FR2775189A1 - Determining human leucocyte antigen-G transcription or expression profile in solid tumors, for selecting treatment or for monitoring - Google Patents

Abstract

Methods for determining the HLA (human leucocyte antigen) transcription or expression profile of a solid tumor, for selection of appropriate treatments and/or for monitoring progress of the tumor.- DETAILED DESCRIPTION - Methods for determining the HLA (human leucocyte antigen) transcription or expression profile of a solid tumor, for selection of appropriate treatments and/or for monitoring progress of the tumor. Either: - (i) mRNA is extracted from a tumor sample, reverse transcribed and the resulting cDNA amplified (successively or simultaneously) using primers specific for each isoform of HLA-G, and the amplicons analyzed by electrophoresis and/or specific hybridization; - (ii) a histological section is labeled with antibodies specific for membrane-bound and soluble isoforms of HLA-G, and the labeled cells detected; or - (iii) cells in the sample are optionally labeled, lysed and the lysate reacted with antibodies directed against HLA Class I antigens to form - INDEPENDENT CLAIMS are also included for the following: - (1) a method for selecting factors (I) that regulate transcription and/or expression of HLA-G in tumor cells; - (2) an antitumor vaccine containing autologous tumor cells or (fragments of) soluble HLA-G5; - (3) an antitumor composition containing an anti-HLA-G antibody (Ab) or any factor (I') that regulates transcription and/or expression of HLA-G; - (4) a combined product containing Ab and (I'), for simultaneous, separate or staged use; - (5) a model for studying transcription and/or expression of HLA-G comprising a cell culture established from a tumor biopsy; and - (6) a method for monitoring progression of a cancer that expresses HLA-G by measuring a soluble form of HLA-G in the serum.- ACTIVITY - Anticancer.- MECHANISM OF ACTION - Some isoforms of HLA-G (different ones for different tumors) protect tumor cells against lysis by natural killer cells, so inhibiting these isoforms will increase the native antitumor response

Description

 The present invention relates to a method for selecting solid tumors sensitive to anticancer treatment, which inhibits or prevents the HLA-G activity of said solid tumors and its applications.

 The major histocompatibility complex (MHC) antigens are divided into several classes, the class I antigens (HLA-A, HLA-B and HLA-C), which have 3 globular domains (cul, a2 and out3), and whose domain (x3 is associated with ss2 microglobulin, class fi antigens (HLA-DP, HLA-DQ and HLA-DR) and ffl class antigens (complement).

 The class I antigens comprise, in addition to the abovementioned antigens, other antigens, called nonclassical class I antigens, and in particular the HLA-E, HLA-F and HLA-G antigens; the latter, in particular, is expressed by the extravillous trophoblasts of the normal human placenta.

The sequence of the HLA-G gene (HLA-oO gene) has been described by
GERAGHTY et al., (Proc Natl Acad Sci USA, 1987 84 9145-9149): it comprises 4396 base pairs and has an intron / exon organization homologous to that of the HLA-A, -B and -C genes. . More precisely, this gene comprises 8 exons, 7 introns and a 3 'untranslated end; the 8 exons correspond respectively to: exon 1: signal sequence, exon 2: extracellular domain al, exon 3: extracellular domain a2, exon 4: extracellular domain ct3, exon 5: transmembrane region, exon 6: cytoplasmic domain I, exon 7: cytoplasmic domain (untranslated), exon 8: cytoplasmic domain m (untranslated) and 3 'untranslated region (GERAGHTY et al., cited above, ELLES et al., J. Immunol., 1990, 144, 731-735; KIRSZENBAUM M. et al.,
Oncogeny of hematopoiesis. Aplastic anemia Eds. E. Gluckman, L. Coulombel, INSERM Symposium / John Libbey Eurotext Ltd). However, the HLA-G gene differs from other class I genes, in that the translation termination codon, in phase, is located at the second codon of exon 6; as a result, the cytoplasmic region of the protein encoded by this HLA-oO gene is considerably shorter than that of the cytoplasmic regions of the HLA-A, -B and -C proteins.

 These SA-G antigens are mainly expressed by placenta cytotrophoblastic cells and are considered to play a role in the protection of the fetus (absence of rejection by the mother). In addition, since the HLA-G antigen is monomorphic, it may also be involved in the growth or function of placental cells (KOVATS et al., Science, 1990, 948, 330-223).

 Further research concerning this class I non-classical antigen (ISHITANI et al., Proc Natl Acad Sci USA, 1992, 89, 3947-39r 1) has shown that the primary transcript of the HLA-G gene can be spliced in several ways and produced at least 3 distinct mature mRNAs: the primary HLA-G transcript provides a complete copy (G1) of 1700 bp, a fragment of 900 bp (G2) and a fragment of 600 bp (G3) .

