FR2863484A1 - Cosmetic use of compounds capable of acting on the dopachrome tautomerase metabolic pathway as agents for protecting hair follicle melanocytes, e.g. for preventing gray hair - Google Patents
Cosmetic use of compounds capable of acting on the dopachrome tautomerase metabolic pathway as agents for protecting hair follicle melanocytes, e.g. for preventing gray hair Download PDFInfo
- Publication number
- FR2863484A1 FR2863484A1 FR0351029A FR0351029A FR2863484A1 FR 2863484 A1 FR2863484 A1 FR 2863484A1 FR 0351029 A FR0351029 A FR 0351029A FR 0351029 A FR0351029 A FR 0351029A FR 2863484 A1 FR2863484 A1 FR 2863484A1
- Authority
- FR
- France
- Prior art keywords
- hair
- acting
- metabolic pathway
- melanocytes
- dopachrome tautomerase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q5/00—Preparations for care of the hair
- A61Q5/06—Preparations for styling the hair, e.g. by temporary shaping or colouring
- A61Q5/065—Preparations for temporary colouring the hair, e.g. direct dyes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/58—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing atoms other than carbon, hydrogen, halogen, oxygen, nitrogen, sulfur or phosphorus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q5/00—Preparations for care of the hair
- A61Q5/10—Preparations for permanently dyeing the hair
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/70—Biological properties of the composition as a whole
Abstract
Description
La présente invention se rapporte à l'utilisation cosmétique d'un composéThe present invention relates to the cosmetic use of a compound
capable d'agir sur la voie métabolique de la DOPAchrome tautomérase, en tant qu'agent protecteur des mélanocytes du follicule pileux. En particulier, ce composé est destiné à lutter contre la disparition des mélanocytes du follicule pileux en maintenant et/ou régénérant la capable of acting on the metabolic pathway of DOPAchrome tautomerase, as a protective agent of melanocytes of the hair follicle. In particular, this compound is intended to combat the disappearance of melanocytes from the hair follicle by maintaining and / or regenerating the hair follicle.
population des mélanocytes actifs du bulbe et des mélanocytes quiescents de la région supérieure du follicule pileux. population of active melanocytes of the bulb and quiescent melanocytes of the upper region of the hair follicle.
Le follicule pileux est une invagination tubulaire de l'épiderme qui s'enfonce jusqu'aux couches profondes du derme. La partie inférieure, ou bulbe pileux, comporte elle-même une invagination dans laquelle se trouve la papille dermique. La partie inférieure du bulbe est une zone de prolifération cellulaire où se trouvent les précurseurs des cellules kératinisées constituant le cheveu. Les cellules en ascension issues de ces précurseurs se kératinisent progressivement dans la partie supérieure du bulbe, et cet ensemble de cellules kératinisées formera la tige pilaire. The hair follicle is a tubular invagination of the epidermis that penetrates to the deep layers of the dermis. The lower part, or hairy bulb, itself contains an intussusception in which is the dermal papilla. The lower part of the bulb is a zone of cellular proliferation where the precursors of the keratinized cells constituting the hair are found. Ascending cells from these precursors keratinize progressively in the upper part of the bulb, and this set of keratinized cells will form the hair shaft.
La couleur des cheveux et des poils repose notamment sur la présence en quantités et ratios variables de deux groupes de mélanines: les eumélanines (pigments bruns et noirs) et les phéomélanines (pigments rouges et jaunes). La pigmentation du cheveu et des poils requiert la présence de mélanocytes au niveau du bulbe du follicule pileux. The color of hair and hair is based in particular on the presence in quantities and variable ratios of two groups of melanins: eumelanins (brown and black pigments) and pheomelanines (red and yellow pigments). The pigmentation of hair and hair requires the presence of melanocytes in the bulb of the hair follicle.
Ces mélanocytes sont dans un état actif, c'est-à-dire qu'ils synthétisent des mélanines. Ces pigments sont transmis aux kératinocytes destinés à former la tige pilaire ce qui conduira à la pousse d'un cheveu ou d'un poil pigmenté. Cette structure est appelée ci-après unité folliculaire de pigmentation . These melanocytes are in an active state, i.e. they synthesize melanins. These pigments are transmitted to the keratinocytes intended to form the hair shaft which will lead to the growth of a pigmented hair or hair. This structure is hereinafter called follicular unit of pigmentation.
Chez les mammifères, la mélanogénèse implique au moins trois enzymes: la 25 tyrosinase, la DOPAchrome tautomérase (TRP-2, pour Tyrosinase Related Protein 2) et la DHICAoxydase (TRP-1, pour Tyrosinase Related Protein 1). In mammals, melanogenesis involves at least three enzymes: tyrosinase, DOPAchrome tautomerase (TRP-2, for Tyrosinase Related Protein 2), and DHICAoxidase (TRP-1, for Tyrosinase Related Protein 1).
La tyrosinase est l'enzyme qui initie la biosynthèse des mélanines. Elle est également décrite comme étant l'enzyme limitante de la mélanogénèse. Tyrosinase is the enzyme that initiates the biosynthesis of melanins. It is also described as the limiting enzyme of melanogenesis.
La TRP-2 catalyse la tautomérisation du DOPAchrome en acide 5,6Dihydroxyindole-2-30 carboxylique (DHICA). En l'absence de TRP-2, le DOPAchrome subit une décarboxylation spontanée pour former le 5,6dihydroxyindole (DHI). TRP-2 catalyzes the tautomerization of DOPAchrome to 5,6-dihydroxyindole-2-30 carboxylic acid (DHICA). In the absence of TRP-2, DOPAchrome undergoes spontaneous decarboxylation to form 5,6-dihydroxyindole (DHI).
DHICA et DHI sont tous deux des précurseurs de pigments, TRP-1 oxyde les molécules de DHICA pour former des dérivés de quinones (Pawelek JM and Chakraborty AK. The enzymology of melanogenesis. In: Nordlund JJ, Boissy RE, Hearing VJ, King RA, Or-tonne J-P. The Pigmentary System: Physiology and Pathophysiology. New York: Oxford university press; 1998. p. 391-400). DHICA and DHI are both precursors of pigments, TRP-1 oxidizes DHICA molecules to form quinone derivatives (Pawelek JM and Chakraborty AK.) The enzymology of melanogenesis In: Nordlund JJ, Boissy RE, Hearing VJ, King RA , Or-ton JP, The Pigmentary System: Physiology and Pathophysiology, New York: Oxford University Press, 1998. pp. 391-400).
Les trois enzymes, tyrosinase, TRP-2 et TRP-1, apparaissent spécifiquement impliquées dans la mélanogénèse. De plus, l'activité de ces trois enzymes a été décrite comme nécessaire à l'activité maximale de biosynthèse des eumélanines. The three enzymes, tyrosinase, TRP-2 and TRP-1, appear specifically involved in melanogenesis. In addition, the activity of these three enzymes has been described as necessary for maximal activity of eumelanin biosynthesis.
L'expression de TRP-2 a été observée dans les poils de souris noires, à la fois dans les mélanocytes actifs du bulbe et dans les mélanocytes quiescents de la gaine épithéliale externe. De plus, il est connu que l'activité DOPAchrome tautomérase est augmentée pendant la phase anagène chez la souris noire. Cependant aucune corrélation claire n'a été établie entre l'expression de TRP-2 et l'intensité de la pigmentation (Sturm et al. 1995). TRP-2 expression was observed in black mouse hairs, both in the active melanocytes of the bulb and in the quiescent melanocytes of the outer epithelial sheath. In addition, it is known that the DOPAchrome tautomerase activity is increased during the anagen phase in the black mouse. However, no clear correlation was found between TRP-2 expression and pigmentation intensity (Sturm et al., 1995).
Par ailleurs, TRP-2 a également été décrite comme conférant aux mélanocytes qui l'expriment une résistance à des agents endommageant l'ADN tel que le cisdiamminedichloroplatinum(II) (Chu et al. 2000 et Pak et al. 2000). Ces résultats suggèrent que TRP-2 serait aussi impliquée dans une fonction indépendante de la mélanogènèse, l'enzyme pourrait jouer un rôle cytoprotecteur. Moreover, TRP-2 has also been described as conferring on the melanocytes that express it resistance to DNA damaging agents such as cisdiamminedichloroplatinum (II) (Chu et al., 2000 and Pak et al., 2000). These results suggest that TRP-2 would also be involved in a function independent of melanogenesis, the enzyme could play a cytoprotective role.
Le cheveu et le poil subissent un cycle. Ce cycle comprend une phase de croissance (phase anagène), une phase de dégénérescence (phase catagène) et une phase de repos (phase télogène) à la suite de laquelle une nouvelle phase anagène se développera. En raison de ce cycle pilaire, et contrairement à l'unité de pigmentation épidermique, l'unité folliculaire de pigmentation doit également être cycliquement renouvelée. Hair and hair undergo a cycle. This cycle comprises a growth phase (anagen phase), a degeneration phase (catagen phase) and a rest phase (telogen phase) following which a new anagen phase will develop. Because of this hair cycle, and unlike the epidermal pigmentation unit, the follicular unit of pigmentation must also be cyclically renewed.
Ce processus a été récemment décrit chez l'homme (Commo S. et Bernard B., 2000, Pigment Cell Res. 13:253-259). II a plus particulièrement été montré qu'au cours de la transition télogène-anagène, une partie des mélanocytes inactifs contenus dans la capsule télogène prolifère, se positionne autour de la papille dermique du bulbe naissant et commence à exprimer des enzymes nécessaires à la synthèse de mélanines: cette population de mélanocytes correspond aux mélanocytes actifs du bulbe. En parallèle, l'autre partie des mélanocytes reste inactive dans la région supérieure du follicule pileux: cette population de mélanocytes correspond aux mélanocytes quiescents de la région supérieure du follicule pileux. This process has recently been described in humans (Commo S. and Bernard B., 2000, Pigment Cell Res 13: 253-259). In particular, it has been shown that during the telogen-anagen transition, a part of the inactive melanocytes contained in the telogen capsule proliferates, is positioned around the dermal papilla of the incipient bulb and begins to express enzymes necessary for the synthesis of melanins: this population of melanocytes corresponds to the active melanocytes of the bulb. In parallel, the other part of the melanocytes remains inactive in the upper region of the hair follicle: this population of melanocytes corresponds to the quiescent melanocytes of the upper region of the hair follicle.
Ces enzymes mélanogènes seront exprimées dans les mélanocytes du bulbe pendant toute la durée de la phase anagène mais ne seront plus exprimées pendant les phases catagène et télogène. Le cycle normal des mélanocytes dans le follicule pileux humain requiert la présence de mélanocytes quiescents dans la région supérieure du follicule pileux, région autrement nommée réservoir , qui seront cycliquement activés pour régénérer l'unité folliculaire de pigmentation. Ce mécanisme de renouvellement cellulaire participant au maintien de la pigmentation est spécifique de l'unité folliculaire de pigmentation; on ne le retrouve pas dans l'unité épidermique de pigmentation. These melanogenic enzymes will be expressed in the melanocytes of the bulb throughout the duration of the anagen phase but will no longer be expressed during the catagen and telogen phases. The normal cycle of melanocytes in the human hair follicle requires the presence of quiescent melanocytes in the upper region of the hair follicle, a region otherwise named reservoir, which will be cyclically activated to regenerate the follicular unit of pigmentation. This cell renewal mechanism participating in the maintenance of pigmentation is specific to the follicular unit of pigmentation; it is not found in the epidermal unit of pigmentation.
