FR2767336A1 - Mycobacterial DNA vectors containing reporter constructs - Google Patents

Abstract

The following are claimed: (1) a recombinant screening, cloning and/or expression vector that replicates in mycobacteria, comprising: a replicon functional in mycobacteria; a selectable marker; and a reporter cassette comprising (a) a multiple cloning site (polylinker), (b) optionally a mycobacterial transcription terminator upstream of the polylinker, (c) a coding sequence from a gene coding for a protein expression, export and/or secretion marker, the coding sequence lacking its start codon and regulatory sequences, and (d) a coding sequence from a gene coding for a cis-acting promoter activity marker, the coding sequence having its start codon; (2) a recombinant vector as above containing a mycobacterial nucleic acid sequence in one of the cloning sites of the polylinker, where the mycobacterial nucleic acid sequence is one "in which one detects a polypeptide capable of being exported and/or secreted, and/or of being induced or repressed during infection by said mycobacterium or constitutively expressed or produced, as well as associated promoter and/or regulatory sequences capable of permitting or enhancing the export and/or secretion of said polypeptide, or all or part of a gene coding for said polypeptide"; (3) a method for screening mycobacterial nucleotide sequences to detect sequences coding for exported and/or secreted polypeptides that may be induced or repressed during infection, promoter and/or (other) regulatory sequences associated with such coding sequences, especially sequences that permit or enhance the export and/or secretion of such polypeptides, or all or part of genes coding for such polypeptides, using a vector as above; (4) a method as in (3) comprising: (a) physically or enzymatically fragmenting mycobacterial DNA sequences and recovering the resulting fragments; (b) inserting the fragments into a compatible cloning site in the vector's polylinker; (c) if necessary, amplifying the fragments contained in the vector, e.g. by replicating the vector in a cell, preferably of E. coli; (d) transforming host cells with the vector; (e) culturing the transformed cells in a medium permitting detection of the export and/or secretion marker and/or the promoter activity marker; (f) detecting positive colonies that express the export and/or secretion marker and/or the promoter activity marker; (g) isolating DNA from the positive colonies and inserting this DNA into a cell identical to that of step (c); (h) "the selection of insertions contained in the vector, permitting clones positive for the export and/or secretion marker, and/or for the promoter activity marker to be obtained"; and (i) isolating and characterising mycobacterial DNA sequences contained in the inserts and optionally sequencing selected inserts; (5) a mycobacterial genomic DNA or cDNA library obtained by the method of (3) and/or by a method comprising steps (a) and (b) or steps (a), (b) and (c) of the method of (4); (6) a mycobacterial nucleotide sequence selectable by the method of (3) or (4); (7) a polynucleotide which has a sequence complementary to the sequence of (6), or has a sequence that is at least 50% identical to the sequence of (6), or hybridises with the sequence of (6) under high-stringency conditions, or consists of a fragment of at least 8 consecutive nucleotides of the sequence of (6); (8) a polypeptide, "their fragments or biologically active fragments or their homologous polypeptides", that is encoded by a mycobacterial nucleotide sequence as in (6) or (7) and is capable of being exported and/or secreted and/or induced and/or repressed or constitutively expressed during infection; (9) a recombinant mycobacterium transformed with a recombinant vector as above; (10) a polypeptide encoded by a mycobacterial nucleotide sequence as in (6) or (7); (11) a polypeptide selected from: (a) a polypeptide having a sequence selected from SEQ ID NO:1 to SEQ ID NO:24C, SEQ ID NO:27A to SEQ ID NO:28 and SEQ ID NO:30 to SEQ ID NO:50F all defined sequences given in the specification, (b) a polypeptide homologous to the polypeptide of (a), (c) a fragment comprising at least 5 amino acids of the polypeptide of (a) or (b), and (d) a biologically active fragment of the polypeptide of (a), (b) or (c); (12) a recombinant cloning, expression and/or insertion vector containing a nucleotide sequence as in (6) or (7); (13) a host cell transformed with the vector of (12); (14) a process for preparing a polypeptide using the vector of (12); (15) a recombinant polypeptide obtainable by the process of (14); (16) a hybrid polypeptide comprising at least one polypeptide sequence as in (8), (11) or (15) and a sequence of a polypeptide capable of inducing an immune response in humans or other animals; (17) a polynucleotide encoding the hybrid polypeptide of (16); (18) mono- or polyclonal antibodies, antibody fragments or chimeric antibodies capable of specifically recognising the polypeptide of (8), (11) or (15); (19) a method of screening for molecules capable of inhibiting the growth or survival of mycobacteria in a host, characterised in that the molecules block the synthesis or function of polypeptides encoded by the nucleotide sequence of (6) or the polynucleotide of (7); (20) molecules capable of inhibiting the growth or survival of mycobacteria in a host, where the molecules are synthesised according to the structure of polypeptides encoded by the nucleotide sequence of (6) or the polynucleotide of (7).

Description

Recombinant vectors, polynucleotide encoding a polypeptide

  DP428 of 12kD mycobacteria belonging to the Mycobacterium tuberculosis complex and applications to

  diagnosis and prevention of tuberculosis.

  The subject of the invention is novel recombinant screening, cloning and / or expression vectors that replicate in mycobacteria. The invention also relates to a polypeptide, designated DP428, of approximately 12 kD corresponding to an exported protein found in mycobacteria belonging to the Mycobacterium tuberculosis complex. The invention also provides a polynucleotide comprising a sequence encoding this polypeptide. It also relates to the use of the polypeptide or fragments thereof and polynucleotides encoding them for the realization of means for detecting in vitro the presence of a mycobacterium belonging to the Mycobacterium tuberculosis complex in a biological sample. The invention finally relates to the use of the polypeptide or fragments thereof and the polynucleotides encoding them as means for the preparation of an immunogenic composition, capable of inducing an immune response against mycobacteria belonging to the Mycobacterium tuberculosis complex, or a vaccine composition for the prevention and / or treatment of infections caused by mycobacteria belonging to said complex, in particular tuberculosis. 3M The genus Mycobacterium, which includes at least 56 different species, includes major human pathogens such as M. leprae and M. tuberculosis, agents responsible for leprosy and tuberculosis, which remain serious health problems

public around the world.

2 2767336

  Tuberculosis continues to be a public health problem around the world. Today, this disease is the cause of 2 to 3 million deaths in the world and about 8 million new cases are observed each year (Bouvet, 1994). In developed countries M. tuberculosis is the most common cause of mycobacterial infections. In France there are about 10,000 new cases per year and among the notifiable diseases it is tuberculosis that includes the largest number of cases. Vaccination with BCG (Bacillus Calmette and Guerin), an avirulent strain derived from M. bovis and widely used as a vaccine against tuberculosis, is far from effective in all populations. This efficiency varies from about 80% in Western countries such as England, to 0% in India (results of the last vaccination trial at Chingleput, published in 1972 in Indian J. Med Res.). In addition, the emergence of antituberculosis-resistant M. tuberculosis strains and the increased risk of developing tuberculosis in immunosuppressed patients with AIDS necessitates the development of rapid, specific and reliable methods for diagnosis. tuberculosis. For example, an epidemiological study in Florida, published in 1993 in AIDS Therapies, found that 10% of AIDS patients have tuberculosis at the time of AIDS diagnosis or 18 months before AIDS diagnosis. . In these patients, tuberculosis appears in 60% of cases in a disseminated form, therefore not recognizable by conventional diagnostic criteria.

  such as chest radiography or sputum analysis.