 Gl transcript does not include lexon 7 and corresponds to the sequence described by ELLIS et al. (supra), i.e., it encodes a protein that comprises a leader sequence, three external domains, a transmembrane region and a cytoplasmic sequence. G2 mRNA does not include exon 3, i.e. it encodes a protein in which the α1 and α3 domains are directly joined; G3 mRNA contains neither exon 3 nor exon 4, i.e. it encodes a protein in which the α1 domain and the transmembrane sequence are directly joined.

The splicing that prevails to obtain the HLA-G2 antigen results in the junction of an adenine (A) (from the coding domain ul) with an AC sequence (resulting from the coding domain a3), which leads to the creation a codon
AAC (asparagine) in place of the GAC codon (aspartic acid), encountered at the beginning of the sequence encoding the a3 domain in HLA-G1.

 The splicing generated to obtain HLA-G3 does not result in the formation of a new codon in the splice area.

 The authors of this article also analyzed the different proteins expressed: the 3 mRNAs are translated into protein in the .221-G cell line.

The authors of this article conclude that HLA-G plays a fundamental role in protecting the fetus against a maternal immune response (induction of immune tolerance). However, it is specified that the role of the protein
G3, which does not contain domain a3 is not established.

Some of the inventors have shown the existence of other spliced forms of HLA-G mRNA: the HLA-G4 transcript, which does not include exon 4 the HLA-G5 transcript, which includes intron 4, between exons 4 and 5, thus causing a modification of the reading frame, during the translation of this transcript and in particular the appearance of a stop codon, after llintron 4 amino acid 21, and the HLA transcript
G6, possessing llintron 4, but having lost llexon 3 (KIRSZENBAUM M et al., Proc.

Natl. Acad. Sci. USA, 1994, 91, 4209-4213; European application EP 0 677 582;
KIRSZENBAUM M. et al., Human Immunol., 1995, 43, 237-241; MOREAU P. et al.,
Human Immunol. 1995, 43, 231-236); they have also shown that these different transcripts are expressed in several types of fetal and adult human cells, especially in lymphocytes (Kirszenbaum M. et al., Human Immunol., 1995, cited above; Moreau P. et al., Human Immunol. 1995, supra).
Thus, there are at least 5 different HLA-G mRNAs that potentially encode 5 HLA-G isoforms.

 Although the fetus may be considered a semiallograft, fetal cells survive and are not rejected by the mother; It has been found that HLA-G molecules expressed on the surface of trophoblasts protect fetal cells from lysis by maternal natural tiller (NK) cells (CAROSELLA ED et al., CR Acad Sci., 318, 827-830). CAROSELLA ED et al, Immunol Tokay, 1996, 407409).

Previous studies have shown that the expression of molecules
HLA-G on the surface of target cells makes it possible to protect said target cells from the lytic activity of the NK cells of the deciduous layer of the maternal endometrium (CHUMBLEY G. et al., Cell Immunol., 1994, 155, 312- 322, DENIZ G. et al., J.

Immunol., 1994, 152, 42554261; ROUAS-FREISS N. et al., Proc. Natl. Acad. Sci., 1997, 94, 5249-5254). It should be noted that these target cells are obtained by transfection with vectors comprising genomic DNA of HLA-G, potentially generating all alternative transcripts.

NK cells express killer inhibitory receptors (KIR or NKIR) receptors, which are responsible for the inhibition of cytotoxicity, when these FILA molecules, acting as ligands, are recognized by these receptors; for example,
N. ROUAS-FREISS et al. (Proc Natl Acad Sci., 1997 94. 5249-5254) have shown that HLA-G expression protects against lysis the target cells K562 (human erythroleukemic cell line), transfected with the HLA gene. G. These cells are usually sensitive to NK cells. Some of the inventors have shown that NK cells do not express any HLA-G transcript, this result confirming that HLA-G gene expression products are likely to play a role in immuno-tolerance (TEYSSIER M. et al., Nat Immunol., 1995, 14, 262-270).

Given the important role that the HLA-G molecule can play both in pathologies where the NK cells are particularly active (autoimmune diseases, transplants) or are on the contrary inhibited (abnormal presence of HLA-G molecules, especially on certain tumors or in the viral infections), the inventors, continuing their work have more particularly studied the tumor cells. We have surprisingly found that at least some solid tumors express the HLA-G antigen and have shown that this antigen
HLA-G plays a functional role in protecting tumor cells (solid tumors) from destruction by NK cells. Es have further shown the effective presence of some of the HLA-G isoforms on the surface of said tumor cells.

 However, also surprisingly, depending on the tumor lines, the HLA-G profile (transcripts and proteins) will be different.

 For example, in some melanoma lines one can observe the presence of the FILA-G2 / G4 and G3 isoforms, which protect these lines from NK-cell-mediated cell lysis, as does the HLA-G1 isoform, in vitro. other lineages.