Il est admis que la canitie (blanchissement naturel des cheveux) est associée à une diminution de mélanine dans la tige pilaire. La cause de cette diminution n'est pas à ce jour élucidée. Plusieurs hypothèses sont avancées, elle pourrait être liée à une diminution de l'activité mélanogène, par analogie au mécanisme de pigmentation de la peau, mais également à une altération du transfert des mélanines ou à une diminution lo du nombre de mélanocytes dans le bulbe (Tobin et Paus, 2001) ; aucune démonstration n'a permis à ce jour de valider l'une ou l'autre de ces hypothèses. It is accepted that canitia (natural whitening of the hair) is associated with a decrease of melanin in the hair shaft. The cause of this decrease is not yet clear. Several hypotheses are advanced, it could be related to a decrease in melanogenic activity, by analogy to the mechanism of skin pigmentation, but also to an alteration of melanin transfer or a decrease lo of the number of melanocytes in the bulb ( Tobin and Paus, 2001); no demonstration has to date validated one or the other of these hypotheses.
Or la Demanderesse a mis en évidence deux résultats qui valident pour la première fois l'hypothèse selon laquelle la canitie serait liée à une diminution du nombre de mélanocytes actifs dans le bulbe et une diminution du nombre de mélanocytes quiescents dans la région supérieure du follicule pileux. Cette diminution et/ou disparition précoce des mélanocytes est spécifique au follicule pileux et n'affecte pas de façon visible l'épiderme. However, the Applicant has shown two results which validate for the first time the hypothesis that canitia is linked to a decrease in the number of active melanocytes in the bulb and a decrease in the number of quiescent melanocytes in the upper region of the hair follicle. . This decrease and / or early disappearance of melanocytes is specific to the hair follicle and does not visibly affect the epidermis.
Jusqu'à présent, on pensait en effet que des mélanocytes quiescents étaient présents dans les follicules pileux de cheveux blancs (Takada et al. 1992, Horikawa et al. 1996, Jenner et Randall 2000). Until now, it was thought that quiescent melanocytes were present in hair follicles of white hair (Takada et al 1992, Horikawa et al., 1996, Jenner and Randall 2000).
Or, la Demanderesse a constaté que la progression de la canitie est associée à une diminution du nombre de mélanocytes dans les bulbes pileux, qui, bien qu'en nombre restreint, synthétisent et transfèrent les mélanines. La Demanderesse a également observé de façon inattendue et surprenante que la population de mélanocytes quiescents de la région supérieure du follicule pileux humain (encore appelée réservoir ) est également diminuée au cours du processus de canitie, les cheveux blancs ne possédant plus que quelques - voire plus aucun - mélanocytes, contrairement à l'infundibulum et l'épiderme avoisinant ces cheveux blancs. Cette disparition affecte prématurément et spécifiquement les mélanocytes contenus dans les cheveux. However, the Applicant has found that the progression of canities is associated with a decrease in the number of melanocytes in hair bulbs, which, although limited in number, synthesize and transfer melanins. The Applicant has also unexpectedly and surprisingly observed that the quiescent melanocyte population of the upper region of the human hair follicle (also called reservoir) is also diminished during the process of canities, the white hair having only a few - or even more none - melanocytes, unlike the infundibulum and the epidermis bordering these white hairs. This disappearance affects prematurely and specifically the melanocytes contained in the hair.
Il apparaît donc nécessaire de lutter contre la disparition des mélanocytes des follicules pileux humains, processus affectant à la fois les mélanocytes actifs des bulbes et les mélanocytes quiescents de la région supérieure des follicules pileux, pour lutter contre la canitie. It therefore seems necessary to fight against the disappearance of melanocytes from human hair follicles, a process that affects both the active melanocytes of the bulbs and the quiescent melanocytes of the upper region of the hair follicles, to fight against canities.
Par ailleurs, la Demanderesse a également constaté de façon inattendue que l'enzyme TRP-2 n'est pas exprimée dans les mélanocytes des follicules pileux humains pigmentés (bruns, noirs et roux) chez l'individu caucasien, asiatique et africain. Cette enzyme n'est détectée ni dans les mélanocytes actifs du bulbe, ni dans les mélanocytes quiescents de la région supérieure du follicule pileux humain alors qu'elle est exprimée dans l'épiderme et l'infundibulum de l'individu caucasien, africain et asiatique. L'absence de TRP-2 est associée à la disparition précoce des mélanocytes qui ne l'expriment pas, c'est-à-dire, les mélanocytes quiescents de la région supérieure du follicule pileux et les mélanocytes actifs du bulbe. Moreover, the Applicant has also unexpectedly found that the TRP-2 enzyme is not expressed in the melanocytes of pigmented human hair follicles (brown, black and red) in the Caucasian, Asian and African individual. This enzyme is detected neither in the active melanocytes of the bulb nor in the quiescent melanocytes of the upper region of the human hair follicle, whereas it is expressed in the epidermis and infundibulum of the Caucasian, African and Asian individual. . The absence of TRP-2 is associated with the early disappearance of melanocytes that do not express it, ie, the quiescent melanocytes of the upper hair follicle region and the active melanocytes of the bulb.
La Demanderesse a donc mis en évidence que TRP2, qui joue un rôle dans la mélanogénèse (synthèse de mélanine) au niveau de l'unité épidermique de pigmentation, joue un rôle différent et méconnu jusqu'ici, à savoir un rôle cytoprotecteur: la présence d'un composé capable d'agir sur la voie métabolique de TRP2 permet de maintenir et/ou régénérer la population de mélanocytes quiescents de la région supérieure du follicule pileux et la population de mélanocytes actifs du bulbe et favoriser ainsi le renouvellement cyclique de l'unité folliculaire garant du maintien de la pigmentation des cheveux, cils et/ou poils. The Applicant has thus demonstrated that TRP2, which plays a role in melanogenesis (melanin synthesis) at the level of the epidermal pigmentation unit, plays a different and previously unknown role, namely a cytoprotective role: the presence of a compound capable of acting on the metabolic pathway of TRP2 makes it possible to maintain and / or regenerate the population of quiescent melanocytes of the upper region of the hair follicle and the population of active melanocytes of the bulb and thus to promote the cyclic renewal of the follicular unit ensuring the maintenance of the pigmentation of hair, eyelashes and / or hair.
La Demanderesse a identifié un moyen de maintenir et/ou régénérer la population de mélanocytes du follicule pileux responsables de la pigmentation des cheveux: en effet, elle a montré qu'il était possible d'agir sur la voie métabolique contrôlée par TRP-2. The Applicant has identified a means of maintaining and / or regenerating the hair follicle melanocyte population responsible for hair pigmentation: indeed, it has shown that it is possible to act on the TRP-2 controlled metabolic pathway.
TRP-2 a une activité métabolique qui permet de protéger les mélanocytes suivant trois 25 processus distincts: (i) TRP-2 transforme un métabolite M1 toxique en un métabolite M'1 non toxique; (ii) TRP-2 transforme un métabolite M2 non toxique en un autre métabolite M'2 non toxique empêchant ainsi la production d'un métabolite M"2 toxique qui serait produit à partir de M2 sans l'intervention de TRP-2; (iii) TRP-2 transforme un métabolite M3 non toxique en un métabolite M'3 bénéfique à la survie des mélanocytes. TRP-2 has a metabolic activity that protects melanocytes following three distinct processes: (i) TRP-2 transforms a toxic M1 metabolite into a non-toxic metabolite M'1; (ii) TRP-2 transforms a non-toxic M2 metabolite into another non-toxic metabolite M'2, thereby preventing the production of a toxic metabolite M-2 that would be produced from M2 without the intervention of TRP-2; iii) TRP-2 transforms a non-toxic M3 metabolite into an M'3 metabolite beneficial to melanocyte survival.
Ainsi selon l'invention, un composé capable d'agir sur la voie métabolique de TRP-2 35 pour protéger les mélanocytes du follicule pileux peut agir de trois façons: (1) par des composés capables de dégrader ou capter le métabolite M1 toxique; (2) par des composés capables de capter le métabolite M"2 toxique et/ou capables de freiner sa production; (3) par des composés capables de favoriser la production du métabolite M'3. Thus according to the invention, a compound capable of acting on the metabolic pathway of TRP-2 to protect melanocytes from the hair follicle can act in three ways: (1) by compounds capable of degrading or capturing the toxic M1 metabolite; (2) compounds capable of capturing the toxic metabolite M "2 and / or capable of curbing its production, and (3) compounds capable of promoting the production of the metabolite M'3.
Par ailleurs, la Demanderesse a évalué l'activité cytoprotectrice de composés capables d'agir sur la voie métabolique de TRP2 dans des conditions induisant l'apoptose et/ou la 10 sénescence des mélanocytes du follicule pileux. Moreover, the Applicant has evaluated the cytoprotective activity of compounds capable of acting on the metabolic pathway of TRP2 under conditions inducing the apoptosis and / or senescence of the melanocytes of the hair follicle.
Elle a ainsi mis au point un moyen pour prévenir et/ou limiter et/ou stopper le développement de la canitie et même de maintenir la pigmentation naturelle des cheveux et/ou des poils gris ou blancs. She has thus developed a means to prevent and / or limit and / or stop the development of canities and even to maintain the natural pigmentation of hair and / or gray or white hairs.
Ainsi un premier objet de l'invention se rapporte à l'utilisation cosmétique d'un composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase, en tant qu'agent protecteur des mélanocytes du follicule pileux. Thus, a first object of the invention relates to the cosmetic use of a compound capable of acting on the metabolic pathway of DOPAchrome tautomerase, as a protective agent for the melanocytes of the hair follicle.
Par 'agent protecteur des mélanocytes du follicule pileux', on entend un agent capable de protéger les mélanocytes du follicule pileux notamment contre des agents cytotoxiques responsables de la sénescence et/ou de l'apoptose des mélanocytes du follicule pileux. Parmi les agents cytotoxiques, on peut citer des molécules à caractères génotoxiques et des molécules induisant un stress oxydatif comme le TNF alpha, les lipofuscines, les céroïdes, le TGF beta, le ligand de FasICD95, L'IL1 beta, les ions ferreux et cuivreux, des composés chimiques génotoxiques comme le cisplatine et l'oxaloplatine, ou encore des composés comme le cyclophosphamide. By "protective agent of the melanocytes of the hair follicle" is meant an agent capable of protecting the melanocytes of the hair follicle, in particular against cytotoxic agents responsible for the senescence and / or apoptosis of the melanocytes of the hair follicle. Among the cytotoxic agents, mention may be made of genotoxic and oxidative stress-inducing molecules such as TNF alpha, lipofuscins, ceroids, TGF beta, FasICD95 ligand, IL1 beta, ferrous and cuprous ions. , genotoxic chemicals such as cisplatin and oxaloplatin, or compounds such as cyclophosphamide.
En particulier, le composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase tel que défini selon l'invention est destiné à lutter contre la disparition des mélanocytes du follicule pileux en maintenant et/ou en régénérant la population des mélanocytes actifs du bulbe et des mélanocytes quiescents de la région supérieure du follicule pileux. In particular, the compound capable of acting on the metabolic pathway of DOPAchrome tautomerase as defined according to the invention is intended to combat the disappearance of melanocytes from the hair follicle by maintaining and / or regenerating the population of active melanocytes of the bulb and quiescent melanocytes from the upper region of the hair follicle.
Le composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase 35 selon l'invention est également destiné à favoriser le renouvellement cyclique de l'unité folliculaire de pigmentation. The compound capable of acting on the metabolic pathway of DOPAchrome tautomerase 35 according to the invention is also intended to promote the cyclic renewal of the follicular unit of pigmentation.
En particulier, l'objet de l'invention concerne l'utilisation d'un composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase pour prévenir et/ou limiter et/ou arrêter le développement de la canitie. In particular, the subject of the invention relates to the use of a compound capable of acting on the metabolic pathway of DOPAchrome tautomerase to prevent and / or limit and / or stop the development of canities.
L'objet de l'invention se rapporte aussi à l'utilisation d'un composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase pour maintenir la pigmentation naturelle des cheveux et/ou des poils gris. The subject of the invention also relates to the use of a compound capable of acting on the metabolic pathway of DOPAchrome tautomerase to maintain the natural pigmentation of hair and / or gray hairs.
