FR2775691A1 - SPECIFIC MONOCLONAL ANTIBODIES OF ESM-1 PROTEIN, AND USE OF SUCH ANTIBODIES FOR DETECTION OF ESM-1 PROTEIN - Google Patents

Abstract

The invention concerns anti-ESM-1 monoclonal antibodies and their uses for detecting ESM-1 protein. Different forms of the ESM-1 protein have been isolated by means of said antibodies. Said antibodies and said proteins can be used for treating inflammatory diseases.

Description

 The present invention relates to monoclonal antibodies specific for the ESM-1 protein.

 It also relates to the use of these antibodies for the detection of this protein, or of proteins or peptides exhibiting cross immunoreactivity.

 It also relates to proteins having cross-immunoreactivity with the protein ESM-I.

 At the interface between circulating cells and tissues, endothelial cells play a particularly important role vis-à-vis leukocytes. In fact, the migration of leukocytes requires signal molecules, which are present in endothelial cells. The emission of these signal molecules is under the control of cytokines. The proteins ICAM-1 and ICAM-2, and lnterleukin-6 are thus strongly expressed in endothelial cells in the presence of cytokines.

 The identification of specific molecules of endothelial cells can therefore contribute to a better understanding of the interactions between leukocytes and endothelial cells, and make it possible to find new therapies for diseases linked to the migration of leukocytes, in particular inflammatory diseases.

 The DNA sequence complementary to the ESM-1 protein cloned from human endothelial cells of the umbilical vein has recently been described by LASSALLE et al. (1996, J. Biol. Chem., 271, ne34, 20458-20464) .

 This complementary DNA sequence contains an open reading phase of 552 nucleotides, as well as a non-transcribed region of 1398 nucleotides. A sequence of 184 amino acids has been deduced therefrom. It is shown in Figure 1 of this article.

 Obtaining polyclonal antibodies by immunizing a rabbit with the purified ESM-1 protein is also described in this article.

 Polyclonal antibodies generally have many disadvantages. In particular, the polyclonal antibodies described in this article probably recognize various antigenic determinants of the protein with more or less strong affinities and specificities. As a result, preparations containing these antibodies exhibit low sensitivity.

 In addition, antibodies directed against antigenic determinants other than those of the protein ESM-1 are present in this preparation, thus making them not very specific.

 Consequently, the use of the polyclonal antibodies described in this article, for the detection and the assay of ESM-1 cannot be envisaged.

 Obtaining hybridomas producing monoclonal antibodies specific for various proteins has been known for many years.

 However, obtaining monoclonal antibodies specific for a given protein is never a routine operation, and requires an appropriate protocol for each particular case.

 In the present case, the protein ESM-1, which is a human protein, could only be obtained in an appropriate quantity by expression of the gene in a bacterium, that is to say in a prokaryotic system, and not in eukaryote.

One of the problems posed therefore consisted in finding a method making it possible to select hybridomas recognizing both the ESM-1 protein expressed from a prokaryotic system and the protein
ESM-1 expressed by a eukaryotic system.

 In addition, this protein is rich in cysteine which makes it difficult to obtain monoclonal antibodies recognizing its unreduced form.

 The inventors therefore set out to find a protocol enabling monoclonal antibodies to be obtained which specifically recognize and with high affinity the human ESM-1 protein.

 The present invention therefore relates to monoclonal antibodies characterized in that they specifically bind to at least one antigenic determinant, or epitope, of the protein ESM-1, as described in FIG. 1 of the article by LASSALLE and al. (1996, previously cited).

 These monoclonal antibodies can bind to various antigenic determinants of the ESM-I protein.

 Preferably, such a monoclonal antibody binds to the part of the ESM-1 protein comprised between the proline at position 79 and the cysteine at position 99 (antigenic determinant D1), of the peptide sequence of the protein ESM-1. Antibodies directed against this part of the ESM-1 protein are particularly advantageous because they have a particularly high affinity.

 Other preferential monoclonal antibodies are those which specifically bind to the part of the ESM-1 protein between glycine at position 159 and arginine at position 184 (antigenic determinant D3).

 These latter antibodies have a perfectly acceptable affinity, although less important than the antibodies directed against the antigenic determinant D3.

These monoclonal antibodies are obtained from hybridoma lines. Antibodies specific for the antigenic determinant D3 can be obtained from the hybridoma lines 1-1942 (MEP14) and I1943 (MEP19), deposited on November 19, 1997 with the Collection
National Culture of Microorganisms of the Pasteur Institute (CNCM).

The monoclonal antibodies specific for the antigenic determinant D1 can be obtained from the line 1-1944 (MEP21) deposited on 19
November 1997 with the National Collection of Culture of
Microorganisms of the Pasteur Institute (CNCM).

Monoclonal antibodies specific for the antigenic determinant
D2 between serine 119 and valine 139 can be obtained from the line 1-1941 (MEP08) deposited on November 19, 1997 with the
National Collection of Culture of Microorganisms of the Pasteur Institute (CNCM).

 The present invention further relates to conjugates consisting of a monoclonal antibody as defined above covalently linked to a molecule allowing its direct or indirect detection.

The hybridomas secreting antibodies according to the present invention can be obtained by a process comprising the following steps:
- immunization of a mammal with adequate amounts of ESM1 or one of its fragments,
- fusion of mammalian lymphoid cells with myeloma cells, and
- selection of hybridomas producing antibodies according to the present invention for their reactivity with respect to the fusion protein, consisting of part of the protein ESM-1 and part of an immunoglobulin (ESM-1g) , and possibly their lack of reactivity towards the fusion protein between a part of the ICAM-1 protein and a part of an immoglobulin (ICAM1-1g).

