FR2846666A1 - New insect acetylcholine esterase, useful in screening for insecticides effective against strains resistant to organophosphates and carbamates - Google Patents

Abstract

An insect acetylcholine esterase (I) with a central catalytic region (A) that is (i) a 524 amino acid (aa) sequence (SEQ ID No:1), given in the specification, or (ii) a sequence 60 % identical or 70 % similar to SEQ ID No:1, is new, where the enzyme of sequence NCBI AAK 0973 is excluded. Independent claims are also included for the following: (1) peptide (II) that is a fragment of (I) with at least 7 aa; (2) isolated nucleic acid (III) that (i) encodes (I); (ii) is the sense or antisense complement of (i), or (iii) is a fragment with at least 8 bp, from (i) or (ii); (3) method for detecting insects that carry resistance to organophosphorus and carbamate insecticides (X); (4) recombinant vector that contains (III); (5) cells that contain the vector of (4); (6) antibody (Ab) directed against (I) or (II); (7) reagent for method (3) comprising (III) or Ab; (8) transgenic invertebrate animal containing cells transformed with (III); (9) methods of screening for insecticides; (10) reagent for method (9) containing (I), vectors of (4), cells of (5) or animals of (8); (11) detecting or screening kit containing reagents of (7) or (10); and (12) method of screening for inhibitors of (I).

Description

<Desc / Clms Page number 1>

 The present invention relates to a new acetylcholinesterase gene responsible for insecticide resistance, particularly in mosquitoes, to the products of this gene (cDNA, protein) and their applications, particularly for the screening of new insecticides and genetic detection of organophosphorus and / or carbamate resistance in mosquito populations.

Acetylcholinesterase (AChE, EC 3. 1.1.7) is an essential enzyme that hydrolyzes acetylcholine in synapses, thus ending cholinergic transmissions at neuronal or neuromuscular junctions. The inhibition of AChE prevents disabling of the synaptic signal, leading to a loss of control of cholinergic transmission. The biology of acetylcholinesterase has been extensively studied in invertebrates, especially insects, because this enzyme is the target of the main classes of pesticides used, organophosphorus and carbamate. However, the massive use of pesticides in recent decades has led to the emergence of resistant species. Among the resistance mechanisms, the selection of mutations making AChE insensitive to insecticides has been observed in many cases (For a review, see Fournier et al.
Comp. Biochem. Physiol., 1994, 108, 19-31).

 In order to accurately determine the nature of the target AChE insecticides, as well as the mutations responsible for their resistance, the genes encoding AChE (ace genes) have been isolated from different arthropod species (insects and arachnids).

 The first ace gene has been identified in Drosophila (Drosophila melanogaster), by reverse genetics (Hall et al., EMBO J., 1986, 5, 2949-2954). Evidence that this gene was involved in insecticide resistance was provided by the demonstration of amino acid substitutions in AChE of resistant drosophila, conferring insensitivity to cholinergic insecticides (Mutéro et al., PNAS, 1994). , 91, 5922-5926). Therefore, studies in D. melanogaster appeared to indicate the presence of a single ace gene in insects coding for the target AChE of cholinergic insecticides.

 However, with the exception of the ace gene of two other insects, Musca domestica (Williamson et al., 1992, In Multidisciplinary Approaches to Cholinesterase Functions, Eds Schafferman A. & Velan B., Plenum Press, New York, pp. 86;

<Desc / Clms Page number 2>

Walsh et al., Biochem. J., 2001, 359, 175-181; Kozaki et al., Insect. Biochem. Mol.
Biol., 2001, 31, 991-997) and Bactrocera oleae (Vontas et al., Insect Molecular
Biology, 2002, 11, 329-339), the study of the ace genes isolated from other insects or from arachnids, by homology with that of Drosophila, indicate that they are not involved in insecticide resistance. .

 Indeed, no mutation in the amino acid sequence of AChE encoded by the ace gene of Aphis gossypii, Nephotettix cincticeps and Boophilus microplus is observed between resistant and susceptible individuals (Menozzi et al., Thesis of PhD from Paul Sabatier University, Toulouse, 2000, et al., Insect Biochem, Mol Biol., 200,30, 325-333, Baxter et al., Insect Biochem Mol.

Biol., 1998, 28, 581-589; Hernandez et al., J. Med. Entomol., 1999, 36, 764-770), and independent segregation is observed between the ace gene of Culex pipiens and C. tritaeniorychus and insecticide resistance (Malcolm et al., Insect Mol., Biol.
1998, 7, 107-120; Mori et al., Insect Mol. Biol., 2001, 10, 197-203).

 With respect to other ace genes isolated from other insects, their role in insecticide resistance has not been studied (Lucilia cuprina: Chen et al., Insect Biochem Mol Mol Biol., 2001,31, 805-816 Schizaphis graminum: Gao et al., Insect Biochem Mol Mol Biol., 2001, 31, 1095-1104) or any form of AChE insensitive to insecticides has been described (Aedes aegypti, Anopheles gambiae and Anopheles stephensi: Anthony et al., FEBS letters, 1995, 368, 461-465, Malcolm et al., In Molecular Insect Science, Eds Hageborn et al., Plenum Press, New York, pp. 57-65).

 Two hypotheses have been put forward to explain the difference in insecticide resistance observed between Drosophila melanogaster or Musca domestica and the other insects or arachnids that have been studied: the presence of a "modifying gene" responsible for post-transcriptional modifications or posttranslational AChE, leading to AChE forms with different catalytic activities, and the presence of a second ace gene.

 However, no study has verified these hypotheses and therefore the nature of the gene and that of the target (AChE) involved in insecticide resistance in insects other than Drosophila melanogaster and Musca domestica or in arachnids :

<Desc / Clms Page number 3>

- The discovery in C. pipiens of two forms of AChE with distinct catalytic activities supports both hypotheses and the biochemical analysis of these AChE did not make it possible to determine the nature of the AChE involved in the insecticide resistance (Bourguet et al., J. Neurochemistry,
1996, 67, 2115-2123).

 A second ace gene has been isolated from arachnids; however, this gene is not involved in insecticide resistance (Hernandez et al., Baxter et al., supra).

 A second ace gene could not be isolated from insects despite numerous attempts in different species (Menozzi et al., Tomita et al., Mori et al., Cited above, Severson et al., J. Hered., 1997). , 88, 520-524).

 It follows from the foregoing that the nature of the gene and target (AChE), involved in organophosphorus and / or carbamate resistance, has not been identified in most insects and in arachnids, particularly in where they were sought; the most important in the areas of human or animal health and agriculture as vectors of pathogens and pests, including many mosquitoes such as Culex pipiens, Aedes aegypti, Anopheles gambiae, Anopheles albimanus, Anopheles stephensi, and pests of crops such as Aphis gossypii, Nephotettix cincticeps and Leptinotarsa decemlineata.

 The inventors have identified a new locus of the ace gene in the genome of Anopheles gambiae and 15 different species of mosquitoes and they have shown that this new locus, non-homologous to the locus previously described in D. melanogaster, was involved in resistance. insecticides in mosquitoes.

 The inventors have also shown that the resistance to insecticides, at least in the mosquitoes Culex pipiens species and Anopheles gambiae, was linked to a single mutation in the acetylcholinesterase sequence encoded by this new gene, located in the vicinity of the catalytic site of the enzyme.

 This new gene represents a diagnostic tool for the genetic detection of insecticide resistance (organophosphorus, carbamate) in mosquito populations. The AChE encoded by this gene represents a target for the

<Desc / Clms Page number 4>

 screening of new active molecules on insecticide resistant mosquito populations currently in use.

 The subject of the present invention is therefore a protein, characterized in that it comprises a central catalytic region which has an amino acid sequence selected from the group consisting of the sequence SEQ ID NO: 1 and the sequences having at least 60% identity or 70% similarity with the sequence SEQ ID NO: 1, excluding the sequence NCBI AAK0973 corresponding to the acetylcholinesterase of Schizaphis graminum.

 The protein according to the invention represents a new insect acetylcholinesterase, hereinafter referred to as AchEl, responsible for resistance to organophosphorus and / or carbamates, at least in mosquitoes, in particular in C. pipiens; the locus encoding said AchE1 is hereinafter referred to as ace-1 ace-2 represents the second ace locus, which is not involved in insecticide resistance in mosquitoes. The unique ace gene present in Drosophila melanogaster, which is homologous to ace-2, is therefore also called ace-2.

 According to the invention, said central catalytic region contains the catalytic domain of AChE and corresponds to that situated between positions 70 and 593 of the AChE1 1 sequence of Anopheles gambiae (SEQ ID NO: 3, 643 acids). amines); corresponds to that located respectively between positions 100 and 629 of the Schizaphis graminum AChEl sequence (NCBI AAK0973), 60 and 582 of the AChE1 sequence of Culex pipiens (SEQ ID NO: 34 and 593 of the sequence of AChE2 of Anopheles gambiae (Figure 1, SEQ ID NO: 53), and 41 and 601 of the AChE2 sequence of Drosophila melanogaster (NCBI AAF54915) .This central region that contains the catalytic domain is conserved in vertebrates and invertebrates whereas the N- and C-terminal ends show a high variability between the different species.

 According to the invention, the identity of a sequence with respect to a reference sequence (SEQ ID NO: 1) is assessed according to the percentage of amino acid residues which are identical, when the sequences corresponding to the catalytic region as defined above are aligned, so as to obtain the maximum of correspondence between them.

<Desc / Clms Page number 5>

 A protein having an amino acid sequence having at least X% identity with the reference sequence SEQ ID NO: 1 is defined in the present invention as a protein whose sequence corresponds to the central catalytic region as defined above. above may include up to 100-X alterations per 100 amino acids of the sequence SEQ ID NO: 1. For the purposes of the present invention, the term alteration includes consecutive or dispersed deletions, substitutions or insertions of amino acids in the reference sequence. This definition applies, by analogy, to nucleic acid molecules.

 The similarity of a sequence with respect to the reference sequence SEQ ID NO 1 is judged according to the percentage of amino acid residues which are identical or different by conservative substitutions, when the sequences corresponding to the central catalytic region. as defined above are aligned so as to obtain the maximum of correspondence between them. For the purposes of the present invention, the term "conservative substitution" means the substitution of one amino acid by another which has similar chemical properties (size, charge or polarity), which generally does not modify the functional properties of the protein.

 A protein having an amino acid sequence with at least X% similarity to the sequence SEQ ID NO: 1 is defined in the present invention as a protein whose sequence corresponding to the central catalytic region as defined above may include up to 100-X non-conservative alterations per 100 amino acids of the reference sequence. For the purposes of the present invention, the term non-conservative alterations includes deletions, non-conservative substitutions or consecutive or dispersed insertions of amino acids in the sequence SEQ ID NO: 1.

 The comparison of the AChE1 according to the invention with the AChE of insect available on the databases, by alignment of the sequences corresponding to the central region as defined above, using the BLAST software (http: / /www.ncbi.nlm.nih.gov/gorf/b12.html, default settings, inactive filter) shows that: - AChEl and AChE2 insect sequences have 36-39% identity (53 -57% similarity) between them.

<Desc / Clms Page number 6>

- AChEl insect sequences have 65-97% identity (79-
98% similarity) between them, - the AChE2 insect sequences have 58-99% identity (73-
99% similarity) to each other,
In addition, phylogenetic analysis of AChE of different animal species shows that AChE1 protein sequences form a significant autonomous group (bootstrap 795/1000), and that insect AChE1 form a distinct distinct subgroup (bootstrap 856). / 1000).

 The AChE1 according to the invention comprises characteristic patterns of AChE (FIG. 1) located at the following positions, respectively in the sequence SEQ ID NO: 3 and in the Torpedo californica reference sequence (SWISSPROT P04058): a canonical pattern of the type FGESAG around the serine at position 266 (200), which is characteristic of the active site of AchE, a choline binding site (tryptophan residue at position 151 (84)), three residues of the catalytic triad (serine, acid residues glutamic and histidine at positions 266 (200), 392 (327) and 506 (440, respectively, six cysteine residues potentially involved in conserved disulfide bridges (C134 (67) -C161 (94); C320 (254) -C333 (265); ), C468 (402) -C589 (521)), aromatic residues bordering the throat of the active site (10 residues) and a phenylalanine residue at position 355 (290) but not at position 353 (288), which distinguishes AChE from invertebrates from those of vertebrates.It also has a pep hydrophobic C-terminal tide corresponding to a glycolipid addition signal, indicating the posttranslational cleavage of a C-terminal fragment and the addition of a glycolipidic anchoring residue as in Drosophila; the cysteine residue in the C-terminal sequence preceding the potential cleavage site of the hydrophobic peptide could be involved in an intermolecular disulfide bond, linking the two catalytic subunits of the AChE dimer.

