FR2801319A1 - CONSTRUCTION OF NUCLEIC ACID CARRIER OF A GENE EXPRESSION REGULATING SYSTEM - Google Patents

Abstract

This invention relates to a nucleic acid construct comprising at least one sequence coding for a protein regulating the expression of at least one gene of interest, in which the activity of said regulatory protein is modulated as a function of the presence or the absence of a pharmacological agent and the amount of said regulatory protein produced is a function of the partial pressure of oxygen.

Description

<Desc / Clms Page number 1>

 The present invention relates to a regulated system for the production of proteins of interest, which allows both expression of these proteins as a function of partial oxygen pressure and modulation by a pharmacological agent.

 The regulation of transgenes is an essential subject in gene therapy. Therapeutic proteins must in fact be produced in more or less wide concentration intervals, the lower limit being represented by the efficacy threshold, the upper limit being the toxic dose not to be exceeded.

 To date, several regulatory systems have been developed.

 The expression of genes can in particular be controlled by tetracycline, which blocks the activity of a regulatory protein, tTa, capable of activating a transgene in the absence of the antibiotic (US 5,814,618; Bujard et al, 1992; Shockett et al., 1995). The article Rinsch et al., 1997 also mentions the possibility of regulating the expression of genes by tetracycline, but proposes as an alternative another regulatory system, which would itself be a function of the partial pressure of oxygen brought into the tissues .

 International patent application WO 95/21927 discloses in this sense a nucleotide construct comprising a transgene operably linked to a sequence for controlling the expression inducible in hypoxia. The system described aims to express proteins of therapeutic interest in a specific manner in hypoxic tissues. However, this system does not provide for any negative control, however essential for safety reasons, to avoid exceeding toxic doses.

 The authors of the present invention have now designed a regulatory system which meets this expectation, a system whose activity varies according to the oxygenation state of the tissues and which can be inhibited by a pharmacological agent.

 A more particular subject of the invention is a nucleic acid construct comprising at least one sequence coding for a protein regulating the expression of at least one gene of interest, in which

<Desc / Clms Page number 2>

 the activity of said regulatory protein is modulated as a function of the presence or absence of a pharmacological agent and the amount of said regulatory protein produced is a function of the partial pressure of oxygen.

 By “nucleic acid construction” is meant in particular a nucleic acid such as DNA or RNA, linear or circular. It may for example be a plasmid or a modified viral vector, such as an adenovirus vector.

 By "partial oxygen pressure" is meant the partial oxygen pressure in the cells into which the nucleic acid constructs of the invention are transferred.

 By "regulatory protein" is meant any protein capable of activating transcription in eukaryotic cells (we then speak of a trasactivator) or any protein capable of inhibiting this transcription (we then speak of a repressor).

 Preferably, said regulatory protein is an activator protein for the expression of said gene of interest under hypoxic conditions and in the absence of said pharmacological agent.

 In a first embodiment of the invention, said sequence coding for a regulatory protein can be associated with at least one element, designated element H, placed upstream or downstream of said sequence, said element H allowing expression of the protein inducible regulator in hypoxic conditions.

 The H elements allowing an inducible expression under hypoxic conditions can consist of "HRE" ("Hypoxia Response Element").

 This HRE regulatory element of genes induced by hypoxia has been identified through the study of the regulation of the gene encoding erythropoietin (EPO). Located 3 ′ of its open reading phase, it is recognized by the HIF1 transactivating protein complex ("Hypoxia Inducible Factor") whose DNA binding activity depends on the partial oxygen pressure (Semenza et al., 1992). HRE oxygen response element is required

<Desc / Clms Page number 3>

 hypoxic induction of the erythropoietin gene in the fetal liver, kidney and hepatic cell lines. Also present in other genes, it is recognized by the HIF1 complex in all the cell types studied (Wang et al., 1993). The consensus sequence present in all of the inducible genes is as follows: 5'-RCGTG-3 '(Semenza et al., 1996). It constitutes the HRE element.

 Preferably, at least one HRE element is placed upstream of said sequence coding for a regulatory protein.

 Advantageously, the construction according to the invention comprises one or more copies of the elements allowing induction of expression under hypoxic conditions, preferably about ten copies.

 The construction of the invention may also comprise one or more copies of such elements placed downstream of the sequence coding for the regulatory protein.

 In a second embodiment of the invention, it is possible, in association with said element H or independently (in the absence thereof), to provide a nucleic acid construct, in which said sequence coding for a regulatory protein comprises at least one element, designated element D, which destabilizes the regulatory protein in normoxia.

 Such an element D may in particular be a fragment of the HIF1a protein, in particular a sequence coding for all or part of the ODD domain of 200 amino acids of the HIF1a protein.

 All of the cellular processes resulting from the decrease in the oxygen concentration have the effect of modulating the activity of the HIF1 complex. Activation of HIF1 does not require that the gene be transcribed more than it is already in normoxia, but that the protein be stabilized and modified (Semenza et al., 1992). When Hep3B or HeLa cells are cultured in hypoxia the amount of HIF1 [alpha] increases considerably and very quickly (maximum induction in less than 4 hours). After returning to normoxia, the subunit disappeared in less than 15 minutes. Hypoxia has the effect of increasing the stability of the protein HIF1a. The protein is permanently degraded to normoxia, proteolysis being due to the recognition of

<Desc / Clms Page number 4>

 HIF1a by ubiquitin followed by degradation of the complex by the proteasome (Salceda et al., 1997; Huang et al., 1998). A 200 amino acid region of HIF1 a, the ODD ("oxygen-dependent degradation") domain is the target of degradation. Deprived of this domain, HIF1a binds to ARNT and constitutively activates the expression of genes controlled by an HRE motif (Huang et al., 1998). This 200 amino acid domain has been studied in terms of transactivation and induction capacity (Jiang et al., 1997; Pugh et al., 1997). Region 549 to 575 of the HIF1a protein of human origin contains a relatively weak transactivation domain, inducible in hypoxia. Inducibility is mainly linked to the decrease in protein stability in normoxia, a condition in which this small protein region is the target of the proteasome (Salceda et al., 1997; Huang et al., 1998).

