FR2813612A1 - USE OF IP3 KINASES FOR THE PREPARATION OF NEW DRUGS IP3 KINASES AND CORRESPONDING DNA SEQUENCES - Google Patents

USE OF IP3 KINASES FOR THE PREPARATION OF NEW DRUGS IP3 KINASES AND CORRESPONDING DNA SEQUENCES Download PDF

Info

Publication number
FR2813612A1
FR2813612A1 FR0011397A FR0011397A FR2813612A1 FR 2813612 A1 FR2813612 A1 FR 2813612A1 FR 0011397 A FR0011397 A FR 0011397A FR 0011397 A FR0011397 A FR 0011397A FR 2813612 A1 FR2813612 A1 FR 2813612A1
Authority
FR
France
Prior art keywords
sep
seq
sequence
nucleotide
sequence seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
FR0011397A
Other languages
French (fr)
Inventor
Herve Tricoire
Veronique Monnier
Anne Marie Pret
Denise Emmanuelle Cabet Busson
Jeannine Brissard Zahraoui
Patricia Vandurka
Fabrice Girardot
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Original Assignee
Centre National de la Recherche Scientifique CNRS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS filed Critical Centre National de la Recherche Scientifique CNRS
Priority to FR0011397A priority Critical patent/FR2813612A1/en
Priority to AU2001289981A priority patent/AU2001289981A1/en
Priority to PCT/FR2001/002708 priority patent/WO2002020742A1/en
Publication of FR2813612A1 publication Critical patent/FR2813612A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00—General protective or antinoxious agents
    • A61P39/06—Free radical scavengers or antioxidants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Abstract

.The invention concerns the use of proteins comprising or consisting of the sequences SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, for preparing medicines for treating diseases related to oxidative stress or to endoplasmic reticulum stress, or neurodegenerative disorders, in particular retinal.

Description

<Desc/Clms Page number 1> <Desc / Clms Page number 1>

UTILISATION D'IP3 KINASES POUR LA PREPARATION DE MEDICAMENTS, NOUVELLES IP3 KINASES ET SEQUENCES D'ADN CORRESPONDANTES
L'invention concerne l'utilisation d'IP3 kinases pour la préparation de médicaments. L'invention concerne également de nouvelles IP3 kinases et les séquences d'ADN correspondantes. USE OF IP3 KINASES FOR THE PREPARATION OF MEDICAMENTS, NEW IP3 KINASES AND CORRESPONDING DNA SEQUENCES
The invention relates to the use of IP3 kinases for the preparation of medicaments. The invention also relates to novel IP3 kinases and corresponding DNA sequences.

Les inositols phosphates et particulièrement IP3 (Ins (1,4,5) P3) ont été reconnus depuis longtemps comme des acteurs majeurs pour le contrôle des flux calciques cellulaires. IP3 se fixe sur des récepteurs IP3 (IP3R) présents dans la membrane du réticulum endoplasmique et une partie des stocks de calcium contenus dans le réticulum endoplasmique est libérée puis déversée dans le cytoplasme (Patel et al., 1999).  Inositol phosphates and particularly IP3 (Ins (1,4,5) P3) have long been recognized as major players in the control of cellular calcium fluxes. IP3 binds to IP3 receptors (IP3R) present in the endoplasmic reticulum membrane and some of the calcium stocks in the endoplasmic reticulum are released and released into the cytoplasm (Patel et al., 1999).

Les IP3 kinases sont des enzymes susceptibles de catalyser la réaction suivante :
ATP + ID-myo-inositol 1,4,5 triphosphate # ADP + ID-myo-inositol 1,3,4,5 tetrakisphosphate
L'IP3 kinase (IP3K) phosphoryle IP3 en inositol tetrakiphosphate IP4 (Ins (1,3,4,5) P4). IP3K agit probablement à la fois en modifiant le niveau d'IP3 mais aussi en produisant un autre second messager IP4 dont le rôle fonctionnel est encore mal connu (Fukuda et al., 1997 ; Irvine et al., 1999) : il se fixe sur une protéine de la membrane cellulaire (protéine GAP1). La diminution de la concentration de IP3 induit une diminution de l'activité du récepteur IP3R. IP3 kinases are enzymes that can catalyze the following reaction:
ATP + ID-myo-inositol 1,4,5 triphosphate # ADP + ID-myo-inositol 1,3,4,5 tetrakisphosphate
IP3 kinase (IP3K) phosphorylates IP3 to inositol tetrakiphosphate IP4 (Ins (1,3,4,5) P4). IP3K probably works both by modifying the level of IP3 but also by producing another second IP4 messenger whose functional role is still poorly understood (Fukuda et al., 1997, Irvine et al., 1999): it is fixed on a protein of the cell membrane (GAP1 protein). Decreasing the concentration of IP3 induces a decrease in IP3R receptor activity.

Chez la Drosophile, IP3R est exprimé dans les tissus musculaires et nerveux.  In Drosophila, IP3R is expressed in muscle and nerve tissues.

L'absence du gène est létale. Son rôle est encore mal connu ; il est impliqué dans le déclenchement des métamorphoses larvaires mais pourrait l'être aussi dans le contrôle des processus neurosensoriels et dans le développement du muscle. The absence of the gene is lethal. His role is still poorly understood; it is involved in the triggering of larval metamorphoses but could also be involved in the control of neurosensory processes and in the development of muscle.

Chez C.elegans, une mutation perte de fonction dans IP3K conduit à la suppression du phénotype de stérilité, indépendant de la voie ras, observé dans des mutants lin3- (EGF). Un gain de fonction de IP3K conduit a contrario à un défaut de contraction et de dilatation de la spermathèque lors du passage des ovules et à une stérilité associée (Clandinin et al., 1998).  In C. elegans, a loss of function mutation in IP3K leads to the suppression of the sterility phenotype, independent of the ras pathway, observed in lin3- (EGF) mutants. A gain in function of IP3K leads to a contrario deficiency of contraction and dilation of the spermatheca during egg passage and associated sterility (Clandinin et al., 1998).

Le rôle fonctionnel mais aussi la spécificité des isoformes des IP3K chez les vertébrés sont encore mal connus. Cependant, plusieurs articles décrivent le clonage des kinases humaines IP3K-A, IP3K-B et IP3K-C (Takazawa et al., 1991 ; et al., 1991 et Communi et al., 1999).  The functional role but also the specificity of isoforms of IP3K in vertebrates are still poorly understood. However, several articles describe the cloning of human kinases IP3K-A, IP3K-B and IP3K-C (Takazawa et al., 1991, et al., 1991 and Communi et al., 1999).

La référence Jun et al. (1998) concerne le rôle de l'IP3K-A chez la souris. D'après cet article, un résultat récent obtenu sur la souris prouve que l'IP3K-A joue un rôle important dans les neurones. Ceux-ci ont un grand nombre de récepteurs IP3 et les  The reference Jun et al. (1998) concerns the role of IP3K-A in mice. According to this article, a recent result obtained on the mouse proves that IP3K-A plays an important role in neurons. These have a large number of IP3 receivers and

<Desc/Clms Page number 2><Desc / Clms Page number 2>

stocks de Ca2+ jouent un grand rôle dans la potentiation ou la dépression à long terme (LTP ou LTD). Chez la souris, le récepteur IP3 de type 1 est la forme neuronale majeure exprimée dans les cellules de Purkinje, la région CA1 de l'hippocampe, le noyau caudé et le cortex. Dans le développement de la souris, de hauts niveaux d'IP3Rl sont corrélés avec des tissus subissant l'apoptose. L'absence totale de ce gène conduit à une mort prématurée, souvent in utero, et à une sévère ataxie accompagnée de crises épileptiques.  Ca2 + stocks play a big role in long-term potentiation or depression (LTP or LTD). In mice, the type 1 IP3 receptor is the major neuronal form expressed in Purkinje cells, the CA1 region of the hippocampus, the caudate nucleus and the cortex. In mouse development, high levels of IP3R1 are correlated with tissues undergoing apoptosis. The complete absence of this gene leads to premature death, often in utero, and severe ataxia accompanied by epileptic seizures.

L'IP3K-B existe dans deux pools intracellulaires : l'un cytosolique, l'autre lié fortement au réseau étendu du réticulum endoplasmique et colocalisé avec rab2 (Soriano et al., 1997). Le domaine catalytique fait face au cytosol et l'association à la membrane dépend d'interactions protéine-protéine.  IP3K-B exists in two intracellular pools: one cytosolic, the other tightly bound to the extensive network of endoplasmic reticulum and colocalized with rab2 (Soriano et al., 1997). The catalytic domain faces the cytosol and the association with the membrane depends on protein-protein interactions.

En réponse à l'activation de récepteurs muscariniques dans les astrocytes, les
IP3K-A et B sont activées par la phosphorylation de la Cam kinase II (calcium calmoduline dépendante) (Communi et al., 1997 et 1999). L'IP3K-B est aussi activée par la phosphorylation de la PKC (Communi et al., 1999). In response to the activation of muscarinic receptors in astrocytes,
IP3K-A and B are activated by phosphorylation of Cam kinase II (calmodulin-dependent calcium) (Communi et al., 1997 and 1999). IP3K-B is also activated by phosphorylation of PKC (Communi et al., 1999).

Le stress oxydatif est lié à la génération par les organismes aérobies d'espèces oxygénées réactives (EOR) qui peuvent provoquer des dommages intracellulaires en modifiant des macromolécules telles que les lipides, les protéines et l'ADN. Le site principal de production de ces EOR et notamment de 02 au cours de la respiration est la mitochondrie (Lenaz, 1998). H202 est généré par la conversion de 02' et par le métabolisme des lipides dans les peroxysomes. Puis 02- peut réagir avec H202, via une réaction de Haber-Weiss catalysée par les métaux, pour former le composé très réactif
OH'. Oxidative stress is related to the generation by aerobic organisms reactive oxygen species (ROS) that can cause intracellular damage by modifying macromolecules such as lipids, proteins and DNA. The main site of production of these EORs including 02 during respiration is mitochondria (Lenaz, 1998). H202 is generated by 02 'conversion and lipid metabolism in peroxisomes. Then 02- can react with H2O2, via a metal-catalyzed Haber-Weiss reaction, to form the highly reactive compound
OH'.

Les organismes ont développé de nombreuses défenses antioxydantes sous la forme d'enzymes comme les superoxydes dismutases et les catalases et sous la forme de composés antioxydants. Mais ces défenses sont parfois inefficaces lors d'états pathologiques ce qui entraîne des dommages cellulaires. Ainsi les EOR ont été impliqués dans de nombreux processus pathologiques tels que les maladies cardiovasculaires, les processus inflammatoires et les maladies neurodégénératives.  The organisms have developed numerous antioxidant defenses in the form of enzymes such as superoxide dismutases and catalases and in the form of antioxidant compounds. But these defenses are sometimes ineffective in pathological states resulting in cellular damage. EORs have been implicated in many pathological processes such as cardiovascular diseases, inflammatory processes and neurodegenerative diseases.

Comme la surexpression des enzymes de détoxication protègent les cellules des effets délétères du stress oxydatif ainsi que, dans certains paradigmes, les animaux, ces enzymes ont été proposées comme outils thérapeutiques dans plusieurs pathologies (Ames et al., 1993 ; Gate et al., 1999; Ruef et al., 1999; Patel and Day, 1999).  As the overexpression of the detoxification enzymes protects the cells from the deleterious effects of oxidative stress and, in some paradigms, animals, these enzymes have been proposed as therapeutic tools in several pathologies (Ames et al., 1993, Gate et al. 1999, Ruef et al., 1999, Patel and Day, 1999).

Néanmoins les résultats thérapeutiques sont limités, probablement du fait de la perméabilité limitée des cellules à ces molécules de grande taille. D'autres composés antioxydants tels les métalloporphyrines ont été développés et ont prouvé leur efficacité dans certains protocoles animaux (Patel and Day, 1999). Cependant, cette efficacité est très variable et ces composés ne passent pas la barrière hématoencéphalique. De plus, une des difficultés de mise en #uvre d'une détoxication directe des radicaux libres par  Nevertheless, the therapeutic results are limited, probably because of the limited permeability of the cells to these large molecules. Other antioxidant compounds such as metalloporphyrins have been developed and have proven effective in certain animal protocols (Patel and Day, 1999). However, this efficacy is highly variable and these compounds do not pass the blood-brain barrier. Moreover, one of the difficulties of implementing a direct detoxification of free radicals by

<Desc/Clms Page number 3><Desc / Clms Page number 3>

surexpression d'enzymes de détoxication vient du fait que ces composants jouent aussi un rôle de second messager dans la cellule où ils sont utilisés dans de nombreux processus normaux (Remacle et al., 1995 ; Morel et al., 1999).  Overexpression of detoxification enzymes is due to the fact that these components also play a role of second messenger in the cell where they are used in many normal processes (Remacle et al., 1995, Morel et al., 1999).

Un autre type de stress impliqué dans de nombreuses maladies est le stress du réticulum endoplasmique (RE), qui a été très étudié chez la levure, où une voie génétique majeure, le stress UPR (unfolded protein response) a été mise en évidence (Kaufman, 1999). Le stress UPR est déclenché par la baisse du Ca2+ dans le RE, l'accumulation de protéines mal repliées ou la diminution du glucose.  Another type of stress involved in many diseases is the stress of the endoplasmic reticulum (ER), which has been extensively studied in yeast, where a major genetic pathway, UPR (unfolded protein response) stress has been demonstrated (Kaufman , 1999). UPR stress is triggered by the decrease of Ca2 + in ER, the accumulation of misfolded proteins or the decrease of glucose.

La réponse au stress UPR induit la production de chaperonnes résidentes du RE, notamment GRP78 ou la calciréticuline. Chez l'homme, des altérations dans cette voie sont susceptibles de conduire à de nombreuses pathologies ; si ce stress est trop important, cela entraîne la mort de la cellule.  The UPR stress response induces the production of resident ER chaperones, including GRP78 or calcireticulin. In humans, alterations in this way are likely to lead to many pathologies; if this stress is too important, it causes the death of the cell.

On a récemment mis en évidence l'implication du stress du réticulum endoplasmique dans les maladies neurodégénératives et la possibilité de les combattre par suractivation de la réponse UPR.  The involvement of endoplasmic reticulum stress in neurodegenerative diseases has recently been demonstrated and the possibility of controlling them by overactivation of the UPR response.

Ainsi, il a été montré en culture de cellules que la réponse au stress UPR est réduite dans des mutants de la présélinine-1, qui correspondent aux plus fréquentes anomalies génétiques mises en évidence dans la maladie d'Alzheimer (Katayama et al., 1999). Par ailleurs des niveaux de GRP78 réduits sont observés dans les cerveaux de patients atteints de la maladie d'Alzheimer, le niveau de GRP78 étant corrélé avec la sévérité de la pathologie. Enfin, dans un modèle de Drosophile de neurodégénérescence induite par une forme mutante poly-glutamine de la protéine humaine impliquée dans l'ataxie spinocérébelleuse de type 3, il a été montré in vivo que la surexpression de la chaperonne HSP70 du RE provoque une forte réduction des phénotypes de neurodégénérescence (Warrick et al., 1999).  Thus, it has been shown in cell culture that the stress response UPR is reduced in mutants of preselinin 1, which correspond to the most frequent genetic abnormalities found in Alzheimer's disease (Katayama et al., 1999 ). Moreover, reduced levels of GRP78 are observed in the brains of patients with Alzheimer's disease, the level of GRP78 being correlated with the severity of the pathology. Finally, in a Drosophila model of neurodegeneration induced by a poly-glutamine mutant form of the human protein involved in spinocerebellar ataxia type 3, it has been shown in vivo that overexpression of the HSP70 chaperone of ER causes a strong reduction. neurodegeneration phenotypes (Warrick et al., 1999).

L'invention a pour objet de nouvelles protéines IP3 kinases et leurs séquences d'ADN correspondantes.  The subject of the invention is novel IP3 kinase proteins and their corresponding DNA sequences.

L'invention a également pour objet l'utilisation de protéines IP3 kinases, notamment dans le cadre de la résistance au stress oxydatif et au stress du réticulum endoplasmique.  The subject of the invention is also the use of IP3 kinase proteins, particularly in the context of the resistance to oxidative stress and to the stress of the endoplasmic reticulum.

L'invention a également pour objet l'utilisation de protéines IP3 dans le cadre du traitement des maladies neurodégénératives, notamment rétiniennes.  The subject of the invention is also the use of IP3 proteins in the context of the treatment of neurodegenerative diseases, in particular retinal diseases.

L'invention a également pour objet l'utilisation des séquences d'ADN codant pour les protéines IP3 kinases pour l'obtention d'animaux transgéniques non humains surexprimant l'une des nouvelles protéines IP3 kinases.  The invention also relates to the use of the DNA sequences coding for the IP3 kinase proteins for obtaining non-human transgenic animals overexpressing one of the new IP3 kinase proteins.

L'invention a également pour objet l'utilisation des séquences d'ADN codant pour les protéines IP3 kinases pour l'obtention d'animaux transgéniques non humains,  The subject of the invention is also the use of the DNA sequences coding for the IP3 kinase proteins for obtaining non-human transgenic animals,

<Desc/Clms Page number 4><Desc / Clms Page number 4>

dans lesquels on a supprimé l'expression du gène codant pour l'une des nouvelles protéines IP3 kinases.  in which the expression of the gene coding for one of the new IP3 kinase proteins was deleted.

