FR2848569A1 - New nucleic acid encoding variants of human kallikrein-3, useful for diagnosis of prostatic cancer and in screening for therapeutic agents, also related polypeptides and antibodies - Google Patents

Abstract

Nucleic acids (I) encoding variants of human kallikrein-3 are new. They are any of 4 sequences of 404, 359, 251 or 184 base pairs given in the specification, degenerate versions of them within the genetic code, complementary strands of them, or specific fragments of them, are new. Independent claims are also included for the following: (1) polypeptides (II) encoded by (I); (2) nucleic acid probes for detecting (I) by selective hybridization; (3) primers, or their pairs, for selective amplification of (I); (4) antibody (Ab) specific for (II); (5) detecting disease, or a predisposition to it, by detecting (I) or (II); (6) kit for method (5); (7) selecting or identifying active gents from their ability to modulate, in vitro or ex vivo, expression or activity of (II) being expressed in a cell; (8) vector that contains (I); (9) recombinant cells that contain the vectors of (8); and product comprising (I), (II) or Ab immobilized on a support.

Description

<Desc / Clms Page number 1>

 Variants of Human Kallikrein-2 and Kallikrein-3 and Their Uses The present invention relates to the field of biology, genetics and medicine. It relates in particular to new nucleotide sequences associated with alternative splicing events of the genes corresponding to the PSA antigen (prostate specific antigen or KLK3) and to kallikrein-2 (KLK2). The invention also relates to methods for detecting the presence or for determining the level of expression of these nucleic acids or the corresponding proteins in biological samples, as well as methods of selecting molecules capable of modulating their activity or their expression.

The invention is particularly suitable for screening or monitoring cancers, especially of the prostate and in particular in the differentiation between prostate cancer and benign prostatic hyperplasia (BPH), as well as to the development of new therapeutic approaches. of these diseases.

Kallikreins correspond to a group of proteins whose protease activity allows the post-translational modification of protein precursors to biologically active forms. Some members of this family, kallikrein-3, also known under the name of PSA (prostatespecific antigen or specific antigen of the prostate), and more recently, kallikrein-2 are considered as the best available markers usable in the detection, diagnosis and monitoring of prostate cancer.

The use of tests measuring the amount of PSA in the blood has made it possible to diagnose an increasing number of patients with prostate cancer (Pca). However, since PSA is also produced by non-cancerous prostate epithelial cells, it is often difficult to differentiate patients with prostate cancer from those with benign hyperplastic symptom (BPH). In serum, PSA exists in free, uncomplexed form and in complexed form, in particular with alpha-antichymotrypsin.

<Desc / Clms Page number 2>

Measuring these different forms and their relationships improves the differentiating factor between Pca and BPH.

The alternative splicing constitutes a mechanism of regulation of the expression of the genes making it possible to generate functional diversity from limited genetic information. This highly regulated mechanism can undergo alterations during the development of human pathologies. Thus, the deregulation of the splicing machinery in cancers can allow the expression of isoforms or variants specifically expressed in certain human tumors. These isoforms may have a determining functional role in the development or maintenance of the pathological state. The specific expression of such isoforms constitutes an event of choice for a rational and targeted approach to the development of drugs and / or diagnostic methods. A gene expression profiling technology (DATAS) has been recently developed to systematically identify genes and, within these genes, the domains likely to be altered by alternative splicing (WO99 / 46403).

The present invention now describes novel genetic events associated with alternative splicing of the PSA and KLK2 genes in prostate tissue. The present invention results in particular from the construction of a directory of splicing alterations associated with prostate tumor tissues, and from the identification of structural alterations in the PSA and KLK2 genes or in the corresponding mRNAs. The present invention thus provides new therapeutic and diagnostic approaches for cancers, in particular prostate cancer.

More particularly, a differential qualitative analysis was carried out using RNA extracted from samples of prostate tissue originating from tumor and non-tumor areas of patients with prostate carcinomas.

This analysis was carried out by qualitative differential screening thanks to the implementation of the DATAS technique (described in application no. W099 / 46403)

<Desc / Clms Page number 3>

 which has unmatched benefits. The application of DATAS technology on RNAs from tumor and non-tumor prostate tissue has made it possible to isolate various cDNA fragments derived from human kalikrein 2 and kalikrein 3 (PSA) mRNAs. These results then made it possible to identify a certain number of cDNAs revealing events linked to alternative splicing.

The present invention therefore describes original molecular events which can lead to the specific expression of isoforms or variants of KLK3 (PSA) and KLK2 in prostate tissues and, more specifically, in cancerous tissues or tissues associated with a benign hyperplasia (BPH). The present invention provides molecular data which justify the use of one or more of these variants as new therapeutic and diagnostic targets which can advantageously be used in the diagnosis and treatment of cancers and in particular prostate cancer.

A first aspect of the present application therefore relates to variants of human PSA and KLK2, in particular splicing variants. The invention relates to the nucleic acids corresponding to these variants or to the specific alterations which they exhibit, as well as the proteins (or polypeptides or protein domains) encoded.

Another aspect of the present application relates to methods and tools for detecting the presence of these variants or alterations in biological samples (blood, plasma, urine, serum, saliva, biopsies or cell cultures, etc.), or for determining their ( s) respective quantity (s) or proportion (s). Such tools include in particular nucleic probes or primers, antibodies or other specific ligands, kits, supports, chips, etc. Detection methods can include hybridization, PCR, chromatography, immunology, etc. These methods are particularly suitable for the detection, characterization, monitoring of progression or

<Desc / Clms Page number 4>

 the effectiveness of a treatment for cancers, in particular prostate cancer, or in determining a predisposition.