Le composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase (TRP-2) pourra notamment être le PBA (L-P-boronophénylalanine) qui réagit avec le DHI en complexant le catechol du DHI évitant ainsi l'oxydation du DHI en dérivés cytotoxiques. The compound capable of acting on the metabolic pathway of DOPAchrome tautomerase (TRP-2) may especially be PBA (LP-boronophenylalanine) which reacts with DHI by complexing the catechol of DHI thus avoiding the oxidation of DHI into cytotoxic derivatives .
Un autre objet de l'invention est une composition pour lutter contre la canitie, comprenant dans un milieu cosmétiquement acceptable, au moins un composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase (TRP-2) tel que défini précédemment. Another object of the invention is a composition for combating canities, comprising in a cosmetically acceptable medium, at least one compound capable of acting on the metabolic pathway of DOPAchrome tautomerase (TRP-2) as defined above.
La composition selon l'invention comprend une quantité de composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase comprise entre 0.001 % et 10 % en poids par volume, préférentiellement entre 0,01 et 5% en poids par volume et encore plus préférentiellement entre 0,1 et 1% en poids par volume. The composition according to the invention comprises an amount of compound capable of acting on the metabolic pathway of DOPAchrome tautomerase of between 0.001% and 10% by weight per volume, preferably between 0.01% and 5% by weight by volume and even more preferably between 0.1 and 1% by weight by volume.
La composition selon l'invention peut être administrée par voie orale ou appliquée sur la peau (sur toute zone cutanée du corps recouverte de poils) et/ou le cuir chevelu. The composition according to the invention may be administered orally or applied to the skin (on any cutaneous area of the body covered with hair) and / or the scalp.
Par voie orale, la composition selon l'invention peut contenir, le ou les composés capables d'agir sur la voie métabolique de la DOPAchrome tautomérase en solution dans un liquide alimentaire tel qu'une solution aqueuse ou hydroalcoolique, éventuellement aromatisée. Ils peuvent également être incorporés dans un excipient solide ingérable et se présenter par exemple sous forme de granulés, de pilules, de comprimés ou de dragées. Ils peuvent également être placés en solution dans un liquide alimentaire conditionné lui-même éventuellement dans des capsules ingérables. Orally, the composition according to the invention may contain the compound (s) capable of acting on the metabolic pathway of DOPAchrome tautomerase in solution in a food liquid such as an aqueous or aqueous-alcoholic solution, optionally flavored. They can also be incorporated in an unmanageable solid carrier and be for example in the form of granules, pills, tablets or dragees. They can also be placed in solution in a food liquid conditioned itself possibly in unmanageable capsules.
Selon le mode d'administration, la composition de l'invention peut se présenter sous toutes les formes galéniques normalement utilisées, particulièrement en cosmétologie. Une composition préférée de l'invention est une composition cosmétique adaptée à une application topique sur le cuir chevelu et/ou la peau. Depending on the mode of administration, the composition of the invention may be in any galenical form normally used, particularly in cosmetology. A preferred composition of the invention is a cosmetic composition suitable for topical application to the scalp and / or the skin.
Pour une application topique, la composition utilisable selon l'invention peut être notamment sous la forme d'une solution aqueuse, hydroalcoolique ou huileuse ou de dispersion du type lotion ou sérum, d'émulsions de consistance liquide ou semi-liquide du type lait, obtenues par dispersion d'une phase grasse dans une phase aqueuse (HIE) ou inversement (E/H), ou de suspensions ou émulsions de consistance molle du type crème ou gel aqueux ou anhydres, ou encore de microcapsules ou microparticules, ou de dispersions vésiculaires de type ionique et/ou non ionique. Elle peut ainsi se présenter sous forme d'onguent, de teinture, de crème, de pommade, de poudre, de timbre, de tampon imbibé, de solution, d'émulsion ou de dispersion vésiculaire, de lotion, de gel, de spray, de suspension, de shampooing, d'aérosol ou de mousse. Elles peuvent être anhydres ou aqueuses. Elle peut également consister en des préparations solides constituant des savons ou des pains de nettoyage. For topical application, the composition that may be used according to the invention may especially be in the form of an aqueous, aqueous-alcoholic or oily solution or of the lotion-type or serum-type dispersion, of emulsions of liquid or semi-liquid consistency of the milk type, obtained by dispersion of a fatty phase in an aqueous phase (HIE) or conversely (W / O), or suspensions or emulsions of soft consistency of the cream or gel type aqueous or anhydrous, or microcapsules or microparticles, or dispersions vesicles of ionic and / or nonionic type. It can thus be in the form of ointment, tincture, cream, ointment, powder, patch, impregnated buffer, solution, emulsion or vesicular dispersion, lotion, gel, spray, suspension, shampoo, aerosol or foam. They can be anhydrous or aqueous. It can also consist of solid preparations constituting soaps or cleaning rolls.
Ces compositions sont préparées selon les méthodes usuelles. These compositions are prepared according to the usual methods.
La composition utilisable selon l'invention peut en particulier être une composition pour soins capillaires, et notamment un shampooing, une lotion de mise en plis, une lotion traitante, une crème ou un gel coiffant, une composition de teintures (notamment teintures d'oxydation) éventuellement sous forme de shampooings colorants, des lotions restructurantes pour les cheveux, de masque. The composition that may be used according to the invention may in particular be a composition for hair care, and in particular a shampoo, a setting lotion, a treatment lotion, a cream or a styling gel, a dye composition (in particular oxidation dyes). ) optionally in the form of coloring shampoos, restructuring lotions for the hair, mask.
La composition cosmétique selon l'invention sera préférentiellement une crème, une lotion capillaire, un shampooing ou un après-shampooing. The cosmetic composition according to the invention will preferably be a cream, a hair lotion, a shampoo or a conditioner.
Les quantités des différents constituants des compositions utilisables selon l'invention sont celles classiquement utilisées dans les domaines considérés. The amounts of the various constituents of the compositions that can be used according to the invention are those conventionally used in the fields under consideration.
Lorsque la composition utilisable selon l'invention est une émulsion, la proportion de la phase grasse peut aller de 5% à 80% en poids, et de préférence de 5% à 50% en poids par rapport au poids total de la composition. Les huiles, les cires, les émulsionnants et les coémulsionnants utilisés dans la composition sous forme d'émulsion sont choisis parmi ceux classiquement utilisés dans le domaine cosmétique. L'émulsionnant et le coémulsionnant sont présents, dans la composition, en une proportion allant de 0,3% à 30% en poids, et de préférence de 0,5 à 20% en poids par rapport au poids total de la composition. L'émulsion peut, en outre, contenir des vésicules lipidiques. When the composition that can be used according to the invention is an emulsion, the proportion of the fatty phase can range from 5% to 80% by weight, and preferably from 5% to 50% by weight relative to the total weight of the composition. The oils, the waxes, the emulsifiers and the coemulsifiers used in the composition in emulsion form are chosen from those conventionally used in the cosmetics field. The emulsifier and the coemulsifier are present in the composition in a proportion ranging from 0.3% to 30% by weight, and preferably from 0.5% to 20% by weight relative to the total weight of the composition. The emulsion may further contain lipid vesicles.
Lorsque la composition utilisable selon l'invention est une solution ou un gel huileux, la 5 phase grasse peut représenter plus de 90% du poids total de la composition. When the composition that can be used according to the invention is an oily solution or gel, the fatty phase may represent more than 90% of the total weight of the composition.
Dans une variante de l'invention, la composition sera telle que le composé capable d'agir sur la voie métabolique de la DOPAchrome tautomerase est encapsulé dans un enrobage tel que des microsphères, des nanosphères, des oléosomes ou des Io nanocapsules, l'enrobage sera choisi selon la nature chimique du composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase. In one variant of the invention, the composition will be such that the compound capable of acting on the metabolic pathway of DOPAchrome tautomerase is encapsulated in a coating such as microspheres, nanospheres, oleosomes or nanocapsules, the coating will be chosen according to the chemical nature of the compound capable of acting on the metabolic pathway of DOPAchrome tautomerase.
A titre d'exemple, les microsphères pourront être préparées selon la méthode décrite dans la demande de brevet EP 0 375 520. By way of example, the microspheres may be prepared according to the method described in the patent application EP 0 375 520.
Les nanosphères pourront se présenter sous forme de suspension aqueuse et être préparées selon les méthodes décrites dans les demandes de brevet FR 0015686 et FR 0101438. The nanospheres may be in the form of an aqueous suspension and be prepared according to the methods described in patent applications FR 0015686 and FR 0101438.
Les oléosomes consistent en une émulsion huile dans eau formée par des globules huileux pourvus d'un enrobage cristal liquide lamellaire dispersé dans une phase aqueuse (voir les demandes de brevet EP 0 641 557 et EP 0 705 593). The oleosomes consist of an oil-in-water emulsion formed by oily globules provided with a lamellar liquid crystal coating dispersed in an aqueous phase (see patent applications EP 0 641 557 and EP 0 705 593).
Le composé capable d'agir sur la voie métabolique de la DOPAchrome tautomerase pourra aussi être encapsulé dans des nanocapsules consistant en un enrobage lamellaire obtenu à partir d'un tensio-actif siliconé (voir la demande de brevet EP 0 780 115), les nanocapsules pourront également être préparées à base de polyesters sulfoniques hydrodispersibles (voir la demande de brevet FR 0113337). The compound capable of acting on the metabolic pathway of DOPAchrome tautomerase may also be encapsulated in nanocapsules consisting of a lamellar coating obtained from a silicone surfactant (see patent application EP 0 780 115), the nanocapsules may also be prepared based on water-dispersible sulfonic polyesters (see patent application FR 0113337).
Le composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase pourra également être complexé à la surface de globules huileux cationiques, quelques soit leur taille (voir les demandes de brevet EP 1 010 413, EP 1 010 414, EP 1 010 415, EP 1 010 416, EP 1 013 338, EP 1 016 453, EP 1 018 363, EP 1 020 219, EP 1 025 898, EP 1 120 101, EP 1 120 102, EP 1 129 684, EP 1 160 005 et EP 1 172 077). The compound capable of acting on the metabolic pathway of DOPAchrome tautomerase may also be complexed on the surface of cationic oily globules, whatever their size (see patent applications EP 1 010 413, EP 1 010 414, EP 1 010 415 , EP 1 010 416, EP 1 013 338, EP 1 016 453, EP 1 018 363, EP 1 020 219, EP 1 025 898, EP 1 120 101, EP 1 120 102, EP 1 129 684, EP 1 160 005 and EP 1 172 077).
Le composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase peut enfin être complexé à la surface de nanocapsules ou nanoparticules pourvues d'un enrobage lamellaire (Voir EP 0 447 318 et EP 0 557 489) et contenant un tensio-actif cationique à la surface (voir les références citées précédemment pour les tensio-actifs cationiques). The compound capable of acting on the metabolic pathway of DOPAchrome tautomerase may finally be complexed on the surface of nanocapsules or nanoparticles provided with a lamellar coating (see EP 0 447 318 and EP 0 557 489) and containing a cationic surfactant. at the surface (see references cited above for cationic surfactants).
En particulier, on préférera une composition telle que l'enrobage contenant le composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase a un diamètre inférieur ou égale à 10 pm. Lorsque l'enrobage ne forme pas une vésicule sphérique, on entend par diamètre la dimension la plus grande de la vésicule. In particular, preference will be given to a composition such that the coating containing the compound capable of acting on the metabolic pathway of DOPAchrome tautomerase has a diameter of less than or equal to 10 μm. When the coating does not form a spherical vesicle, diameter is understood to mean the largest dimension of the vesicle.