L'invention concerne l'utilisation de protéines comprenant ou constituées par : - les séquences SEQ ID NO : 2, SEQ ID NO : 4, SEQ ID NO : 5, SEQ ID
NO : 6 ou SEQ ID NO : 7, - ou toute séquence dérivée des séquences SEQ ID NO : 2, SEQ ID
NO : 4, SEQ ID NO : 5, SEQ ID NO : 6 ou SEQ ID NO : 7, notamment par substitution, suppression ou addition d'un ou plusieurs acides aminés, sous réserve qu'elle possède une activité IP3 kinase, - toute séquence homologue des séquences SEQ ID NO: 2, SEQ ID
NO : 4, SEQ ID NO : 5, SEQ ID NO : 6 ou SEQ ID NO : 7, ayant de préférence une homologie d'au moins environ 50% avec les régions comprises entre les acides aminés en position (159) à (441), (360) à (669), (187) à (461), (195) à (472) et (331) à (604) des séquences SEQ ID NO : 2, SEQ ID NO : 4, SEQ ID
NO : 5, SEQ ID NO : 6 ou SEQ ID NO : 7 respectivement, sous réserve qu'elle possède une activité IP3 kinase, - ou tout fragment d'au moins environ 250 acides aminés contigus de l'une des séquences ci-dessus, sous réserve qu'il possède une activité IP3 kinase, pour la préparation de médicaments destinés au traitement de maladies liées au stress oxydatif ou au stress du réticulum endoplasmique, ou de maladies neurodégénératives, notamment rétiniennes. The invention relates to the use of proteins comprising or consisting of: the sequences SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID
NO: 6 or SEQ ID NO: 7, - or any sequence derived from SEQ ID NO: 2, SEQ ID
NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, in particular by substitution, deletion or addition of one or more amino acids, provided that it has an IP3 kinase activity, - any homologous sequence of the sequences SEQ ID NO: 2, SEQ ID
NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, preferably having a homology of at least about 50% with the regions between amino acids in position (159) to (441). ), (360) to (669), (187) to (461), (195) to (472) and (331) to (604) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID
NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7 respectively, provided that it has an IP3 kinase activity, - or any fragment of at least about 250 contiguous amino acids of any of the sequences above , provided that it possesses an IP3 kinase activity, for the preparation of medicaments intended for the treatment of diseases related to oxidative stress or to the stress of the endoplasmic reticulum, or of neurodegenerative diseases, in particular retinal diseases.

Par définition, on rappelle que les IP3 kinases sont des enzymes susceptibles de catalyser la réaction suivante :
ATP + ID-myo-inositol 1,4,5 triphosphate # ADP + ID-myo-inositol 1,3,4,5 tetrakisphosphate
L'activité IP3 kinase d'une protéine peut être mesurée par le test fonctionnel de Takazawa et al. (1990). By definition, it is recalled that the IP3 kinases are enzymes capable of catalyzing the following reaction:
ATP + ID-myo-inositol 1,4,5 triphosphate # ADP + ID-myo-inositol 1,3,4,5 tetrakisphosphate
The IP3 kinase activity of a protein can be measured by the functional test of Takazawa et al. (1990).

La séquence SEQ ID NO : 2 est une nouvelle protéine isolée chez Drosophila melanogaster, notée DIP3K1 et représentée sur la figure 1.  The sequence SEQ ID NO: 2 is a new protein isolated from Drosophila melanogaster, denoted DIP3K1 and represented in FIG.

La séquence SEQ ID NO : 4 est une nouvelle protéine isolée chez Drosophila melanogaster, notée DIP3K2 et représentée sur la figure 2.  The sequence SEQ ID NO: 4 is a new protein isolated from Drosophila melanogaster, denoted DIP3K2 and represented in FIG.

La séquence SEQ ID NO : 5 est la protéine humaine IP3K-A représentée sur la figure 3.  The sequence SEQ ID NO: 5 is the human protein IP3K-A shown in FIG.

La séquence SEQ ID NO : 6 est la protéine humaine IP3K-B représentée sur la figure 4.  The sequence SEQ ID NO: 6 is the human protein IP3K-B shown in FIG.

La séquence SEQ ID NO : 7 est la protéine humaine IP3K-C représentée sur la figure 5.  The sequence SEQ ID NO: 7 is the human protein IP3K-C shown in FIG.

<Desc/Clms Page number 5> <Desc / Clms Page number 5>

L'invention concerne une protéine caractérisée en ce qu'elle comprend ou est constituée par : - la séquence SEQ ID NO : 2, - ou toute séquence dérivée de SEQ ID NO :2, notamment par substitution, suppression ou addition d'un ou plusieurs acides aminés, possédant une activité IP3 kinase, - toute séquence homologue de SEQ ID NO : 2, ayant de préférence une homologie d'au moins environ 61 % avec la région comprise entre les acides aminés en position (159) et (441) de la séquence SEQ ID NO : 2 et possédant une activité IP3 kinase, - ou tout fragment d'une des séquences définies ci-dessus, sous réserve qu'il possède une activité IP3 kinase, notamment tout fragment étant constitué d'au moins environ 250 acides aminés contigus de la séquence SEQ ID NO : 2.  The invention relates to a protein characterized in that it comprises or consists of: the sequence SEQ ID NO: 2, or any sequence derived from SEQ ID NO: 2, in particular by substitution, deletion or addition of one or several amino acids, having an IP3 kinase activity, - any homologous sequence of SEQ ID NO: 2, preferably having a homology of at least about 61% with the region between amino acids in position (159) and (441) of the sequence SEQ ID NO: 2 and having an IP3 kinase activity, or any fragment of one of the sequences defined above, provided that it has an IP3 kinase activity, in particular any fragment consisting of at least about 250 contiguous amino acids of the sequence SEQ ID NO: 2.

Selon un mode de réalisation avantageux de l'invention, la protéine de l'invention, telle que définie ci-dessus, est caractérisée en ce qu'elle comprend ou est constituée par la séquence SEQ ID NO : 2, représentée sur la figure 1.  According to an advantageous embodiment of the invention, the protein of the invention, as defined above, is characterized in that it comprises or consists of the sequence SEQ ID NO: 2, represented in FIG. .

L'invention concerne également une protéine caractérisée en ce qu'elle comprend ou est constituée par : - la séquence SEQ ID NO : 4, - ou toute séquence dérivée de SEQ ID NO: 4, notamment par substitution, suppression ou addition d'un ou plusieurs acides aminés, possédant une activité IP3 kinase, - toute séquence homologue de SEQ ID NO :4, ayant de préférence une homologie d'au moins environ 71 % avec la région comprise entre les acides aminés en position (360) et (669) de la séquence SEQ ID NO :4 et possédant une activité IP3 kinase, - ou tout fragment d'une des séquences définies ci-dessus, sous réserve qu'il possède une activité IP3 kinase, notamment tout fragment étant constitué d'au moins environ 250 acides aminés contigus de la séquence SEQ ID NO : 4.  The invention also relates to a protein characterized in that it comprises or consists of: the sequence SEQ ID NO: 4, or any sequence derived from SEQ ID NO: 4, in particular by substitution, deletion or addition of a or more amino acids, having an IP3 kinase activity, - any homologous sequence of SEQ ID NO: 4, preferably having a homology of at least about 71% with the region between the amino acids in position (360) and (669 ) of the sequence SEQ ID NO: 4 and having an IP3 kinase activity, or any fragment of one of the sequences defined above, provided that it has an IP3 kinase activity, in particular any fragment consisting of at least about 250 contiguous amino acids of the sequence SEQ ID NO: 4.

Selon un mode de réalisation avantageux de l'invention, la protéine de l'invention, telle que définie ci-dessus, est caractérisée en ce qu'elle comprend ou est constituée par la séquence SEQ ID NO : 4, représentée sur la figure 2.  According to an advantageous embodiment of the invention, the protein of the invention, as defined above, is characterized in that it comprises or consists of the sequence SEQ ID NO: 4, represented in FIG. .

L'invention concerne des fragments de protéines telles que définies ci-dessus choisis parmi les séquences délimitées : - de l'acide aminé en position (159) à l'acide aminé en position (441) de la séquence SEQ ID NO : 2,  The invention relates to protein fragments as defined above, chosen from delimited sequences: from the amino acid in position (159) to the amino acid in position (441) of the sequence SEQ ID NO: 2,

<Desc/Clms Page number 6><Desc / Clms Page number 6>

- de l'acide aminé en position (360) à l'acide aminé en position (669) de la séquence SEQ ID NO : 4, - de l'acide aminé en position (187) à l'acide aminé en position (461) de la séquence SEQ ID NO : 5, - de l'acide aminé en position (195) à l'acide aminé en position (472) de la séquence SEQ ID NO : 6, - de l'acide aminé en position (331) à l'acide aminé en position (604) de la séquence SEQ ID NO : 7.  from the amino acid in position (360) to the amino acid in position (669) of the sequence SEQ ID NO: 4, from the amino acid in position (187) to the amino acid in position (461) ) of the sequence SEQ ID NO: 5, - the amino acid in position (195) to the amino acid in position (472) of the sequence SEQ ID NO: 6, - the amino acid in position (331 ) at the amino acid in position (604) of the sequence SEQ ID NO: 7.

L'invention concerne une séquence nucléotidique codant pour l'une des protéines telles que définies ci-dessus.  The invention relates to a nucleotide sequence encoding one of the proteins as defined above.

Une séquence d'ADN avantageuse de l'invention comprend ou est constituée par : - la séquence nucléotidique SEQ ID NO : 1, - ou toute séquence nucléotidique dérivée, par dégénérescence du code génétique, de la séquence SEQ ID NO : 1 codant pour une protéine représentée par la séquence SEQ ID NO : 2, - ou toute séquence nucléotidique dérivée, notamment par substitution, suppression ou addition d'un ou plusieurs nucléotides, de la séquence SEQ ID NO : 1 codant pour une protéine dérivée de la séquence SEQ ID NO : 2 possédant une activité IP3 kinase, - ou toute séquence nucléotidique homologue de la séquence SEQ ID NO: 1, ayant de préférence une homologie d'au moins environ 50% avec 700 nucléotides contigus situés dans le domaine délimité du nucléotide en position (1425) au nucléotide en position (3969) de la séquence SEQ ID NO : 1, codant pour une protéine homologue de la séquence SEQ ID NO : 2 et possédant une activité IP3 kinase, - ou tout fragment de la séquence nucléotidique SEQ ID NO : 1 ou des séquences nucléotidiques définies ci-dessus, ledit fragment étant de préférence constitué d'au moins environ 700 nucléotides contigus situés dans le domaine délimité au nucléotide en position (1425) au nucléotide en position (3969) de ladite séquence et codant pour une protéine qui possède une activité IP3 kinase, - ou toute séquence nucléotidique complémentaire des séquences ou fragments susmentionnés, - ou toute séquence nucléotidique susceptible d'hybrider dans des conditions stringentes avec la séquence complémentaire de l'une des séquences ou de l'un des fragments susmentionnés.  An advantageous DNA sequence of the invention comprises or consists of: the nucleotide sequence SEQ ID NO: 1, or any nucleotide sequence derived, by degeneracy of the genetic code, from the sequence SEQ ID NO: 1 coding for a protein represented by the sequence SEQ ID NO: 2, or any nucleotide sequence derived, in particular by substitution, deletion or addition of one or more nucleotides, of the sequence SEQ ID NO: 1 coding for a protein derived from the sequence SEQ ID NO: 2 possessing an IP3 kinase activity, or any nucleotide sequence homologous to the sequence SEQ ID NO: 1, preferably having a homology of at least approximately 50% with 700 contiguous nucleotides located in the delimited domain of the nucleotide in position ( 1425) to the nucleotide in position (3969) of the sequence SEQ ID NO: 1, coding for a protein homologous to the sequence SEQ ID NO: 2 and having an IP3 kinase activity, - or all of the nucleotide sequence SEQ ID NO: 1 or the nucleotide sequences defined above, said fragment preferably consisting of at least about 700 contiguous nucleotides located in the domain delimited at the nucleotide in position (1425) to the nucleotide in position ( 3969) of said sequence and encoding a protein which possesses an IP3 kinase activity, or any nucleotide sequence complementary to the aforementioned sequences or fragments, or any nucleotide sequence capable of hybridizing under stringent conditions with the sequence complementary to the one sequences or one of the aforementioned fragments.

Par conditions stringentes d'hybridation on entend par exemple : - température d'hybridation : 42 C, - milieu d'hybridation : 5X SSC, 50% formamide, 5X Denhardt, 0,1% de sodium dodécyl sulfate (SDS),  By stringent conditions of hybridization is meant for example: hybridization temperature: 42 C, hybridization medium: 5X SSC, 50% formamide, 5X Denhardt, 0.1% sodium dodecyl sulfate (SDS),

<Desc/Clms Page number 7><Desc / Clms Page number 7>

- température de lavage : 42 C, - milieu de lavage : 0,1 X SSC (15 mM NaCI ; 1,5 mM citrate de sodium), 0,1%
SDS. - Washing temperature: 42 C, - Washing medium: 0.1 X SSC (15 mM NaCl, 1.5 mM sodium citrate), 0.1%
SDS.

Une autre séquence d'ADN avantageuse de l'invention comprend ou est constituée par : - la séquence nucléotidique SEQ ID NO : 3, - ou toute séquence nucléotidique dérivée, par dégénérescence du code génétique, de la séquence SEQ ID NO : 3 codant pour une protéine représentée par la séquence SEQ ID NO : 4, - ou toute séquence nucléotidique dérivée, notamment par substitution, suppression ou addition d'un ou plusieurs nucléotides, de la séquence SEQ ID NO :3 codant pour une protéine dérivée de la séquence SEQ ID NO : 4 possédant une activité IP3 kinase, - ou toute séquence nucléotidique homologue de la séquence SEQ ID NO: 3, ayant de préférence une homologie d'au moins environ 50% avec 700 nucléotides contigus situés dans le domaine délimité du nucléotide en position (3234) au nucléotide en position (6021) de la séquence SEQ ID NO : 3, codant pour une protéine homologue de la séquence SEQ ID NO : 4 et possédant une activité IP3 kinase, - ou tout fragment de la séquence nucléotidique SEQ ID NO : 3 ou des séquences nucléotidiques définies ci-dessus, ledit fragment étant de préférence constitué d'au moins environ 700 nucléotides contigus situés dans le domaine délimité au nucléotide en position (3234) au nucléotide en position (6021) de ladite séquence et codant pour une protéine qui possède une activité IP3 kinase, - ou toute séquence nucléotidique complémentaire des séquences ou fragments susmentionnés, - ou toute séquence nucléotidique susceptible d'hybrider dans des conditions stringentes avec la séquence complémentaire de l'une des séquences ou de l'un des fragments susmentionnés.  Another advantageous DNA sequence of the invention comprises or consists of: the nucleotide sequence SEQ ID NO: 3, or any nucleotide sequence derived, by degeneracy of the genetic code, from the sequence SEQ ID NO: 3 coding for a protein represented by the sequence SEQ ID NO: 4, or any nucleotide sequence derived, in particular by substitution, deletion or addition of one or more nucleotides, of the sequence SEQ ID NO: 3 coding for a protein derived from the sequence SEQ ID NO: 4 possessing an IP3 kinase activity, or any nucleotide sequence homologous to the sequence SEQ ID NO: 3, preferably having a homology of at least about 50% with 700 contiguous nucleotides located in the delimited domain of the nucleotide in position (3234) to the nucleotide at position (6021) of the sequence SEQ ID NO: 3, coding for a protein homologous to the sequence SEQ ID NO: 4 and having an IP3 kinase activity, or a fragment of the nucleotide sequence SEQ ID NO: 3 or the nucleotide sequences defined above, said fragment preferably consisting of at least about 700 contiguous nucleotides located in the domain delimited at the nucleotide at position (3234) at the nucleotide in position (6021) of said sequence and encoding a protein which has an IP3 kinase activity, - or any nucleotide sequence complementary to the aforementioned sequences or fragments, - or any nucleotide sequence capable of hybridizing under stringent conditions with the sequence complementary to the one of the sequences or one of the aforementioned fragments.

L'invention concerne un vecteur recombinant, notamment plasmide, cosmide, phage ou ADN de virus, contenant l'une des séquences nucléotidiques telles que mentionnées ci-dessus.  The invention relates to a recombinant vector, in particular plasmid, cosmid, phage or viral DNA, containing one of the nucleotide sequences as mentioned above.

L'invention concerne également un vecteur recombinant tel que défini ci-dessus, contenant les éléments nécessaires à l'expression dans une cellule hôte des polypeptides codés par les acides nucléiques tels que définis ci-dessus, insérés dans ledit vecteur.  The invention also relates to a recombinant vector as defined above, containing the elements necessary for the expression in a host cell of the polypeptides encoded by the nucleic acids as defined above, inserted in said vector.

Selon un mode de réalisation avantageux de l'invention, le vecteur recombinant défini ci-dessus contient notamment un promoteur reconnu par l'ARN polymérase de la cellule hôte, en particulier un promoteur inductible et éventuellement une séquence de transcription, de terminaison, et éventuellement une séquence signal et/ou d'ancrage.  According to an advantageous embodiment of the invention, the recombinant vector defined above contains in particular a promoter recognized by the RNA polymerase of the host cell, in particular an inducible promoter and optionally a transcription, termination sequence, and optionally a signal and / or anchoring sequence.

<Desc/Clms Page number 8> <Desc / Clms Page number 8>

Selon un autre mode de réalisation avantageux de l'invention, le vecteur recombinant, tel que défini ci-dessus, contient les éléments qui permettent l'expression d'une séquence nucléotidique, telle que définie ci-dessus, en tant que protéine mature ou protéine de fusion.  According to another advantageous embodiment of the invention, the recombinant vector, as defined above, contains the elements which allow the expression of a nucleotide sequence, as defined above, as a mature protein or fusion protein.

