FR2794755A1 - PROCESS FOR CIRCULARIZING OLIGONUCLEOTIDES AROUND A DOUBLE-STRANDED NUCLEIC ACID, THE STRUCTURES OBTAINED AND THEIR APPLICATIONS - Google Patents

Abstract

The invention concerns a method for circularizing an oligonucleotide which consists in: incubating a double stranded nucleic acid comprising a target sequence, with a single stranded oligonucleotide comprising a central part capable of being fixed on said target sequence, bound by spacer segments to 5' and 3' terminal sequences, said sequences being: either a) complementary to the sequence of an oligonucleotide matrix; or x) partly complementary to each other, so as to be capable of being hybridized to each other forming a double strand while preserving a single stranded end, which is capable of being hybridized with the terminal sequence of another oligonucleotide, called loop-oligonucleotide, which has a hairpin structure, with one single stranded part and a folded part forming a double strand; contacting, in the first case a) the complex formed with said oligonucleotide matrix, in conditions enabling the hybridization of the 3' and 5' ends, adjacently, with the matrix, and in the case x), contacting the complex formed with said loop-oligonucleotide, in conditions enabling, through hybridization of the free ends of the single stranded oligonucleotides and of the loop-oligonucleotide, the juxtaposition of the 3' and 5' ends of said oligonucleotides; ligating the hybridized ends so as to circularize the oligonucleotide around the double stranded nucleic acid and, optionally, isolating the circularized structure. The invention also concerns the applications and the resulting structures obtained for diagnostic and therapeutic purposes.

Description

<Desc / Clms Page number 1>

PROCESS OF CI RCULARI SATION OF OLIGONUCLEOTIDE S AROUND A
DOUBLE-STRANDED NUCLEIC ACID, THE STRUCTURES OBTAINED
AND THEIR APPLICATIONS
The subject of the invention is a method of ci rcula ris ati on of oligonucleotides around a double-stranded nucleic acid, the structures obtained and their applications.

 Short chain oligonucleotides have already been described which can specifically bind to double helix DNA to form a triple helix or triplex structure. The fixation takes place at the level of the large groove of the DNA double helix with establishment of non-covalent interactions.

 Such oligonucleotides have been developed with the aim of artificially controlling the expression of specific genes at the level of transcription, but can be used for other applications, such as for example the purification of plasmids.

 It has also been proposed to chemically modify the triplex-forming oligonucleotides to induce irreversible modifications of the target nucleic acids.

Target cleavage can be achieved with an oligonucleotide covalently linked to an Fe-EDTA or Cu-phenanthroline complex, while psoralen-oligonucleotide conjugates can be crosslinked to their target after UV irradiation.

 Interest has been focused in recent years on cyclic oligonucleotides due to their

<Desc / Clms Page number 2>

 topological and recognition properties of nucleic acids.

 Compared to linear oligonucleotides, cyclic oligonucleotides make it possible to design improved genetic analysis tools, in particular thanks to their efficient amplification by loop replication.

 The link between a preformed oli gonuucleoti and a short double-stranded DNA fragment can be carried out in two topologically distinct ways.

 In one of these pathways, the oligonucleotide binds in the large DNA groove while remaining outside this duplex. In the other way, the rculai oligonucleotide encircles the duplex after one of the ends of the latter has slipped into this rcle oli gonucleoti di that. This second structure can be inserted into a longer double-stranded DNA fragment, but this procedure requires the initiation of binding steps whose performance and ef fi cacy can be limits.

 The invention relates to a new method allowing the ci rcula ris ati on of an oli gonucleoti directly around a double-stranded nucleic acid, whatever its length and topological state and, without the need to enzymatically or chemically modify the nucleic acid target. This process is based on the development of a three-strand complex, comprising an oligonucleotide which can be wound around

<Desc / Clms Page number 3>

 of the double strand of nucleic acid, and which may be cyclic.

 The ci rcula ris ati on method according to the invention is characterized in that it comprises the incubation of a double-stranded nucleic acid comprising a target sequence, with. or a single-stranded oligonucleotide a) comprising a central part capable of binding to said target sequence, linked by spacer sequences to terminal sequences in 5 ′ and 3 ′, themselves complementary to the sequence of a matrix oli gonuucleoti di that either a single-stranded oligonucleotide b) whose terminal sequences in 5 ′ and 3 ′ can be fixed adjacent to the target sequence, said incubation step being carried out under conditions allowing the fixing of the single oligonucleotide strand a) or b) at the level of the target sequence by formation of binding links, which leads to the winding of the oligonucleotide around its target, - in the first case a), contacting of the complex formed with this matrix oli gonuucleotide that, under conditions allowing the hyb ri dati on of the 5 'and 3' ends, adjacent to the matrix, - the li gati on of the hybridized ends, so thatregularize the oligonucleotide around the double-stranded nucleic acid and, if desired,

<Desc / Clms Page number 4>

 - Isolation of the circularized structure, where the target nucleic acid is padlocked with the circular oligonucleotide, followed where appropriate by its purification.

 It will be observed that, advantageously, this ci rcula ris ati on technique can be carried out without chemical or enzymatic modification of the target nucleic acid and only involves a short sequence on the target.

 The double-stranded nucleic acid used according to the invention is constituted, according to one embodiment, by a DNA in double helix.

 It will be noted that such a double helix DNA may be a linear or ci rculai re plasmid, and in particular a supercoiled ci rculai re plasmid.