 The pharmacological agent used can in particular be tetracycline, said sequence coding for a protein regulating the expression of a gene of interest then advantageously comprising a tetR element, of the tetracycline resistance system of the bacterial transposon Tn10.

 In bacteria containing this transposon, in the absence of tetracycline, the TetR protein binds in the form of a dimer to operating sequences located in the tetracycline operon, thus blocking the transcription of the gene coding for the protein for resistance to tetracycline. In the presence of the antibiotic, tetR can no longer bind to operating sequences; the inhibitory effect on the transcription of the resistance gene is then abolished. In 1992, Gossen and Bujard carried out the fusion of the proteins tetR and VP16 (protein of the virus Herpes Simplex Virus essential for the transcription of the early viral genes). In genetically modified eukaryotic cells, the resulting chimeric protein (tTA: "Tetracycline controlled TransActivator") is capable of activating the expression of reporter genes located downstream of tetO operator sequences. In the presence of tetracycline the chimeric protein tTA does not bind to tetO and does not activate the transcription of its target genes.

 According to a preferred embodiment, the tTA set is used, as a sequence coding for a regulatory protein allowing inhibition of expression by tetracycline.

<Desc / Clms Page number 5>

 Advantageously, an element D destabilizing the transactivator in normoxia can be introduced into tTA, for example between the sequences coding for tetR and VP16.

 It is also possible to use, in accordance with the present invention, elements of a tetracycline-inducible system which are derived, by modifications, from the operon containing the sequences described above (Gossen et al, 1995). Such modifications are only admissible if they do not significantly affect the functionality of the system.

 The pharmacological agent used can also be a tetracycline analog, such as anhydrotetracycline, doxycycline, chlorotetracycline, epioxytetracycline, etc.

 The nucleic acid construct of the invention carrying the regulatory system described above can be used to modulate the expression of at least one gene of interest, coding for a protein itself designated "protein of interest" , which can be an endogenous protein and / or a recombinant protein. In the latter case, two embodiments are possible: (a) either at least one sequence coding for a recombinant protein of interest, the expression of which is regulated by the regulatory protein as defined above; (b) either the nucleic acid construct comprising the regulatory system as described above is associated with a second nucleic acid construct comprising at least one sequence coding for a recombinant protein of interest, the expression of which is regulated by the regulatory protein as defined above.

 A more particular subject of the invention is therefore, in the first embodiment above (a), a nucleic acid construct as defined above further comprising a sequence coding for a recombinant protein of interest, including expression is regulated by said regulatory protein.

 The subject of the invention is also, in the second embodiment (b), a nucleic acid composition, comprising:

<Desc / Clms Page number 6>

 i) a nucleic acid construct comprising at least one sequence coding for a protein regulating the expression of at least one gene of interest, in which the activity of said regulatory protein is inhibited in the presence of a pharmacological agent and the quantity of said regulatory protein produced is a function of the partial pressure of oxygen; and ii) a nucleic acid construct comprising at least one sequence coding for a recombinant protein of interest, the expression of which is regulated by the regulatory protein carried by the nucleic acid construction of point i).

 The invention also relates to a kit for the regulated production of at least one protein of interest, comprising: i) a first container containing a nucleic acid construct comprising at least one sequence coding for a protein regulating the expression of at least one gene of interest, in which the activity of said regulatory protein is inhibited in the presence of a pharmacological agent and the amount of said regulatory protein produced is a function of the partial pressure of oxygen; and ii) a second container containing a nucleic acid construct comprising at least one sequence coding for a recombinant protein of interest, the expression of which is regulated by the regulatory protein carried by the nucleic acid construct of point i).

 In all cases, the expression of the recombinant protein of interest must be able to be modulated by said regulatory protein. For this, the nucleotide sequence coding for the recombinant protein is associated with target elements of the regulatory protein.

 When the regulatory protein comprises a tetR element, the recombinant protein of interest is associated with a tetO target operator element.

 A particularly preferred embodiment of the invention relates to a system with two vectors, namely a composition or a kit comprising: - a nucleic acid construct comprising, from upstream to downstream: ten HRE units, a promoter sequence and the tTA transactivator modified by the presence of an element destabilizing the protein in normoxia, and

<Desc / Clms Page number 7>

 a nucleic acid construct comprising, from upstream to downstream, a tetO operating sequence, a promoter sequence and a sequence coding for a protein of interest.

 The regulatory system of the invention allows a high degree of regulation, without attenuating the expression of the gene of interest, which on the contrary can be very strong.

 Said protein of interest can be a protein of therapeutic interest. It may for example be erythropoietin (EPO), particularly useful in the treatment of anemias or else a factor stimulating the proliferation of endothelial cells, useful in the treatment of ischemias.

 It can also be a cytotoxic or cytostatic protein having an action against the proliferation or survival of unwanted cells, particularly useful in the treatment of tumors, in particular solid tumors, such as interleukins or interferons.

 The protein of interest can also be a protein capable of transforming a prodrug into a drug effective against the proliferation or survival of unwanted cells such as tumor cells.

 It is also possible to use the nucleic acid construct of the invention comprising at least one sequence coding for a protein regulating the expression of at least one gene of interest, in which the activity of said protein regulator is modulated according to the presence or absence of a pharmacological agent and the amount of said regulatory protein produced is a function of the partial pressure of oxygen, to modulate the expression of at least one endogenous protein of interest .

 To this end, a sequence coding for a regulatory protein is chosen or constructed so that it can act specifically on the promoter of the endogenous protein or proteins of interest.

 The nucleotide constructs and compositions according to the invention are useful as a medicament, in the context of gene therapy.

 The subject of the invention is a pharmaceutical composition comprising at least one nucleic acid construct as defined

<Desc / Clms Page number 8>

 previously, in combination with a pharmaceutically acceptable vehicle.