 The general conditions for implementing the process for obtaining hybridomas are well known to those skilled in the art, who can find them in the publication by Kohler and Milstein (1975, Nature (London) 256, 495-497).

 The antibodies according to the present invention can be used to detect the protein ESM-1, a protein exhibiting cross-immunoreactivity with ESM-1, or even fragments of these proteins.

 The detection of these proteins can in particular be part of a more general diagnosis of diseases linked to leukocyte migration, and in particular of inflammatory diseases.

Such a method for detecting these proteins in a biological fluid can comprise the following steps:
bringing said fluid into contact with at least one monoclonal antibody according to the present invention, and
- highlighting of the complexes possibly formed between said antibody and one of these proteins.

 Advantageously, the fluid is brought into contact with two monoclonal antibodies specific for two antigenic determinants of the protein ESM-1, advantageously specific respectively for the antigenic determinants D3 and D1.

 The biological fluid can be, in particular: a serum, a plasma, whole blood, urine, a cerebrospinal fluid, or cell supernatants or lysates.

 The process used can advantageously be of the sandwich type.

 The complex possibly formed can be demonstrated using an antibody, or a specific conjugate of the class or subclass of one of the monoclonal antibodies brought into contact with the fluid.

 Another object of the present invention is such complexes, formed between the ESM-1 protein, or a protein exhibiting cross-immunoreactivity, or even a fragment thereof, and a monoclonal antibody according to the present invention.

 The process defined above can advantageously be carried out using a suitable kit comprising at least one antibody or a conjugate according to the present invention in an appropriate form.

 The use of the antibodies according to the present invention has made it possible to demonstrate in the supernatants of certain cell lines expressing the protein ESM-1, proteins having a cross immunoreactivity with the protein ESM-1, as defined by LASSALLE et al. in their 1996 article cited above, and having a different molecular weight from the ESM-I protein.

 The present invention therefore also relates to proteins of molecular weights different from the ESM-1 protein as described in the article by LASSALLE et al., And having a cross-immunoreactivity with the ESM-1 protein.

 The subject of the present invention is therefore a protein, reacting specifically with a monoclonal antibody specific for one of the antigenic determinants Di or D2, characterized in that it has a molecular weight of between approximately 15 and 15.5 kD, in non-denaturing condition.

 Without the inventors being committed to such a hypothesis, this form could result from a process of cleavage of the protein ESM-1 as defined in the article by LASSALLE et al. (1996, previously cited), dependent on proteases.

 Another form, demonstrated using the antibodies according to the present invention, is that having a molecular weight of between approximately 44 and 56 kD, and preferably of approximately 50 kD under non-denaturing conditions.

 The inventors have shown that this form is O-glycosylated.

 Consequently, the present invention also relates to a protein of molecular weight between 44 and 56 kD as defined above, glycosylated by at least one N-acetyl galactosamine residue, and in particular by a chondroitin sulfate residue.

 Advantageously, such a protein is glycosylated on only one of its amino acids, and even more preferably on a serine.

 Such a protein can also be characterized in that it comprises at least partially a part of the sequence described in FIG. 1 of the article by LASSALLE et al. (1996, previously cited).

These various proteins can advantageously be obtained from supernatants or cell lysates of the CHO K1-ESM, 293-ESM and A549-ESM cell lines deposited on January 28, 1998 with the
CNCM, respectively under nos. 1-1970,1-1971 and II 972.

 The CHO-Ki-ESM line (deposit no. 1-1970) is a line of hamster ovary cells stably expressing the ESM-i protein. This line was established by transfection of the CHO-K1 cell line (n "ATCC deposit: CCL-61) with the plasmid pcDNA3-ESM (LASSALLE et al., 1996, previously cited), then selected.

 The cell line 293-ESM (deposit number 1-1971) is a human epithelial line stably expressing the protein ESM-1. The line was established by transfection of the human cell line 293 (deposit number ATCC: CRL-1573) with the plasmid pcDNA3-ESM, then selected.

 The A549-ESM line (deposit no. 1-1972) is a human epithelial line stably expressing the ESM-I protein. This line was established by transfection of the human epithelial line deposited with the ATCC Collection under the number n CCL185, with the plasmid pcDNA3-ESM then selected.

 These proteins and antibodies can be used in the treatment, or diagnosis, of diseases linked to leukocyte migration, and in particular in the treatment of inflammatory diseases.

 They can also be used to study the evolution of kidney transplants. In particular, the antibodies according to the present invention can be used to assay for the presence of ESM-1 in the blood or urine of patients who have undergone a kidney transplant.

 Consequently, the present invention relates to compositions containing a pharmaceutically effective amount of an antibody or of one of the proteins described above, as well as pharmaceutically acceptable excipients.

 The present invention further relates to medicaments containing such antibodies and proteins, and the use of such antibodies and proteins for the manufacture of medicaments for the treatment of diseases linked to leukocyte migration, and in particular for the treatment of diseases inflammatory, especially chronic inflammatory diseases.

 The present invention is illustrated without however being limited by the examples which follow.

 Figure 1 illustrates the detection of anti-ESM-1 antibodies by the use of ESM-1g protein. The plates coated with human anti-immunoglobulin G antibodies (anti-hlgG), were incubated with CHO or HEK293 cell supernatants, supernatants containing ESM-1g, or supernatants containing 3D-ICAM1-1g.

