FR2829501A1 - Analyzing phenotypic characteristics of human immune deficiency virus, useful e.g. for assessing infective or replicative capacity or susceptibility to viral inhibitors - Google Patents

Abstract

Analyzing (M) a phenotypic characteristic (A) of HIV in a patient sample where (A) is the result of one or more mutations in the viral genome that can affect viral infection, is new. M comprises: (a) extracting nucleic acid (NA) from the sample; (b) at least one PCR amplification of a segment of NA, using primers that flank at least part of the genome that encodes the envelope (env), potentially mutated; (c) preparing a vector containing all parts of the HIV genome required for replication except for the segment amplified in (b), optionally also the gene encoding the envelope protein; (d) transfection of a first host cell with this vector and the product of (b), optionally also with a vector that provides the envelope gene, if not already present in the first vector; (e) culturing the cells to produce particles of chimeric virus formed by homologous recombination in a single cycle of replication; (f) using these particles to infect second host cells, able to be infected by (pseudotyped) HIV and optionally containing a marker gene (MG) activated only after viral infection; and (g) detecting and/or quantifying MG expression in the second cells. An Independent claim is also included for a kit for carrying out M.

Description

<Desc / Clms Page number 1>

NEW METHOD OF ANALYZING THE PHENOTYPIC CHARACTERISTICS OF HUMAN IMMUNODEFICIENCY VIRUSES (HIV)
The present invention relates to a method for analyzing phenotypic characteristics that present certain strains of viruses, in particular viruses
HIV.

 Genotypic tests that are fast and widely available to detect the presence of mutations in viral genes have been developed for example to detect mutations present in the genes encoding protease or HIV reverse transcriptase.

 Although some mutations have been associated with a particular inhibitor of viral activity, many others are associated with treatment with multiple molecules. In addition, with the development of new inhibitor molecules, the genotyping of variants of viruses that escape treatment becomes increasingly complex. This makes it difficult to assess and to know which inhibitors the viruses become resistant to or still retain a slight susceptibility. Under these circumstances, the presence and accumulation of resistance mutations can surely be a good indicator of the evolution of resistance, but the simple detection of these mutations at the genotypic level is no longer sufficient to quantitatively assess the level of resistance, a This parameter is crucial for optimizing the therapeutic orientations of patients who have failed antiviral therapy.

 The phenotypic characteristics of viruses are related to various aspects of viral behavior and

<Desc / Clms Page number 2>

 directly involved in many interactions between said viruses and their environment.

 Only the phenotypic tests, which directly measure in the culture medium the modification of the phenotypic characteristic of the virus, such as the inhibition of the viral activity, for example in the presence of compounds which inhibit said viral activity, provide a quantitative index of resistance.

 Other phenotypic characteristics whose analysis proves to be of interest, in particular from a medical point of view, are those which confer on a virus its resistance with respect to inhibitory agents capable of blocking at least one mechanism involved in the treatment. viral activity, those which confer on a virus its replicative capacity, those which confer on a virus its tropism towards particular targets or those which confer on a virus its ability to be neutralized by molecules, such as antibodies, chemokines or inhibitors.

Among the phenotypic characteristics of the HIV virus whose analysis is of particular interest from a medical point of view are those related to the expression of genes, susceptible to undergo at least one mutation, located in the GAG, ENV, or POL regions. of the viral genome, such as those listed below:
I Infectivity, replicative capacity and virulence.

 These phenotypic characteristics of HIV viruses may be related to the function of all

<Desc / Clms Page number 3>

 regions of the viral genome, whether they are parts coding for proteins or regions involved in the different mechanisms or stages of the viral replicative cycle. In particular, it is important to evaluate the effect produced by mutations in the genes encoding the protease, reverse transcriptase, integrase or envelope on the replication of viruses and especially viruses that have developed resistance to antiviral agents.

 His analysis makes it possible to measure the replicative capacity of a virus, also called infectivity or "fitness".

 II Susceptibility / Resistance to reverse transcriptase inhibitors.

 This phenotypic characteristic of HIV viruses is related to the expression of a portion of the POL region encoding the reverse transcriptase.

 His analysis allows the adjustment of antiretroviral therapy with nucleoside analogues or non-nucleoside reverse transcriptase inhibitors (NNRTI).

 III Susceptibility / Resistance to integrase inhibitors.

 This phenotypic characteristic of HIV viruses is related to the expression of a portion of the POL region encoding integrase.

 His analysis provides indications for adjusting antiretroviral therapy with integrase inhibitors.

<Desc / Clms Page number 4>

 IV. Susceptibility / Resistance to virus entry inhibitors in the target cell.

 This phenotypic characteristic of the HIV viruses is related to the expression of the HIV envelope glycoprotein and in particular to the expression of the transmembrane subunit of said glycoprotein encoded by part of the ENV gene.

 The analysis of this phenotypic characteristic allows the demonstration of the action of the inhibitory agents which block the fusion of the viral membrane with the membrane of the target cell.

 V Susceptibility / Resistance to inhibitors targeting co-receptors of HIV viruses.

 This phenotypic characteristic is also related to the expression of at least a portion of the ENV region of HIV viruses that encodes polypeptides that participate in binding with co-receptors of the target cell. The envelope / coreceptor interaction allows entry of the HIV virus into said target cell.

 His analysis measures the resistance of HIV viruses to the action of inhibitors blocking the coreceptors used by HIV to enter the target cell.

 Inhibitory agents interfere with the co-receptor by inhibiting its interaction with the HIV envelope.

 In particular, it is important to evaluate the effect of mutations in the ENV region that modify the interaction of certain regions of the envelope protein with the CXCR4 or CCR5 receptors of HIV target cells.

<Desc / Clms Page number 5>

VI Tropism
This phenotypic characteristic is also related to the expression of at least a portion of the ENV region encoding HIV envelope polypeptides, which participate in binding with one or more receptors of the target cell, particularly with CXCR4 or CCRS coreceptors
Its analysis makes it possible to measure in vivo the capacity of the HIV virus to use said receptors, in particular CXCR4 or CCR5, which are expressed differently in various cell types and makes it possible to know whether the virus uses one or the other of the receptors, or both.

 The indications provided by this analysis allow to deduce viral behavior in certain cell types, natural targets of HIV.

 VII Virulence.

 This phenotypic characteristic is also related to the expression of all or part of the ENV region that codes for the envelope polypeptides of HIV viruses.

 His analysis makes it possible to evaluate the cytopathic power of an HIV virus.

 VIII Neutralizing capacity.

 This phenotypic characteristic is also related to the expression of envelope proteins of HIV viruses.

 Its analysis makes it possible to evaluate the susceptibility of viruses to the inhibitory action of antibodies or substances naturally present in the body and present in serum or in other fluids.

<Desc / Clms Page number 6>

 The first tests to detect, for example, the phenotypic characteristic of HIV virus resistance to antiviral treatments were carried out using primary isolates and phytoagglutinin-stimulated (PHA) peripheral blood lymphocytes (PBL) according to a laborious and difficult to reproduce procedure. . An innovative alternative to these tests, a recombinant virus test, hereafter called RVA, was proposed by Kellam and Larder in 1994.

 This method of RVA analysis measured the resistance of a recombinant virus carrying the reverse transcriptase isolated from the plasma of a patient carrying the virus by co-transfection of the sequences thereof duly amplified by a polymerase chain reaction (PCR ), with a clone of laboratory-derived virus, which is deleted from its reverse transcriptase and is competent for replication in a variety of well-established cell lines.

 Several modifications of this method have now been described (Boucher, C., Keulen, W., Bommel, T., Nijhuis, M., Jong, D., Jong, M., SChipper, P. and Back, N., K. (1996) HIV-1 drug susceptibility determination using recombinant patient generated viruses will be tested in a cell-killing assay.

Antimicrobial Agents and Chemotherapy "40 (10), 2404-2409) (Shi, C. and Mellors, JW (1997)" A Recombinant Retroviral System for Rapid In Vivo Analysis of Human Immunodeficiency Virus Type 1 Susceptibility to Reverse Transcriptase Inhibitors ". Agents Chemother 41 (12), 2781-5) (Hertogs, K., Bethune, MP, Miller, V., Ivens, T., Schel, P., Van Cauwenberge, A., Van Den Eynde, C., Van Gerwen, V., Azijn, H., Van Houtte, M.,

<Desc / Clms Page number 7>

 Peeters, F., Staszewski, S., Conant, M., Bloor, S., Kemp, S., Larder, B. and Pauwels, R. (1998) "A rapid method for simultaneous detection of phenotypic resistance to inhibitors of protease and reverse transcriptase in recombinant human immunodeficiency virus type 1 isolates from patients treated with antiretroviral drugs.

Antimicrob Agents Chemother 42 (2), 269-76. ) (Hecht, FM, Grant, RM, Petropoulos, CJ, Dillon, B., Chesney, MA, Tian, H., Hellmann, NS, Bandrapalli, NI, Digilio, L., Branson, B. and Kahn, OJ ( 1998) "Sexual transmission of an HIV-1 variant resistant to multiple reverse transcriptase and protease inhibitors." N Engl J Med 339 (5), 307-11) (Medina, DJ, Tung, PP, Nelson, CJ, Sathya, B., Casareale, D. and Strair, RK (1998) "Characterization and Use of a Recombinant Retroviral System for the Analysis of Drug-Resistant HIV", Virol Methods 71 (2), 169-76).

 However, most of these recombinant systems have disadvantages because, as for the method using PBMCs, the production of a pool of infectious particles expressing a particular phenotypic characteristic that one seeks to detect and measure requires an amplification of the virus. by exponential growth of lymphocyte cells. The virus is then subjected to genetic drifts during its replication and can lose mutations that are essential for the expression of the desired phenotypic characteristic thus modifying the reliability of the method.

 Another drawback for detecting for example a phenotypic characteristic of resistance which is present in the methods of analysis of the art

<Desc / Clms Page number 8>

 This is due to the fact that the simultaneous presence of several mutations capable of conferring resistance to the various retroviral inhibitors reduces the replicative capacity of the virus.

 The inventors have developed a novel method of analyzing a phenotypic characteristic of HIV viruses that requires only a single cycle of replication.

 This method of analysis is based on the construction of a recombinant virus (RAV) obtained by cotransfection and homologous recombination with: a) the DNA sequences obtained from an HIV to be analyzed, capable of including mutations capable of modifying the desired phenotypic characteristic, said sequences being extracted from a biological medium such as plasma, serum, saliva, sperm or other secretions, from a patient carrying said virus, b) a first vector having a specific deletion of the sequences allowing the replication of HIV as well as a deletion of all or part of the sequence conferring on the HIV the desired phenotypic characteristic and c) a second vector, for example a plasmid, comprising the sequences completing those necessary for the replication of said virus and which are absent from the first vector.

 The method developed by the inventors is rapid, it requires about seven days to be performed and can be used for routine determinations such as measuring the

<Desc / Clms Page number 9>

 Susceptibility of HIV-infected patients to inhibitors of viral activity.

 Thus, the inventors have already described in US Pat. No. 6,103,462 a first application of this method of analysis, based on the formation of a particular recombinant virus, to determine the susceptibility of an HIV virus to protease inhibitors. .