 A more particular subject of the invention is the use of a nucleic acid construct or a composition according to the invention for the manufacture of a medicament intended for the treatment, in a patient, of conditions involving cellular hypoxia .

 Among such conditions, there may be mentioned in particular anemia, ischemia or cancer.

 The invention finally relates to a therapeutic treatment method in which a patient requiring such treatment is administered an effective amount of a composition or of a nucleotide construct as described above.

 The nucleic acid constructs according to the invention can be administered to a vertebrate in the form of a viral vector, or can be administered as such.

 The target vertebrates are preferably mammals, more preferably humans.

 The nucleic acid construct or composition of the invention can in particular be used in a naked form, free from any vehicle promoting transfer to the target cell, such as anionic liposomes, cationic lipids, microparticles, for example microparticles of gold, precipitating agents, for example calcium phosphate, or any other agent facilitating transfection. In this case, the polynucleotide can be simply diluted in a physiologically acceptable solution, such as a sterile solution or a sterile buffer solution, in the presence or in the absence of a vehicle.

 Alternatively, a nucleic acid construct of the invention can be combined with agents which facilitate transfection. It can be, among others, (i) associated with a chemical agent which modifies cellular permeability such as bupivacaine; (ii) encapsulated in liposomes, possibly in the presence of additional substances which facilitate transfection; or (iii) associated with cationic lipids or microparticles of silica, gold or tungsten.

<Desc / Clms Page number 9>

 When the nucleic acid constructs of the invention cover microparticles, these can be injected intradermally or intraepidermally by the gene gun technique, "gene gun" (WO 94/24263).

 The amount to be used as a drug depends in particular on the construction of nucleic acid itself, the individual to whom this nucleic acid is administered, the mode of administration and the type of formulation, and the pathology. Generally, a therapeutically or prophylactically effective amount varying from about 0.1 g to about 1 mg, preferably from about 1 g to about 800 g and, preferably from about 25 g to about 250 g, can be administered to human adults.

 The nucleic acid constructs of the invention can be administered by any conventional route of administration, such as in particular parenterally. The choice of route of administration depends in particular on the formulation chosen, but also on the condition to be treated. In the case of treatment of a solid tumor, it is advantageous to inject the constructs of the invention at the site of the tumor.

 The invention also relates to a host cell modified by a nucleic acid construct as defined above.

 Such a modified cell can in particular be cloned. They can be cell lines, primary cells, for example of the myoblast or fibroblast type.

 Eukaryotic cells modified ex vivo may be useful for implantation in recipient animals or humans. In this case, it may for example be mammalian cells of the myoblast, fibroblast or hematopoietic type.

 The present invention therefore also relates to a process for obtaining a modified eukaryotic cell ex vivo in which at least one nucleic acid construct as defined above is transferred to a cell, so that said construct penetrates so stable in the nucleus of said cell. A cell can also be modified by the presence of at least two vectors:

<Desc / Clms Page number 10>

 one consisting of a nucleic acid construct comprising at least one sequence coding for a regulatory protein for the expression of a gene of interest, in which the activity of said regulatory protein is inhibited in the presence of a pharmacological agent and the amount of said regulatory protein produced is a function of the partial pressure of oxygen, the other consisting of a nucleic acid construct comprising a sequence coding for a recombinant protein of interest, the expression of which is regulated by said regulatory protein.

 In the context of "cell" therapy, the present invention also relates to a method of therapeutic treatment in which cells thus modified are implanted in recipient patients.

 Advantageously, transformed hematopoietic stem cells producing erythropoietin under the control of the regulatory system as described above can for example be implanted in patients with chronic anemia.

 The methods of implantation of cells depend in particular on the type of cells and the disease aimed for.

 Cells such as myoblasts or fibroblasts can advantageously be incorporated into biocompatible capsules. Among the capsular systems that can be used, there may be mentioned in particular AN69 (poly (acrylonitrile-sodium methallylsulfonate), Serguera et al, 1999), PTFE (polytetrafluoroethylene, Brauker et al, 1998), LAPA (Alginate polylysine alginate, Hortelano et al, 1996), silicone (Page et al, 1997), polypropylene (Sagot et al, 1995), PAN / PVC (polyacrylonitrile, polyvinyl chloride, Kordower et al, 1997), PES (polyethersulfone, Rinsch et al, 1997) or agarose (Taniguchi et al, 1997). Then these capsules can be implanted subcutaneously, intraperitoneally or any other appropriate place, compatible with the envisaged therapy.

 The figures and examples below illustrate the invention without limiting its scope.

<Desc / Clms Page number 11>

LEGENDS OF THE FIGURES:
FIG. 1 represents the diagrams of the nucleic acid constructs of the invention: vectors 3A, 8A, 12A and 12A-hH104 as described in Example 1 below.

 FIG. 2 represents a diagram illustrating the association of 10 double-stranded fragments (containing the promoter region of PGK1 conferring hypoxic inducibility) after cloning at the SalI site of pBluescript II KS +.

The orientation of the arrows follows the direction of the sequence as it occurs in the promoter of the murine PGK1 gene, from upstream to downstream. In the plasmids associating tTAk and HRE10, the orientation is always the same: Clal towards Bsp120l from 5 'to 3' relative to tTAk.

 FIG. 3 represents a graph illustrating the result of an experiment of transfections carried out in parallel with five different plasmids (20ng) containing multiple HREs placed upstream, or upstream and downstream relative to the transactivator, 400ng of reporter plasmid and 50ng of plasmid pCMVss-Gal. The last two columns represent the expression of the reporter in the absence of a transactivator (background noise). Inductions are indicated for each vector on the first line. The relative values Luciferase / -galactosidase in normoxia and in hypoxia are indicated on the third and fourth lines.

 FIG. 4A represents a graph illustrating the result of a study of hypoxic induction as a function of the reporter / transactivator ratio. FIG. 4B represents a graph illustrating the result of a study of the effect of the presence of a destabilizing fragment in the transactivator. The cells were transfected with 5 to 100 ng of the plasmids containing the transactivator under the control of the HREs elements, 400 ng of pTRE-Luc and 50 ng of pCMV-pGal.