Another aspect of the present application relates to tools and methods for the production of compounds active on the variants described, that is to say capable of modulating their expression or their activity. These tools and methods include in particular nucleic acids, vectors, recombinant cells (or preparations derived from such cells), binding tests, etc. The invention also relates to the compounds thus identified or produced, to pharmaceutical compositions containing them, as well as to their therapeutic uses.

The present invention is thus applicable to the diagnosis and development of therapeutic strategies for cancers, in particular of the prostate.

Variants of KLK2 and KLK3 A first aspect of the present application therefore relates to variants of KLK-2 and KLK-3 (PSA), or particular genetic alterations affecting these genes (or the corresponding RNAs or proteins). A more particular subject of the invention relates to nucleic acids corresponding to these variants of human PSA and KLK2 or to the specific alterations which they exhibit, as well as the proteins (or polypeptides or protein domains) encoded.

A number of isoforms of the KLK2 and KLK3 genes have been described in the prior art. These isoforms all correspond to the total retention of an intron (David et.al (2002), Riegman et.al (1988), Riegman et.al (1991), Liu et.al (1999), Heuze et.al ( 1999), Tanaka et.al (2000)). The present application now describes the existence of different forms of the PSA and KLK2 genes, and their correlation to pathological situations.

These isoforms have been identified from tumor samples. The description of the cDNAs and of the proteins / polypeptides encoded by these cDNAs is given below.

<Desc / Clms Page number 5>

 below. The complete sequences are provided in the Sequence List annexed to this request.

Variants of KLK2: The nucleotide numbering refers to the Genbank accession number M18157 unless otherwise specified. The reference protein is KLK2 provided with its signal peptide.

KLK2-EHT101 (SEQ ID NO: 1): This isoform has a deletion of exon 1 associated with retention of part of intron 1 (deletions of nucleotides 483 to 738). This isoform KLK2EHT101 deletes the initiation codon used by KLK2 in exon 1. An open reading phase is proposed from two ATG initiation codons in phase at positions 845 and 878 to produce two polypeptides of 77 and 66 acids amino respectively (KLK2-EHT101 prota / SEQ ID NO: 8 and KLK2EHT101protb / SEQ ID NO: 9). KLK2-EHT101 protb / SEQ ID NO: 9 has in its amino-terminal part a signal peptide very homologous to that of KLK2 of wild type. Depending on the cleavage site used, between 16 and 20 amino acids can be cleaved from KLK2-EHT101 protb / SEQ ID NO: 9 to form a secret polypeptide of 46-50 amino acids (KLK2-EHT101 protc / SEQ ID NO: 10) .

KLK2-EHT102 (SEQ ID NO: 2): This isoform has a deletion in intron 1 between positions 1032 and 1774 (intron junction 1 with exon 2). This KLK2-EHT102 isoform puts a peptide of 52 amino acids into phase with the coding phase of secreted KLK2 (from exon 2), thus coding for a protein of 297 amino acids (KLK2-EHT102prota / SEQ ID NO: 11 ). The amino-terminal part of KLK2EHT102prota / SEQ ID NO: 11 has the same signal peptide as KLK2EHT101 protb / SEQ ID NO: 9. Depending on the cleavage site used, between 16 and 20 amino acids can be cleaved from KLK2-EHT102prota / SEQ ID NO: 11 to form the secret polypetide KLK2-EHT102protb / SEQ ID NO: 12. Depending on the cleavage site used, the 32 -36 N-terminal amino acids of KLK2-EHT102protb

<Desc / Clms Page number 6>

 (KLK2-EHT102protc / SEQ ID NO: 13) are new and may have one or more original epitopes.

KLK2-EHT103 (SEQ ID NO: 3): This isoform has a deletion in intron 1 between positions 965 and 1774 (junction intron 1 with exon 2). An open reading phase is proposed from two ATG initiation codons in phase at positions 845 and 878 to produce two polypeptides of 91 and 80 amino acids respectively (KLK2EHT103prota / SEQ ID N0: 14 and KLK2-EHT103protb / SEQ ID N0 : 15). Identical to KLK2-EHT101 protb, KLK2-EHT103protb / SEQ ID NO: 15 has in its amino-terminal part a signal peptide very homologous to that of KLK2 of wild type. Depending on the cleavage site used, between 16 and 20 amino acids can be cleaved from KLK2-EHT103protb / SEQ ID NO: 15 to form a secret polypeptide of 60-64 amino acids (KLK2-EHT103protc / SEQ ID NO: 16).

Variants of PSA (or KLK3): The nucleotide numbering refers to the Genbank accession number M27274 unless otherwise specified. The reference protein is PSA provided with its signal peptide.

PSA-EHT101 (SEQ ID NO: 4): This isoform presents a deletion of exon 1 associated with a retention of part of intron 1 (deletions of nucleotides 636 to 918). This PSAEHT101 isoform deletes the initiation codon used by PSA in exon 1. An open reading phase is proposed from an ATG initiation codon at position 1057 to produce a polypeptide of 60 amino acids (PSA-EHT101 prota / SEQ ID NO: 17). PSA-EHT101 prota / SEQ ID NO: 17 presents in its amino-terminal part a signal peptide very homologous to that of PSA of wild type. Depending on the cleavage site used, between 16 and 20 amino acids can be cleaved from PSA-EHT101 prota / SEQ ID NO: 17 to form a secret polypeptide of 40-44 amino acids (PSA-EHT101 protb / SEQ ID NO: 18)

<Desc / Clms Page number 7>

 PSA-EHT102 (SEQ ID NO: 5): This isoform presents a deletion of exon 1 associated with a retention of part of intron 1 (deletions of nucleotides 636 to 963). As PSA-EHT101 deletes, this PSA-EHT102 isoform deletes the initiation codon used by PSA in exon 1. An open reading phase is proposed from an ATG initiation codon at position 1057 to produce a polypeptide of 60 amino acids (PSA-EHT101prota / SEQ ID NO: 17). PSA-EHT101prota / SEQ ID NO: 17 presents in its amino-terminal part a signal peptide very homologous to that of PSA of wild type. Depending on the cleavage site used, between 16 and 20 amino acids can be cleaved from PSA-EHT101 prota / SEQ ID NO: 17 to form a secret polypeptide of 40-44 amino acids (PSA-EHT101 protb / SEQ ID NO: 18) .