 The new methods of analysis used in the context of the present invention HIV, are based on the determination of phenotypic characteristics of HIV viruses associated mutations that may be present at least in a gene selected from the group comprising the genes gag, pol, protease, reverse transcriptase, RNAse H, integrase, live, vpr, tat, rev, vpu, env, nef, cis-active sequences, LTR, dimerization sequences, regulatory splice sequences, RRE by means of ad-hoc recombinant viruses.

 The invention thus relates to a method for analyzing a phenotypic characteristic of the HIV viruses present in a biological sample of a patient, said phenotypic characteristic resulting from one or more mutations of the viral genome likely to influence the viral infection, characterized in that it comprises: a) extracting the nucleic acids contained in a biological sample, b) at least one PCR amplification of a segment of the nucleic acids of step (a), each with a pair of nucleic acids. primers surrounding a nucleic acid sequence of the viral genome capable of carrying at least one mutation,

<Desc / Clms Page number 10>

 c) the preparation of a vector comprising the parts of a genome of an HIV virus necessary for viral replication except for the segment amplified in step (b) and possibly with the exception of the gene coding for the envelope protein, d) transfection of a first cellular host with: - the nucleic acids obtained in step (b), - the vector prepared in step (c), - optionally a second vector comprising a gene coding for an envelope protein if the envelope gene is deleted from the vector prepared in step (c), to obtain a chimeric virus by homologous recombination, e) culturing said first cellular host under conditions making it possible to produce viral particles during a single replication cycle, f) infection with the viral particles obtained in step (e) of at least one second cellular host likely to be infected with an HIV virus or a pseudotyped virus HIV and possibly including a an activatable marker only following the viral infection, and g) detecting and / or quantifying the marker expressed in step (f) in order to demonstrate at least one phenotypic characteristic of the HIV viruses present in the biological sample.

 More particularly, the PCR amplification of step (b) is carried out with a pair of primers surrounding a nucleic acid sequence comprising all or part of a region of the viral genome chosen from: gag, pol, protease, reverse transcriptase, RNAse H,

<Desc / Clms Page number 11>

 integrase, live, vpr, tat, rev, vpu, env, nef, cis-active sequences, LTR, dimerization sequences, splice regulatory sequences or the Rev response element (RRE).

 According to a particular embodiment of the analysis method of the invention, the PCR amplification of step (b) is carried out with a pair of primers flanking a nucleic acid sequence coding for a part of the gag protein of the human immunodeficiency virus and a nucleic acid sequence coding for the protease, capable of carrying at least one mutation in the gene coding for the protease and, in that the vector of the step (c ) is constructed from a genome of an HIV virus where all or part of the gene coding for the protease is deleted.

 Advantageously, the amplification of step (b) according to the analysis method of the invention, of a nucleic acid sequence likely to carry at least one mutation in the gene coding for the protease is carried out with a pair of primers having a size of between 10 and 50 oligonucleotides, comprising the sequences Fit A-: (5'TCA CCT AGA ACT TTA AAT GC 3 ') (SEQ ID No: 1) and Pro A-: (5'GGC AAA TAC TGG AGT ATT GTA TG3'3 ') (SEQ ID NO: 2), or constituted by fragments thereof, or analogous sequences thereof carrying mutations of one or more nucleotides which do not modify essentially their ability to hybridize the region of the protease gene carrying the mutation (s), followed by a second amplification with a pair of primers having a size of between 10 and 50 oligonucleotides, including the sequences: Fit B: ( 5'AGA ACT TTA AAT GCA TGG GT 3 ')

<Desc / Clms Page number 12>

(SEQ ID No: 3) and Pro B-: (5'GGA GTA TTG TAT GGA TTT TCA GG 3 ') (SEQ ID NO: 4), or constituted by fragments thereof, or alternatively analogous sequences of these carrying mutations of one or more nucleotides which do not substantially alter their ability to hybridize the region of the protease gene carrying the mutation (s)
Most preferably, the amplification of step (b) according to the analysis method of the invention, of a nucleic acid sequence likely to carry at least one mutation in the gene coding for the protease is carried out with a pair of primers:
Fit A-: (5'TCA CCT AGA ACT TTA AAT GC 3 ') (SEQ ID NO: 1) and
Pro A-: (5'GGC AAA TGG TAC AGT ATT GTA TG3 '3') (SEQ ID NO: 2), followed by a second amplification with a pair of primers:
Fit B: (5'AGA ACT TTA AAT GCA TGG GT 3 ') (SEQ ID NO: 3) and
Pro B-: (5'GGA GTA TTG TAT GGA TTT TCA GG 3 ') (SEQ ID NO: 4), to obtain a 1460 base pair DNA segment, extending between residues 3950 and 5410 inclusive, and the vector of step (c) is a retroviral vector deleted from the reading frame region coding for the HIV-1 protease extending from residues 1505 to 2565 inclusive, deleted from the envelope region and comprising a unique MluI restriction site.

 According to a second particular embodiment of the method of analysis of the invention, the PCR amplification of step (b) of the method

<Desc / Clms Page number 13>

 method of analysis according to the invention is carried out with a pair of primers flanking a nucleic acid sequence capable of carrying at least one mutation in the gene coding for reverse transcriptase, and the transfection of step (c) is carried out with a first vector constructed from a genome of an HIV virus where all or part of the gene encoding the reverse transcriptase is deleted.

 Advantageously, the amplification of step (b) according to the analysis method of the invention, with a pair of primers flanking a nucleic acid sequence capable of carrying at least one mutation in the gene coding for the transcriptase reverse is performed with a pair of primers having a size of between 10 and 50 oligonucleotides, including MJ3 sequences (5'AGT AGG ACC TAC ACC TGT CA 3 ') (SEQ ID NO: 5) and RT-EXT (5' TTC CCA ATG CAT ATT GTG AG 3 ') (SEQ ID No: 6), or constituted by fragments thereof, or analogous sequences thereof carrying mutations of one or more nucleotides which do not modify essentially their ability to hybridize the region of the transcriptase gene carrying at least one mutation, followed by a second amplification step with a pair of primers comprising the sequences: A35 (5'TTG GTT GCA TAA ATT TTC CCA TTA GTC CTA TT 3 ') (SEQ ID No: 7) and RT-IN (5'TCG ATG CAT ATT GTG AG 3') (SEQ ID NO: 8) or constituted by fragments thereof, or analogous sequences thereof bearing mutations of one or more nucleotides which do not substantially alter their ability to hybridize the region of the gene reverse transcriptase carrying at least one mutation.

<Desc / Clms Page number 14>

Most preferably, the amplification of step (b) according to the analysis method of the invention, with a pair of primers flanking a nucleic acid sequence capable of carrying at least one mutation in the gene encoding the Reverse transcriptase is performed with a pair of primers:
MJ3 (5'AGT AGG ACC TAC ACC TGT CA 3 ') (SEQ ID NO: 5) and
RT-EXT (5'TCG ATG CAT ATT GTG AG 3 ') (SEQ ID NO: 6), followed by a second amplification step with a pair of primers:
A35 (5'TTG GTT GCA TAA ATT TTC CCA TTA GTC CTA TT 3 ') (SEQ ID No: 7) and
RT-IN (SEQ ID NO: 8) to obtain a 1530 base pair DNA segment extending beyond the codon 93 of the coding region of the protease and beyond the codon 503 of the polymerase coding region (POL) and the vector of step (c) is a retroviral vector deleted from the pol reading frame region encoding the HIV-1 reverse transcriptase , extending from residues 2618 to 2872 inclusive, and having a unique MluI restriction site.

 The invention also relates to an assay method for determining the susceptibility of an HIV virus to a reverse transcriptase inhibiting compound, whether to add or not said reverse transcriptase inhibitor compound, optionally at different concentrations, to the second host. cell, prior to infection thereof with the viral particles obtained in step (e), and comprising in step (g) the comparison of the expression of the gene

<Desc / Clms Page number 15>

marker with and without reverse transcriptase inhibitor compound
According to a third particular embodiment of the analysis method of the invention, the PCR amplification of step (b) is carried out with a pair of primers flanking a nucleic acid sequence capable of carrying at least one mutation in the gene coding for the integrase, and the vector of step (c) is a retroviral vector deleted from all or part of the gene coding for the integrase.

 Advantageously, the amplification of step (b) according to the analysis method of the invention with a pair of primers flanking a nucleic acid sequence capable of carrying at least one mutation in the gene coding for integrase. is carried out with the primer pair having a size of between 10 and 50 oligonucleotides, comprising the sequences: INT B ± 5'GTTACTAATAGAGGAAGACAAA3 '(SEQ ID NO: 9) and INT B-5'TTTTGGTGTTATTAATGCT3' (SEQ ID NO: 10 ), or analogous sequences thereof having mutations of one or more nucleotides which do not substantially alter their ability to hybridize the integrase gene region carrying at least one mutation, followed by a second amplification step, with the pair of primers: INT V + 5'CACCCTAACTGACACAACAA3 '(SEQ ID No: 11) and INT V-5'AAGGCCTTTCTTATAGCAGA3' (SEQ ID No: 12), or similar sequences thereof carrying mutations of one or more nucleotides that do not alter not essential to their ability to hybridize the region of the integrase gene carrying at least one mutation

<Desc / Clms Page number 16>

Most preferably, the amplification of step (b) according to the analysis method of the invention with a pair of primers surrounding a nucleic acid sequence capable of carrying at least one mutation in the gene coding for the integrase is performed with the primer pair:
INT B ± 5'GTTACTAATAGAGGAAGACAAA3 '(SEQ ID NO: 9) and
INT B-5'TTTTGGTGTTATTAATGCT3 '(SEQ ID No: 10), followed by a second amplification step, with the primer pair:
INT V + 5'CACCCTAACTGACACAACAA3 '(SEQ ID NO: 11) and
INT V-5'AAGGCCTTTCTTATAGCAGA3 '(SEQ ID NO: 12), to obtain a 1460 base pair DNA fragment extending residues 3950 to 5410 inclusive and the vector of step (c) is a retroviral vector deleted whole region of the pol frame encoding the HIV-1 integrase extending residues 4228 to 5093 inclusive and the viral envelope coding region between positions 6343 and 7611 inclusive.

 The invention also relates to an assay method for determining the susceptibility of an HIV virus to an integrase inhibitory compound, whether or not to add said integrase inhibitor compound, optionally at different concentrations, during the step (e), before step (f) and comprising in step (g) the comparison of the expression of the marker gene with and without integrase inhibiting compound.

<Desc / Clms Page number 17>

 According to a fourth particular embodiment of the analysis method of the invention, the PCR amplification of step (b) is carried out with a pair of primers flanking a nucleic acid sequence capable of bringing the minus one mutation in the gene encoding the coat protein, and the vector of step (c) is a retroviral vector constructed from a genome of an HIV virus where all or part of the gene encoding the protein envelope is deleted.

 Preferably, the vector of step (c) is a retroviral vector deleted from the entire region coding for the extracellular portion of the gp41 subunit of the envelope of HIV-1, extending residues 7745 to 8263 inclusive, of the region of the HIV-1 genome that constitutes the Rev response element (RRE).