De façon connue, la composition selon l'invention peut contenir également des adjuvants habituels dans le domaine cosmétique, tels que les gélifiants hydrophiles ou lipophiles, les additifs hydrophiles ou lipophiles, les conservateurs, les antioxydants, les solvants, les parfums, les charges, les filtres, les absorbeurs d'odeur et les matières colorantes. Les quantités de ces différents adjuvants sont celles classiquement utilisées dans le domaine cosmétique, et par exemple de 0, 01% à 10% du poids total de la composition. Ces adjuvants, selon leur nature, peuvent être introduits dans la phase grasse, dans la phase aqueuse et/ou dans les sphérules lipidiques. In a known manner, the composition according to the invention may also contain adjuvants customary in the cosmetic field, such as hydrophilic or lipophilic gelling agents, hydrophilic or lipophilic additives, preservatives, antioxidants, solvents, perfumes, fillers, filters, odor absorbers and dyes. The amounts of these various adjuvants are those conventionally used in the cosmetics field, and for example from 0.01% to 10% of the total weight of the composition. These adjuvants, depending on their nature, can be introduced into the fatty phase, into the aqueous phase and / or into the lipid spherules.
Comme huiles ou cires utilisables dans l'invention, on peut citer les huiles minérales (huile de vaseline), les huiles végétales (fraction liquide du beurre de karité, huile de tournesol), les huiles animales (perhydrosqualène), les huiles de synthèse (huile de Purcellin), les huiles ou cires siliconées (cyclométhicone) et les huiles fluorées (perfluoropolyéthers), les cires d'abeille, de carnauba ou paraffine. On peut ajouter à ces huiles des alcools gras et des acides gras (acide stéarique). As oils or waxes that can be used in the invention, mention may be made of mineral oils (vaseline oil), vegetable oils (liquid fraction of shea butter, sunflower oil), animal oils (perhydrosqualene), synthetic oils ( Purcellin oil), silicone oils or waxes (cyclomethicone) and fluorinated oils (perfluoropolyethers), bees, carnauba or paraffin waxes. To these oils can be added fatty alcohols and fatty acids (stearic acid).
Comme émulsionnants utilisables dans l'invention, on peut citer par exemple le stéarate de glycérol, le polysorbate 60 et le mélange de PEG6/PEG-32/Glycol Stéarate vendu sous la dénomination de Tefose 63 par la société Gattefosse. As emulsifiers that may be used in the invention, mention may be made, for example, of glycerol stearate, polysorbate 60 and the PEG6 / PEG-32 / glycol stearate mixture sold under the name Tefose 63 by the company Gattefosse.
Comme solvants utilisables dans l'invention, on peut citer les alcools inférieurs, notamment l'éthanol et l'isopropanol, le propylène glycol. As solvents that can be used in the invention, mention may be made of lower alcohols, in particular ethanol and isopropanol, and propylene glycol.
Comme gélifiants hydrophiles utilisables dans l'invention, on peut citer les polymères carboxyvinyliques (carbomer), les copolymères acryliques tels que les copolymères d'acrylates/alkylacrylates, les polyacrylamides, les polysaccharides tels que l'hydroxypropylcellulose, les gommes naturelles et les argiles, et, comme gélifiants lipophiles, on peut citer les argiles modifiées comme les bentones, les sels métalliques d'acides gras comme les stéarates d'aluminium et la silice hydrophobe, éthylcellulose, polyéthylène. As hydrophilic gelling agents that may be used in the invention, mention may be made of carboxyvinyl polymers (carbomer), acrylic copolymers such as acrylate / alkylacrylate copolymers, polyacrylamides, polysaccharides such as hydroxypropylcellulose, natural gums and clays, and, as lipophilic gelling agents, mention may be made of modified clays such as bentones, metal salts of fatty acids such as aluminum stearates and hydrophobic silica, ethylcellulose and polyethylene.
Les compositions utilisables selon l'invention peuvent associer au moins un composé capable d'agir sur la voie métabolique de TRP-2 à d'autres agents actifs. Parmi ces agents actifs, on peut citer à titre d'exemple: les agents modulant la différenciation et/ou la prolifération et/ou la pigmentation des cellules de la peau tels que le rétinol et ses esters, la vitamine D et ses dérivés, les oestrogènes tels que l'oestradiol, les modulateurs de l'AMPc tels que les dérivés de POMC, l'adénosine, ou la forskoline et ses dérivés, les prostaglandines et leurs dérivés, la triiodotrionine et ses dérivés; - des extraits de végétaux tels que ceux d'Iridacées ou de soja, extraits pouvant alors contenir ou non des isoflavones; - des extraits de micro-organismes; - les agents anti-radicaux libres tels que l'a-tocophérol ou ses esters, les superoxyde dismutases ou ses mimétiques, certains chélatants de métaux ou l'acide ascorbique et ses esters; - les anti-séborrhéiques tels que certains acides aminés soufrés, l'acide 13-cis 20 rétinoïque, l'acétate de cyprotérone; - les autres agents de lutte contre les états desquamatifs du cuir chevelu comme le zinc pyrithione, le disulfure de sélénium, le climbazole, l'acide undécylénique, le Kétoconazole, la piroctone olamine (octopirox) ou la ciclopiroctone (ciclopirox) ; en particulier, il pourra s'agir d'actifs stimulant la repousse et/ou favorisant le ralentissement de la chute des cheveux, on peut plus particulièrement citer à titre non limitatif: - les esters d'acide nicotinique, dont notamment le nicotinate de tocophérol, le nicotinate de benzyle et les nicotinates d'alkyles en C1- C6 comme les nicotinates de méthyle ou d'hexyle; - les dérivés de pyrimidine, comme le 2,4-diamino 6-piperidinopyrimidine 3-oxyde ou "Minoxidil" décrit dans les brevets US 4,139,619 et US 4,596, 812; l'Aminexil ou 2,4 diamino pyrimidine 3 oxyde décrit dans WO96/09048; - les agents inhibiteur de la lipoxygenase ou inducteur de la cyclooxydase favorisant la repousse des cheveux comme ceux décrits par la Demanderesse dans la demande de 35 brevet européen EP 0 648 488; - les agents antibactériens tels que les macrolides, les pyranosides et les tétracyclines, et notamment I'Erythromycine; - les agents antagonistes de calcium, comme la Cinnarizine, la Nimodipine et la Nifedipine; - des hormones, telles que l'estriol ou des analogues, ou la thyroxine et ses sels; - des agents antiandrogènes, tels que l'oxendolone, la spironolactone, le diéthylstilbestrol et la flutamide; - des inhibiteurs stéroïdiens ou non stéroïdiens des 5-a-réductases tels que ceux décrits par la Demanderesse dans les demandes de brevet européen EP 0 964 852 et EP 1 068 858 ou encore le finastéride; - des agonistes des canaux potassiques dépendant de l'ATP tels que la cromakalim et le nicorandil; des extraits végétaux à activité pro-pigmentante comme les extraits de chrysanthème tels que décrits dans FR 2768343 et les extraits de Sanguisorba décrits dans FR 2782920A1. The compositions that may be used according to the invention may combine at least one compound capable of acting on the metabolic pathway of TRP-2 with other active agents. Among these active agents, there may be mentioned by way of example: agents that modulate the differentiation and / or proliferation and / or pigmentation of skin cells such as retinol and its esters, vitamin D and its derivatives, estrogens such as estradiol, cAMP modulators such as POMC derivatives, adenosine, or forskolin and its derivatives, prostaglandins and their derivatives, triiodotrionine and its derivatives; extracts of plants such as Iridaceae or soybean extracts, which may then contain isoflavones or not; extracts of microorganisms; anti-free radical agents such as α-tocopherol or its esters, superoxide dismutases or its mimetics, certain metal chelators or ascorbic acid and its esters; anti-seborrhoeics such as certain sulfur amino acids, 13-cis retinoic acid, cyproterone acetate; other desquamating agents of the scalp such as zinc pyrithione, selenium disulphide, climbazole, undecylenic acid, ketoconazole, piroctone olamine (octopirox) or ciclopirocton (ciclopirox); in particular, it may be active stimulating regrowth and / or promoting the slowing down of hair loss, it may more particularly be mentioned without limitation: - nicotinic acid esters, including in particular tocopherol nicotinate benzyl nicotinate and C1-C6 alkyl nicotinates such as methyl or hexyl nicotinates; pyrimidine derivatives, such as 2,4-diamino-6-piperidinopyrimidine 3-oxide or "Minoxidil" described in US Pat. Nos. 4,139,619 and 4,596,812; Aminexil or 2,4 diamino pyrimidine 3 oxide described in WO96 / 09048; the lipoxygenase or cyclooxidase inducing agents promoting hair regrowth, such as those described by the Applicant in the European patent application EP 0 648 488; antibacterial agents such as macrolides, pyranosides and tetracyclines, and in particular Erythromycin; calcium antagonists, such as Cinnarizine, Nimodipine and Nifedipine; hormones, such as estriol or analogues, or thyroxine and its salts; antiandrogenic agents, such as oxendolone, spironolactone, diethylstilbestrol and flutamide; steroidal or nonsteroidal inhibitors of 5-a-reductases such as those described by the Applicant in European Patent Applications EP 0 964 852 and EP 1 068 858 or else finasteride; ATP-dependent potassium channel agonists such as cromakalim and nicorandil; plant extracts with pro-pigmenting activity such as chrysanthemum extracts as described in FR 2768343 and extracts of Sanguisorba described in FR 2782920A1.
De préférence, le composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase est associé à un autre actif choisi parmi les agents de lutte des états desquamatifs du cuir chevelu, des agents favorisant la repousse des cheveux, des extraits végétaux à activité propigmentante. Preferably, the compound capable of acting on the metabolic pathway of DOPAchrome tautomerase is associated with another active agent chosen from desquamating agents of the scalp, hair growth promoting agents and plant extracts with propigmenting activity. .
Un autre objet de la présente invention se rapporte à un procédé de traitement cosmétique de la canitie caractérisé en ce qu'on administre ou qu'on applique sur la zone à traiter une composition telle que définie précédemment comprenant au moins un composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase. Another subject of the present invention relates to a process for the cosmetic treatment of canities, characterized in that a composition as defined above, comprising at least one compound capable of acting, is administered or applied to the zone to be treated. on the metabolic pathway of DOPAchrome tautomerase.
L'invention se rapporte aussi à un procédé de traitement cosmétique destiné à maintenir la pigmentation naturelle des cheveux et/ou des poils gris ou blancs caractérisé en ce qu'on administre ou qu'on applique sur la zone à traiter une composition telle que définie précédemment comprenant au moins un composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase. The invention also relates to a cosmetic treatment method intended to maintain the natural pigmentation of hair and / or gray or white hairs, characterized in that a composition as defined is administered or applied to the zone to be treated. previously comprising at least one compound capable of acting on the metabolic pathway of DOPAchrome tautomerase.
Les procédés de traitement de la canitie et de pigmentation des cheveux et/ou des poils gris ou blancs peuvent également consister en l'ingestion d'une composition comprenant au moins un composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase. The methods of treating canities and pigmentation of hair and / or gray or white hairs may also consist in the ingestion of a composition comprising at least one compound capable of acting on the metabolic pathway of DOPAchrome tautomerase.
Les zones à traiter peuvent être, par exemple et sans aucune limitation, le cuir chevelu, les sourcils, la moustache et/ou la barbe et toute zone de la peau recouverte de poils. The areas to be treated may be, for example and without any limitation, the scalp, the eyebrows, the mustache and / or the beard and any area of the skin covered with hair.
Plus particulièrement, les procédés de traitement cosmétique de la canitie et de pigmentation naturelle des cheveux et/ou poils gris ou blancs consistent à appliquer une composition comprenant au moins un composé capable d'agir sur la voie métabolique de la DOPAchrome tautomerase. More particularly, the methods of cosmetic treatment of canities and natural pigmentation of gray and white hair and / or hair consist in applying a composition comprising at least one compound capable of acting on the metabolic pathway of DOPAchrome tautomerase.