 Consequently, the inventors have set themselves the goal of providing tools for the selection of solid tumors sensitive to a treatment that inhibits HLA-G antigens.

The subject of the present invention is a method for establishing the HLA-G transcription profile of a solid tumor, characterized in that it comprises:
(i) the taking of a tumor sample
(ii) extracting the mRNA from said sample; ; in particular, a modified method of Chomczynski and Sacchi can be used, using the reagent RNA NOW (Ozyme, France)
(iii) reverse transcription (RT) of said RNA
(iv) the successive or concomitant amplifications of the cDNAs obtained in (iii), in the presence of specific primers of each HLA-G isoform and the analysis of the amplification products obtained, by electrophoresis and / or specific hybridization and
(v) establishing the HLA-G transcription profile of said sample.

 Preferably, the reverse transcripts are primed with oligo-dT on mRNA, previously denatured, for example at 65 ° C, in the presence of a reverse transcriptase, such as M-MLV reverse transcriptase (Gibco-BRL). Life Technologies).

Also preferably, the amplification of the cDNAs is carried out by polymerase chain reaction (PCR), using primers specific for the different isoforms of HLA-G, according to the following Tables.

<tb> Primers <SEP> Sequences <SEP> nucleotides <SEP> Temperatures <SEP> Isoforms
<tb><SEP> hybridization <SEP> amplified
<tb><SEP>("C)<SEP>
<tb> G.257 <SEP>5'-GGAAGAGGAGACACGGAACA<SEP> 61 <SEP> G1, <SEP> G2, <SEP> G3,
<tb> G3.U <SEP>5'-GGCTGGTCTCTGCACAAAGAGA<SEP> G4, <SEP> G5, <SEP> G6
<tb> G.526 <SEP>5'-CCAATGTGGCTGAACAAAGG<SEP> 61 <SEP> GI, <SEP> G4, <SEP> G5
<tb> G3.U <SEP> 5 <SEP>'<SEP> -GGCTGGTCTCTGCACAAAGAGA <SEP>
<tb> G-34 <SEP> 5 '<SEP> -ACCAGAGCGAGGCCAAGCAG <SEP> 65 <SEP> G3
<tb> G3.U <SEP>5'-GGCTGGTCTCTGCACAAAGAGA<SEP>
<tb> G-3 <SEP> 5 '<SEP> -ACCAGAGCGAGGCCAACCCC <SEP> 65 <SEP> G2, <SEP> G6
<tb> G3 <SEP> .U <SEP>5'-GGCTGGTCTCTGCACAAAGAGA<SEP>
<tb> G.-3 <SEP>5'-ACCAGAGCGAGGCCAACCCC<SEP> 61 <SEP> G6
<tb> G.i4b <SEP> 5 '<SEP> -AAAGGAGGTGAAGGTGAGGG
<tb> G.526 <SEP> 5 '<SEP> -CCAATGTGGCTGAACAAAGG <SEP> 61 <SEP> G5
<tb> G.i4b <SEP> 5 '<SEP> -AAAGGAGGTGAAGGTGAGGG
<Tb>

<tb><SEP> Probes <SEP> Sequences <SEP> nucleotides <SEP> Temperatures <SEP> Isoforms
<tb><SEP> of <SEP> hybridization detected
<tb><SEP> (C) <SEP>
<tb> GR <SEP> SE-GGTCTGCAGGTTCATTCTGTC <SEP> 60 <SEP> HLA-GI, G2, <SEP>
<tb><SEP> G3, G4, GS, G6 <SEP>
<tb> G.647 <SEP> F <SEP>5'-CCACCACCCTGTCTTTGACT<SEP> 60 <SEP> HLA-GI <SEP>
<tb><SEP> G2, GS, G6 <SEP>
<tb> G.14 <SEP> F <SEP> GAGGCATCATGTCTGTTAGG <SEP> 55 <SEP> HLA-GS, <SEP> G6
<tb> G.927 <SEP> F <SEP>5'-ATCATGGGTATC<SEP> GTTGCTGG <SEP> 55 <SEP> HLA-G1-G4 <SEP>
<Tb>
The present invention also relates to a method for establishing the HLA-G expression profile of a solid tumor, characterized in that it comprises:
(i) the taking of a tumor sample,
(ii) optionally labeling the cells of said sample,
(iii) lysis of the cells,
(iv) contacting the lysed cells with different antibodies directed against class I HLA antigens, to form, optionally, HLA-G / antibody isoform complexes and
(v) establishing the HLA-G expression profile of said sample, by detecting the complexes formed in step (iv).

 Preferably, in step (iv), immunoprecipitates are obtained, which are separated, in step (v) by electrophoresis, transferred to membrane and detected.