The error bars represent the standard deviation between two values. The amounts of the transactivating plasmid are indicated below the graph, on the first line. The hypoxic inductions are indicated on the second line. The penultimate series of values (-TA) corresponds to the expression of the reporter in the absence of a transactivator. The last series represents the level

<Desc / Clms Page number 12>

 of expression which can be achieved with the plasmid pTet-tTAk (Schockett et al., 1995) unmodified by the presence of HREs.

 FIG. 5 represents a graph illustrating the double regulation, pharmacological and hypoxic, as a function of the quantity of the plasmids 3A or ptet-tTak. The cells were transfected with either 5.20 or 100 ng of the 3A or ptet-tTAk transactivating plasmids, 400ng of pTRE-Luc reporter plasmid and 50ng of pCMV-pGal normalizing plasmid, or with 400ng of pGL3 and 50 ng of pCMV-pGal either with 400 ng of pTRE-Luc and 50 ng of pCMV-ssGal but without transactivator (-TA). Below the graph, the amounts of transfected activating plasmids (5.20 or 100 ng) are indicated, the hypoxic induction in the absence of tetracycline (Hypo / Normo, -tet) and in the presence of tetracycline (Hypo / Normo, + tet) as well as the degree of inhibition of expression by tetracycline in hypoxia (- / + tet, Hypo) and in normoxia (- / + tet, Normo). The error bars represent the standard deviations calculated on the results of an experiment carried out in triplicate.

 Also attached is a sequence listing, in which the sequence SEQ ID No. 1 represents the sequence of the open reading phase of tTAk-hH104 (after introduction of the hH104 fragment in tTAk at the site BsiWI corresponding to the sequence CGTACG). The sequence corresponding to the 104 amino acids of HIF1a as well as the BsiWI sites are highlighted and blackened.

 The sequences SEQ ID No. 3,4, 5,6, 7 and 8 correspond to the oligonucleotides HRE1, HRE2, hH1, hH3, PTAK5 and PTAK6 respectively.

 EXAMPLES: # - Nucleic acid constructs: 1) Materials: a) pBluescript Il KS + plasmids (Stratagene 212207), pTet-tTak and pTet-splice (Gibco, 10583-011), pTRE-Luc (Clontech, K1620-1) , pTK-hygro (Clontech,

<Desc / Clms Page number 13>

6153-1), pCMV-pGal (Stratagene, 200 388) and pGL3-Control (Promega, E1741) were purchased. pTet-tTak is a modified version (Shockett et al., 1995) of the vector described in 1992 (Gossen et al., 1992). It contains the tetO element and the minimal CMV promoter in place of the CMV promoter / enhancer. Some nucleotides have been modified so that the first ATG of tTA is in a Kozak context (tTAk). Downstream of tTAk are the intronic sequence of the Small t Antigen and the early polyadenylation sequence of SV40. b) Cells
All of the constructions were carried out in E.Coli JM109 (Promega) or DH5 [alpha] (Clontech) cells. c) oligonucleotides (Genset): HRE1: 5'TCGAGTGTCACGTCCTGCACGACG3 '(SEQ ID n ° 3) ID n 6) PTAK5: 5'GGCCTTGAATTGATCATATGC3 '(SEQ ID n 7) PTAK6: 5'GTCGTCGTCCGGGAGATC3' (SEQ ID n 8)
2) HRE and tTAk association a) pBS-HRE10
The oligonucleotides HRE1 and HRE2 were phosphorylated, hybridized one on the other then subcloned at the SalI site of pBluescript II KS +.

After studying the number and orientation of the HRE1 / HRE2 hybrids, a plasmid containing 10 copies of the hybrid (plasmid pBS-HRE10) was selected.

 This plasmid contains 10 times the following sequence:

<Desc / Clms Page number 14>

(-313) 5'-CGTCGTGCAGGACGTGACA-3 '(-295) (SEQ ID n 9)
3'-GCAGCACGTCCTGCACTGT-5 '(SEQ ID no 10)
The numbers -295 and -313 correspond to the positions of the bases with respect to the ATG initiator of the open reading phase of the murine PGK1 gene. The sequence-312 to-295 corresponds to that of the oligonucleotide P18 capable of conferring on a minimal promoter a hypoxic inducibility (Firth et al., 1994, Dachs et al., 1997). FIG. 2 illustrates the orientation of the hybrids as they have been subcloned in the plasmid pBluescript II KS +, from T3 to T7.

The orientation of the arrows follows the direction of the sequence as it occurs in the promoter of the murine PGK1 gene, from upstream to downstream. b) HRE10 B-CIK (Bsp120l-Clal / Klenow) and HRE10 AH / K (Asp718l-HindIII / Klenow) Fragments
The plasmid pBS-HRE10 was digested with Bsp1201 + ClaI or else with Asp7181 + Hindlll. The cohesive ends of the fragments containing 10 copies of the HRE1 / HRE2 hybrid were filled with Klenow and then purified. c) pHRE10 (TATA) -tTAK (vector 3A)
The tetO box (Xhol-Stul fragment) contained in the plasmid pTet-tTak was eliminated and the Xhol site was filled with Klenow. The HRE10 BC / K fragment was then introduced in place of the tetO elements. the resulting plasmid contains 10 elements of response to hypoxia located upstream of the TATA box of the CMV promoter and of the open reading phase of tTAk. d) pBSHRE10 (TATA) -tTAk (vector 8A)
The Stul / NotI fragment of pTet-tTAk (TATA box + tTAk + intron + polyadenylation signal) was inserted into pBS-HREio digested with EcorV and

<Desc / Clms Page number 15>

Notl. The resulting plasmid contains 10 elements of response to hypoxia located upstream of the TATA box of the CMV promoter and of the open reading phase of tTAk and is very similar to the vector 3A. e) pBS (TATA) -tTAk
The Stul / NotI fragment of pTet-tTAk (TATA box + tTAk + intron + polyadenylation signal) was inserted into pBluescript KS II + digested with EcorV and NotI. f) 3'UTR-HREm fragment
The HRE10 AH / K fragment was introduced into the NotI site of pBS (TATA) tTAk, the ends of which were made blunt. The resulting plasmid contains 10 elements of response to hypoxia located downstream of the SV40 early polyadenylation signal. This plasmid was then digested with Spel and Nael and the fragment containing the intron, the polyadenylation sequence as well as the HRE copies was purified. g) pHRE10 (TATA) -tTAkHRE10 (vector 12A)
The 3'UTR-HREio fragment was introduced in place of the intron and of the polyadenylation signal of the plasmid 3A (digested with Spel and Nael). The resulting plasmid contains from 5 'to 3': HRE, a TATA box, the open reading phase of tTAk, an intron, a polyadenylation signal and 10 other HREs.