 As regards the single-stranded oligonucleotide a), which must be circularized, in accordance with the invention, around the nucleic acid target, this oligonucleotide must have a length sufficient to bind on the one hand to the target and on the other hand to the oligonucleotide matrix. It can thus comprise more than 30 nucleotides, in particular from 30 to several hundred nucleotides. It is advantageous to use an oligonucleotide comprising from 30 to 300 nucleotides, in particular from 30 to 100, with as central part, intended to be fixed on the nucleic acid target, a sequence of 10 to 25 nucleotides.

 According to a provision of the inventi on, it is possible to use single-stranded oligonucleotides in which the chain comprising nucleic bases is not

<Desc / Clms Page number 5>

 made up of only natural nuclei of the phosphodi es te r type, but may for example contain bonds of phosphorothiate, phosphoramidate, methylphos phonate or nucleic acid or peptide type, or mixtures of these li ais ons.

 According to another arrangement, the single-stranded oli gonucleoti is chemically modified so as to be covalently linked to one or more molecules of low molecular mass. These are, for example, markers, such as biotin, or molecules stabilizing triple helices, which can be covalently linked, such as benzo-indolo-quinolines, benzo-quinoquinoxalines, benzo-pyrido-indoles , and the benzo- py ri do-qui noxa li nes.

 In general, the single-stranded oligonucleotide binds to the target nucleic acid sequence and wraps around the double-strand, if appropriate, as indicated above, by DNA in double helix.

 It will be observed that the o li gonucleoti of can bind simultaneously to two double-stranded sequences carried by two different nucleic acids, in particular two different DNAs, which can be in double helix, and for example plasmids.

 In one embodiment of the invention, the attachment of the central part to a target DNA sequence in double helix leads to the formation of a triple helix.

<Desc / Clms Page number 6>

 The target sequence on the double-stranded DNA is advantageously an oligopurine sequence. oligopyrimidine.

 The binding of the oligonucleotide to the double-stranded nucleic acid, in particular the formation of a triple helix, can be induced by adding to the reaction medium a ligand of low molecular weight.

 By decreasing the amount of ligand, or even removing the ligand, it is possible to detach the ring from its target and control its movement along the target.

 In a preferred embodiment of the invention, the oli gonucleoti binds to an oligopurine sequence of the target.

 The li on on of the oli gonucleoti can be done parallel to the oligopurine strand of the oligopurine sequence. oligopyrimidine or, as a variant, antiparallel with respect to the oligopurine strand of the said sequence according to the t riplets engaged.

 The oligonucleotide matrix on which the ends of the single stranded oligonucleotide will hybridize a) contains 10 to 36 nucleotides. The ends which hybridize with such a matrix generally comprise, each 5 to 18 nucleotides.

 For carrying out the incubation, the conditions in particular of pH, temperature, ionic strength,

<Desc / Clms Page number 7>

 are chosen so as to obtain the desired fixing.

 Generally, the operation is carried out at a pH of 5 to 8.5, in particular from 6 to 8, with or without heating.

 The hybridization and ligation steps are carried out after the incubation step, in the same buffer as for the incubation.

 The temperature depends on the ligation agent used.

 It can be an enzyme. We will operate advantageously at a temperature of 16 to 45 C with a li gas e from E.coli, or from 35 to 65 C with a li gas e the rmos table like that as rci alis ée under the brand Ampli gas e .

 Alternatively, a chemical agent is used for the circularization of the oligonucleotide. Examples include N- (3-dimethylaminopropyl) -N '-ethylcarbodiimide (EDC), cyanogen bromide, or cyanoimidazole.

With such agents, the ligation can be carried out at temperatures below 10 ° C., in particular of the order of 4 ° C.

 The ionic concentrations can vary from 0 to 20mM approximately, for ions such as Mg ++, and from 0 to 1M for ions such as Na + or K +.

 When an oligonucleotide matrix is used, it is added after

<Desc / Clms Page number 8>

 i ncubati on and just before addi ti on of the li gati on agent.

 In order to isolate the complex structure, the ligase is inactivated, and advantageously the purification of the complex. This purification step can be carried out by loading the sample on a gel, for example a 1% agarose gel, by chromatography, exclusion column, or using beads carrying a receptor for a fixed ligand. on the single-stranded oligonucleotide.

 The invention relates, as new products, to the intermediate structures and the structured structures formed.

 Thus, within the scope of the invention, intermediate structures of nucleic acids are characterized, characterized in that they comprise a single-stranded oligonucleotide as defined above, fixed by reversible bonds to the target nucleic acid sequence.

 More specifically, the invention relates to such structures in which the nucleic acid target is a double helix DNA, and in particular a plasmid, in particular a supercoiled plasmid.

 In such structures, the oli gonucleotide is attached to the nucleic acid target, wrapped around that target.

<Desc / Clms Page number 9>

 In particular, the oli gonucleotide is attached to DNA in a double helix and forms a triple helix.

 In such a structure, the target sequence of the double-stranded DNA is advantageously an oligopurine sequence. oligopyrimidine.

 These structures include in particular a sequence with 10 to 25 triplets, formed by the oligopurineoligopyrimidine sequence of the target on which the oli gonucleoti of is fixed.

 In these triple helices, the oligonucleotide is fixed parallel to the strand containing the oligopurine sequence, the triplets formed being for example T.A x T; C. G x C; C. G x G.

 As a variant, the oli gonucleotide of is fixed antiparallel with respect to the oligopurine sequence, the triplets formed being T. A x T; T. A x A; C.G x G.