Les procédés de traitement cosmétique pour lutter contre la canitie et/ou pour maintenir la pigmentation naturelle des cheveux et/ou des poils gris ou blancs peut par exemple consister à appliquer la composition sur les cheveux et le cuir chevelu, le soir, garder la composition toute la nuit et éventuellement effectuer un shampooing le matin ou laver les cheveux à l'aide de cette composition et à laisser à nouveau en contact quelques minutes avant de rincer. La composition conforme à l'invention s'est révélée particulièrement intéressante lorsqu'elle est appliquée sous forme de lotion capillaire, éventuellement rincée ou même sous forme d'un shampooing. Cosmetic treatment methods for combating canities and / or for maintaining the natural pigmentation of hair and / or gray or white hairs may for example consist in applying the composition to the hair and the scalp, in the evening, keeping the composition all night and possibly shampoo in the morning or wash the hair with this composition and leave it in contact for a few minutes before rinsing. The composition according to the invention has proved particularly advantageous when it is applied in the form of a hair lotion, optionally rinsed or even in the form of a shampoo.
Dans un autre de ses objets, la présente invention se rapporte à une méthode d'identification d'un composé capable d'agir sur la voie métabolique de la DOPAchrome 20 tautomérase. In another of its objects, the present invention relates to a method of identifying a compound capable of acting on the metabolic pathway of DOPAchrome tautomerase.
Cette méthode comprend l'étape préalable d'identification des métabolites impliqués dans la voie métabolique de la DOPAchrome tautomérase qui est décrite à l'exemple 3 ci-après. This method comprises the preliminary step of identifying the metabolites involved in the metabolic pathway of DOPAchrome tautomerase which is described in Example 3 below.
La méthode d'identification d'un composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase comprend les étapes suivantes: a-mise en culture d'une population cellulaire, de préférence une population de mélanocytes, de préférence qui n'exprime pas ou peu la DOPAchrome tautomérase; b- ajout dans le milieu de culture d'un composé pour lequel on souhaite tester la capacité d'agir sur la voie métabolique de la DOPAchrome tautomérase; c- incubation de la population cellulaire un temps suffisamment long pour permettre au composé évalué d'être actif; dextraction des métabolites cellulaires; e- analyse du ou des métabolites recherchés; f- sélection des composés qui agissent sur le taux des métabolites recherchés. The method for identifying a compound capable of acting on the metabolic pathway of DOPAchrome tautomerase comprises the following steps: a-culturing a cell population, preferably a melanocyte population, preferably that does not express no or little DOPAchrome tautomerase; b) addition in the culture medium of a compound for which it is desired to test the ability to act on the metabolic pathway of DOPAchrome tautomerase; incubating the cell population for a time long enough to allow the evaluated compound to be active; dextraction of cellular metabolites; e-analysis of the desired metabolite (s); f- selection of the compounds which act on the rate of the desired metabolites.
Dans un mode de réalisation particulière de la méthode d'identification d'un composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase, les cultures cellulaires sont réalisées en étuve, à 37 C, 5% CO2. In a particular embodiment of the method for identifying a compound capable of acting on the metabolic pathway of DOPAchrome tautomerase, the cell cultures are carried out in an oven, at 37 ° C., 5% CO 2.
En particulier l'étape (a) pourra être réalisée selon le protocole suivant: les mélanocytes sont ensemencés à JO avec du milieu RPMI-1640 (Gibco BRL - 42401) contenant 5% de sérum de voeu foetal, 1 % glutamine et 0,5% d'antibiotiques. Les cellules sont maintenues dans ces conditions 12 à 72 heures avant d'être traitées. In particular, step (a) may be carried out according to the following protocol: the melanocytes are seeded at 0 with RPMI-1640 medium (Gibco BRL-42401) containing 5% fetal saline serum, 1% glutamine and 0.5 % of antibiotics. The cells are maintained under these conditions 12 to 72 hours before being treated.
L'étape (b) pourra être réalisée selon le protocole suivant: les mélanocytes sont traités en culture par le composé pour lequel on souhaite tester la capacité d'agir sur la voie métabolique de la DOPAchrome tautomérase pendant un temps nécessaire pour révéler cette propriété, ce temps peut-être compris entre 1 heure et 72 heures. Step (b) may be carried out according to the following protocol: the melanocytes are treated in culture with the compound for which it is desired to test the ability to act on the metabolic pathway of DOPAchrome tautomerase for a time necessary to reveal this property, this time may be between 1 hour and 72 hours.
Dans un mode particulier de réalisation de l'étape (b), les cellules sont exposées à une condition induisant un stress oxydatif ou encore l'apoptose ou encore la sénescence, il pourra s'agir, par exemple, d'un facteur pro-apoptotique (TNF a), de l'absence d'un facteur de survie (IGF- 1), d'un traitement par le cis-platine (Pak B.J. et al., 2000, Melanoma Res. 10:499-505) ou l'oxaliplatine, d'un agent toxique (cyclophosphamide), d'un stress oxydatif (H2O2,, diethylmaleate) (voir Vaux D.L. & Strasser A., 1996, Proc.Natl.Acad.Sci. 93:2239-2244), peu de temps après l'ajout du composé pour lequel on souhaite tester la capacité d'agir sur la voie métabolique de la DOPAchrome tautomérase. In a particular embodiment of step (b), the cells are exposed to a condition inducing oxidative stress or apoptosis or senescence, it may be, for example, a factor pro apoptotic (TNF a), absence of a survival factor (IGF-1), treatment with cisplatin (Pak BJ et al., 2000, Melanoma Res., 10: 499-505) or oxaliplatin, a toxic agent (cyclophosphamide), oxidative stress (H2O2, diethylmaleate) (see Vaux DL & Strasser A., 1996, Proc.Natl.Acad.Sci., 93: 2239-2244), shortly after the addition of the compound for which it is desired to test the ability to act on the metabolic pathway of DOPAchrome tautomerase.
L'étape (e) pourra être réalisée à l'aide de n'importe quelle méthode d'analyse adaptée à la caractérisation ou à la quantification du ou des métabolites recherchés, par exemple chromatographie liquide à haute performance (HPLC), résonance magnétique nucléaire (NMR), chromatographie liquide couplée à la spectrométrie de masse (LC-MS), chromatographie gazeuse couplée à la spectrométrie de masse (GC-MS), ou encore spectrométrie infra rouge. Step (e) may be carried out using any analytical method suitable for the characterization or quantification of the desired metabolite (s), for example high performance liquid chromatography (HPLC), nuclear magnetic resonance (NMR), liquid chromatography coupled to mass spectrometry (LC-MS), gas chromatography coupled to mass spectrometry (GC-MS), or infrared spectrometry.
L'invention se rapporte aussi à l'utilisation d'un composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase susceptible d'être identifié par la méthode décrite ci-dessus dans un procédé de traitement cosmétique pour prévenir et/ou limiter et/ou arrêter le développement de la canitie et/ou pour maintenir la pigmentation naturelle des cheveux et/ou des poils gris ou blancs. The invention also relates to the use of a compound capable of acting on the metabolic pathway of DOPAchrome tautomerase, which can be identified by the method described above in a cosmetic treatment process for preventing and / or limiting and / or stop the development of canities and / or to maintain the natural pigmentation of hair and / or gray or white hairs.
L'invention se rapporte enfin à l'utilisation d'un composé capable d'agir sur la voie métabolique de la DOPAchrome tautomerase susceptible d'être identifié par la méthode décrite ci-dessus pour la préparation d'une composition cosmétique destinée à prévenir et/ou limiter et/ou arrêter le développement de la canitie et/ou à maintenir la pigmentation naturelle des cheveux et/ou des poils gris ou blancs. The invention finally relates to the use of a compound capable of acting on the metabolic pathway of DOPAchrome tautomerase that can be identified by the method described above for the preparation of a cosmetic composition intended to prevent and / or limit and / or stop the development of canities and / or maintain the natural pigmentation of hair and / or gray or white hairs.
L'invention se rapporte encore à une méthode d'évaluation de l'activité cytoprotectrice d'un composé capable d'agir sur la voie métabolique de la DOPAchrome tautomerase susceptible d'être identifié par la méthode décrite précédemment, comprenant les étapes suivantes: a- mise en culture d'une population de mélanocytes dans un milieu limitant l'expression de la TRP-2 à une expression basale faible; b- ajout d'un composé capable d'agir sur la voie métabolique de la DOPAchrome 15 tautomérase au milieu de culture; c- exposition des cellules à une condition induisant l'apoptose ou la sénescence; d- mesure de la cytotoxicité ; e- sélection des composés capables d'agir sur la voie métabolique de la DOPAchrome tautomérase avec un effet cytoprotecteur. The invention also relates to a method for evaluating the cytoprotective activity of a compound capable of acting on the metabolic pathway of DOPAchrome tautomerase that can be identified by the method described above, comprising the following steps: culturing a population of melanocytes in a medium limiting the expression of TRP-2 to a weak basal expression; b) addition of a compound capable of acting on the metabolic pathway of DOPAchrome tautomerase in the culture medium; c- exposure of the cells to a condition inducing apoptosis or senescence; measurement of cytotoxicity; e-selection of compounds capable of acting on the metabolic pathway of DOPAchrome tautomerase with a cytoprotective effect.
Dans un mode de réalisation particulier, les cultures cellulaires sont réalisées en étuve, à 37 C, 5% CO2. In a particular embodiment, the cell cultures are carried out in an oven, at 37 ° C., 5% CO 2.
En particulier, l'étape (a) pourra être réalisée selon le protocole suivant: les mélanocytes sont ensemencés à JO avec du milieu M2 (PromoCell, Heidelberg, D). In particular, step (a) can be carried out according to the following protocol: the melanocytes are seeded at 0 with medium M2 (PromoCell, Heidelberg, D).
Après un temps nécessaire à l'adhérence des cellules compris entre 2 et 18 heures, le milieu est remplacé par un milieu dans lequel les mélanocytes expriment peu ou pas la TRP-2 (expression faible basale) :DMEM:F12 (Gibco BRL - 42400-044), Ultroser G (Gibco BRL - 15950-017) 0, 5%, PC-1 (BioWhittaker 344022) 0,5%, bFGF (Pepro Tech Inc 100-18B) 5 ng/ml, héparine (Sigma H-3149) 75 ng/ml, 1% antibiotiques, 1% glutamine. Les cellules sont maintenues dans ce milieu de culture le temps compris entre 12 et 72 heures nécessaire à la diminution de l'expression de TRP-2. After a time necessary for cell adhesion between 2 and 18 hours, the medium is replaced by a medium in which the melanocytes express little or no TRP-2 (weak basal expression): DMEM: F12 (Gibco BRL - 42400 -044), Ultroser G (Gibco BRL-15950-017) 0.5%, PC-1 (BioWhittaker 344022) 0.5%, bFGF (Pepro Tech Inc 100-18B) 5 ng / ml, heparin (Sigma H- 3149) 75 ng / ml, 1% antibiotics, 1% glutamine. The cells are maintained in this culture medium for the time between 12 and 72 hours necessary to reduce the expression of TRP-2.
L'étape (b) pourra être réalisée selon le protocole suivant: les mélanocytes sont traités en culture par le composé capable d'agir sur la voie métabolique de la DOPAchrome 35 tautomérase. Step (b) may be carried out according to the following protocol: the melanocytes are treated in culture with the compound capable of acting on the metabolic pathway of DOPAchrome tautomerase.
L'étape (c) pourra être réalisée par exemple selon le protocole suivant: les cellules sont traitées au cis-platine (par exemple entre 5 et 50 pM) dans le milieu de culture pendant le temps nécessaire à l'induction de l'apoptose, ce temps est généralement compris entre 12 et 24 heures. Step (c) may be carried out for example according to the following protocol: the cells are treated with cisplatin (for example between 5 and 50 μM) in the culture medium for the time necessary for the induction of apoptosis this time is usually between 12 and 24 hours.