  At present, a certainty about the diagnosis brought by the demonstration of cultivable bacilli in a sample taken from the patient is obtained for less than half of the cases of tuberculosis, even in cases of pulmonary tuberculosis. The diagnosis of tuberculosis and other related mycobacteria is therefore difficult to achieve, and this for various reasons: mycobacteria are often present in small quantities, their generation time is very

3 2767336

  long (24h for M. tuberculosis) and their culture is difficult.

(Bates et al., 1986).

  Other techniques can be used clinically, to identify a mycobacterial infection: a). Direct identification of microorganisms under the microscope; this technique is rapid, but does not allow the identification of the observed mycobacterial species and lacks

sensitivity (Bates, 1979).

  Crops, when positive, have a specificity approaching 100% and allow the identification of

  the isolated mycobacterial species; nevertheless, as specified above

  above, the growth of mycobacteria in vitro is long (can only be carried out in 3 to 6 weeks of repeated

  (Bates, 1979, Bates et al., 1986)) and expensive.

  b). Serological techniques may be useful under certain conditions, but their use is sometimes limited by their low sensitivity and / or specificity.

(Daniel et al., 1987).

  c). The presence of mycobacteria in a biological sample can also be determined by molecular hybridization with DNA or RNA using oligonucleotide probes specific for the desired sequences (Kiehn et al., 1987; Roberts et al. 1987, Drake et al., 1987). Several studies have shown the interest of this

  technique for the diagnosis of mycobacterial infections.

  The probes used consist of DNA, ribosomal RNA or uncharacterized mycobacterial DNA fragments from genebanks. The principle of these techniques is based on the polymorphism of the nucleotide sequences of the fragments used or on the polymorphism of the neighboring regions. In all cases, they require the use of crops and are not applicable

  directly on the biological samples.

  The small amount of mycobacteria present in a biological sample and therefore the low amount of target DNA to be detected in this sample may require the use of specific in vitro amplification of the target DNA.

4 2767336

  before detection using the nucleotide probe and using in vitro amplification techniques such as PCR (polymerase chain reaction) The specific amplification of DNA by the PCR technique can be the first step in a method for detecting the presence of a mycobacterial DNA in a biological sample, the actual detection of the amplified DNA being carried out in a second step using an oligonucleotide probe capable of hybridizing specifically to the DNA

amplified.

  A test for detecting mycobacteria belonging to the Mycobacterium tuberculosis complex by sandwich hybridization (test using a capture probe and a detection probe) has been described by Chevrier et al. in 1993. Mycobacterium tuberculosis complex is a group of mycobacteria that includes M. bovis-BCG, M. bovis, M.

  tuberculosis, M. africanum and M. microti.

  A method for detecting small amounts of mycobacteria, belonging to the tuberculosis complex, by gene amplification and hybridization directly on biological samples has been developed. Said method uses the insertion sequence IS6110 (European patent EP 0 490 951 BU). Thierry et al. described in 1990 a specific sequence of the Mycobacterium tuberculosis complex and named IS 6110. Some authors proposed to specifically amplify DNA from Mycobacterium using nucleic primers in an amplification method, such as the polymerase chain reaction ( PCR). Patel et al. described in 1990 the use of several nucleic primers selected from a sequence known as a probe in the identification of M. tuberculosis. However, the length of the fragments obtained using these primers was different from the expected theoretical length and several fragments of variable size were obtained. In addition, the authors observed 3> the lack of hybridization of the amplified products with the plasmid

2767336

  used to determine the primers. These results indicate that these primers would not be appropriate in detecting the presence of M. tuberculosis in a biological sample and confirm the critical nature of the choice of primers. In the same year, JL Guesdon and D. Thierry described a method of detection of M. tuberculosis, of high sensitivity, by amplification of a fragment of M. tuberculosis DNA located within the sequence IS6110 (European patent EP 461 045) using primers generating fragments () of amplified DNA of constant length, even when the choice of primers led to the amplification of long fragments (of the order of 1000 to 1500 bases) o the risk The interruption of the polymerization is high because of the effects of the secondary structure of the sequence. Other specific primers of the

  sequence IS6110 are described in the European patent N EP-

0490 951.

  The inventors have shown (unpublished results) that certain clinical isolates of Mycobacterium tuberculosis were free of the IS6110 insertion sequence and could therefore not be detected using the oligonucleotides specific for this sequence, which could thus lead to false diagnosis results. negative. These results confirm a similar observation made by Yuen et al. in 1993. The impossibility of detecting these pathogenic strains potentially present in a biological sample taken from a patient is thus likely to lead to

  difficulties or even misdiagnosis.

  M. bovis and M. tuberculosis, the causative agents of

  tuberculosis, are facultative intracellular bacteria.

  These agents have developed mechanisms to ensure their survival and replication inside the macrophage, one of the cell types that is supposed to eradicate invasion by microorganisms. These agents are able to modulate the normal evolution of their phagosome and prevent them from differentiating into a hydrolase-rich acidic compartment (5, 6,

6 2767336

  23, 26). However, this modulation is only possible if the bacterium is alive within the phagosome, suggesting that compounds synthesized actively and / or secreted inside the cell are part of this mechanism. Exported proteins are probably involved in this mechanism. Despite the major health problems associated with these pathogenic organisms, little is known about their exported and / or secreted proteins. SDS-PAGE analyzes of M. tuberculosis culture filtrate show at least 30 secreted proteins (1,19,38). Some of them have been

  characterized, their genes cloned and sequenced (7,35,37).

  Others, although they are immunodominant antigens of major importance for inducing protective immunity (2,21), are not fully identified. In addition, it is likely that many exported proteins will remain attached to the cell membrane and therefore not present in culture supernatants. It has been shown that proteins located on the outer surface of various pathogenic bacteria, such as the Yersina Pseudotuberculosis 103 kDa invasin (14) or the Listeria monocytoqenes 80 kDa internalin (10) play an important role in interactions with the host cells and therefore in the

  pathogenicity as in the induction of protective responses.

  Thus, a membrane-bound protein could be important for M. tuberculosis infection as well as for induction of a protective response against this infection. These proteins could be of interest for the preparation of vaccines. Recently, the adaptation to mycobacteria of a genetic methodology for the identification and phenotypic selection of exported proteins has been described (15). This method uses the periplasmic alkaline phosphatase (PhoA) of E. coli. A plasmid vector has been constructed allowing the fusion of genes between a truncated PhoA gene and genes encoding exported proteins (3, 11).

7 2767336

  By this method, it has been possible to identify a M. tuberculosis gene (erp (2)) having homologies with an exported 28 kDa protein of M. leprae, which is a frequent target of humoral responses of the lepromatous form of the leprosy, and with a protein having amino acid motifs

  characteristics of plant desaturase (des).