 According to the invention, said antibodies are preferably monoclonal antibodies.

 This expression of HLA-G by the tumor cells makes it possible to better evaluate the type of potentially effective treatment.

 The present invention also relates to an anti-tumor vaccine, capable of inhibiting HLA-G antigens, characterized in that it is selected from the group consisting of autologous tumor cells or a soluble HLA-GS antigen; such vaccines induce the formation of tumor-specific cytotoxic T lymphocytes and anti-HLA-G antibodies.

When said vaccine consists of autologous cells (in particular tumor cells of the individual to be treated expressing at least one HLA isoform
G), said cells are preferably modified so as to effectively induce the production of anti-HLA-G antibodies. The cells are for example subjected to a treatment with cholesterol or a hyperbaric treatment.

 Advantageously, said soluble anti-HLA-GS antigen is coupled to a suitable protein and optionally combined with an adjuvant such as aluminum hydroxide or calcium phosphate.

 The said vaccine is preferably administered subcutaneously or intradermally.

 The present invention also relates to an antitumor composition, capable of inhibiting HLA-G antigens, characterized in that it consists of anti-HLA-G antibodies (passive immunotherapy).

 The present invention further relates to products containing anti-HLA-G antibodies and HLA-G expression regulating factors, capable of inhibiting HLA-G antigens, as combination products for simultaneous use. separated or spread over time, in the treatment of solid tumors expressing at least one HLA-G isoform.

 Among said regulatory factors, there may be noted in particular the sex hormones such as testosterone.

In addition to the foregoing, the invention further comprises other arrangements, which will become apparent from the following description, which refers to examples of implementation of the present invention and to the accompanying drawings in which
- Figure 1 illustrates
(A): RT-PCR analysis of mRNAs of HLA-G isoforms in melanoma cells. Pan-HLA-G primers [G.257 primer (exon 2) and 3G.2 (untranslated 3 'end)] are used for PCR amplification of transcripts
HLA-G corresponding to the different known isoforms of HLA-G. JEG-3 choriocarcinoma cell cDNA, first-trimester trophoblasts (TRO) and peripheral blood mononuclear cells (PBMC) are used as control cells for high transcriptional and basal transcription rates, respectively. HLA-G. IgR, M8 and M74 correspond to the amplification of cDNA of melanoma cell lines. Specific HLA-G bands are revealed by hybridization with the GR-specific probe, located in exon 2. The bands corresponding to HLA-G transcripts 1, G2, G3, G4 and G5 are indicated by arrows.

The PCR products, co-amplified during the same reaction, with the p-actin primers are detected on the same membrane using an ss-actin probe;
(B): this figure corresponds to the RT-PCR detection of alternative transcripts in melanoma cells. Primer 3 is specific for isoforms
HLA-G2 and soluble HLA-G2 (G6) that do not have exon 3. Primer 3.4 distinguishes HLA-G4 mRNA transcripts. Primers G.526 and 14b specifically amplify the HLA-GS transcript, which corresponds to the soluble form. The PCR products, co-amplified in the same reaction with the p-actin primers, are detected on the same membrane by a specific ss-actin probe;
(C): this figure corresponds to the RT-PCR analysis of the ARlNm of
Class I HLAs. The cDNAs of PBMCs, trophoblasts and melanoma cells are amplified by RT-PCR, using HLA-A specific primers,
HLA-B, HLA-C or HLA-DRA. Specific bands are revealed using specific probes (HLA-A, HLA-B, HLA-C and HLA-DRA). The products of the
PCR, co-amplified in the same reaction with the β-actin primers, are detected on the same membrane by a specific ss-actin probe (quantitative control of RNA levels).

FIG. 2 illustrates the RT-PCR analysis of the HLA-G isoform mRNAs in the biopsies of melanoma metastases (in vivo and ex vivo analysis of the skin). The pan-HLA-G G.257 and 3G.U primers are used for amplification
RT-PCR of HLA-G transcripts, from ex vivo skin metastases (MET) and from healthy skin biopsies, from the same patient (HS); JEG-3 cells and first trimester trophoblasts are used as controls (high level of HLA-G transcription). The HLA-G specific bands are revealed by hybridization with a GR-specific probe, located in exon 2. The bands corresponding to transcripts HLA-G1, G2, G3, G4 and G5 are indicated by arrows.

FIG. 3 illustrates the detection of HLA-GI proteins in JEG-3 cells but not in IGR and M8 melanoma cells using the monoclonal antibody W6 / 32:
(A): immunoprecipitation of metabolically labeled proteins.

(B): biotinylated melanoma surface proteins and cells
JEG-3 are immunoprecipitated with monoclonal antibody W6 / 32; the immunoprecipitates are separated by 12% SDS-PAGE and transferred to a cellulose membrane. Class I surface molecules are detected with peroxidase conjugated with streptavidin.