 FIGS. 2A and 2B illustrate the characterization and the mapping of the epitopes by the anti-ESM-1 monoclonal antibodies. FIG. 2A represents an acrylamide gel stained with Coomassie blue, purified GST-ESM peptides. FIG. 2B schematically represents the protein ESM-1, the peptide ESM-1 F0 used for the immunization as well as the peptides F1, F2, F3 and F4 used for the mapping of the epitopes.

 Figures 3A to 3D illustrate the quantification of ESM-1 in various cellular models expressing it. The measurements in the supernatants correspond to the dark squares, while the measurements carried out in the cell lysates correspond to the dark circles. FIG. 3A illustrates the results obtained with HUVEC cells conditioned with growth factors (rounds or white squares) or unconditioned (rounds or dark squares). FIGS. 3B, 3C and 3D correspond respectively to the COS-ESM, HEK-ESM and CHO-ESM cells.

FIGS. 4A to 4C illustrate the effect of cytokines (TNFa, IFNy and
TNFa and IFNy) on the expression of ESM-1 and ICAM1 in cells
HUVEC. FIGS. 4A and 4B relate to the expression of ESM-1 respectively in the supernatants and the lysates of HUVEC cells while FIG. 4C relates to the expression of lCAM-1 in the lysates of HUVEC cells.

FIGS. 5A to 5D represent immunotransferts of ESM-1 in different cell models expressing this protein. Figure 5A is a transfer of crude supernatant from HEK-ESM and CHO-ESM cells. FIG. 5B relates to the immunoprecipitation of cell supernatants
COS-ESM, CHO-ESM and HEK-ESM. FIG. 5C relates to the immunoprecipitation of lysates of different cell types. FIG. 5D relates to the immunoprecipitation of supernatants and cell lysates
HUVEC. (S = supernatant; L = lysate). These immunoblots were revealed by a mixture of the antibodies MEP21 and MEP19 (1, ug / ml).

Figures 6A to 6E illustrate immunostaining of cells and in the lungs, kidneys and intestines. Figure 6A shows cells
COS (x 100). FIG. 6B illustrates the cytoplasmic staining of the cells
HUVEC (x 1000). Figure 6C shows normal lung tissue (arrowhead: capillary endothelial cells, complete arrow: bronchial epithelial cells) (x 250). FIG. 6D represents normal kidney tissues (arrow: distal tubules; G: capillaries of the glomeruli, x 400). FIG. 6E represents normal intestinal tissues (arrow heads: capillary endothelial cells; x 100).

 MATERIALS AND METHODS USED IN THE EXAMPLES.

 1) Cell cultures.

 Human endothelial cells derived from the umbilical vein (HUVEC) by treatment with collagenase were cultured in RPMI 1640 medium supplemented with 20% fetal calf serum, 2 mM L-glutamine, 10 μg / ml of heparin and 25 μg ml of endothelial cell growth supplement marketed by the company Sigma.

The HUVEC cells were cultured in culture plates, the wells of which were covered with 0.5% gelatin. At confluence, cells
HUVECs were washed and incubated overnight with the medium containing 20% fetal calf serum. Before adding the cytokines, the cells
HUVECs were washed once and incubated in RPMI 1640 containing 5% fetal calf serum. The following cytokines were then added to the cell cultures: TNFa (200 U / ml, Genzyme), gamma interferon (IFNy) (1000 U / ml, Genzyme), Interleukin beta 1 (1L-1ss) (10 U / ml,
Genzyme). After activation by cytokines, the cellular supernatants were clarified by centrifugation and stored at -20 ° C. to allow the determination of ESM-1.

 Human endothelial cells transfected with the SV40 virus (SV1 cells) were cultured in RPMI 1640 containing 2 mM Lglutamine and 10% fetal calf serum (1992, LASSALLE et al., Eur. J. immunol. 22, 425 -431).

 HEK293 cells were maintained in complementary DMEM medium with 10% horse serum. The COS cells were maintained in DMEM medium supplemented with 10% fetal calf serum.

 For the determination of the quantity of ESM-1 in cell supernatants and in cell lysates, HUVEC cells and cell lines expressing ESM-1 were cultured in 35 mm culture plates. At confluence, the cells were washed three times and 2 ml of fresh medium were added during the period ranging from 4 hours to 3 days of culture. At different times, the cell supernatants were centrifuged and allowed to freeze in order to allow the evaluation of the quantity of ESM-1.

 The adherent cells were washed three times with HBSS and lysed for 30 minutes at 4 "C with stirring in 1 ml of cold PBS buffer containing 0.5% NP40 and antiproteases (Complete, Boehringer).

 After centrifugation at 10,000 g for 10 minutes, the clarified lysates were kept cold to allow the amount of ESM 1 to be evaluated.

 2) Production of ESM-1 and purification.

 The preparation of ESM-1 has been described by LASSALLE et al. (1996, previously cited).

 Briefly, the Xma I fragment of the complementary DNA of ESM-1 was subcloned into the vector pGEX-2TK (Pharmacia), resulting in the expression of a fusion protein containing glutathione S-transferase (GST) and the 14 kDa C-terminal peptide of ESM-i. This fusion protein was then purified on a glutathione-sepharose column. The ESM-1 peptide is released from the column by treatment with thrombin, following the protocol recommended by the Company Pharmacia. These different purification steps made it possible to obtain between 40 and 60 μg of ESM-1 peptide per liter of bacterial culture. This ESM-1 peptide is hereinafter referred to as Fo.

 3) Oliclonucleotide constructs.

 The nucleotide constructs allowing ESM-1lg and 3D-ICAM1-lg to be obtained were obtained in the following manner.