 In other structures according to the invention, the oligonucleotide binds simultaneously to two different nucleic acid sequences, carried by two different nucleic acids, in particular two double helix DNAs, in particular two plasmids.

 In still other intermediate structures, the 2 ends of the oligonucleotide are also hybridized on the oli gonucleotide matrix and advantageously linked enzymatically or chemically. The corresponding structures therefore comprise a triplet sequence implicating the target nucleic acid, linked from each

<Desc / Clms Page number 10>

 side, by spacer sequences, to a doublet sequence involving the oligonucleotide matrix.

 Advantageous structures comprise on the one hand a target comprising 10 to 25 triplets and on the other hand a matrix comprising 10 to 36 doublets, preferably from 14 to 20.

 The invention relates in particular to the structures as defined above but released from the matrix, comprising a double-stranded nucleic acid encircled by a ring formed by a single-stranded oligonucleotide.

 In the structures obtained, the ring is fixed noncovalently to the nucleic acid target. Alternatively, it is free to move along the target nucleic acid. As indicated above, the movement of the ring relative to the target can be controlled by adding or removing a specific ligand of the complex formed between the sequence of the oli gonuucleoti involved in the li ais on and that of the target.

 In these different structures, the oligonucleotide can contain li ais ons other than phos phodi. are you, or be chemically linked to other molecules, as defined above.

 As indicated above in relation to the method, the target is advantageously DNA in double helix. In particular, the target is a linear or ci rculai re plasmid, in particular a supercoiled ci rculai re plasmid.

The corresponding structure then consists of 2

<Desc / Clms Page number 11>

 ci rculai res DNA molecules, one in double strand, the other in single strand, which are attached to each other and can be separated, if desired, by breaking the bond on covalent .

 In structures where the oligonucleotide is fixed simultaneously on two different nucleic acid sequences, carried for example by two different plasmids, the two plasmids are linked after circularization covalently.

 It will be observed that the single-stranded oligonucleotide regularized around the double-stranded nucleic acid allows the labeling of this nucleic acid and thus constitutes a tool of great interest for detection applications or for the purification of nucleic acids.

 The invention therefore relates to the application of the circularization process defined above for the labeling or detection of double-stranded nucleic acids, in particular of plasmids, comprising the use of a single-stranded oligonucleotide covalently linked to a molecule of interest.

 Such labeling, which requires no chemical or enzymatic modification of the target, is particularly advantageous in the case of plasmids and more particularly of supercoiled plasmids.

 The single-stranded oligonucleotide can be labeled radioactively or chemically, for example by fluorescent groups. Indirect labeling, for example with biotin, can be revealed by

<Desc / Clms Page number 12>

 the use of streptavidin coupled with fluorescein.

 The intensity of the labeling can be improved by using anti-streptavidin antibodies coupled to biotin, followed by a second layer of s t reptavi di ne f luo res céi ne.

 Alternatively, labeling can be done through another nucleic acid molecule capable of hybridizing with the single-stranded oligonucleotide.

 Detection can also be carried out by a loop replication mechanism which makes it possible to amplify the sequence of the single stranded oligonucleotide.

 Structured structures produced with such oligonucleotides advantageously make it possible to count the plasmids in cells, even present in small numbers, which constitutes an advantage compared to FISH techniques which only allow the measurement of transfection in an efficient manner. when the plasmid is present with a very high copy number.

 They also make it possible to differentiate two sequences differing by only 1 or 2 mutations, by detecting the oligonucleotide attached to one of these two sequences thanks to the mmolecule carried on this oligonucleotide or by a loop replication process.

 According to another application, it will be noted that the process of ci rcula ris ati on according to the invention can be

<Desc / Clms Page number 13>

 implemented to select, for example from degenerate single-stranded nucleic acid sequences, nucleic acid sequences capable of binding to a double-stranded nucleic acid, and in particular sequences capable of promoting the penetration of nucleic acids double stranded in cells, or targeting these nucleic acids to specific cellular compartments, in particular to the nucleus.

 Using this process, structures are formed where the oligonucleotide is irreversibly attached to its target, which can be isolated, for example, by chromatography, gel purification, exclusion columns. By using oligonucleotides containing a partially random sequence, it is possible to isolate and, if desired, amplify the sequences which give the oligonucleotide the ability to bind to the nucleic acid target by wrapping itself around it.

 The invention also relates to the applications of di your structures, in particular in detection and in gene therapy.

 In accordance with the invention, the single-stranded oligonucleotide may comprise a residue of chemical compound chosen to improve, for example, plasmid purification protocols, the intracellular delivery of plasmids to a specific cellular compartment (nucleus, mitochondria, for example), or targeting in gene therapy app li cati ons.

 It is thus possible to vectorize double-stranded nucleic acids, advantageously DNAs, and

<Desc / Clms Page number 14>

 in particular plasmids, using structures in which the single-stranded oligonucleotide is covalently coupled to molecules capable of promoting its penetration through the cellular and / or nuclear membrane. Mention will in particular be made of peptides, such as the Nuclear Localization Sequence (NLS) of the product of the large T antigen of the SV4 0 virus (Pro-Lys-Lys-Lys-Arg-Lys-Val), synthetic molecules of a different nature as peptide, or fragments of nucleic acids (DNA or A RN) which can be integrated into the sequence of the single-stranded oligonucleotide.

 Sequences with these properties can be isolated by selection-amplification experiments from minicircles containing a random sequence.