L'étape (d) pourra être réalisée par exemple selon le protocole suivant: la cytotoxicité peut être mesurée à l'aide du kit Cell Proliferation Kit II (XTT) mis en oeuvre selon le protocole donné par le fournisseur (Roche 1-465-015). L'apoptose peut être quantifiée à l'aide du kit "Cell Death Detection ELISA plus", mis en oeuvre selon le protocole donné par le fournisseur (Roche 1 774 425). Step (d) can be carried out for example according to the following protocol: the cytotoxicity can be measured using the Cell Proliferation Kit II kit (XTT) implemented according to the protocol given by the supplier (Roche 1-465- 015). Apoptosis can be quantified using the "Cell Death Detection ELISA plus" kit, implemented according to the protocol given by the supplier (Roche 1774 425).
Fiqures: Fiqure 1: cette figure rassemble différentes photographies représentant la distribution de mélanocytes dans le follicule pileux lors de la phase anagène visualisée au microscope. Figures: Figure 1: this figure gathers different photographs representing the distribution of melanocytes in the hair follicle during the anagen phase visualized under a microscope.
Légendes: (A) est une série de clichés de la gaine épithéliale externe grossie 40 fois, (B) est une 20 série de clichés de la gaine épithéliale externe (centrés sur la tige) grossie 20 fois et (C) est une série de clichés du bulbe grossie 20 fois. Legends: (A) is a series of images of the external epithelial sheath magnified 40 times, (B) is a series of external sheath epithelial sheath (centered on the stem) magnified 20 times and (C) is a series of snapshot of the bulb magnified 20 times.
(1) représente un cheveu très foncé, (2) un cheveu modérément pigmenté, (3) à (5) des cheveux de différentes nuances de gris et (6) un cheveu blanc. (1) represents a very dark hair, (2) a moderately pigmented hair, (3) to (5) hair of different shades of gray and (6) a white hair.
Figure 2: Ces photographies permettent de visualiser l'expression de TRP2 dans les mélanocytes de l'épiderme et du cheveu (gaine épithéliale externe et bulbe pileux). Etude immunohistologique analysée en microscopie confocale laser. Figure 2: These photographs make it possible to visualize the expression of TRP2 in the melanocytes of the epidermis and the hair (outer epithelial sheath and hair bulb). Immunohistological study analyzed by confocal laser microscopy.
Fiqure 3: Ces photographies représentent les résultats obtenus après la mise en oeuvre 30 des essais de Western Blot décrits à l'exemple 2B. FIG. 3: These photographs represent the results obtained after the implementation of the Western Blot tests described in Example 2B.
Exemple 1 révélation immunohistochimique des mélanocytes dans les follicules pileux à différents stades de blanchissement, par marquage de la protéine pMel-17. Example 1 Immunohistochemical revelation of melanocytes in hair follicles at different stages of bleaching, by labeling pMel-17 protein.
Plus de 120 follicules pileux isolés à partir de biopsies issues de 8 donneurs âgés de 49 à 71 ans ont été étudiés. More than 120 hair follicles isolated from biopsies from 8 donors aged 49 to 71 years were studied.
A - Protocole d'isolement des follicules pileux entiers (Commo S and Bernard BA Pigment Cell Res 2000;13:253-259) Des fragments de biopsie sont incubés dans la dispase (2,4 Ulml, Boehringer Mannheim, D) la nuit à +04 C. Les cheveux sont ensuite isolés à l'aide de pinces sous binoculaires. A - Isolation protocol for whole hair follicles (Commo S and Bernard BA Pigment Cell Res 2000; 13: 253-259) Biopsy fragments are incubated in the dispase (2.4 Ulml, Boehringer Mannheim, D) at night. +04 C. The hair is then isolated using binocular forceps.
B - Protocole d'immunomarquage sur follicules pileux entiers (Commo S and Bernard BA 15 Pigment Cell Res 2000;13:253-259) Les cheveux entiers sont fixés dans l'éthanol à -20 C pendant 10 minutes. Chaque étape des procédures de fixation et de marquage est suivie de lavages au tampon phosphate (pH 7,4 (PBS))-Tween20 0,05%. Sauf précision, toutes les étapes se font à température ambiante. Les péroxydases endogènes de l'échantillon sont neutralisées en incubant l'échantillon dans une solution de péroxyde d'hydrogène à 0,1% pendant 10 minutes. Pour bloquer les sites de fixation non spécifiques, l'échantillon est incubé avec du lait écrémé 1%, 15 minutes. L'anticorps (Ac) primaire NK1-beteb reconnaissant spécifiquement la protéine pMel-17 (Monosan, Paris, F) est dilué au 1/40 dans du PBS Tween 0,05%, contenant 10 % de sérum normal (X0907, DAKO, Trappes, F). L'Ac primaire est incubé 18 heures sur les cheveux à +04 C. L'Ac secondaire couplé à la biotine (E-433, DAKO, Trappes, F) est dilué au 1/400 et incubé 30 minutes. Le cheveu est ensuite incubé en présence de streptavidine biotine-péroxydase (K-0377, DAKO, Trappes, F), et finalement l'immunomarquage est révélé en présence de 3-amino-9-éthylcarbazole (AEC) (AEC kit-101, Sigma, Saint Quentin Fallavier, F). B - Immunolabeling protocol on whole hair follicles (Commo S and Bernard BA Pigment Cell Res 2000; 13: 253-259) The whole hair is fixed in ethanol at -20 C for 10 minutes. Each step of the fixation and labeling procedures is followed by phosphate buffer washes (pH 7.4 (PBS)) - 0.05% Tween20. Unless specified, all steps are at room temperature. Endogenous peroxidases in the sample are neutralized by incubating the sample in 0.1% hydrogen peroxide solution for 10 minutes. To block non-specific binding sites, the sample is incubated with 1% skimmed milk, 15 minutes. The primary (Ac) NK1-beteb antibody specifically recognizing the pMel-17 protein (Monosan, Paris, F) is diluted 1/40 in PBS Tween 0.05%, containing 10% normal serum (X0907, DAKO, Trappes, F). The primary Ac is incubated for 18 hours on the hair at +04 C. The secondary Ac coupled to biotin (E-433, DAKO, Trappes, F) is diluted to 1/400 and incubated for 30 minutes. The hair is then incubated in the presence of streptavidin-biotin-peroxidase (K-0377, DAKO, Trappes, F), and finally the immunolabeling is revealed in the presence of 3-amino-9-ethylcarbazole (AEC) (AEC kit-101, Sigma, Saint Quentin Fallavier, F).
En comparant les clichés (B1) à (B5) de la figure 1, on constate que la diminution de pigmentation du cheveu est associé à une diminution de mélanine dans le bulbe et à une diminution de mélanocytes dans le bulbe (voir Cl à C5). Le cheveu blanc dont la tige est dépourvue de mélanine (B6) ne contient pas de mélanocyte dans le bulbe (C6). Comparing the snapshots (B1) to (B5) of Figure 1, we find that the decrease in hair pigmentation is associated with a decrease in melanin in the bulb and a decrease in melanocytes in the bulb (see Cl to C5) . White hair whose stem lacks melanin (B6) does not contain a melanocyte in the bulb (C6).
Les cheveux gris et blanc contiennent une quantité variable de mélanocytes dans la partie haute de la gaine épithéliale externe, cette quantité pouvant même être nulle dans le cas du cheveu blanc (A3 à 6) à la différence des cheveux pigmentés (Al et 2). The gray and white hair contains a variable amount of melanocytes in the upper part of the outer epithelial sheath, this amount may even be zero in the case of white hair (A3 to 6) unlike pigmented hair (Al and 2).
Exemple 2 - mise en évidence de l'expression différentielle de la DOPAchrome tautomérase dans les mélanocytes de follicules pileux et de l'épiderme chez l'individu caucasien. EXAMPLE 2 Demonstration of the Differential Expression of DOPAchrome tautomerase in the Melanocytes of Hair Follicles and of the Epidermis in the Caucasian Individual
A Etude immunohistologique analysée en microscopie confocale laser A.1 Obtention de coupes congelées de follicule pileux (Commo S and Bernard BA Pigment Cell Res 2000;13:253-259) Un fragment de biopsie de scalp contenant des follicules pileux est inclus dans du tissue-Tek-OCT (Miles, Naperville, IL, USA) et ensuite congelé sur de la carbo-glace. La biopsie congelée est ensuite coupée (7 pm) à l'aide d'une cryostat (CM3050, Leica, Rueil-Malmaison, F). A Immunohistological study analyzed by laser confocal microscopy A.1 Obtaining frozen sections of hair follicle (Commo S and Bernard BA Pigment Cell Res 2000; 13: 253-259) A scalp biopsy fragment containing hair follicles is included in tissue -Tek-OCT (Miles, Naperville, IL, USA) and then frozen on carbo-ice. The frozen biopsy is then cut (7 μm) using a cryostat (CM3050, Leica, Rueil-Malmaison, F).
A.2 - Protocole d'isolement des follicules pileux entiers et des lambeaux épithéliaux de peau (Commo S and Bernard BA Pigment Cell Res 2000;13:253259) Des fragments de biopsie sont incubés dans la dispase (2,4 U/ml, Boehringer Mannheim, D) la nuit à +04 C. Le compartiment épithélial est séparé du derme à l'aide de pinces sous binoculaire. Les structures épithéliales sont ensuite micro-disséquées pour séparer les follicules pileux et l'épiderme, puis triées. A.2 - Protocol for the isolation of whole hair follicles and skin epithelial flaps (Commo S and Bernard BA Pigment Cell Res 2000; 13: 253259) Biopsy fragments are incubated in the dispase (2.4 U / ml, Boehringer Mannheim, D) overnight at +04 C. The epithelial compartment is separated from the dermis using binocular forceps. The epithelial structures are then micro-dissected to separate the hair follicles and the epidermis, and then sorted.
A.3 - Protocole d'immunomarquage sur follicules pileux entiers, lambeau de peau et coupe congelée Les cheveux entiers, les lambeaux épithéliaux de peau et les coupes congelées sont fixés dans l'éthanol à -20 C pendant 10 minutes. Chaque étape des procédures de fixation et de marquage est suivie de lavages au tampon phosphate (pH 7,4 (PBS))- Tween20 0,05%. Sauf précision, toutes les étapes se font à température ambiante. Les péroxydases endogènes de l'échantillon sont neutralisées en incubant l'échantillon dans une solution de péroxyde d'hydrogène à 0,1% pendant 10 minutes. Pour bloquer les sites de fixation non spécifiques, l'échantillon est incubé avec du lait écrémé 1%, 15 minutes. Les anticorps (Ac) primaires sont dilués dans du PBS Tween 0,05%, contenant 10 % de sérum normal (X0907, DAKO, Trappes, F). Les Ac primaires NK1- beteb reconnaissant spécifiquement la protéine pMel-17 (1/40, Monosan, Paris, F), et aPEP8h (1/2000, Dr VJ.Hearing, NIH, Bethesda, MD, USA) reconnaissant spécifiquement la protéine TRP2 humaine (Virador et al. 2001) sont incubés simultanément 18 heures à +04 C sur les cheveux entiers et les lambeaux épithéliaux de peau, et 30 minutes à température ambiante sur les coupes congelées. L'Ac secondaire de chèvre dirigé contre les immunoglobulines (Ig) G2b couplé à la Cy3 (M32410, TEBU, le Perray en Yveline, F) est dilué au 1/80, et l'Ac secondaire dirigé contre les Ig couplé à la Cy5 (111-175-144, Jackson Immunoresearch Lab. Inc. West Grove, PA, USA) est dilué au 1/500 sont incubés simultanément 30 minutes sur les échantillons. Les immunomarquages sont analysés en microscopie confocale laser (LSM510, Cari Zeiss, Oberkochen, D). A.3 - Immunolabelling protocol on whole hair follicles, skin flap and frozen section Whole hair, skin epithelial flaps and frozen sections are fixed in ethanol at -20 C for 10 minutes. Each step of the fixation and labeling procedures is followed by phosphate buffer washes (pH 7.4 (PBS)) - 0.05% Tween20. Unless specified, all steps are at room temperature. Endogenous peroxidases in the sample are neutralized by incubating the sample in 0.1% hydrogen peroxide solution for 10 minutes. To block non-specific binding sites, the sample is incubated with 1% skimmed milk, 15 minutes. The primary (Ac) antibodies are diluted in 0.05% PBS Tween containing 10% normal serum (X0907, DAKO, Trappes, F). The primary Ac NK1-beteb specifically recognizing pMel-17 protein (1/40, Monosan, Paris, F), and aPEP8h (1/2000, Dr. VJ.Hearing, NIH, Bethesda, MD, USA) specifically recognizing TRP2 protein Virador et al., 2001) were incubated simultaneously for 18 hours at +04 C on whole hair and skin epithelial flaps, and 30 minutes at room temperature on frozen sections. Goat secondary liver directed against Cy2-coupled immunoglobulin (Ig) G2b (M32410, TEBU, Perray en Yveline, F) is diluted 1/80, and Cy5-linked secondary Ig against Cy5 (111-175-144, Jackson Immunoresearch Lab Inc. West Grove, PA, USA) is diluted 1/500 and incubated simultaneously for 30 minutes on the samples. The immunolabelings are analyzed by laser confocal microscopy (LSM510, Carl Zeiss, Oberkochen, D).