3) Association hH104. HRE and tTAk a) Production of the hH104 fragment by PCR
CDNA obtained from human tumor cells

<Desc / Clms Page number 16>

 mammaries was prepared and subjected to 30 cycles of amplification 30 "94 c, 30" 50 C, 30 "72 C with the system" Expand High Fidelity PCR system "(Roche), in the presence of the oligonucleotides hH1 and hH3.

The PCR product was digested with BsiWI. b) pTet Plasmid (TATA) -hH104tTAk
The hH104 fragment digested by BsiWI was introduced into the BsiWI site of the plasmid pTet-tTAk, located in the open reading phase of tTAk between the DNA binding domain tetR and the transactivation domain VP16. This fragment contains 104 amino acids derived from hHIF1 (aa 531 to 634).

The orientation and the sequence of hH104 were verified by sequencing using the primers HH1, HH3, PTAK5 and PTAK6. PTAK 5 and 6 are located on either side of hH104, in tTA.

The resulting protein contains 444 amino acids: tTAk (336 amino acids) plus 108 amino acids including 104 belonging to HIF1, a proline at each end and two additional amino acids due to the creation of a second BsiWI site (Arginine and Threonine). c) pHRE10 Plasmids (TATA) -hH104tTAkHRE10 (Vector 12AhH104)
The Ndel-Spel fragment of pTet (TATA) -hH104tTAk was introduced into the vector 12A digested with Ndel and Spel.

4) Association of pTet and murine erythropoietin: plasmid pTetmEPO
The murine erythropoietin cDNA found in the plasmid pBluescript (Naffakh et al., 1995) was purified after digestion with Asp7181, filling of the cohesive end then digestion with Sali and introduced between the Sali and EcorV sites of pTet -Splice.

<Desc / Clms Page number 17>

II - Hypoxic induction after transient transfection:
1) C2C12 cell material
Murine myoblast line cells (ATCC, CRL-1772) cultivated in: DMEM (Gibco), SVF 10% (Hyclone), penicillin 100 iu / mi (Gibco), streptomycin 100 g / ml (Gibco), glutamine 2mM (Gibco).

2) Methods a) Transient transfections
50,000 C2C12 cells are seeded per well in a 24-well plate (TPP, ATGC). The following day, the cells are transfected with polyethyleneimine (PEI: ExGen500, EUROMEDEX) as follows: the cells are rinsed twice with PBS 1X and then placed in the presence of 200 l of OptiMEM (Gibco). In a tube A are dispensed 2.5 l of PEI and 7.5 l of 0.9% NaCl; in a tube B 300 to 600 ng of plasmid are diluted in 10 l of 0.9% NaCl. The 10 l of tube A are mixed with the 10 l of tube B. After 10 minutes, 20 l of the transfection mixture are distributed in each well to be transfected. After 2 hours, 1 ml of culture medium with 10% FCS is added to each well. The culture supernatants as well as the cells are recovered approximately 36 hours later for analysis. b) Determination of luciferase after transient transfections
To measure the efficiency of regulating the expression of the transactivator under different conditions (normoxia, hypoxia), the cells are transiently cotransfected with three plasmids: one contains the transactivator with possibly regulatory systems, the other is a reporter vector coding for luciferase (pTRE-luc), the third code for

<Desc / Clms Page number 18>

 ss-galactosidase under the control of the CMV promoter / enhancer and makes it possible to normalize the results with respect to each other. The luciferase and ss-galactosidase activities are assayed respectively with the "Luciferase Assay Reagent" (Promega) and the "p-Gal reporter gene assay" (Roche).

3) Results: a) Effect of the presence of the HRE hybrids on the expression of the tTAk transactivator
In vectors 3A and 8A, ten successive elements of the promoter of the murine PGK1 gene are located upstream of the TATA box and of tTAk.

 The vector 12A combines two series of these elements, upstream and downstream of tTAk.

 In order to define the best vector in terms of expression and regulation efficiency in murine muscle cells, the authors of the invention transfected C2C12 cells with three types of plasmids: 20ng of vector coding for the regulated transactivator (TA ), 400ng of pTRE-Luc (reporter) and 50ng pCMV-pGal (normalizer). The results are shown in Figure 3.

 If there is not enough protractor (relative to the amount of transactivator), it is not possible to define the optimal induction. For this reason, the authors of the invention have studied the expression and induction efficiency as a function of the amount of transactivator (5 to 100 ng) and for a fixed amount of reporter (400 ng). The results of FIG. 4A show that there is an optimal transactivator / reporter ratio. Maximum inducibility is obtained with 1 / 80th to 1 / 20th of a transactivator. Beyond this, the quantity of reporter is no longer sufficient to satisfy the large number of transactivator molecules produced in hypoxia. This results in a more rapid increase in expression in normoxia than in hypoxia and therefore a decrease in induction. In this experiment, it should be noted that the expression levels reached by the vectors 3A, 8A and 12A can be as strong as that reached

<Desc / Clms Page number 19>

with 100ng of the original vector, pTet-tTAk. However, 50 to 100 ng of transactivating plasmid is required to equal this level, a quantity for which induction is no longer optimal. b) Effect of the presence of a destabilizing fragment on the degree of induction
In order to obtain a maximum level of expression (as it is with 50 to 100 ng of transactivating plasmid) but an always high induced level, a protein destabilizing element has been introduced into the transactivator. Theoretically this element (hH104) is ubiquitinated and degraded by the proteasome in normoxia. The comparative results of the study of the expression of two vectors, 12A and 12A-hH104 are presented in FIG. 4B.

