R Receptor of Interleukin Interleukin 7 GA 002185.2 GAATGGATCGCAGCACTCACT TTCAGGCACTTTACCTCCACGAGG 7 Receptor GA (SEQ ID NO: 17) (SEQ ID NO: 18) IL-7R 8 Interleukin 8 Interleukin 8 NM 000584.2 CTCTCTTGGCAGCCTTCCTGAT GGGTGGAAAGGTTTGGAGTATG TT (SEQ ID NO: 19) (SEQ ID NO: 20) JUN oncogene jun jun oncogene NM_002228.3 TGGAAACGACCTTCTATGACG AGGGTCATGCTCTGTTTCAGGAT AT (SEQ ID NO: 21) (SEQ ID NO: 22) PLAUR plasminogen activator, plasmino CTGCAACACCACCAAATGCAA CGGCAGTCAATGAGGAAAGTCTCT urokinase receptor activator, CGA (SEQ ID NO: 23) (SEQ ID NO: 24) Urokinase receptor TNF-A Tumor necrosis tumor necrosis NM 000594.2 GATCATCTTCTCGAACCCCGA ACTGGAGCTGCCCCTCAGCTTGA Factor (TNF GTG (SEQ ID NO: 25 ) (SEQ ID NO: 26) superfamily, member 2) Table 1 2) Quantitative analysis The substances in Table 2 were used as irritant controls (SLS, octanoic acid, Cholobenzene, lactic acid, bromo-butane, methyl salicylate, butanol) and non-irritating (glycerol, Cetyl trimethylammonium bromide and Dipropylene Glycol). Class Name CAS # Abbreviation No ù Cetyl trimethylammonium bromide 57-09-0 CTAB Irritant No ù Dipropylene Glycol 25265-71-8 LG Irritant No ù Glycerol 56-81-5 Glyc Irritant Irritant Octanoic acid / caprylic acid 124-07-2 OA Irritant Lactic Acid 598-82-3 LA Irritant nButanol- 1Butanol 71-36-3 Purpose Irritant Lauryl Sodium Sulphate 151-21-3 SLS Irritant Chlorobenzene 108-90-7 CBZ Irritant BromoButane 109-65-9 Irritant BrBut Methylsalicylate 119-36 Table 2 shows the level of expression of the biomarkers of irritation for these different substances. It is clear that irritants strongly induce most biomarkers.

It is also noted that in the case of already known biomarkers (TNF-A, IL-1, IL-7, PLAUR, IL-8, JUN), at least one of the non-irritating substances (CTAB, DPG or Glycerol) induces expression of these genes which may lead to the definition of false positive substances if only these markers are used. Thus it can be deduced that, preferably, if at least 6 genes tested are overexpressed compared to the untreated control and / or the average increase in the expression of these genes exceeds 2, then the substance is considered irritating in a certain way.

Table 3: Expression-Specific Gene Expression Rates in the EPISKIN Model 16 Substance Property Q D J? QHQ = Û m J il H c Û SLS 5% Irritant 49.1 3.6 24.4 6.3 10.2 11.2 6.6 4.4 48.2 1.4 1.6 1.8 7 Chlorobenzene Irritant 38.3 8.5 3.2 18.4 3.7 1.6 3.2 2 23.4 1.4 1.3 1.3 4.5 Irritant acid 40.7 1.5 14.7 8.1 30.4 5.5 21.4 9.3 55 4.1 2.9 3.8 41.2 octanoic Butanol Irritating 17.5 1.4 13.3 0.5 19.1 0.6 13 , 4 9,4 1,8 1,6 3,3 2,5 15,7 Methyl Irritant 32,3 2,7 5,2 2,7 1,2 1,3 3,3 55,2 4,1 1 , 6 1,4 2,2 18,1 salicylate Bromo-butane Irritant 34,3 9.2 12.2 14.3 30.5 18 20.6 46.2 1.5 2.9 3.4 6.7 69.6 Lactic acid Irritant 1.2 0.4 0.7 2.2 2.7 2.6 3.3 1.5 2.4 1.6 1.4 2.2 6.9 Glycerol No 0.6 1.1 1.1 0.8 0.5 0.5 0.4 0.4 0.7 0.6 1.6 0.3 0.6 Irritant Diprobpylene No 2.6 1.7 1.1 0, 7 0.8 1.8 1.0 0.4 0.1 0.6 0.3 1.1 1.2 Irritant CTAB No 2.2 1.0 1.4 1.6 0.7 1.1 0 , 6 0.6 0.7 0.5 1 0.6 0.8 Irritant Table 3 In addition, for substances that are too corrosive, such as SLS at doses greater than 10% or lactic acid greater than 1%, tissue degradation is then too important, even with a contact time limited to 15 minutes, the amount of RNA collected is then too low to be analyzed by RT-PCR.

Typically, this amount is 20 μg / cm 2, the analysis is not carried out if this level is less than 15 μg / cm 2 of skin.