14), soit les séquences FuA : 5'AAGCAATGTATGCCCCTCCCAT3' (SEQ ID No : 23) et FuB : 5'GGTGGTAGCTGAAGAGGCACAGG3' (SEQ ID No : 24) ou constitués par des fragments de celles-ci ou encore par des séquences analogues de celles-ci portant des mutations d'un ou plusieurs nucléotides qui ne modifient pas de manière essentielle leur capacité à hybrider la région du gène de l'enveloppe portant au moins une mutation suivie d'une deuxième étape d'amplification, effectuée avec une paire d'amorces ayant Advantageously, the amplification of step (b) with a pair of primers surrounding a nucleic acid sequence capable of carrying at least one mutation in the gene coding for the envelope protein is carried out with a pair of primers having a size of between 10 and 50 oligonucleotides, comprising either the sequences: FIN-A: 5'TCAAATATTACAGGGCTGCT3 '(SEQ ID No: 13) and FIN-B: 5'TAGCTGAAGAGGCACAGG3' (SEQ ID NO:

14), either the FuA sequences: 5'AAGCAATGTATGCCCCTCCCAT3 '(SEQ ID No: 23) and FuB: 5'GGTGGTAGCTGAAGAGGCACAGG3' (SEQ ID No: 24) or constituted by fragments thereof or by sequences similar to those of with mutations of one or more nucleotides that do not substantially alter their ability to hybridize the envelope gene region carrying at least one mutation followed by a second amplification step, performed with a pair of 'primers having

<Desc / Clms Page number 18>

5'TCCACCTTCTTCTTCGATT3' (SEQ ID No : 16), soit les séquences FuC : 5'ATATGAGGGACAATTGGAGAAGTGA3' (SEQ ID No : 25), utilisée en combinaison avec un mélange de deux séquences suivantes : Fut 1 5'TCTGTCTCTCTCTCCACCTTCTTCTT3' (SEQ ID No : 26) et FuD2 : 5'TCTGTCTTGCTCTCCACCTTCTTCTT3' (SEQ ID No : 27) ou constitués par des fragments de celles-ci, ou encore par des séquences analogues de celles-ci portant des mutations d'un ou plusieurs nucléotides qui ne modifient pas de manière essentielle leur capacité à hybrider la région du gène de l'enveloppe portant au moins une mutation
Tout préférentiellement, l'amplification de l'étape (b) avec une paire d'amorces encadrant une séquence d'acide nucléique susceptible de porter au moins une mutation dans le gène codant pour la protéine d'enveloppe est effectuée avec une paire d'amorces :
FIN-A : 5'TCAAATATTACAGGGCTGCT3' (SEQ ID No : 13) et
FIN-B : 5'TAGCTGAAGAGGCACAGG3' (SEQ ID No : 14) suivie d'une deuxième étape d'amplification, effectuée avec la paire d'amorces :
FIN-C : 5'CTATTAACAAGAGATGGTGG3' (SEQ ID No : 15) et
FIN-D : 5'TCCACCTTCTTCTTCGATT3' (SEQ ID No : 16), pour obtenir un segment d'ADN de 965 paires de bases s'étendant des résidus 7553 à 8517 inclus et le vecteur de l'étape (c) est un vecteur retroviral délété de toute la région codant pour la portion extracellulaire a size between 10 and 50 oligonucleotides, comprising either the sequences: FIN-C: 5'CTATTAACAAGAGATGGTGG3 '(SEQ ID No: 15) and FIN-D:

5'TCCACCTTCTTCTTCGATT3 '(SEQ ID No: 16), or FuC sequences: 5'ATATGAGGGACAATTGGAGAAGTGA3' (SEQ ID No: 25), used in combination with a mixture of two following sequences: Fut 1 5'TCTGTCTCTCTCTCCACCTTCTTCTT3 '(SEQ ID No : 26) and FuD2: 5'TCTGTCTTGCTCTCCACCTTCTTCTT3 '(SEQ ID NO: 27) or constituted by fragments thereof, or alternatively by analogous sequences thereof carrying mutations of one or more nucleotides which do not alter essentially their ability to hybridize the envelope gene region carrying at least one mutation
Most preferably, the amplification of step (b) with a pair of primers surrounding a nucleic acid sequence capable of carrying at least one mutation in the gene coding for the envelope protein is carried out with a pair of primers:
FIN-A: 5'TCAAATATTACAGGGCTGCT3 '(SEQ ID NO: 13) and
FIN-B: 5'TAGCTGAAGAGGCACAGG3 '(SEQ ID NO: 14) followed by a second amplification step, performed with the primer pair:
FIN-C: 5'CTATTAACAAGAGATGGTGG3 '(SEQ ID NO: 15) and
FIN-D: 5'TCCACCTTCTTCTTCGATT3 '(SEQ ID NO: 16), to obtain a 965 base pair DNA segment extending residues 7553 to 8517 inclusive and the vector of step (c) is a vector retroviral deleted from the entire coding region for the extracellular portion

<Desc / Clms Page number 19>

 the gp41 subunit of the HIV-1 envelope, ranging from residues 7745 to 8263 inclusive, and has a unique Mull restriction site.

et un mélange des amorces suivantes : FuD1 : 5'TCTGTCTCTCTCTCCACCTTCTTCTT3' (SEQ ID No : 26)
FuD2 : 5'TCTGTCTTGCTCTCCACCTTCTTCTT3' (SEQ ID No : 27), ledit mélange étant préférentiellement effectué dans un rapport compris entre (10% : 90%) et (90% : 10%) et tout préférentiellement entre (60% : 40%) et (40% : 60%), pour obtenir un segment d'ADN de 805 paires de bases s'étendant des résidus 7635 à 8440 inclus et le vecteur de l'étape (c) est un vecteur retroviral délété de toute la région codant pour la portion extracellulaire Most preferably, the analysis method according to the invention allows the amplification of sequences of the envelope region of HIV virus regardless of their subtype and in particular viruses subtypes A, B, C, D and E), using for the amplification of step (b) with a primer pair flanking a nucleic acid sequence capable of carrying at least one mutation in the gene encoding the coat protein is carried out with a pair of primers:
FuA: 5'AAGCAATGTATGCCCCTCCCAT3 '(SEQ ID NO: 23) and
FuB: 5'GGTGGTAGCTGAAGAGGCACAGG3 '(SEQ ID NO: 24) followed by a second amplification step, performed with the primer:
FuC: 5'ATATGAGGGACAATTGGAGAAGTGA3 '(SEQ ID NO: 25)

and a mixture of the following primers: FuD1: 5'TCTGTCTCTCTCTCCACCTTCTTCTT3 '(SEQ ID No: 26)
FuD2: 5'TCTGTCTTGCTCTCCACCTTCTTCTT3 '(SEQ ID NO: 27), said mixture being preferably carried out in a ratio of between (10%: 90%) and (90%: 10%) and most preferably between (60%: 40%) and (40%: 60%), to obtain a 805 base pair DNA segment extending residues 7635 to 8440 inclusive and the vector of step (c) is a retroviral vector deleted from the entire coding region for the extracellular portion

<Desc / Clms Page number 20>

 the gp41 subunit of the HIV-1 envelope, ranging from residues 7745 to 8263 inclusive, and has a unique Mull restriction site.

ID No : 17) et FIN-B : 5'TAGCTGAAGAGGCACAGG3' (SEQ ID No : 14) ou FuB : 5'GGTGGTAGCTGAAGAGGCACAGG3' (SEQ ID No : 24) ou constitués par des fragments de celles-ci, ou encore par des séquences analogues de celles-ci portant des mutations d'un ou plusieurs nucléotides qui ne modifient pas de manière essentielle leur capacité à hybrider la région du gène de l'enveloppe portant au moins une mutation, suivie d'une deuxième étape d'amplification, avec la paire d'amorces ayant une taille comprise entre 10 et 50 oligonucléotides, comprenant les séquences : NEU-C : 5'GTGGGTCACAGTCTATTATGGGG3' (SEQ ID No : 18) et FIN-D : 5'TCCACCTTCTTCTTCGATT3' (SEQ ID No : 16) ou un mélange des séquences suivantes : FuD1 : 5'TCTGTCTCTCTCTCCACCTTCTTCTT3' (SEQ ID No : 26) et FuD2 : 5'TCTGTCTTGCTCTCCACCTTCTTCTT3' (SEQ ID No : 27), ou constitués par des fragments de celles-ci, ou encore par des séquences analogues de celles-ci portant des mutations d'un ou plusieurs nucléotides qui ne modifient pas de manière essentielle leur capacité à hybrider la région du gène de l'enveloppe portant au moins une mutation. Advantageously, the amplification of step (b) with a pair of primers surrounding a nucleic acid sequence capable of carrying at least one mutation in the gene coding for the envelope protein is carried out with a pair of primers having a size of between 10 and 50 oligonucleotides, comprising the sequences: NEU-A: 5'TAGAAAGAGCAGAAGACAGTGGCAATG3 '(SEQ

ID No: 17) and FIN-B: 5'TAGCTGAAGAGGCACAGG3 '(SEQ ID No: 14) or FuB: 5'GGTGGTAGCTGAAGAGGCACAGG3' (SEQ ID NO: 24) or constituted by fragments thereof, or by sequences analogs thereof having mutations of one or more nucleotides which do not substantially alter their ability to hybridize the envelope gene region carrying at least one mutation, followed by a second amplification step, with the primer pair having a size of between 10 and 50 oligonucleotides, comprising the sequences: NEU-C: 5'GTGGGTCACAGTCTATTATGGGG3 '(SEQ ID No: 18) and FIN-D: 5'TCCACCTTCTTCTTCGATT3' (SEQ ID No: 16) or a mixture of the following sequences: FuD1: 5'TCTGTCTCTCTCTCCACCTTCTTCTT3 '(SEQ ID No: 26) and FuD2: 5'TCTGTCTTGCTCTCCACCTTCTTCTT3' (SEQ ID No: 27), or constituted by fragments thereof, or by sequences analogs thereof carrying mutations of one or more nucleotides which do not alter essentially their ability to hybridize the envelope gene region carrying at least one mutation.

<Desc / Clms Page number 21>

Most preferably, the amplification of step (b) with a pair of primers surrounding a nucleic acid sequence capable of carrying at least one mutation in the gene coding for the envelope protein is carried out with a pair of primers:
NEU-A: 5'TAGAAAGAGCAGAAGACAGTGGCAATG3 '(SEQ ID NO: 17) and
FIN-B: 5'TAGCTGAAGAGGCACAGG3 '(SEQ ID NO: 14), followed by a second amplification step, with the primer pair:
NEU-C: 5'GTGGGTCACAGTCTATTATGGGG3 '(SEQ ID NO: 18) and
FIN-D: 5'TCCACCTTCTTCTTCGATT3 '(SEQ ID NO: 16), to obtain a 2320 base pair DNA fragment extending residues 6197 to 8517 inclusive and the vector of step (c) is a vector retroviral deleted from the entire region encoding the majority of the gp120 subunit and the extracellular portion of gp41 of the HIV-1 envelope, ranging from residues 6480 to 8263 inclusive, and includes a unique restriction site Mull.