L'invention concerne également une cellule hôte, choisie notamment parmi les bactéries, les virus, les levures, les champignons, les plantes ou les cellules de mammifères, ladite cellule hôte étant transformée, notamment à l'aide d'un vecteur recombinant tel que défini ci-dessus.  The invention also relates to a host cell, chosen in particular from bacteria, viruses, yeasts, fungi, plants or mammalian cells, said host cell being transformed, in particular using a recombinant vector such as defined above.

Selon un mode de réalisation avantageux de l'invention, la cellule hôte, telle que définie ci-dessus, contient les éléments de régulation permettant l'expression de la séquence nucléotidique telle que définie ci-dessus.  According to an advantageous embodiment of the invention, the host cell, as defined above, contains the regulatory elements allowing the expression of the nucleotide sequence as defined above.

L'invention concerne également le produit de l'expression d'un acide nucléique exprimé par une cellule hôte transformée telle que définie ci-dessus.  The invention also relates to the product of the expression of a nucleic acid expressed by a transformed host cell as defined above.

L'invention concerne également un anticorps caractérisé en ce qu'il est dirigé de manière spécifique contre une protéine de l'invention.  The invention also relates to an antibody characterized in that it is directed specifically against a protein of the invention.

On ne se limite pas aux anticorps polyclonaux ; l'invention concerne également tout anticorps monoclonal produit par tout hybridome susceptible d'être formé selon les méthodes classiques à partir, d'une part, de cellules de rate d'animaux, en particulier de souris ou de rat, les cellules de l'animal étant immunisées contre la protéine de l'invention, et d'autre part de cellules d'une lignée cellulaire de myélome, ledit hybridome étant susceptible d'être choisi selon la capacité de la lignée cellulaire à produire des anticorps monoclonaux reconnaissant la protéine utilisée au préalable pour l'immunisation des animaux.  It is not limited to polyclonal antibodies; the invention also relates to any monoclonal antibody produced by any hybridoma capable of being formed according to conventional methods from, on the one hand, spleen cells of animals, in particular mouse or rat, the cells of the animal being immunized against the protein of the invention, and secondly cells of a myeloma cell line, said hybridoma being capable of being selected according to the capacity of the cell line to produce monoclonal antibodies recognizing the protein used beforehand for the immunization of animals.

L'invention concerne également une sonde nucléotidique capable d'hybrider avec l'une quelconque des séquences nucléiques de l'invention.  The invention also relates to a nucleotide probe capable of hybridizing with any one of the nucleic acid sequences of the invention.

L'invention concerne également les oligonucléotides antisens ou ARN messager antisens dérivés des séquences nucléotidiques tels que définis ci-dessus.  The invention also relates to the antisense oligonucleotides or antisense messenger RNA derived from the nucleotide sequences as defined above.

L'invention concerne également une composition pharmaceutique caractérisée en ce qu'elle comprend une protéine ou un fragment de protéine tels que définis ci-dessus et un vecteur pharmaceutique acceptable.  The invention also relates to a pharmaceutical composition characterized in that it comprises a protein or a protein fragment as defined above and an acceptable pharmaceutical vector.

Une composition pharmaceutique avantageuse de l'invention comprend l'une des nouvelles protéines ou un fragment d'une des nouvelles protéines tels que définis cidessus et un vecteur pharmaceutique acceptable.  An advantageous pharmaceutical composition of the invention comprises one of the novel proteins or a fragment of one of the novel proteins as defined above and an acceptable pharmaceutical carrier.

Une autre composition pharmaceutique avantageuse de l'invention comprend l'une des protéines ou un fragment d'une des protéines déjà connues tels que définis ci-dessus et un vecteur pharmaceutique acceptable.  Another advantageous pharmaceutical composition of the invention comprises one of the proteins or a fragment of one of the already known proteins as defined above and an acceptable pharmaceutical vector.

<Desc/Clms Page number 9> <Desc / Clms Page number 9>

L'invention concerne également l'utilisation de l'une des protéines telles que définies ci-dessus pour la préparation de médicaments destinés au traitement de maladies liées au stress oxydatif.  The invention also relates to the use of one of the proteins as defined above for the preparation of medicaments for the treatment of diseases related to oxidative stress.

Les pathologies concernées sont par exemple des infections chroniques comme l'arthrite ou certaines formes de cancers.  The pathologies concerned are, for example, chronic infections such as arthritis or certain forms of cancer.

L'invention concerne également l'utilisation de l'une des protéines telles que définies ci-dessus pour la préparation de médicaments destinés au traitement de maladies liées au stress du réticulum endoplasmique.  The invention also relates to the use of one of the proteins as defined above for the preparation of medicaments for the treatment of endoplasmic reticulum-related stress diseases.

Parmi les pathologies concernées, on peut citer comme exemples la fibrose cystique et la maladie d'Alzheimer.  Examples of pathologies include cystic fibrosis and Alzheimer's disease.

L'invention concerne également l'utilisation de l'une des protéines telles que définies ci-dessus pour la préparation de médicaments destinés au traitement de maladies neurodégénératives, notamment rétiniennes.  The invention also relates to the use of one of the proteins as defined above for the preparation of medicaments for the treatment of neurodegenerative diseases, in particular retinal diseases.

Parmi les pathologies concernées, on peut citer comme exemples la maladie d'Alzheimer et la chorée de Hungtington ainsi que les rétinopathies pigmentaires.  Among the pathologies concerned, examples include Alzheimer's disease and Hungtington's chorea as well as retinopathies pigmentosa.

L'invention concerne également des cellules animales qui contiennent, dans leur génome, l'une des séquences nucléotidiques de l'invention.  The invention also relates to animal cells which contain, in their genome, one of the nucleotide sequences of the invention.

L'invention concerne également un animal transgénique non humain contenant des cellules telles que définies ci-dessus, et qui surexprime l'une des protéines de l' invention.  The invention also relates to a non-human transgenic animal containing cells as defined above, and which overexpresses one of the proteins of the invention.

En jouant non pas sur le niveau des radicaux libres dans la cellule mais sur les conséquences néfastes qu'ils entraînent, la surexpression de l'activité IP3K protège la cellule sans altérer l'homéostasie des radicaux libres dans la cellule qui peut être importante pour son fonctionnement normal.  By not playing on the level of free radicals in the cell but on the harmful consequences they entail, the overexpression of IP3K activity protects the cell without altering the free radical homeostasis in the cell which may be important for its normal running.

L'invention concerne également un animal transgénique non humain contenant des cellules telles que définies ci-dessus, dans lequel l'expression du gène, codant pour l'une des protéines de l'invention, est supprimée.  The invention also relates to a non-human transgenic animal containing cells as defined above, in which the expression of the gene coding for one of the proteins of the invention is suppressed.

Un tel mutant, obtenu par excision imprécise du transposon (un morceau d'ADN génomique est en même temps enlevé) permet de connaître les phénotypes associés à une perte complète du gène. Si son absence s'avère létale, la génération de clones somatiques permet de tester les conséquences de la perte totale de DIP3K1 dans les différents tissus de l'organisme, y compris dans les tissus nerveux où l'insertion UY530 est associée à de la neurodégénérescence.  Such a mutant, obtained by imprecise excision of the transposon (a piece of genomic DNA is at the same time removed) allows to know the phenotypes associated with a complete loss of the gene. If its absence is lethal, the generation of somatic clones makes it possible to test the consequences of the total loss of DIP3K1 in the various tissues of the body, including in the nervous tissues where the insertion UY530 is associated with neurodegeneration. .

<Desc/Clms Page number 10> <Desc / Clms Page number 10>

DESCRIPTION DES FIGURES
La Figure 1 représente la séquence nucléotidique SEQ ID NO : 1 et la séquence protéinique correspondante SEQ ID NO : 2. DESCRIPTION OF THE FIGURES
Figure 1 shows the nucleotide sequence SEQ ID NO: 1 and the corresponding protein sequence SEQ ID NO: 2.

La Figure 2 représente la séquence nucléotidique SEQ ID NO : 3 et la séquence protéinique correspondante SEQ ID NO : 4.  Figure 2 shows the nucleotide sequence SEQ ID NO: 3 and the corresponding protein sequence SEQ ID NO: 4.

La Figure 3 représente la séquence nucléotidique SEQ ID NO : 5.  Figure 3 shows the nucleotide sequence SEQ ID NO: 5.

La Figure 4 représente la séquence nucléotidique SEQ ID NO : 6.  Figure 4 shows the nucleotide sequence SEQ ID NO: 6.

La Figure 5 représente la séquence nucléotidique SEQ ID NO : 7.  Figure 5 shows the nucleotide sequence SEQ ID NO: 7.

Les Figures 6A et 6B représentent la résistance au stress oxydatif de mâles (figure 6A) et de femelles (figure 6B) de contrôle (génotype daGAL4/+) ou surexprimant l'IP3K (génotype UY530/+ ;daGAL4/+) sur un milieu de concentration 1% en H2O2. On a représenté le pourcentage de survie en fonction du temps, exprimé en heures. La courbe avec les losanges correspond aux mouches de contrôle et la courbe avec les carrés correspond aux mouches qui surexpriment l'IP3 kinase.  Figures 6A and 6B show the oxidative stress resistance of males (Figure 6A) and control females (Figure 6B) (genotype daGAL4 / +) or overexpressing IP3K (genotype UY530 / +; daGAL4 / +) on medium concentration 1% H2O2. The percentage of survival as a function of time, expressed in hours, is shown. The curve with the diamonds corresponds to the control flies and the curve with the squares corresponds to the flies which overexpress the IP3 kinase.

Les Figures 6C et 6D représentent la résistance au stress oxydatif de mâles (figure 6C) et de femelles (figure 6D) de contrôle (génotype daGAL4/+) ou surexprimant l'IP3K (génotype UY530/+ ; daGAL4/+) sur un milieu de concentration 3% en H202.  Figures 6C and 6D show the oxidative stress resistance of males (Figure 6C) and control females (Figure 6D) (genotype daGAL4 / +) or overexpressing IP3K (genotype UY530 / +; daGAL4 / +) on medium 3% concentration in H202.

On a représenté le pourcentage de survie en fonction du temps, exprimé en heures. La courbe avec les losanges correspond aux mouches de contrôle et la courbe avec les carrés correspond aux mouches qui surexpriment l'IP3 kinase. The percentage of survival as a function of time, expressed in hours, is shown. The curve with the diamonds corresponds to the control flies and the curve with the squares corresponds to the flies which overexpress the IP3 kinase.

Les Figures 6E et 6F représentent la résistance au stress oxydatif de mâles (figure 6E) et de femelles (figure 6F) de contrôle (génotype daGAL4/+) ou surexprimant l'IP3K (génotype UY530/+ ; daGAL4/+) sur un milieu de concentration 5% en H202.  Figures 6E and 6F represent the oxidative stress resistance of males (Figure 6E) and control females (Figure 6F) (genotype daGAL4 / +) or overexpressing IP3K (genotype UY530 / +; daGAL4 / +) on medium concentration 5% H 2 O 2.

On a représenté le pourcentage de survie en fonction du temps, exprimé en heures. La courbe avec les losanges correspond aux mouches de contrôle et la courbe avec les carrés correspond aux mouches qui surexpriment l'IP3 kinase. The percentage of survival as a function of time, expressed in hours, is shown. The curve with the diamonds corresponds to the control flies and the curve with the squares corresponds to the flies which overexpress the IP3 kinase.

La Figure 7 représente le temps de développement avant l'émergence à 26 C. On compare le pourcentage de mouches émergées de différents génotypes en fonction du temps, exprimé en heures. La courbe avec les carrés noirs concerne les mouches femelles témoins de génotype daGAL4/+, la courbe avec les ronds noirs concerne les mouches mâles témoins de génotype daGAL4/+, la courbe avec les carrés blancs concerne les mouches femelles de génotype UY530/+ ; daGAL4/+ et la courbe avec les ronds blancs concerne les mouches mâles de génotype UY530/+ ; daGAL4/+.  Figure 7 represents the development time before emergence at 26 C. The percentage of emerged flies of different genotypes as a function of time is compared in hours. The curve with the black squares concerns the control female flies of the genotype daGAL4 / +, the curve with the black circles concerns the control male flies of genotype daGAL4 / +, the curve with the white squares concerns the female flies of genotype UY530 / +; daGAL4 / + and the curve with the white circles concerns male flies of genotype UY530 / +; daGAL4 / +.

La Figure 8A représente la résistance au stress oxydatif induit par H202. On a étudié chez des mouches de génotypes divers le pourcentage de survie sur un milieu contenant 1% de H202 en fonction du temps en heures. La courbe avec les losanges noirs concerne les mouches possédant une seule dose du récepteur IP3R (génotype  Figure 8A shows resistance to oxidative stress induced by H2O2. Flies of various genotypes have been studied for the percentage of survival on a medium containing 1% H2O2 as a function of time in hours. The black diamond curve is for flies with a single dose of the IP3R receptor (genotype

<Desc/Clms Page number 11><Desc / Clms Page number 11>

itprl664/+) ; la courbe avec les ronds noirs concerne les mouches qui surexpriment DIP3K1 (génotype UY530/+ ; daGAL4/+) ; la courbe avec les carrés noirs concerne les mouches de contrôle (génotype daGAL4/+) ; la courbe avec les triangles noirs concerne les mouches homozygotes pour l'insertion dans DIP3K1 (génotype UY530/UY530).  itprl664 / +); the curve with the black circles concerns the flies which overexpress DIP3K1 (genotype UY530 / +; daGAL4 / +); the curve with the black squares concerns control flies (daGAL4 / + genotype); the curve with the black triangles concerns flies homozygous for insertion in DIP3K1 (genotype UY530 / UY530).

La Figure 8B représente la résistance au stress UPR induit par la tunicamycine.  Figure 8B shows the UPR stress resistance induced by tunicamycin.

On a étudié chez des mouches de génotypes divers le pourcentage de survie sur un milieu contenant 3 M de tunicamycine en fonction du temps en heures. La courbe avec les losanges noirs concerne les mouches possédant une seule dose du récepteur IP3R (génotype itprl664/+) ; la courbe avec les ronds noirs concerne les mouches qui surexpriment DIP3K1 (génotype UY530/+ ; daGAL4/+) ; la courbe avec les carrés noirs concerne les mouches de contrôle (génotype daGAL4/+) ; la courbe avec les triangles noirs concerne les mouches homozygotes pour l'insertion dans DIP3K1 (génotype UY530/UY530). The percentage of survival on a medium containing 3 M tunicamycin as a function of time in hours was studied in flies of various genotypes. The black diamond curve is for flies with a single dose of the IP3R receptor (genotype itprl664 / +); the curve with the black circles concerns the flies which overexpress DIP3K1 (genotype UY530 / +; daGAL4 / +); the curve with the black squares concerns control flies (daGAL4 / + genotype); the curve with the black triangles concerns flies homozygous for insertion in DIP3K1 (genotype UY530 / UY530).

La Figure 9 représente la réduction de la longévité dans la souche homozygote pour l'insertion UY530 au début de l'unité transcriptionnelle de DIP3K. On a représenté le pourcentage de survie en fonction du temps en jours. Indiscernable du contrôle jusqu'à 19 jours le taux de survie de UY530/UY530 chute ensuite brutalement. Ceci est associé à une neurodégénérescence rétinienne. La courbe en pointillés concerne les mouches de contrôle (génotype daGAL4/+) et la courbe en trait plein concerne les mouches de la lignée UY530/UY530.  Figure 9 shows the reduction of longevity in the homozygous strain for UY530 insertion at the beginning of the DIP3K transcriptional unit. The percentage of survival as a function of time is shown in days. Indistinguishable from control up to 19 days the survival rate of UY530 / UY530 then drops sharply. This is associated with retinal neurodegeneration. The dotted line is for control flies (genotype daGAL4 / +) and the solid line for flies of line UY530 / UY530.

La Figure 10 concerne la comparaison des lobes optiques sur des mouches de 25 à 27 jours de génotype daGAL4/+ (A, C) ou UY530/UY530 (B, D). Des vacuoles caractéristiques de dégénérescence neuronale, dont le nombre augmente avec l'âge, sont clairement visibles dans les lobes optiques des mouches homozygotes pour UY530.  Figure 10 relates to the comparison of the optical lobes on flies of 25 to 27 days of genotype daGAL4 / + (A, C) or UY530 / UY530 (B, D). Vacuoles characteristic of neuronal degeneration, the number of which increases with age, are clearly visible in the optic lobes of flies homozygous for UY530.

<Desc/Clms Page number 12> <Desc / Clms Page number 12>

MATERIEL ET METHODES
Différentes lignées mutantes utilisées
On a utilisé des lignées déjà connues qui sont : - W ; da-GAL4 : lignée d'expression de la protéine GAL4 sous la dépendance du promoteur ubiquitaire du gène daughterless (Wodarz et al., 1995). MATERIAL AND METHODS
Different mutant lines used
Previously known lines have been used which are: - W; da-GAL4: expression line of the GAL4 protein under the control of the ubiquitous promoter of the daughterless gene (Wodarz et al., 1995).

- Itpr P1664/TM3: insertion hypomorphe du récepteur à l'IP3 (Venkatesh and
Hasan, 1997). Cette lignée a été utilisée dans des tests de résistance après croisement avec une lignée w de référence pour donner des individus itprP1664/+. - Itpr P1664 / TM3: hypomorphic insertion of the receptor at IP3 (Venkatesh and
Hasan, 1997). This line was used in resistance tests after crossing with a reference line w to give itprP1664 / + individuals.