PSA-EHT103 (SEQ ID NO: 6): This isoform has a deletion in intron 1 between positions 1211 and 1958 (intron junction 1 with exon 2). This PSA-EHT103 isoform puts a peptide of 52 amino acids into phase with the coding phase of secreted PSA (from exon 2), thus coding for a protein of 297 amino acids (PSAEHT103prota / SEQ ID NO: 19). The amino-terminal part of PSAEHT103prota / SEQ ID NO: 19 has the same signal peptide as PSAEHT101prota / SEQ ID NO: 17. Depending on the cleavage site used, between 16 and 20 amino acids can be cleaved from PSA-EHT103prota / SEQ ID NO: 19 to form the secret polypeptide PSA-EHT103protb / SEQ ID NO: 20. Depending on the cleavage site used, the 32-36 N-terminal amino acids of PSA-EHT103protb (PSA-EHT103protc / SEQ ID NO: 21) are new and may present one or more original epitopes.

PSA-EHT104 (SEQ ID NO: 7): This isoform has a deletion in intron 1 between positions 1144 and 1958 (intron junction 1 with exon 2). An open reading phase is proposed from an ATG initiation codon at position 1057 to produce a

<Desc / Clms Page number 8>

 85 amino acid polypeptide (PSA-EHT104prota / SEQ ID N0: 22). Identical to PSA-EHT101prota, PSA-EHT104prota / SEQ ID NO: 22 has in its amino-terminal part a signal peptide very homologous to that of wild type PSA. Depending on the cleavage site used, between 16 and 20 amino acids can be cleaved from PSA-EHT104prota / SEQ ID NO: 22 to form a secret polypeptide of 65-69 amino acids (PSA-EHT104protb / SEQ ID NO: 23).

A first subject of the invention relates to nucleic acids comprising the sequence of the variants of PSA and KLK-2 described above.

Another subject of the invention relates to nucleic acids specific for the genetic alterations carried by the variants of PSA and KLK-2 described above.

Such nucleic acids may in particular be complementary to mutated regions, retained intronic domains or junctions newly created by deletions.

Another subject of the invention relates to a nucleic acid comprising all or part of a sequence derived from messenger RNAs (or cDNAs) from KLK2EHT101 to KLK2-EHT103 and from PSA-EHT101 to PSA-EHT104 or any combination of these variants as well that their uses for the implementation of a method of diagnosis, detection or monitoring of cancers, in particular prostate cancer and more particularly of the benign form of the latter, BPH.

Another object of the invention resides in any nucleic acid characterized in that it comprises a sequence chosen from: a) the sequences SEQ ID NOs: 1 to 7, b) a variant of the sequences SEQ ID NOs: 1 to 7 resulting degeneracy of the genetic code, c) the complementary strand of the sequences SEQ ID NOs: 1 to 7, and d) a specific fragment of the sequences a) to c).

<Desc / Clms Page number 9>

The term fragment or specific part designates a fragment characteristic of the variants considered, typically a fragment carrying at least one genetic alteration characteristic of the variants considered. Such specific fragments are therefore distinguished from the wild-type sequence by the presence of their own structural characteristic (eg, mutation, new junction, intron retention, sequence deletion, stop codon, new sequence resulting from a shift in the reading frame, etc.) resulting from an alteration event highlighted by the applicants in patients. This specific structural characteristic is also designated by the expression target sequence.

Specific fragments according to the invention therefore comprise at least one target sequence as defined above. Preferred fragments comprise at least 5 consecutive nucleotides of the sequence considered, preferably at least 8, more preferably at least 12. Fragments can comprise up to 50.75 or 100 nucleotides, or even more.

Within the meaning of the invention, the nucleic acids may be DNAs, preferably chosen from cDNAs and gDNAs, or RNAs. They can be synthetic or semi-synthetic nucleic acids, PCR fragments, oligonucleotides, double- or single-stranded regions, etc. Nucleic acids can be produced by synthesis, recombinantly, by cloning, by genetic assembly (s), mutagenesis, etc., or a combination of these techniques.

The nucleic acids can be used to produce a PSA or KLK-2 variant of the invention in vitro, ex vivo, in vivo or in an acellular transcription system. They can also be used for the manufacture of antisense molecules, capable of reducing the translation of the corresponding mRNAs in a cell. They can also be used for the production of probes, in particular labeled, allowing, by hybridization reactions, to specifically demonstrate the presence of a mutated form of PSA or KLK-2 of the invention in a sample. They can still be used for production

<Desc / Clms Page number 10>

 nucleic acid primers, useful for the amplification of a PSA or KLK-2 variant (or of a target sequence of such a variant) in a sample, in particular for the purpose of screening or diagnosis.