 FIG. 4 illustrates the immunoprecipitation of HLA-G isoforms of IGR melanoma cells by a monoclonal antibody directed against the free HLA-G heavy chain and by the monoclonal antibodies 4FI94 and HCA9. The cells are labeled for 30 min, immunoprecipitated with the specific antibodies and the immunoprecipitates are analyzed by 10% SDS-PAGE. The 4H94 antibody, which reacts with the HLA-G heavy chain (39 kDa band in JEG-3 cells), cross-reacts with the HLA-A, B and / or C heavy chains (band 45 kDa in all cells tested).

- Figure 5 illustrates
(A): Effect of HLA-G expression in IGR melanoma on lysis sensitivity by clone YT2C2-PR. The K562 cells transfected with either the vector alone (K562-pRc / RSV), or with the HLA-GI vector (K562-HLA-G1) or the HLA-G2 vector (K562-HLA-G2) and the M8 lines, M74 and IGR are used as target cells (T). Clone YT2C2-PR is used as an effector cell (E) in an effector / target cell (E / T) ratio of 50: 1. The results are expressed as the percentage of lysis recorded in 4 hours in a chromium 51 release test. The spontaneous release never exceeds 10% of the maximum release.

This experiment is carried out at least 5 times and produces the same results each time.
(B): The inhibition of the lysis induced by the clone YT2C2-PR is due to an off signal transmitted by the IGR cells. The M8 line is used as target cell (T), labeled with chromium. Clone YT2C2-PR is used as an effector cell (E) in a UT ratio of 50: 1. IGR cells are added as inhibitory cells in an inhibitory cell / target cell ratio of 100, 50 and 25: 1.

0 indicates that no IGR cells were added in the test.
It should be understood, however, that these examples are given solely by way of illustration of the subject matter of the invention, of which they in no way constitute a limitation.

EXAMPLE 1 Analysis of HLA-G Profiles of Different Tumor Lines
A / MATERIAL AND METHODS
1 / Cell lines
The human erythroleukemic cell line K562 (ATCC) and the immature leukemic T cell line (clone YT2C2-PR) with NK activity) are maintained in RPMI 1640 medium supplemented with heat-inactivated 10% fetal calf serum of 2mM L-glutamine, gentamicin at 1 μg / ml and fungizone (Sigma, Saint-Quentin, France) and cultured at 37 ° C. in an incubator, humidified with a 5% CO2 enriched atmosphere. are selected in a medium containing geneticin 1 mg / ml (G4 18 sulfate,
Sigma).

 The HLA-G-positive human choriocarcinoma cell line called JEG-3 (ATCC) is cultured in DMEM (Sigma) supplemented with heat-inactivated 10% fetal calf serum, antibiotics and L-glutamine. 2 mM. Cell lines do not contain mycoplasma.

In addition to the above mentioned lines, we use
melanoma lines IGR (HLA-A2, A3, B58 / male), M74 (HLA-A1, A2, B8, B14 / female) and M8 (HLA-A1, A2, B12 and B40 / male),
trophoblastic tissues of the first trimester, obtained after abortion; these tissues are cut into thin strips and immediately used to extract the RNA, and
peripheral blood mononuclear cells (PBMC), obtained from healthy volunteers and isolated on a Ficoll-Hypaque 1077 density gradient.

2 / Tumor samples
Biopsies are performed from tissue samples of patients.

3 / Monoclonal antibodies
The following antibodies are used
W6 / 32: IgG2a, HLA class I anti-chain I associated with P2-m (Sigma); ; HCA1: anti-HLA-A and IgG IgG and anti-HLA-G IgG.

4 / RT-PCR
Total mRNA is extracted from 107 cells using the reagent
RNA NOW (Biogentex, Inc.) in accordance with the manufacturer's recommendations. The quality of the RNA is verified by electrophoresis on 1.5C7O denaturing agarose gel.

The cDNAs were prepared from 10 RNA total treated with DNAse I (Boerhinger Mannheim) using oligo- (dT) 1, 18 primer and M-MLV reverse transcriptase (GIBCO-BRL). The RT-PCR amplifications are carried out using the following primers: G.257 (exon 2) and G3.U (3'UT) (Ishitani A. et al., Proc., Nad.

Acad. Sci., 1992, 89, 3947-3951; Kirszenbaum M. et al., Proc. Natl. Acad. Sci., 1994, 91, 42094213 and Moreau P. et al., CR Acad. Sci, 1995, 318, 837-842), to detect all HLA-G mRNA isoforms. A specific amplification of each form of HLA-G mRNA is performed with the following sets of primers
- G.526 (exon 3) and G3.U (3 'UT) for isoforms G1 and G4;
- G.526 (exon 3) and G.i4b (intron 4) for the G5 isoform
- G.-3 (partially covering exons 2 and 4) and G3.U (3 'UT) for isoforms G2 and G6
G.34 (partially covering exons 2 and 5) and G3.U (3 'UT) for isoform G3.