On a également utilisé les nouvelles lignées mutantes suivantes : - yw ; pP{Mae-UAS.6.11}UY530, qui est obtenue par l'insertion du transposon pP{Mae-UAS.6.11} 3 paires de bases en aval du début de l'unité de transcription correspondant de l'ADNc SD07279 codant pour la protéine D-
IP3K1 (lignée notée UY530 dans le texte) - yw ; pP{Mae-UAS.6.11}UY530R2, yw ; pP{Mae-UAS.6.11}UY530R16, yw ; pP{Mae-UAS.6.11}UY530R21, obtenues à la suite d'excisions exactes (sans délétions chromosomiques adjacentes) du transposon pP{Mae-UAS.6.11}UY530 (lignées notées UY530R2, UY530R16, UY530R21 dans le texte) - W; PUAST-D-IP3K1-10A, W ; PUAST-D-IP3K1-32, W ; PUAST-D-
IP3K1-37, qui sont des souches transgéniques permettant la surexpression de la protéine D-IP3K1. The following new mutant lines have also been used: yw; pP {Mae-UAS.6.11} UY530, which is obtained by the insertion of the transposon pP {Mae-UAS.6.11} 3 base pairs downstream from the beginning of the corresponding transcription unit of the SD07279 cDNA encoding the D protein
IP3K1 (line noted UY530 in the text) - yw; pP {Mae-UAS.6.11} UY530R2, yw; pP {Mae-UAS.6.11} UY530R16, yw; pP {Mae-UAS.6.11} UY530R21, obtained as a result of exact excisions (without adjacent chromosomal deletions) of the transposon pP {Mae-UAS.6.11} UY530 (lines denoted UY530R2, UY530R16, UY530R21 in the text) - W; PUAST-D-IP3K1-10A, W; PUAST-D-IP3K1-32, W; PUAST-D
IP3K1-37, which are transgenic strains allowing the overexpression of the protein D-IP3K1.

Mutagenèse
La mutagenèse a été effectuée à partir d'un transposon pP{Mae-UAS.6.11} comprenant des séquences UAS et le gène marqueur yellow (y) donné par J. Merriam (Merriam, 1997). Des femelles de génotype yw, pP{Mae-UAS.6.11} sont croisées avec des mâles de génotype w ; A23, Sb/TM6. Les mâles descendants yw, pP{Mae- UAS.6.11} ; +/A23, Sb sont croisés en tubes individuels avec des femelles yw. Dans la descendance les mâles de phénotype {y+, Sb+} qui correspondent à des évènements de transposition indépendants sur un des deux autosomes sont sélectionnés et croisés individuellement avec des femelles yw avant de balancer le chromosome portant l'insertion selon des techniques standards. Les lignées résultantes, de génotype yw;pP{Mae-UAS.6.11}UYN (N désignant le numéro de la lignée) sont notées yw ; UYN dans ce qui suit par mesure de simplicité. mutagenesis
Mutagenesis was performed from a pP {Mae-UAS.6.11} transposon comprising UAS sequences and the yellow (y) marker gene given by J. Merriam (Merriam, 1997). Females of genotype yw, pP {Mae-UAS.6.11} are crossed with males of genotype w; A23, Sb / TM6. The descending males yw, pP {Mae- UAS.6.11}; + / A23, Sb are crossed into individual tubes with females yw. In the offspring, phenotype males {y +, Sb +} that correspond to independent transposition events on one of the two autosomes are selected and crossed individually with females yw before balancing the chromosome carrying the insertion according to standard techniques. The resulting lines, of genotype yw; pP {Mae-UAS.6.11} UYN (N denoting the number of the line) are denoted yw; UYN in the following for the sake of simplicity.

<Desc/Clms Page number 13> <Desc / Clms Page number 13>

Identification dupoint d'insertion du transposon UY530 L'ADN des mouches de la lignée yw ; est extrait, digéré par l'enzyme Msplpuis, après précipitation, le produit de cette digestion est ligué avec une ligase T4 et 2 (il utilisé pour une amplification par PCR avec les amorces OUY52 (ACACAACCTTTCCTCTCAACAA) et OUY31 (ATTGATTCACTTTAACTTGCAC) qui sont contenus dans le transposon. Le fragment résultant est séquence et la séquence comparée avec la séquence génomique de la Drosophile par le programme BLAST, permettant la localisation du point d'insertion du transposon et l'identification du gène D-IP3K1 adjacent.  Identification of the insertion point of transposon UY530 The DNA of flies of line yw; is extracted, digested with the enzyme Msplpuis, after precipitation, the product of this digestion is ligated with a ligase T4 and 2 (it used for amplification by PCR with the primers OUY52 (ACACAACCTTTCCTCTCAACAA) and OUY31 (ATTGATTCACTTTAACTTGCAC) which are contained in The resulting fragment is sequenced and the sequence compared with the genomic sequence of Drosophila by the BLAST program, allowing localization of the transposon insertion point and identification of the adjacent D-IP3K1 gene.

Excision du transposon
Des femelles de génotype yw, UY530 sont croisées avec des mâles de génotype w ; CyO/+; A23, Sb/+. Les mâles descendants yw, UY530/CyO ; +/A23, Sb sont croisés en tubes individuels avec des femelles yw ; CyO/Sp. Dans la descendance les mâles de phénotype {y, w, Cy, Sb+, Sp+} qui correspondent à des évènements potentiels indépendants d'excision du transposon sont sélectionnés et croisés individuellement avec des femelles yw ; CyO/Sp pour établir les lignées révertantes notées UY530Ri (i = 2, 16, 21). Pour confirmer le type d'événement de révertion, l'ADN des mouches de chaque lignée révertante est alors extrait et utilisé pour une analyse par PCR et en vue d'un séquençage de la région d'insertion du transposon selon des techniques standards. Excision of the transposon
Females of genotype yw, UY530 are crossed with males of genotype w; CYO / +; A23, Sb / +. Downstream males yw, UY530 / CyO; + / A23, Sb are crossed into individual tubes with females yw; CYO / Sp. In the offspring, phenotype males {y, w, Cy, Sb +, Sp +} that correspond to potential independent excision events of the transposon are selected and crossed individually with females yw; CyO / Sp to establish the revertant lines noted UY530Ri (i = 2, 16, 21). To confirm the type of revertive event, the flies DNA of each revertant line is then extracted and used for PCR analysis and sequencing of the transposon insertion region according to standard techniques.

Obtention de lignées transgéniques de surexpression de l'IP3K1
Un fragment EcoRI-Xholisolé du cDNA SD07279 a été clone dans le vecteur PUAST (Brand and Perrimon, 1993) et l'ADN résultant utilisé avec l'ADN d'un vecteur contenant la transposase A23 pour obtenir des lignées transgéniques selon des techniques standards. Trois lignées indépendantes ont été ainsi obtenues notées W ; PUAST-D-IP3K1-i ( i=10A, 32, 37). Obtaining transgenic lines of overexpression of IP3K1
An EcoRI-Xholisole fragment of the cDNA SD07279 was cloned into the PUAST vector (Brand and Perrimon, 1993) and the resulting DNA used with the DNA of a vector containing the A23 transposase to obtain transgenic lines according to standard techniques. Three independent lines were thus obtained denoted W; PUAST-D-IP3K1-i (i = 10A, 32, 37).

Tests de résistance
Les mouches de même sexe âgées de 3 à 5 jours sont placées par groupes de 30 dans un tube de 50 ml contenant un milieu solide composé de 1,3% d'agarose à bas point de fusion, 1% de sucrose et du produit à tester pour la résistance (1% de peroxyde d'hydrogène ou 5mM de paraquat (produit Sigma) ou 3 M de tunicamycine (produit Resistance tests
Same-sex flies, 3-5 days old, are placed in groups of 30 in a 50 ml tube containing a solid medium consisting of 1.3% low-melting agarose, 1% sucrose and test for resistance (1% hydrogen peroxide or 5mM paraquat (Sigma product) or 3M tunicamycin (product

<Desc/Clms Page number 14><Desc / Clms Page number 14>

Sigma) selon le test effectué). Les tubes sont maintenus à 26 C et les mouches mortes sont comptées 2 fois par jour pour établir les courbes de survie.  Sigma) according to the test performed). The tubes are kept at 26 C and the dead flies are counted twice a day to establish the survival curves.

Test de longévité
Pour chaque génotype les mâles nouveaux nés sont placés par groupes de 30 dans un tube de 50 ml maintenus à 26 C. Les mouches sont transférées tous les 2 ou 3 jours dans des tubes frais et les morts sont comptés à cette occasion pour établir les courbes de survie. Un minimum de 5 tubes indépendants sont utilisés pour s'assurer de la validité statistique des écarts observés. Longevity test
For each genotype, the newborn males are placed in groups of 30 in a 50 ml tube maintained at 26 C. The flies are transferred every 2 or 3 days in fresh tubes and the dead are counted on this occasion to establish the curves. survival. A minimum of 5 independent tubes are used to ensure the statistical validity of the observed deviations.

RESULTATS Tableau 1 (Figure 6A) Pourcentage de survie de Drosophiles mâles de génotype daGAL4/+ (mouches de contrôle) ou de génotype UY530/+; da-GAL4/+ sur un milieu contenant 1% de H202

Figure img00140001
RESULTS Table 1 (Figure 6A) Percentage of survival of male Drosophila genotype daGAL4 / + (control flies) or genotype UY530 / +; da-GAL4 / + on medium containing 1% H 2 O 2
Figure img00140001

<tb>
<tb> % <SEP> de <SEP> survie <SEP> des <SEP> Drosophiles
<tb> temps <SEP> (heures) <SEP> génotype <SEP> daGAL4/+ <SEP> génotype <SEP> UY530/+ <SEP> ; <SEP> daGAL4/+
<tb> 0 <SEP> 100 <SEP> 100
<tb> 39 <SEP> 98 <SEP> 98
<tb> 51 <SEP> 92 <SEP> 98
<tb> 66 <SEP> 43 <SEP> 96
<tb> 75 <SEP> 18 <SEP> 91
<tb> 88 <SEP> 1 <SEP> 69
<tb> 97 <SEP> 0 <SEP> 53
<tb> 118 <SEP> 0 <SEP> 29
<tb> 138 <SEP> 0 <SEP> 20
<tb> 160 <SEP> 0 <SEP> 11
<tb> 182 <SEP> 0 <SEP> 7
<tb> 256 <SEP> 0 <SEP> 4
<tb> 289 <SEP> 0 <SEP> 2
<tb> <Tb>
<tb>% <SEP> of <SEP> survival <SEP> of <SEP> Drosophila
<tb> time <SEP> (hours) <SEP> genotype <SEP> daGAL4 / + <SEP> genotype <SEP> UY530 / + <SEP>;<SEP> daGAL4 / +
<tb> 0 <SEP> 100 <SEP> 100
<tb> 39 <SEP> 98 <SEP> 98
<tb> 51 <SEP> 92 <SEP> 98
<tb> 66 <SEP> 43 <SEP> 96
<tb> 75 <SEP> 18 <SEP> 91
<tb> 88 <SEP> 1 <SEP> 69
<tb> 97 <SEP> 0 <SEP> 53
<tb> 118 <SEP> 0 <SEP> 29
<tb> 138 <SEP> 0 <SEP> 20
<tb> 160 <SEP> 0 <SEP> 11
<tb> 182 <SEP> 0 <SEP> 7
<tb> 256 <SEP> 0 <SEP> 4
<tb> 289 <SEP> 0 <SEP> 2
<Tb>

<Desc/Clms Page number 15> <Desc / Clms Page number 15>

Les moyennes sont établies selon les formules standards à partir d'un minimum de trois tubes de trente mouches. The averages are established according to standard formulas from a minimum of three tubes of thirty flies.

On constate une forte protection contre le stress oxydant induit par H2O2 des individus mâles de génotype UY530/+ ; daGAL4/+ surexprimant DIP3K1 par rapport aux individus de contrôle de génotype daGAL4/+. Ainsi, par exemple, après 88 heures passées sur le milieu à 1% de H202, seul 1% des individus de contrôle restent vivants contre 69% des individus surexprimant DIP3K1.  There is strong protection against H2O2-induced oxidative stress in male individuals of the UY530 / + genotype; daGAL4 / + overexpressing DIP3K1 compared to daGAL4 / + genotype control individuals. Thus, for example, after 88 hours spent on medium at 1% H2O2, only 1% of control individuals remain alive against 69% of individuals overexpressing DIP3K1.

Tableau 2 (Figure 6B) Pourcentage de survie de Drosophiles femelles de génotype daGAL4/+ (mouches de contrôle) ou de génotype UY530/+ ; da-GAL4/+ sur un milieu contenant 1% de H2O2

Figure img00150001
Table 2 (Figure 6B) Percent survival of female Drosophila genotype daGAL4 / + (control flies) or genotype UY530 / +; da-GAL4 / + on medium containing 1% H2O2
Figure img00150001

<tb>
<tb> % <SEP> de <SEP> survie <SEP> des <SEP> Drosophiles
<tb> temps <SEP> (heures) <SEP> génotype <SEP> daGAL4/+ <SEP> génotype <SEP> UY530/+ <SEP> ; <SEP> daGAL4/+
<tb> 0 <SEP> 100 <SEP> 100
<tb> 39 <SEP> 97 <SEP> 93
<tb> 51 <SEP> 88 <SEP> 92
<tb> 66 <SEP> 74 <SEP> 91
<tb>
<tb> 75 <SEP> 60 <SEP> 91
<tb> 88 <SEP> 27 <SEP> 88
<tb> 97 <SEP> 14 <SEP> 85
<tb> 118 <SEP> 1 <SEP> 66
<tb> 138 <SEP> 0 <SEP> 48
<tb> 160 <SEP> 0 <SEP> 32
<tb> 182 <SEP> 0 <SEP> 23
<tb> 256 <SEP> 0 <SEP> 11
<tb> 289 <SEP> 0 <SEP> 5
<tb> <Tb>
<tb>% <SEP> of <SEP> survival <SEP> of <SEP> Drosophila
<tb> time <SEP> (hours) <SEP> genotype <SEP> daGAL4 / + <SEP> genotype <SEP> UY530 / + <SEP>;<SEP> daGAL4 / +
<tb> 0 <SEP> 100 <SEP> 100
<tb> 39 <SEP> 97 <SEP> 93
<tb> 51 <SEP> 88 <SEP> 92
<tb> 66 <SEP> 74 <SEP> 91
<Tb>
<tb> 75 <SEP> 60 <SEP> 91
<tb> 88 <SEP> 27 <SEP> 88
<tb> 97 <SEP> 14 <SEP> 85
<tb> 118 <SEP> 1 <SEP> 66
<tb> 138 <SEP> 0 <SEP> 48
<tb> 160 <SEP> 0 <SEP> 32
<tb> 182 <SEP> 0 <SEP> 23
<tb> 256 <SEP> 0 <SEP> 11
<tb> 289 <SEP> 0 <SEP> 5
<Tb>

<Desc/Clms Page number 16> <Desc / Clms Page number 16>

Les moyennes sont établies selon les formules standards à partir d'un minimum de trois tubes de trente mouches. The averages are established according to standard formulas from a minimum of three tubes of thirty flies.

On constate une forte protection contre le stress oxydant induit par H2O2 des individus femelles de génotype UY530/+ ; daGAL4/+ surexprimant DIP3K1 par rapport aux individus de contrôle de génotype daGAL4/+. Ainsi, par exemple, après 118 heures passées sur le milieu à 1% de H202, seul 1% des individus de contrôle restent vivants contre 66% des individus surexprimant DIP3K1.  There is strong protection against H2O2-induced oxidative stress in female individuals of the UY530 / + genotype; daGAL4 / + overexpressing DIP3K1 compared to daGAL4 / + genotype control individuals. Thus, for example, after 118 hours spent on 1% H202 medium, only 1% of control individuals remain alive against 66% of individuals overexpressing DIP3K1.

Tableau 3 (Figure 6C) Pourcentage de survie de Drosophiles mâles de génotype daGAL4/+ (mouches de contrôle) ou de génotype UY530/+ ; da-GAL4/+ sur un milieu contenant 3% de H202

Figure img00160001
Table 3 (Figure 6C) Percentage survival of male Drosophila genotype daGAL4 / + (control flies) or genotype UY530 / +; da-GAL4 / + on medium containing 3% H202
Figure img00160001

<tb>
<tb> % <SEP> de <SEP> survie <SEP> des <SEP> Drosophiles
<tb> temps <SEP> (heures) <SEP> génotype <SEP> daGAL4/+ <SEP> génotype <SEP> UY530/+ <SEP> ; <SEP> daGAL4/+
<tb> 0 <SEP> 100 <SEP> 100
<tb> 39 <SEP> 94 <SEP> 98
<tb> 51 <SEP> 46 <SEP> 98
<tb> 66 <SEP> 5 <SEP> 84
<tb> 75 <SEP> 1 <SEP> 55
<tb> 88 <SEP> 0 <SEP> 30
<tb> 97 <SEP> 0 <SEP> 21
<tb> 118 <SEP> 0 <SEP> 4
<tb> 138 <SEP> 0 <SEP> 1
<tb> 160 <SEP> 0 <SEP> 0
<tb> 182 <SEP> 0 <SEP> 0
<tb> 256 <SEP> 0 <SEP> 0
<tb> 289 <SEP> 0 <SEP> 0
<tb> <Tb>
<tb>% <SEP> of <SEP> survival <SEP> of <SEP> Drosophila
<tb> time <SEP> (hours) <SEP> genotype <SEP> daGAL4 / + <SEP> genotype <SEP> UY530 / + <SEP>;<SEP> daGAL4 / +
<tb> 0 <SEP> 100 <SEP> 100
<tb> 39 <SEP> 94 <SEP> 98
<tb> 51 <SEP> 46 <SEP> 98
<tb> 66 <SEP> 5 <SEP> 84
<tb> 75 <SEP> 1 <SEP> 55
<tb> 88 <SEP> 0 <SEP> 30
<tb> 97 <SEP> 0 <SEP> 21
<tb> 118 <SEP> 0 <SEP> 4
<tb> 138 <SEP> 0 <SEP> 1
<tb> 160 <SEP> 0 <SEP> 0
<tb> 182 <SEP> 0 <SEP> 0
<tb> 256 <SEP> 0 <SEP> 0
<tb> 289 <SEP> 0 <SEP> 0
<Tb>

<Desc/Clms Page number 17> <Desc / Clms Page number 17>

Les moyennes sont établies selon les formules standards à partir d'un minimum de trois tubes de trente mouches. The averages are established according to standard formulas from a minimum of three tubes of thirty flies.