  However, this genetic method of identification of exported proteins does not make it possible to easily evaluate the intracellular expression of the corresponding genes. Such an evaluation is of paramount importance both for the selection of good vaccine candidates and for understanding the interactions between bacteria and their host cells. Induction of factor factor expression

  virulence by pathogenic target cell contact has been described.

  This is the case, for example, for the virulence factor Yops (18) of Yersina pseudotuberculosis. Shigella by contact with the target cells releases the Ipa proteins into the culture medium, and Salmonella synthesizes new surface structures. In view of the above, there is now a great need to develop new vaccines against pathogenic mycobacteria as well as new specific, reliable and rapid diagnostic tests. These developments require the development of even more efficient specific tools that make it possible, on the one hand, to isolate or obtain sequences of new specific polypeptides, in particular immunogens, and, on the other hand, to better understand the mechanism interactions between bacteria and their host cells such as induction of virulence factor expression. This is precisely the object of the present invention. The inventors have defined and realized for this purpose new vectors allowing the screening, cloning and / or expression of DNA sequences of mycobacteria in order to identify, among these sequences, nucleic acids encoding

8 2767336

  for proteins of interest, preferably exported proteins, which can be localized on the bacterial membrane and / or secreted, and to identify among these sequences those which

  are induced or suppressed during the infection.

  The invention also relates to novel polypeptides and new polynucleotides of mycobacteria which have been isolated by means of the above vectors and which may be used in the production of compositions for the detection of an infection by mycobacteria, or for protection against

  an infection due to mycobacteria.

  The invention therefore relates to a recombinant vector for screening, cloning and / or expression, characterized in that it replicates in mycobacteria and in that it contains: 1) a functional replicon in mycobacteria ; 2) a selection marker; 3) a reporter cassette comprising: a) a multiple cloning site (polylinker), b) optionally an active transcription terminator in mycobacteria, upstream of the polylinker, c) a nucleotide sequence coding from a gene coding for a marker for expressing, exporting and / or secreting protein, said nucleotide sequence being devoid of its initiation codon and its regulatory sequences, and d) a coding nucleotide sequence derived from a gene coding for a marker of promoter activity contained in (the same fragment, said nucleotide sequence being provided

of his initiation codon.

  The export and / or secretion marker is a nucleotide sequence whose expression followed by export and / or secretion depends on the elements of the

  regulation that control its expression.

  By "sequences or elements of regulation of the expression

9 2767336

  the production of polypeptides and its location "means a transcription promoter sequence, a sequence comprising the ribosome binding site (RBS), the sequences responsible for the export and / or secretion such as the sequence said sequence signals. A first interesting export and / or expression marker is a coding sequence derived from the phoA gene. If necessary, it is truncated in such a way that the alkaline phosphatase activity is however likely to be restored when the truncated coding sequence is placed under

  control of a promoter and appropriate regulatory elements.

  Other exposure, export and / or secretion markers may be used. By way of example, a sequence of the 3-agarase gene, of the nuclease of a

staphylococcus or β-lactamase.

  Among the interesting markers of promoter activity contained in the same fragment, a coding sequence derived from the luciferous luciferase luc gene with its initiation codon is preferred. Other promoter activity markers contained in the same fragment can be used. Examples include a sequence of the GFP gene (Green Fluorescent Protein). The transcription terminator must be functional in mycobacteria. An advantageous terminator is in this respect the terminator of coliphage T4 (tT4). Other terminators suitable for carrying out the invention can be isolated using the technique presented in the examples,

  for example by means of the cassette vector.

  A particularly preferred vector for carrying out the invention is a plasmid chosen from the following plasmids deposited at the CNCM (National Collection of Cultures of Microorganisms, Paris, France): a) pJEVDa deposited at the CNCM under N 1-1797, the 12/12

1996

  b) pJEVDb deposited at the CNCM under N 1-1906 on 25

1 0 ZIIQ2767336

  July 1997, c) pJEVDc filed with the CNCM under N 1-1799, on 12/12 1996,

  d) pJEVD / M. tuberculosis deposited at the CNCM under N 1-

1907, July 25, 1997.

  For the selection, or the identification of nucleic acid sequences of mycobacteria encoding polypeptides which may be incorporated into I (immunogenic or antigenic compositions for the detection of an infection, or likely to induce or repress a virulence factor of mycobacteria, the vector of the invention will comprise, in one of the multiple cloning sites of the polylinker, a nucleotide sequence of a mycobacterium in which the presence of sequences corresponding to exported polypeptides and / or or secreted which can be induced or repressed during the infection, or constitutively expressed or produced, their associated promoter and / or regulatory sequences likely to allow or (2) promote the export and / or secretion of said polypeptides. interest, or all or part of genes of interest coding for

said polypeptides.

  Preferably, this sequence is obtained by physical fragmentation or by enzymatic digestion of the genomic DNA or of the DNA complementary to an RNA of a

  mycobacteria and preferably a pathogenic mycobacterium.

  According to a first embodiment of the invention, the enzymatic digestion of genomic DNA or DNA

  complementary is carried out from M. tuberculosis.

  3 () Preferably this DNA is digested with an enzyme such as

that sau3A, BclI, BglII.

  Other digestion enzymes such as ScaI, ApaI, SacII, KDnI or nucleases or polymerases can naturally be used, as long as they make it possible to obtain fragments whose ends can be inserted into the one of the cloning sites of the polylinker of

vector of the invention.

  il 2767336 If applicable, digests with different enzymes

will be performed simultaneously.

  Preferred recombinant vectors for carrying out the invention are chosen from the following recombinant vectors deposited at the CNCM: a) p6D7 deposited on January 28, 1997 at the CNCM under No. I-1814, b) p5A3 filed on January 28, 1997 to the CNCM under the N I-1815, c) p5F6 deposited on January 28, 1997 to the CNCM under N I-1816, d) p2A29 deposited on January 28, 1997 to the CNCM under N I-1817,

  e) pDP428 filed on January 28, 1997 at the CNCM under N I-

  1818, f) p5B5 filed January 28, 1997 with the CNCM under the N I-1819, g) plC7 deposited on January 28, 1997 with the CNCM under N I-1820, h) p2D7 deposited on January 28, 1997 with the CNCM under N I-1821,

  i) plB7 filed on 31 January 1997 at the CNCM under No. I-1843.

  Among the most preferred, the recombinant vector pDP428 deposited on January 28, 1997 at the CNCM under N-1818 is preferred. The vectors of the invention can also be used to determine the presence of sequences of interest, preferably corresponding to exported and / or secreted proteins, and / or capable of being induced or repressed during infection, in particular during phagocytosis by macrophages, pJEVD and as previously described, in mycobacteria such as M. africanum, M. bovis, M. avium or M. leprae which will have been treated with DNA or cDNA with

determined enzymes.

  3) The invention also relates to a method for screening nucleotide sequences derived from mycobacteria to determine the presence of sequences corresponding to exported and / or secreted polypeptides that can be induced or repressed during infection, their promoter sequences and / or 3 associated regulators capable in particular of allowing or promoting the export and / or the secretion of said polypeptides of interest, or all or part of genes of interest

12 2767336

  coding for said polypeptides, characterized in that it

  a recombinant vector according to the invention.