 The AChE1 according to the invention is distinguished from the AChE of Drosophila (AChE2) by the absence of a hydrophilic insertion of 31 amino acids between the residues located at positions 174 and 175 of the sequence SEQ ID NO: 3 (FIG. ); this hydrophilic insertion could be characteristic of AChE2, at least in Diptera.

 The invention encompasses AChEl of insect susceptible or resistant to organophosphorus and / or carbamate.

<Desc / Clms Page number 7>

 For the purposes of the present invention, the term "sensitive AChE" means an AChE whose acetylcholinesterase activity is inhibited in the presence of organophosphorus compounds or carbamates.

 For the purposes of the present invention, the term "resistant AChE" is understood to mean an AChE whose activity is not inhibited by concentrations of organophosphorus compounds or carbamates which inhibit 100% of the corresponding "sensitive AChE" activity resulting from an individual of the same species; this "resistant AChE" differs from the previous one by the presence of one or more mutations in its amino acid sequence (amino acid substitutions) which modify its sensitivity to acetylcholinesterase inhibitors; among these mutations, the following may be mentioned: F78S, I129V, G227A, F288Y, the amino acids being numbered with reference to the AChE sequence of Torpedo californica (SWISSPROT P04058).

 Acetylcholinesterase activity and catalytic parameters of AChE are measured by conventional enzymatic techniques such as those described in Bourguet et al., Supra.

 The proteins according to the invention include any natural, synthetic, semi-synthetic or recombinant protein of any prokaryotic or eukaryotic organism, comprising or consisting of an amino acid sequence of an AChE1 protein as defined above. These include natural proteins isolated from any insect species, as well as recombinant proteins produced in an appropriate expression system.

 According to an advantageous embodiment of said AChEl, it corresponds to that of an insect belonging to the order Diptera (Diptera); preferably, said insect is selected from the family Culicidae, from the genera Culex, Aedes and Anopheles.

 According to an advantageous arrangement of this embodiment, said AChE1 consists of the sequences SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 126 of Anopheles gambiae and the sequence SEQ ID NO: of Culex pipiens (strain S-LAB), sensitive to organophosphorus and / or carbamates.

 According to another advantageous arrangement of this embodiment, said catalytic central region of the AChE comprises a sequence selected from the group consisting of the sequences SEQ ID NO: 8 to 21 representing a fragment

<Desc / Clms Page number 8>

 approximately 91 amino acids (K fragment, Figure 1), corresponding to that between positions 445 and 535 of the sequence SEQ ID NO: 3.

 According to another advantageous embodiment of the invention, said AChE1 is an acetylcholinesterase resistant to insecticides of the class of organophosphorus and carbamates including a mutation of glycine located at position 119, in serine (mutation Gl19S); said position being indicated with reference to the AChE sequence of Torpedo californica (SWISSPROT P04058).

 In fact, the inventors have shown that the residue at position 119 is close to the residues of the catalytic site (serine 200 and histidine 440) and that the AChE1 glycine replacement of sensitive mosquitos by a serine, in the AChEI of the resistant mosquitoes, reduces the space of the catalytic site and prevents the insecticide from interacting with the catalytic serine (S200), because of the steric hindrance of Van der Waals bonds of the serine side chain at position 119. The role of the G119S mutation in insecticide resistance was confirmed by analysis of acetylcholinesterase activity of recombinant AChEl proteins produced from sensitive Culex pipiens cDNA (S-LAB strain possessing AChE1 including glycine in position 119) or resistant (strain SR whose AchE1 differs from the previous one only by the presence of a serine in position 119) to insecticides; 90% of the AChE1 activity of the susceptible strain is inhibited in the presence of 10-3 M propoxur whereas the AChE1 of the resistant strain retains 75% of its activity in the presence of 100 times higher concentrations of this protein. insecticide (10-1 M propoxur).

 According to an advantageous arrangement of this embodiment of said AChEl resistant, it corresponds to that of an insect (insecticide resistant) which belongs to the order Diptera (Diptera); preferably, said insect is selected from the family Culicidae, from the genera Culex, Aedes and Anopheles.

 Preferably, said resistant AChE1 has a sequence selected from the group consisting of: the sequence SEQ ID NO: 57, corresponding to the complete sequence of the C. pipiens strain SR, resistant to insecticides,

<Desc / Clms Page number 9>

 the sequence SEQ ID NO: 122, corresponding to the complete AChE1 sequence of the YAO strain of An, gambiae (isolated in Ivory Coast), resistant to insecticides, and the sequences comprising a sequence fragment SEQ ID NO: 90.93, 94.95, 97-101,103 and 106 showing a peptide fragment of about 150 amino acids encoded by the third exon encoding the ace-1 gene of a resistant insect as defined above, containing the mutation Gl 19S.

 According to yet another advantageous embodiment of the invention, said AChE1 is an acetylcholinesterase sensitive to insecticides of the class of organophosphorus and carbamates comprising a sequence selected from the group consisting of SEQ ID NO: 91,92, 96,102 to 112,114 , 115 and 117 to 119, representing a fragment of about 150 amino acids of the third exon encoding the ace-1 gene from an insect as defined above, sensitive to insecticides, said fragment including a glycine at position 119 in reference to the AChE sequence of Torpedo californica (SWISSPROT P04058).

 The subject of the present invention is also a peptide, characterized in that it consists of a fragment of at least 7 amino acids of the AChE1 protein, as defined above; these fragments are particularly useful for the production of antibodies specifically recognizing the AChE1 protein.

 The present invention also relates to antibodies, characterized in that they are directed against the AChE1 protein or a fragment thereof, as defined above.

 According to the invention, said antibodies are either monoclonal antibodies or polyclonal antibodies.

 These antibodies can be obtained by conventional methods, known per se, including in particular the immunization of an animal with a protein or a peptide according to the invention, in order to make it produce antibodies directed against said protein or said peptide.

 The subject of the present invention is also an isolated nucleic acid molecule, characterized in that it has a sequence selected from the group consisting of:

<Desc / Clms Page number 10>

 the sequences coding for an AChE1 protein as defined above (cDNA and genomic DNA fragment corresponding to the ace-1 gene), and the complementary sequences of the previous ones, meaning or antisense.

 fragments at least 8 bp, preferably 15 bp to 500 bp from the preceding sequences.

 The invention encompasses the sequences of alleles of the ace-1 gene derived from any insect, as well as the sequences of the natural mutants (sensitive and resistant alleles) or artificial mutants of the ace-1 gene coding for a sensitive or resistant AChE1 protein. as defined above.

 According to an advantageous embodiment of the invention, said sequence coding for an AChE1 protein is selected from the group consisting of: a) the sequences SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 125, SEQ ID NO: 6, SEQ ID NO: 56 and SEQ ID NO: 121 which correspond to the cDNA of the AChE1 protein of sequence in amino acids, respectively SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 126, SEQ ID NO: 7, SEQ ID NO: 57 and SEQ ID NO: 122, as defined above, b) the sequences SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 127 which correspond to the gene Anopheles gambiae ace-1 encoding the AChE1 as defined above, which gene has an exon-intron organization comprising at least 9 exons (Table I), and c) the sequences comprising the sequence SEQ ID NO: 120 which corresponds to the almost complete sequence of the anopheles gambiae ace-1 gene coding for the resistant AChE1 of sequence SEQ ID NO: 122, as defined above.

Table 1: Intron-Exon Organization of the ace-1 Gene

<Tb>
<tb> Site <SEP> 5 '~~~~~~~~~~~ Site <SEP>3'
<tb> Position <SEP> Sequence <SEP> Position <SEP> Sequence
<tb> Intron <SEP> 1 <SEP> 301 <SEP> AGCAA / gtaat <SEP> 1255 <SEP> cgcag / CCATT <SEP>
<tb> Intron2 <SEP> 1413 <SEP> CAATG / gtgag <SEP> 5338 <SEP> tgtag / CGCTC <SEP>
<tb> Intron3 <SEP> 5696 <SEP> CGCAG / gtcgg <SEP> 7634 <SEP> ttcag / ACGCA <SEP>
<tb> Intron4 <SEP> 7769 <SEP> CTCGG / gtaag <SEP> 7855 <SEP> ggcag / ACGCG <SEP>
<tb> Intron5 <SEP> 8393 <SEP> CTACG / gtagg <SEP> 8472 <SEP> gtcag / CTGGG <SEP>
<tb> Intron6 <SEP> 8670 <SEP> CTAAG / gtacg <SEP> 8756 <SEP> tccag / AGCAC <SEP>
<tb> Intron7 <SEP> 9464 <SEP> ACCGG / gtaag <SEP> 9530 <SEP> tacag / CAATC <SEP>
<tb> Intron8 <SEP> 9703 <SEP> TACCT / gtaag <SEP> 9810 <SEP> aacag / CGAAC
<Tb>

<Desc / Clms Page number 11>

In accordance with the present invention, the third exon coding of the ace-1 gene corresponds to that which is located between intron 4 and intron 5 in the sequence of An. gambiae (Table I), that is to say between positions 7854 and 8393 of the sequence SEQ ID NO: 127.

 According to another advantageous embodiment of the invention, said fragment is selected from the group consisting of the primers of sequence SEQ ID NO: 39 to 50,54, 55,58, 59,123, 124 and the fragments of sequences SEQ ID NO : 24 to 38 and 60 to 89.

 The nucleic acid molecules according to the invention are obtained by conventional methods, known in themselves, following the standard protocols such as those described in Current Protocols in Molecular Biology (Frederick M.

AUSUBEL, 2000, Wiley and his Inc, Library of Congress, USA). For example, they can be obtained by amplification of a nucleic sequence by PCR or RTPCR, by screening of genomic DNA libraries by hybridization with a homologous probe, or by total or partial chemical synthesis.

 The nucleic acid molecules as defined above can be used as probes or as primers to isolate the ace-1 gene from other species or alleles of this gene, in particular by screening a genomic DNA library or cDNA, as well as for detecting / amplifying nucleic acid molecules (mRNA or genomic DNA) encoding an AChE1 protein as defined above.

 These different nucleic acid molecules make it possible to highlight the ace-1 gene, allelic variants of this gene, a functional alteration of this ace-1 gene (substantial change in sensitivity to insecticides) resulting from a mutation (insertion deletion or substitution) of one or more nucleotides at said gene.

 The subject of the present invention is also a method for detecting insects carrying resistance to insecticides of the class of organophosphorus compounds and carbamates, characterized in that it comprises: the preparation of a sample of nucleic acids to from insects to test, and

<Desc / Clms Page number 12>

 detection by any appropriate means of the presence, in said nucleic acid sample, of a mutation in the ace-1 gene as defined above.

 Said detection is carried out by the conventional techniques which are known per se, for example: (i) by amplification of a region of said ace-1 gene capable of containing a mutation, then detection of said mutation by sequencing or by digestion with a appropriate restriction enzyme, the PCR product obtained, or (ii) by hybridization with a labeled probe specific for a region of said ace-1 gene likely to contain a mutation, then direct detection of mismatches and / or digestion with an enzyme appropriate restriction.

 According to a first advantageous embodiment of said method, a fragment of approximately 320 bp (fragment K) is amplified using the primers SEQ ID NO: 39 and SEQ ID NO: 40. For example, in mosquitoes a fragment of sequence SEQ ID NO: 24 to 38 is obtained which exhibits mutations between the mosquitos that are sensitive and resistant to insecticides. For example, in C. pipiens there are 3 substitutions in the sequence of resistant individuals, one of which introduces an EcoRI site. Analysis of the restriction profile after PCR amplification of the K fragment and digestion of the products obtained by EcoRI (RFLP analysis) makes it possible to rapidly detect the ace-1 genotype in a population of C. pipiens; the presence of a single fragment corresponds to resistant homozygotes (RR), the presence of 2 fragments of approximately 106 bp and 214 bp corresponds to susceptible homozygous individuals (SS) and the presence of 3 fragments of 106 bp, 214 bp and 320 pb corresponds to resistant heterozygous individuals (RS).

 According to a second advantageous embodiment of said method, the Gl19S mutation in the third exon coding for the ace-1 gene which is responsible for resistance to insecticides of the class of organophosphorus compounds and carbamates in mosquitoes is detected according to the invention. one of the following alternatives, respectively in C. pipiens and An. gambiae mosquitoes: - in Culex pipiens mosquitoes, a 520 bp fragment of the third coding exon is amplified from the genomic DNA, by PCR using the pair of primers Ex3dir and Ex3rev (SEQ ID NO: 58 and 59); PCR fragment is digested with Alu I and the digestion product is separated by gel electrophoresis

<Desc / Clms Page number 13>

 agarose, then the restriction profile thus obtained is analyzed: the presence of a fragment of 520 bp corresponds to the SS sensitive homozygous individuals, the presence of two fragments (357 bp and 163 bp) corresponds to RR resistant homozygous individuals and the presence of 3 fragments (520 bp, 357 bp and 163 bp) corresponds to the RS-resistant heterozygous individuals, - in the mosquitoes of the Anopheles gambiae species, a 541 bp fragment of the third coding exon is amplified from the genomic DNA by PCR using the pair of primers Ex3AGdir and Ex3AGrev (SEQ ID NO: 123 and 124); the PCR fragment is digested with Alu I and the digestion product is separated by agarose gel electrophoresis, and the restriction profile thus obtained is analyzed: the presence of two fragments (403 bp and 138 bp) corresponds to the susceptible homozygous individuals SS, the presence of 3 fragments (253 bp, 150 bp and 138 bp) corresponds to RR resistant homozygous individuals and the presence of 4 fragments (403 bp, 253 bp, 150 bp and 138 bp) corresponds to RS resistant heterozygous individuals; Since the 150 bp and 138 bp fragments co-migrate, the homozygous and heterozygous resistant individuals are detected respectively by the presence of 2 bands (253 bp and about 150 bp) and 3 bands (403 bp, 253 bp and about 150 bp).