In addition, dose-dependent response analyzes with SLS have shown that IL-8, 4-1BBL or col7Al biomarkers can be used to quantify the strength of irritation, as shown in Figure 1. .

Indeed, Figure 1 shows a linearity in the level of expression of these 3 genes relative to the amount, thus demonstrating a dose-dependent reaction. It is therefore possible to use the SLS at different doses to establish a standard curve for each experiment. This is of interest to the extent that the thickness, in particular of the stratum corneum, introduces variations between the experiments, in particular by slowing the rate of penetration, which has an influence on the level of expression observed at 6 h. However, whatever the conditions used, a linearity in the expression as a function of the dose is observed and it is possible to find the same values of irritation force, as shown in the following Table 4. The value of the SLS 5% was arbitrarily set at 1. The methyl salicylate at 10% is not irritating in the test. 18 gene SLS 5% SLS 1% Chlorob Bromobutane pure Bromob Methyl Methyl enzene utane salicylate salicylate 50% 10% 50% 10% Expl IL-8 1 0.2 0.31 4.2 0.3 0.72 0 4-1BBL 1 0.21 0.42 4.1 0.32 0.81 0 Co17A1 1 0.28 0.27 3.2 0.27 0.68 0 Exp2 IL-8 1 0.14 0.2 3.9 0 , 41 0.81 0 4-1BBL 1 0.17 0.36 3.7 0.37 1.1 Co17A1 1 0.25 0.28 2.8 0.22 0.72 0 Exp3 IL-8 1 0 , 19 0.38 4.1 0.32 0.83 0 4-1BBL 1 0.21 0.46 3.9 0.31 0.89 0 Co17A1 1 0.19 0.32 3.5 0.24 0 , 74 0 Table 4: quantitative analysis of irritant

Claims (11)

REVENDICATIONS1. A method of evaluating the irritating potential of a test compound, comprising the steps of: a) contacting a test compound with a biological sample; b) determining the level of expression of at least one gene selected from the group consisting of: 4.1 BBL (TNF superfamily member 9), COL7A1 (collagen, type VII, alpha 1), CTSD (cathepsin D), FDXR (ferredoxin reductase), GAA (glucosidase, alpha; acid), HAST (hyaluronan synthase 1) and RELT (Member 19 of the TNF superfamily receptor). 2. Evaluation method according to claim 1, further comprising a step of comparing the level of expression of said at least one gene with a reference value. 3. Evaluation method according to one of claims 1 or 2, wherein the level of expression of said at least one gene is determined by measuring the level of expression of the polypeptide encoded by said gene or a fragment thereof or by measuring the level of expression of the mRNA of the at least one gene or fragment thereof. 4. Evaluation method according to any one of the preceding claims, comprising a further step of amplifying the mRNA or cDNA of said at least one gene, the complementary sequence thereof or a fragment. of it. 5. Method according to any one of the preceding claims, characterized in that the biological sample is a skin sample, preferably a skin sample reconstructed in vitro. The method according to any one of the preceding claims, wherein step b) comprises determining the level of expression of at least 2, at least 3, at least 4, at least 5. , at least 6, at least 7, and even more preferably at least 8 genes selected from the group consisting of: 4.1 BBL (TNF superfamily member 9), COL7A1 (collagen, type VII, alpha 1 ), CTSD (cathepsin D), FDXR (ferredoxin reductase), GAA (glucosidase, alpha, acid), HAS1 (hyaluronan synthase 1), RELT (Member 19 of the TNF superfamily receptor), IL-1A (interleukin 1, alpha ), IL-7R (Interleukin receptor) 7), IL-8 (Interleukin 8), JUN (oncogene jun), PLAUR (plasminogen activator, urokinase receptor) and TNF-A (tumor necrosis factor). The method according to any of the preceding claims, wherein step b) is performed between 2 and 24 hours after step a), more preferably between 4 and 18 hours after step a), particularly preferably between 5 and 7 hours after step a) and preferably between 6 hours after step a). 8. A method according to any one of the preceding claims, wherein step c) makes it possible to evaluate the irritating force of said test compound. 9. Use of at least one gene selected from the group consisting of: 4.1 BBL (member 9 of the TNF superfamily), COL7A1 (collagen, type VII, alpha 1), CTSD (cathepsin D), FDXR (ferredoxin reductase) GAA (glucosidase, alpha; acid), HAS1 (hyaluronan synthase 1) and RELT (Member 19 of the TNF superfamily receptor), for the in vitro evaluation of the irritant potential and / or irritancy of a test compound . 10. A kit for carrying out a method according to any one of the preceding claims. 11. Kit according to claim 10, comprising at least one pair of primers allowing the amplification of at least one gene selected from the group consisting of: 4.1 BBL (member 9 of the TNF superfamily), COL7A1 (collagen, type VII, alpha 1), CTSD (cathepsin D), FDXR (ferredoxin reductase), GAA (glucosidase, alpha; acid), HAST (hyaluronan synthase 1) and RELT (Member 19 of the TNF superfamily receptor).