  The invention also relates to a screening method, according to the invention, characterized in that it comprises the following steps: a) the digestion of the DNA sequences of mycobacteria by at least one determined enzyme and the recovery of the fragnents of digestion achieved; b) the insertion of the digestion fragments into a () cloning site compatible with the enzyme of step a) of the polylinker of a vector according to the invention; c) if necessary, the amplification of the digestion fragment contained in the vector, for example by replication of the latter after insertion of the vector thus modified in a specific cell, for example E coli; d) transforming the host cells with the vector amplified in step c), or in the absence of amplification, with the vector of step b); e) culturing the transformed host cells in a medium which makes it possible to detect the export and / or secretion marker, and / or the promoter activity marker contained in the vector; f) detecting positive host cells :: ... O.sub.s (positive colonies) for expression of the export and / or secretion marker, and / or the promoter activity marker; g) isolating the DNA from the positive colonies and inserting this DNA into a cell identical to that of step c); h) selecting the insertions contained in the vector, to obtain positive clones for the export and / or secretion marker, and / or for the promoter activity marker; i) isolation and characterization of DNA fragments

  of mycobacteria contained in these inserts.

  The implementation of this method allows the construction of DNA libraries comprising sequences corresponding to

13 2767336

  polypeptides capable of being exported and / or secreted, and / or likely to be induced or repressed during infection when produced within recombinant mycobacteria. Step i) of the method may comprise a step of sequencing the selected insertions. Preferably, in the method according to the invention, the vector used is chosen from the plasmids pJEVDa (CNCM, N I-1797), pJEVDb (CNCM, N 1-1906), pJEVDc (CNCM, N 1-1799) or pJEVD / M. tuberculosis (CNCM, N, I-1907, 1907), and the digestion of the DNA sequences of mycobacteria is carried out at

medium of the enzyme sau3A.

  According to a preferred embodiment of the invention, the screening method is characterized in that the mycobacterial sequences are derived from a pathogenic mycobacterium, for example M. tuberculosis, M. bovis, M. avium, M. africanum or

Mr. leprae.

  The invention also comprises a genomic DNA or cDNA library complementary to mycobacterium mRNA, characterized in that it is obtained by a process comprising the steps a), b) and c) of the preceding method according to the invention. invention, preferably a genomic DNA or cDNA library complementary to mycobacterial pathogenic mycobacterium mRNA, preferably mycobacteria belonging to the Mycobacterium tuberculosis complex group, preferably Mycobacterium

tuberculosis.

  The subject of the invention is also the nucleotide sequences of mycobacteria selected after the

  performing the method according to the invention described above.

  According to a particular embodiment of the invention, preferred sequences are, for example, DNA fragments of mycobacteria of sequence SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7. , SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10,

  contained respectively in the vectors p6D7 (CNCM, N I-

  1814), p5A3 (CNCM, N I-1815), p5F6 (CNCM, N I-1816), p2A29 (CNCM, N I-1817), p5B5 (CNCM, N I-1819), pC7 (CNCM, N I- 1820),

  p2D7 (CNCM, N I-1821) and pB7 (CNCM, N I-1843).

14 2767336

  The nucleic sequences SEQ ID N 11 are also preferred.

and SEQ ID N 24.

  When the coding sequence resulting from the export and / or secretion marker gene is a sequence derived from the phoA gene, the export and / or secretion of the product of the phoA gene, where appropriate truncated, is obtained only when this sequence is inserted in phase with the polynucleotide production expression regulatory sequence or element and its upstream location, which contains the elements controlling the expression, export and / or secretion from

sequence of mycobacteria.

  The recombinant vectors of the invention can of course comprise multiple cloning sites shifted by one or two nucleotides with respect to a vector according to the invention, thus making it possible to express the polypeptide corresponding to the inserted mycobacterium DNA fragment and capable of to be translated according to one of the three frames of

reading possible.

  () For example, the preferred vectors pJVEDb and pJVEDc of the invention differ from the preferred vector pJVEDa by a respective shift of one and two nucleotides at the level of

multiple cloning site.

  Thus, the vectors of the invention are capable of expressing each of the polypeptides capable of being encoded by inserted mycobacterium DNA fragment. Said polypeptides, characterized in that they are capable of being encoded by said DNA fragment and in that they are capable of being exported and / or secreted, and / or induced or

  The subject of the invention is also recombinant mycobacteria containing

  a recombinant vector according to the invention described above. A favorite mycobacterium is

  a mycobacterium type M. smeqmatis.

  M. smeqmatis advantageously makes it possible to test the efficacy of mycobacterial sequences for the control of expression, export and / or secretion, and / or

2767336

  the promoter activity of a given sequence, for example a sequence coding for a marker such as phosphatase

alkaline and / or luciferase.

  Another preferred mycobacterium is a mycobacterium of the M. bovis type, for example the BCG strain currently used.

  for vaccination against tuberculosis.

  Another preferred mycobacterium is a strain of M. tuberculosis, M. bovis or M.africanum with potentially

  all appropriate regulatory systems.

  The inventors have thus characterized a polynucleotide consisting of a nucleotide sequence present in all the tested strains of mycobacteria belonging to the Mycobacterium tuberculosis complex. This polypeptide, designated DP428, contains an open reading frame (ORF) encoding a polypeptide of about 12 kD. This molecular weight (MW) corresponds to the theoretical PM of the mature protein obtained after cleavage of the signal sequence, the PM of the DP428 protein or polypeptide being approximately 10 kD after potential anchoring to the peptidoglycan and potential cut between S and G of the motif.

LPISG.

  This polynucleotide includes, on the one hand, an open reading frame corresponding to a structural gene and, on the other hand, the signals for regulating the expression of the coding sequence upstream and downstream of the latter. DP428 is composed of a signal peptide, a hydrophilic core region and a hydrophobic C-terminal region. The latter ends with two arginine residues (R), a retention signal, and is preceded by an LPISG motif that is reminiscent of the

  LPXTG motif for peptidoglycan anchoring (Schneewind et al).

  By structural gene for the purposes of the present invention is meant a polynucleotide encoding a protein, a polypeptide or a fragment thereof, said polynucleotide comprising only the sequence corresponding to the open reading frame (ORF), which excludes sequences on the 5 'side of the open reading frame (ORF) that direct

initiation of transcription.

162767336

  Thus, the invention relates to a sequence polynucleotide

SEQ ID N 01.

  More particularly, the invention relates to a polynucleotide characterized in that it comprises a polynucleotide chosen from: a) a polynucleotide of sequence SEQ ID No. 01 or SEQ ID No. 2, b) a polynucleotide whose sequence is complementary to the sequence of polynucleotide defined in a), c) a polynucleotide whose sequence comprises at least 80% identity with a polynucleotide defined in a) or b), d) a polynucleotide hybridizing under conditions of high stringency with a polynucleotide sequence defined in a), b) or c), e) a polynucleotide fragment defined in a), b), c) or d),

  and having at least 8 nucleotides.

  The term nucleotide sequence, polynucleotide or nucleic acid, according to the present invention, both double-stranded DNA, single-stranded DNA and

transcription of said DNAs.