 The present invention also relates to an insect detection reagent carrying organophosphorus and / or carbamate resistance, characterized in that it is selected from the group consisting of: nucleic acid molecules and their fragments as defined above (probes, primers) and the antibodies as defined above.

 The present invention also relates to a recombinant vector, characterized in that it comprises an insert selected from the group consisting of nucleic acid molecules encoding an AChEl protein and their fragments as defined above.

 Preferably, said recombinant vector is an expression vector wherein said nucleic acid molecule or a fragment thereof is under the control of appropriate transcriptional and translational regulatory elements.

 These vectors are constructed and introduced into host cells by conventional methods of recombinant DNA and genetic engineering, which are known

<Desc / Clms Page number 14>

 in themselves. Many vectors in which a nucleic acid molecule of interest can be inserted in order to introduce and maintain it in a eukaryotic or prokaryotic host cell are known per se; the choice of an appropriate vector depends on the use envisaged for this vector (for example replication of the sequence of interest, expression of this sequence, maintenance of the sequence in extrachromosomal form or integration into the chromosomal material of the host ), as well as the nature of the host cell. For example, viral vectors such as baculoviruses or non-virals can be used as plasmids. To express AChE1, the ace-1 cDNA can be placed under the control of a constitutive promoter such as the 5C actin promoter, in a suitable vector, and said recombinant vector is introduced into insect cells. such as Drosophila cells (Schneider S2 cells).

 The subject of the present invention is also prokaryotic or eukaryotic cells, modified by a recombinant vector as defined above; preferably these cells are insect cells.

 The recombinant vectors and the modified cells as defined above are particularly useful for the production of AChEl proteins and peptides according to the invention.

 The present invention also relates to a transgenic invertebrate animal, characterized in that it contains cells modified by at least one nucleic acid molecule as defined above; preferably said animal is an insect.

 The transgenic animals and the modified cells as defined above, are useful in particular for the screening of insecticidal substances and for the biological control of vectors of pathogens and harmful insects.

 The subject of the present invention is also a method for screening an insecticidal substance, characterized in that it comprises: a) bringing the substance under test into contact with an AChE1 protein selected from: the AChEl protein isolated according to invention, a modified cell extract or a biological sample of a transgenic animal containing said AChE1 protein, as defined above, in the presence of acetylcholine or a derivative thereof,

<Desc / Clms Page number 15>

 b) the measurement by any appropriate means of the acetylcholinesterase activity of the mixture obtained in a), and c) the selection of substances capable of inhibiting said activity.

 The subject of the present invention is also a method for screening an insecticidal substance, characterized in that it comprises: contacting a transgenic animal as defined above with the substance to be tested, and measuring the survival of the animal.

 Advantageously, said screening methods use AChEl resistant to organophosphorus or carbamates or transgenic cells or animals containing them.

 The present invention also relates to a reagent for screening insecticidal substances, characterized in that it is selected from the group consisting of AChEl proteins, recombinant vectors, modified cells and transgenic animals as defined above.

Insecticidal substances capable of inhibiting the acetylcholinesterase activity of AChEl proteins resistant to insecticides of the class of organophosphorus compounds and carbamates commonly used have applications in human and animal health, for the control of pathogen vectors (for example Aedes aegypti, vector of arboviruses such as dengue and yellow fever, Culexpipiens WestNile virus vector, Anopheles gambiae african vector of the malaria agent, etc.) and in the field of agriculture, to fight against pests that devastate crops (eg the Colorado potato beetle (Leptinotarsa decemlineata) which attacks potatoes, aphid pests such as Aphis gossypii and Myzus persicae, etc.).

 The invention further relates to a detection and / or screening kit for the implementation of the methods as defined above, characterized in that it includes at least one reagent as defined above.

 In addition to the foregoing, the invention also comprises other arrangements which will emerge from the description which follows, which refers to examples of implementation of the ace-1 gene and its products (cDNA, protein) according to the

<Desc / Clms Page number 16>

 the invention and the table summarizing the sequences of the application and the accompanying drawings in which: - Figure 1 illustrates the alignment of amino acid sequences AChEl proteins Anopheles gambiae, Schizaphis graminum, An. stephensi, Aedes aegypti , Drosophila melanogaster, Lucilia cuprina, Musca domestica and Culex pipiens. By convention, amino acids are numbered with reference to the AChE sequence of torpedo fish (Torpedo californica; SWISSPROT P04058). The N- and C-terminal sequences are not represented because of their variability.

The amino acids conserved between AChE1 and AChE2 are indicated in gray. The specific amino acids of AChE2 are indicated in black. The 3 residues representing the catalytic triad (S200, E327 and H44o) are framed. The choline binding site (W84) is underlined. The circles represent the position of the 14 aromatic residues bordering the throat of the active site in AChE Torpedo, 10 of which are present in all
AChEl and AChE2 (solid circles), the others not being preserved (empty circles).

Three intramolecular disulfide bonds between cysteine residues are indicated. The horizontal arrow indicates the position of fragment K (amplified using primers PdirAGSG and PrevAGSG). The hypervariable region of AChE2 that is absent in AChEl is surrounded.

 FIG. 2 illustrates the genetic detection of organophosphorus and / or carbamate resistant mosquitoes by PCR-RFLP: FIG. 2A represents the comparison of the amino acid sequence of the K fragment of different mosquito species: Pip (Culex pipiens), Ae alb (Aedes albopictus), Ae aeg (Aedes aegypti), An alb (Anopheles albimanus), An gamb (Anopheles gambiae), An funeral (Anopheles funestus), An nil (Anopheles nili), An bag (Anopheles sacharovi), An pele (Anopheles pseudopunctipennis). The variant amino acids are grayed out. The following sequences are identical: An. Darlingi and An. Albimanus; An. Sundaicus, An. Gambiae and An. Arbiensis; An. Moucheti, An. Funestus and An. Minimus; An. Stephensi and An. Saccharovi.

 . FIG. 2B illustrates the comparison of the nucleotide sequences corresponding to the K fragment of the sensitive (S-LAB) and resistant (SR) strains. The variant nucleotides are greyed out (t # c at position 3; a # g at position 84: the EcoRel site (Gaattc) located around this position, used for PCR-RFLP analysis, is

<Desc / Clms Page number 17>

present only in the S-LAB strain; c # t in position 173). Figure 2C illustrates the restriction profiles obtained after agarose gel electrophoresis of EcoRI digests, PCR amplified K fragment. The susceptible homozygous strain S-LAB has a profile characterized by 2 bands (214 bp and
106 bp), the resistant homozygous strain has a profile characterized by a single band of 320 bp and the resistant mosquitoes from the crossover have a heterozygous profile characterized by 3 bands (320 bp, 214 bp and 106 bp).

 - Figure 3 illustrates the phylogenetic tree of AChE proteins.

Phylogenetic analysis was performed from 47 AChE protein sequences from 35 different species from the ESTHER database (http://www.ensam.inra.fr/cgi-bin/ace/index). The sequences were aligned and a tree was constructed as described in Example 1. Only nodes corresponding to bootstrap values> 50% (i.e., scores greater than 500) are indicated.

The scale represents a divergence of 10%. Agam: An. Gambiae; Aeg: Aedes aegypti; Aste: Anopheles stephensi; Cp: Culex pipiens; Dmel: Drosophila melanogaster: Lupine: Lucilia cuprina: Mdom: Musca domestica: Ldec: Leptinotarsa decemlineata; Amel: Apis mellifera: Ncin: Nephotettix cincticeps; Sgra: Schizaphis graminum; Rapp: Rhipicephalus appendiculatus; Bmic: Boophilus microplus; Bdec: Boophilus decoloratus; Hsap: Homo sapiens; Btau: Bos taurus; Fcat: Felix catus; Ocun: Oryctolagus cunhiculus; Rnor: Rattus norvegicus; Mmus: Mus musculus; Ggal: Gallus gallus; Drer: Danio reno; Eele: Electrophorus electricus; Tamr: Torpedo marmorata; Tcal: Torpedo californica; Bfas: Bungarus fasciatus; Mglu: Myxine glutinosa; Bflo: Branchiostoma floridae; Blan: Branchiostoma lanceolatum; Cint: Ciona intestinalis; Csav: Ciona savignyi; Celé: Caenorhabditis elegans; Cbrig: Caenorhabditis briggsae; Dviv: Dictyocaulus viviparus; Lopa: Loligo opalescens.

 FIG. 4 illustrates the cladogram of AChE1 and AChE2 proteins.

The AChE1 and AChE2 protein sequences were processed as in Figure 1. The Bmic sequence was added as an external sequence to define the origin of the tree.

Frames marked with an asterisk represent the proteins encoded by a gene that segregates with insecticide resistance. Empty frames represent proteins encoded by a gene that does not segregate with insecticide resistance. The scale corresponds to a divergence of 10%.

<Desc / Clms Page number 18>

 FIG. 5 illustrates the comparison of the amino acid sequences of the AChE1 protein of C. pipiens, between a sensitive strain (S-LAB) and a resistant strain (SR) with insecticides. The unique glycine mutation 247 (119) # serine 247 (119) (indicated in gray) is responsible for insecticide resistance in C. pipiens mosquitoes; it corresponds to the substitution of the glycine located at position 247 of the AChE1 sequence of C. pipiens (or in position 119, with reference to the AChE sequence of the torpedo fish) by a serine.

 FIGS. 6A and 6B illustrate the comparison of the nucleotide sequences coding for the AChE1 protein of C. pipiens, between a sensitive strain (S-LAB) and a resistant strain (SR) with insecticides; all mutations are silent with the exception of the mutation at position 739 (G # A), which leads, on the one hand, to the substitution of the glycine codon (GGC) at position 247 of the AchE1 protein sequence of the susceptible strain ( S-LAB) by a serine codon (AGC) responsible for insecticide resistance in the SR strain, and on the other hand, the appearance of an Alu I site (AGCT) in the sequence of the resistant strain, useful for the detection of the mutation. The mutation (G - A) at position 739 of the nucleotide sequence and the glycine # serine mutation at position 247 of the amino acid sequence are indicated in gray. The sequences of the primers used to detect the mutation at position 739 (primer Ex3dir and Ex3rev), as well as the site Alu I are indicated in bold and underlined.

FIG. 7 (A, B and C) illustrates the three-dimensional structure of Achel of C. pipiens, obtained by molecular modeling from the structure of the AchE of the torpedo fish:
Figure 7A illustrates (i) the overall structure of the two proteins and (ii) and the steric hindrance of Van der Waals bonds of serine 200 and histidine 440 of the catalytic site of the enzyme, as well as that of the amino acid at position 119 which is mutated in the cases of resistance; the residue at position 119 is close to residues S200 and H440 of the catalytic site.

 FIGS. 7B and 7C illustrate the comparison of the steric hindrance of Van der Waals bonds with amino acids glycine (FIG. 7C) and serine (FIG. 7B) at position 119, of the sensitive and resistant strain, respectively.

The congestion of the serine side chain in position 119 in the strain

<Desc / Clms Page number 19>

 resistant, reduces the space of the catalytic site which presumably prevents the insecticide from interacting with the catalytic serine (S200).

 FIG. 8 illustrates the PCR-RFLP detection of the glycine # serine mutation in the third exon coding for the ace-1 gene, in C. pipiens mosquitoes: 1 band (520 bp) is detected in individuals SS-sensitive homozygotes, 2 bands (357 bp and 163 bp) are detected in RR-resistant homozygous individuals and 3 bands (520 bp, 357 bp and 163 bp) are detected in RS-resistant heterozygous individuals.

 FIGS. 9A and 9B illustrate the comparison of the sequences of the ance-1 gene of An. gambiae, between a susceptible strain (KISUMU) and a resistant strain (YAO) to insecticides; all mutations are silent with the exception of two mutations: the first corresponds to the replacement of valine (CGT) at position 33 of the AChE1 sequence of the susceptible strain (SEQ ID NO: 5) by an alanine (CGC ) in the resistant strain and the second is the same glycine (GGC) - serine (AGC) mutation found in Culex pipiens. The glycine (GGC) -> serine (AGC) mutation causes the appearance of a second Alu I site (AGCT) in the sequence of the third exon coding for the resistant strain, useful for the detection of the mutation. The coding sequences of the ace-1 gene are indicated in bold and the mutations are indicated in gray. The sequences of the Ex3AGdir and Ex3Agrev primers used to detect the glycine mutation (GGC) # serine (AGC), as well as the Alu I sites of the third coding exon are indicated in bold and underlined.