Conclusion des observations: on constate sur la figure 2 la présence de TRP-2 dans les mélanocytes de l'épiderme, en revanche, cette enzyme n'est exprimée ni dans les mélanocytes de la gaine épithéliale du follicule pileux, ni dans les mélanocytes du bulbe pileux. Conclusion of the observations: one sees in figure 2 the presence of TRP-2 in the melanocytes of the epidermis, on the other hand, this enzyme is expressed neither in the melanocytes of the epithelial sheath of the hair follicle, nor in the melanocytes of the hair bulb.
B étude biochimique par analyse en Western Blot B.1 - Protocole d'extraction de protéine de follicules pileux humains et de mélanocytes 20 (Commo S et al. Differentiation 2000;66:157-164) - Extraction protéique à partir de bulbes pileux: les follicules pileux sont isolés après traitement de biopsies de scalp à la dispase (2,4 U/ml, Boehringer Mannheim, D) la nuit à +04 C. Après isolement, les follicules pileux sont micro-disséqués pour isoler la partie du bulbe pileux. 80 bulbes pileux ainsi isolés sont placés dans un tampon de lyse approprié pour extraction protéique et analyse en western blot. B Biochemical Study by Western Blot Analysis B.1 - Protein Extraction Protocol from Human Hair Follicles and Melanocytes (Commo S et al., Differentiation 2000; 66: 157-164) - Protein Extraction from Hair Bulbs: the hair follicles are isolated after treatment of dispase scalp biopsies (2.4 U / ml, Boehringer Mannheim, D) at night at +04 C. After isolation, the hair follicles are micro-dissected to isolate the part of the bulb hair. 80 hair bulbs thus isolated are placed in a lysis buffer suitable for protein extraction and analysis in western blot.
- Extraction protéique à partir de culture de mélanocytes: Les mélanocytes cultivés en milieu M2 (PromoCell, Heidelberg, D) sont lysés avec un même tampon de lyse approprié pour extraction protéique et analyse en western blot. Protein Extraction from Melanocyte Culture: The melanocytes cultured in M2 medium (PromoCell, Heidelberg, D) are lysed with the same lysis buffer suitable for protein extraction and analysis in western blot.
Le Western blot (voir protocole dans Maniatis et al.) est réalisé avec les anticorps suivants: aPEP8h, anticorps polyclonal spécifique de la TRP2 humaine donné par Dr VJ Hearing (NIH, Bethesda, USA), et T311, anticorps monoclonal spécifique de la tyrosinase humaine (Novocastra, New Castle, UK). The Western blot (see protocol in Maniatis et al.) Is carried out with the following antibodies: aPEP8h, polyclonal antibody specific for human TRP2 given by Dr. VJ Hearing (NIH, Bethesda, USA), and T311, a monoclonal antibody specific for tyrosinase human (Novocastra, New Castle, UK).
On observe (figure 3) que la tyrosinase est détectée dans les extraits de bulbe pileux. L'enzyme n'est pas détectée dans les extraits de gaine épithéliale externe. L'expression de la tyrosinase est régulée. Cette enzyme n'est pas ou peu exprimée dans les mélanocytes inactifs (ne produisant pas de mélanine), c'est le cas des mélanocytes contenus dans le scalp inter folliculaire d'individu caucasien. It is observed (Figure 3) that tyrosinase is detected in hair bulb extracts. The enzyme is not detected in the outer epithelial sheath extracts. The expression of tyrosinase is regulated. This enzyme is not or poorly expressed in inactive melanocytes (not producing melanin), this is the case of melanocytes contained in the inter follicular scalp of Caucasian individuals.
Par ailleurs, la DOPAchrome tautomérase (TRP-2) n'est détectée ni dans les extraits de bulbe ni dans les extraits de gaine épithéliale externe. L'expression de la TRP-2 ne suit pas celle de la tyrosinase et l'induction de la mélanogénèse, elle n'est pas exprimée dans les mélanocytes actifs des bulbes pileux. In addition, DOPAchrome tautomerase (TRP-2) is not detected in either the bulb extracts or the outer epithelial sheath extracts. The expression of TRP-2 does not follow that of tyrosinase and the induction of melanogenesis, it is not expressed in the active melanocytes of hair bulbs.
Exemple 3 Identification des métabolites impliqués dans la voie métabolique de la DOPAchrome tautomérase. Example 3 Identification of metabolites involved in the metabolic pathway of DOPAchrome tautomerase.
L'identification des métabolites modulés par la DOPAchrome tautomérase (TRP-2) est obtenue en comparant le métabolome de deux lignées mélanocytaires distinctes uniquement par l'expression différentielle de la TRP-2. L'expression différentielle spécifique de TRP-2 est obtenue: asoit par expression ectopique de TRP-2 obtenue après transfection de n'importe que vecteur approprié contenant la région codant du gène humain TYRP2 (par exemple tel que décrit dans genebank n S69231, n NM_001922, n AJ000503) dans une lignée de mélanocytes qui n'exprime pas de façon constitutive TRP-2; b- soit par neutralisation de l'expression de TRP-2 par exemple par la méthode du siRNA dans une lignée de mélanocytes qui exprime de façon constitutive TRP-2. Comme oligonucléotide double brin capable de provoquer l'extinction de l'ARN messager codant pour la TRP2, on pourra utiliser les 3 séquences nucléotidiques suivantes (positions 838, 1589 et 2164 respectivement du gène codant pour TRP2) : Les SEQ ID de numéro impair correspondent au brin 5' antisens; les SEQ ID de numéro pair correspondent au brin 5' sens. The identification of metabolites modulated by DOPAchrome tautomerase (TRP-2) is obtained by comparing the metabolome of two distinct melanocyte lines only by the differential expression of TRP-2. The specific differential expression of TRP-2 is obtained as follows by ectopic expression of TRP-2 obtained after transfection of any suitable vector containing the coding region of the human TYRP2 gene (for example as described in genebank No. S69231, No. NM_001922, n AJ000503) in a melanocyte line that does not constitutively express TRP-2; b- by neutralizing the expression of TRP-2, for example by the siRNA method in a melanocyte line that constitutively expresses TRP-2. As a double-stranded oligonucleotide capable of causing the extinction of the messenger RNA coding for TRP2, the following 3 nucleotide sequences (positions 838, 1589 and 2164 respectively of the gene coding for TRP2) may be used: The SEQ IDs of odd number correspond to on the 5 'antisense strand; the even number SEQ IDs correspond to the 5 'sense strand.
SEQ ID N 1: 5'- AACATCCATTCCTTGAGTCCTCCTGTCTC -3' SEQ ID N 2: 5'AAAGGACTCAAGGAATGGATGCCTGTCTC -3' SEQ ID N 3: 5'AAGTGATGAGCCTTCATAATTCCTGTCTC -3' 35 SEQ ID N 4: 5'AAAATTATGAAGGCTCATCACCCTGTCTC -3' SEQ ID N 5: 5'AATCCTCACTGTTCCTTCTTGCCTGTCTC -3' SEQ ID N 6: 5'AACAAGAAGGAACAGTGAGGACCTGTCTC -3' La fonctionnalité de ces séquences siRNAs, comme inhibiteurs spécifiques de la TRP2, est vérifiée par une mesure en Western blot de l'extinction de l'expression de la TRP2 dans des mélanocytes en présence de ces siRNAs sous forme de duplex (brin antisens et brin sens). SEQ ID N 1: 5'-AACATCCATTCCTTGAGTCCTCCTGTCTC -3 'SEQ ID N 2: 5'AAAGGACTCAAGGAATGGATGCCTGTCTC -3' SEQ ID N 3: 5'AAGTGATGAGCCTTCATAATTCCTGTCTC -3 'SEQ ID N 4: 5'AAAATTATGAAGGCTCATCACCCTGTCTC -3' SEQ ID N 5 The functionality of these siRNAs, as specific inhibitors of TRP2, is verified by a Western blot measurement of the extinction of the expression of the TRP2 expression. TRP2 in melanocytes in the presence of these siRNAs in duplex form (antisense strand and sense strand).
A partir d'une population de mélanocyte MeI-A on obtient ainsi une deuxième population cellulaire Mel-Al distincte uniquement par l'expression de TRP-2. From a MeI-A melanocyte population a second Mel-Al cell population is thus obtained distinct only by the expression of TRP-2.
Les deux populations Mel-A et Mel-Al sont cultivées strictement dans les mêmes conditions de milieu, de température, etc...pendant 24 à 48 heures. Dans une condition particulière les deux populations cellulaires sont cultivées dans des conditions de stress oxydatifs ou dans des conditions favorisant l'apoptose ou encore dans des conditions favorisant le sénescence en utilisant par exemple, d'un facteur pro-apoptotique (TNF a), de l'absence d'un facteur de survie (IGF-1), d'un traitement par le cisplatine (Pak B.J. et al., 2000, Melanoma Res. 10:499-505) ou l'oxaliplatine, d'un agent toxique (cyclophosphamide), d'un stress oxydatif (H2O2,, diethylmaleate) (voir Vaux D.L. & Strasser A., 1996, Proc.Natl.Acad.Sci. 93:2239-2244). The two populations Mel-A and Mel-Al are cultivated strictly under the same conditions of medium, temperature, etc ... for 24 to 48 hours. In a particular condition, the two cell populations are cultured under oxidative stress conditions or under conditions that promote apoptosis or under conditions promoting senescence using, for example, a pro-apoptotic factor (TNF a), the absence of a survival factor (IGF-1), treatment with cisplatin (Pak BJ et al., 2000, Melanoma Res., 10: 499-505) or oxaliplatin, with a toxic agent (cyclophosphamide), oxidative stress (H2O2, diethylmaleate) (see Vaux DL & Strasser A, 1996, Proc.Natl.Acad.Sci., 93: 2239-2244).
On réalise ensuite une extraction des métabolites cellulaires dans des conditions adaptées, par exemple telles que décrites dans Lazzarino G et al. Analytical Biochemistry 2003,322:51-59, ou encore dans Gonzalez B et al. Yeast 1997,13:1347- 1355, ou encore Raamsdonk LM et al. Nat Biotechnol. 2001,19;45-50. The cellular metabolites are then extracted under suitable conditions, for example as described in Lazzarino G et al. Analytical Biochemistry 2003, 322: 51-59, or in Gonzalez B et al. Yeast 1997, 13: 1347-1355, or Raamsdonk LM et al. Nat Biotechnol. 2001.19; 45-50.