In this regard, another object of the invention relates to a nucleic probe characterized in that it allows the detection of a nucleic acid as defined above, typically by selective hybridization from a population of nucleic acids test. Generally, the probe comprises the sequence of a nucleic acid as defined above or a (specific) part of the sequence of such a nucleic acid. The specific part is preferably characteristic of a variant as described above, in particular a part containing an alteration associated with prostate cancer. The probe typically comprises from 10 to 1000 nucleotides, preferably from 50 to 800, and is generally single-stranded. A particular example of a probe is represented by an oligonucleotide specific and complementary to a region of at least one nucleic acid as defined above. The oligonucleotide is typically single-stranded, and generally has 10 to 100 bases. The oligonucleotides and / or nucleic probes according to the invention can be labeled, for example by means of radioactive, enzymatic, fluorescent, luminescent markers, etc.

Another subject of the invention relates to a nucleic primer, allowing the (selective) amplification of a nucleic acid as defined above or of a (specific) part of such a nucleic acid. The amplified part preferably comprises an alteration characteristic of one of the variants described above, in particular an alteration associated with prostate cancer. A primer according to the invention is typically single-stranded, and advantageously composed of 3 to 50 bases, preferably from 3 to 40 and even more preferably from 3 to 35 bases. A particular primer is complementary to at least one region of the PSA or KLK-2 gene, or of the corresponding RNA.

 A preferred embodiment resides in a primer consisting of a single-stranded nucleic acid comprising from 3 to 50 nucleotides complementary to a

<Desc / Clms Page number 11>

 at least part of one of the sequences SEQ ID NOs: 1 to 7 or of their complementary strand. Examples of such nucleic primers are provided in the experimental section.

The invention also relates to a pair of primers comprising a sense sequence and a reverse sequence, characterized in that the primers of said pair hybridize with a region of a nucleic acid as defined above and allow the amplification of at least a portion of this nucleic acid.

Specific pairs of primers according to the invention are provided in Table 1.

Another object of the present application relates to any vector comprising a nucleic acid as defined above. They can be plasmids, cosmids, episomes, artificial chromosomes, viruses, phages, etc. Mention may be made of various commercial plasmids such as pUC, pcDNA, pBR, etc. Among the viral vectors, mention may be made of retroviruses, adenoviruses, AAVs, herpesviruses, etc.

Another subject of the invention relates to recombinant cells comprising a nucleic acid or a vector as defined above. The cells can be prokaryotic or eukaryotic. Among the prokaryotic cells, mention may in particular be made of bacteria such as E. coli. Among the eukaryotic cells, mention may be made of yeast cells or cells of mammals, insects or plants. It can be primary cultures or lines. One can quote the cells COS, CHO, 3T3, HeLa, etc.

Another subject of the invention relates to a composition comprising a nucleic acid as defined above immobilized on a support. The invention relates in particular to compositions comprising a plurality of nucleic acids in admixture, in soluble form or immobilized to a support, the composition comprising at least one nucleic acid as defined above.

<Desc / Clms Page number 12>

Another subject of the invention relates to a (product comprising a) support on which one or more nucleic acids as defined above are immobilized. The support can be solid, flat or not, regular or not, such as for example nylon, glass, plastic, metal, fiber, ceramic, silica, polymer, etc., or any other compatible material. The nucleic acids are preferably immobilized at one end, under conditions leaving the molecule accessible for a hybridization reaction. The nucleic acids can be precisely arranged on the support, and deposited in several copies.

Another subject of the invention relates to a (product comprising a) support on which one or more recombinant cells as defined above are immobilized or cultured. The support can be solid, flat or not, regular or not, such as for example nylon, glass, plastic, metal, fiber, ceramic, silica, polymer, etc., or any other compatible material. The cells are, for example, distributed in wells of a microplate or immobilized in a gel or on a suitable support.

The invention also relates to the peptides and protein sequences encoded by all or part of the isoforms KLK2-EHT101 to KLK2-EHT103 and PSA-EHT101 to PSA-EHT104, in particular those described among the sequences SEQ ID NO: 8 to 23 as well as their uses for the implementation of a method for diagnosing, detecting or monitoring cancers, in particular prostate cancer and more particularly the benign form of the latter, BPH.

A particular subject of the present application relates to a polypeptide comprising all or a specific part of a sequence chosen from SEQ ID NOs: 8 to 23. Particular polypeptides are composed or comprise a sequence or part of a sequence created by the alteration of the gene or corresponding messenger. Within the meaning of the invention, the term part preferably designates at least 5 contiguous residues, preferably at least 8, more

<Desc / Clms Page number 13>

 preferably at least 10, even more preferably at least 15.

As explained above, the splicing alterations of the PSA or KLK-2 gene lead to the production of mutated proteins, comprising newly created sequences (target sequences). These can be new sequences (e.g., offset translation, insertions), new junctions, etc. Particular peptides of the invention correspond to or include these target sequences, coded by the sequences SEQ ID Nos: 1 to 7.

Another subject of the invention relates to a (product comprising a) support on which one or more polypeptides as defined above are immobilized.

The support can be solid, flat or not, regular or not, such as for example nylon, glass, plastic, metal, fiber, ceramic, silica, polymer, etc., or any other compatible material. The polypeptides are preferably immobilized at one end, under conditions leaving the molecule accessible for an interaction reaction with a specific ligand, such as an antibody. The polypeptides can be precisely arranged on the support, and deposited in several copies.

Techniques for immobilizing materials (such as nucleic acids, polypeptides, antibodies, etc.) on supports have been described in the literature, and in particular in patent applications No. EP619,321, WO91 / 08307, US4,925,785 and GB2 , 197,720, for example.