 Classical HLA class I cDNAs are amplified as described in King et al. (J. Immunol., 1996, 156, 2068-2076), using a unique HLA-5P2 5 'primer and 3', HLA-3pA, HLA-3pB and HLA-3pC primers that respectively amplify HLA-A mRNAs. , HLA-B and HLA-C.

 Specific DRA primers are described in King et al. supra.

Co-amplification of the p-actin cDNA was performed in each experiment with the Clontech test (16 cycles), in order to evaluate the comparative amounts of RNA in the samples. The PCR products are analyzed by electrophoresis on 1% agarose gel and stained with ethidium bromide. The specificity of the PCR products is confirmed by alkaline blotting of the fragments in
0.4 N NaOH on nylon membranes (Hybond N +, Amersham, France).

The specific HLA-G probes are as follows
- specific GR of exon 2,
- G.647 F (5 '-CCACCACCCTGTCTTTGACT: specific to exon 4),
G.I4 F (GAGGCATCATGTCTGTTAGG: specific to intron 4), and
- G.927 F (5'-ATCATGGGTATCGTTGCTGG: specific for exon 5).

The other probes are as follows
- HLA-A specific probe (5 'GGAGGACCAGACCCAGGACAC-
G)
- HLA-B specific probe (5'AGCTCCGATGACCACAACTGC)
- HLA-C specific probe (5'TGTCCTAGCTGCCTAGGAG) and
- HLA-DRA specific probe (TGTGATCATCCAGGCCGAG).

 The filters are exposed on Kodak (Biomax) films with amplifier displays for 4 to 16 hours at -80 C.

 5 / Metabolic labeling, immunoprecipitation and gel electrophoresis.

 The cells are metabolically labeled with 0.5 mCi [35S] methionine + [35S] cysteine (Amersham) for 2.107 cells for 30 min or 1 h in methionine and cysteine free medium containing 5% fetal calf serum.

 The cells are washed twice with cold PBS and lysed in a buffer consisting of 1% Triton X100PBS for 30 min at 4 ° C. After pre-clarification by incubation with a Sepharose-Protein A CL-4B column (Pharmacia) and serum normal, the preclared cell lysates are incubated with specific antibodies (W6 / 32, 4H94 and HCA2) The immunoprecipitated products are washed 5 times in a buffer comprising 0.1% Triton X100 / 20 nM Tris pH 7.5 150 mM NaCI, 0.05% NaN 3 (Dunq) and once in a buffer comprising 0 are then analyzed on a 12 or 10% SDS-PAGE gel The gels are dried and exposed to Kodak XAR-5 film at -70 C.

6 / Immunoprecipitaflon of biotinylated surface proteins and
Western blot.

Surface proteins are labeled with biotin. After washing in PBS, 1.5 × 10 7 cells are incubated in 1 ml of cold PBS containing 5 ml of NHS-SS-biotin (Pierce, Rockford, L) for 15 min at 4 ° C. Residual active groups are inhibited in 50 mM NH4Cl for 10 min at 4 ° C. The cells are lysed in 1% Triton X100 / PBS. Proteins precipitated with antibody
W6 / 32 are separated on 12% SDS-PAGE, transferred to nitrocellulose membrane and placed in the presence of horseradish peroxidase-streptavidin conjugate. After extensive washing of the membrane, the color reaction is performed using the ECL Western blotting detection reagent (Amersham, France), after which the membrane is exposed to a Kodak film at room temperature.

 7 / Cytotoxicity assays.

 The cytolytic activity of peripheral blood mononuclear cells, NK cells and YT2C2-PR cells (effector cells or E) against HLA-G transfectants (target cells or T cells) is estimated using Chromium 51 release for 4 hours, in which the effector cells are mixed with 5 × 10 3 of 51 chromium-labeled target cells (100 μCi of 5'Cr-sodium chromate, Amersham, UK), in different E / T ratios, in microtiter plates with a U-shaped bottom.

 After 4 hours at 37 ° C. in a humidified incubator containing 5% CO 2, 100 μl of supernatant are taken for liquid scintillation counting (Wallac 1450 Microbeta, Pharmacia, France) The percentage of specific lysis is calculated as follows : percentage of specific lysis = [cpm in the experimental well - spontaneous release cpm] / (maximum release cpm - spontaneous release cpm)] x 100.