For 100 ng of transactivating plasmid, an inducibility four to five times greater is observed in the presence of this element than in its absence. Thanks to the introduction of part of HIF1a into the tTAk transactivator, it is possible to reach a high level of hypoxic expression while maintaining minimal expression in normoxia.

III - Physiological and pharmacological regulation in transient transfection 1) Material
Same as paragraph II and tetracycline (Sigma, T-7660)
2) Methods
Identical to those used in paragraph II.

 Tetracycline is added to the culture media at a rate of 1 g / ml, after the two hours of transfection.

<Desc / Clms Page number 20>

3) Results
The degrees of expression as well as the capacities of the regulatory system to allow both hypoxic induction and pharmacological inhibition of the expression of the reporter gene have been studied for example by comparison of the vectors 3A and pTet-tTAk (FIG. 5).

 The results obtained confirm: - that the level of expression obtained in hypoxia with the plasmid 3A is at least as strong if not more than with the original vector ptet-tTAk.

 - that the hypoxic induction is all the more important as the quantity of plasmid transactivator 3A is low. and show: - that the expression levels obtained with plasmids 3A and ptettTAk are much higher than what is observed with an equivalent amount of a vector containing the luciferase gene under the control of a promoter and an enhancer from the SV40 virus genome (pGL3).

 - that the presence of tetracycline in the culture media makes it possible to completely inhibit the activity of the transactivator, whether in normoxia or in hypoxia (we can in this sense compare the levels of expression achieved with the vectors 3A or ptet- tTAk, in normoxia or hypoxia under tetracycline and the levels observed under the same conditions in the absence of transactivator).

IV - Physiological and pharmacological regulation in stable transfection
1) Material: DAE7 cells cells of a subclone derived from the Da-1 cell line (Setoguchi et al., 1987). Cells proliferating in the same medium as that in which the C2C12 cells proliferate, with an additional 2 u / ml of erythropoietin.

<Desc / Clms Page number 21>

2) Methods: a) Stable transfections
100,000 C2C12 cells are seeded in a petri dish (10 cm, Beckton). The following day the cells are transfected as follows: in tube A are dispensed 20 g of DNA in 750 l of OptiMEM (Gibco). In tube B 60 l of lipofectamine (Gibco) are diluted in 690 l of OptiMEM. Solution B is mixed with solution A. After 45 minutes, 4.5 ml of OptiMEM are added to the transfection mixture. The cells are rinsed twice with a 1 × PBS solution and then placed in the presence of the 6 ml from the transfection mixture. After 2 hours, 24 ml of culture medium with 10% fetal calf serum are added to the dish. The medium is changed 6 hours after transfection. After 2 days, the cells are trypsinized, counted and distributed by 50,000 in new petri dishes.

The next day, three days after transfection, the cells are cultured in the presence of hygromycin (Roche) 160 g / ml. Eight days after the start of selection, the clones are trypsinized and the cells are seeded in 6-well plates in the presence of hygromycin. At approximately 50% confluence, the cells are trypsinized, frozen and possibly subcultured for future analyzes (assay of erythropoietin, degree of regulation). b) Determination of erythropoietin after stable transfection.

 To measure the efficiency of the expression and the regulation of the expression of the transactivator under different conditions, 1000 selected C2C12 cells are seeded in 24-well plates. The next day, the environment is changed. Three days later, the medium is removed and the cells are counted. The amount of erythropoietin is measured using DaE7 cells which proliferate in the presence of erythropoietin (Sakaguchi et al., 1987). 3000 DaE7 cells are cultured for three days in the presence of either known amounts of recombinant human EPO (EPREX) or in the presence of several dilutions of the samples to be assayed. Cell viability is

<Desc / Clms Page number 22>

 measured using a colorimetric test (based on the metabolism of the substrate WST-1, Roche). By comparison of the optical densities of the samples and those of the reference range, the concentration of erythropoietin per mililiter of culture is determined. It can be reduced either to the number of C2C12 cells, or to the protein quantity of C2C12 cells as well as to the secretion time.

2) Results:
Establishment of a stable line and measurement of the degree of regulation
C2C12 cells were transfected as indicated above with the following three plasmids: 1.3 g pTK-Hygro, 18 g pTet-mEPO and 2 g 12A-hH104. After selection under hygromycin, the authors of the invention isolated and measured the production of erythropoietin in normoxia and hypoxia from 107 independent clones. Some clones produce a lot of EPO but in an unregulated manner, others produce EPO in a regulated but in a small quantity, and some combine the two qualities. Two clones (no E4B50 and E4B57) were selected.

 For these two clones, one thousand cells were seeded in the presence or absence of tetracycline. The next day, the media were changed (+/- tetracycline) and the cells were placed in normoxia (20% 02) or hypoxia (1% 02), with or without tetracycline for three days. At the end of this period (4 days in total, including 3 days of secretion), the amounts of erythropoietin present in the supernatants were assayed and the cells were counted. The cells of the two clones were therefore placed in four different conditions, normoxia without tetracycline, normoxia with tetracycline, hypoxia without tetracycline, hypoxia with tetracycline. For each condition and for each clone, the experiments were carried out six times.

The study of the results obtained with the range points makes it possible to define the

<Desc / Clms Page number 23>

 total amount of erythropoietin secreted per well. The value 22n / (1 + 2n + 22n), with n = number of divisions per day, is the normalization factor which makes it possible to define approximately, after multiplying this value by the quantity of EPO per well, the quantity of erythropoietin secreted on the last day.

The count of the number of cells at the end of secretion also makes it possible to normalize the results with respect to a fixed number of cells. The results are given here in erythropoietin units per million cells per day.