Specific ligands The invention also relates to specific ligands, preferably peptide, in particular antibodies (polyclonal, monoclonal) and their fragments, specific for peptide regions characteristic of the proteins coded by KLK2-EHT101 and KLK2EHT103 and of PSA-EHT101-104 (in particular selected intronic domains or specifically created junctions), and their uses for the detection, diagnosis or monitoring of cancers and

<Desc / Clms Page number 14>

 including prostate cancer. In particular, it may involve diagnosing the BPH form and differentiating it from carcinoma of the prostate.

In this regard, another subject of the invention relates to any antibody capable of binding, preferably selectively, to a polypeptide as defined above. The antibody can be polyclonal or monoclonal. It can also be fragments and derivatives of antibodies having substantially the same antigenic specificity, in particular antibody fragments (eg, Fab, Fab'2, CDRs), humanized, polyfunctional, single-stranded antibodies (ScFv) , etc.

Antibodies can be produced using conventional methods, including immunizing an animal and recovering its serum (polyclonal) or spleen cells (so as to produce hybridomas by fusion with appropriate cell lines).

Methods of producing polyclonal antibodies from various species are described in the prior art. Typically, the antigen is combined with an adjuvant (eg, Freund's adjuvant) and administered to an animal, typically by subcutaneous injection. Repeated injections can be given. Blood samples are collected and immunoglobulin or serum are separated. Conventional methods of producing monoclonal antibodies include immunizing an animal with an antigen, followed by the recovery of spleen cells which are then fused with immortalized cells, such as myeloma cells. The resulting hybridomas produce monoclonal antibodies and can be selected by limiting dilutions so as to isolate the individual clones. The Fab or F (ab ') 2 fragments be produced by digestion using a protease according to conventional techniques.

The invention also relates to a method for producing antibodies, comprising injecting a polypeptide as defined above or an immunogenic fragment thereof into a non-human animal and recovering the antibodies or producer cells. antibody. Preferred antibodies are

<Desc / Clms Page number 15>

 antibodies specific for the isoforms of PSA and KLK-2 described in the present application, and essentially non-specific for wild forms.

Particular antibodies are specific for a target sequence as defined above.

The invention relates to hybridomas producing the monoclonal antibodies described above and their use for producing said antibodies.

The antibodies can be coupled to heterologous fragments such as toxins, markers, drugs or any other therapeutic agent, covalently or not, either directly or through coupling agents. The markers can be chosen from radio-markers, enzymes, fluorescent agents, magnetic particles, etc.

The antibodies of the invention can be used as screening agents or to detect or quantify the presence or amount of PSA or KLK-2 isoforms in samples collected from a subject, typically a biological fluid from 'a mammal, for example from a human.

Another subject of the invention relates to a (product comprising a) support on which one or more antibodies (or fragments or derivatives) as defined above are immobilized. The support can be solid, flat or not, regular or not, such as for example nylon, glass, plastic, metal, fiber, ceramic, silica, polymer, etc., or any other compatible material. The antibodies are preferably immobilized at one end, under conditions leaving the molecule accessible for an interaction reaction with a specific antigen. The antibodies can be precisely arranged on the support, and deposited in several copies.

Detection / diagnostic methods

<Desc / Clms Page number 16>

 The present application also describes new methods for detecting a pathology or a predisposition to a pathology in a subject, comprising determining the presence, in a sample of said subject, of a nucleic acid, or an alteration genetic or a protein or polypeptide as defined above.

The determination can be carried out by various techniques, such as sequencing, hybridization and / or selective amplification. Methods that can be used to determine the presence of proteins are based, for example, on immunoenzymatic reactions, such as ELISA, RIA, EIA, etc. Techniques that can be used to determine the presence of altered genes or RNA are for example PCR, RT-PCR, ligation chain reaction (LCR), PCE or TMA (Transcriptional Mediated Amplification) technique, migration over gel, electrophoresis, in particular DGGE (denaturing gel gradient electrophoresis), etc.

In the case where an amplification step is carried out, this preferably uses a primer or a pair of primers as defined above.

A particular object of the invention relates to the use of complementary and specific nucleic acids of fragments of the genes or messengers of KLK2-EHT101-103 and of PSA-EHT101-104 (eg, retained intronic domains, specifically created junctions, mutations particular, etc.) for the detection of cancers, in particular prostate cancer, and more particularly of its benign form, BPH. This detection may in particular be carried out by means of DNA chips or by the implementation of a PCR from biological fluids such as blood (serum in particular), urine, seminal fluid, etc.

The invention also resides in the development and use of immunological tests containing one or more antibodies as described above.

<Desc / Clms Page number 17>

 or fragments thereof. These tests make it possible to individually detect and / or measure a variant using a specific antibody, several variants, in parallel, using the appropriate specific antibodies, or one or more relationships between the isoforms as described above or between said isoforms and other forms described for kallikrein-2 and PSA.

A particular method comprises bringing a sample from a subject into contact with a probe as defined above, and demonstrating hybridization.

Another particular method comprises bringing a sample from a subject into contact with a primer or a pair of primers as defined above, and demonstrating an amplification product.

Another particular method comprises bringing a sample from a subject into contact with an antibody as defined above, and demonstrating an antigen-antibody complex.

Typically, several tests are carried out in parallel, using several samples and / or using several probes, primers and / or antibodies. Thus, in a particular embodiment, the method of the invention comprises the determination, in parallel, of the presence of several genetic variants or alterations as described above in a sample of a patient. The methods according to the invention can be implemented using various biological samples, in particular biological fluids (eg, blood, plasma, urine, serum, saliva, etc.), biopsies of tissues or cell cultures, for example and, more generally, from any sample likely to contain nucleic acids or proteins (or polypeptides). The biological sample can be treated before implementing the process, to facilitate or allow accessibility to the polypeptides or nucleic acids which it contains. The sample can also be purified, centrifuged, fixed, etc., possibly frozen or stored before use.