Spontaneous release is determined by incubation of the labeled target cells (T) with the medium. Maximum release is determined by solubilization of target cells in 0.1 M ICI. In all experiments, spontaneous release is less than 10% of maximal release. The results are presented as averages of three samples. In experiments in which monoclonal antibodies are used to block HLA-G interaction
NK, the target cells are incubated with the corresponding monoclonal antibody, then washed and incubated with goat anti-mouse F (ab ') 2 antibody (Jackson
Immunoresearch, USA) to avoid antibody-dependent cellular cytotoxicity (ADCC) by receptor interaction for the Fc immunoglobulin fragment, expressed on NK cells with the first antibody used. The toxicities of the monoclonal antibodies are also verified in each test and are always less than 3%.

Il - Results
1 / Identification of the different HLA-G transcripts in melanoma cell lines.

The HLA-G cDNAs of 3 melanoma cell lines (IGR, M8 and NI74) are amplified, using the previously described primers (A. Ishitani et al.
Proc. Natl. Acad. Sci. USA, 1992, 89, 3947-3951; M. Kirszenbaum et al., Proc. Cati.

Acad. Sci. USA, 1994, 91, 42094213), derived from the specific sequences of exon 2 and the 3 'untranslated region (see Materials and Methods).

 The choriocarcinoma JEG-3 line and trophoblastic cells, which have high levels of HLA-G transcripts, are used as positive controls and healthy volunteers' peripheral blood mononuclear cells (PBMCs) are used as negative controls ( low HLA-G transcripts).

Hybridization of the PCR products allowed to identify important levels of HLA-G mRNA in 2 melanoma cell lines, namely
IGR and M74, while no signal can be detected in the M8 melanoma cell line.

 In JEG-3 cells and trophoblasts, all HLA-G transcripts are detected (Figure 1A).

 In IGR melanoma cells, all transcripts are also detected by pan-HLA-G primers (Figure 1A).

 However, the pan-HLA-G primers do not distinguish between the HLA-G1 and HLA-G5 signals, which are present both, at a band corresponding to 1000 bp. nor between the HLA-G2 and HLA-GI signals, which comigrate as a 600-bp fragment. An RT-PCR identification makes it possible to isolate the isoforms using specific primers (Moreau P. et al., C.R. Acad.

Sci., 1995, 318, 837-842) (see Materials and Methods).

 IGR cells express all HLA-G isoforms as transcripts, HLA-G4 and HLA-G5 being expressed at low levels (Figure 1B).

In the M74 melanoma cell line, pan-HLA primers
G detect bands corresponding to HLA-GI and HLA-G5 (1000 bp) (strong signals), a signal for HLA-G2 and G4 (600 bp), but no signal for HLA-G3 (300 bp) (Figure 1A) ). The primers for the specific isoforms reveal that in these cells the isoforms G1 and G4 are more abundant than in the PBMCs while the G5 transcript level is comparable to that observed in the PBMCs.

 Low levels of HLA-G2 and HLA-G6 mRNA (soluble form of HLA-G2) are detected in these M74 cells, whereas specific amplification of the HLA-G3 transcript confirms the absence of observed HLA-G3 with pan-HLA-G primers in these cells (Figures 1A and 1B).

No HLA-G hybridization signal is observed in cells
M8 (Figures 1A and 1B).

PCR analysis of classical MHC transcripts, using specific HLA-A, HLA-B, HLA-C primers (A. King et al., J. Immunol., 1996, 156, 20682076) and HLA. RD (Bull et al., Mol Cell Biol., 1990, 10, 3792-3796) discloses high levels of transcription of classical class I HLAs in all melanoma cell lines, while detects little or no transcripts
HLA-DRA in these cells (Figure 1C).

 These results are confirmed by flow cytometric analysis, using monoclonal antibodies directed against HLA class I and II antigens; they show that the HLA-A, B and C molecules are expressed on the surface of melanoma cell lines, whereas no class II antigen can be detected.

 The table below summarizes the transcription profiles obtained with these different cells.

JEG-3 PBMC TRO LGR M8 M74
GI ++++ ++ ++++ +++ - +44 G2 ++ + +++ ++ - +/-
G3 +++ - +++ ++
G4 +++ + +44 + - +
G5 ++++ ++ ++++ + - ++
G6 ++ + ++ + - + 1-
2 / Analvse of HLA-G transcription in ex-vivo melanoma biopsies.

 All HLA-G transcripts are detected at high levels in melanoma biopsies, whereas only the 1000-bp band is detected in healthy human skin (Figure 2). These results have been confirmed in other biopsies and show that the significant levels of transcription observed in melanoma cells are specific to melanoma cells.

 3 / Analysis of HLA-G proteins in melanoma cells.

 To determine whether HLA-G transcripts detected in melanomas are translated into HLA-G proteins, immunoprecipitation studies were performed with different class I anti-HLA monoclonal antibodies on metabolically labeled cell lysates (35S). methionine / cysteine).