 The plasmid containing the Fc fragment of human IgG1 was supplied by Doctor R. Devos (Roche Research Gent, Gent, Belgium). It has been described by (ELISON et al. (1982), Nuc. Acids Rez.10, 4071-4079). The plasmid was digested with Eag I and Pst I and subcloned into the vector pBluescript SK sold by Stratagene. The construct was then digested with HIND II and EcoR I and ligated with the DNA fragment coding for ESM-1 obtained by PCR, which contains the entire coding sequence and which is flanked by the HIND III and EcoR I sites respectively at the ends. 5 'and 3' (primer sense 5'-CTCAAGCTTCCCACCAGCAAAGACCAC; antisense primer 5s-TTTGAATTCCGCCGCTGGGATTTAACCATTTCCT).

 The construct obtained was digested with HIND III and Eag I and subcloned into the vector pcDNA3 digested with HIND III and Not I (marketed by In Vitrogen).

In parallel, a control fusion protein was also constructed, which contains the first three domains of the human protein ICAM-1 instead of the protein ESM-1 (primer sense 5 '
CTCAAGCTTCCATTGTGCTCTAAAGACCTC; 5 'antisense primer
AAAGAATTCCGCCCTCTGGCTTCGTCAGAATCACG).

 The merged regions have been sequenced to confirm that the reading frame is correct.

As regards the DNA constructs coding for ESM-1 used in the mapping of epitopes, several DNA fragments amplified by PCR of the protein ESM-1 were subcloned into the vector pGEX-4T3 marketed by Pharmacia and containing EcoR I - Xho sites
I. The sense primers were selected in order to eliminate the 20 amino acids from the N-terminal end of the 14 kDa peptide, which served for the immunization of mice (sense primers (FP): FP 1: 5 ′ -TATGAATTCATGCAAAGACTGTCCCTACGGC,
FP2: 5'-TATGAATTCAGGCATCTGTGACAGGGGGAC FP3: 5'-ATAGAATTCAGTAACCAAGTCUCCAACAGA
FP4 5'-AAAGAATTCAGGCAATATTGTGAGAGAAGAAGT; antisense primer 5'-GGGCTCGAGTAACAAATCTACATGCATTCG).

 The GST-ESM fusion proteins were produced in the Escherichia coli DH1 strain, purified on a column of glutathione sepharose and eluted with 5 mM reduced glutathione. This purification process made it possible to obtain between 1.2 and 1.6 mg of ESM-1 fusion protein per liter of bacterial culture.

 The ESM-1 construction contained in the plasmid pcDNA3 is that described in the article by LASSALLE et al., (1996 previously cited).

4) Use of l1ESM-lci for the detection of anti-antibodies
ESM-1.

ELISA plates were coated overnight with an affinity purified polyclonal antibody and directed against the Fc fragment of
Human immunoglobulin (IgG) (5 μg / ml, Sigma) diluted in carbonate buffer (0.1 M Na2CO3, 0.1 M NaHCO3, pH 9).

After one hour of saturation with PBS buffer supplemented with 5 mM EDTA and 0.1% BSA, the supernatants of the transfected cells, containing the chimeric proteins, were incubated for one hour at room temperature. After several washes, the chimeric proteins retained were detected using an anti-polyclonal rabbit antibody
ESM-1, as described by LASSALLE et al. (1996, previously cited), or monoclonal antibodies directed against ICAM-1 (Becton - Dickinson) and by clone 1648 (provided free of charge by R. Vazeux (ICOS Corporation,
Seattle, USA)). The complexes were revealed by antibodies labeled with peroxidase directed against both rabbit and mouse immunoglobulins (Sigma), then by staining using OPD in a buffer (0.1 M Na2HPO4 , 0.1 M NaH2PO4, 0.1 M citric acid, pH 5.5), containing 0.025% hydrogen peroxide. The coloring reaction is stopped by adding a 4 N solution of hydrochloric acid.

 5) Establishment of lines secreting ESM-lg, 3D-lCAMI-lg, and ESM-1.

The purified oligonucleotide constructs containing ESM-1g, protein 3D-ICAM1-1g, and ESM-1 were subcloned into the vector pcDNA3 and then transferred into CHO and HEK293 cell lines with lipofectamine as recommended by the manufacturer, the GIBCO Company
BRL. After a week of selection with 500 ugiml of G418 (GIBCO
BRL), the cells were subcloned at a rate of 0.5 cells per well in four culture plates in the presence of G418.

 Three weeks later, the cell supernatants were screened for the presence of ESM-1g, 3DICAM1-1g by ELISA as described above.

 Three cell clones with the highest levels of chimeric proteins were selected.

 6) Immunization of mice, cell fusion, screening of hybridomas and subcloning.

 Balb / c mice were immunized with the 14 kDa peptide of ESM-1, obtained from Escherichia coli (10 μg per mouse). They were restimulated three times by injection into each of the legs.

The sera of the mice were tested in the ELISA sandwich test, as a second antibody both against ESM-1g and against 3D-ICAMI-1g. A mouse was re-stimulated three weeks later. Three days after the last immunization, cells from inguinal lymph nodes (108 cells) were fused with cells of the sp2 / 0 myeloma cell line by addition of
PEG 1500 (Boehringer), as recommended by the manufacturer. They were then seeded in culture plates in a medium containing RPMI 1640 supplemented with 10% fetal calf serum, 50 lU / ml of human interleukin-6 supplemented, hypoxanthine, aminopterin and thymidine (HAT, Gibco BRL).