 The means of the erythropoietin concentrations obtained from an experiment carried out six times per condition are given in table 1; Tables 2 and 3 respectively give the significance and the degree of regulation obtained.

Table 1: Average EPO (ul / 106 cells / day) clone E4B50 clone E4B57 Normoxia - tet 10.2 +/- 2.2 1.2 +/- 0.2 Normoxia + tet 6.7 +/- 1.6 <0.8 Hypoxia - tet 242.8 +/- 68.7 194.5 +/- 41.1 Hypoxia + tet 8.2 +/- 2.9 <1.2
Table 2: Significance (t-student) clone E4B50 clone E4B57 Normoxia-tet / + tet p = 0.08 Normo / Hypo - tet p = 0.00009 p = 0.000009 Hypoxia -tet / + tet p = 0.00008 p <0.000009

<Desc / Clms Page number 24>

Table 3: Degree of regulation clone E4B50 clone E4B57 hypoxic induction 23.8 162 tetracycline inhibition 29.6> 162
The calculation of the means of the quantities of erythropoietin secreted shows that it is possible to obtain both a strong hypoxic induction and a strong inhibition by tetracycline, both greater than 150 times (clone E4B57). The differences observed between normoxia and hypoxia (without tetracycline) as well as in hypoxia with and without tetracycline are clearly significant (p <0.0001).

 Finally, the plasmid constructs used during this work make it possible to produce quantities of erythropoietin comparable to what they are with a strong and ubiquitous promoter (Rinsh et al., 1997).

V. Preclinical study of the regulatory potential by ex vivo transfer
A. Implantation of myoblasts or fibroblasts modified ex vivo
Cells (myoblasts, fibroblasts in particular) are genetically modified by transformation with at least one nucleic acid construct of the invention, so that these cells produce erythropoietin (or another protein) under the double control of the partial pressure of oxygen and tetracycline (or an analog). These cells are inserted into bio-compatible capsules about one centimeter long, type AN69 ((poly (acrylonitrile-sodium methallylsulfonate), Serguera et al, 1999), or PES (polyethersulfone, Rinsch et al, 1997), then implanted subcutaneously.

<Desc / Clms Page number 25>

B. Implantation of hematopoietic cells modified ex vivo
The modification and then the stable implantation of hematopoietic stem cells have the great advantage of ensuring long-term treatment of patients with chronic anemia. For this reason, hematopoietic stem cells are transduced with retroviral vectors containing at least one nucleic acid construct as defined above and transferred to recipient animals previously irradiated.

VI. Highlighting the potential for regulation by direct transfer
The introduction of DNA into the muscles by electrotransfer is an efficient and simple process to carry out. Furthermore, erythropoietin secreted by muscle cells is perfectly active in vivo. For these reasons, it is interesting to test the levels of expression and regulation by the partial pressure of oxygen and by the tetracycline of proteins produced from the vectors as described above, after muscular injection.

<Desc / Clms Page number 26>

 BIBLIOGRAPHICAL REFERENCES - Brauker et al, Sustained expression of high levels of human factor IX from human cells implanted within an immunoisolation device into athymic rodents. Hmm. Gene Ther. 1998; -Dachs GU, Patterson AV, Firth JD, Ratcliffe PJ, Townsend KM, Stratford IJ and Harris AL. Targeting gene expression to hypoxic tumor cells.

Nat Med 1997; 3: 515-520.

 - Firth JD, Ebert BL, Pugh CW and Ratcliffe PJ. Oxygen-regulated control elements in the phosphoglycerate kinase 1 and lactate dehydrogenase A genes: similarities with the erythropoietin 3 'enhancer. Proc Natl Acad Sci U S A 1994; 6496-500.

 - Gossen M and Bujard H. Tight control of gene expression in mammalian cells by tetracycline- responsive promoters. Proc Natl Acad Sci U S A 1992; 5547-5551.

 - Gossen M, Freundlieb S, Bender G, Muller G, Hillen W and Bujard H. Transcriptional activation by tetracyclines in mammalian cells.

Science 1995; 268: 1766-1769 - Hortelano G et al, Delivery of human factor IX in mice by encapsulated recombinant myoblasts: A novel approach towards allogeneic gene therapy of hemophilia B. Blood, 1996; -Huang LE, Gu J, Schau M and Bunn HF. Regulation of hypoxia- inducible factor 1 alpha is mediated by an 02- dependent degradation domain via the ubiquitin-proteasome pathway. Proc Natl Acad Sci U S A 1998; 95: 7987-7992.

 - Jiang BH, Zheng JZ, Leung SW, Roe R and Semenza GL.

Transactivation and inhibitory domains of hypoxia-inducible factor 1 alpha.

Modulation of transcriptional activity by oxygen tension. J Biol Chem 1997;
19253-19260.

 - Kordower et al, Cellular delivery of NGF does not alter the expression of beta-amyloid immunoreactivity in young or aged nonhuman primates. Exp. Neurol., 1997; 145: 586-591.

<Desc / Clms Page number 27>

 - Naffakh N, Henri A, Villeval JL, Rouyer FP, Moullier P, Blumenfeld N, Danos 0, Vainchenker W, Heard JM and Beuzard Y. Sustained delivery of erythropoietin in mice by genetically modified skin fibroblasts. Proc Natl Acad Sci U S A 1995; 92: 3194-3198.

 - Page SM et al, An ex vivo keratinocyte model for gene therapy of hemophilia B. J. Invest. Dermatol. 1997 ; 109: 139-145.

 - Pugh CW, O'Rourke JF, Nagao M, Gleadle JM and Ratcliffe PJ.

Activation of hypoxia-inducible factor-1; definition of regulatory domains within the alpha subunit. J Biol Chem 1997; 272: 11205-11214.