  By polynucleotide of complementary sequence is meant any DNA whose nucleotides are complementary to those of SEQ ID N01 or a part of SEQ ID N01, and whose

the orientation is reversed.

  By homology percentage in the sense of the present invention is meant a percentage identity between the bases of the two homologous polynucleotides, this percentage being purely statistical and the differences between the two polynucleotides being randomly distributed over their entire length. Hybridization under conditions of high stringency means that the conditions of temperature and ionic strength are chosen in such a way that they allow the maintenance

  hybridization between two complementary DNA fragments.

  By way of illustration, conditions of high stringency of the hybridization step in order to define the polynucleotide fragments described above are advantageously as follows:

172767336

  the hybridization is carried out at a preferred temperature of 65 ° C., in the presence of buffer marketed under the name of rapid-hyb buffer by Amersham (RPN 1636) and 100

Mg / ml of E. coli DNA.

  The washing steps may, for example, be the following: two washes of 10 minutes, preferably at 65 ° C., in a buffer of 2 × SSC and 0.1% SDS; two washings of 10 min, preferably at 65 ° C., in a buffer of 2 × SSC and 0.1% SDS; a washing of 10 min, preferably at 65 ° C., in a

buffer of 0.1 x SSC and 0.1% SDS.

  1 x SSC corresponds to 0.15 M NaCl and 0.05 M Na citrate and a solution of 1 x Denhardt corresponds to 0.02% Ficoll, 0.02%

  of polyvinylpyrrolidone and 0.02% of bovine serum albumin.

  Advantageously, a nucleotide fragment corresponding to the preceding definition will have at least 8 nucleotides, preferably at least 12 nucleotides, and still more preferably at least 20 consecutive nucleotides of

2 () the frequency from which it is derived.

  For the conditions of use of the restriction enzymes in order to obtain nucleotide fragments of the polynucleotides according to the invention, reference will be made to

  advantageously to the work of Sambrook of 1989.

  Advantageously, a polynucleotide of the invention will contain at least one sequence comprising the sequence of nucleotides going from the nucleotide at position nt 964 to

  nucleotide nt 1234 of the polynucleotide of sequence SEQ ID N 01.

  The present invention also relates to a 3) polypeptide derived from a mycobacterium, characterized in that it is present only in mycobacteria belonging to the

  complex of Mycobacterium tuberculosis.

  The subject of the present invention is also a polypeptide of amino acid sequence SEQ ID N01 or SEQ ID No. 2. The invention also relates to a polypeptide characterized in that it comprises a polypeptide chosen from:

18 2767336

  a) a polypeptide of amino acid sequence SEQ ID N 1 or SEQ

ID N 2,

  b) a polypeptide homologous to the polypeptide defined in a), c) a fragment of at least 5 amino acids of a polypeptide defined in a) or b), d) a biologically active fragment of a polypeptide defined in

a), b), or c).

  The term "homologous polypeptide" will be understood to denote the polypeptides having, relative to the natural polypeptide DP428, certain modifications such as, in particular, a deletion, addition or substitution of at least one amino acid, a truncation, an elongation, a chimeric fusion, and / or a mutation. Among the homologous polypeptides, those whose amino acid sequence has at least 80%, preferably 90%, homology with the amino acid sequences of the polypeptides according to the invention are preferred. In the case of a substitution, one or more consecutive or non-consecutive amino acids are replaced by "equivalent" amino acids. The term "equivalent" amino acid is intended here to designate any amino acid that may be substituted for one of the amino acids of the basic structure without essentially modifying the immunogenic properties of the corresponding peptides. In other words, the equivalent amino acids will be those which make it possible to obtain a modified sequence polypeptide which allows the in vivo induction of antibodies capable of recognizing the sequence polypeptide.

  SEQ ID N 2 or one of its fragments defined above.

  These equivalent aminoacyls can be determined either on the basis of their structural homology with the aminoacyls to which they are substituted, or on the results of the cross-immunogenicity tests to which the different

  peptides are likely to give rise.

  By way of example, mention may be made of the possibilities of substitutions that may be carried out without resulting in a thorough modification of the immunogenicity of the corresponding modified peptides, the replacements, for example, of leucine by valine or isoleucine,

19 2767336

  aspartic acid with glutamic acid, glutamine with asparagine, arginine with lysine etc., with the opposite substitutions being naturally

the same conditions.

  By biologically active fragment, is meant in particular a polypeptide amino acid sequence fragment having at least one of the characteristics of the polypeptides according to the invention, especially in that it is: - capable of being exported and / or secreted by a mycobacterium, and / or to be induced or repressed during mycobacterial infection; and / or - capable of inducing, repressing or modulating, directly or indirectly, a virulence factor of mycobacterium; and / or - capable of inducing an immunogenicity reaction against mycobacteria; and / or - capable of being recognized by a mycobacterium specific antibody. By fragment of polypeptide is meant a polypeptide having at least 5 amino acids,

  preferably 10 amino acids and 15 amino acids.

  A polypeptide of the invention, or a fragment thereof, as defined above, is capable of being specifically recognized by the antibodies present in the serum of patients infected with mycobacteria belonging to the complex.

of Mycobcaterium tuberculosis.

  DP428 polypeptide of sequence ID N 01 or ID N 2, which can be obtained by cleavage of said polypeptide by a proteolytic enzyme, such as trypsin or chymotrypsin or collagenase, or by a chemical reagent, such as cyanogen bromide (CnBr) or by placing the polypeptide DP428 in

  a very acidic environment, for example at pH 2.5.

  Preferred peptide fragments according to the invention, for use in diagnosis or vaccination, are the fragments contained in regions of the DP428 polypeptide which may be naturally exposed to the solvent and thus have important immunogenicity properties. Of

2767336

  such peptide fragments may be prepared, without distinction, by chemical synthesis, from hosts transformed with an expression vector according to the invention containing a nucleic acid allowing the expression of said fragments, placed under the control of the regulatory elements and / or 'expression

  or by chemical or enzymatic cleavage.

  An analysis of the hydrophilicity of the DP428 polypeptide was carried out using the DNA StriderTM software (marketed by CEA Saclay), on the basis of a character calculation.

  hydrophilic region of the coding region for DP428 of SEQ ID N 2.

  The results of this analysis are shown in FIG. 4, where, for each of the position amino acids (AA), 72.99 and 107, defined in SEQ ID No. 2, the hydrophilicity index is detailed. The higher the hydrophilicity index, the more likely the amino acid is to be exposed to the solvent in the native molecule, and is therefore likely to have a high degree of antigenicity. Thus, a chain of at least seven amino acids having a high hydrophilicity index (> 0.3) may form the basis of the structure of an immunogenic candidate peptide according to the present invention. The invention also relates to the nucleic acid sequences that can be used as a probe or primer, characterized in that said sequences are chosen from among the sequences

  polynucleotide nucleic acid according to the invention.

  The invention further relates to the use of a nucleic acid sequence of polynucleotides according to the invention as a probe or primer, for the detection and / or amplification of

nucleic acid sequence.