 Two weeks later, the supernatants of the hybridomas were screened for the presence of anti-ESM-1 antibodies by ELISA on ESM-1g, then again screened for the lack of reactivity against the protein 3D-ICAM1. -lg. Twenty-three hybridoma cell lines were selected. Several of them have been subcloned and the antibodies produced have been characterized.

 7) Characterization of the anti-ESM-1 monoclonal antibody.

The isotype of each monoclonal antibody was determined using two commercial assay tests (Isostrip, marketed by
Boehringer and Mouse Immunoglobulin Isotyping Kit, marketed by
Pharmingen). Epitope mapping was performed by ELISA using the GST-ESM-1 fusion proteins used as fixed antigens.

8) Purification of monoclonal antibodies
The hybridomas were cultured in a conditioned medium without fetal calf serum (CHO-SFM II marketed by GIBCO BRL).

 The culture supernatants were passed over a protein A-sepharose column specific for monoclonal antibodies IgG2a and a protein G sepharose column specific for monoclonal antibodies IgGi (Pharmacia).

After the washing step with 20 mM Na2HPO4 (pH 7), the anti-ESM-1 antibodies were eluted with 0.1 M glycine at pH 2.7, and immediately neutralized with 3 M Tris buffer. eluted antibodies were then dialyzed in PBS buffers and concentrated using a
Centricon 30 (Amicon). The total amounts of protein were confirmed by assay of Bio Rad protein. The purity was verified by staining with Coomassie blue SDS-PAGE, and the anti-ESM-i activity by ELISA assay on ESM-1g.

 The purified anti-ESM-1 antibodies were stored at -20 ° C. until they were used.

 9) Immunoprecipitation.

Cells expressing ESM-1 were washed three times with cold H BSS and were lysed in a lysis buffer containing 0.5% of
NP40 and antiproteases (Boehringer), in PBS buffer for 30 minutes at 4 C, with shaking.

 The cell lysates were clarified either by centrifugation (12,000 g for 10 minutes) or by filtration through 0.45 μm filters (Millipore).

 2 <R

 The concentrations of each of these primary antibodies are 1 g / ml in PBS buffer, containing 0.1% of Tween 20 detergent. They were incubated for one hour at room temperature.

 The second antibody is an affinity purified mouse immunoglobulin anti-Fc fragment labeled with peroxidase (Sigma). It was diluted to 1: 1000 (v: v), and incubated for one hour at room temperature.

Preliminary immunoprecipitation studies from HUVEC cell lysates indicated that anti-ESM-1 monoclonal antibodies against the antigenic determinant D3 gave the best results. Among these monoclonal antibodies, the MEP 04 antibody (IgG1, K),
The MEP 14 antibody (IgG2a, K) obtained from line 1-1942 and the antibody
MEP 19 obtained from line 1-1943 (IgGi, K) gave fairly similar results.

 10) Quantitative determination by ELISA of ESM-1.

 A sandwich test has been developed to quantify the ESM-1.

 It is based on two anti-ESM-1 antibodies: MEP 19 (IgG1, K: directed against the antigenic determinant D3) and MEP 21 (lgG2a, K; directed against the antigenic determinant D1), respectively produced by the lines. filed under numbers 1-1943 and 1-1944 with the CNCM.

 ELISA plates were coated overnight with the MEP19 antibody (100 µl / well or 5 µg / ml in carbonate buffer). The plates were then washed twice with PBS and saturated for one hour at room temperature with 200 l / well of saturation buffer (0.1% BSA, 5 mM EDTA in PBS).

 After three washes with ELISA buffer (0.1% Tween 20 added to saturation buffer), 100 µl of standard dilutions of ESM-1 (100 ng / ml to 0.5 ng / ml) were incubated for one hour with stirring, at room temperature.

 After three further washes with ELISA buffer, 100 µl of MEP21 hybridoma supernatant, or 1 µg / ml of purified MEP21 antibody in ELISA buffer was added and incubated another hour at room temperature, with shaking.

 After three washes with ELISA buffer, the wells were filled with 100 μl of rat anti-mouse monoclonal antibody lgG2a conjugated to peroxidase. (Pharmingen) diluted to 1: 1000 (v / v) in ELISA buffer, and incubated for another 1 hour period.

 After three washes with ELISA buffer and two washes with PBS buffer, a colorimetric reaction is carried out with OPD in carbonate buffer containing 0.025% hydrogen peroxide. This reaction is stopped with 4N hydrochloric acid.

 The absorbance is read at 492 nm on a spectrophotometer.

 In order to determine the real specificity of this test, a known quantity (1 μg) of purified ESM-1 was diluted in 1 ml containing 100% fetal calf serum. The amount of ESM-1 was determined using serial dilutions with 100% fetal calf serum.

The results clearly demonstrate that there is no reactivity with fetal calf serum alone, and no difference in the absorbances whatever the type of dilution.
The sensitivity of this test is 1-2 ng / ml. The percentages of variation from one experiment to another, and within the same experiment are 17% (average of it independent experiences). The samples to be tested were diluted in series in an ELISA buffer before the quantification of ESM-1.

 11) Immunostaining for the detection of ESM-1.

 The HUVEC cells obtained from the umbilical vein were subcultured in culture wells of staining slides.

 COS-ESM cells transfected for 24 hours were subcultured on slides of the same type for 1 day.

 Cells grown on the slides were fixed with 4% PFA for 30 minutes and washed with PBS buffer. The slides were then subjected to immunocytological detection with the purified anti-ESM-1 monoclonal antibodies using the usual APAAP protocol.

 The human lung and kidney sections were obtained from tissues surgically removed from localized tumors.