Most preferably, the amplification of step (b) with a pair of primers surrounding a nucleic acid sequence capable of carrying at least one mutation in the gene coding for the envelope protein is carried out with a pair of primers:
NEU-A: 5'TAGAAAGAGCAGAAGACAGTGGCAATG3 '(SEQ ID NO: 17) and
FuB: 5'GGTGGTAGCTGAAGAGGCACAGG3 '(SEQ ID NO: 24), followed by a second amplification step, with the primers:

<Desc / Clms Page number 22>

NEU-C: 5'GTGGGTCACAGTCTATTATGGGG3 '(SEQ ID No: 18) and a mixture of the following primers
FuD1: 5'TCTGTCTCTCTCTCCACCTTCTTCTT3 '(SEQ ID No: 26) and
FuD2: 5'TCTGTCTTGCTCTCCACCTTCTTCTT3 '(SEQ ID NO: 27), said mixture being preferably carried out in a ratio of between (10%: 90%) and (90%: 10%) and most preferably between (60%: 40%) and (40%: 60%), to obtain a 2118 base pair DNA fragment extending residues 6322 to 8440 inclusive and the vector of step (c) is a retroviral vector deleted from the entire coding region for the majority of the gp120 and extracellular portion of gp41 of the HIV-1 envelope, ranging from residues 6480 to 8263 inclusive, and has a unique Mull restriction site.

 Advantageously, the amplification of step (b) with a pair of primers surrounding a nucleic acid sequence capable of carrying at least one mutation in the gene coding for the envelope protein is carried out with a pair of primers having a size of between 10 and 50 oligonucleotides, comprising the sequences: EOO: 5'TAGAAAGAGCAGAAGACAGTGGCAATGA3 '(SEQ ID No: 19) and ES8B: 5'CACTTCTCCAATTGTCCCTCA3' (SEQ ID NO: 20), or constituted by fragments thereof; or analogous sequences thereof having mutations of one or more nucleotides which do not substantially alter their ability to hybridize the envelope gene region carrying at least one mutation, followed by a second amplification step, with a pair of primers having a

<Desc / Clms Page number 23>

 size between 10 and 50 oligonucleotides comprising the sequences: E20: 5'GGGCCACACATGCCTGTGTACCCACAG3 '(SEQ ID No: 21) and E115: 5'AGAAAAATTCCCCTCCACAATTAA3' (SEQ ID No: 22), or alternatively by analogous sequences thereof mutations of one or more nucleotides which do not substantially alter their ability to hybridize the protease gene region carrying at least one mutation.

Most preferably, the amplification of step (b) with a pair of primers surrounding a nucleic acid sequence capable of carrying at least one mutation in the gene coding for the envelope protein is carried out with a pair of primers:
EOO: 5'TAGAAAGAGCAGAAGACAGTGGCAATGA3 '(SEQ ID NO: 19) and
ES8B: 5'CACTTCTCCAATTGTCCCTCA3 '(SEQ ID NO: 20), followed by a second amplification step, with the primer pair:
E20: 5'GGGCCACACATGCCTGTGTACCCACAG3 '(SEQ ID NO: 21) and
E115: 5'AGAAAAATTCCCCTCCACAATTAA3 '(SEQ ID NO: 22), to obtain a DNA segment of 938 base pairs extending residues 6426 to 7364 inclusive and the vector of step (c) is a deleted retroviral vector of the region, coding for domains ranging from V1 loop to V3 loop of HIV-1 envelope extending from 6617 to 7250 inclusive and comprises a unique NheI restriction site.

<Desc / Clms Page number 24>

 The invention also relates to an assay method for determining the susceptibility of an HIV virus to a fusion inhibitor compound targeting the HIV-1 gp41 protein, comprising amplifying step (b) with either the primer pair SEQ ID No: 13, SEQ ID No: 14 followed by a second amplification with the primer pair SEQ ID No: SEQ ID No: 16, or with the primer pair SEQ ID No: 17 SEQ ID No: 18 followed by a second amplification with the primer pair SEQ ID No: 18, SEQ ID No: 16, to add or not said fusion inhibitor compound, possibly at different concentrations, during the cultivation of the cell host obtained in step (e), before step (f) and comprising in step (g) the comparison of the expression of the marker gene with and without a fusion inhibitor compound targeting HIV-40 gp41. 1.

 The invention also relates to an assay method for determining the susceptibility of an HIV virus to an input inhibitory compound of said HIV virus in a target cell, comprising amplifying step (b) with the pair. of primers SEQ ID No: 17 and SEQ ID No: 18 followed by a second amplification with the pair of primers SEQ ID No: 18 and SEQ ID No: 16, to add or not said input inhibiting compound, optionally at different concentrations, to the cellular host obtained in step (e) before the infection of step (f) and comprising in step (g) the comparison of the expression of the marker gene with and without input inhibitor compound.

 The invention also relates to an assay method for determining the susceptibility of an HIV virus to the inhibitory action of antibodies, comprising

<Desc / Clms Page number 25>

 amplify step (b) with primer pair SEQ ID NO: 17 SEQ ID NO: 18 followed by a second amplification with primer pair SEQ ID NO: 18, SEQ ID No: 16 , to add or not said antibodies during step (e) of culture, optionally at different concentrations and comprising in step (g) the comparison of the expression of the marker gene with and without antibodies.

 The invention also relates to an assay method for determining the tropism of an HIV virus for a cellular receptor, comprising performing the amplification of step (b) with the primer pair SEQ ID No: 17 SEQ ID No: 18 followed by a second amplification with the primer pair SEQ ID NO: 18, SEQ ID No: 16, to carry out the infection of step (f) with the viral particles obtained in step (e). ) on two distinct cellular hosts and comprising in step (g) the comparison of the expression of the marker gene by each of the two distinct cellular hosts.

 Advantageously, the cellular hosts used for the infection of step (f) according to the analysis method of the invention are chosen from cell hosts expressing the CCRS receptor or the CXCR4 receptor.

 The invention also relates to an assay method for determining the susceptibility of an HIV virus to an inhibitory compound targeting HIV-1 co-receptors, comprising amplifying step (b) with the primer pair. SEQ ID No: 17 SEQ ID No: 18 followed by a second amplification with the primer pair SEQ ID No: 18, SEQ ID No: 16, to be added or

<Desc / Clms Page number 26>

 not said inhibitor compound targeting HIV-1 co-receptors, possibly at different concentrations, during step (e) of culture, the infection of step (f) being carried out on two distinct cellular hosts and comprising at least one step (g) comparing the expression of the marker gene by each of the two distinct cellular hosts.

 The invention also relates to an assay method for determining the tropism of an HIV virus for a cellular receptor, comprising performing the amplification of step (b) with the primer pair SEQ ID No: 19 and SEQ ID No: 20, followed by a second amplification with the pair of primers SEQ ID No: 21 and SEQ ID No: 22, to infect in step (f) two distinct cellular hosts with the viral particles obtained at the step (e) and comprising in step (g) the comparison of the expression of the marker gene by each of the two distinct cellular hosts.

 The invention also relates to an assay method for determining the susceptibility of an HIV virus to an inhibitory compound targeting HIV-1 co-receptors, comprising amplifying step (b) with the primer pair. SEQ ID NO: 19 and SEQ ID NO: 20 followed by a second amplification with primer pair SEQ ID No: 21 and SEQ ID No: 22, whether to add or not said inhibitor compound targeting HIV-1 co-receptors, optionally at different concentrations, during the culture of step (d), to carry out the infection of step (f) with the viral particles obtained in step (e) on two distinct cellular hosts and to compare with step (g) the expression of the marker gene by each of the two distinct cellular hosts.

<Desc / Clms Page number 27>

 The invention also relates to an assay method for determining the infectivity or replicative capacity of an HIV virus by comparing in step (g) the expression of the marker gene by the second infected cell host with the viral particles. obtained by applying steps (a) to (f) to a biological sample of a patient, and the expression of the marker gene by the same second cell host infected with reference viral particles obtained by applying steps (a) to (f) a sample containing a reference virus.

 Advantageously, the viral reference particles derived from a reference virus are viral particles obtained by applying steps (a) to (f) to a biological sample of the same patient at a prior stage of the therapeutic treatment or before this one. .

 The invention also relates to an assay method for determining the virulence of an HIV virus comprising amplifying step (b) with either the primer pair SEQ ID NO: 13, SEQ ID NO: 14 followed by a second amplification with the primer pair SEQ ID No: SEQ ID No: 16, or with the primer pair SEQ ID No: 17 SEQ ID No: 18 followed by a second amplification with the pair of primer SEQ ID NO: 18, SEQ ID NO: 16, and to measure, during the infection of step (f), the cytopathogenic effect produced on the second cellular host.

 Advantageously, the cytopathogenic effect produced during the infection of step (f) on the second host

<Desc / Clms Page number 28>

 Cellularity is measured using cytotoxicity techniques such as measuring syncytia induction, apoptosis induction, or flow cytometry.

 The invention also relates to a method of analysis for determining the susceptibility of an HIV virus to hydroxyurea, whether or not to add hydroxyurea, optionally at different concentrations, during the step (e) of culture or at the second cellular host and performing in step (g) the comparison of the expression of the marker gene with and without hydroxyurea.

 Preferably, the duration of the culture step (e) according to the method of the invention is between 12 and 72 hours, most preferably it is between 24 and 48 hours.

 The subject of the invention is also a kit for implementing a method for analyzing a phenotypic characteristic of HIV viruses present in a biological sample of a patient, characterized in that it comprises: i) a pair of primers surrounding a nucleic acid sequence of the viral genome likely to carry at least one mutation, ii) a vector comprising the parts of a genome of an HIV virus necessary for viral replication except for the amplified segment with the primers defined in (i) and the gene coding for the envelope protein, iii) a second vector comprising a gene coding for an envelope protein,

<Desc / Clms Page number 29>

 iv) a first cellular host likely to be infected with an HIV virus, v) a second cellular host likely to be infected with an HIV virus and having an activatable marker gene only following the viral infection, vi) the products and reagents necessary to carry out the amplification by PCR, vii) the products and reagents allowing the detection of the expressed marker.

 Advantageously, the kit according to the invention comprises: i) the primer pairs of sequences: SEQ ID No: 1 and SEQ ID No: 2 SEQ ID No: 3 and SEQ ID No: 4 ii) a retroviral vector deleted of the pol-reading frame region coding for the HIV-1 protease extending from residues 1505 to 2565 inclusive, deleted from the envelope region and having a unique MluI restriction site, iii) a pseudotyped virus with a gene encoding an envelope protein. iv) a first cellular host likely to be infected with an HIV virus, v) a second cellular host likely to be infected with an HIV virus and having an activatable marker gene only following the viral infection, vi) the products and reagents necessary to carry out the amplification by PCR, vii) the products and reagents allowing the detection of the expressed marker.

<Desc / Clms Page number 30>

 Advantageously, the kit according to the invention comprises: i) the primer pairs of sequences: SEQ ID No: 5 and SEQ ID No: 7 SEQ ID No: 6 and SEQ ID No: 8 ii) a retroviral vector deleted from the pol reading frame region coding for HIV-1 reverse transcriptase, ranging from residues 2618 to 2872 inclusive, and having a unique MluI restriction site, iii) a virus pseudotyped by a gene coding for a protein of envelope, iv) a first cellular host likely to be infected with an HIV virus, v) a second cellular host likely to be infected with an HIV virus and having an activatable marker gene only following the viral infection, vi ) the products and reagents necessary to carry out the amplification by PCR, vii) the products and reagents allowing the detection of the expressed marker.