 FIG. 10 illustrates the quantification of the acetylcholinesterase activity of the recombinant AChE1 proteins of Culex pipiens, sensitive (S-LAB, white bars) and resistant (SR, gray bars), produced in S2 insect cells, in comparison with that crushed C. pipiens of S-LAB strain (hatched white bars) and SR strain (shaded gray bars). The acetylcholinesterase activity of the cell extracts and the crushed mosquitoes was measured in the absence (C) and in the presence of 10-4M and 10-2M propoxur. The single mutation glycine247 (119) -> serine247 (119) renders acetylcholinesterase insensitive to insecticide.

<Desc / Clms Page number 20>

Table II: List of sequences

<Tb>
<tb> Number <SEP> Sequence
<tb> identification
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 1 <SEP> fragment <SEP> of <SEP> the <SEP> region <SEP> Central <SEP> of <SEP> the <SEP> protein <SEP> AChE1 <SEP> Anopheles
<tb> gambiae <SEP> (positions <SEP> 70 <SEP> to <SEP> 593 <SEP> of <SEP> the <SEQ> SEQ <SEP> ID <SEP> NO: <SEP> 3). <September>
<Tb>

SEQ <SEP> ID <SEP> NO: 2 <SEP> cDNA <SEP> AChE1 <SEP> Anopheles <SEP> gambiae
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 3 <SEP> Protein <SEP> AChE1 <SEP> Anopheles <SEP> gambiae
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 4 <SEP> cDNA <SEP> AChE1 <SEP> Anopheles <SEP> gambiae <SEP> (strain <SEP> KISUMU)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 5 <SEP> Protein <SEP> AChE1 <SEP> Anopheles <SEP> gambiae <SEP> (strain <SEP> KISUMU)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 6 <SEP> cDNA <SEP> AChE1 <SEP> Culex <SEP> pipiens <SEP> strain <SEP> S-LAB <SEP> (Sequence <SEP > complete)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 7 <SEP> Protein <SEP> AChE1 <SEP> Culex <SEP> pipiens <SEP> strain <SEP> S-LAB <SEP> (Sequence <SEP > complete)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 8 <SEP> fragment <SEP> peptidic <SEP> K <SEP> AChE1 <SEP> Culex <SEP> pipiens
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 9 <SEP> Peptide fragment <SEP>SEP> K <SEP> AChE1 <SEP> Aedes <SEP> aegypti
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 10 <SEP> fragment <SEP> peptidic <SEP> K <SEP> AChE1 <SEP> Aedes <SEP> albopictus
<tb> SEQ <SEP> ID <SEP> N0: 11 <SEP> peptide fragment <SEP> peptide <SEP> K <SEP> peptide <SEP> AChE1 <SEP> Anopheles <SEP> darlingi
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 12 <SEP> Peptide fragment <SEP>SEP> K <SEP> AChE1 <SEP> Yr. <SEP> sundaicus
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 13 <SEP> peptide <SEP> fragment <SEP> K <SEP> AChE1 <SEP> Yr. <SEP> minimus
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 14 <SEP> fragment <SEP> peptidic <SEP> K <SEP> AChE1 <SEP> Yr. <SEP> moucheti
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 15 <SEP> peptide fragment <SEP><SEP> K <SEP> AChE1 <SEP> Yr. <SEP> arabiensis
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 16 <SEP> Peptide fragment <SEP>SEP> K <SEP> AChE1 <SEP> An. <SEP> funestus
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 17 <SEP> fragment <SEP> peptidic <SEP> K <SEP> AChE1 <SEP> Yr. <SEP> pseudopunctipennis
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 18 <SEP> fragment <SEP> peptidic <SEP> K <SEP> AChE1 <SEP> Yr. <SEP> sacharovi
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 19 <SEP> peptide <SEP> fragment <SEP> K <SEP> AChE1 <SEP> Yr. <SEP> stephensi
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 20 <SEP> peptide fragment <SEP>SEP> K <SEP> AChE1 <SEP> An, <SEP> albimanus
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 21 <SEP> fragment <SEP> peptide <SEP> K <SEP> AChE1 <SEP> Yr. <SEP> nili
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 22 <SEP> gene <SEP> ace-1 <SEP> Yr. <SEP> gambiae
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 23 <SEP> gene <SEP> ace-1 <SEP> Yr. <SEP> gambiae <SEP> KISUMU
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 24 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> C. <SEP> pipiens <SEP> (strain <SEP> S-LAB)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 25 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> C. <SEP> pipiens <SEP> (strain <SEP> SR)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 26 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> Aedes <SEP> aegypti
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 27 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> Aedes <SEP> albopictus
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 28 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> Anopheles <SEP> darlingi
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 29 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> An. <SEP> sundaicus
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 30 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> An. <SEP> minimus
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 31 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> Yr. <SEP> moucheti
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 32 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> Yr. <SEP> arabiensis
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 33 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> An. <SEP> funestus
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 34 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> Yr. <SEP> pseudopunctipennis
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 35 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> Yr. <SEP> sacharovi
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 36 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> Yr. <SEP> stephensi
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 37 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> Yr. <SEP> albimanus
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 38 <SEP> fragment <SEP> nucleotide <SEP> K <SEP> AChE1 <SEP> An. <SEP> nili
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 39 <SEP> primer <SEP> PkdirAGSG
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 40 <SEP> primer <SEP> PkrevAGSG
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 41 <SEP> primer <SEP> PbdirAGSG
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 42 <SEP> primer <SEP> PbrevAGSG
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 43 <SEP> primer <SEP> culex-bdir1
<Tb>

<Desc / Clms Page number 21>

<Tb>
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 44 <SEP> primer <SEP> culex-krev1
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 45 <SEP> primer <SEP> AG1-Adir
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 46 <SEP> primer <SEP> AG1-Arev
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 47 <SEP> primer <SEP> AG1-Bdir
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 48 <SEP> primer <SEP> AG1-Brev <SEP>
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 49 <SEP> primer <SEP> AG1-Cdir
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 50 <SEP> primer <SEP> AG1-Crev
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 51 <SEP> Protein <SEP> AChE1 <SEP> Ciona <SEP> intestinalis
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 52 <SEP> Protein <SEP> AChE1 <SEP> Ciona <SEP> savignyi
<tb> SEQ <SEP> ID <SEP> NO: <SEQ> 53 <SEP> Protein <SEP> AChE2 <SEP> Anopheles <SEP> gambiae
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 54 <SEP> Primer <SEP>culex-5'dir
<tb> SEQ <SEP> ID <SEP> NO <SEP>: 55 <SEP> Primer <SEP>culex-3'dir
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 56 <SEP> cDNA <SEP> AChE1 <SEP> C. <SEP> pipiens <SEP> strain <SEP> SR <SEP> (SEP sequence) complete)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 57 <SEP> Protein <SEP> AChE1 <SEP> C. <SEP> pipiens <SEP> strain <SEP> SR <SEP> (sequence <SEP> complete)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 58 <SEP> Primer <SEP> Ex3dir
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 59 <SEP> Primer <SEP> Ex3rev
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 60 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Espro <SEP> -P * -R ****
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 61 <SEP> Fragment <SEP> nucleotide <SEP> of the <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Pro- RQ ** - S
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 62 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> S- LAB-QS *****
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 63 <SEP> Fragment <SEP> nucleotide <SEP> of the <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Padova- PR
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 64 <SEP> Fragment <SEP> nucleotide <SEP> of the <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Praias- PR
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 65 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Supercar- QR
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 66 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> BrugesA- PS
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 67 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> BQ- QR
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 68 <SEP> Fragment <SEP> nucleotide <SEP> of the <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> DJI- QR
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 69 <SEP> Fragment <SEP> nucleotide <SEP> of the <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Harare- QR
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 70 <SEP> Fragment <SEP> nucleotide <SEP> of the <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Martinique- QR
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 71 <SEP> Fragment <SEP> nucleotide <SEP> of the <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Barriol- PR
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 72 <SEP> Fragment <SEP> nucleotide <SEP> of the <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Blueberry- PS
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 73 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> BrugesB- PS
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 74 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Heteren PS
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 75 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Ling QS
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 76 <SEP> Fragment <SEP> nucleotide <SEP> of the <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Mao QS
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 77 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> TemR- QS
<tb> SEQ <SEP> ID <SEP> NO: <SEQ> 78 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Uppsala T *** - S
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 79 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Trans- QS
SEQ SEP ID SEP NO: SEP 80 SEP Fragment SEP nucleotide SEP third SEP exon SEP encoding SEP
<tb> SEQ <SEP> ID <SEP> NO: <SEQ> 81 <SEP> Fragment <SEP> nucleotide <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> BSQ-QS
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 82 <SEP> Fragment <SEP> nucleotide <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Brazza-QS
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 83 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Bouaké QR
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 84 <SEP> Fragment <SEP> nucleotide <SEP> of the <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Thai QS
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 85 <SEP> Fragment <SEP> nucleotide <SEP> of the <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Madurai- QS
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 86 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Recife- QR
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 87 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Brazil <SEP> QS
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 88 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Moorea <SEP> QS
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 89 <SEP> Fragment <SEP> nucleotide <SEP> of <SEP> third <SEP> exon <SEP> encoding <SEP> strain <SEP> Killcare <SEP> PS
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 90 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 91 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 92 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 93 <SEP> (1)
<Tb>

<Desc / Clms Page number 22>

<Tb>
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 94 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 95 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 96 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 97 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 98 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 99 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 100 <SEP> (1)
<tb> SEO <SEP> ID <SEP> NO: <SEP> 101 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEQ> 102 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEQ> 103 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 104 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 105 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 106 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 107 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 108 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 109 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 110 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 111 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 112 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 113 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 114 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 115 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 116 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: 117 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: 118 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 119 <SEP> (1)
<tb> SEQ <SEP> ID <SEP> N0: 120 <SEP> gene <SEP> ace-1 <SEP> An. <SEP> gambiae <SEP> strain <SEP> YAO
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 121 <SEP> cDNA <SEP> AChE1 <SEP> An. <SEP> gambiae <SEP> strain <SEP> YAO <SEP> (SEP sequence) complete)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 122 <SEP> protein <SEP> AChE1 <SEP> An. <SEP> gambiae <SEP> strain <SEP> YAO <SEP> (SEP sequence) complete)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 123 <SEP> primer <SEP> Ex3 <SEP> AG <SEP> dir
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 124 <SEP> primer <SEP> Ex3 <SEP> AG <SEP> rev
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 125 <SEP> cDNA <SEP> AChE1 <SEP> Yr. <SEP> gambiae <SEP> strain <SEP> KISUMU <SEP> (SEP sequence) complete)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 126 <SEP> protein <SEP> AChE1 <SEP> An. <SEP> gambiae <SEP> strain <SEP> KISUMU <SEP> (SEP sequence) complete)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 127 <SEP> gene <SEP> ace-1 <SEP> of An. <SEP> gambiae <SEP> (including <SEP> 2 <SEP> exons <SEP>5'non-coding)
<Tb>
* P = Culexpipiens pipiens (subspecies pipiens) ** Q = Culex pipiens quinquefasciatus (subspecies quinquefasciatus) *** T = Culex torrentium **** R = resistant ***** S = sensitive (1) peptide fragments The third coding exon corresponding to the nucleotide fragments SEQ ID NO: 60 to 89 EXAMPLE 1 and methods a) Strains and crosses Five strains of C. pipiens were used: a standard strain sensitive to insecticides (Georghiou et al., 1966, Bull Wld Hlth Org., 35, 691-708), SA1, SA4 and EDIT which have a single insecticide-sensitive AChE,

<Desc / Clms Page number 23>

 and SR which is homozygous for insect-insensitive AChE (Berticat et al., Genet Res., 2002, 79, 41-47). The strains possessing a sensitive and insensitive AChE are designated respectively S and R. b) Nomenclature of the ace genes and numbering of the amino acid sequences ace-1 represents the locus coding for a cholinergic AChE responsible for resistance to organophosphorus compounds and / or carbamates in C. pipiens (AChE1), previously named Ace.l (Raymond et al., Genetica, 2001, 112/113, 287-296). ace-2 represents the second ace locus, which is not involved in insecticide resistance in C. pipiens (previously named Ace.2), whose function is unknown in C. pipiens. The unique ace gene present in Drosophila melanogaster, which is homologous to ace-2, is therefore referred to as the same.