<Desc / Clms Page number 18>

In a particular embodiment, the invention relates to a method for detecting the presence of an altered form of KLK-2 or KLK-3 in a subject, comprising bringing into contact, in vitro or ex vivo, of a sample of said subject with a specific probe, primer or ligand as defined above and the determination of the formation of a hybrid, of an amplification product or of a complex, respectively, said formation being indicative the presence of an altered form.

Another object of the invention resides in a kit which can be used for implementing a method as defined above comprising i. a pair of primers or a probe or an antibody as defined above, and ii. the reagents necessary for amplification or for a hybridization or immunological reaction.

The invention also resides in the development of a method making it possible to detect and / or measure specific partners of one or more of these variants by adding one or more of these variants or their fragments in biological fluids to be tested, such as blood (serum in particular), urine or seminal fluid.

Screening of active compounds The specific variants of KLK2 and of KLK3 according to the invention have been identified and isolated from pathological subjects and therefore represent therapeutic targets which are particularly advantageous for the treatment of cancers and in particular prostate cancer.

In this regard, a particular object of the invention resides in methods of selection, identification, characterization, optimization or production of

<Desc / Clms Page number 19>

 active compounds, comprising a step of determining the capacity of a test compound to modulate the expression or the activity of a polypeptide as defined above.

The compounds are more particularly selected on the basis of their capacity to modulate the synthesis of a polypeptide as defined above (that is to say in particular the production or the maturation of the corresponding RNAs, or their translation) or the activity of such a polypeptide (that is to say in particular their maturation, transport, or their interaction with intra- or extracellular targets).

In an alternative embodiment, the method comprises contacting in vitro or ex vivo a test compound with a polypeptide as defined above or a nucleic acid encoding such a polypeptide (eg, gene, cDNA, RNA), and selecting compounds that bind to said polypeptide or nucleic acid. The binding of the polypeptide to the gene or to the corresponding RNA can be measured by various techniques, such as the displacement of a labeled ligand, migration on gel, electrophoresis, etc. It can be carried out in vitro, for example using the polypeptide or the nucleic acid immobilized on a support.

In another alternative embodiment, the method comprises contacting in vitro or ex vivo a test compound with a cell expressing a polypeptide as defined above, and the selection or identification of compounds modulating the expression or the activity of said polypeptide. The modulation of expression can be determined by assaying the RNAs or proteins, or by means of a reporter system.

The cells used can be any compatible cell, in particular eukaryotic or prokaryotic cells as mentioned above. Typically, a modified cell is used to express said molecule, especially recombinant cells. Such recombinant cells can be

<Desc / Clms Page number 20>

 prepared by the introduction of a recombinant nucleic acid expressing the polypeptide, or of a vector comprising the latter. Such recombinant cells constitute particular objects of the invention.

The method can be implemented to select or identify an activator or an inhibitor of the expression or activity of the specific antigen of PSA or of KLK-2. The selection methods can be carried out in different formats, such as for example in multi-well plates, by testing multiple candidate compounds in parallel.

In a particular embodiment, the compound is an antisense nucleic acid capable of inhibiting the expression of the variants described. The antisense nucleic acid can comprise all or part of specific sequences of the variants described. The antisense can in particular comprise a region complementary to the form of splicing identified (e.g., of a target sequence), and inhibit (or reduce) its translation into protein.

According to another embodiment, the compound is a chemical compound, of natural or synthetic origin, in particular an organic or inorganic molecule, of plant, bacterial, viral, animal, eukaryotic, synthetic or semi-synthetic origin, capable of modulating the expression or activity of one or more of the variants described above.

Specific compounds are preferred, that is to say capable of modulating the expression or the activity of the variants, without significantly affecting the expression or the activity of the wild forms.

The compounds thus identified can be used for the preparation of a composition intended for the treatment of prostate cancer.

Another object of the invention lies in the use of a compound capable of modulating, i. e. stimulate, inhibit or reduce the expression of one or more

<Desc / Clms Page number 21>

 several variants as described above, for the preparation of a composition intended for the treatment of cancers and in particular prostate cancer.

In the context of the invention, the term treatment designates preventive, curative or palliative treatment, as well as the care of patients (reduction of suffering, improvement of lifespan, slowing down the progression of the disease), etc. The treatment can also be carried out in combination with other active agents.

Another subject of the invention relates to methods of selection, identification, or characterization of active compounds which can be used in the context of the preparation of compositions intended for the treatment of cancerous pathologies, comprising the bringing into contact of one or more test compounds with cellular extracts expressing the proteins described in the present invention, or with said purified proteins.

The invention also relates to a method for producing a medicament for the treatment of cancers, in particular prostate cancer, comprising (i) the selection of active compounds according to the above methods and (ii) the conditioning of said compound or a functional analog thereof in the presence of a pharmaceutically acceptable carrier. The functional analog is typically a compound derived from the active compound identified, by chemical modification, in particular with the aim of improving its activity or its pharmacokinetics, or with the aim of reducing its toxicity. The functional analog may be a pro-drug of the identified compound. Techniques for preparing functional analogs are well known to those skilled in the art, for example molecular modeling, coupling of NO groups, etc. The method can in this regard comprise an intermediate step of synthesis of the selected compound or of the functional analog thereof.