The comparison is made in the presence of a positive control (cell
JEG-3) and a negative control (M8 melanoma cells).

Immunoprecipitation results with monoclonal antibodies
W6 / 32 are illustrated in Figure 3.

 With JEG-3 cells, the W6 / 32 antibody immunoprecipitates two 45 kDa (HLA-C molecule) and 39 kDa (membrane bound HLA-G1 isoform) proteins (Figure 3A).

 In IGR and M8 cells, only a 45 kDa protein is detected.

 Similar results are obtained by immunoprecipitation of biotinylated surface proteins (Figure 3B).

 These data show that the HLA-GI protein is not expressed in IGR cells, even though the latter express the corresponding mRNA.

 However, the absence of HLA-G1 protein in IGR cells does not exclude the expression of 3 other HLA-G isoforms (HLA-G2, G3 and G4).

 These proteins can not be revealed by the monoclonal antibody W6 / 32, because of their inability to associate with 2m.

 To demonstrate these proteins, the immunoprecipitation of methionine-labeled proteins (35S-methionine) is performed using monoclonal antibodies that recognize free FILA-G, denatured HLA-G, and HLA-A ( HCA2 antibody) and an al domain localized epitope present in all isoforms of the HLA-G protein (HLA-G Ig monoclonal antibody).

 The monoclonal antibody reveals the presence of the 39 kDa HLA-GI protein in JEG-3 cells and its absence in IGR cells (FIG. 4).

Additional bands, which migrate at 32-34 kDa and at 18 kDa, which correspond respectively to the size of the HLA-G2 protein and / or the protein
HLA-G4 or G3, are detected in IGR cells with both monoclonal Ig anti HLA-G antibody and HCA2 antibody (Figure 4).

 The additional bands specific for the HLA-G protein are not observed in the M74 and M8 cells which do not have the corresponding HLA-G transcripts (FIG. 4).

 4 / Protection of the IGR line of the nv cell-induced tumolysis.

YT2C2-PR cells are used as effector cells
NK.

 Only the IGR cell line, which expresses the HLA-G2 and / or G4 and G3 isoforms, abolishes the lysis induced by the YT2C2-PR clone.

The M74 melanoma cell line, which expresses classical class I MHC antigens but exhibits a selective defect in the transcription and expression of the HLA-G2 and HLA-G3 isoforms, is lysed by the YT2C2 clone.
PR.

Lysis is also observed with the M8 cell line, which expresses classical class I MHC antigens, but which transcribes no
HLA-G mRNA (Figure 13A).

 To show that only HLA-G are involved in this inhibition of NK cell-mediated lysis, several EBV-B cell lines expressing no SA-G but sharing at least one HLA-A, B or C allele with the IGR line are used as target cells.

 All these EBV-B lines are lysed by the YT2C2-PR clone, showing that the HLA-A, B and C antigens are not involved in the protection of IGR melanoma, YT2C2-PR lysis.

To show that the inhibition of lysis, induced by clone YT2C2
PR by IGR cells, is not due to a signal transmitted by this cell line but is well linked to intrinsic resistance of these IGR cells to NK cells, IGR cells were used as inhibitors, in a cytotoxicity test in which target cells (T) are M8 cells and YT2C2-PR cells, effector cells (E).

 Figure 5B shows that IGR cells effectively inhibit lysis of M8 cells by clone YT2C2-PR; this inhibition is proportional to the number of IGR cells used for the competitive test.

 As is apparent from the foregoing, the invention is not limited in any way to those of its modes of implementation, implementation and application which have just been described more explicitly it embraces all variants on the contrary. which may come to the attention of the skilled artisan, without departing from the scope or scope of the present invention.

Claims (6)

 1 ") Anti-tumor vaccine, capable of inhibiting HLA-G antigens, characterized in that it is selected from the group consisting of autologous tumor cells or a soluble HLA-G5 antigen.  2 ") Vaccine according to claim 1, characterized in that when said vaccine consists of autologous cells (in particular tumor cells of the individual to be treated expressing at least one isoform of HLA-G), said cells are modified so to induce the production of anti-HLA-G antibodies.  3) Vaccine according to claim 1, characterized in that said anti-HLA-G5 soluble antigen is coupled to a suitable protein and optionally combined with an adjuvant such as aluminum hydroxide or calcium phosphate.  4) Anti-tumor composition, capable of inhibiting HLA-G antigens, characterized in that it consists of anti-HLA-G antibodies.  5) Products capable of inhibiting HLA-G antigens, containing anti-HLA-G antibodies and HLA-G expression regulating factors, as combination products for simultaneous, separate or spread use over time in the treatment of solid tumors expressing at least one HLA-G isoform.  6) Products according to claim 5, characterized in that said regulating factors are in particular selected from the group consisting of sex hormones.