In the following analyzes, the positions of the amino acid residues are indicated with reference to the AChE sequence of the torpedo fish [Torpedo californica; GENBANK P04058], according to the nomenclature recommended by Massoulié et al., 1992, In Multidisciplinary Approaches to Cholinesterase Functions, Eds, Schafferman, A. & Velan, B. (Plenum Press New York), p 285-288]. c) Analysis of the transmission of the ace-1 gene
Females being indicated first, FI (SXR) crosses and back crosses (FIX S-LAB and S-LAB X FI) were obtained by mass crossing of adults. Some larvae from backcrossing were treated with a dose of carbamate (propoxur, 4mg / L) that kills 100% of susceptible larvae. The binding between ace-1 and propoxur resistance was studied by RFLP in surviving larvae, from a 320 bp PCR product to identify the S and R alleles. The experiments were performed independently, with S = SA1, S = SA4 and S = EDIT. d) Sequence analysis and gene assembly
All the sequence analyzes were made from the raw Anopheles gambiae sequences available on the INFOBIOGEN server (http://www.infobiogen.fr) and the tools available on the site (http: //www.ncbi.nlm .nih.gov / blast / blast). The genomic sequences coding for AChE have been identified using the software programs TBLASTN and BLAST (Altschul et al., J.

Biol. Mol., 1990, 251, 403-410). The genomic sequences identified were assem-

<Desc / Clms Page number 24>

http ://www. j gi .doe. gov/prosrams/ciona/ciona mainae.html). Les recherches dans les bases de données de Drosophila ont été effectuées à l'aide de Flybase (http://www.fruitfly.org/). e) Comparaisons de séquences
Les séquences des protéines AChEl et AChE2 d'Anopheles gambiae déduites des séquences génomiques et les séquences peptidiques déduites de fragments PCR de C. pipiens et A. aegypti ont été alignées avec celles des AChE connues, à l'aide du logiciel ClustalW, en utilisant une matrice BLOSUM et des paramètres par défaut (Thompson et al., N. A.R., 1994,22, 4673-4680). using the ABI Prism Auto-Assembler software (v2.1, PERKIN ELMER). The sequences were verified and corrected using the Ensembl Trace Server software (http: // trace.ensembl.org/). Two concatenations of respectively 5195 and 6975 base pairs, coding respectively for AChE1 and AChE2 were assembled from respectively 64 and 74 independent sequences (average redundancy of 10.5 and 6.5). The exons and protein sequences were identified using a combination of FGENESH (http://www.sanger.uk) and BLASTX (http://www.ncbi.nlm.nih.gov) software. The genome sequences of AChE ascidians were assembled from raw sequences deposited in the databases of NCBI (Ciona savignyi) and the Doe Joint Institute (Ciona intestinalis,

http: // www. j gi .doe. gov / prosrams / ciona / ciona mainae.html). Drosophila databases were searched using Flybase (http://www.fruitfly.org/). e) Sequence comparisons
The sequences of the AChE1 and AChE2 proteins of Anopheles gambiae deduced from the genomic sequences and the peptide sequences deduced from PCR fragments of C. pipiens and A. aegypti were aligned with those of the known AChE using the ClustalW software, using a BLOSUM matrix and default parameters (Thompson et al., NAR, 1994,22, 4673-4680).

A phylogenetic tree was constructed using the neighbor-joining algorithm of Clustal W's DDBJ (http://hypernig.nig.ac.jp/homology/ex clustalw-e.shtml) . Bootstrap analysis (1000 counts and 111 input values) was used to evaluate confidence levels for tree topology. Tree construction was performed using the Treeview software (v1.6.6). f) Accession numbers
Sequence numbers (accession numbers in the databases or identification numbers in the sequence listing) used in the genetic analysis are as follows.

 - Craniata: Homo sapiens: NP ~ 00046; Bos taurus: P23795; Felix catus: 06763; Oryctolagus cuniculus: Q29499; Norwegian rats: P36136; Mus musculus: P21836; Gallus gallus: CAC37792; Danio reno: Q9DDE3; electrophoresis

<Desc / Clms Page number 25>

rus electricus: 6730113; Torpedo marmorata: P07692; Torpedo californica:
P04058; Bungarus fasciatus: Q92035; Myxine glutinosa: Q92081.

 - Cephalocordates: Branchiostoma floridae: 076998 and 076999; Branchiostoma lanceolatum: Q95000 and Q95001.

- Urocordates: Ciona intestinalis: SEQ ID NO: 51; Ciona savignyi:
SEQ ID NO: 52.

 - Nematodes: Caenorhabditis elegans (1 to 4): P38433,061371, 061459 and 061372; Caenorhabditis briggsae (1-4) Q27459, 061378Q9NDG9 and Q9NDG8; Dictyocaulus viviparus: Q9GPLO.

 - Insects: Anopheles gambiae (1 and 2): ID NO: 3 and SEQ ID NO: 53 (BM 629847 and BM 627478); Aedes aegypti (1 and 2): SEQ ID NO: 9 and AAB3500; An. Stephensi: P56161; Culex pipiens: SEQ ID NO: 7 (ace-1) and Esther data base for ace-2; Drosophila melanogaster: P07140; Lucilia cuprina: P91954; Musca domestica: AAK69132.1; Leptinotarsa decemlineata: Q27677; Apis mellifera: AAG43568; Nephotettix cincticeps: AF145235 ~ 1; Schizaphis graminum: Q9BMJ 1.

- Arachnids: Rhipicephalus appendiculatus: 062563; Boophilus microplus (1 and 2): 045210 and 061864; Boophilus decoloratus: 061987; - Molluscs: Loligo opalescens: 097110. g) Cloning of fragment K and genotyping of ace-1 in Culex pipiens
Mosquito DNA was extracted as described in Rogers et al., [Plant Molecular Biology manual, 1988, eds. Gelvin, SB1Schilperoot, RA (Kluwer Academic Publishers, Boston), VoIA6, pl-10]. Oligonucleotides PkdirAGSG (5'ATMGWGTTYGAGTACACSGAYTGG-3 ', SEQ ID NO: 39) and PkrevAGSG (5'GGCAAARTTKGWCCAGTATCKCAT-3', SEQ ID NO: 40) amplify a 320 bp fragment (fragment K) from genomic DNA. several mosquitoes. 30 cycles of PCR amplification were performed under the following conditions: 94 C for 30s, 50 C for 30s at and 72 C for 30s. The sequences were determined directly on the PCR products on an ABI prism 310 sequencer, using the Big Dye Terminator kit.

 The genotyping of ace-1 in Culex is carried out under the following conditions: The K fragments obtained as described previously are digested by

<Desc / Clms Page number 26>

EcoRI and the digest was separated by electrophoresis on a 2% agarose gel. Restriction patterns show: 1 band (320 bp) in RR resistant homozygous mosquitoes, 2 bands (106 bp and 214 bp) in homozygous SS mosquitoes and 3 bands (103 bp, 214 bp and 320 bp) in heterozygous mosquitoes RS. h) Cloning of ace-1 cDNA in susceptible and resistant individuals
The cDNA of the Culex pipiens ace-1 gene was obtained from the RNA extracted from individuals of the S-LAB reference strain and the SR resistant strain, at the very first stage of L1 larval development. Reverse transcription was performed with an 18T oligonucleotide and SuperScriptIIRNaseH (IN VITROGEN), according to the conditions recommended by the manufacturer.

- strain S-LAB
Two cDNA fragments were amplified by PCR using degenerate oligonucleotides obtained from the alignment of the sequences of the ance-1 genes of Anopheles gambiae and Schizaphis graminum: a fragment b (193 bp) was amplified using the pair of primers PbdirAGSG (5'GGYGCKACMATGTGGAAYCC3 ', SEQ ID NO: 41) and PbrevAGSG (5'ACCAMRATCACGTTYTCYTCCGAC3', SEQ ID NO: 42).

a fragment k (320 bp) was amplified using the pair of primers PkdirAGSG (5'ATMGWGTTYGAGTACACSGAYTGG3 ', SEQ ID NO: 39) and PkrevAGSG (5'GGCAAARTTKGWCCAGTATCKCAT3', SEQ ID NO: 40).

 The fragments b and k thus obtained were then cloned and sequenced, according to standard techniques known in themselves to those skilled in the art, as described in Current Protocols in Molecular Biology (Frederick M. A USUBEL, 2000, Wiley and his Inc, Library of Congress, USA).

 A larger size cDNA fragment was amplified by PCR, using Culex pipiens specific primers deduced from previously obtained b and k fragment sequences. Namely: a CulexA fragment (1127 bp) was amplified by PCR using the pair of primers: culex-bdirl (5'TACATCAACGTGGTCGTGCCACG3 ', SEQ ID NO: 43) and culex-krevl (5'GTCACGGTTGCTGTTCGGG3 ', SEQ ID NO: 44). The 1127 bp Culex A fragment thus obtained was then cloned and sequenced as above.

<Desc / Clms Page number 27>

 The ends of the cDNAs were amplified by the Rapid Amplification of cDNA Ends (RACE) technique, using a commercial kit (from the Gene Racer kit (IN VITROGEN) according to the conditions indicated in the user manual. were cloned and sequenced, as above.

- strain SR
The complete sequence of the cDNA of the ace-1 gene of the SR resistant strain was amplified by PCR using the culex-5'dir primers (5'CCACACGCCAGAAGAAAAGA-3 ', SEQ ID NO: 54) and culex- 3'dir (5'AAAAACGGGAACGGGAAAG-3, SEQ ID NO: 55) and the 2497 bp fragment thus obtained was cloned and sequenced, as above. i) Cloning of ace-1 gene in susceptible and resistant individuals
The genomic DNA of the strain KISUMU (West African reference strain) and the YAO strain (isolated resistant strain in Côte d'Ivoire) of A. gambiae was extracted from individuals homozygotes as described in Rogers et al., [Plant Molecular Biology manual, 1988, eds. Gelvin, SB Schilperoot, RA (Kluwer Academy Publishers, Boston), VolA6, pl-10].

 3 overlapping fragments (A, B and C) were amplified under the following conditions: 94 C for 30s, 50 C for 30s at and 72 C for 30s (30 cycles), using primers synthesized from the sequence of the ace-1 gene. Namely: fragment A (1130bp) was amplified using the pair of primers AG1-Adir (5'CGACGCCACCTTCACA3 ', SEQ ID NO: 45) and AGI-Arev (5'GATGGCCCGCTGGAACAGAT3', SEQ ID NO 46), fragment B (1167bp) was amplified using the pair of AGI-Bdir primers (5'GGGTGCGGGACAACATTCAC3 ', SEQ ID NO: 47) and AGI-Brev (5'CCCCGACCGACGAAGGA3', SEQ ID NO: 48), and the fragment C (876bp) was amplified using the pair of primers AG1-Cdir (5'AGATGGTGGGCGACTATCAC3 ', SEQ ID NO: 49) and AGI-Crev (5'CTCGTCCGCCACCACTTGTT3', SEQ ID NO: 50).

 The sequences of fragments A, B and C were determined directly on the PCR products, using internal oligonucleotides included in these fragments, using the Big Dye Terminator kit and an ABI prism 310 sequencer.

<Desc / Clms Page number 28>

j) detection of the mutation of the third coding exon responsible for insecticide resistance in C. pipiens and An. zambiae mosquitoes
The mosquito DNA was extracted as described in Rogers et al., Supra, then a fragment of the third coding exon was amplified by PCR, sequence and the mutation in the coding sequence of the third coding exon was detected by PCR-RFLP. , according to the principle as described above for the fragment K.

- C. pipens
A 520 bp fragment of the third coding exon was amplified from the genomic DNA of several mosquitoes, by PCR using the pair of primers: Ex3dir 5'-CGACTCGGACCCACTGGT-3 '(SEQ ID NO: 58 ) and - Ex3rev 5'-GTTCTGATCAAACAGCCCCGC-3 '(SEQ ID NO: 59).

 The fragment thus obtained was digested with Alu I and the digestion product separated by electrophoresis on a 2% agarose gel. The expected restriction profiles are: 1 fragment (520 bp) in SS susceptible homozygous individuals, 2 fragments (357 bp and 163 bp) in RR resistant homozygous individuals and 3 fragments (520 bp, 357 bp and 163 bp) in resistant heterozygous individuals RS.

- An. Gambiae
A 541 bp fragment of the third coding exon was amplified from the genomic DNA of several individuals, by PCR using the pair of primers: Ex3AGdir 5'-GATCGTGGACACCGTGTTCG -3 '(SEQ ID NO: 123 ) and - Ex3AGrev 5'-AGGATGGCCCGCTGGAACAG -3 '(SEQ ID NO: 124).

 The fragment thus obtained was digested with Alu I and the product separated by electrophoresis on a 2% agarose gel. The expected restriction profiles are as follows: 2 fragments (403 bp and 138 bp) in SS-sensitive homozygous individuals, 3 fragments (253 bp, 150 bp and 138 bp) in RR resistant homozygous individuals and 4 fragments (403 bp, 253 bp, 150 bp and 138 bp) in RS resistant heterozygous individuals; As 150 bp and 138 bp fragments co-migrate, homozygous and heterozygous resistant individuals are detected.