  3 () The polynucleotides according to the invention can thus be used to select nucleotide primers,

especially for the PCR technique.

  This technique requires the choice of pairs of oligonucleotides flanking the fragment that needs to be amplified. For example, reference can be made to the technique described in U.S. Patent No. 4,683,202. These oligodeoxyribonucleotide or oligoribonucleotide primers have

21 2767336

  advantageously a length of at least 8 nucleotides, preferably at least 12 nucleotides, and still more preferably at least 20 nucleotides. Primers of a length of between 8 and 30 and preferably 12 and 22 nucleotides are particularly preferred. One of the two primers is complementary to the strand (+) [forward primer] of the matrix and

  the other primer is complementary to the strand (-) [return primer].

  It is important that the primers do not have a structure

  secondary or sequence complementary to each other.

  On the other hand, the length and sequence of each primer should be chosen so that the primers do not hybridize with other nucleic acids from prokaryotic or eukaryotic cells, particularly nucleic acids from mycobacteria. not belonging to the Mycobacterium tuberculosis complex, nor to the human DNA or RNA that may contaminate the biological sample. The amplified fragments can be identified after electrophoresis in agarose or polyacrylamide gel, or after capillary electrophoresis, or else after a chromatographic technique (gel filtration, hydrophobic chromatography or ion exchange chromatography). The specificity of the amplification can be controlled by molecular hybridization using, as probes, the nucleotide sequences of the polynucleotides of the invention, plasmids

  containing these sequences or their amplification products.

  The amplified nucleotide fragments can be used as reagents in hybridization reactions in order to demonstrate the presence, in a biological sample, of a target nucleic acid of sequence complementary to that of said amplified nucleotide fragments. Among the polynucleotides according to the invention, usable as nucleotide primers, it is preferred: SEQ ID No. 25 and SEQ

ID N 26.

22 2767336

  Among the polynucleotides according to the invention, which can be used as nucleotide probes, the polynucleotide fragment comprising the nucleotides 964 to 1234 of SEQ is preferred.

ID N01.

  These probes and amplicons can be labeled or not by radioactive elements or by non-radioactive molecules,

  such as enzymes or fluorescent elements ..

  The invention also relates to the nucleotide fragments that can be obtained by amplification using

primers according to the invention.

  Other amplification techniques of the target nucleic acid can be advantageously used as alternatives

at the PCR.

  Strand Displacement Amplification (SDA) or strand displacement amplification technique (Walker et al., 1992) is an isothermal amplification technique whose principle is based on the ability of a restriction enzyme to cut off one of the two strands of its recognition site which is in a hemiphosphorothioate form and on the property of a DNA polymerase to initiate the synthesis of a new DNA strand from the 3'OH end created by the restriction enzyme and move the strand previously

synthesized which is downstream.

  The polynucleotides of the invention, in particular the primers according to the invention, can also be used in other methods of amplification of a target nucleic acid, such as: the TAS technique (Transcription-based Amplification System ), described by Kwoh et al. in 1989; the 3SR technique (Self-Sustained Sequence Replication), described by Guatelli et al. in 1990; NASBA (Nucleic Acid Sequence Based Amplification) technique, described by Kievitis et al. in 1991;

  - the TMA (Transcription Mediated Amplification) technique.

  The polynucleotides of the invention can also be used in amplification or modification techniques for nucleic acid as a probe, such as:

23 2767336

  the LCR technique (Ligase Chain Reaction), described by Landegren et al. in 1988 and perfected by Barany et al. in 1991, which employs a thermostable ligase; the technique of RCR (Repair Chain Reaction), described by Segev in 1992; the CPR (Cycling Probe Reaction) technique, described by Duck et al. in 1990; the Qbeta-replicase amplification technique, described by Miele et al. in 1983 and perfected in particular by Chu et al. in 1986, Lizardi et al. in 1988, then by Burg et al.

as well as by Stone et al. in 1996.

  In the case where the target polynucleotide to be detected is an RNA, for example an mRNA, it will advantageously be used, prior to carrying out an amplification reaction with the aid of the primers according to the invention or the implementation of A method of detecting, using the probes of the invention, a reverse transcriptase enzyme to obtain a cDNA from the RNA contained in the biological sample. The cDNA obtained will then serve as a target for the primers or probes used in the process.

  amplification or detection according to the invention.

  The detection probe will be chosen in such a way that it hybridises with the amplicon generated. Such a detection probe advantageously has for sequence a sequence of at least 12 nucleotides, in particular at least 15 nucleotides.

  nucleotides, and preferably less than 200 nucleotides.

  Nucleotide probes according to the invention are specific for detecting mycobacteria belonging to the Mycobacterium tuberculosis complex, more precisely because these mycobacteria possess in their genome at least one copy of polynucleotides according to the invention. By the specific probes according to the invention is meant especially any oligonucleotide hybridizing with the nucleotide sequence of a polypeptide according to the invention, more particularly any oligonucleotide hybridizing with the sequence SEQ ID No. 01 encoding the polypeptide DP428 of M. tuberculosis, and not exhibiting a cross-hybridization or amplification (PCR) reaction

24 2767336

  with sequences present in mycobacteria

  not belonging to the Mycobacterium tuberculosis complex.

  The nucleotide probes according to the invention specifically hybridize with a molecule of DNA or polynucleotide RNA according to the invention, under high stringency hybridization conditions such as data in the form of

* example previously.

  The unlabeled sequences can be used directly as probes, however the sequences are generally labeled with a radioactive element (32p, 35S, 3H, I) or by a non-radioactive molecule (biotin, acetylaminofluorene, digoxigenin, 5-bromo-deoxyuridine, fluorescein) to obtain probes that can be used for

many applications.

  Examples of non-radioactive labeling of probes are described, for example, in French Patent No. 78.10975 or

  by Urdea et al. or by Sanchez-Pescador et al. in 1988.

  In the latter case, one of the marking methods described in patents FR 2 422 956 and FR 2 518 755 can also be used. The hybridization technique can be carried out in various ways (Matthews et al., 1988). The most general method consists of immobilizing the nucleic acid extracted from the mycobacteria cells on a support (such as nitrocellulose, nylon, polystyrene) and incubating, under well-defined conditions, the target nucleic acid immobilized with the probe. After hybridization, the excess probe is removed and the hybrid molecules formed are detected by the appropriate method (measurement of radioactivity,

  fluorescence or enzymatic activity related to the probe).

  3 () Advantageously, the labeled nucleotide probes according to the invention may have a structure such that they render

  possible amplification of the radioactive or non-radioactive signal

  radioactive. An amplification system as defined above will include detection probes in branched DNA form as described by Urdea et al. in 1991. According to this technique, several types of

2767336

  probes including a capture probe, for immobilizing the target DNA or RNA on a support, and a detection probe. The detection probe binds a "plugged" DNA having a branched structure. The branched DNA, in turn, is capable of binding oligonucleotide probes that are themselves coupled to alkaline phosphatase molecules. Then the activity of this enzyme is highlighted by a

  chemiluminescent substrate, for example a dioxetane derivative

  phosphate. According to another advantageous mode of implementation of the nucleic probes according to the invention, the latter can be used as capture probes. In this case, a probe, called a "capture probe", is immobilized on a support in a covalent or non-covalent manner and serves to capture, by specific hybridization, the target nucleic acid obtained from the biological sample to be tested. If necessary, the solid support is separated from the sample and the duplex formed between the capture probe and the target nucleic acid is then detected by means of a second probe, called a "detection probe", labeled

  by an easily detectable element.