 The formation of triplex structures according to the invention is also of interest for specifically repressing the expression of a gene. This repression can be inducible, in particular by using a specific ligand of the triple helices. It is thus possible to eliminate the expression of the transgene by treating the patients with said ligand.

 They also make it possible to covalently connect 2 different double-stranded nucleic acid molecules, and in particular 2 sequences carried by 2 different plasmids, which makes it possible to increase, for example, the yields of co-t rans fecti on of bacteria or co-transformation of cells, ensuring the concomitant presence of 2 different plasmids.

<Desc / Clms Page number 15>

 It will be noted that the formation of triplex structures of the invention can also be used to carry out genetic analyzes, for example to detect mutations in cytological samples, or even to study the distribution of certain sequences.

 According to another application, it will be noted that the ci rcula ris ati on according to the invention can be used to select, for example from degenerate single-stranded nucleic acid sequences, nucleic acid sequences capable to bind to a double-stranded nucleic acid, and in particular sequences capable of promoting the penetration of double-stranded nucleic acids into cells, or the targeting of these nucleic acids towards specific cellular compartments, in particular towards the core.

 Using this process, structures are formed where the oli gonucleotide is irreversibly attached to its target, which can be isolated, for example, by chromatography, gel purification, exclusion columns. By using oligonucleotides containing a partially random sequence, it is possible to isolate and, if desired, to amplify the sequences which give the oligonucleotide the ability to bind to the nucleic acid target by wrapping around him.

 Other characteristics and advantages of the invention are given in the examples which follow.

In the description of these examples, reference is made to FIGS. 1 to 9, which respectively represent:

<Desc / Clms Page number 16>

 - Figure 1, a schematic diagram of the method of regularization of an oligonucleotide around a plasmid and around a DNA in double helix, - Figure 2, a target sequence of the plasmid construction pAR1 with insertion of the promoter of androgen receptor (-146, +131), a single-stranded oligonucleotide to be circularized and an oligonucleotide matrix, - Figure 3, test results showing the formation of a triple helix, - Figure 4, a photo of a electrophoresis gel under denaturing conditions, with the li gati on and cleavage products, - Figure 5, a photo of a non-denaturing gel showing the dissociation of triple helices in the absence of magnesium, - the FIG. 6, a target sequence of the plasmid construction pGA1, consisting of the insertion of a synthetic duplex between the Eco RI and Ps t 1 sites of the plas mi of pBluescript SK +, as rci alized by Proméga, the sequence of the part oligonucleotide central to circularize for constructions 2 and 3, and the ligands used for construction 1, - Figure 7, a photo of a gel in denaturing conditions, with the li gati on and cleavage products,

<Desc / Clms Page number 17>

 - Figure 8, a photo of an agarose electrophoresis gel, with li gati on products, vis ualis é either by lighting with a UV lamp in the presence of ethidium bromide (right), or by autoradiography after drying of the gel (on the left), and - Figure 9, a photo of an electrophoresis gel in denaturing conditions, with the li gati on products.

Example 1: Triple helix constructions
The diagram of the regularization process used in the examples is given in FIG. 1, the examination of which shows the central part (1) of the linear oligonucleotide which binds to the large groove of a specific sequence inside. plasmid (2) (left part) or double stranded DNA (3) (right part), to form a triple helix complex. Its 5 'and 3' ends (4) and (5) hybridize one next to the other, to an oligonucleotide matrix (6) and are linked by a ligation agent (7) to form an oligonucleotide ci rculai re (8) padlocked with plasmid DNA (left part) or with a DNA fragment (right part) In accordance with this scheme, 3 different types of triple helix were produced.

Construction 1, between the BamH I and Xho I sites:
This construction is shown in FIG. 2 which represents the plasmid pAR1 constructed by insertion of the promoter of the mouse androgen receptor (-146, + 131) between the BamH I and Xho I site of the plasmid p BL - CAT (in

<Desc / Clms Page number 18>

the plasmid pAR4, the GC base pairs indicated by an * were mutated in TA)
SEQ ID N 1 represents the sequence-119, -70 of the promoter and SEQ ID N 2, the complementary sequence.

SEQ ID N 1: 5'AGGGGAGAAAAGGAAAGGGGAGGGGAGGGGAGGGGAGAGAGAAAGGAGGT 3 'SEQ ID N 2: 5' ACCTCCTTTCTCTCTCCCCTCCCCTCCCCTCCCCTTTCCTTTTCTCCCCT 3 '
The target DNA sequence for the formation of the triple helix is located between positions -102 and -88 on SEQ ID N 1. It corresponds to SEQ ID N 4.

 FIG. 2 also gives the complete sequence of the oligonucleotide 89-mer (SEQ ID N 3) on which the site binding on the target has been indicated ("triplex site") and which corresponds to SEQ ID N 4, and the sequence of the 20 nucleotide matrix (SEQ ID N 5).

SEQ ID N 3: 5 'CGTACGGTCGACGCTAGCTTTTTTTTTTTTTTTTTTTTTGAGGGGAGGGGAGGGTTT TTTTTTTTTTTTTTTTCACGTGGAGCTCGGATCC 3'
The 89-mer oligonucleotide comprises - a central sequence (SEQ ID N 4) capable of forming a triple helix: SEQ ID N 4: GAGGGGAGGGGAGGG - two linkers linking SEQ ID N 4 to terminal sequences of ten bases each, located at the ends , being able to form respectively ten base pairs with the matrix of 20nucleotides (SEQ ID N 5),

<Desc / Clms Page number 19>

SEQ ID N 5: CGACCGTACGGGATCCGAGC
A phosphate group is added to the 5 ′ end of the oligonucleotide for the following step of enzymatic ci rcula ris ati on. Using 32P-ATP, the radiolabelled oli gonuucleoti is obtained.