On constate une forte protection contre le stress oxydant induit par H202 des individus mâles de génotype UY530/+ ; daGAL4/+ surexprimant DIP3K1 par rapport aux individus de contrôle de génotype daGAL4/+. Ainsi, par exemple, après 75 heures passées sur le milieu à 3% de H2O2, seul 1% des individus de contrôle restent vivants contre 55% des individus surexprimant DIP3K1.  There is strong protection against H202-induced oxidative stress in male individuals of the UY530 / + genotype; daGAL4 / + overexpressing DIP3K1 compared to daGAL4 / + genotype control individuals. Thus, for example, after 75 hours spent on the medium at 3% H2O2, only 1% of control individuals remain alive against 55% of individuals overexpressing DIP3K1.

Tableau 4 (Figure 6D) Pourcentage de survie de Drosophiles femelles de génotype daGAL4/+ (mouches de contrôle) ou de génotype UY530/+ ; da-GAL4/+ sur un milieu contenant 3% de H202

Figure img00170001
Table 4 (Figure 6D) Percent survival of female Drosophila genotype daGAL4 / + (control flies) or genotype UY530 / +; da-GAL4 / + on medium containing 3% H202
Figure img00170001

<tb>
<tb> % <SEP> de <SEP> survie <SEP> des <SEP> Drosophiles
<tb> temps <SEP> (heures) <SEP> génotype <SEP> daGAL4/+ <SEP> génotype <SEP> UY530/+ <SEP> ; <SEP> daGAL4/+
<tb> 0 <SEP> 100 <SEP> 100
<tb> 39 <SEP> 81 <SEP> 93
<tb> 51 <SEP> 68 <SEP> 92
<tb> 66 <SEP> 22 <SEP> 85
<tb> 75 <SEP> 2 <SEP> 81
<tb> 88 <SEP> 0 <SEP> 74
<tb> 97 <SEP> 0 <SEP> 59
<tb> 118 <SEP> 0 <SEP> 49
<tb> 138 <SEP> 0 <SEP> 45
<tb> 160 <SEP> 0 <SEP> 2
<tb> 182 <SEP> 0 <SEP> 0
<tb> 256 <SEP> 0 <SEP> 0
<tb> 289 <SEP> 0 <SEP> 0
<tb> <Tb>
<tb>% <SEP> of <SEP> survival <SEP> of <SEP> Drosophila
<tb> time <SEP> (hours) <SEP> genotype <SEP> daGAL4 / + <SEP> genotype <SEP> UY530 / + <SEP>;<SEP> daGAL4 / +
<tb> 0 <SEP> 100 <SEP> 100
<tb> 39 <SEP> 81 <SEP> 93
<tb> 51 <SEP> 68 <SEP> 92
<tb> 66 <SEP> 22 <SEP> 85
<tb> 75 <SEP> 2 <SEP> 81
<tb> 88 <SEP> 0 <SEP> 74
<tb> 97 <SEP> 0 <SEP> 59
<tb> 118 <SEP> 0 <SEP> 49
<tb> 138 <SEP> 0 <SEP> 45
<tb> 160 <SEP> 0 <SEP> 2
<tb> 182 <SEP> 0 <SEP> 0
<tb> 256 <SEP> 0 <SEP> 0
<tb> 289 <SEP> 0 <SEP> 0
<Tb>

<Desc/Clms Page number 18> <Desc / Clms Page number 18>

Les moyennes sont établies selon les formules standards à partir d'un minimum de trois tubes de trente mouches. The averages are established according to standard formulas from a minimum of three tubes of thirty flies.

On constate une forte protection contre le stress oxydant induit par H202 des individus femelles de génotype UY530/+ ; daGAL4/+ surexprimant DIP3K1 par rapport aux individus de contrôle de génotype daGAL4/+. Ainsi, par exemple, après 88 heures passées sur le milieu à 3% de H202, il ne reste plus d'individus de contrôle alors que 74% des individus surexprimant DIP3K1 restent vivants.  There is strong protection against H202-induced oxidative stress in female individuals of genotype UY530 / +; daGAL4 / + overexpressing DIP3K1 compared to daGAL4 / + genotype control individuals. Thus, for example, after 88 hours spent on the medium at 3% H202, there are no longer control individuals while 74% of individuals overexpressing DIP3K1 remain alive.

Tableau 5 (Figure 6E) Pourcentage de survie de Drosophiles mâles de génotype daGAL4/+ (mouches de contrôle) ou de génotype UY530/+ ; da-GAL4/+ sur un milieu contenant 5% de H202

Figure img00180001
Table 5 (Figure 6E) Percent survival of male Drosophila genotype daGAL4 / + (control flies) or genotype UY530 / +; da-GAL4 / + on medium containing 5% H 2 O 2
Figure img00180001

<tb>
<tb> % <SEP> de <SEP> survie <SEP> des <SEP> Drosophiles
<tb> temps <SEP> (heures) <SEP> génotype <SEP> daGAL4/+ <SEP> génotype <SEP> UY530/+ <SEP> ; <SEP> daGAL4/+
<tb> 0 <SEP> 100 <SEP> 100
<tb> 39 <SEP> 92 <SEP> 97
<tb> 51 <SEP> 26 <SEP> 87
<tb> 66 <SEP> 1 <SEP> 17
<tb> 75 <SEP> 0 <SEP> 7
<tb> 88 <SEP> 0 <SEP> 3
<tb> 97 <SEP> 0 <SEP> 0
<tb> 118 <SEP> 0 <SEP> 0
<tb> 138 <SEP> 0 <SEP> 0
<tb> 160 <SEP> 0 <SEP> 0
<tb> 182 <SEP> 0 <SEP> 0
<tb> 256 <SEP> 0 <SEP> 0
<tb> 289 <SEP> 0 <SEP> 0
<tb> <Tb>
<tb>% <SEP> of <SEP> survival <SEP> of <SEP> Drosophila
<tb> time <SEP> (hours) <SEP> genotype <SEP> daGAL4 / + <SEP> genotype <SEP> UY530 / + <SEP>;<SEP> daGAL4 / +
<tb> 0 <SEP> 100 <SEP> 100
<tb> 39 <SEP> 92 <SEP> 97
<tb> 51 <SEP> 26 <SEP> 87
<tb> 66 <SEP> 1 <SEP> 17
<tb> 75 <SEP> 0 <SEP> 7
<tb> 88 <SEP> 0 <SEP> 3
<tb> 97 <SEP> 0 <SEP> 0
<tb> 118 <SEP> 0 <SEP> 0
<tb> 138 <SEP> 0 <SEP> 0
<tb> 160 <SEP> 0 <SEP> 0
<tb> 182 <SEP> 0 <SEP> 0
<tb> 256 <SEP> 0 <SEP> 0
<tb> 289 <SEP> 0 <SEP> 0
<Tb>

<Desc/Clms Page number 19> <Desc / Clms Page number 19>

Les moyennes sont établies selon les formules standards à partir de deux tubes de trente mouches. The averages are established according to standard formulas from two tubes of thirty flies.

On constate une forte protection contre le stress oxydant induit par H202 des individus mâles de génotype UY530/+ ; daGAL4/+ surexprimant DIP3K1 par rapport aux individus de contrôle de génotype daGAL4/+. Ainsi, par exemple, après 66 heures passées sur le milieu à 5% de H202, seul 1% des individus de contrôle restent vivants contre 17% des individus surexprimant DIP3K1.  There is strong protection against H202-induced oxidative stress in male individuals of the UY530 / + genotype; daGAL4 / + overexpressing DIP3K1 compared to daGAL4 / + genotype control individuals. Thus, for example, after 66 hours spent on the 5% H 2 O 2 medium, only 1% of the control individuals remain alive against 17% of individuals overexpressing DIP3K1.

Tableau 6 (Figure 6F) Pourcentage de survie de Drosophiles femelles de génotype daGAL4/+ (mouches de contrôle) ou de génotype UY530/+ ; da-GAL4/+ sur un milieu contenant 5% de H202

Figure img00190001
Table 6 (Figure 6F) Percentage survival of female Drosophila genotype daGAL4 / + (control flies) or genotype UY530 / +; da-GAL4 / + on medium containing 5% H 2 O 2
Figure img00190001

<tb>
<tb> % <SEP> de <SEP> survie <SEP> des <SEP> Drosophiles
<tb> temps <SEP> (heures) <SEP> génotype <SEP> daGAL4/+ <SEP> génotype <SEP> UY530/+ <SEP> ; <SEP> daGAL4/+
<tb> 0 <SEP> 100 <SEP> 100
<tb> 39 <SEP> 75 <SEP> 95
<tb> 51 <SEP> 46 <SEP> 92
<tb> 66 <SEP> 16 <SEP> 85
<tb> 75 <SEP> 2 <SEP> 76
<tb> 88 <SEP> 0 <SEP> 51
<tb> 97 <SEP> 0 <SEP> 29
<tb> 118 <SEP> 0 <SEP> 7
<tb> 138 <SEP> 0 <SEP> 5
<tb> 160 <SEP> 0 <SEP> 0
<tb> 182 <SEP> 0 <SEP> 0
<tb> 256 <SEP> 0 <SEP> 0
<tb> 289 <SEP> 0 <SEP> 0
<tb> <Tb>
<tb>% <SEP> of <SEP> survival <SEP> of <SEP> Drosophila
<tb> time <SEP> (hours) <SEP> genotype <SEP> daGAL4 / + <SEP> genotype <SEP> UY530 / + <SEP>;<SEP> daGAL4 / +
<tb> 0 <SEP> 100 <SEP> 100
<tb> 39 <SEP> 75 <SEP> 95
<tb> 51 <SEP> 46 <SEP> 92
<tb> 66 <SEP> 16 <SEP> 85
<tb> 75 <SEP> 2 <SEP> 76
<tb> 88 <SEP> 0 <SEP> 51
<tb> 97 <SEP> 0 <SEP> 29
<tb> 118 <SEP> 0 <SEP> 7
<tb> 138 <SEP> 0 <SEP> 5
<tb> 160 <SEP> 0 <SEP> 0
<tb> 182 <SEP> 0 <SEP> 0
<tb> 256 <SEP> 0 <SEP> 0
<tb> 289 <SEP> 0 <SEP> 0
<Tb>

<Desc/Clms Page number 20> <Desc / Clms Page number 20>

Les moyennes sont établies selon les formules standards à partir d'un minimum de trois tubes de trente mouches. The averages are established according to standard formulas from a minimum of three tubes of thirty flies.

On constate une forte protection contre le stress oxydant induit par H202 des individus femelles de génotype UY530/+ ; daGAL4/+ surexprimant DIP3K1 par rapport aux individus de contrôle de génotype daGAL4/+. Ainsi, par exemple, après 75 heures passées sur le milieu à 5% de H202, seuls 2% des individus de contrôle restent vivants contre 76% des individus surexprimant DIP3K1.  There is strong protection against H202-induced oxidative stress in female individuals of genotype UY530 / +; daGAL4 / + overexpressing DIP3K1 compared to daGAL4 / + genotype control individuals. Thus, for example, after 75 hours spent on the 5% H2O2 medium, only 2% of the control individuals remain alive against 76% of the individuals overexpressing DIP3K1.

<Desc/Clms Page number 21> <Desc / Clms Page number 21>

Tableau 7 (figure 7) Comparaison des pourcentages de mouches émergées de différents génotypes en fonction du temps exprimé en heures

Figure img00210001
Table 7 (Figure 7) Comparison of percentages of emerged flies of different genotypes as a function of time expressed in hours
Figure img00210001

<tb>
<tb> % <SEP> de <SEP> Drosophiles <SEP> émergées <SEP> de <SEP> différents <SEP> génotypes
<tb> Drosophiles <SEP> mâles <SEP> Drosophiles <SEP> femelles
<tb> temps <SEP> (h) <SEP> daGAL4/+ <SEP> UY530/+ <SEP> ; <SEP> daGAL4/+ <SEP> daGAL4/+ <SEP> UY530/+ <SEP> ; <SEP> daGAL4/+ <SEP>
<tb> 200 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0
<tb> 208 <SEP> 7 <SEP> 0 <SEP> 11 <SEP> 0
<tb> 210 <SEP> 17 <SEP> 0 <SEP> 34 <SEP> 0
<tb> 213 <SEP> 33 <SEP> 0 <SEP> 71 <SEP> 4
<tb> 214 <SEP> 40 <SEP> 0 <SEP> 75 <SEP> 8
<tb> 217 <SEP> 58 <SEP> 5 <SEP> 80 <SEP> 22
<tb> 218 <SEP> 59 <SEP> 8 <SEP> 81 <SEP> 24
<tb> 219 <SEP> 81 <SEP> 8 <SEP> 90 <SEP> 48
<tb> 221 <SEP> 83 <SEP> 32 <SEP> 91 <SEP> 60
<tb> 223 <SEP> 88 <SEP> 38 <SEP> 93 <SEP> 78
<tb> 234 <SEP> 88 <SEP> 41 <SEP> 94 <SEP> 82
<tb> 237 <SEP> 89 <SEP> 60 <SEP> 94 <SEP> 84
<tb> 238 <SEP> 91 <SEP> 60 <SEP> 97 <SEP> 84
<tb> 239 <SEP> 98 <SEP> 94 <SEP> 100 <SEP> 94
<tb> 240 <SEP> 98 <SEP> 95 <SEP> 100 <SEP> 94
<tb> 243 <SEP> @ <SEP> 99 <SEP> 95 <SEP> 100 <SEP> 94
<tb> 267 <SEP> 99 <SEP> 95 <SEP> 100 <SEP> 94
<tb> 270 <SEP> 99 <SEP> 97 <SEP> 100 <SEP> 98
<tb> 272 <SEP> 100 <SEP> 100 <SEP> 100 <SEP> 100
<tb> <Tb>
<tb>% <SEP> of <SEP> Drosophila <SEP> emerged <SEP> from <SEP> different <SEP> genotypes
<tb> Drosophila <SEP> male <SEP> Drosophila <SEP> females
<tb> time <SEP> (h) <SEP> daGAL4 / + <SEP> UY530 / + <SEP>;<SEP> daGAL4 / + <SEP> daGAL4 / + <SEP> UY530 / + <SEP>;<SEP> daGAL4 / + <SEP>
<tb> 200 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0
<tb> 208 <SEP> 7 <SEP> 0 <SEP> 11 <SEP> 0
<tb> 210 <SEP> 17 <SEP> 0 <SEP> 34 <SEP> 0
<tb> 213 <SEP> 33 <SEP> 0 <SEP> 71 <SEP> 4
<tb> 214 <SEP> 40 <SEP> 0 <SEP> 75 <SEP> 8
<tb> 217 <SEP> 58 <SEP> 5 <SEP> 80 <SEP> 22
<tb> 218 <SEP> 59 <SEP> 8 <SEP> 81 <SEP> 24
<tb> 219 <SEP> 81 <SEP> 8 <SEP> 90 <SEP> 48
<tb> 221 <SEP> 83 <SEP> 32 <SEP> 91 <SEP> 60
<tb> 223 <SEP> 88 <SEP> 38 <SEP> 93 <SEP> 78
<tb> 234 <SEP> 88 <SEP> 41 <SEP> 94 <SEP> 82
<tb> 237 <SEP> 89 <SEP> 60 <SE> 94 <SEP> 84
<tb> 238 <SEP> 91 <SEP> 60 <SEP> 97 <SEP> 84
<tb> 239 <SEP> 98 <SEP> 94 <SEP> 100 <SEP> 94
<tb> 240 <SEP> 98 <SEP> 95 <SEP> 100 <SEP> 94
<tb> 243 <SEP> @ <SEP> 99 <SEP> 95 <SEP> 100 <SEP> 94
<tb> 267 <SEP> 99 <SEP> 95 <SEP> 100 <SEP> 94
<tb> 270 <SEP> 99 <SEP> 97 <SEP> 100 <SEP> 98
<tb> 272 <SEP> 100 <SEP> 100 <SEP> 100 <SEP> 100
<Tb>

A 26 C, on constate un retard important d'émergence des individus mâles et femelles de génotype UY530/+ ; daGAL4/+ surexprimant DIP3K1 par rapport aux individus de contrôle de génotype daGAL4/+. Ainsi, par exemple, après 219 heures At 26 C, there is a significant delay in the emergence of male and female individuals of genotype UY530 / +; daGAL4 / + overexpressing DIP3K1 compared to daGAL4 / + genotype control individuals. So, for example, after 219 hours

<Desc/Clms Page number 22><Desc / Clms Page number 22>

passées depuis la ponte des #ufs, 81% des individus mâles de contrôle ont émergé contre 8% des individus surexprimant DIP3K1.  After egg-laying, 81% of male control individuals emerged, compared to 8% of individuals over-expressing DIP3K1.