<Desc / Clms Page number 29>

respectively by the presence of 2 bands (253 bp and about 150 bp) and 3 bands (403 bp, 253 bp and about 150 bp) in agarose gel. k) Measurement of acetylcholinesterase activity
The cDNAs encoding the AchE1s of respectively the S-LAB strain and the SR strain were cloned in the eukaryotic expression vector pAc5.1 / V5-His (INVITROGEN), according to standard recombinant DNA techniques following standard protocols such as those described in Current Protocols in Molecular Biology, supra. Drosophila cells (Schneider S2 cells) were transfected with the recombinant vectors thus obtained, using the Fugen reagent (ROCHE), following the manufacturer's instructions. 24 hours after transfection, the cells were harvested by centrifugation and then lysed in 0.25M phosphate buffer containing 1% Triton X-100. The acetylcholinesterase activity of the cell extracts obtained was measured, in the presence or in the absence of insecticide (propoxur), by the method as described in Bourguet et al. Biochemical Genetics, 1996, 34, 351-362.

EXAMPLE 2: Evidence of 2 ace genes in Anopheles gambiae
Homologous genes from human acetylcholinesterase and Drosophila genes were searched for fragments of sequences deposited in the databases using TBLASTN software. Two groups of distinct fragments encoding AChE very similar to that of Drosophila have been identified. Two genes of 6975 bp (ace-1) and 5195 bp (ace-2) respectively were reconstructed from overlapping fragments of each group. Gene analysis using FGENESH and BLASTX software shows that the ace-1 and ace-2 genes consist of at least 7 and 8 exons coding for proteins of about 534 and 569 amino acids, respectively. respectively AChEl and AChE2. However, this analysis did not make it possible to determine with certainty the sequence of the 5 'and 3' ends of the cDNA and the NH 2 and COOH sequences of the corresponding proteins, which are not conserved between the different AChEs.

 The analysis of amino acid sequences confirms that AChE1 and AChE2 proteins are highly homologous to Drosophila AChE (BLASTP: P <e-180) and contain a FGESAG canonical motif around serine at position 200, reference to the sequence of Torpedo's Ache (S200 figure 1), which is characteristic

<Desc / Clms Page number 30>

 of the active site of AchE. In addition, other characteristic AChE motifs were also found in the two sequences (AChE1 and AChE2): the choline binding site (tryptophan residue at position 84, W84), the three residues of the catalytic triad (serine residues). , glutamic acid and histidine at positions 200, 327 and 440 respectively: S200, E327 and H44o), the six cysteine residues potentially involved in conserved disulfide bridges (C67-C94, C254-C265, C402-C521), and residues aromatics bordering the throat of the active site (10 and 11 residues, respectively for AChElet AChE2).

 In both sequences, the presence of a phenylalanine residue at position 290 (F290) but not at position 288 is observed; common feature of invertebrate AChE is responsible for a broader substrate specificity of invertebrate AChE compared to vertebrate.

 The analysis of the C-terminal sequences of the dipteran AChE shows the presence of a hydrophobic peptide corresponding to a glycolipid addition signal, indicating the post-translational cleavage of a C-terminal fragment and the addition of a glycolipidic anchoring residue as in Drosophila and other mosquito species. In all the sequences, the presence of a cysteine residue in the C-terminal sequence preceding the potential cleavage site of the hydrophobic peptide is also observed. This cysteine residue could be involved in an intermolecular disulfide bond, linking the two catalytic subunits of the AChE dimer.

 AChEl and AChE2 proteins of An. gambiae show 53% similarity to each other and show: 76% and 55% similarity with AChE of Schizaphis graminum (accession number NCBI AAK09373 or GENBANK 12958609), 53% and 98% similarity with AChE 'Year. stephensi (GENBANK 2494391), 54% and 95% similarity to Aedes aegypti AChE (GENBANK 2133626), 52% and 83% similarity to Drosophila AChE (GENBANK 17136862).

 The major difference between AChE1 and AChE2 is an insertion of 31 amino acids in the AChE2 sequence (Figure 1). This sequence, called "hydrophilic insertion" in Drosophila AChE, is absent in vertebrate and nematode AChEs and may be characteristic of AChE2, at least in Diptera.

<Desc / Clms Page number 31>

 These results demonstrate the presence of two ace genes in the Anopheles gambiae genome, one encoding AChE1 which is related to AChE of Schizaphis graminum, and the other for AChE2 which is related to AChE of Drosophila and AChEs known to mosquitoes. The presence of other ace genes in An. Gambiae is highly unlikely as further research in the An gambiae genome databases, using less stringent parameters, has detected only alpha-coding sequences. esterases (EC 3.1.1) and carboxylesterases (EC 3.1.1.1).

EXAMPLE 3 Demonstration of a unique ace gene in Drosophila melanogaster
The presence of a homologous gene of the ace-1 gene has been sought in the Drosophila genome. TBLASTN searches detected the previously identified ace gene homologous to the ance-2 gene of Anopheles gambiae but failed to detect other homologous sequences of the ace-1 gene. Searches using less stringent parameters have detected only alpha and carboxylesterases. These results demonstrate that the Drosophila genome contains a unique ace (ace-2) gene.

EXAMPLE 4: Evidence of at least two ace genes in other species of mosquito
The presence of the ace-1 gene in the genome of other mosquito species was analyzed by PCR using degenerate oligonucleotides (PdirAGSG and PrevAGSG, SEQ ID NO: 39 and 40) to amplify an exon fragment ( fragment K, of approximately 320 bp FIG. 1), corresponding to sequences conserved between the AChE1 sequences of An. gambiae and Schizaphis graminum but divergent between AChEl and AChE2 sequences of An. gambiae.

 The sequence of PCR products obtained from the genomic DNA of different mosquito species shows a very high percentage identity between the Anopheles, Culex and Aedes sequences. In addition, most substitutions are silent since the amino acid sequences deduced from these nucleotide sequences differ from each other only by 5 to 6 amino acids (Figure 2A). The K fragment was also amplified by RT-PCR from C. pipiens mRNA, indicating that the ace-1 gene is expressed as mRNA; this result is in

<Desc / Clms Page number 32>

 agree with the existence, in C. pipiens, of two AChEs with distinct catalytic properties.

EXAMPLE 5 Analysis of the Link Between the Ace-1 Gene and Insecticide Resistance
In order to analyze the binding between the 6! Ce-7 gene and the insecticide resistance, the amplified K fragment from the genomic DNA of resistant C. pipiens (strain R) was sequenced. The comparison of the K fragment sequences between the S and R strains shows differences at the level of 3 nucleotides (silent substitutions, Figure 2B). One of these substitutions affects an EcoRI site, which makes it easy to differentiate the ace-1 locus of the S and R strains by PCR-RFLP: the restriction profiles show 1 band (320 bp) in resistant homozygous individuals, 2 bands (106 bp and 214 bp) in homozygous SS and 3-band mosquitoes (103 bp, 214 bp and 320 bp) in heterozygous RS mosquitoes (Figure 2C).

 The binding between the ace-1 gene and the propoxur resistance was studied, in triplicate, as follows: cross-over (S x R) x S larvae were treated with a lethal dose for susceptible individuals and the genotype of ace-1 was analyzed in survivors by PCR-RFLP.

 The results show that exposure to propoxur kills 50% of the larvae in all return crosses, ie all susceptible individuals.

All surviving larvae (100 for each backcross, 300 in total) show a heterozygous RFLP profile, indicating that they all possess a copy of the ace-1 gene of strain R.

 These results demonstrate that the ace-1 gene is very closely related to insecticide resistance (less than 1% recombination with a confidence level of 0.05).

 EXAMPLE 6 Phylogeny of the ace-1 and ace-2 genes

 Phylogenetic trees were constructed from the sequences of the conserved regions of AChE of An gambiae (SEQ ID NO: 1 and fragment 34-393 of the sequence SEQ ID NO: 53, FIG. 1), K fragments of C. pipiens and Aedes aegypti (SEQ ID NO: 8 and 9) and 33 AChE sequences available in GENBANK, using the neighbor-joining method as described in the materials and methods.

<Desc / Clms Page number 33>

 Figure 3 illustrates the heterogeneity of the number of ace genes during evolution of the animal kingdom. In strings, cephalocordates possess at least two ace genes whereas urocordates have only one, as deduced from the analysis of their genome. In arthropods, Diptera possess either a single ace gene (Drosophila suborder Brachycera) or two ace genes (mosquito suborder Nematocera). The topology of the tree shows that these two ace genes duplicated themselves very early in evolution, probably before the separation between protostomes and deuterostomes. These results are supported by the fact that AChEs of molluscs, nematodes and arthropods branch out from the sequences of chordates (craniatia, cephalocordate and urocorded). The results show that arthropods and nematodes have a related AChE.

 These results indicate that the ace-1 and ace-2 genes identified in insects come from a very old duplication event and the absence of the ace-1 gene, at least in some species of the suborder Brachycere (Drosophila ) results from the loss of an ace gene rather than recent duplication of the ace gene in nematocera. These results also suggest that extrapolations from D. melanogaster studies are to be considered with caution as the Drosophila situation is not representative of Diptera or the entire class of insects.

EXAMPLE 7 Determination of the cDNA sequence of the ace-1 gene
The ace-1 cDNA was cloned from two strains of Anopheles gambiae (susceptible KISUMU strain and resistant YAO strain) and two strains of Culex pipiens (susceptible S-LAB strain and resistant SR strain) as described. in materials and methods.

 The complete sequence of the cDNA of strain KISUMU corresponds to the sequence SEQ ID NO: 125 which encodes a protein of 737 amino acids (SEQ ID NO: 126). The complete sequence of the cDNA and the AChE1 protein of the YAO strain correspond to the sequences SEQ ID NO: 121 and SEQ ID NO: 122, respectively.

 The sequences SEQ ID NO: 4 and SEQ ID NO: 5 correspond to the quasi-complete sequence (with the exception of the first exon coding for the ace-1 gene), respectively the cDNA and the AChEl protein of the KISUMU strain. .

<Desc / Clms Page number 34>

 The complete sequence of the C. pipiens S-LAB and SR strains cDNA corresponds respectively to the sequences SEQ ID NO: 6 and SEQ ID NO: 56 which encode a protein of 702 amino acids (SEQ ID NO: 7 and SEQ ID NO: 57, respectively for strain S-LAB and strain SR).

EXAMPLE 8 Determination of the sequence of the ace-1 gene
The sequence of the ace-1 gene was determined from the genomic DNA of two strains $ Anopheles gambiae, the West African reference strain (strain KISUMU) and a resistant strain of Ivory Coast. (YAO strain), as described in the materials and methods.

The complete sequence of An. gambiae corresponds to the sequence SEQ ID NO: 127 which has an intron-exon organization comprising at least 9 exons and including two 5 'non-coding exons (Table I)
The almost complete sequence (with the exception of the first two 5 'non-coding exons) of the ace-1 gene of the strain KISUMU corresponds to the sequence SEQ ID NO: 23.

 The almost complete sequence (with the exception of the first two non-coding exons and the first coding exon) of the ace-1 gene of the YAO strain corresponds to the sequence SEQ ID NO: 120.

 EXAMPLE 9: mutation (s) in the amino acid sequence of the AchE1 protein, responsible (s) for insecticide resistance in mosquitoes Culex pipiens species and Anopheles gambiae.

 The nucleotide sequence encoding the AChE1 protein (cDNA) was determined from two strains of Anopheles gambiae (strain KISUMU sensitive and strain YAO resistant) and two strains of Culex pipiens (strain S-LAB sensitive and strain SR resistant), as described in Example 7.

 The amino acid sequences of the AChE1 protein of the sensitive and resistant strains, deduced from the preceding sequences, were then aligned (FIGS. 5, 6 and 9).

 The comparison of the amino acid sequences of the C. pipiens AChE1 protein (FIGS. 5 and 6) shows that there is a single non-silent mutation between the sensitive strain (S-LAB, SEQ ID NO: 7) and the strain. insecticide resistant (strain SR, SEQ ID NO: 57), located in the region coded by the third

<Desc / Clms Page number 35>

 exon coding for the ace-1 gene: glycine (GGC) in position 247 (or in position 119, with reference to the AChE sequence of the torpedo fish) of the susceptible strain is replaced by a serine (AGC) in the strain resistant (G247 (119) # S247 (119)).

 The localization of the amino acid at position 247 in the structure of C. pipiens acetylcholinesterase and the effect of the glycine # serine substitution on this structure were analyzed by molecular modeling from the structure of the acetylcholinesterase of torpedo fish. The results are illustrated in Figure 7 (A, B and C). Figure 7A shows that the amino acid at position 119 is close to the residues of the catalytic site (S200 and H44o). FIG. 7C shows that, by comparison with the glycine of the susceptible strain (FIG. 7B), the congestion of the serine side chain of the resistant strain reduces the space of the catalytic site, which presumably prevents the insecticide from interact with the catalytic serine (S200).