 The position of the restriction site for BsiW 1 within the 20 bp oligonucleotide matrix is also indicated.

Two other matrix sequences were used, namely
SEQ ID N 6, 36-mer: 5 'GCTAGCGTCGACCGTACGGGATCCGAGCTCCACGTG 3' SEQ ID N 7, 14-mother: 5 'CCGTACGGGATCCG 3'. Constructions 2 and 3, between Hind III and Pst I:
FIG. 6 comprises the sequences of the synthetic duplex between the Eco RI and Ps t I sites (SEQ ID N 8 and SEQ ID N 9) of the plasmid pGAl.

SEQ ID N 8: 5 'AG CTT CGTACGG CG CCCGAGTTAAGGGAGAAGAGGAAAGAGATTGAG CGAG CCCT AGGGACGTCCCGGGCTAGCGAATTCCTGCA 3' SEQ ID N 9: 5 'GGAATTCGCTAGCCCGGGACGTCCCTAGGGCTCGCTCAATCTCTCCCCTCCGCTGCCGCTCCGCTCCGCTCCGCTCCGCC

<Desc / Clms Page number 20>

The target sequence is an oligopurine sequence. 20 bp oligopyrimidine (SEQ ID N 10).

SEQ ID N 10: 5'AAGGGAGAAGAGGAAAGAGA 3 '
Two types of nucleotides have been developed so that they can be cycled around this target sequence.

. Cons t ructi on 2:
Those of construction 2 have a central part of 18 nucleotides composed of G and T (SEQ ID N ll). their total length can vary from 43 to 89 nucleotides.

SEQ ID N 11: 5 'TGTTTGGTGTTGTGGGTT 3'
The following corresponding single stranded oligonucleotides were prepared: 5'CGTACGGTCGACGCTAGCTTTTTTTTTTTTTTTTTTTGTTTGGTGTTGTGGGTTT TTTTTTTTTTTTT CACGTGGAGCT CGGAT CC 31 (SEQ ID NO 12, 89mère), 5 'CGTACGGTCGACGCTAGCTTTTTTTTTGTTTGGTGTTGTGGGTTTTTTTTTCACG TGGAGCTCGGATCC3' (SEQ ID NO 13, 69-mer) 5 'CGTACGGTCGACGCTAGCTTTTGTTTGGTGTTGTGGGTTTTCACGTGGAGCTCGG ATCC3' (SEQ ID N 14, 59-mother), 5 'CGTACGGTCGACGTTTTGTTTGGTGTTGTGGGTTTTGGAGCTCGGATCC3' (49-mother) (SEQ ID N 15, 49-mother), and

<Desc / Clms Page number 21>

5 'CGTACGGTCGTTTTGTTTGGTGTTGTGGGTTTTGCTCGGATCC3' (SEQ ID N 16, 43-mother). Cons t ructi on 3:
The oligonucleotides of construction 3 comprise a central part of 15 nucleoti composed of T and
C (SEQ ID N 17).

 SEQ ID N 17: 5 'CTCTTCTCCTTTCTCT 3' The single-stranded oligonucleotide corresponding to the following sequence has been prepared: 5 'CGTACGGTCGACGCTAGCTTTTCTCTTCTCCTTTCTCTTTTTCACGTGGAGCTCG GATCC 3' (SEQ ID N 18).

Example 2 Analysis of the formation of a triple helix by co-migration test
The formation of a triple helix is verified in the first construction, between the o li gonuc leoti of 89-mer and its target sequence on the plasmid, by carrying out the following co-migration test, the results of which are given in Figure 3: the 89-mer oligonucleotide (10 fmol) is incubated in 10 l of 50 mM Tris-HCl (pH 7.5), lOmM MgCl, 10 mM dithiothreitol, 1 mM ATP, 25 ug / ml d bovine serum albumin, in the absence of plasmid (lane 1 in FIG. 3), in the presence of 60 fmol of overwound pARl (lane 2), 60 fmol of pARl digested with BamHI and Xho I (lane 3), and 60 fmol of pAR4 (lane 4).

<Desc / Clms Page number 22>

 The samples are heated to 75 ° C., then cooled to 37 ° C. and loaded onto a 6% polyacrylamide gel.

 The migration is carried out at 37 ° C. in a T BE buffer containing 10 mM of MgCl2.

 Staining the gel with ethidium bromide shows that the supercoiled plasmid fully penetrates the gel (lane 2) and the comparison with the electrophoretic mobi lity of molecular weight markers indicates that the lane 3 band migrates as a 700 bp duplex.

 When the oligonucleotide and the plasmid pAR1 are incubated together, the labeled oligonucleotide migrates at the same time as the plasmid. This migration does not occur with the plasmid pAR4, in which the formation of the triple helix cannot occur as a result of 6 mutations of G to T in the target sequence (these mutations are represented in FIG. 2, and designated by a asterisk).

 When pAR1 is digested with both Xho I and BamH I, the labeled oligonucleotide migrates at the same time as the 700 bp fragment which contains the target sequence.