Tableau 8 (figure 8A) Pourcentage de survie en fonction du temps exprimé en heures de Drosophiles mâles de génotype daGAL4/+ (mouches de contrôle), de génotype UY530/+ ; daGAL4/+, de génotype UY530/UY530 et de génotype itprl664/+ sur un milieu contenant 1% de H202

Figure img00220001
Table 8 (FIG. 8A) Percentage of survival as a function of time expressed in hours of male Drosophila of genotype daGAL4 / + (control flies), genotype UY530 / +; daGAL4 / +, genotype UY530 / UY530 and genotype itprl664 / + on medium containing 1% H202
Figure img00220001

<tb>
<tb> % <SEP> de <SEP> survie <SEP> des <SEP> Drosophiles <SEP> de <SEP> différents <SEP> génotypes
<tb> temps <SEP> (heures) <SEP> daGAL4/+ <SEP> UY530/+ <SEP> ; <SEP> daGAL4/+ <SEP> UY530/UY530 <SEP> itprl664/+
<tb> 0,0 <SEP> 100 <SEP> 100 <SEP> 100 <SEP> 100
<tb> 38,0 <SEP> 86 <SEP> 95 <SEP> 88 <SEP> 98
<tb> 46,0 <SEP> 83 <SEP> 92 <SEP> 68 <SEP> 98
<tb> 62 <SEP> 53 <SEP> 86 <SEP> 37 <SEP> 94
<tb> 70,7 <SEP> 35 <SEP> 74 <SEP> 24 <SEP> 85
<tb> 86,0 <SEP> 3 <SEP> 33 <SEP> 2 <SEP> 40
<tb> 95,5 <SEP> 1 <SEP> 12 <SEP> 0 <SEP> 19
<tb> 110,0 <SEP> 0 <SEP> 1 <SEP> 0 <SEP> 4
<tb> 118,5 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 2
<tb> 134,8 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 2
<tb> 143,3 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 2
<tb> 162,0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 2
<tb> <Tb>
<tb>% <SEP> of <SEP> survival <SEP> of <SEP> Drosophila <SEP> of <SEP> different <SEP> genotypes
<tb> time <SEP> (hours) <SEP> daGAL4 / + <SEP> UY530 / + <SEP>;<SEP> daGAL4 / + <SEP> UY530 / UY530 <SEP> itprl664 / +
<tb> 0.0 <SEP> 100 <SEP> 100 <SEP> 100 <SEP> 100
<tb> 38.0 <SEP> 86 <SEP> 95 <SEP> 88 <SEP> 98
<tb> 46.0 <SEP> 83 <SEP> 92 <SEP> 68 <SEP> 98
<tb> 62 <SEP> 53 <SEP> 86 <SEP> 37 <SEP> 94
<tb> 70.7 <SEP> 35 <SEP> 74 <SEP> 24 <SEP> 85
<tb> 86.0 <SEP> 3 <SEP> 33 <SEP> 2 <SEP> 40
<tb> 95.5 <SEP> 1 <SEP> 12 <SEP> 0 <SEP> 19
<tb> 110.0 <SEP> 0 <SEP> 1 <SEP> 0 <SEP> 4
<tb> 118.5 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 2
<tb> 134.8 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 2
<tb> 143.3 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 2
<tb> 162.0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 2
<Tb>

Les moyennes sont établies selon les formules standards à partir d'un minimum de 3 tubes de trente mouches. The averages are established according to standard formulas from a minimum of 3 tubes of thirty flies.

On constate une forte protection contre le stress oxydant induit par H2O2 des mâles de génotype UY530/+ ; daGAL4/+ surexprimant DIP3K1 ou de génotype itprl664/+ ayant une réduction du niveau du récepteur IP3R par rapport aux individus de contrôle de génotype daGAL4/+. Ainsi, par exemple, après 86 heures passées sur le milieu à 1% de H202, seuls 3% des individus de contrôle restent vivants contre 33% des  There is strong protection against H2O2-induced oxidative stress in males with UY530 / + genotype; daGAL4 / + overexpressing DIP3K1 or itprl664 / + genotype with a reduction in the level of the IP3R receptor compared to the daGAL4 / + genotype control individuals. Thus, for example, after 86 hours spent on medium at 1% H2O2, only 3% of the control individuals remain alive compared with 33% of the

<Desc/Clms Page number 23><Desc / Clms Page number 23>

individus surexprimant DIP3K1 et 40% des individus sousexprimant IP3R. La lignée homozygote UY530/UY530 est de façon reproductible plus sensible que la lignée témoin au stress oxydant induit par H202.  individuals overexpressing DIP3K1 and 40% of individuals under-expressing IP3R. The homozygous UY530 / UY530 line is reproducibly more sensitive than the H202-induced oxidative stress control line.

Tableau 9 (figure 8B) Pourcentage de survie en fonction du temps exprimé en heures de Drosophiles mâles de génotype daGAL4/+ (mouches de contrôle), de génotype UY530/+ ; daGAL4/+, de génotype UY530/UY530 et de génotype itprl664/+ sur un milieu contenant de la tunicamycine à une concentration de 3 M

Figure img00230001
Table 9 (FIG. 8B) Percentage of survival as a function of time expressed in hours of male Drosophila of genotype daGAL4 / + (control flies), genotype UY530 / +; daGAL4 / +, genotype UY530 / UY530 and genotype itprl664 / + on a medium containing tunicamycin at a concentration of 3 M
Figure img00230001

<tb>
<tb> % <SEP> de <SEP> survie <SEP> des <SEP> Drosophiles <SEP> de <SEP> différents <SEP> génotypes
<tb> temps <SEP> (heures) <SEP> daGAL4/+ <SEP> UY530/+ <SEP> ; <SEP> daGAL4/+ <SEP> UY530/UY530 <SEP> itpr1664/+
<tb> 0,0 <SEP> 100 <SEP> 100 <SEP> 100 <SEP> 100
<tb> 38,0 <SEP> 93 <SEP> 97 <SEP> 98 <SEP> 100
<tb> 46,0 <SEP> 91 <SEP> 94 <SEP> 98 <SEP> 100
<tb> 62 <SEP> ! <SEP> 67 <SEP> 84 <SEP> 76 <SEP> 100
<tb> 70,7 <SEP> 56 <SEP> 75 <SEP> 66 <SEP> 100
<tb> 86,0 <SEP> 37 <SEP> 60 <SEP> 36 <SEP> 100
<tb> 95,5 <SEP> 20 <SEP> 40 <SEP> 17 <SEP> 98
<tb> 110,0 <SEP> 2 <SEP> 12 <SEP> 1 <SEP> 52
<tb> 118,5 <SEP> 0 <SEP> 2 <SEP> 0 <SEP> 18
<tb> 134,8 <SEP> 0 <SEP> 1 <SEP> 0 <SEP> 0
<tb> 143,3 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0
<tb> 162,0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0
<tb> <Tb>
<tb>% <SEP> of <SEP> survival <SEP> of <SEP> Drosophila <SEP> of <SEP> different <SEP> genotypes
<tb> time <SEP> (hours) <SEP> daGAL4 / + <SEP> UY530 / + <SEP>;<SEP> daGAL4 / + <SEP> UY530 / UY530 <SEP> itpr1664 / +
<tb> 0.0 <SEP> 100 <SEP> 100 <SEP> 100 <SEP> 100
<tb> 38.0 <SEP> 93 <SEP> 97 <SEP> 98 <SEP> 100
<tb> 46.0 <SEP> 91 <SEP> 94 <SEP> 98 <SEP> 100
<tb> 62 <SEP>! <SEP> 67 <SEP> 84 <SEP> 76 <SEP> 100
<tb> 70.7 <SEP> 56 <SEP> 75 <SEP> 66 <SEP> 100
<tb> 86.0 <SEP> 37 <SEP> 60 <SEP> 36 <SEP> 100
<tb> 95.5 <SEP> 20 <SEP> 40 <SEP> 17 <SEP> 98
<tb> 110.0 <SEP> 2 <SEP> 12 <SEP> 1 <SEP> 52
<tb> 118.5 <SEP> 0 <SEP> 2 <SEP> 0 <SEP> 18
<tb> 134.8 <SEP> 0 <SEP> 1 <SEP> 0 <SEP> 0
<tb> 143.3 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0
<tb> 162.0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0
<Tb>

Les moyennes sont établies selon les formules standards à partir d'un minimum de 3 tubes de trente mouches. The averages are established according to standard formulas from a minimum of 3 tubes of thirty flies.

On constate une forte protection contre le stress UPR induit par la tunicamycine des mâles de génotype UY530/+ ; daGAL4/+ surexprimant DIP3K1 ou de génotype itprl664/+ ayant une réduction du niveau du récepteur IP3R par rapport aux individus  There is strong protection against tunicamycin-induced UPR stress in males with UY530 / + genotype; daGAL4 / + overexpressing DIP3K1 or itprl664 / + genotype with a reduction in the level of the IP3R receptor compared to individuals

<Desc/Clms Page number 24><Desc / Clms Page number 24>

de contrôle de génotype daGAL4/+. Ainsi, par exemple, après 95,5 heures passées sur le milieu à 3 M de tunicamycine, seuls 20% des individus de contrôle restent vivants contre 40% des individus surexprimant DIP3K1 et 98% des individus sousexprimant IP3R.  daGAL4 / + genotype control. Thus, for example, after 95.5 hours spent on the 3 M medium of tunicamycin, only 20% of the control individuals remain alive against 40% of individuals overexpressing DIP3K1 and 98% of individuals under-expressing IP3R.

Tableau 10 (figure 9) Pourcentage de survie à 26 C de Drosophiles mâles de génotype daGAL4/+ et de génotype UY530/UY530 en fonction du temps exprimé en jours sur un milieu standard

Figure img00240001
Table 10 (Figure 9) Percent survival at 26 C of male Drosophila genotype daGAL4 / + and genotype UY530 / UY530 as a function of time expressed in days on a standard medium
Figure img00240001

<tb>
<tb> % <SEP> de <SEP> survie <SEP> des <SEP> Drosophiles
<tb> temps <SEP> (jours) <SEP> génotype <SEP> da-GAL4/+ <SEP> génotype <SEP> UY530/UY530
<tb> 0 <SEP> 100 <SEP> 100
<tb> 1 <SEP> 100 <SEP> 100
<tb> 2 <SEP> 100 <SEP> 99
<tb> 3 <SEP> 100 <SEP> 98
<tb> 4 <SEP> 98 <SEP> 98
<tb> 97 <SEP> 97
<tb> 97 <SEP> 97
<tb> 7 <SEP> 97 <SEP> 96
<tb> 8 <SEP> 96 <SEP> 94
<tb> 95 <SEP> 94
<tb> 10 <SEP> 95 <SEP> 94
<tb> 11 <SEP> 95 <SEP> 94
<tb> 12 <SEP> 94 <SEP> 94
<tb> 13 <SEP> 94 <SEP> 93
<tb> 14 <SEP> 94 <SEP> 93
<tb> 15 <SEP> 93 <SEP> 91
<tb> 16 <SEP> 92 <SEP> 89
<tb> 17 <SEP> 90 <SEP> 89
<tb> 18 <SEP> 90 <SEP> 88
<tb> 19 <SEP> 90 <SEP> 86
<tb> 20 <SEP> 89 <SEP> 83
<tb> 21 <SEP> 88 <SEP> 79
<tb> 22 <SEP> 87 <SEP> 76
<tb> 23 <SEP> 87 <SEP> 70
<tb> <Tb>
<tb>% <SEP> of <SEP> survival <SEP> of <SEP> Drosophila
<tb> time <SEP> (days) <SEP> genotype <SEP> da-GAL4 / + <SEP> genotype <SEP> UY530 / UY530
<tb> 0 <SEP> 100 <SEP> 100
<tb> 1 <SEP> 100 <SEP> 100
<tb> 2 <SEP> 100 <SEP> 99
<tb> 3 <SEP> 100 <SEP> 98
<tb> 4 <SEP> 98 <SEP> 98
<tb> 97 <SEP> 97
<tb> 97 <SEP> 97
<tb> 7 <SEP> 97 <SEP> 96
<tb> 8 <SEP> 96 <SEP> 94
<tb> 95 <SEP> 94
<tb> 10 <SEP> 95 <SEP> 94
<tb> 11 <SEP> 95 <SEP> 94
<tb> 12 <SEP> 94 <SEP> 94
<tb> 13 <SEP> 94 <SEP> 93
<tb> 14 <SEP> 94 <SEP> 93
<tb> 15 <SEP> 93 <SEP> 91
<tb> 16 <SEP> 92 <SEP> 89
<tb> 17 <SEP> 90 <SEP> 89
<tb> 18 <SEP> 90 <SEP> 88
<tb> 19 <SEP> 90 <SEP> 86
<tb> 20 <SEP> 89 <SEP> 83
<tb> 21 <SEP> 88 <SEP> 79
<tb> 22 <SEP> 87 <SEP> 76
<tb> 23 <SEP> 87 <SEP> 70
<Tb>

<Desc/Clms Page number 25> <Desc / Clms Page number 25>

Figure img00250001
Figure img00250001

<tb>
<tb> 24 <SEP> 86 <SEP> 63
<tb> 25 <SEP> 85 <SEP> 54
<tb> 26 <SEP> 85 <SEP> 47
<tb> 27 <SEP> 83 <SEP> 40
<tb> 28 <SEP> 81 <SEP> 33
<tb> 29 <SEP> 79 <SEP> 26
<tb> 30 <SEP> 78 <SEP> 20
<tb> 31 <SEP> 78 <SEP> 17
<tb> 32 <SEP> 77 <SEP> 14
<tb> 33 <SEP> 76 <SEP> 12
<tb> 34 <SEP> 75 <SEP> 9
<tb> 35 <SEP> 74 <SEP> 7
<tb> 36 <SEP> 73 <SEP> 6
<tb> 37 <SEP> 72 <SEP> 5
<tb> 38 <SEP> 72 <SEP> 5
<tb> 39 <SEP> 70 <SEP> 3
<tb> 40 <SEP> 68 <SEP> 3
<tb> 41 <SEP> 65 <SEP> 2
<tb> 42 <SEP> 64 <SEP> 2
<tb> 43 <SEP> 61 <SEP> 2
<tb> 44 <SEP> 58 <SEP> 1
<tb> 45 <SEP> 56 <SEP> 0
<tb> 46 <SEP> 52 <SEP> 0
<tb> 47 <SEP> 48 <SEP> 0
<tb> 48 <SEP> 44 <SEP> 0
<tb> 49 <SEP> 40 <SEP> 0
<tb> 50 <SEP> 37 <SEP> 0
<tb> 51 <SEP> 35 <SEP> 0
<tb> 52 <SEP> 34 <SEP> 0
<tb> 53 <SEP> 32 <SEP> 0
<tb> 54 <SEP> 30 <SEP> 0
<tb> 55 <SEP> 27 <SEP> 0
<tb> 56 <SEP> 24 <SEP> 0
<tb> 57 <SEP> 19 <SEP> 0
<tb> 58 <SEP> 17 <SEP> 0
<tb> 59 <SEP> 15 <SEP> 0
<tb> <Tb>
<tb> 24 <SEP> 86 <SEP> 63
<tb> 25 <SEP> 85 <SEP> 54
<tb> 26 <SEP> 85 <SEP> 47
<tb> 27 <SEP> 83 <SEP> 40
<tb> 28 <SEP> 81 <SEP> 33
<tb> 29 <SEP> 79 <SEP> 26
<tb> 30 <SEP> 78 <SEP> 20
<tb> 31 <SEP> 78 <SEP> 17
<tb> 32 <SEP> 77 <SEP> 14
<tb> 33 <SEP> 76 <SEP> 12
<tb> 34 <SEP> 75 <SEP> 9
<tb> 35 <SEP> 74 <SEP> 7
<tb> 36 <SEP> 73 <SEP> 6
<tb> 37 <SEP> 72 <SEP> 5
<tb> 38 <SEP> 72 <SEP> 5
<tb> 39 <SEP> 70 <SEP> 3
<tb> 40 <SEP> 68 <SEP> 3
<tb> 41 <SEP> 65 <SEP> 2
<tb> 42 <SEP> 64 <SEP> 2
<tb> 43 <SEP> 61 <SEP> 2
<tb> 44 <SEP> 58 <SEP> 1
<tb> 45 <SEP> 56 <SEP> 0
<tb> 46 <SEP> 52 <SEP> 0
<tb> 47 <SEP> 48 <SEP> 0
<tb> 48 <SEP> 44 <SEP> 0
<tb> 49 <SEP> 40 <SEP> 0
<tb> 50 <SEP> 37 <SEP> 0
<tb> 51 <SEP> 35 <SEP> 0
<tb> 52 <SEP> 34 <SEP> 0
<tb> 53 <SEP> 32 <SEP> 0
<tb> 54 <SEP> 30 <SEP> 0
<tb> 55 <SEP> 27 <SEP> 0
<tb> 56 <SEP> 24 <SEP> 0
<tb> 57 <SEP> 19 <SEP> 0
<tb> 58 <SEP> 17 <SEP> 0
<tb> 59 <SEP> 15 <SEP> 0
<Tb>

<Desc/Clms Page number 26> <Desc / Clms Page number 26>

Figure img00260001
Figure img00260001

<tb>
<tb> 60 <SEP> 13 <SEP> 0
<tb> 61 <SEP> 10 <SEP> 0
<tb> 62 <SEP> 9 <SEP> 0
<tb> 63 <SEP> 8 <SEP> 0
<tb> 64 <SEP> 7 <SEP> 0
<tb> 65 <SEP> 6 <SEP> 0
<tb> 66 <SEP> 6 <SEP> 0
<tb> 67 <SEP> 4 <SEP> 0
<tb> 68 <SEP> 4 <SEP> 0
<tb> 69 <SEP> 3 <SEP> 0
<tb> 70 <SEP> 2 <SEP> 0
<tb> 71 <SEP> 2 <SEP> 0
<tb> 72 <SEP> 2 <SEP> 0
<tb> 73 <SEP> 2 <SEP> 0
<tb> 74 <SEP> 2 <SEP> 0
<tb> 75 <SEP> 1 <SEP> 0
<tb> 76 <SEP> 1 <SEP> 0
<tb> 77 <SEP> 1 <SEP> 0
<tb> 78 <SEP> 1 <SEP> 0
<tb> 79 <SEP> 1 <SEP> 0
<tb> 80 <SEP> 0 <SEP> 0
<tb> <Tb>
<tb> 60 <SEP> 13 <SEP> 0
<tb> 61 <SEP> 10 <SEP> 0
<tb> 62 <SEP> 9 <SEP> 0
<tb> 63 <SEP> 8 <SEP> 0
<tb> 64 <SEP> 7 <SEP> 0
<tb> 65 <SEP> 6 <SEP> 0
<tb> 66 <SEP> 6 <SEP> 0
<tb> 67 <SEP> 4 <SEP> 0
<tb> 68 <SEP> 4 <SEP> 0
<tb> 69 <SEP> 3 <SEP> 0
<tb> 70 <SEP> 2 <SEP> 0
<tb> 71 <SEP> 2 <SEP> 0
<tb> 72 <SEP> 2 <SEP> 0
<tb> 73 <SEP> 2 <SEP> 0
<tb> 74 <SEP> 2 <SEP> 0
<tb> 75 <SEP> 1 <SEP> 0
<tb> 76 <SEP> 1 <SEP> 0
<tb> 77 <SEP> 1 <SEP> 0
<tb> 78 <SEP> 1 <SEP> 0
<tb> 79 <SEP> 1 <SEP> 0
<tb> 80 <SEP> 0 <SEP> 0
<Tb>

Les moyennes sont établies selon les formules standards à partir de sept tubes de trente mouches. The averages are established according to standard formulas from seven tubes of thirty flies.