 The sample was immediately cut into small pieces, some being frozen in liquid nitrogen, others being fixed in 4% paraformaldehyde in cacodylate buffer, then coated in paraffin.

 The best results have been obtained with dilutions of 1/50 to 1/100 (v / v) from an initial concentration of i mg / ml.

 The monoclonal antibodies directed against the antigenic determinants 1, 2 and 3 gave similar results with regard to the cells fixed on the slides. On the other hand, the monoclonal antibodies directed against the antigenic determinant 1, in the tissue sections have been shown to give unsatisfactory results.

 All immunohistochemical studies were carried out using the antibodies MEP 08 and MEP 14, directed respectively against the antigenic determinants D2 and D3.

 After incubation for 5 minutes in 3% hydrogen peroxide, the cell sections frozen or fixed using PFA were brought into contact overnight with the primary antibody (1/50 dilution). The sections were then incubated for 30 minutes with an anti-mouse or anti-rabbit IgG antibody conjugated with biotin (Dako). After washing, the sections were incubated for 20 minutes, with peroxidase conjugated to avidin (Sigma) and then brought into contact with a chromogenic substrate (3-amino-9-ethyl carbazole / H2O2). Gill's hematoxylin was used as a negative stain control.

EXAMPLE 1:
Use of ESM-lg for the detection of anti-ESM-1 antibodies
In order to detect anti-ESM-1 antibodies by ELISA, the eukaryotic ESM-1 labeled with the Fc fragment of human anti-ESM1 IgG (ESM1g) was used as an antigen in a sandwich ELISA test, comprising antibodies anti-human Fc goat attached, and further comprising goat antibodies believed to be anti-ESM-1.

 Affinity immobilized ESM-1g has been found to be detectable by polyclonal anti-ESM-1 antibodies in rabbits and mice, indicating that there are cross-reacting, non-dependent epitopes in ESM-1 host cells producing it, i.e. not dependent on Escherichia coli or eukaryotic cell lines.

 The detection threshold for rabbit serum is high (between 0.3 and 0.4 optical density values) which does not allow dilutions of the supernatants containing ESM-lg to more than 1/800 (v / v) .

 The best results were obtained with the serum containing polyclonal anti-ESM-1 mouse antibodies, as shown in FIG. 1, because the threshold was low (0.02 optical density units). Serial dilutions have detected ESM-lg up to 1/4000 (v / v).

 The recognition of ESM-1 seems to be specific, since anti-ESM-1 sera do not react with the protein 3D-ICAM-1-lg, and the antibodies binding to ESM-1g are specifically inhibited by the preincubation of the anti-ESM-1 mouse serum, with cell supernatants containing ESM-i or ESM-1-lg.

 In contrast, anti-lCAM-1 monoclonal antibodies react specifically with the 3D-ICAMI-lg protein, but not with ESM-lg, which confirms the validity of the selection protocol for these monoclonal antibodies.

EXAMPLE 2:
Selection of anti-ESM-1 monoclonal antibodies and characterization.

 Using the two chimeric molecules ESM-1g and 3D-ICAM1-1g, 10 culture plates containing 96 wells each and containing hybridomas were screened.

 23 wells showing high reactivity with ESM-1g were highlighted, which corresponds to a frequency of at least 2.3% of mouse B cells reacting with ESM-1, assuming that all the wells contain hybridoma cells.

 The 23 hybridomas having a positive reaction against ESM-1g, did not react with 3-D-ICAM1-1g, which confirms specific recognition of ESM-i.

 Two hybridomas, called MEP 01 and MEP 23, were selected.

 In order to locate the antigenic determinants recognized by the supernatants of hybridomas, GST-ESM fusion proteins, in which the 20 amino acids of the N-terminal end correspond to the 14 kDa peptide which had served for the immunization of mice ( Figure 2A), have been prepared.

 The purified GST-ESM fusion proteins were used as the fixed antigen in an ELISA test. GST, ESM-lg and 3D-ICAM1-lg were used as controls.

 It appears from the results in the table below that none of the monoclonal anti-ESM-1 antibodies reacts with 3D-ICAMI-1g or GST alone, which confirms that only peptides of the ESM-1 type express the antigenic determinants recognized by these antibodies.

Three families of monoclonal ESM-1 antibodies can be defined as illustrated in FIG. 2B., Depending on the recognized antigenic determinant:
- Di antigenic determinant of proline 79 to cysteine 99 of the sequence of ESM-1,
- D2 antigenic determinant of serine 119 to valine 139,
- D3 antigenic determinant of glycine 159 to arginine 184.

EXAMPLE 3:
Preparation of an immunological test for the quantitative determination of ESM-1.

 Since purified and native ESM-1 was not available, ESM-1 purified from Escherichia coli was used as the reference antigen to determine the best pair of monoclonal antibodies that can be used in a test. ELISA to quantify the ESM-i.

 Among the pairs tested, the antibodies recognizing the antigenic determinants D1 and D3 give the best results.

 The test is even better when the antibodies fixed are those directed against the antigenic determinant D3.

 This method of quantification is specific, since a dilution in 100% of fetal calf serum, or horse serum does not show any interference, and shows a sensitivity of 1-2 ng / ml.

This test was used to determine the quantities of ESM-1 produced in different cell models. In cell supernatants, the highest levels were found in cells
CHO-ESM (between 0.5 and 2 pg / ml), as shown in Figure 3D. Cells
HEK-ESM also have significant rates: between 0.02 and 0.5, ug / ml (Figure 3C), as well as COS transfected cells (between 0.01 and 0.3pg / ml as shown in Figure 3B ).