 EXAMPLE 3 Analysis of the products of the li gati on and of the cleavage by gel electrophoresis under denaturing conditions with the structure 1 a - study of the products of li gati on

<Desc / Clms Page number 23>

The oligonucleotide labeled 89-mother is incubated as described above in connection with FIG. 3 when used, as the gas, for the subsequent stage of li gati on, the li gas e phage T4. With Ampligase, use a 20 mM Tris-HCl buffer (pH 8.3), 25 mM KC1, 10 mM MgCl2, 0.5 mM NAD, 0.01% Triton X100 and, with the E. coli ligase, a 50 mM Tris-HCl buffer (pH 7.8), 10 mM MgCl2, 10 mM DTT, 26 μM NAD, bovine serum albumin 25 pg / ml.

 The ligation reaction is carried out at 45 ° C. for 1 hour, using 40 U of T4 DNA ligase (New England, BLolabs). Carrying out the reaction at this temperature makes it possible to reduce the formation of molecules of linear dimers which are formed as a result of the ligation of two different 89-mer oligonucleotides hybridizing to the 20-mer matrix. The gas is inactivated by heat for 15 minutes at 65 C before treatment with restriction endonucl es.

 The results of the various tests are given in FIG. 4. In tracks 3 to 6 and 8, the plasmid is present during the ligation reaction.

 In lane 7, the plasmid is added after the regularization of the 89-mer oligonucleotide, followed by heat denaturation of the DNA ligase, as indicated by the expert. The samples are precipitated by addition of ethanol and resuspended in 80% formamide, 10 mM NaOH, 1 mM EDTA as loading buffer.

<Desc / Clms Page number 24>

 The reaction mixture is heated at 90 ° C. for 5 minutes, then loaded onto a 6% denaturing polyacrylamide gel.

 It is noted on examining FIG. 4 that in the presence of the matrix of 20 oligonucleotides, the linear oligonucleotide 89-mother is transformed into a molecule rculaire. The migration speed in a 6% denaturing polyacrylamide gel appears to be lower.

 As indicated above, the li gati on is also carried out in the presence of the plasmid pAR1, under conditions allowing the formation of the triple helix.

 The labeled oligonucleotide is transformed into a species having a very low migration speed, similar to that of the plasmid itself, as revealed by the staining with ethidium bromide (FIG. 4, lane 4).

 The nature of this species has been identified using two different approaches. b - study of binding products The sample was treated with the restriction endonuclease Xho I, which makes it possible to linearize the plasmid pAR1.

 This treatment releases the cyclic oligonucleotide as shown by the electrophoretic mobility (FIG. 4, lane 6).

<Desc / Clms Page number 25>

 As a variant, the sample was treated with the restriction endonuclease BsiW I. This enzyme does not cleave pAR1, but can cleave the oligonucleotide rculai re in the presence of the oligonucleotide matrix.

 The cleavage product migrates exactly like the linear 89-mer oligonucleotide (Figure 4, lane 5).

 The species with low migration cannot be detected in the following tests: - when using, in place of pAR1, pAR4 which does not form a triplex with the 89-mer oligonucleotide (lane 8), - when 'the plasmid pAR1 is added after the circularization of the 89-mer oligonucleotide and the heat denaturation of the T4 DNA ligase (lane 7), and also - when used for the ci rcula ris ati on un another linear oligonucleotide which cannot form a triple helix.

 These experiments show that the oli gonucleotide has been circularized around the double stranded DNA target and therefore has been padlocked to the plasmid.

 The two molecules remain associated under highly denaturing conditions and can only be separated by severing the chemical bonds.

<Desc / Clms Page number 26>

 However in this complex, the cyclic oligonucleotide, capable of forming a triple helix, can diffuse in one dimension along the double helix.

Example 4 Dissociation of the Triple Helices in the Absence of Magnesium in a Non-Denaturing Gel
The samples are prepared as described above in the presence of magnesium and loaded onto a 6% polyacrylamide gel free of magnesium.

 The migration is carried out at 37 ° C. in a TEE buffer in the absence of MgCl2.

 The results of the tests are given in FIG. 5.

 No triple helix formation was detected between the linear 89-mer oligonucleotide and the plasmid pAR1 when the incubated samples were migrated in a buffer containing magnesium in a non-denaturing gel, without magnesium. (Figure 5, track 2).

 The radiolabelled oligonucleotide remains associated with the plasmid only when it has been regularized in the presence of the plasmid and of magnesium before loading the gel (lane 4).

 When the plasmid is digested with Xho I, the cyclic oligonucleotide remains associated with the linear plasmid when the gel contains magnesium, but dissociates in the absence of magnesium, although the site of

<Desc / Clms Page number 27>

 cleavage is located 200 bp from the target site of the triple helix.

 In lane 6, the plasmid is added after regularization of the 89-mer oligonucleotide, followed by heat denaturation of the bound DNA.

 The absence of magnesium (or any other divalent cation) therefore appears to be sufficient to prevent the formation of the triple helix and to allow the cyclic oligonucleotide to move around the plasmid.

 Other strategies can be used to label the plasmid so as to lose the interaction of the triple helix after ligation, for example by forming a triple helix induced by a ligand or a given pH value.

EXAMPLE 5 Analysis of the Li gati on and Cleavage Products by Gel Electrophoresis under Denaturing Conditions with Construction 2
The results obtained are shown in Figure 7.