<Desc / Clms Page number 22>

The pharmaceutically acceptable vehicle or excipient can be chosen from buffer solutions, solvents, binders, stabilizers, emulsifiers, etc. Buffer or diluent solutions include dicalcium phosphate, calcium sulfate, lactose, cellulose, kaolin, mannitol, sodium chloride, starch, powdered sugar and hydroxy propyl methyl cellulose (HPMC) (for delayed release).

Binders are for example starch, gelatin and filling solutes such as sucrose, glucose, dextrose, lactose, etc. Natural or synthetic gums can also be used, such as alginate, carboxymethylcellulose, methylcellulose, polyvinyl pyrrolidone, etc. Other excipients are for example cellulose and magnesium stearate. Stabilizing agents can be incorporated into the formulations, such as for example polysaccharides (acacia, agar, alginic acid, guar gum and tragacanth, chitin or its derivatives and cellulose ethers. Solvents or solutes are for example the Ringer solution, l , distilled water, phosphate buffers, phosphate salt solutions, and other conventional fluids.

Another subject of the invention relates to the use of cytotoxic ligands specific for one or more variants as described above located on the surface of cancer cells and in particular prostate cancer cells.

Other aspects and advantages of the present invention will appear on reading the examples which follow, which should be considered as illustrative and not limiting.

MATERIALS AND METHODS The qualitative differential analysis was carried out using poly adenylated RNA (poly A +) extracted from tumor and normal prostate samples. Poly A + RNAs are prepared according to techniques known to those skilled in the art. he

<Desc / Clms Page number 23>

 may in particular be a treatment with chaotropic agents such as guanidium thiocyanate followed by extraction of total RNA with solvents (phenol, chloroform for example). Such methods are well known to those skilled in the art (see Maniatis et al., Chomczynsli et al., Anal. Biochem. 162 (1987) 156), and can be easily implemented using kits available in the art. trade. From these total RNAs, the poly A + RNAs are prepared according to conventional methods known to those skilled in the art and described in commercial kits.

These poly A + RNAs serve as a template for reverse transcription reactions using reverse transcriptases. Advantageously, reverse transcriptases lacking RNase H activity are used. They make it possible to obtain complementary DNA strands of sizes larger than those obtained using conventional reverse transcriptases. Such preparations of reverse transcriptases without RNase H activity are commercially available.

In accordance with the DATAS technique, for each point of the kinetics, hybridizations of mRNA (C) with cDNAs (T) and reciprocal hybridizations of mRNA (T) with cDNAs (C) are carried out.

These mRNA / cDNA heteroduplexes are then purified according to the protocols provided by the DATAS technique.

RNA sequences not paired with complementary DNA are released from these heteroduplexes under the action of RNase H, this enzyme degrading the paired RNA sequences. These unpaired sequences represent the qualitative differences which exist between RNAs which are otherwise homologous to one another. These qualitative differences can be located anywhere on the RNA sequence, either in 5 ′ or 3 ′ as within the sequence and in particular within the coding sequence. Depending on their location, these sequences can be not only modifications of splicing but also the consequences of translocations or deletions.

<Desc / Clms Page number 24>

The RNA sequences representing the qualitative differences are then cloned according to techniques known to those skilled in the art and in particular those described in the patent relating to the DATAS technology.

These sequences are grouped together within cDNA libraries which constitute qualitative differential banks. One of these banks contains exons and introns specific to the healthy situation; the other banks contain the splicing events characteristic of the pathological conditions.

The fragments derived from the human genes of KLK2 and KLK3 come from these banks.

Four tumor samples were mixed to form a tumor pool.

This RNA pool was treated with Dnase using the DNA free kit from the company Ambion (cat. No. 1906). A pool of prostate tumor cell lines has also been established.

These RNAs are then reverse transcribed using the reverse transcriptase of the High capacity cDNA Archive kit from the company Aplied Biosystems (cat.

4322171).

The cDNA thus produced serves as a template for PCR reactions in order to specifically amplify different regions of messenger RNAs derived from human kallikrein-2 and kallikrein-3 according to the following protocol: Invitrogen 10X buffer: 2 l 2mM DNTPs : 2 l MgCI2 50mM: 0.6pL Upstream primer 10 M: 0.4pL
Primer downstream 1 OpM: 0.4uL Taq polymerase: 0.2pL
H20: 13.4uL cDNA 1 L Final volume: 19 L
According to the following cycle program:
94 C 3min

<Desc / Clms Page number 25>

 94 C 30sec 55 C 1 min) 35 cycles 72 C 3min 72 C 6min The oligonucleotides used as PCR primers are as follows: For KLK2: 419: KLK2 5 ': 421: intron 1 stop: GACTCAGGGTGGGAGGCAG 450 KLK2 intron 1 ATG: 422 : KLK2 exon 2 rev1: TGTGCCCATCCATGACTGTA For PSA: 413: PSA 5 ': AGGTTTTATAGGGCTCCTGG 415: PSA intron 1 stop: CATTGCCAGACTGAGGGACC 449: PSA intron 1 ATG: GGACCGTATCACTGGTCCAT 416on products: PSACC2: amplified from the company Invitrogen (cat. no K4600) according to the protocol provided. The ligation products are transformed into competent Top 10 cells. The colonies are identified on agar / LB medium supplemented with ampicillin.