 Advantageously, the kit according to the invention comprises: i) the pairs of primers of sequences: SEQ ID NO: 9 and SEQ ID NO: 10 SEQ ID NO: 11 and SEQ ID NO: 12 ii) a retroviral vector deleted from the entire pol-reading frame region coding for HIV-1 integrase ranging from residues 4228 to 5093 inclusive and the viral envelope coding region between positions 6343 and 7611 inclusive, iii) pseudotyped virus a gene coding for an envelope protein,

<Desc / Clms Page number 31>

 iv) a first cellular host likely to be infected with an HIV virus, v) a second cellular host likely to be infected with an HIV virus and having an activatable marker gene only following the viral infection, vi) the products and reagents necessary to carry out the amplification by PCR, vii) the products and reagents allowing the detection of the expressed marker.

 Advantageously, the kit according to the invention comprises: i) the primer pairs of sequences - SEQ ID No: 13 and SEQ ID No: 14 - SEQ ID No: 15 and SEQ ID No: 16 ii) a retroviral vector deleted from any the coding region for the extracellular portion of the gp41 subunit of the HIV-1 envelope, extending from residues 7745 to 8263 inclusive, and having a unique Mull restriction site, iv) a first susceptible cell host by an HIV virus, v) a second cell host likely to be infected with an HIV virus and having an activatable marker gene only following the viral infection, vi) the products and reagents necessary to carry out the PCR amplification vii) products and reagents for the detection of the expressed marker.

 Advantageously, the kit according to the invention comprises:

<Desc / Clms Page number 32>

 i) the primer pairs of sequences - SEQ ID No: 17 and SEQ ID No: 14 - SEQ ID No: 18 and SEQ ID No: 16 ii) a retroviral vector deleted from the entire region coding for the majority of the sub unit gp120 and the extracellular portion of the gp41 of the HIV-1 envelope, extending residues 6480 to 8263 inclusive, and having a unique Mull restriction site; iv) a first susceptible cell host; by an HIV virus, v) a second cell host capable of being infected with an HIV virus and having a marker gene activatable solely by viral particles, vi) the products and reagents necessary to carry out the amplification by PCR, vii) the products and reagents for detecting the expressed marker.

 Advantageously, the kit according to the invention comprises: i) the primer pairs of sequences - SEQ ID No: 19 and SEQ ID No: 20 - SEQ ID No: 21 and SEQ ID No: 22 ii) a retroviral vector deleted from the region, coding for the domains ranging from loop VI to loop V3 of the envelope of HIV-1 ranging from 6617 to 7250 inclusive and having a unique restriction site NheI, iv) a first cellular host likely to be infected with an HIV virus, v) a second cellular host susceptible to infection by an HIV virus and having an activatable marker gene only following the viral infection,

<Desc / Clms Page number 33>

 vi) the products and reagents necessary to carry out the amplification by PCR, vii) the products and reagents allowing the detection of the expressed marker.

Advantageously, the kit according to the invention comprises: i) the primer pairs of sequences - SEQ ID No: 23 and SEQ ID No: 24 - SEQ ID No: 25 and SEQ ID No: 26 with SEQ
ID No: 27 ii) a retroviral vector deleted from the entire region coding for the extracellular portion of the gp41 subunit of the HIV-1 envelope, extending from residues 7745 to 8263 inclusive, and including a restriction site unique Mull, iv) a first cellular host likely to be infected by an HIV virus, v) a second cellular host capable of being infected with an HIV virus and comprising an activatable marker gene only following the viral infection, vi) the products and reagents necessary to carry out the amplification by PCR, vii) the products and reagents allowing the detection of the expressed marker.

Advantageously, the kit according to the invention comprises: i) the primer pairs of sequences - SEQ ID No: 17 and SEQ ID No: 24 - SEQ ID No: 18 and SEQ ID No: 26 and SEQ ID
No: 27

<Desc / Clms Page number 34>

 ii) a retroviral vector deleted from the entire region coding for the majority of the gp120 subunit and the extracellular portion of the gp41 of the HIV-1 envelope, extending from residues 6480 to 8263 inclusive, and comprising a Mull unique restriction site, iv) a first cell host capable of being infected with an HIV virus, v) a second cellular host capable of being infected with an HIV virus and comprising a marker gene activatable solely by viral particles, vi ) the products and reagents necessary to carry out the amplification by PCR, vii) the products and reagents allowing the detection of the expressed marker.

Other advantages and characteristics of the invention are illustrated in the examples which follow and which refer to the following figures:
Figure 1 schematically shows the plasmid pSRT. The region coding for the pNL4-3xcenv reverse transcriptase is deleted by means of BalI-SnaBI digestion. Linearization of the resulting pSRT is accomplished by the use of Nru I.

 Figure 2 illustrates the dose response curves obtained for two patients versus AZT and 3TC before and after treatment with reverse transcriptase inhibitors.

 The details of the treatment, the samples taken with respect to time and the genotypes are on the headers of the figures.

 Curves show inhibition of infection by a recombinant P4 cell virus

<Desc / Clms Page number 35>

 treated either with zidovidin (AZT, panels A and C) or lamivudine (3TC, panels B and D), according to the technique described later, in the paragraph material and methods. For patient I, the samples were tested at 0 (+), 9 (e) and 18 (D) months after treatment, and for patient 2, at 0 (+) and 27 (e) months after treatment. treatment.

 Figure 3 is a diagram of the first steps (a and b) of a particular implementation of the method of the invention. The diagram illustrates the steps of extraction (a) and amplification (b) of the reverse transcriptase sequences extracted from a patient's plasma by RT PCR of the method of the invention as well as the plasmid / pRVA / plasmid construction schemes. RT used later in step (d).

 FIG. 4 is a diagram of steps (c) to (g) of a particular implementation of the method of the invention. This scheme illustrates the step (d) of cotransfection in HeLa / 293T cells of the amplified nucleic acids of step (b), of a first plasmid p43xcsnAenv RT constructed from a genome of an HIV virus. not comprising a nucleic acid segment corresponding to all or part of the nucleic acid sequence amplified in step (b) nor a fragment of the nucleic acid sequence coding for the envelope protein and a second plasmid pVSV G comprising the coding sequence for the envelope protein; the step (e) of culture for producing viral particles, the step (f) of transfection of the viral particles obtained in step (e) in P4 cells, previously incubated in the presence or absence of serial dilutions of different transcriptase inhibitors

<Desc / Clms Page number 36>

 inverse, said P4 indicator cells comprising an expression system of the gene coding for the betagalactosidase enzyme activatable exclusively by the tat activation sequences expressed by the recombinant virus, and the step (g) of detecting and / or quantifying the betagalactosidase using the CPRG substrate.

 I-Material and Methods 1. 1-Amplification by polymerase chain reaction (PCR).

 RNA is isolated from patients' plasma using a Roche Amplicor e kit (Roche Diagnostics, 38242 Meylan Cedex, France), and the genes of interest are isolated using reverse transcriptase and a PCR reaction. subsequent.

à 500C (30 minutes) et à 940C (2 minutes), suivi de 40 cycles à 940C (30 secondes), 550C (30 secondes) et 680C (90 secondes) et une étape finale d'extension à 980C durant 10 minutes. Ceci amplifie un produit de 1530 pb qui s'étend au-delà du codon 93 de la région codant de la protéase et au-delà du codon 503 de la région codant de la polymérase (pol). The amplification of the region coding for the reverse transcriptase (RT) is carried out by means of the external primers MJ3 (AG'AGT ACC TAC ACC TGT CA 3 ') (Sequence SEQ ID No: 5, appended) and RT-EXT (5'TTC CCA ATG CAT ATT GTG AG 3 ') (Sequence SEQ ID No: 6, appended) and A35 internal primers (5'TTG GTT GCA TAA ATT TTC CCA TTA GTC CTA TT 3') (Sequence SEQ ID No: 7, in the appendix) and RT-IN (5'TCA ATG CAT ATT GTG AG 3 ') (Sequence SEQ ID No: 8, attached) with an initial cycle

at 500C (30 minutes) and 940C (2 minutes), followed by 40 cycles at 940C (30 seconds), 550C (30 seconds) and 680C (90 seconds) and a final step of extension at 980C for 10 minutes. This amplifies a 1530 bp product that extends beyond codon 93 of the protease coding region and beyond codon 503 of the polymerase (pol) coding region.

<Desc / Clms Page number 37>

The products thus obtained by PCR are purified on QuiaAmp columns and analyzed for size, degree of purity and approximate concentration by electrophoresis on agarose gels.

1. 2 - Genotyping The nucleotide sequences of the coding regions of the reverse transcriptase are determined by automatic sequencing of the termination of the dideoxinucleotide chain of the crude PCR products.

1. 3-plasmids
The HIV-1 molecular clones used in the assay method derive from pNL4-3.

 The reverse transcriptase-deleted plasmid was constructed by a modification of the mutated pNL4-3xc ~ env to carry unique SnaBI restriction sites at position 3872 and Nru I at position 3892.

 Ba I and SnaB I enzymes are used to remove the reverse transcriptase coding region (between positions 2618 and 2872) and linearization of the resulting plasmid pSRT is performed using the Nru I enzyme. Expression of the glycoprotein VSV-G envelope in the transfected cells is provided by the plasmid pVSV which contains the coding sequence vsv-g under the control of a CMV promoter.

 1. 4-Cell cultures.

 HeLa, 293 T and P4 cells are cultured in DMEM medium supplemented with 10% fetal calf serum (FCS). 50 IU / ml penicillin and 50 ua / ml of

<Desc / Clms Page number 38>

 streptomycin. The P4 cells are Hela-CD4, LTR-LacZ cells in which the expression of betagalactosidase is strictly inducible by the HIV transactivator Tat protein, thus allowing precise quantification of the infectivity or replicative capacity of the viruses. HIV-I based on a single replication cycle (Charneau, P., Mirambeau, G., Roux, P., Paulous, S., Buc, H. and Clavel, F. (1994) HIV-1 reverse transcription. Molecol 241 (5), 651-62.) The P4 cells are cultured in the presence of 500 μg / ml of geneticin.

 II.-Determination of Susceptibility of an HIV Virus to an Inverse Transcription Inhibitor.

(RTI).

 The determination of the susceptibility of an HIV virus to a reverse transcriptase inhibitor is carried out as follows: 293 T cells are transfected with 7.5 μg of NruI linearized plasmid pSRT, 0.1 μg of plasmid pVSV-G and 0.5 and 1 μg of the product from the PCR reverse transcription reaction of HIV. The transfection precipitate is removed from the cells after 18 hours of incubation and fresh growth medium is added. After 24 hours of culture, the supernatant is clarified by centrifugation (500 g, 15 minutes) and transferred to P4 indicator cells which have been pre-incubated with serial dilutions of a reverse transcriptase inhibitor, in triplicate wells, for four hours. The range of inhibitor concentrations used varies according to the compounds. The signal produced by the activation of the marker gene was developed with CPRG for 48 hours, as for the analysis of the susceptibility to an inhibitor

<Desc / Clms Page number 39>

 of reverse transcriptase and the ICgo index was calculated using the median effect equation.

 III-Optimization of the method of analysis to determine the susceptibility of an HIV virus to reverse transcriptase inhibitors.