 The oli gonucleoti of, which can be a 59-mer (tracks 1 to 6), a 69-mother (tracks 7 to 12), or an 89-mother (tracks 13 to 18) (Ofmol) is incubated in the medium described in connection with FIG. 3 in Example 2, in the absence of plasmid (tracks 1,2,7,8,13,14), in the presence of pGAl (lug) (tracks 4,5,6 , 10,11,12,16,17,18), or in the presence of plasmid pBLuescript which does not contain the target for the formation of the triple helix (lug) (lanes 3,9 and 15) and

<Desc / Clms Page number 28>

 in some cases in the presence of li gand SD46 (4uM) (tracks 3,5,6,9,11,12,15,17,18). The samples are heated to 70 ° C. and then cooled to 37 ° C. The ci rcula ris ati on reaction is carried out at 37 ° C. for 1 h, using 40 U of T4 DNA ligase. The matrix was not added in lanes 1,7 and 13. The gas is inactivated by heat. 10 l of a formamide solution containing charge dyes is then added directly to the samples. The reaction mixture is heated at 90 ° C. for 5 min, then loaded onto a 5% denaturing polyacrylamide gel.

It can be seen on examining FIG. 7 that, in the presence of the matrix of 20 nucleotides, the oligonucleotides of 59.69 and 89-mer are transformed into molecular molecules of lower migration. The appearance of very slow migration products is observed only if the oligonucleotide has been previously incubated with the plasmid pGAl containing the target sequence and the ligand SD4 6. This species was treated with the Hind III restriction endonuclease, which makes it possible to linearize the plasmid pGAl. This treatment releases the rculai oligonucleotide. These experiments demonstrate that the oligonucleotides were circularized around the plasmid by formation of a triple helix inducible by the ligand SD4 6.

Example 6: Radiolabelling of a supercoiled plasmid using the 89-mer oligonucleotide The results are given in FIG. 8.

 The 89-mer oli gonucleoti is incubated as indicated above, in the presence of plasmid pGAl (lug) (lanes 1,2,4

<Desc / Clms Page number 29>

 and 5) or p Bluescript (tracks 3 and 6), in the presence of 2 μM of ligand SD27 (tracks 1 to 3) or SD46 (tracks 4 to 6).

In tracks 1 and 4, the matrix is omitted. After reaction of ci rcula ris ati on and inactivation of the gas, 2ul of glycerol were added to the samples which were loaded on a 1% agarose gel and migrated for 30 min at 50V in TEE buffer. The gel was viewed under UV lamp. The presence of ethidium bromide in the gel reveals the presence of supercoiled plasmid in all of the wells (on the right) (wells 7 and 8 contain the plasmids p Bluescrpit and pGAl, respectively, which have not undergone any treatment). The gel was then dried and autoradiographed. An important radioactive signal is detected at the plasmid level when the circularization has been carried out in the presence of pGA1 and of ligand SD27 or SD4 6. This experiment demonstrates that the topological state of the plasmid is not affected by the treatments carried out and that a radiolabeled oligonucleotide locked with a plasmid makes it possible to radiolabel this plasmid.

Example 7: Analysis of the li gati on products by gel electrophoresis, under denaturing conditions with the structure 3 The results are given in FIG. 9.

The 59-mer oligonucleotide (10 fmol) is incubated in 10 μl of 50 mM ME S (pH 6.0), 20 mM MgCl2, 3 mM DTT, 1 mM ATP, in the absence of plasmid (lanes 1 and 2), in the presence of pGAl (5 μg) (lane 4) or p Bluescript (lane 3). The samples are heated to 70 ° C. and then cooled to 4 ° C. After at least approximately 14 hours, the regularization reaction is carried out at ambient temperature for 2 hours, using 40 U of T4 bound DNA. The

<Desc / Clms Page number 30>

 li gas e is deactivated by heat. 10 l of a formamide solution containing filler dyes is then added directly to the samples. The reaction mixture is treated as indicated above with FIG. 4. Under these conditions, the oligonucleotide can be circularized by the DNA ligase of phage T4 (lane 2).

It is circularized around the plasmid when it contains the target sequence for the formation of the triple helix (well 4).

Claims (30)