On constate une forte réduction de la longévité des mâles de génotype UY530/UY530 par rapport aux individus de contrôle de génotype daGAL4/+. Ainsi, par exemple, après 26 jours, moins de la moitié des individus de génotype UY530/UY530 restent en vie contre 85% des individus de contrôle. Au bout de 45 jours, lorsque tous les individus de génotype UY530/UY530 sont morts, il reste encore plus de la moitié des individus de contrôle. Il faut également noter que jusqu'à 18 jours, les taux de survie sont statistiquement indiscernables, ce qui suggère que les individus de génotype UY530/UY530 ne présentent pas un taux de mortalité initial particulièrement élevé.  There is a strong reduction in the longevity of the UY530 / UY530 genotype males compared to the daGAL4 / + genotype control individuals. Thus, for example, after 26 days, less than half of the UY530 / UY530 genotype individuals remain alive compared to 85% of control individuals. After 45 days, when all UY530 / UY530 genotype individuals died, more than half of the control individuals remain. It should also be noted that up to 18 days, survival rates are statistically indistinguishable, suggesting that individuals with UY530 / UY530 genotype do not have a particularly high initial mortality rate.

<Desc/Clms Page number 27> <Desc / Clms Page number 27>

REFERENCES - Ames et al., Oxidants, antioxidants and the degenerative diseases of ageing, PNAS (1993) 90,7915-7922, - Brand, A. and Perrimon, N., Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development (1993) 118,401-415, - Clandinin et al., Inositol triphosphate mediates a RAS independent response to LET-
23 receptor tyrosine kinase activation in C.elegans, Cell (1998) 92, 523-533, - Communi et al., Calcium calmodulin dependent protein kinase 2 and protein kinase
C mediated phosphorylation and activation of D-myo-inositol 1,4,5-triphosphate 3- kinase B in astrocytes, J. Biol. Chem. (1999) 274,14734-14742, - Communi et al., D-myo-inositol triphosphate 3-kinase A is activated by receptor activation through a calcium calmodulin dependent protein kinase II phosphorylation mechanism, Embo J (1997) 16, 1943-1952, - Communi et al., Purification and biochemical properties of a high-molecular-mass inositol 1,4,5-trisphosphate 3-kinase isoenzyme in human platelets, Biochem. J. REFERENCES - Ames et al., Oxidants, antioxidants and the degenerative diseases of aging, PNAS (1993) 90, 7915-7922, - Brand, A. and Perrimon, N., Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development (1993) 118, 401-415, - Clandinin et al., Inositol triphosphate mediates at RAS independent response to LET-
Receptor tyrosine kinase activation in C. elegans, Cell (1998) 92, 523-533, Communi et al., Calcium calmodulin dependent protein kinase 2 and protein kinase
C mediated phosphorylation and activation of D-myo-inositol 1,4,5-triphosphate-3-kinase B in astrocytes, J. Biol. Chem. (1999) 274, 14734-14742, Communi et al., D-myo-inositol triphosphate 3-kinase A is activated by receptor activation through a calcium calmodulin dependent protein kinase II phosphorylation mechanism, Embo J (1997) 16, 1943- 1952, Communi et al., Purification and biochemical properties of a high-molecular-mass inositol 1,4,5-trisphosphate 3-kinase isoenzyme in human platelets, Biochem. J.

(1994) Mar 15 ; Pt 3 : -Fukuda et al., The function of inositol high polyphosphate binding proteins,
BioEssays (1997) 19, 593-603, - Gate et al., Oxidative stress induced in pathologies : the role of antioxidants, Biomed
Pharmacother (1999) 53 (4), -Irvine et al., Inositol 1,3,4,5-tetrakisphosphate as a second messenger - a spécial rôle in neurones ? Chem. Phys. Lipids (1999) 98, 49-57, - Jun et al., Enhanced hippocampal CA1 LTP but normal spatial learning in Inositol
1,4,5-triphosphate3-kinaseA-deficient mice, Learning and Memory (1998) 5,317-
330, - Katayama et al., Presenilin-1 mutations downregulate the signalling pathway of the unfolded protein response, Nature Cell Biol. (1999) 1, 479-485, - Kaufman R., Stress signaling from the lumen of the endoplasmic reticulum : coordination of gene transcriptionnal and translational controls, Genes Dev. (1999)
13, 1211-1233, - Lenaz G., Role of mitochondria in oxidative stress and ageing, Bioch. Biophys. Acta (1998) 1366, 53-67, - Merriam, 1997 : 1997.5.9Personal communication to FlyBase available from http ://flybase.bio.indiana.edu/.bin/fbpcq.html~FBrf0093303), - Morel et al., Repression of gene expression by oxidative stress, Biochem. J. (1999)
481-496, (1994) Mar. 15; Pt 3: Fukuda et al., The function of inositol high polyphosphate binding proteins,
BioEssays (1997) 19, 593-603, Gate et al., Oxidative stress induced in pathologies: the role of antioxidants, Biomed
Pharmacother (1999) 53 (4), Irvine et al., Inositol 1,3,4,5-tetrakisphosphate as a second messenger - has a special role in neurons? Chem. Phys. Lipids (1999) 98, 49-57, Jun et al., Enhanced hippocampal CA1 LTP normal purpose spatial learning in Inositol
1,4,5-triphosphate-3-kinaseA-deficient mice, Learning and Memory (1998) 5,317-
330, Katayama et al., Presenilin-1 mutations downregulate the signaling of the unfolded protein response, Nature Cell Biol. (1999) 1, 479-485, Kaufman R., Stress signaling from the lumen of the endoplasmic reticulum: coordination of transcriptional gene and translational controls, Genes Dev. (1999)
13, 1211-1233, - Lenaz G., Role of mitochondria in oxidative stress and aging, Bioch. Biophys. Acta (1998) 1366, 53-67, Merriam, 1997: 1997.5.9Personal communication to FlyBase available from http: //flybase.bio.indiana.edu/.bin/fbpcq.html~FBrf0093303), - Morel et al. Repression of gene expression by oxidative stress, Biochem. J. (1999)
481-496,

<Desc/Clms Page number 28><Desc / Clms Page number 28>

- Patel and Day, Metalloporphyrin class of therapeutic catalytic antioxidants, Trends
Pharmacol. Sci. (1999) 20, 359-364, - Patel et al., Molecular properties of inositol 1,4,5 triphosphate receptors, Cell
Calcium (1999) 25, 247-264, - Remacle et al., Low levels of reactive oxygen species as modulators of cell function,
Mut. Res. (1995)316, 103-122, - Ruef et al., Oxidative stress and atherosclerosis : its relationship to growth factors, thrombus formation and therapeutic approaches, Thromb Haemost (1999) 82 Suppl
1 : :32-7, - Soriano et al., Membrane association, localization and topology of rat inositol 1,4,5- triphosphate 3-kinase B : for membrane traffic and Ca2+ homoeostasis, Biochem. J. (1997) 324, 579-589, - Takazawa et al., Biochem J. (1990) 268, 213-217, - Takazawa et al., Molecular cloning and expression of a human brain inositol 1,4,5- trisphosphate 3-kinase, Biochem. Biophys. Res. Commun. (1991) 174,529-535, - Takazawa et al., Molecular cloning and expression of a new putative inositol 1,4,5- triphosphate 3-kinase isoenzyme, Biochem. J. (1991) 278,883-886, - Venkatesh, K. and Hasan, G., Disruption of the IP3 receptor gene of drosophila affects larval metamorphosis and ecdysone release. Curr. Biol. (1997) 7, 500-509, - Warrick et al., Suppression of polyglutamine-mediated neurodegeneration in
Drosophila by the molecular chaperone HSP70, Nat. Genet. (1999) 23,425-428, - Wodarz et al., Expression of crumbs confers apical character on plasma membrane domains of ectodermal epithelia ofDrosophila. Cell (1995) 82,67-76.- Patel and Day, Metalloporphyrin class of therapeutic catalytic antioxidants, Trends
Pharmacol. Sci. (1999) 20, 359-364, Patel et al., Molecular properties of inositol 1,4,5 triphosphate receptors, Cell
Calcium (1999) 25, 247-264, Remacle et al., Low levels of reactive oxygen species as modulators of cell function,
Mut. Res. (1995) 316, 103-122, - Ruef et al., Oxidative stress and atherosclerosis: its relationship to growth factors, thrombus formation and therapeutic approaches, Thromb Haemost (1999) 82 Suppl
1:: 32-7, - Soriano et al., Membrane Association, Localization and Topology of rat Inositol 1,4,5-triphosphate 3-kinase B: for membrane trafficking and Ca2 + homoeostasis, Biochem. J. (1997) 324, 579-589, Takazawa et al., Biochem J. (1990) 268, 213-217, Takazawa et al., Molecular cloning and expression of a 1,4,5-human brain inositol. trisphosphate 3-kinase, Biochem. Biophys. Res. Common. (1991) 174, 529-535, Takazawa et al., Molecular cloning and expression of a new putative inositol 1,4,5-triphosphate 3-kinase isoenzyme, Biochem. J. (1991) 278, 838-886, - Venkatesh, K. and Hasan, G., Disruption of the IP3 receptor gene of drosophila affects larval metamorphosis and ecdysone release. Curr. Biol. (1997) 7, 500-509, - Warrick et al., Suppression of polyglutamine-mediated neurodegeneration in
Drosophila by the molecular chaperone HSP70, Nat. Broom. (1999) 23,425-428, - Wodarz et al., Expression of crumbs confers apical character on plasma membrane domains of ectodermal epithelia ofDrosophila. Cell (1995) 82, 67-76.

Claims (18)