 Plasmid pSRT carrying a deletion in the pol coding region from codon 24 of reverse transcriptase (base 2618) to codon 432 of reverse transcriptase (base 3872) includes all the mutations associated with a resistance phenomenon known to date. The homologous sequences of the reverse transcriptase product from PCR extend 88 base pairs upstream and 186 bases downstream of the deletion in pSRT. Transfections for determining susceptibility to reverse transcriptase inhibitors are performed with a 293T cell line having a high capacity to be transfected rather than with HeLa cells. This is not a problem because cells are removed from the virus containing supernate by centrifugation prior to P4 cell transfer.

 The transfer conditions are optimized using a chessboard test. The variation in the ratio of plasmid / product derived from PCR does not significantly alter the amount of p24 or reverse transcriptase produced or the rate of reaction with CPRG. Since the circular plasmid, pVSV-G appears to be extremely toxic to 293T cells, the amount thereof was reduced from 3 μg to 0.1 μg in the transfection mixture, resulting in high yields of p24 ( > 20 ng / ml compared to 9.8 ng / ml).

<Desc / Clms Page number 40>

 Since the early phases of virus replication, including reverse transcription, occur in indicator P4 cells in this type of determination, it is these cells that are treated with serial dilutions of reverse transcriptase inhibitors.

 The ranges of inhibitor concentration used are chosen according to the cellular toxicity of each compound and the IC 50 / IC 50 ratio for the susceptibility of resistant isolates (Table 1). For example, since the ICgo index for abacavir for P4 cells is about 250 μM whereas the ICso index for this compound for the native strain of the virus is about 3 μM, the detection of resistance is limited by toxicity. A series of four serial dilutions, starting at 200 μM, was used for abacavir, allowing the detection of up to 60 times more resistance.

 On the other hand, since the toxicity of AZT for P4 cells is high (> 300 μM) while the ICso value is considerably lower, a wider range of dilutions has been used (serial dilution 1/10 to from 5 μM) to allow detection of high levels of resistance (up to 100 times).

ICso est utilisé plutôt que l'indice IC,, car la détection de l'indice ICgo pour les virus résistants pourrait demander des niveaux de composé toxiques pour la plupart d'inhibiteurs de transcriptase inverse. For the reverse transcriptase RVA, the index

ICso is used rather than the ICI index, as the detection of the ICgo index for resistant viruses could require toxic compound levels for most reverse transcriptase inhibitors.

<Desc / Clms Page number 41>

TABLE 1: Susceptibility of NL4-3 reference virus to reverse transcriptase inhibitors (RTI).

<Tb>
<Tb>

<SEP> Concentrations in <SEP> Drugs
<tb> Medium <SEP> Susceptibility
<tb> Deviation
<tb> Inhibitors <SEP> used <SEP> Deflection
<tb> inhibitors <SEP> used <SEP> Deflection
<tb> geometric <SEP> detectable
<tb> of <SEP> RT <SEP> standard
<tb> IC50a <SEP> maximumb
<tb> Gamms / Stages <SEP> of <SEP> dilution
<tb> AZT <SEP> 50 <SEP> μM-5 <SEP> nM <SEP> 10 <SEP> x <SEP> 0, <SEP> 018 <SEP> μM <SEP> 2, <SEP> 7 <SEP > 2700
<tb> 3TC <SEP> 200 <SEP> - <SEP> 0.02 <SEP> M <SEP> 10 <SEP> x <SEP> 1, <SEP> 512 <SEP> uM <SEP> 2.2 <SEP> 130
<tb> D4T <SEP> 100 <SEP> - <SEP> 0.01 <SEP> M <SEP> 10 <SEP> x <SEP> 0, <SEP> 444 <SEP> uM <SEP> 2.7 <SEP> 220
<tb> DDI <SEP> 100 <SEP> - <SEP> 0.01 <SEP> M <SEP> 10 <SEP> x <SEP> 1, <SEP> 613 <SEP> uM <SEP> 2.5 <SEP> 60
<tb> Abacavir <SEP> 200-0, <SEP> 8 <SEP> μM <SEP> 4 <SEP> x <SEP> 2,229 <SEP> μM <SEP> 1,8 <SEP> 90
<tb> Effavirenz <SEP> 100-0, <SEP> 16 <SEP> nM <SEP> 5 <SEP> x <SEP> 0.716 <SEP> nM <SEP> 2.2 <SEQ> 140
<tb> Nevirapine <SEP> 50 <SEP> M <SEP> - <SEP> 5 <SEP> nM <SEP> 10 <SEP> x <SEP> 0.037 <SEP> uM2, <SEQ> 01300
<Tb>
geometric mean and standard deviation of 20 repeated tests for reverse transcriptase inhibitors. b-maximum approximate difference for the ICso and ICgo indices between NL43 and the tested virus that can be measured using the given drug concentration range

<Desc / Clms Page number 42>

The assay method for determining the susceptibility of the HIV virus to reverse transcriptase inhibitors provides a Standard Geometric Mean Deviation for 20 tests between 1.78 (abacavir) and 2.7 (D4T and AZT). The median standard deviation for the reverse transcriptase inhibitors (RTI) tested (AZT, 3TC, D4T, DDI, abacavir, efavirenz and nevirapine) is 2.2. In order to simplify the automatic interpretation of patient sample results, an arbitrary IR Index value of IR = 5 was defined as the minimum reduction in susceptibility to an ITR considered to be significantly reduced compared to NL43.

 To determine if NL43 is a suitable reference virus for comparison with clinical isolates, a panel of samples taken from patients with common treatment was tested on 3 RVA replicates for their susceptibility to reverse transcriptase inhibitors. the median ICso found for 22 viruses tested tended to be slightly higher than that found for NL43 with a median IR of around 0.92 (for stavudine) and 1.22 (lamivudine). Although IR is below the defined limit of 5 on total inhibitors for most tested samples, the range of IR appears broad, particularly for non-nucleoside inhibitors. In particular, a resistance index of 11.0 for nevirapine was obtained for a gold virus, this virus carried a mutation on the 98 (A for S) codon of reverse transcriptase, which had previously been implicated in the resistance to NNRTIs.

<Desc / Clms Page number 43>

IV-Reproducibility
The reproducibility of the method for determining the susceptibility of recombinant virus (RVA) to reverse transcriptase inhibitors (RTI) was evaluated by a series of tests on 5 samples, chosen to represent a wide range of susceptibility patterns, between 4 and 8 tests per sample, using RNA preparations and separate PCR reactions.

 The inter-assay variation for determining the susceptibility of HIV viruses to reverse transcriptase inhibitors indicates that in some cases there is a difference greater than 5 between the maximum IR and the minimum IR found for repeated determinations (Table 2). ), however, the standard deviation of the geometric mean is maintained = 2.2 in all cases except one (R4, AZT). In three of the samples, the IR obtained in repeat tests ranged from <5 to> 5 for those compounds for which viruses can be moderately resistant (IR no greater than 12).

<Desc / Clms Page number 44>

TABLE 2: Reproducibility of susceptibility to ITRs.

<Tb>
<Tb>

Sample <SEP> Index <SEP> of <SEP> Resistanceb
<tb> (Number <SEP> of <SEP> Genotypea
<tb> (Number <SEP> AZT <SEP> 3TC <SEP> D4T <SEP> DDI <SEP> Abacavir <SEP> Efavirenz <SEP> Nevirapine
<tb> tests)
<tb> MGc <SEP> 1, <SEP> 5 <SEP> 1, <SEP> 3 <SEP> 1, <SEP> 4 <SEP> 1.1 <SEP> 1.0 <SEP> 2.2
<tb> R1 <SEP> 69N / T. <SEP> 70B <SEP> SDd <SEP> 1, <SEP> 5 <SEP> 1, <SEP> 5 <SEP> 1.4 <SEP> 1, <SEP> 6 <SEP> 1, <SEP> 2 <SEP> 1, <SEP> 1 <SEP> 1, <SEP> 8
<tb> (6) <SEP> max / mine <SEP> 2, <SEP> 9 <SEP> 2, <SEP> 8 <SEP> 2, <SEP> 2 <SEP> 2, <SEP> 8 <SEP > 1, <SEP> 6 <SEP> 1, <SEP> 2 <SEP> 3.8
<tb>n> 4 / Nf <SEP> 0/6 <SEP> 0/6 <SEP> 0/6 <SEP> 0/6 <SEP> 0/6 <SEP> 0/6 <SEP> 0/6
<tb> 41L, <SEP> 62V, <SEP> 67N, <SEP> 69N, <SEP> MGc <SEP> 1232, <SEP> 6 <SEP>> f <SEP> 43, <SEP> 5 <SEP> 26, <SEP> 9 <SEP>><SEP> 74, <SEP> 9
<tb> R2 <SEP> 115F, 116Y, 151M, <SEQ> 181C, <SEP> SDd <SEP> 1.6 <SEP> na <SEP> 2.1 <SEP> 1.7 <SEP> na <SEP > 1,7
<tb> (6) <SEP> 115F, <SEP> 116Y, <SEP> 151M, <SEP> 81C, <SEP> max / mine <SEP> 3, <SEP> 8 <SEP> na <SEP> 8, 1 <SEP> 4.1 <SEP> na <SEP> 3.9 <SEP> na
<tb> 104V, <SEP> 190A
<tb>n> 4 / Nf <SEP> 6/6 <SEP> 6/6 <SEP> 6/6 <SEP> 6/6 <SEP> 6/6 <SEP> 6/6 <SEP> 6/6
<tb> 208Y, <SEQ> 215F, <SEP> 219Q
<tb> MGc <SEP> 13.2 <SEP>><SEP> 3.2 <SEP> 3.1 <SEP> 4.3 <SEP> 1.0 <SEP> 1,2
<tb> R3 <SEP> 184V. <SEP> 215F <SEP> SDd <SEP> 2.7 <SEP> na <SEP> 1.8 <SEP> 1.6 <SEP> 1.4 <SEP> 1.0 <SEP> 1, <SEP> 3
<tb> (6) <SEP> 184V, <SEP> 215F <SEP> max / mine <SEP> 8.9 <SEP> na <SEP> 5.7 <SEP> 3, <SEP> 3 <SEP> 2 , <SEP> 4 <SEP> 1, <SEP> 0 <SEP> 1, <SEP> 6
<tb>n> 4 / Nf <SEP> 5/6 <SEP> 1/6 <SEP> 1/6 <SEP> 1/6 <SEP> 4/6 <SEP> 0/6 <SEP> 0/6
<tb> MGc <SEP> 137.5 <SEP>><SEP> 3.6 <SEP> 3.0 <SEP> 6.1 <SEP> 149.8 <SEP>>
<tb> 41L, <SEP> 67N, <SEP> 69D, <SEP> 184V,
<tb> R4 <SEP> SDd <SEP> 1.8 <SEP> na <SEP> 2.0 <SEP> 1.3 <SEP> 1.6 <SEP> 1.6 <SEP> na
<tb> 190A,
<tb> (5) <SEP> max / mine <SEP> 4.5 <SEP> na <SEP> 4.1 <SEP> 1.7 <SEP> 3.3 <SEP> 3.9 <SEP> na
<tb> H208Y, <SEP> 210W, <SEP> 215Y
<tb>n> 4 / Nf <SEP> 5/5 <SEP> 5/5 <SEP> 3/5 <SEP> 5/5 <SEP> 3/5 <SEP> 5/5 <SEP> 5/5
<tb> MGc <SEP> 3.3 <SEP> 1.8 <SEP> 1.7 <SEP> 2.6 <SEP> 1.7 <SEP>><SEP> 580, <SEP> 5
<tb> R5 <SEP> 215Y, <SEQ> 41L, <SEP> 74V, <SEQ> 1001, <SEQ> SD <SEP> 1, <SEP> 6 <SEP> 1.7 <SEQ> 1.8 <MS> 1.6 <SEP> 1.6 <SEP> na <SEP> 1.8
<tb> (5) <SEP> 103N <SEP> max / mine <SEP> 3, <SEP> 0 <SEP> 3.7 <SEP> 3.7 <SEP> 2.5 <SEQ> 2.9 <SEP> na <SEP> 2,2
<tb>n> 4 / Nf <SEP> 1/5 <SEP> 0/5 <SEP> 0/5 <SEP> 0/5 <SEP> 0/5 <SEP> 5/5 <SEP> 5/5
<Tb>

<Desc / Clms Page number 45>

 (a) Only amino acid substitutions already known to be associated with resistance to reverse transcriptase inhibitors are indicated.