 CLAIMS 1 / Method for circularizing an oligonucleotide characterized in that it comprises - the incubation of a double-stranded nucleic acid comprising a target sequence, with. either a single-stranded oligonucleotide a) comprising a central part capable of binding to said target sequence, linked by spacer sequences to 5 'and 3' terminal sequences, themselves complementary to the sequence of an oli gonucleotide matrix , or a single-stranded oligonucleotide b) whose terminal sequences in 5 ′ and 3 ′ can be fixed adjacent to the target sequence, the said incubation step being carried out under conditions allowing the fixing of the oligonucleotide single strand a) or b) at the target sequence by the formation of reversible bonds, which leads to the winding of the oligonucleotide around its target, - in the first case a), bringing the complex formed into contact with said oligonucleotide matrix, under conditions allowing the hybridization of the 5 ′ and 3 ′ ends, adjacent to the matrix, the connection of the hybridized ends, so as to regularize the oligonucleotide around the double-stranded nucleic acid and, if desired, - the isolation of the regularized structure, where the target nucleic acid is padlocked with the regular oligonucleotide, followed where appropriate by its purification . <Desc / Clms Page number 32> 2 / A method according to claim 1, characterized in that the nucleic acid used is DNA in double heli ce. 3 / A method according to claim 2, characterized in that the nucleic acid is a plasmid, in particular a supercoiled plasmid. 4 / A method according to any one of claims 1 to 3, characterized in that the single-stranded oligonucleotide comprises more than 30 nucleotides, in particular from 30 to 300 nucleotides, in particular from 30 to 100, with as central part, intended for bind to the nucleic acid target, a sequence of 10 to 25 nucleotides. 5 / A method according to any one of claims 1 to 4, characterized in that single-stranded oligonucleotides are used in which the chain of nucleic bases comprises, in addition to links of phos phodi es te r type, phosphorothiate, phos pho rami date, methylphos phonate or nucleic acid peptide bonds, or mixtures of these li ais ons or, as a variant, is chemically modified so as to be covalently linked to one or more molecules of low molecular mass . 6 / A method according to any one of the preceding claims, characterized in that the single-stranded oli gonucleoti binds to the target nucleic acid sequence and wraps around the double strand of nucleic acid formed, where appropriate. , by DNA in double helix. <Desc / Clms Page number 33> 7 / A method according to any one of the preceding claims, characterized in that the fixing of the single-stranded oligonucleotide is carried out on a target DNA sequence in double helix and leads to the formation of a triple helix. 8 / A method according to any one of the preceding claims, characterized in that the target sequence on the double-stranded DNA is an oligopurine sequence. oligopyrimidine. 9 / A method according to any one of the preceding claims, characterized in that the li ais on of the oligonucleotide on the double-stranded nucleic acid, in particular the formation of a triple helix, is induced by adding to the reaction medium a low molecular weight ligand. 10 / A method according to any one of the preceding claims, characterized in that the oligonucleotide matrix on which the ends of the single-stranded oligonucleotide will hybridize contains 10 to 36 nucleotides.  11 / A method according to any one of the preceding claims, characterized in that the step of incubating the nucleic acid with the oligonucleotide is carried out at a pH of 5 to 8.5, in particular from 6 to 8, with or without heating. 12 / A method according to any one of the preceding claims, characterized in that the hybridization step <Desc / Clms Page number 34>  and the ligation are carried out after the incubation step, in the same buffer as for the incubation. 13 / Process according to any one of the preceding claims, characterized in that the ends of the hybridized single-stranded oligonucleotide are connected by an enzymatic process. 14 / A method according to any one of claims 1 to 13, characterized in that the ends of the hybridized single-stranded oligonucleotide are connected by a chemical process. 15 / A method according to any one of the preceding claims, characterized in that the isolation and the purification of the circularized structure are carried out on gel, by chromatography, exclusion column, or by means of bi l carrying them a receptor for a ligand attached to the single-stranded oligonucleotide. 16 / Complex structure of nucleic acids characterized in that it comprises a single-stranded oligonucleotide as used in the process according to any one of the preceding claims, fixed by reversible links to the target acid sequence nucleic acid, in particular on a double helix DNA.  17 / Structure according to claim 16, characterized in that, the oligonucleotide is attached to the nucleic acid target, wound around this target. <Desc / Clms Page number 35>  18 / Structure according to claim 16, characterized in that the oligonucleotide is attached to a DNA in double helix, forming a triple helix. 19 / Structure according to claim 18, characterized in that the target sequence of the double-stranded DNA is an oligopurine sequence. oligopyrimidine. 20 / Structure according to any one of claims 16 to 19, characterized in that it comprises a sequence with 10 to 25 triplets, formed by the oligopurineoligopyrimidine sequence of the target on which the oligonucleotide is fixed. 21 / Structure according to any one of claims 16 to 20, characterized in that the 2 ends of the oligonucleotide are hybridized on the oligonucleotide matrix, and if necessary linked together by enzymatic or chemical route. 22 / Complex structure of nucleic acids comprising a double-stranded nucleic acid encircled by a ring formed by a single-stranded oligonucleotide, the ring being optionally free to move along the target nucleic acid. 23 / Structure according to claim 22, characterized in that the movement of the ring is controlled by the addition or the removal of a specific ligand of the complex formed between the sequence of the oligonucleotide and that of the target sequence. <Desc / Clms Page number 36> 24 / Structure according to claim 22 or 23, characterized in that the nucleic acid that is a DNA in double helix, in particular a plasmi of, in particular a supercoiled plasmid. 25 / Application of the circularization method according to any one of claims 1 to 15, for the labeling or detection of double-stranded nucleic acids, in particular of plasmids, comprising the use of a single stranded oligonucleotide covalently connected to a molecule of interest. 26 / Application of the circularization method according to any one of claims 1 to 15, for the detection of a specific sequence present on the nucleic acid that targets in double strand, comprising the use of molecules coupled to the oligonucleotide, or the implementation of a loop replication process. 27 / Application of the circularization method according to one that any of claims 1 to 15, to differentiate two sequences differing only in 1 or 2 mutations, by detecting the oligonucleotide attached to one of these two sequences thanks to the molecule carried on this oligonucleotide or by a loop replication process. 28 / Application of the circularization method according to any one of claims 1 to 15, to select, for example from degenerate single-stranded nucleic acid sequences, nucleic acid sequences capable of binding to a double-stranded nucleic acid , and in particular sequences capable of promoting the <Desc / Clms Page number 37>  penetration of double-stranded nucleic acids into cells, or targeting these nucleic acids to specific cell compartments, in particular to the nucleus. 29 / Application of the structures according to any one of claims 16 to 24, in gene therapy, for the specific i nhi bi ti on of a gene carried by a double-stranded nucleic acid, in particular by a plasmid, by fixation of the oligonucleotide ci rculai re on the nucleic acid, and co-control of this fixation by molecules of low molecular mass, in particular by a ligand specific for triple helices. 30 / Application of the structures according to any one of claims 16 to 25, in which the oligonucleotide is coupled to a molecule allowing a nucleic acid to penetrate into a cell, or also allowing targeting of the structure towards a cell compartment and / or nuclear.