  The oligonucleotide fragments may be obtained from the sequences according to the invention, by cleavage with restriction enzymes, or by chemical synthesis according to conventional methods, for example according to the method described in European Patent No. EP-0305929 (Millipore Corporation) or

still by other methods.

  An appropriate mode of preparation of the nucleic acids of the invention comprising at most 200 nucleotides (or 200 bp in the case of double-stranded nucleic acids) comprises the following steps: the synthesis of DNA using the automated method of betacyanethylphosphoramidite described in 1986, - the cloning of the nucleic acids thus obtained in a suitable vector and the recovery of the nucleic acid by

  hybridization with a suitable probe.

  A mode of preparation, by chemical means, of nucleic acids according to the invention of length greater than 200

26 2767336

  nucleotides (or 200 bp in the case of double-stranded nucleic acids) comprises the following steps: - the assembly of chemically synthesized oligonucleotides, provided at their end with sites of different restrictions, the sequences of which are compatible with the amino acid sequence of the natural polypeptide according to the principle described in 1983, - the cloning of the nucleic acids thus obtained in a suitable vector and the recovery of the nucleic acid

  sought by hybridization with a suitable probe.

  Nucleotide probes used for recovery

  of the nucleic acid sought in the methods

  mentioned, generally consist of 8 to 200 nucleotides of the polypeptide sequence according to the invention and are capable of hybridizing with the desired nucleic acid under the hybridization conditions defined above. The synthesis of these probes can be performed according to the automated method of beta cyanethylphosphoramidites

described in 1986.

  The oligonucleotide probes according to the invention may be implemented in a detection device comprising a matrix library of oligonucleotides. An exemplary embodiment of such a matrix bank may consist of a matrix of probe-supported probe oligonucleotides, the sequence of each probe of a given length being located offset from one or more bases with respect to the previous probe. , each of the probes of the matrix arrangement thus being complementary to a sequence distinct from the target DNA or RNA to be detected and each probe of known sequence being fixed at a predetermined position of the support. The target sequence to be detected can be advantageously labeled radioactively or non-radioactively. When the labeled target sequence is brought into contact with the matrix device, the latter forms hybrids with the probes of complementary sequences. Nuclease treatment, followed by washing, makes it possible to eliminate target sequence-probe hybrids that are not perfectly complementary. Because of the

27673333

  precise knowledge of the sequence of a probe at a given position of the matrix, it is then possible to deduce the

  nucleotide sequence of the target DNA or RNA sequence.

  This technique is particularly effective when using large oligonucleotide probe arrays. An alternative to the use of a labeled target sequence may be the use of a support allowing a "bioelectronic" detection of the hybridization of the target sequence on the probes of the matrix support, when said support is constituted or comprises a material capable of acting, for example, as an electron donor at the positions of the matrix to which a hybrid has been formed. Such an electron donor material is for example gold. Detection of the nucleotide sequence of the target DNA or RNA

  is then determined by an electronic device.

  An embodiment of a biosensor, as defined

  above, is described in the European patent application N EP-

  0721 016 in the name of Affymax Technologies N.V. or in the

  U.S. Patent No. 5,202,231 to Drmanac.

  The subject of the invention is also the hybrid polynucleotides resulting from either the formation of a hybrid molecule between an RNA or a DNA (genomic DNA or cDNA) coming from a sample

  biological with a probe or a primer according to the invention.

  or the formation of a hybrid molecule between an RNA or a DNA (genomic DNA or cDNA) originating from a biological sample with a nucleotide fragment amplified using

  a pair of primers according to the invention.

  For the purposes of the present invention, the term "cDNA" refers to a DNA molecule obtained by having a reverse transcriptase enzyme act on an RNA molecule, in particular a messenger RNA (mRNA) molecule, according to the techniques

  described in Sambrook et al. in 1989.

  The present invention also relates to a family of recombinant plasmids, characterized in that they contain at least one polynucleotide nucleotide sequence according to

28 2767336

  the invention. According to an advantageous embodiment of said plasmid, it comprises the nucleotide sequence SEQ ID N01 or

a fragment of it.

  Another subject of the present invention is a vector for cloning, expression and / or insertion of a sequence, characterized in that it comprises a polynucleotide nucleotide sequence according to the invention at a non-essential site for its replication, if necessary under the control of regulatory elements likely to intervene in the expression of the

  polypeptide DP428, in a specific host.

  Particular vectors are for example plasmids,

  phages, cosmids, phagemids, YACs.

  These vectors are useful for transforming host cells to clone or express nucleotide sequences

of the invention.

  The invention also includes host cells

  transformed by a vector according to the invention.

  Preferably, the host cells are transformed under conditions allowing the expression of a polypeptide

recombinant according to the invention.

  A preferred host cell according to the invention is a mycobacterium belonging to a strain of M. tuberculosis, M. bovis or M.africanum potentially possessing all the

  appropriate regulatory systems.

  It is now easy to produce proteins or polypeptides in a relatively large quantity by genetic engineering using expression vectors plasmids, phages, phagemids. All or part of the DP428 gene, or any polynucleotide according to the invention, can be inserted into an appropriate expression vector in order to produce a polypeptide according to the invention in vitro, in particular the DP428 polypeptide. microplate to develop a serological test for the purpose of diagnostic

  in patients with tuberculosis.

29 2767336

  Thus, the present invention more particularly relates to a method for preparing a polypeptide of the invention comprising the following steps: - if necessary, prior amplification according to the PCR technique of the amount of nucleotide sequences encoding said polypeptide to using two DNA primers chosen so that one of these primers is identical to the first 10 to 25 nucleotides of the nucleotide sequence encoding said polypeptide, while the other primer is complementary to the 10 to 25 last nucleotides (or hybridizes with these last 10 to 25 nucleotides) of said nucleotide sequence, or vice versa so that one of these primers is identical to the last 10 to 25 nucleotides of said sequence, while the other primer is complementary to the first 10 to 25 nucleotides (or hybridizes with the first 10 to 25 nucleotides) of said nucleotide sequence, followed by the introduction of said sequences thus amplified in a suitable vector, - culturing, in a suitable culture medium, a cellular host previously transformed with a suitable vector containing a nucleic acid according to the invention comprising the nucleotide sequence coding for said polypeptide, and separation from said culture medium of said

  polypeptide produced by said transformed cell haste.

  The subject of the invention is also a polypeptide, characterized in that it is capable of being obtained by a method of

  the invention as described above.

  The peptides according to the invention can also be prepared by conventional techniques in the field of peptide synthesis. This synthesis can be done in

  homogeneous solution or in solid phase.

  For example, we will use the technique of synthesis in

  homogeneous solution described by Houbenweyl in 1974.