 The comparison of the amino acid sequences of the AChE1 protein of An. gambiae shows that there are two non-silent mutations between the susceptible strain (KISUMU, SEQ ID NO: 5) and the insecticide resistant strain (YAO strain, SEQ ID NO: 122): the first corresponds to the replacement of valine ( CGT) at position 33 of the sequence of the susceptible strain (SEQ ID NO: 5) by an alanine (CGC) in the resistant strain and the second is the same glycine # serine mutation as that found in Culex pipiens.

 Given the external position of valine in the structure of acetylcholinesterase, this mutation is certainly not involved in resistance in Anopheles gambiae and only serine should be responsible for insecticide resistance, both in Anopheles gambiae and Culex pipiens.

 EXAMPLE 10: mutation in the third exon coding of the ace-1 gene responsible for insecticide resistance in mosquitoes of the Culex pipiens and Anopheles gambiae species.

 The restriction profile of the third exon coding for the ace-1 gene containing the glycine # serine mutation was verified in numerous populations and strains of C. pipiens and An. Gambiae mosquitoes, susceptible and resistant to insecticides of the class of organophosphorus and carbamates, by PCR-RFLP according to the protocol as described in Example 1.

 More precisely:

<Desc / Clms Page number 36>

 in C. pipiens, the glycine (GGC) serine mutation (AGC) introduces an Alu I site (AGCT) unique in the sequence of the resistant strain, which is evidenced from a PCR product of 520 bp, amplified using primers Ex3dir and Ex3rev, as shown in Figure 6.

 - in An. gambiae, the glycine mutation (GGC) # serine (AGC) introduces a second Alu I site (AGCT) in the sequence of the resistant strain, which is demonstrated from a PCR product of 541 bp, amplified using primers Ex3AGdir and Ex3AGrev, as shown in Figure 9.

 The PCR-RFLP results were then verified by sequencing the 520 bp or 541 bp PCR fragment of the third coding exon.

- Species C. pipiens
The populations and strains of Culex pipiens, resistant (R) or sensitive (S) that have been analyzed are presented in Table III below:

<Desc / Clms Page number 37>

Table III: and populations of the species C. pipiens analyzed

<Tb>
<tb> Classification <SEP> Name <SEP> R / S * <SEP> Country <SEP> Reference
<tb> C. <SEP> P <SEP> BO <SEP> R <SEP> Burkina-Faso <SEP> Isolated <SEP> by <SEP> the <SEP> inventors
<tb> quinque <SEP> HARARE <SEP> R <SEP> Zimbabwe <SEP> Isolated <SEP> by <SEP> the <SEP> inventors
<tb> fasciatus <SEP> SUPERCAR <SEP> R <SEP> Cote <SEP> Ivory <SEP> (F. <SEP> Chandre, <SEP> Thesis <SEP> from <SEP> PhD, <SEP> University <SEP> Paris <SEP> XII, <SEP> 1998). <September>
<Tb>

DJI <SEP> R <SEP> Mali <SEP> Isolated <SEP> by <SEP> the <SEP> inventors
<tb> MARTINIQUE <SEP> R <SEP> Martinique <SEP> Bourguet <SEP> and <SEP> al., <SEP> Biochem. <SEP> Genet., <SEP> 1996, <SEP> 34, <SEP> 351-362 <SEP>
<tb> RECIFE <SEP> R <SEP> Brazil <SEP> Isolated <SEP> in <SEP> 1995 <SEP> byA.B. <SEP> Failloux, <SEP> Institut <SEP> Pasteur, <SEP> Paris <SEP> (France)
<tb> PRO-R <SEP> S <SEP> United States <SEP> Georghiou <SEP> and <SEP> al., <SEP> Bull. <SEP> Wld <SEP> Hlth <SEP> Org., <SEP> 1966, <SEP> 35, <SEP> 691-708. <September>
<Tb>

S-LAB <SEP> S <SEP> United States <SEP> Georghiou <SEP> and <SEP> al., <SEP> Bull. <SEP> Wld <SEP> Hlth <SEP> Org., <SEP> 1966, <SEP> 35, <SEP> 691-708. <September>
<Tb>

TEM-R <SEP> S <SEP> United States <SEP> Georghiou <SEP> and <SEP> al., <SEP> J. <SEP> Econ. <SEP> Entomol., <SEP> 1978, <SEP> 71, <SEP> 201-205. <September>
<Tb>

Trans-P <SEP> S <SEP> United States <SEP> Priesteret <SEP> al., <SEP> J. <SEP> Econ. <SEP> Entomol., <SEP> 1978, <SEP> 71, <SEP> 197-200
<tb> LING <SEP> S <SEP> China <SEP> Weill, <SEP> and <SEP> al., <SEP> J. <SEP> American <SEP> Mosquito <SEP> Control <SEP> Assoc <SEP >, <SEP> 2001, <SEP> 17, <SEP> 238-244 <SEP>
<tb> THAI <SEP> S <SEP> Thailand <SEP> Guillemaud <SEP> and <SEP> al., <SEP> Heredity, <SEP> 1996, <SEP> 77, <SEP> 535-543. <September>
<Tb>

MAO <SEP> S <SEP> China <SEP> Qiao <SEP> and <SEP> al., <SEP> Biochem. <SEP> Genet., <SEP> 1998, <SEP> 36, <SEP> 417426. <SEP>
<Tb>

MADURAI <SEP> S <SEP> India <SEP> Nielsen-Leroux, <SEP> and <SEP> al., <SEP> J. <SEP> Med. <SEP> Entomol., <SEP> 2002, <SEP> 39, <SEP> 729-735 <SEP>
<tb> BSQ <SEP> S <SEP> Africa <SEP> du Sud <SEP> Isolated <SEP> in <SEP> 1991 <SEP> by <SEP> A. <SEP> J. <SEP> Cornel <SEP> Sth <SEP> Afr. <SEP> Inst. <SEP> Med. <SEP> Res., <SEP> South <SEP> Africa)
<tb> BED <SEP> S <SEP> Africa <SEP> du Sud <SEP> Isolated <SEP> in <SEP> 1991 <SEP> by <SEP> A. <SEP> J. <SEP> Cornel <SEP> Sth <SEP> Afr. <SEP> Inst. <SEP> Med. <SEP> Res., <SEP> South <SEP> Africa
<tb> BOUAKE <SEP> S <SEP> Coast <SEP> of Ivory <SEP> Magnin <SEP> and <SEP> ai., <SEP> J. <SEP> Med. <SEP> Entomol., <SEP> 1988, <SEP> 25, <SEQ> 99-104 <SEP>
<tb> BRAZZA <SEP> S <SEP> Congo <SEP> Beyssat-Arnaouty, <SEP> Thesis <SEP> from <SEP> PhD, <SEP> University <SEP> from <SEP> Montpellier <SEP> Il <SEP > (1989). <September>
<Tb>

BRAZIL <SEP> S <SEP> Brazil <SEP> Isolated <SEP> by <SEP> the <SEP> inventors
<tb> MOOREA <SEP> S <SEP> Polynesia <SEP> N. <SEP> Pasteur, <SEP> and <SEP> al., <SEP> Genet. <SEP> Res., <SEP> 1995, <SEP> 66, <SEP> 139-146
<tb> C. <SEP> p. <SEP> pipiens <SEP> ESPRO <SEP> R <SEP> Tunisia <SEP> H. <SEP> Ben <SEP> Sheikh <SEP> and <SEP> al., <SEP> J. <SEP> Am. <MS> Mosquito <SEP> Contrai <SEP> Assoc., <SEP> 1993, <SEP> 9, <SEP> 335-337 <SEP>
<tb> PRAIAS <SEP> R <SEP> Portugal <SEP> Bourguet <SEP> and <SEP> al., <SEP> J. <SEP> Econ. <SEP> Entomol., <SEP> 1996, <SEP> 89, <SEP> 1060-1066 <SEP>
<tb> PADOVA <SEP> R <SEP> Italy <SEP> Bourguet <SEP> and <SEP> al., <SEP> Genetics, <SEP> 1997,147, <SEP> 1225-1234.
<Tb>

BARRIOL <SEP> R <SEP> France <SEP> Chevillon <SEP> and <SEP> al., <SEP> Evolution, <SEP> 1995, <SEP> 49, <SEP> 997-1007. <September>
<Tb>

BRUGES-A <SEP> S <SEP> Belgium <SEP> Raymond <SEP> and <SEP> al., <SEP> Genet. <SEP> Res., <SEP> 1996, <SEP> 67, <SEP> 19 <SEP> -26. <September>
<Tb>

BRUGES-B <SEP> S <SEP> Belgium <SEP> Raymond <SEP> and <SEP> al., <SEP> Genet. <SEP> Res., <SEP> 1996, <SEP> 67, <SEP> 19-26.
<Tb>

KILLCARE <SEP> S <SEP> Autralie <SEP> Guillemaud <SEP> and <SEP> al., <SEP> Proc. <SEP> R. <SEP> Soc. <SEP> Lond. <SEP> B, <SEP> 1997, <SEP> 264, <SEP> 245-251, <SEP>
<tb> BLEUET <SEP> S <SEP> France <SEP> Rioux <SEP> and <SEP> al., <SEP> C. <SEP> R. <SEP> Sessions <SEP> Soc. <SEP> Biol. <SEP> Wire, 1961, <SEP> 155, <SEP> 343-344 <SEP>
<tb> HETEREN <SEP> S <SEP> Netherlands <SEP> Isolated <SEP> by <SEP> the <SEP> inventors
<tb> C. <SEP> torrentium <SEP> UPPSALA <SEP>, <SE> S <SEP> Sweden <SEP> M. <SEP> Raymond, <SEP> Ent. <SEP> Tidskr., <SEP> 1995, <SEP> 116, <SEP> 65-66.
<Tb>

* R / S resistant or susceptible to insecticides of the organophosphorus and carbamate class
The PCR-RFLP analysis of all the mosquitos in Table III shows that there is a perfect correlation between insecticide resistance and the restriction profile by PCR-RFLP, namely: 1 band (520 bp) is detected in SS susceptible homozygous individuals, 2 bands (357 bp and 163 bp) were detected in RR resistant homozygous individuals and 3 bands (520 bp, 357 bp and 163 bp) were detected in RS resistant heterozygous individuals (Figure 8).

 These results were confirmed by the sequencing of the 520 bp PCR product for all Table III mosquitos analyzed by PCR-RFLP.

<Desc / Clms Page number 38>

 The alignment of the sequences obtained (SEQ ID NO: 60 to 89), shown in Table IV below, shows that in C. pipiens mosquitoes, the glycine # serine mutation, located at position 739 with reference to the cDNA sequence of the ace-1 gene of the reference strain (strain S-LAB), which is responsible for insecticide resistance, comes from two groups of independent mutations, in C. pipiens pipiens and C. pipiens quiquefasciatus.