 The level of ESM-1 in the supernatants of HUVEC cells is between 1 and 20 ng / ml, depending on the culture conditions. In the presence of specific growth factors, such as endothelial cell growth supplements and heparin, a 2-3 fold increase in the level of ESM-1 is observed in cell supernatants, as illustrated in FIG. Figure 3A.

 In cell lysates, the highest ESM-1 levels are observed for HEK-ESM and CHO-ESM cells.

EXAMPLE 4:
Effects of cytokines on the release of ESM-1 from cells
HUVEC.

 In order to determine the effects of cytokines on the expression of ESM1, the HUVEC cells were conditioned in a medium without growth factor.

 FIG. 4A shows that the HUVEC cells release ESM-1 and that this release is improved after addition of TNFα.

This increase is detectable after 24 hours of culture and becomes significant after 48 hours of culture. This level remains stable for up to 72 hours of culture. l'lie gives similar results to
TN Fa.

 In cell lysates of unstimulated HUVEC cells, the content of ESM-1 decreases as a function of time, due to the absence of growth factor in the medium, as illustrated in FIG. 4B. In the presence of TNFα, the content of ESM-1 is significantly different from the basic values after 24 hours and 48 hours (FIG. 4B).

The presence of lnterferon gamma (IFNy) induces a slight decrease in ESM-1 content in cell supernatants
HUVEC, compared to the control, as shown in Figure 4A.

 The ability of gamma interferon to inhibit the release of ESM-1 is greatly enhanced when combined with factor TNFa, resulting in almost complete inhibition of release induced by TNFa, as shown in Figure 4A.

 As a control, the level of ICAM-1 was determined in the lysates of HUVEC cells in parallel with ESM-1. TNFa and IFNy alone induce a significant increase in the content in ICAM-1, as illustrated in FIG. 4C, but unlike ESM-1, the content in ICAM-1 increases synergistically in the presence of TNFα and lFNy , as shown in Figure 4C.

EXAMPLE 5 Immunonecipitation of ESM-1: Identification of two intracellular and secreted forms of ESM-1.

 In cell lysates, Western Blot analyzes of immunoprecipitates show that in transfected COS-ESM cells as well as in HEK-ESM and CHO-ESM cells, ESM-1 is present in two forms with apparent molecular weights of 17 kDa and 17.5 kDa, under non-reducing conditions, as illustrated by the results in FIG. 5C.

 In the lysates of the HUVEC and SV1 cells, these two bands were also detected, but two other bands of lower molecular weight were also detected, around 15 and 15.5 kDa, as illustrated by the results in FIG. 5C .

 In cell supernatants, the forms of ESM-1 appear different. In the crude supernatants of CH0-ESM and HEK-ESM cells, conditioned in a medium devoid of fetal calf serum, the size of ESM-1 was estimated between 45 and 55 kDa. It appears in the form of a broad band during Western Blots, as shown in FIG. 5A.

 In addition, a 14-15 kDa band appears in the supernatants of CHO-ESM cells, probably due to a process of cleavage by proteases, as suggested by the inhibition of its appearance by the addition of antiproteases.

 In the supernatants of HUVEC and COS-ESM cells, the levels of ESM-1 are lower than those found in other cell lines expressing ESM-1, and require immunoprecipitation in order to detect the ESM-i, which appears also as a major band between 45 kDa and 55 kDa, quite similar to that observed in the other cellular models (Figures 5B and 5D).

EXAMPLE 6
Immunochemical study of cells expressing ESM-1
About 10% of the transfected COS cells expressing ESM-i were labeled with anti-ESM-1 monoclonal antibodies.

The immunolabelling is cytoplasmic, with an important expression in the juxtanuclear region, which is in agreement with a distribution
Golgian, as shown in Figure 6A.

 A similar distribution was found in HUVEC cells, (Figure 6B).

 The results are similar with two monoclonal antibodies directed against different epitopes (MEP 04, MEP14 and MEP 08).

 However, no staining of the cytoplasms or of the nuclear membrane could be detected for ICAMI.

 No labeling was further observed when a control consisting of immunoglobulins or anti-ESM-1 antibodies were used.

EXAMPLE 7 Immunolabel d1ESM-1 in human tissues
In the lung, ESM-1 is expressed by the endothelial cells of the venules, arterioles and capillaries that are present in the alveolar walls and in the bronchial submucosa, as shown in Figure 6C.

In addition, the epithelial cells of the bronchi and submucosal glands are also marked by anti-monoclonal antibodies.
ESM-1.

 In the kidney, weak immunostaining with anti-ESM-1 monoclonal antibodies has been demonstrated in the endothelial cells of arterioles and venules, but not in the capillaries of the glomeruli.

 ESM-1 is also expressed by the tubular epithelial cells of the kidney, but its expression is even greater in the epithelium of the distal convoluted tubules compared to the epithelium of the proximal tubules, as illustrated in Figure 6D.

These photographs were obtained with MEP 08 antibodies and
MEP 14, the monoclonal antibodies directed against the antigenic determinant Di being ineffective.