 (b) The Index of Resistance is the ratio of the ICso in the sample to that of NL43 determined in parallel.

 (c) Geometric mean.

 (d) Standard deviation of the geometric mean.

 (e) The highest resistance index obtained in the tests divided by the lowest.

 (f) The number of tests giving a resistance index> 4 classifying the virus as resistant / to the total number of tests carried out.

 (g) An ICso above the detectable range in all tests is indicated by>. In these cases, a standard deviation and a minimum / maximum are not applicable (na).

 The phenotypic results obtained for these reverse transcriptase inhibitors show a concordance with the genotypic profiles of the samples.

 Sample R2, which shows a high degree of resistance to all tested compounds, has multiple mutations including those of the multi-compound resistance complex (62V, 751, 77L, 116Y and 151M) which confers resistance to RTI nucleotides, 3TC resistance associated with the 184V mutation and mutations known to induce reduced susceptibility to NNRTIs (181C, 190A).

 Sample R3 shows a high resistance level at 3TC, again modulated by the 184V mutation, with considerable variation in IR for AZT

<Desc / Clms Page number 46>

 which probably reflects the inconsistent nature of the suppression of 215F resistance by 184V.

 In the R4 sample, such deletion is thwarted by the presence of multiple mutations including a 208Y mutation.

 Sample R5 remains AZT sensitive despite a 41L mutation and a 215Y mutation because of the effects of the 100r mutation which, in combination with 103N, is responsible for the high levels of resistance observed with efavirenz and nevirapine.

V-Validation of the analytical method to determine the susceptibility of an HIV virus to fusion inhibitors.

 The recombinations obtained by using for the amplification of step (b) the primer pair FuA: 5'AAGCAATGTATGCCCCTCCCAT3 '(SEQ ID No: 23) and FuB: 5' GGTGGTAGCTGAAGAGGCACAGG3 '(SEQ ID No: 24) followed by a second amplification, performed with the primer: FuC: 5'ATATGAGGGACAATTGGAGAAGTGA3 '(SEQ ID NO: 25) and a mixture of the following primers: FuD1: 5'TCTGTCTCTCTCTCCACCTTCTTCTT3' (SEQ ID No: 26) FuD2: 5'TCTGTCTTGCTCTCCACCTTCTTCTT3 ' (SEQ ID NO: 27) are very effective.

 Indeed, to obtain a satisfactory viral production it is generally sufficient to 10-50 ng of PCR product, used in the recombination step.

In this method for analyzing the phenotypic characteristic of fusion, a corresponding viral production at 50-400 ng / ml of p24 is obtained after transfection. For target cell infection, between 0.5 and 5 ng p24 / well (96-well plates) are used.

<Desc / Clms Page number 47>

The increase in optical density obtained after infection of target cells is linear if the infection is conducted under these conditions
In order to validate the method of analysis for the susceptibility of HIV viruses to fusion inhibitors, two fusion inhibitors were used: a peptide derived from the distal helix sequence in HIV gp41 (called DP178 or T20) and a betulinic acid derivative (RPR103611). For each inhibitor, the sensitivity reduction of one or more resistant viruses (previously identified by other authors) compared to two reference viruses: a primary plasma virus T5A1 and a virus adapted to in vitro culture (LAI) has been carried out. All viruses were produced recombinantly.

Results
V. Inhibitor DP178 or T20.

 The increase in IC50 for a highly resistant NL-DIM virus (described by Rimsky LT et al., J. Virol 1998, vol 72, pages 986-993) and for NL4.3 virus (which is partially resistant) were measured against this inhibitor.

 The highly resistant DIM virus shows an increase in the IC50 value of 80-fold over T5A1 and more than 100-fold compared with LAI.

caractérisé par une augmentation de l'IC50 de 10 fois par rapport à T5A1 et de 12, 5 fois par rapport a LAI. The partially resistant NL4.3 virus is

characterized by an increase of the IC50 by 10-fold with respect to T5A1 and by 12.5-fold with respect to LAI.

V. 2- Inhibitor RPR103611

<Desc / Clms Page number 48>

The increase of the IC50 of the LAI-L91H resistant virus (Labrosse B. et al J Virol 2000 vol 74 pages 2142-2150) with respect to this inhibitor was measured.

 For the LAI-L91H virus, the increase in ICSO over LAI and T5A1 is greater than 100-fold.

 VI-Optimization of the analytical method to determine the NEUTRALIZING CAPACITY of the HIV viruses.

NEU-C : 5'GTGGGTCACAGTCTATTATGGGG3' (SEQ ID No : 18) et un mélange des amorces FuD1 : 5'TCTGTCTCTCTCTCCACCTTCTTCTT3' (SEQ ID No : 26) et FuD2 : 5'TCTGTCTTGCTCTCCACCTTCTTCTT3' (SEQ ID No : 27) sont également très efficaces. The recombinations obtained using for the amplification of step (b) a pair of NEUA primers: 5'TAGAAAGAGCAGAAGACAGTGGCAATG3 '(SEQ ID No: 17) and FuB: 5'GGTGGTAGCTGAAGAGGCACAGG3' (SEQ ID No: 24), followed a second amplification, with the primers:

NEU-C: 5'GTGGGTCACAGTCTATTATGGGG3 '(SEQ ID NO: 18) and a mixture of primers FuD1: 5'TCTGTCTCTCTCTCCACCTTCTTCTT3' (SEQ ID No: 26) and FuD2: 5'TCTGTCTTGCTCTCCACCTTCTTCTT3 '(SEQ ID No: 27) are also very effective.

 Indeed, during viral production controls, it has been found that to obtain a satisfactory viral production it is generally sufficient to have 10-50 ng of PCR product, used in the recombination step.

 Corresponding viral production at 50-400 ng / ml of p24 after transfection is obtained. For target cell infection, between 0.5 and 5 ng p24 / well (96-well plates) are used. The increase in optical density obtained after infection of target cells is linear if the infection is conducted under these conditions

Claims (25)

1) A method for analyzing a phenotypic characteristic of the HIV viruses present in a biological sample of a patient, said phenotypic characteristic resulting from one or more mutations of the viral genome capable of influencing the viral infection, characterized in that it comprises: a) extraction of the nucleic acids contained in said biological sample, b) at least one PCR amplification of a segment of the nucleic acids of step (a), each with a pair of primers surrounding a nucleic acid sequence of the viral genome encoding the envelope and capable of carrying at least one mutation; c) the preparation of a vector comprising the parts of a genome of an HIV virus necessary for viral replication at the except for the segment amplified in step (b) and possibly with the exception of the gene coding for the envelope protein, d) the transfection of a first cellular host with: the nucleic acids obtained at the step (b), - the vector prepared in step (c), - optionally a second vector comprising a gene coding for an envelope protein if the envelope gene is deleted from the vector prepared in step (c) to obtain a chimeric virus by homologous recombination; e) culturing said first cellular host under conditions that make it possible to produce virus particles during a single replication cycle, <Desc / Clms Page number 50>  f) the infection with the viral particles obtained in step (e) of at least one second cellular host likely to be infected with an HIV virus or an HIV pseudotyped virus and optionally comprising an activatable marker gene only after g) the detection and / or quantification of the marker expressed in step (f) in order to demonstrate at least one characteristic of the HIV viruses present in the biological sample.  2) The method of analysis according to claim 1, characterized in that the PCR amplification of step (b) is carried out with a pair of primers flanking a nucleic acid sequence capable of carrying at least one mutation in the gene coding for the envelope protein, and in that the vector of step (c) is a retroviral vector constructed from a genome of an HIV virus in which all or part of the gene encoding the envelope is deleted.  3) Method of analysis according to claims 1 or 2, characterized in that the vector of step (c) is a retroviral vector deleted the entire region coding for the extracellular portion of the subunit gp41 of the envelope of HIV-1, ranging from residues 7745 to 8263 inclusive, of the region of the HIV-1 genome that constitues the Rev response element (RRE).  4) Method of analysis according to claims 1 to 3, characterized in that the amplification of step (b) is carried out with a pair of primers: <Desc / Clms Page number 51> FIN-D: 5'TCCACCTTCTTCTTCGATT3 '(SEQ ID NO: FIN-C: 5'CTATTAACAAGAGATGGTGG3 '(SEQ ID NO: 15) and FIN-B: 5'TAGCTGAAGAGGCACAGG3 '(SEQ ID NO: 14) followed by a second amplification step, performed with the primer pair: FIN-A: 5'TCAAATATTACAGGGCTGCT3 '(SEQ ID NO: 13) and  16), to obtain a 965 base pair DNA segment extending residues 7553 to 8517 inclusive and that the vector of step (c) is a retroviral vector deleted from the entire coding region for the portion extracellularly of the gp41 subunit of the HIV-1 envelope, extending from residues 7745 to 8263 inclusive, and has a unique restriction site Mull.  5) Method of analysis according to claims 1 to 3, characterized in that the amplification of step (b) with a pair of primers surrounding a nucleic acid sequence capable of carrying at least one mutation in the gene coding for the coat protein is carried out with a pair of primers: FuA: 5'AAGCAATGTATGCCCCTCCCAT3 '(SEQ ID NO: 23) and FuB: 5'GGTGGTAGCTGAAGAGGCACAGG3 '(SEQ ID NO: 24) followed by a second amplification step, performed with the primer: FuC: 5'ATATGAGGGACAATTGGAGAAGTGA3 '(SEQ ID NO: 25)

 and a mixture of the following primers: FuD1: 5'TCTGTCTCTCTCTCCACCTTCTTCTT3 '(SEQ ID No: 26) <Desc / Clms Page number 52>  performed in a ratio between (10%: 90%) and (90%: 10%) and most preferably between (60%: 40%) and (40%: 60%), to obtain a DNA segment of 805. base pairs extending residues 7635 to 8440 inclusive and the vector of step (c) is a retroviral vector deleted from the entire region encoding the extracellular portion of the gp41 subunit of the HIV-1 envelope , extending from residues 7745 to 8263 inclusive, and has a unique restriction site Mull.