Table IV: the origin of the glycine # serine mutation responsible for insecticide resistance in C. pipiens mosquitoes

<Tb>
<tb> Position <SEP> of <SEP> mutations <SEP> in <SEP> reference <SEP> to <SEP><SEP> sequence <SEP> of cDNA <SEP> of
<tb> gene <SEP> ace-1 <SEP> of <SEP> the <SEP> strain <SEP> S-LAB <SEP> (SEQ <SEP> ID <SEP> N0: 6)
<tb> 444455555666666677777777777788
<tb> 5 <SEP> 5 <SEP> 7 <SEP> 9 <SEP> 1 <SEP> 2 <SEP> 6 <SEP> 7 <SEP> 9 <SEP> 0 <SEP> 5 <SEP> 6 <SEP > 8 <SEP> 8 <SEP> 9 <SEP> 9 <SEP> 1 <SEP> 3 <SEP> 3 <SEP> 4 <SEP> 4 <SEP> 5 <SEP> 6 <SEP> 7 <SEP> 7 <SEP> 8 <SEP> 9 <SEP> 9 <SEP> 1 <SEP>
<tb> 031838437310141642917634700836
<tb> Strains <SEP> of <SEP> C. <SEP> pipiens
<tb> C. <SEP> pipiens <SEP> quiquefascia
<tb> BO <SEP> (R) * <SEP> T <SEP> C <SEP> A <SEP> T <SEP> C <SEP> G <SEP> G <SEP> G <SEP> G <SEP> C <SEP> G <SEP> G <SEP> G <SEP> C <SEP> C <SEP> C <SEP> C <SEP> C <SEP> A <SEP> C <SEP> C <SEP> T <SEP> C <SEP> C <SEP> C <SEP> C <SEP> G <SEP> G <SEP> A <SEP> T
<tb> Harare <SEP> (R) <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP > - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP>
<tb> Supercar <SEP> (R) <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP > - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP>
<tb> DJI <SEP> (R) <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP > - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP>
<tb> Martinique <SEP> (R) <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP > - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP>
<tb> Recife <SEP> (R) <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP > - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP>
<Tb>

ProR(S)* - T ~ C ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ G ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ G

ProR (S) * - T ~ C ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ G ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ G

<Tb>
<tb> S-Lab <SEP> (S) <SEP> - <SEP> T <SEP> - <SEP> C <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP > - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> G <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> G
<Tb>

TemR (S) - T ~ ~ ~ ~ ~ A - - - - - - - - - - G - - - - - - - A - - -

TemR (S) - T ~ ~ ~ ~ ~ A - - - - - - - - - - G - - - - - - - A - - -

<Tb>
<tb> Trans <SEP> (S) <SEP> - <SEP> T <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> A <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> G <SEP> - <SEP> - <SEP> - <SEP > - <SEP> - <SEP> - <SEP> - <SEP> A <SEP> - <SEP> - <SEP>
<Tb>

Ling (S - T C C - - - - - - - - - - - - - - G - - - - T - - - - - Thai (S) - T C C - - - - - - - - - - - - - - G - - - - - - - - - - G Mao (S) - T- C - - - - - - - - - - - - - - G - - - - - - - - - - -

Ling (S - TCC - - - - - - - - - - - - - - G - - - - T - - - - - Thai (S) - TCC - - - - - - - - - - - - - - G - - - - - - - - - - G Mao (S) - T- C - - - - - - - - - - - - - - G - - - - - - - - - - -

<Tb>
<tb> Madurai <SEP> (S) <SEP> - <SEP> T <SEP> - <SEP> C <SEP> - <SEP> - <SEP> A <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> G <SEP> - <SEP> - <SEP> - <SEP > - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> G
<Tb>

BSQ (S) - Tee - - - - - - - - - - - - - - G - - - - - - - - - - G BE (S) - T ~ ~ ~ ~ ~ A - - - - - - - - - - G - - - - - - - - - - -

BSQ (S) - Tee - - - - - - - - - - - - - - G - - - - - - - - - - G BE (S) - T ~ ~ ~ ~ ~ A - - - - - - - - - - G - - - - - - - - - - -

<Tb>
<tb> Boualse <SEP> (S) <SEP> - <SEP> T <SEP> - <SEP> C <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> G <SEP> - <SEP> - <SEP> - <SEP > - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> -
<Tb>

Brazza (S) - T C C - - - - - - - - - - - - - - G - - - - - - - - - - G

Brazza (S) - TCC - - - - - - - - - - - - - - G - - - - - - - - - - G

<Tb>
<tb> Brazil <SEP> (S) <SEP> - <SEP> T <SEP> - <SEP> C <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> G <SEP> - <SEP> T <SEP> - <SEP > - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> G <SEP>
<tb> Moorea <SEP> (S) <SEP> - <SEP> T <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> G <SEP> - <SEP> - <SEP> - <SEP > - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> G <SEP> G
<tb> C.pipiens <SEP> pipiens
<tb> Espro <SEP> (R) <SEP> AT-C-A-C-AGTTA-T-TT-GPraias <SEP> (R) <SEP> AT-C-- -A - C --- AGTTA --- T-TT - GPadova <SEP> (R) <SEP> AT-C --- A - C --- AGTTA --- T-TT - GBarriol <SEP> (R) <SEP> A <SEP> T <SEP> - <SEP> C <SEP> - <SEP> - <SEP> - <SEP> A <SEP> - <SEP> - <SEP> C <SEP> - <SEP> - <SEP> - <SEP> A <SEP> G <SEP> T <SEP> T <SEP> A <SEP> - <SEP> - <SEP> - <SEP> T <SEP > - <SEP> T <SEP> T <SEP> - <SEP> - <SEP> G <SEP> - <SEP>
<tb> BrugeA <SEP> (S) <SEP> A <SEP> T <SEP> - <SEP> C <SEP> - <SEP> - <SEP> - <SEP> A <SEP> - <SEP> - <SEP> C <SEP> - <SEP> - <SEP> - <SEP> A <SEP> G <SEP> T <SEP> T <SEP> G <SEP> - <SEP> - <SEP> - <SEP > T <SEP> - <SEP> T <SEP> T <SEP> - <SEP> - <SEP> G <SEP> - <SEP>
<tb> BrugesB <SEP> (S) <SEP> A <SEP> T <SEP> - <SEP> C <SEP> - <SEP> - <SEP> - <SEP> A <SEP> - <SEP> - <SEP> C <SEP> - <SEP> - <SEP> - <SEP> A <SEP> G <SEP> T <SEP> T <SEP> G <SEP> - <SEP> - <SEP> - <SEP > T <SEP> - <SEP> T <SEP> T <SEP> - <SEP> - <SEP> G <SEP> - <SEP>
<tb> Killcare <SEP> (S) <SEP> A <SEP> T <SEP> - <SEP> C <SEP> - <SEP> - <SEP> - <SEP> A <SEP> - <SEP> A <SEP> C <SEP> - <SEP> - <SEP> - <SEP> A <SEP> G <SEP> T <SEP> T <SEP> G <SEP> - <SEP> - <SEP> - <SEP > T <SEP> - <SEP> T <SEP> T <SEP> - <SEP> - <SEP> G <SEP> - <SEP>
<tb> Cornflower <SEP> (S) <SEP> AT-C --- A --- C --- AGTTG --- T-TT - GHeteren <SEP> (S) <SEP> A <SEP> T <SEP> - <SEP> C <SEP> - <SEP> A <SEP> - <SEP> A <SEP> - <SEP><SEP> C <SEP> - <SEP> - <SEP> - <SEP > A <SEP> G <SEP> T <SEP> - <SEP> G <SEP> - <SEP> - <SEP> - <SEP> T <SEP> - <SEP> - <SEP> T <SEP> - <SEP> A <SEP> G <SEP> - <SEP>
<tb> * <SEP> (R) <SEP> resistant <SEP> to <SEP> insecticides
<tb> * <SEP> (S) <SEP> sensitive <SEP> to <SEP> insecticides
<Tb>

<Desc / Clms Page number 39>

- An. Gambiae
Sensitive strains KISUMU (reference strain of East Africa) and VK-PER (reference strain KDR of West Africa) as well as susceptible populations of the Yaoundé region were tested by the PCR-RFLP test as described above.

 The results of the PCR-RFLP test show that for all the An. Gambiae mosquitoes analyzed, there is a perfect correlation between the insecticide resistance and the restriction profile by PCR-RFLP, namely: 2 bands (403 bp) and 138 bp) are detected in susceptible SS homozygous individuals, 2 bands (253 bp and about 150 bp) or 3 bands (403 bp, 253 bp and about 150 bp) are detected in resistant individuals, respectively in homozygous individuals ( RR) and heterozygotes (RS).

EXAMPLE 11 Analysis of the acetylcholinesterase activity of AChEl proteins that are sensitive and resistant to insecticides.

 The recombinant AchE1 of the S-LAB strain and the SR strain respectively were expressed in insect cells and the acetylcholinesterase activity was measured from the cell extracts as described in Example 1.

 The results shown in Figure 10 show that the single mutation glycine247 (119) -> serine247 (119) renders acetylcholinesterase insensitive to insecticide.

 As is apparent from the foregoing, the invention is not limited to those of its modes of implementation, implementation and application which have just been described more explicitly; it encompasses all the variants that may come to the mind of the technician in the field, without departing from the scope or scope of the present invention.

Claims (22)

1) Acetylcholinesterase insect, characterized in that it is resistant to insecticides of the class of organophosphorus and carbamates and in that it comprises a central catalytic region which has an amino acid sequence selected from the group consisting of sequence SEQ ID NO: 1 and sequences having at least 60% identity or 70% similarity to the sequence SEQ ID NO: 1, excluding acetylcholinesterase NCBI sequence AAK0973, which amino acid sequence includes a mutation of the glycine located at position 119, in serine, with reference to the sequence of the acetylcholinesterase of Torpedo californica (SWISSPROT P04058).  2) Acetylcholinesterase according to claim 1, characterized in that it corresponds to that of an insect of the family Culicidae, selected from the genera Culex, Aedes and Anopheles.  3) Acetylcholinesterase insect, characterized in that it is sensitive to insecticides of the class of organophosphorus and carbamates and in that it has a sequence selected from the group consisting of: the sequence SEQ ID NO: 126, and - sequences comprising a central catalytic region as defined in claim 1; sequence shows a glycine at position 119, with reference to the sequence of the acetylcholinesterase Torpedo californica (SWISSPROT P04058), included in a fragment of sequence SEQ ID NO: 91, 92, 96, 102 to 112, 114, 115 and 117 to 119.  4) Acetylcholinesterase according to claim 2, characterized in that it is selected from the group consisting of the sequences SEQ ID NO: 57 and SEQ ID NO: 122.  5) Acetylcholinesterase according to claim 2, characterized in that said central catalytic region comprises a sequence selected from the group consisting of the sequences SEQ ID NO: 90.93, 94.95, 97 to 101, 103 and 106.  6) Peptide, characterized in that it consists of a fragment of at least 7 amino acids of acetylcholinesterase according to any one of claims 1 to 5. <Desc / Clms Page number 41>  7) isolated nucleic acid molecule, characterized in that it has a sequence selected from the group consisting of: the sequences encoding an acetylcholinesterase according to any one of claims 1 to 5 (cDNA and genomic DNA fragment) corresponding to the ace-1 gene), the sequences complementary to the preceding sequences, sense or antisense, and the fragments of at least 8 bp, preferably from 15 bp to 500 bp, of the preceding sequences.  8) nucleic acid molecule according to claim 7, characterized in that it is selected from the group consisting of: the cDNA of sequence SEQ ID NO: 56, SEQ ID NO: 121 and SEQ ID NO: 125, the fragment of the genomic DNA of sequence SEQ ID NO: 127, and the genomic DNA fragment comprising the sequence SEQ ID NO: 120.  9) nucleic acid molecule according to claim 7, characterized in that it is selected from the group consisting of primers of sequence SEQ ID NO: 54,55, 58,59, 123, 124 and fragments of sequence SEQ ID NO: 60 to 89.  10) Method for detecting insects carrying resistance to insecticides of the class of organophosphorus compounds and carbamates, characterized in that it comprises: the preparation of a sample of nucleic acids from insects to be tested and detection by any appropriate means of the presence in said nucleic acid sample of a mutation in the ace-1 gene as defined in claim 7 or claim 8.  11) Method according to claim 10, characterized in that said detection comprises: the amplification of a fragment of approximately 520 bp using the pair of primers SEQ ID NO: 58 and 59, <Desc / Clms Page number 42>  digestion of said fragment with the aid of an appropriate restriction enzyme, and analysis of the restriction profile obtained.  12) Method according to claim 10, characterized in that said detection comprises: - the amplification of a fragment of approximately 541 bp using the pair of primers SEQ ID NO: 123 and 124, - the digestion of said fragment with the aid of an appropriate restriction enzyme, and - the restriction profile analysis obtained.  13) Method according to claim 11 or claim 12, characterized in that said restriction enzyme is Alu I.  14) Recombinant vector, characterized in that it comprises an insert selected from the group consisting of the nucleic acid molecules according to any one of claims 7 to 9.  15) Cells, characterized in that they are modified by a recombinant vector according to claim 14.  16) Antibodies, characterized in that they are directed against acetylcholinesterase according to any one of claims 1 to 5 or the peptide according to claim 6.  17) Insect detection reagent with resistance to insecticides of the class of organophosphorus compounds and carbamates, characterized in that it is selected from the group consisting of nucleic acid molecules and their fragments according to one of the following: any of claims 7 to 9 and the antibodies of claim 16.  18) transgenic invertebrate animal, characterized in that it contains cells transformed with at least one nucleic acid molecule according to claim 7 or claim 8.  19) Method for screening an insecticidal substance, characterized in that it comprises: a) bringing the test substance into contact with an acetylcholinesterase according to any one of claims 1 to 5, an extract of cells <Desc / Clms Page number 43>  modified as defined in claim 15 or a biological sample of a transgenic animal as defined in claim 18, in the presence of acetylcholine or a derivative thereof, and b) the measurement by any appropriate means, of the acetylcholinesterase activity of the mixture obtained in a), and c) the selection of substances capable of inhibiting said activity.  20) Method for screening insecticidal substances, characterized in that it comprises: - bringing a test substance into contact with a transgenic animal according to claim 18, and - measuring the survival of the animal.  21) A screening reagent for insecticidal substances, characterized in that it is selected from the group consisting of acetylcholinesterases according to any one of claims 1 to 5, the recombinant vectors according to claim 14, the cells modified according to claim 15 and the transgenic animals according to claim 18.  22) Detection and / or screening kit, characterized in that it includes at least one reagent according to claim 17 or claim 21.