REVENDICATIONS 1. Utilisation de protéines comprenant ou constituées par : - les séquences SEQ ID NO : 2, SEQ ID NO : 4, SEQ ID NO : 5, SEQ ID1. Use of proteins comprising or consisting of: the sequences SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO : 6 ou SEQ ID NO : 7, - ou toute séquence dérivée des séquences SEQ ID NO: 2, SEQ IDNO: 6 or SEQ ID NO: 7, - or any sequence derived from SEQ ID NO: 2, SEQ ID NO : 4, SEQ ID NO : 5, SEQ ID NO : 6 ou SEQ ID NO : 7, notamment par substitution, suppression ou addition d'un ou plusieurs acides aminés, sous réserve qu'elle possède une activité IP3 kinase, - toute séquence homologue des séquences SEQ ID NO: 2, SEQ IDNO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, in particular by substitution, deletion or addition of one or more amino acids, provided that it has an IP3 kinase activity, - any homologous sequence of the sequences SEQ ID NO: 2, SEQ ID NO : 4, SEQ ID NO : 5, SEQ ID NO : 6 ou SEQ ID NO : 7, ayant de préférence une homologie d'au moins environ 50% avec les régions comprises entre les acides aminés en position (159) à (441), (360) à (669), (187) à (461), (195) à (472) et (331) à (604) des séquences SEQ ID NO : 2, SEQ ID NO : 4, SEQ IDNO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, preferably having a homology of at least about 50% with the regions between amino acids in position (159) to (441). ), (360) to (669), (187) to (461), (195) to (472) and (331) to (604) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO : 5, SEQ ID NO : 6 ou SEQ ID NO : 7 respectivement, sous réserve qu'elle possède une activité IP3 kinase, - ou tout fragment d'au moins environ 250 acides aminés contigus de l'une des séquences ci-dessus, sous réserve qu'il possède une activité IP3 kinase, pour la préparation de médicaments destinés au traitement de maladies liées au stress oxydatif ou au stress du réticulum endoplasmique, ou de maladies neurodégénératives, notamment rétiniennes. NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7 respectively, provided that it has an IP3 kinase activity, - or any fragment of at least about 250 contiguous amino acids of any of the sequences above , provided that it possesses an IP3 kinase activity, for the preparation of medicaments intended for the treatment of diseases related to oxidative stress or to the stress of the endoplasmic reticulum, or of neurodegenerative diseases, in particular retinal diseases. 2. Protéine caractérisée en ce qu'elle comprend ou est constituée par : - la séquence SEQ ID NO : 2, - ou toute séquence dérivée de la séquence SEQ ID NO : 2, notamment par substitution, suppression ou addition d'un ou plusieurs acides aminés, possédant une activité IP3 kinase, - toute séquence homologue de la séquence SEQ ID NO : 2, ayant de préférence une homologie d'au moins environ 61 % avec la région comprise entre les acides aminés en position (159) et (441) de la séquence SEQ ID NO : 2 et possédant une activité IP3 kinase, - ou tout fragment d'une des séquences définies ci-dessus, sous réserve qu'il possède une activité IP3 kinase, notamment tout fragment constitué d'au moins environ 250 acides aminés contigus de la séquence SEQ ID NO : 2.  2. Protein characterized in that it comprises or consists of: the sequence SEQ ID NO: 2, or any sequence derived from the sequence SEQ ID NO: 2, in particular by substitution, deletion or addition of one or more amino acids having an IP3 kinase activity, - any homologous sequence of the sequence SEQ ID NO: 2, preferably having a homology of at least about 61% with the region between the amino acids in position (159) and (441 ) of the sequence SEQ ID NO: 2 and having an IP3 kinase activity, or any fragment of one of the sequences defined above, provided that it has an IP3 kinase activity, in particular any fragment consisting of at least about 250 contiguous amino acids of the sequence SEQ ID NO: 2. 3. Protéine caractérisée en ce qu'elle comprend ou est constituée par : - la séquence SEQ ID NO : 4,  3. Protein characterized in that it comprises or consists of: the sequence SEQ ID NO: 4, <Desc/Clms Page number 30><Desc / Clms Page number 30> - ou toute séquence dérivée de la séquence SEQ ID NO : 4, notamment par substitution, suppression ou addition d'un ou plusieurs acides aminés, possédant une activité IP3 kinase, - toute séquence homologue de la séquence SEQ ID NO :4, ayant de préférence une homologie d'au moins environ 71 % avec la région comprise entre les acides aminés en position (360) et (669) de la séquence SEQ ID NO : 4 et possédant une activité IP3 kinase, - ou tout fragment d'une des séquences définies ci-dessus, sous réserve qu'il possède une activité IP3 kinase, notamment tout fragment constitué d'au moins environ 250 acides aminés contigus de la séquence SEQ ID NO : 4.  or any sequence derived from the sequence SEQ ID NO: 4, in particular by substitution, deletion or addition of one or more amino acids, having an IP3 kinase activity, any sequence homologous to the sequence SEQ ID NO: 4, having preferably a homology of at least about 71% with the region between the amino acids in position (360) and (669) of the sequence SEQ ID NO: 4 and having an activity IP3 kinase, - or any fragment of one of defined above, provided that it has an IP3 kinase activity, in particular any fragment consisting of at least about 250 contiguous amino acids of the sequence SEQ ID NO: 4. 4. Fragments de protéine selon l'une des revendications 2 ou 3 choisis parmi les séquences délimitées : - de l'acide aminé en position (159) à l'acide aminé en position (441) de la séquence SEQ ID NO : 2, - de l'acide aminé en position (360) à l'acide aminé en position (669) de la séquence SEQ ID NO : 4, - de l'acide aminé en position (187) à l'acide aminé en position (461) de la séquence SEQ ID NO : 5, - de l'acide aminé en position (195) à l'acide aminé en position (472) de la séquence SEQ ID NO : 6, - de l'acide aminé en position (331) à l'acide aminé en position (604) de la séquence SEQ ID NO : 7.  4. Fragments of protein according to one of claims 2 or 3 selected from the delimited sequences: - the amino acid in position (159) to the amino acid in position (441) of the sequence SEQ ID NO: 2, from the amino acid in position (360) to the amino acid in position (669) of the sequence SEQ ID NO: 4, from the amino acid in position (187) to the amino acid in position (461) ) of the sequence SEQ ID NO: 5, - the amino acid in position (195) to the amino acid in position (472) of the sequence SEQ ID NO: 6, - the amino acid in position (331 ) at the amino acid in position (604) of the sequence SEQ ID NO: 7. 5. Séquence nucléotidique codant pour une protéine telle que définie dans l'une des revendications 2 à 4.  5. A nucleotide sequence coding for a protein as defined in one of claims 2 to 4. 6. Séquence d'ADN qui comprend ou est constituée par : - la séquence nucléotidique SEQ ID NO : 1, - ou toute séquence nucléotidique dérivée, par dégénérescence du code génétique, de la séquence SEQ ID NO : 1 codant pour une protéine représentée par la séquence SEQ ID NO : 2, - ou toute séquence nucléotidique dérivée, notamment par substitution, suppression ou addition d'un ou plusieurs nucléotides, de la séquence SEQ ID NO : 1 codant pour une protéine dérivée de la séquence SEQ ID NO : 2 possédant une activité IP3 kinase, - ou toute séquence nucléotidique homologue de la séquence SEQ ID NO: 1, ayant de préférence une homologie d'au moins environ 50% avec 700  A DNA sequence which comprises or consists of: the nucleotide sequence SEQ ID NO: 1, or any nucleotide sequence derived, by degeneracy of the genetic code, from the sequence SEQ ID NO: 1 coding for a protein represented by the sequence SEQ ID NO: 2, or any nucleotide sequence derived, in particular by substitution, deletion or addition of one or more nucleotides, of the sequence SEQ ID NO: 1 coding for a protein derived from the sequence SEQ ID NO: 2 having an IP3 kinase activity, or any nucleotide sequence homologous to the sequence SEQ ID NO: 1, preferably having a homology of at least about 50% with 700 <Desc/Clms Page number 31><Desc / Clms Page number 31> nucléotides contigus situés dans le domaine délimité du nucléotide en position (1425) au nucléotide en position (3969) de la séquence SEQ ID NO : 1, codant pour une protéine homologue de la séquence SEQ ID NO : 2 et possédant une activité IP3 kinase, - ou tout fragment de la séquence nucléotidique SEQ ID NO : 1 ou des séquences nucléotidiques définies ci-dessus, ledit fragment étant de préférence constitué d'au moins environ 700 nucléotides contigus situés dans le domaine délimité au nucléotide en position (1425) au nucléotide en position (3969) de ladite séquence et codant pour une protéine qui possède une activité IP3 kinase, - ou toute séquence nucléotidique complémentaire des séquences ou fragments susmentionnés, - ou toute séquence nucléotidique susceptible d'hybrider dans des conditions stringentes avec la séquence complémentaire de l'une des séquences ou de l'un des fragments susmentionnés.  contiguous nucleotides located in the delimited domain of the nucleotide in position (1425) to the nucleotide in position (3969) of the sequence SEQ ID NO: 1, coding for a protein homologous to the sequence SEQ ID NO: 2 and having an IP3 kinase activity, or any fragment of the nucleotide sequence SEQ ID NO: 1 or the nucleotide sequences defined above, said fragment preferably consisting of at least about 700 contiguous nucleotides located in the domain delimited at the nucleotide in position (1425) at the nucleotide in position (3969) of said sequence and encoding a protein which has an IP3 kinase activity, or any nucleotide sequence complementary to the aforementioned sequences or fragments, or any nucleotide sequence capable of hybridizing under stringent conditions with the complementary sequence of one of the sequences or one of the aforementioned fragments. 7. Séquence d'ADN qui comprend ou est constituée par : - la séquence nucléotidique SEQ ID NO : 3, - ou toute séquence nucléotidique dérivée, par dégénérescence du code génétique, de la séquence SEQ ID NO : 3 codant pour une protéine représentée par la séquence SEQ ID NO : 4, - ou toute séquence nucléotidique dérivée, notamment par substitution, suppression ou addition d'un ou plusieurs nucléotides, de la séquence SEQ ID NO : 3 codant pour une protéine dérivée de la séquence SEQ ID NO : 4 possédant une activité IP3 kinase, - ou toute séquence nucléotidique homologue de la séquence SEQ ID NO: 3, ayant de préférence une homologie d'au moins environ 50% avec 700 nucléotides contigus situés dans le domaine délimité du nucléotide en position (3234) au nucléotide en position (6021) de la séquence SEQ ID NO : 3, codant pour une protéine homologue de la séquence SEQ ID NO : 4 et possédant une activité IP3 kinase, - ou tout fragment de la séquence nucléotidique SEQ ID NO : 3 ou des séquences nucléotidiques définies ci-dessus, ledit fragment étant de préférence constitué d'au moins environ 700 nucléotides contigus situés dans le domaine délimité au nucléotide en position (3234) au nucléotide en position (6021) de ladite séquence et codant pour une protéine qui possède une activité IP3 kinase, - ou toute séquence nucléotidique complémentaire des séquences ou fragments susmentionnés, - ou toute séquence nucléotidique susceptible d'hybrider dans des conditions stringentes avec la séquence complémentaire de l'une des séquences ou de l'un des fragments susmentionnés.  A DNA sequence which comprises or consists of: the nucleotide sequence SEQ ID NO: 3, or any nucleotide sequence derived, by degeneracy of the genetic code, from the sequence SEQ ID NO: 3 coding for a protein represented by the sequence SEQ ID NO: 4, or any nucleotide sequence derived, in particular by substitution, deletion or addition of one or more nucleotides, of the sequence SEQ ID NO: 3 coding for a protein derived from the sequence SEQ ID NO: 4 having an IP3 kinase activity, or any nucleotide sequence homologous to the sequence SEQ ID NO: 3, preferably having a homology of at least about 50% with 700 contiguous nucleotides located in the delimited domain of the nucleotide at position (3234) at nucleotide in position (6021) of the sequence SEQ ID NO: 3, coding for a protein homologous to the sequence SEQ ID NO: 4 and possessing an IP3 kinase activity, or any fragment of the sequence n uucleotide SEQ ID NO: 3 or the nucleotide sequences defined above, said fragment preferably consisting of at least about 700 contiguous nucleotides located in the domain delimited at the nucleotide in position (3234) to the nucleotide in position (6021) of said sequence and coding for a protein which has an IP3 kinase activity, or any nucleotide sequence complementary to the aforementioned sequences or fragments, or any nucleotide sequence capable of hybridizing under stringent conditions with the sequence complementary to one of the sequences or of one of the aforementioned fragments. <Desc/Clms Page number 32> <Desc / Clms Page number 32> 8. Vecteur recombinant, notamment plasmide, cosmide, phage ou ADN de virus, contenant une séquence nucléotidique selon l'une des revendications 5,6 ou 7.  8. Recombinant vector, in particular plasmid, cosmid, phage or DNA of virus, containing a nucleotide sequence according to one of claims 5, 6 or 7. 9. Vecteur recombinant selon la revendication 8, contenant les éléments nécessaires à l'expression dans une cellule hôte des polypeptides codés par les acides nucléiques selon l'une des revendications 5, 6 ou 7, insérés dans ledit vecteur.  9. Recombinant vector according to claim 8, containing the elements necessary for the expression in a host cell of the polypeptides encoded by the nucleic acids according to one of claims 5, 6 or 7, inserted in said vector. 10. Cellule hôte, choisie notamment parmi les bactéries, les virus, les levures, les champignons, les plantes ou les cellules de mammifères, ladite cellule hôte étant transformée, notamment à l'aide d'un vecteur recombinant selon l'une des revendications 8 ou 9.  10. Host cell, chosen in particular from bacteria, viruses, yeasts, fungi, plants or mammalian cells, said host cell being transformed, in particular with the aid of a recombinant vector according to one of the claims. 8 or 9. 11. Oligonucléotides antisens ou ARN messager antisens dérivés des séquences nucléotidiques selon l'une des revendications 5,6 ou 7.  11. Antisense oligonucleotides or antisense messenger RNA derived from nucleotide sequences according to one of claims 5,6 or 7. 12. Composition pharmaceutique caractérisée en ce qu'elle comprend une protéine ou un fragment de protéine selon l'une des revendications 2 à 4, en association avec un vecteur pharmaceutique acceptable .  12. Pharmaceutical composition characterized in that it comprises a protein or a protein fragment according to one of claims 2 to 4, in association with an acceptable pharmaceutical carrier. 13. Utilisation de l'une des protéines selon l'une des revendications 2 à 4, pour la préparation de médicaments destinés au traitement de maladies liées au stress oxydatif.  13. Use of one of the proteins according to one of claims 2 to 4, for the preparation of medicaments for the treatment of diseases related to oxidative stress. 14. Utilisation de l'une des protéines selon l'une des revendications 2 à 4, pour la préparation de médicaments destinés au traitement de maladies liées au stress du réticulum endoplasmique.  14. Use of one of the proteins according to one of claims 2 to 4, for the preparation of medicaments for the treatment of diseases related to the stress of the endoplasmic reticulum. 15. Utilisation de l'une des protéines selon l'une des revendications 2 à 4, pour la préparation de médicaments destinés au traitement de maladies neurodégénératives, notamment rétiniennes.  15. Use of one of the proteins according to one of claims 2 to 4, for the preparation of medicaments for the treatment of neurodegenerative diseases, including retinal diseases. 16. Cellules animales qui contiennent, dans leur génome, une séquence nucléotidique codant pour l'une des protéines selon l'une des revendications 2 à 4, et notamment une séquence nucléotidique selon l'une des revendications 5 à 7.  16. Animal cells which contain, in their genome, a nucleotide sequence encoding one of the proteins according to one of claims 2 to 4, and in particular a nucleotide sequence according to one of claims 5 to 7. <Desc/Clms Page number 33> <Desc / Clms Page number 33> 17. Animal transgénique non humain contenant des cellules selon la revendication 16, et qui surexprime l'une des protéines définies dans l'une des revendications 2 à 4.  17. A transgenic non-human animal containing cells according to claim 16, which overexpresses one of the proteins defined in one of claims 2 to 4. 18. Animal transgénique non humain contenant des cellules selon la revendication 16, dans lequel l'expression du gène, codant pour l'une des protéines définies dans les revendications 2 à 4, est supprimée. A transhuman non-human animal containing cells according to claim 16, wherein the expression of the gene encoding one of the proteins defined in claims 2 to 4 is deleted.
FR0011397A 2000-09-07 2000-09-07 USE OF IP3 KINASES FOR THE PREPARATION OF NEW DRUGS IP3 KINASES AND CORRESPONDING DNA SEQUENCES Withdrawn FR2813612A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
FR0011397A FR2813612A1 (en) 2000-09-07 2000-09-07 USE OF IP3 KINASES FOR THE PREPARATION OF NEW DRUGS IP3 KINASES AND CORRESPONDING DNA SEQUENCES
AU2001289981A AU2001289981A1 (en) 2000-09-07 2001-08-31 Use of ip3 kinases for preparing medicines for treating oxidative stress-relateddiseases
PCT/FR2001/002708 WO2002020742A1 (en) 2000-09-07 2001-08-31 Use of ip3 kinases for preparing medicines for treating oxidative stress-related diseases

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
FR0011397A FR2813612A1 (en) 2000-09-07 2000-09-07 USE OF IP3 KINASES FOR THE PREPARATION OF NEW DRUGS IP3 KINASES AND CORRESPONDING DNA SEQUENCES

Publications (1)

Publication Number Publication Date
FR2813612A1 true FR2813612A1 (en) 2002-03-08

Family

ID=8854046

Family Applications (1)

Application Number Title Priority Date Filing Date
FR0011397A Withdrawn FR2813612A1 (en) 2000-09-07 2000-09-07 USE OF IP3 KINASES FOR THE PREPARATION OF NEW DRUGS IP3 KINASES AND CORRESPONDING DNA SEQUENCES

Country Status (3)

Country Link
AU (1) AU2001289981A1 (en)
FR (1) FR2813612A1 (en)
WO (1) WO2002020742A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7067720B2 (en) * 2001-01-12 2006-06-27 Pioneer Hi-Bred International, Inc. Inositol polyphosphate kinase genes and uses thereof
JP2007527235A (en) * 2004-01-28 2007-09-27 エクセリクシス， インク． ITPKs as modifiers of the IGFR pathway and methods of use

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
ALDASHEV A A ET AL: "SPECIFIC PROTEINS SYNTHESIZED IN HUMAN LYMPHOCYTES DURING HYPOXIA", AMERICAN JOURNAL OF PHYSIOLOGY, vol. 261, no. 4 SUPPL., 1991, pages 92 - 96, XP000994719, ISSN: 0002-9513 *
CHOI K Y ET AL: "Biochemical characterization of the transgenic mouse deficient of inositol 1,4,5-trisphosphate 3-kinase.", FASEB JOURNAL, vol. 10, no. 6, 1996, Joint Meeting of the American Society for Biochemistry and Molecular Biology, the American Society for Investigative Pathology and the American Association of Immunologists;New Orleans, Louisiana, USA, pages A1396, XP000993531, ISSN: 0892-6638 *
CLANDININ THOMAS R ET AL: "Inositol trisphosphate mediates a RAS-independent response to LET-23 receptor tyrosine kinase activation in C. elegans.", CELL, vol. 92, no. 4, 20 February 1998 (1998-02-20), pages 523 - 533, XP002151613, ISSN: 0092-8674 *
DATABASE GENEMBL 24 March 2000 (2000-03-24), ADAMS ET AL.: "Drosophila melanogaster genomic scaffold 1420000013386055 section 19 of 63", XP002167629 *
DATABASE GENEMBL 27 March 2000 (2000-03-27), ADAMS ET AL.: "Drosophila melanogaster genomic scaffold 142000013386053 section 9 of 30", XP002167631 *
DATABASE SWISS 1 May 2000 (2000-05-01), ADAMS ET AL.: "Drosophila melanogaster CG1639 protein", XP002167632 *
DATABASE SWISS 1 May 2000 (2000-05-01), ADAMS ET AL.: "Drosphila melanogaster CG4026 protein", XP002167630 *
SORIANO SALVADOR ET AL: "Membrane association, localization and topology of rat inositol 1,4,5-trisphosphate 3-kinase B: Implications for membrane traffic and Ca-2+ homoeostasis.", BIOCHEMICAL JOURNAL, vol. 324, no. 2, 1997, pages 579 - 589, XP001001598, ISSN: 0264-6021 *

Also Published As

Publication number Publication date
WO2002020742A1 (en) 2002-03-14
AU2001289981A1 (en) 2002-03-22

Similar Documents

Publication Publication Date Title
Arden et al. Regulation of the FoxO family of transcription factors by phosphatidylinositol-3 kinase-activated signaling
Nogami et al. Reduced expression of the ATRX gene, a chromatin‐remodeling factor, causes hippocampal dysfunction in mice
WO1998055618A9 (en) Mitofusin genes and their uses
US11122784B2 (en) Parkinson&#39;s disease model and methods
WO2005104836A2 (en) Drosophila models for diseases affecting learning and memory
EP3066199A1 (en) Snorna, compositions and uses
Farhadi et al. How Transmembrane Inner Ear (TMIE) plays role in the auditory system: a mystery to us
ronique Monnier et al. Control of oxidative stress resistance by IP3 kinase in Drosophila melanogaster
Qurashi et al. HSPC300 and its role in neuronal connectivity
US20100175140A1 (en) Leucine-rich repeat kinase (LRRK2) drosophila model for parkinson&#39;s disease: wildtype1 (WT1) and G2019S mutant flies
FR2813612A1 (en) USE OF IP3 KINASES FOR THE PREPARATION OF NEW DRUGS IP3 KINASES AND CORRESPONDING DNA SEQUENCES
Lee et al. Abnormal Chemosensory Jump 6 Is a Positive Transcriptional Regulator of the Cholinergic Gene Locus in DrosophilaOlfactory Neurons
CA2780247A1 (en) Induction of apomixis in sexually reproducing cultivated plants and use for producing totally or partially apomictic plants
Kanzaki et al. Transgene correction maintains normal cochlear structure and function in 6-month-old Myo15a mutant mice
Rodriguez et al. Sink or swim: Does a worm paralysis phenotype hold clues to neurodegenerative disease?
US7176188B2 (en) Method of lethally sensitizing human and animal cells
KR102543554B1 (en) Mice displaying an improved memory flexibility and uses thereof
EP1259606A2 (en) Compositions useful for regulating parkin gene activity
US20130047273A1 (en) Genetically altered animal specimen and related methods
Petridi The role of LRRK2 in the pathogenesis of Parkinson's disease
Matsui et al. Current trends in basic research on Parkinson’s disease: from mitochondria, lysosome to α-synuclein
Kaas Genetic analysis of Shudderer, the lithium-responsive neurological mutant of Drosophila melanogaster
Mendoza Investigation of mitochondrial inheritance in the smut fungus sporisorium reilianum.
Dolen Genetic interaction between Fmr1 and Grm5: a role for mGluR5 in the pathogenesis of fragile X syndrome
Bruders Genetic Links Between Pigmentation and Eye Defects in the Domestic Pigeon (Columba livia)

Legal Events

Date Code Title Description
ST Notification of lapse