Les métabolites extraits sont ensuite analysés par une méthode adaptée par exemple chromatographie liquide à haute performance (HPLC), résonance magnétique nucléaire (NMR), chromatographie liquide couplée à la spectrométrie de masse (LC-MS), chromatographie gazeuse couplée à la spectrométrie de masse (GC-MS), ou encore spectrométrie infra rouge. The extracted metabolites are then analyzed by a suitable method, for example high performance liquid chromatography (HPLC), nuclear magnetic resonance (NMR), liquid chromatography coupled to mass spectrometry (LC-MS), gas chromatography coupled to mass spectrometry (GC-MS), or infrared spectrometry.
Les taux différents de certains métabolites identifiés entre les populations Mel-A et Mel-Al caractérisent les métabolites impliqués dans la voie métabolique de la DOPAchrome tautomérase. The different levels of certain metabolites identified between the Mel-A and Mel-Al populations characterize the metabolites involved in the metabolic pathway of DOPAchrome tautomerase.
Exemple 4 - Compositions - lotion capillaire Composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase 0,5 g Propylène glycol 20 g Ethanol 95 30 g Eau qsp 100 g Cette lotion est appliquée quotidiennement sur les zones à traiter et de préférence sur l'ensemble du cuir chevelu pendant au moins 10 jours et préférentiellement 1 à 2 mois. On constate alors une diminution de l'apparition des cheveux blancs ou gris et une repigmentation des cheveux gris. EXAMPLE 4 Compositions - Hair lotion Compound capable of acting on the metabolic pathway of DOPAchrome tautomerase 0.5 g Propylene glycol 20 g Ethanol 95 30 g Water qs 100 g This lotion is applied daily to the zones to be treated and preferably to the entire scalp for at least 10 days and preferably 1 to 2 months. There is a decrease in the appearance of white or gray hair and a repigmentation of gray hair.
- shampooing traitant Composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase 1,5 g Polyglycéryl 3-hydroxylarylether 26 g Hydroxy propyl cellulose vendue sous la dénomination de Klucell G par la société Hercules 2 g Conservateurs ps Ethanol 95 50 g Eau qsp 100 g Ce shampooing est utilisé à chaque lavage avec un temps de pose d'environ d'une minute. Un usage prolongé, de l'ordre de deux mois, conduit à la repigmentation progressive des cheveux gris. Treatment shampoo Compound capable of acting on the metabolic pathway of DOPAchrome tautomerase 1.5 g Polyglyceryl 3-hydroxylarylether 26 g Hydroxy propyl cellulose sold under the name Klucell G by the company Hercules 2 g Preservatives ps Ethanol 95 50 g Water qs 100 g This shampoo is used with each wash with a laying time of about one minute. Prolonged use, of the order of two months, leads to the progressive repigmentation of gray hair.
Ce shampooing peut également être utilisé à titre préventif afin de retardé le blanchiment des cheveux. This shampoo can also be used as a preventive measure to delay hair whitening.
- Gel traitant Composé capable d'agir sur la voie métabolique de la DOPAchrome tautomérase 0,75 g Huiles essentielles d'Eucalyptus 1 g Econozole 0,2 g Lauryl polyglyceryl 6 cetearyl glycoether 1,9 g Conservateurs qs Carbopol 934P vendu par la société BF Goodrich Corporation 0,3 g Agent de neutralisation qs pH 7 Eau qsp 100 g Ce gel est appliqué sur les zones à traiter deux fois par jour (matin et soir) avec un massage terminal. Après trois mois d'application, on observe une repigmentation des poils ou cheveux de la zone traitée. - Treatment gel Compound capable of acting on the metabolic pathway of DOPAchrome tautomerase 0.75 g Eucalyptus essential oils 1 g Econozole 0.2 g Lauryl polyglyceryl 6 cetearyl glycoether 1.9 g Preservatives qs Carbopol 934P sold by the company BF Goodrich Corporation 0.3 g Neutralization agent qs pH 7 Water qs 100 g This gel is applied to the areas to be treated twice a day (morning and evening) with a final massage. After three months of application, repigmentation of the hairs or hair of the treated area is observed.
Claims (10)
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR0351029A FR2863484B1 (en) | 2003-12-11 | 2003-12-11 | USE OF COMPOUNDS CAPABLE OF ACTING ON THE METABOLIC PATHWAY CONTROLLED BY DOPACHROME TAUTOMERASE TRP-2 AS PROTECTIVE AGENT OF MELANOCYTES OF FOLLICLE AND APPLICATIONS |
PCT/FR2004/003070 WO2005065633A1 (en) | 2003-12-11 | 2004-11-30 | Use of compounds that can act on the metabolic pathway controlled by dopachrome tautomerase trp-2 as a protective agent for hair follicle melanocytes and applications thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR0351029A FR2863484B1 (en) | 2003-12-11 | 2003-12-11 | USE OF COMPOUNDS CAPABLE OF ACTING ON THE METABOLIC PATHWAY CONTROLLED BY DOPACHROME TAUTOMERASE TRP-2 AS PROTECTIVE AGENT OF MELANOCYTES OF FOLLICLE AND APPLICATIONS |
Publications (2)
Publication Number | Publication Date |
---|---|
FR2863484A1 true FR2863484A1 (en) | 2005-06-17 |
FR2863484B1 FR2863484B1 (en) | 2007-04-13 |
Family
ID=34610730
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
FR0351029A Expired - Fee Related FR2863484B1 (en) | 2003-12-11 | 2003-12-11 | USE OF COMPOUNDS CAPABLE OF ACTING ON THE METABOLIC PATHWAY CONTROLLED BY DOPACHROME TAUTOMERASE TRP-2 AS PROTECTIVE AGENT OF MELANOCYTES OF FOLLICLE AND APPLICATIONS |
Country Status (2)
Country | Link |
---|---|
FR (1) | FR2863484B1 (en) |
WO (1) | WO2005065633A1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR2879444A1 (en) * | 2004-12-22 | 2006-06-23 | Oreal | Cosmetic use of a compound capable of increasing growth stimulating hormone rate to prevent and/or to limit and/or to stop the waltness of hair |
EP2113286A1 (en) | 2008-04-30 | 2009-11-04 | L'Oreal | Uses of the BNIPXL-beta in early canities |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR2896159B1 (en) * | 2006-01-13 | 2008-09-12 | Merck Sante Soc Par Actions Si | COMBINATION OF TRIAZINE DERIVATIVES AND INSULIN SENSITIZING AGENTS. |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0759292A1 (en) * | 1995-04-28 | 1997-02-26 | L'oreal | Use of alpha type melanocytes stimulating hormone derivatives to stimulate the hairgrowth |
FR2762784A1 (en) * | 1997-04-30 | 1998-11-06 | Yutaka Mishima | Composition for whitening skin contains boron compounds |
WO2002030372A1 (en) * | 2000-10-09 | 2002-04-18 | L'oreal | Method for treating whitening of hair |
WO2003103568A2 (en) * | 2002-06-11 | 2003-12-18 | L'oreal | Use of an agent inducing dopachrome tautomerase (trp-2) expression as protecting agent for hair follicle melanocytes and uses thereof |
WO2003103616A2 (en) * | 2002-06-11 | 2003-12-18 | L'oreal | Use of an agent mimicking dopachrome tautomerase (trp-2) activity as protective agent for hair follicle melanocytes and uses thereof |
WO2004030661A2 (en) * | 2002-10-03 | 2004-04-15 | Psimei Pharmaceuticals Plc | Therapeutic compositions comprising a boron-containing compound |
-
2003
- 2003-12-11 FR FR0351029A patent/FR2863484B1/en not_active Expired - Fee Related
-
2004
- 2004-11-30 WO PCT/FR2004/003070 patent/WO2005065633A1/en active Application Filing
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0759292A1 (en) * | 1995-04-28 | 1997-02-26 | L'oreal | Use of alpha type melanocytes stimulating hormone derivatives to stimulate the hairgrowth |
FR2762784A1 (en) * | 1997-04-30 | 1998-11-06 | Yutaka Mishima | Composition for whitening skin contains boron compounds |
WO2002030372A1 (en) * | 2000-10-09 | 2002-04-18 | L'oreal | Method for treating whitening of hair |
WO2003103568A2 (en) * | 2002-06-11 | 2003-12-18 | L'oreal | Use of an agent inducing dopachrome tautomerase (trp-2) expression as protecting agent for hair follicle melanocytes and uses thereof |
WO2003103616A2 (en) * | 2002-06-11 | 2003-12-18 | L'oreal | Use of an agent mimicking dopachrome tautomerase (trp-2) activity as protective agent for hair follicle melanocytes and uses thereof |
WO2004030661A2 (en) * | 2002-10-03 | 2004-04-15 | Psimei Pharmaceuticals Plc | Therapeutic compositions comprising a boron-containing compound |
Non-Patent Citations (1)
Title |
---|
PROTA ET AL: "Comparative analysis of melanins and melanosomes produced by various coat color mutans", BIOSIS, 1995, XP002234438 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR2879444A1 (en) * | 2004-12-22 | 2006-06-23 | Oreal | Cosmetic use of a compound capable of increasing growth stimulating hormone rate to prevent and/or to limit and/or to stop the waltness of hair |
US8481762B2 (en) | 2004-12-22 | 2013-07-09 | L'oreal | Administration of compounds that increase glutathione levels in the melanocytes for the treatment of canities |
EP2113286A1 (en) | 2008-04-30 | 2009-11-04 | L'Oreal | Uses of the BNIPXL-beta in early canities |
Also Published As
Publication number | Publication date |
---|---|
WO2005065633A1 (en) | 2005-07-21 |
FR2863484B1 (en) | 2007-04-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1515688B1 (en) | Use of salen-manganese complexes as protective agents for hair follicule melanocytes and cosmetic uses thereof | |
EP1870081B1 (en) | Use of ellagic acid for treating graying hair | |
US20090118203A1 (en) | Administration of agents inducing dopachrome tautomerase (TRP-2) expression for protecting hair follicle melanocytes | |
WO2006070101A1 (en) | Use of a compound capable of increasing glutathione level in melanocytes for treating canities | |
FR2902325A1 (en) | Cosmetic use of 3H-1,2-dithiole-3-thione/anethole dithiolethione and their derivatives/mixture to prevent, limit and/or stop the development of canities | |
EP0993826B1 (en) | Use of a Sanguisorba officinalis extract to stimulate the skin- and/or the hair-pigmentation | |
FR2902320A1 (en) | Cosmetic use of butylated hydroxyanisole to prevent, limit and/or stop the development of canities | |
EP1870087B1 (en) | Use of coumarin, butylated hydroxyanisole and ethoxyquin for treating grey hair | |
US8445004B2 (en) | Administration of agents mimicking dopachrome tautomerase (TRP-2) activity for protecting hair follicle melanocytes | |
FR2863484A1 (en) | Cosmetic use of compounds capable of acting on the dopachrome tautomerase metabolic pathway as agents for protecting hair follicle melanocytes, e.g. for preventing gray hair | |
ES2431309T3 (en) | Use of a sale-manganese complex as a protective agent for hair follicle melanocytes, and cosmetic applications | |
US20210378934A1 (en) | Hair care active agent | |
FR2902321A1 (en) | Cosmetic use of curcumin to prevent, limit and/or stop the development of canities | |
FR2902329A1 (en) | Cosmetic use of sulforaphane, phenetyl isothiocyanate, 6-(methylsulfinyl)hexyl isothiocyanate and/or allyl isothiocyanate or their derivatives, to prevent, limit and/or stop the development of canities | |
FR2908652A1 (en) | Cosmetic use of ethoxyquine, in topical or oral compositions for preventing and/or limiting and-or stopping the whitening or greying of the hair |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
ST | Notification of lapse |
Effective date: 20090831 |