FuD2: 5'TCTGTCTTGCTCTCCACCTTCTTCTT3 '(SEQ ID NO: 27), said mixture being preferentially  6) Method of analysis according to claims 1 to 3, characterized in that the amplification of step (b) is carried out with a pair of primers: NEU-A: 5'TAGAAAGAGCAGAAGACAGTGGCAATG3 '(SEQ ID NO: 17) and FIN-B: 5'TAGCTGAAGAGGCACAGG3 '(SEQ ID NO: 14), followed by a second amplification step, with the primer pair: NEU-C: 5'GTGGGTCACAGTCTATTATGGGG3 '(SEQ ID NO: 18) and FIN-D: 5'TCCACCTTCTTCTTCGATT3 '(SEQ ID NO: 16), to obtain a 2320 base pair DNA fragment extending residues 6197 to 8517 inclusive and in that the vector of step (c) is a deleted retroviral vector of the entire region encoding the majority of the gp120 subunit and the extracellular portion of gp41 of the HIV-1 envelope, <Desc / Clms Page number 53>  extending from residues 6480 to 8263 inclusive, and has a unique restriction site Mlul.  7) Method of analysis according to claims 1 to 3, characterized in that the amplification of step (b) with a pair of primers surrounding a nucleic acid sequence capable of carrying at least one mutation in the gene encoding for the coat protein is performed with a pair of primers: NEU-A: 5'TAGAAAGAGCAGAAGACAGTGGCAATG3 '(SEQ ID No: 17) and FuB: 5'GGTGGTAGCTGAAGAGGCACAGG3 '(SEQ ID No: 24), followed by a second amplification step, with the primers: NEU-C: 5'GTGGGTCACAGTCTATTATGGGG3 '(SEQ ID No: 18) and a mixture of primers FuDl: 5'TCTGTCTCTCTCTCCACCTTCTTCTT3 '(SEQ ID No: 26) and FuD2: 5'TCTGTCTTGCTCTCCACCTTCTTCTT3 '(SEQ ID No: 27), said mixture being preferentially

 performed in a ratio between (10%: 90%) and (90%: 10%) and most preferably between (60%: 40%) and (40%: 60%), to obtain a 2118 DNA fragment. base pairs extending residues 6322 to 8440 inclusive and the vector of step (c) is a retroviral vector deleted from the entire region coding for the majority of the gp120 subunit and the extracellular portion of the gp41 of the envelope of HIV-1, ranging from residues 6480 to 8263 inclusive, and has a unique restriction site Mull. <Desc / Clms Page number 54>  8) Method of analysis according to claims 1 to 3, characterized in that the amplification of step (b) is carried out with a pair of primers: EOO: 5'TAGAAAGAGCAGAAGACAGTGGCAATGA3 '(SEQ ID NO: 19) and ES8B: 5'CACTTCTCCAATTGTCCCTCA3 '(SEQ ID NO: 20), followed by a second amplification step, with the primer pair: E20: 5'GGGCCACACATGCCTGTGTACCCACAG3 '(SEQ ID NO: 21) and E115: 5'AGAAAAATTCCCCTCCACAATTAA3 '(SEQ ID NO: 22), to obtain a 938 base pair DNA segment extending from residues 6426 to 7364 inclusive and in that the vector of step (c) is a retroviral vector deleted from the region, encoding domains ranging from V1 loop to V3 loop of HIV-1 envelope extending from 6617 to 7250 inclusive and has a unique NheI restriction site.  9) A method of analysis according to claims 1 to 8, consisting in determining the susceptibility of an HIV virus to a fusion inhibitor compound targeting the gp41 protein of HIV-1, characterized in that said inhibiting compound of melting, optionally at different concentrations, during the cell host culture obtained in step (e), before step (f) and in that step (g) comprises comparing the expression of the marker gene with and without a fusion inhibitor compound targeting HIV-1 gp41.  10) Analysis method according to claims 1 to 8, consisting in determining the susceptibility of a <Desc / Clms Page number 55>  HIV virus to an input inhibiting compound of said HIV virus in a target cell, characterized in that said input inhibitor compound, optionally at different concentrations, is added to the cell host obtained in step (e). ) before the infection of step (f) and in that step (g) comprises comparing the expression of the marker gene with and without entry inhibiting compound.  11) Method of analysis according to claims 1 to 8, consisting in determining the susceptibility of an HIV virus to the inhibitory action of the antibodies, characterized in that said method is carried out, on the one hand without antibodies and on the other hand alternatively with the antibody, optionally at different concentrations, said antibody being present in step (e), and in that step (g) comprises comparing the expression of the marker gene with and without antibodies.  12) Method of analysis according to claims 1 to 8, of determining the tropism of an HIV virus for a cellular receptor, characterized in that the infection of step (f) with the viral particles obtained at the step (e) is performed on two distinct cell hosts and step (g) comprises comparing the expression of the marker gene by each of two distinct cellular hosts.  13) The method of analysis of claim 12, characterized in that one of two infected cell hosts in step (f) expresses the CCR5 receptor and the other expresses the CXCR4 receptor. <Desc / Clms Page number 56>  14) A method of analysis according to claims 1 to 8, of determining the susceptibility of an HIV virus to an inhibitory compound targeting the co-receptors of HIV-1, characterized in that one adds or not said inhibitor compound targeting the co-receptors of HIV-1, possibly at different concentrations, during step (e) of culture, in that the infection of step (f) is carried out on two distinct cellular hosts and in that the step ( g) comprises comparing the expression of the marker gene by each of the two distinct cellular hosts.  15) A method of analysis according to claims 1 to 8, comprising analyzing the susceptibility of an HIV virus to an inhibitory compound targeting the co-receptors of HIV-1, characterized in that said inhibitory compound targeting the coreceptors of HIV-1 is added. HIV-1, possibly at different concentrations, during the culture of step (d), in that the infection of step (f) with the viral particles obtained in step (e) is carried out on two distinct cell hosts and that step (g) comprises comparing the expression of the marker gene by each of the two distinct cell hosts.  16) A method of analysis according to any one of claims 1 to 15, of determining the infectivity or replicative capacity of an HIV virus characterized in that step (g) comprises comparing the expression of the marker gene by the second cell host infected with the viral particles obtained by applying steps (a) to (f) to a biological sample of a patient, and the expression of the marker gene by the same second infected cell host <Desc / Clms Page number 57>  with the reference viral particles obtained by applying steps (a) to (f) to a sample containing a reference virus.  17) The method of analysis according to claim 16, characterized in that the viral reference particles derived from a reference virus are viral particles obtained by applying steps (a) to (f) to a biological sample of same patient at or prior to the therapeutic treatment.  18) Method of analysis according to claims 1 to 15, of determining the susceptibility of an HIV virus to hydroxyurea, characterized in that hydroxyurea is added or not, optionally at different concentrations, or during step (e) of culture, that is to say the second cellular host, before the infection thereof in step (f) and in that step (g) comprises the comparison of the expression of the gene marker with and without hydroxyurea.  19) Method of analysis according to any one of claims 1 to 18, characterized in that the step (e) of culture is carried out for a period of 12 hours to 72 hours, preferably 24 hours to 48 hours .  20) A kit for carrying out a method according to any one of claims 1 to 19, characterized in that it comprises: i) a pair of primers flanking a nucleic acid sequence of the viral genome coding for the envelope likely to carry at least one mutation, <Desc / Clms Page number 58>  ii) a vector comprising the parts of a genome of an HIV virus necessary for viral replication except for the segment amplified with the primers defined in (i) and the gene coding for the envelope protein, iii) a second vector comprising a gene coding for an envelope protein, iv) a first cellular host capable of being infected with an HIV virus, v) a second cellular host capable of being infected with an HIV virus and comprising an activatable marker gene only after viral infection, vi) the products and reagents necessary to carry out the amplification by PCR, vii) the products and reagents allowing the detection of the expressed marker.  21) A kit according to claim 20, characterized in that it comprises: i) the primer pairs of sequences - SEQ ID No: 13 and SEQ ID No: 14 - SEQ ID No: 15 and SEQ ID No: 16 ii) a retroviral vector deleted from the entire region coding for the extracellular portion of the gp41 subunit of the HIV-1 envelope, extending from residues 7745 to 8263 inclusive, and having a unique restriction site Mull, iv ) a first cellular host likely to be infected by an HIV virus, v) a second cellular host likely to be infected with an HIV virus and having a gene <Desc / Clms Page number 59>  activable marker only following viral infection, vi) the products and reagents necessary to carry out the amplification by PCR, vii) the products and reagents allowing the detection of the expressed marker.  22) A kit according to claim 20, characterized in that it comprises: i) primer pairs of sequences - SEQ ID No: 23 and SEQ ID No: 24 - SEQ ID No: 25 and SEQ ID No: 26 with SEQ ID No: 27 ii) a retroviral vector deleted from the entire region coding for the extracellular portion of the gp41 subunit of the HIV-1 envelope, extending from residues 7745 to 8263 inclusive, and having a unique restriction site Mull iv) a first cell host likely to be infected with an HIV virus; v) a second cellular host capable of being infected with an HIV virus and having an activatable marker gene only following the viral infection; vi) the products and reagents necessary to carry out the amplification by PCR, vii) the products and reagents allowing the detection of the expressed marker.  23) A kit according to claim 20, characterized in that it comprises: i) primer pairs of sequences - SEQ ID No: 17 and SEQ ID No: 14 - SEQ ID No: 18 and SEQ ID No: 16 <Desc / Clms Page number 60>  ii) a retroviral vector deleted from the entire region coding for the majority of the gp120 subunit and the extracellular portion of the gp41 of the HIV-1 envelope, extending from residues 6480 to 8263 inclusive, and comprising a Mull unique restriction site, iv) a first cell host capable of being infected with an HIV virus, v) a second cellular host capable of being infected with an HIV virus and comprising a marker gene activatable solely by viral particles, vi ) the products and reagents necessary to carry out the amplification by PCR, vii) the products and reagents allowing the detection of the expressed marker.  24) A kit according to claim 20, characterized in that it comprises: i) primer pairs of sequences - SEQ ID No: 17 and SEQ ID No: 24 - SEQ ID No: 18 and SEQ ID No: 26 and SEQ ID No: 27 ii) a retroviral vector deleted from the entire region coding for the majority of the gp120 subunit and the extracellular portion of gp41 of the HIV-1 envelope, extending residues 6480 to 8263 inclusive, and having a unique Mull restriction site, iv) a first cell host capable of being infected with an HIV virus, v) a second cellular host capable of being infected with an HIV virus and having a marker gene activatable only by particles vi) the products and reagents necessary to carry out PCR amplification, <Desc / Clms Page number 61>  vii) products and reagents for the detection of the expressed marker.  25) A kit according to claim 20, characterized in that it comprises: i) primer pairs of sequences - SEQ ID No: 19 and SEQ ID No: 20 - SEQ ID No: 21 and SEQ ID No: 22 ii) a retroviral vector deleted from the region, coding for domains ranging from the VI loop to the V3 loop of the HIV-1 envelope extending from 6617 to 7250 inclusive and comprising a unique restriction site NheI, iv) a first cellular host likely to be infected by an HIV virus, v) a second cellular host likely to be infected with an HIV virus and having an activatable marker gene only following the viral infection, vi) the products and reagents necessary to carry out the amplification by PCR, vii) the products and reagents allowing the detection of the expressed marker.