BOARD
Antigen ICAM1-lg ESM-lg GST Fo F1 F2 F3 F4 AgD
Balb / C 0.005 0.035 0.017 0.043 0.068 0.065 0.038 0.041
MIS 0.012 2.720 0.161 2.502 2.662 2.665 2.520 2.510
MEP 01 0.016 2.570 0.003 2.500 0.028 0.030 0.012 0.019 1
MEP 04 0.023 2,700 0.008 nd 2,770 2,800 2,700 2,700 3
MEP 06 0.045 2.590 0.011 2.580 0.024 0.025 0.010 0.020 1
MEP OY 0.076 2.800 0.010 nd 1.540 1.500 0.015 0.014 2
MEP 13 0.012 2.690 0.007 nd 2, S50 2.900 0.035 0.070 2
MEP 14 0.034, 3,000 0.010 rd 3,000 3,000 2,900 3,000 3 MEP 19 0.013 3,000 0.012 nd 3,000 3,000 3,000 3,000 3
MEP 0.008 2.860 0.015 2.630 0.057 0.032 0.020 0.020

Claims (33)

 1. Monoclonal antibody characterized in that it specifically binds to at least one antigenic determinant of the ESM protein  2. Monoclonal antibody according to claim 1, characterized in that it specifically binds to the part of the ESM-1 protein between the proline in position 79 and the cysteine in position 99.  3. Monoclonal antibody according to claim 1, characterized in that it specifically binds to the part of the ESM-1 protein between the glycine in position 159 and the arginine in position 184.  4. Monoclonal antibody according to claim 1 characterized in that it binds specifically to the part of the ESM-1 protein between the serine in position 119 and the valine in position 139.  5. Hybridoma characterized in that it produces an antibody according to one of claims 1 to 4.  6. Hybridoma line according to claim 5 filed on 19 November 1997 under the number l-1941 with the CNCM.  7. Hybridoma line according to claim 5 filed on 19. November 1997 under number 1-1942 at the CNCM.  8. Hybridoma line according to claim 5 filed on the 19th. November 1997 under number 1-1943 at the CNCM.  9. Hybridoma line according to claim 5 filed on the 19th. November 1997 under the number l-1944 with the CNCM.  10. Antibody according to one of claims 1 to 4 characterized in that it is produced by one of the lines according to one of claims 6 to 9.  11. Conjugate consisting of an antibody according to one of claims 1 to 4 and 10 linked covalently to a molecule allowing its direct or indirect detection.  12. Method for obtaining hybridomas according to claim 5, comprising the following steps:  - immunization of a mammal with an adequate amount of ESM-1 or one of its fragments,  - fusion of mammalian lymphoid cells with myeloma cells, and  - selection of hybridomas according to claim 5 for their reactivity with respect to the ESM-lg fusion protein.  13. Method for detecting the ESM-1 protein, or a protein exhibiting cross-immunoreactivity with ESM-1, or fragments of these proteins, in a biological fluid comprising the following steps:  - bringing said fluid into contact with at least one antibody according to one of claims 1 to 4, and 10  - highlighting of the complexes possibly formed between the antibodies and the protein ESM-1, a protein having a cross immunoreactivity, or one of their fragments.  14. Method according to claim 13 characterized in that the fluid is brought into contact with two monoclonal antibodies specific for two different antigenic determinants of the protein ESM-1.  15. Method according to one of claims 13 and 14, characterized in that the fluid is brought into contact with an antibody according to claim 2 and an antibody according to claim 4.  16. Method according to one of claims 13 to 15, characterized in that the complex formed is demonstrated using an antibody, specific for the class or subclass of one of the monoclonal antibodies put in contact with the fluid, or using a conjugate containing such an antibody.  17. Kit for implementing the method according to one of claims 13 to 15 characterized in that it comprises at least one antibody or a conjugate according to one of claims 1 to 4, 10 and 11, in a form appropriate.  18. Complex formed between the ESM-1 protein, or a protein exhibiting cross immunoreactivity, or one of their fragments, and an antibody according to one of claims 1 to 4 and 10.  19. Protein characterized in that it forms a complex with an antibody according to one of claims 1 to 4 and 10 and in that it has a molecular weight of between approximately 15 and 15.5 kD, under non-denaturing conditions .  20. Protein characterized in that it forms a complex with an antibody according to one of claims 1 to 4 and 10 and in that it has a molecular weight of between approximately 44 and 56 kD under non-denaturing conditions.  21. Protein according to claim 20, characterized in that it is glycosylated.  22. Protein according to one of claims 20 and 21, characterized in that it is O-glycosylated.  23. Protein according to one of claims 20 and 21, characterized in that it is glycosylated by an N-acetylgalactosamine residue.  24. Protein according to one of claims 20 and 21, characterized in that it is glycosylated by a chondroitin sulfate residue.  25. Protein according to one of claims 20 to 24, characterized in that it is glycosylated on only one of these amino acids  26. Protein according to one of claims 20 to 25, characterized in that it is glycosylated on a serine.  27. CHO-K1-ESM cell line deposited on January 28, 1998 with the CNCM under -n "l-1970.  28. Cell line 293-ESM deposited on January 28, 1998 with the CNCM under the number "1-1971.  29. Cell line A549-ESM deposited on January 28, 1998 with the CNCM under the number "1-1972.  30. Protein according to one of claims 19 to 26 characterized in that it is capable of being produced by a cell line according to one of claims 27 to 29.  31. Pharmaceutical composition characterized in that it contains a pharmacologically effective amount of an antibody or a protein according to one of claims 1 to 4, 10, 19 to 26 and 30, in combination with pharmaceutically acceptable excipients.  32. Medicinal product, characterized in that it contains an effective amount of an antibody to a protein according to one of claims 1 to 4, 10, 19 to 26 and 30 in combination with pharmaceutically acceptable excipients.  33. Use of an antibody or a protein according to one of claims 1 to 4, 10, 19 to 26 and 30 for the manufacture of a medicament for the treatment of inflammatory diseases.