The cDNAs present in these colonies are amplified individually by PCR amplification using primers Sp6 and T7 according to the following protocol:
Primer T7 1 OpM: 2 L Primer Sp6 10uM 2 L MgCI2 50mM: 1.2pL
DNTPs 2mM: 4 L Buffer 10x 4 L

<Desc / Clms Page number 26>

Taq polymerase: 0.2pL H20: 25.6pL Colony: 1 L final flight 40 L according to the following cycle program:
94 C 5min
94 C 30sec)
55 C 30sec) 30cycles
72 C 1 min)
72 C 5 min The amplification products are then purified by P100 to be sequenced using the Big Dye Terminator kit from the company Applied Biosystems according to the protocol provided by this supplier. Sequence reactions are analyzed using an Applied Biosystems 3100 sequencer. The following table represents the various cDNAs as well as the pairs of priming oligonucleotides used for obtaining them and allowing their amplification in a sample.

Table 1

<Tb>
<tb> Isoforms <SEP> Pair <SEP> of oligonucleotides
<tb> KLK2-EHT101 <SEP> 419/421
<tb> KLK2-EHT102 <SEP> 450 <SEP> / <SEP> 422
<tb> KLK2-EHT103 <SEP> 450/422
<tb> PSA-EHT101 <SEP> 413/415
<tb> PSA-EHT102 <SEP> 413/415
<tb> PSA-EHT103 <SEP> 449/416
<tb> PSA-EHT104 <SEP> 449/416 <SEP>
<Tb>
The complete sequence of variants is provided in the attached sequence list.

<Desc / Clms Page number 27>

 REFERENCES David et.al, (2002) J. Biol. Chem Riegman et al (1988) Biochem. Biophys. Res. Common. 155.181 to 188.

Riegman et.al (1991) Mol. This//. Endicronol. 76, 181-190.

Liu et.al (1999) Biochem. Biophys. Res. Common. 264, 833-839 Heuze et.al (1999) Cancer Res. 59.2820-2824.

Tanaka et.al (2000) Cancer Res. 60.56 to 59.

Claims (24)

 CLAIMS 1.Nucleic acid characterized in that it comprises a sequence chosen from: a) the sequences SEQ ID NOs: 4 to 7, b) a variant of the sequences SEQ ID NOs: 4 to 7 resulting from the degeneration of the genetic code, c) the complementary strand of the sequences SEQ ID NOs: 4 to 7, and d) a specific fragment of the sequences a) to c). 2. Nucleic acid according to claim 1, characterized in that it is a DNA, preferably chosen from cDNAs and gDNAs, or a RNA. 3. A polypeptide encoded by a nucleic acid according to any one of the preceding claims, preferably chosen from a polypeptide comprising all or a specific part of a sequence chosen from SEQ ID Nos: 17 to 23. 4. Protein chosen from variants PSA-EHT101 to PSA-EHT104 of sequence SEQ ID Nos: 17 to 23, respectively. 5. Nucleic probe characterized in that it allows the detection by selective hybridization of a nucleic acid according to one of claims 1 to 2. 6. Probe according to claim 5, characterized in that it comprises the sequence of a nucleic acid according to one of claims 1 to 2. <Desc / Clms Page number 29> 7. A probe according to claim 6, characterized in that it comprises from 10 to 1000 nucleotides, preferably from 50 to 800. 8. Primer, characterized in that it allows the selective amplification of a nucleic acid according to one of claims 1 to 2. 9. A primer according to claim 8, characterized in that it is composed of 3 to 50 bases, preferably from 3 to 40 and even more preferably from 3 to 35 bases. 10. Primer according to one of claims 8 or 9, characterized in that it is complementary to at least one region of the gene coding for the specific PSA antigen carrying a mutation involved in cancer. 11. Primer according to claim 10, characterized in that it consists of a single-stranded nucleic acid comprising from 3 to 50 nucleotides complementary to at least part of one of the sequences SEQ ID NO: 4 to 7 or their complementary strand. 12. A pair of primers comprising a sense sequence and a reverse sequence, characterized in that the primers of said pair hybridize with a region of a nucleic acid according to one of claims 1 to 2 and allow the amplification of 'at least a portion of this nucleic acid. 13. Antibody, characterized in that it is specific for a protein or a polypeptide according to claims 3 or 4. 14. Antibody according to claim 13, characterized in that it is a polyclonal, a monoclonal or a derivative thereof. <Desc / Clms Page number 30> 15. Method for detecting a pathology or a predisposition to a pathology in a subject, comprising determining the presence, in a sample of said subject, of a nucleic acid according to one of claims 1 to 2 or d 'a protein or polypeptide according to claims 3 and 4. 16. Method according to claim 15, characterized in that the determination is carried out by sequencing, hybridization and / or selective amplification. 17. Method according to claim 16, characterized in that the amplification is carried out using a pair of primers according to claim 12. 18. Kit usable for implementing a method as defined in claims 15 to 17 comprising - a pair of primers according to claim 12 or a probe according to one of claims 5 to 7 or an antibody according to one of claims 13 and 14, and the reagents necessary for the amplification or for a hybridization or immunological reaction. 19. A method of selection or identification of active compounds, comprising contacting in vitro or ex vivo a test compound with a cell expressing a polypeptide according to claim 3, and the selection or identification of compounds modulating l expression or activity of said polypeptide. 20. Method according to claim 19, characterized in that it comprises the selection of the compounds binding to said polypeptide. <Desc / Clms Page number 31> 21. Method according to claim 19, characterized in that it comprises the selection of the compounds modulating the expression of said polypeptide. 22. Vector comprising a nucleic acid according to claim 1 or 2. 23. Recombinant cell comprising a vector according to claim 22. 24. Product comprising a nucleic acid according to one of claims 1, 2,5, 6 and 7, a vector according to claim 22, a polypeptide according to claim 3 or 4 or an antibody according to claim 13 or 14 immobilized on a support.