 - Rinsch C, Regulier E, Deglon N, Dalle B, Beuzard Y and Aebischer P. A gene therapy approach to regulated delivery of erythropoietin as a function of oxygen tension. Hum Gene Ther 1997; 1881-1889 - Sagot et al, Polymer encapsulated cell lines genetically engineered to release ciliary neurotropic factor can slow down progressive motor neuronopathy in the mouse. Eur J. Neurosci, 1995; 7: 1313-1322.

 - Sakaguchi M, Koishihara Y, Tsuda H, Fujimoto K, Shibuya K, Kawakita M and Takatsuki K. The expression of functional erythropoietin receptors on an interleukin- 3 dependent cell line. Biochem Biophys Res Commun 1987; 146: 7-12.

 - Salceda S and Caro J. Hypoxia-inducible factor 1 alpha (HIF-1 alpha) protein is rapidly degraded by the ubiquitin-proteasome system under normoxic conditions - Its stabilization by hypoxia depends on redox-induced changes. J Biol Chem 1997; 22642-22647.

 - Semenza GL and Wang GL. A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Mol Cell Biol 1992; 12: 5447-5454.

 - Semenza GL, Jiang BH, Leung SW, Passantino R, Concordet JP, Maire P and Giallongo A. Hypoxia response elements in the aldolase A, enolase 1, and lactate dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1. J Biol Chem 1996; 32529-32537.

 - Serguera C. et al, Control of erythropoietin secretion by

<Desc / Clms Page number 28>

 doxycycline or mifepristone in mice bearing polymer-encapsulated engineered cells. Hmm. Gene Ther., 1999; 10: 375-383.

 - Shockett P, Difilippantonio M, Hellman N and Schatz DG. A modified tetracycline-regulated system provides autoregulatory, inducible gene expression in cultured cells and transgenic mice. Proc Natl Acad Sci U S A 1995; 92: 6522-6526.

 - Taniguchi et al, Constant delivery of proinsulin by encapsulation of transfected cells, J. Surg. Res. 1997 ; 70: 41-45.

 - Wang GL and Semenza GL. General involvement of hypoxiainducible factor 1 in transcriptional response to hypoxia. Proc Natl Acad Sci U S A 1993; 4304-4308.

Claims (21)

1. Nucleic acid construct comprising at least one sequence coding for a regulatory protein for the expression of at least one gene of interest, in which the activity of said regulatory protein is modulated as a function of the presence or of the absence of a pharmacological agent and the amount of said regulatory protein produced is a function of the partial pressure of oxygen.  2. A nucleic acid construct according to claim 1, in which said regulatory protein is a protein activating the expression of said gene of interest under hypoxic conditions and in the absence of said pharmacological agent.  3. Nucleic acid construct according to one of claims 1 or 2, in which said sequence coding for a regulatory protein is associated with at least one element, designated element H, placed upstream or downstream of said sequence, said element H allowing expression of the inducible regulatory protein under hypoxic conditions.  4. A nucleic acid construct according to claim 3, in which said element H is a hre element, preferably placed upstream of said sequence coding for a regulatory protein.  5. Nucleic acid construct according to one of claims 1 to 4, wherein said sequence coding for a regulatory protein comprises at least one element, designated element D, which destabilizes the regulatory protein in normoxia.  6. Nucleic acid construct according to claim 5, in which said element D is a sequence coding for all or part of the ODD domain of 200 amino acids of the protein HIF1 [alpha].  7. Nucleic acid construct according to one of the preceding claims, in which the activity of said regulatory protein is modulated by tetracycline or a tetracycline analog, as a pharmacological agent. <Desc / Clms Page number 30>  8. A nucleic acid construct according to claim 7, in which said sequence coding for a protein regulating the expression of at least one gene of interest comprises a tetR element.  9. A nucleic acid construct according to claim 8, comprising, from upstream to downstream, at least one hre sequence, and a tTA sequence comprising a tetR element fused to a sequence coding for a regulatory protein, the VP16 protein.  10. Nucleic acid construction according to one of the preceding claims, further comprising at least one sequence coding for a recombinant protein of interest, the expression of which is regulated by said regulatory protein.  11. Nucleic acid construct according to claim 10, in which said sequence coding for a recombinant protein of interest is associated with at least one tetO element.  12. Nucleic acid construct according to any one of claims 10 or 11, wherein said protein of interest is a protein of therapeutic interest, such as erythropoietin.  13. A nucleic acid composition comprising at least: - a nucleic acid construct as defined in any one of claims 1 to 9; a nucleic acid construct comprising at least one sequence coding for a recombinant protein of interest, the expression of which is regulated by the regulatory protein carried by the nucleic acid construct as defined in any one of claims 1 at 9.  14. A nucleic acid composition according to claim 13, in which said sequence coding for at least one recombinant protein of interest is associated with at least one tetO element.  15. A nucleic acid composition according to any one of claims 13 or 14, wherein said protein of interest is a protein of therapeutic interest, such as erythropoietin.  16. Nucleic acid construct according to any of claims 1 to 12 or composition according to any of claims 13 to 15, useful as a medicament. <Desc / Clms Page number 31>  17. Kit for the regulated production of a protein of interest, comprising: a first container containing a nucleic acid construct as defined in any one of claims 1 to 9 and a second container containing an acid construct nucleic acid comprising at least one sequence coding for a recombinant protein of interest, the expression of which is regulated by the regulatory protein carried by the nucleic acid construct as defined in any one of claims 1 to 9.  18. Host cell modified by a nucleic acid construct as defined in one of claims 1 to 12.  19. Method for obtaining a eukaryotic cell modified ex vivo into which a nucleic acid construct as defined in one of claims 1 to 12 is transferred and optionally a nucleic acid construct comprising a sequence coding for a recombinant protein of interest, the expression of which is regulated by said regulatory protein in a cell, such that said construct penetrates stably into the nucleus of said cell.  20. Use of a nucleic acid construct according to any one of claims 1 to 12 or of a composition according to any one of claims 13 to 15 for the manufacture of a medicament intended for treatment, in a patient , conditions involving cellular hypoxia.  21. Use according to claim 20, wherein said condition is anemia, cancer or ischemia.