  This method of synthesis consists in successively condensing, successively, two successive aminoacyls in

2767336

  the order required, or to condense aminoacyls and fragments previously formed and already containing several aminoacyls in the appropriate order, or several previously prepared fragments, it being understood that care has to be taken to protect all functions beforehand reagents carried by these aminoacyls or fragments, with the exception of

  amino functions of one and carboxyl of the other or vice versa.

  versa, which should normally intervene in the formation of peptide bonds, especially after activation of the carboxyl function, according to methods well known in the synthesis of peptides. Alternatively, coupling reactions involving conventional coupling reagents may be used.

  of the carbodiimide type, such as, for example, 1-ethyl-3- (3-

  dimethyl-aminopropyl) -carbodiimide. When the aminoacyl used has an additional acid function (especially in the case of glutamic acid), these functions will be protected, for example by

t-butyl ester groups.

  In the case of the progressive synthesis, amino acid by amino acid, the synthesis preferably starts with the condensation of the C-terminal amino acid with the amino acid which corresponds to the neighboring aminoacyl in the desired sequence and

  so on, step by step, up to the amino acid N-

  terminal. According to another preferred technique of the invention,

  recourse to that described by Merrifield.

  To manufacture a peptide chain according to the Merrifield process, a highly porous polymeric resin is used, to which the first C-terminal amino acid of the 3 'chain is attached. This amino acid is attached to the resin via its carboxylic group and functions amine

  is protected, for example by the t-butyloxycarbonyl group.

  When the first C-terminal amino acid is thus fixed on the resin, the protective group of the function is removed.

  amine by washing the resin with an acid.

31 2767336

  In the case where the protective group of the amine function is the t-butyloxycarbonyl group, it can be removed by

  treatment of the resin with trifluoroacetic acid.

  The second amino acid which provides the second aminoacyl of the desired sequence is then coupled from the C-terminal aminoacyl residue to the deprotected amine function of the first C-terminal amino acid attached to the chain. Preferably, the carboxyl function of this second amino acid is activated, for example by dicyclohexylcarbodiimide, and the

  amine function is protected, for example by the t-

  butyloxycarbonyl. This gives the first part of the desired peptide chain, which comprises two amino acids, and whose terminal amine function is protected. As before, the amine function is deprotected and the third aminoacyl can then be fixed under similar conditions

  to those of the addition of the second C-terminal amino acid.

  One thus fixes, one after the other, the amino acids which will constitute the peptide chain on the amine group each time deprotected beforehand of the portion of the chain.

  peptide already formed, and which is attached to the resin.

  When all of the desired peptide chain is formed, the protecting groups of the different amino acids constituting the peptide chain are removed and the peptide is detached from the resin, for example using hydrofluoric acid. Preferably, said polypeptides obtainable by a method of the invention as described above will comprise a region exposed to

  solvent and will have a length of at least 20 amino acids.

  According to another embodiment of the invention, said polypeptides are specific for mycobacteria of the Mycobacterium tuberculosis complex and are therefore not recognized by

  antibodies specific for other mycobacterial proteins.

  The invention further relates to hybrid polypeptides having at least one polypeptide according to the invention

32 2767336

  and a sequence of a polypeptide capable of inducing a response

  immune system in humans or animals.

  Advantageously, the antigenic determinant is such that it is capable of inducing a humoral and / or cellular response, such as, for example, the antigenic determinants of immunogenic proteins selected for example from ESAT 6 and DES of 45/47 kD of Mycobacterium tuberculosis. Such a determinant may comprise a polypeptide according to the invention in glycosylated form used to obtain immunogenic compositions capable of inducing the synthesis of antibodies directed against multiple epitopes. Said glycosylated polypeptides are also part of the invention. These hybrid molecules may consist in part of a molecule carrying a polypeptide according to the invention associated with a part, in particular an epitope of diphtheria toxin, tetanus toxin, a surface antigen of the hepatitis B virus (patent FR 79 21811), the VP1 antigen of poliomyelitis virus or any other toxin or

viral or bacterial antigen.

  Advantageously, a bacterial antigen as defined above will be all or part of the M. tuberculosis 45/47 kD immunogenic protein.

  (International Application PCT / FR 96/0166).

  A viral antigen, as defined above, will preferably be a surface or envelope protein of a hepatitis virus, for example the surface protein of hepatitis B in one of its forms S, SpréS1, S-préS2 or S-préS2-préSl or a protein of a hepatitis A virus, or a non-A, non-B hepatitis, such as a hepatitis virus

C, E or delta.

  More particularly, a viral antigen as defined above will be all or part of one of the glycoproteins encoded by the genome of the HIV-1 virus (patents GB 8324800, EP 84401834 or EP 85905513) or of the HIV-2 virus (EP 87400151), and in particular all or part of a protein

  selected from gag, pol, nef or env of HIV-1 or HIV-2.

  Methods for synthesizing hybrid molecules include methods used in genetic engineering to construct hybrid DNAs encoding the desired polypeptide sequences. For example, it may be advantageous to refer to the technique for obtaining genes

  encoding fusion proteins described by Minton in 1984.

33 2767336

  The hybrid polynucleotides encoding a hybrid polypeptide as well as the hybrid polypeptides according to the invention characterized in that they are recombinant proteins obtained by the expression of said

  hybrid polynucleotides, are also part of the invention.

  The polypeptides according to the invention may advantageously be used in a process for the in vitro detection of antibodies directed against said polypeptides, in particular the DP428 polypeptide, and thus against a bacterium of the M. tuberculosis complex in a biological sample (tissue or fluid biological method) capable of containing them, this method comprising contacting this biological sample with a polypeptide according to the invention under conditions allowing an in vitro immunological reaction between said polypeptide and the antibodies possibly present in

  the biological sample, and the in vitro detection of antigen-

antibodies possibly formed.

  Preferably, the biological sample is constituted by

  a fluid, for example a human or animal serum.

  Any conventional procedure can be implemented to

perform such detection.

  By way of example, a preferred method involves immunoenzymatic processes according to the ELISA technique, by

  immunofluorescence, or radioimmunoassay (RIA) or equivalent.

  Thus, the invention also relates to the polypeptides according to the invention, labeled with a suitable marker such as

  as enzymatic type, fluorescent, radioactive.

  Such methods include, for example, the following steps: depositing specific amounts of a polypeptide composition according to the invention in the wells of a microtiter plate, introducing into said wells increasing dilutions of the serum to be analyzed, incubation of the microplate, - introduction into the wells of the microtitre plate of labeled antibodies directed against human or animal immunoglobulins, the labeling of these antibodies having been carried out with the aid of an enzyme selected from those which are capable of hydrolyze a substrate by modifying

34 2767336

  absorption of radiation from the latter, at least at a determined wavelength, for example at 550 nm, detection, in comparison with a control control, of the

amount of hydrolyzed substrate.

  The invention also relates to a kit or kit for the in vitro diagnosis of infection by a mycobacterium belonging to the Mycobacterium tuberculosis complex, comprising: a polypeptide according to the invention, the reagents for the constitution of the environment conducive to the immunological reaction ,

  - the reagents allowing the detection of the antigenic complexes

  antibodies produced by the immunological reaction, these reagents may also carry a marker, or may be recognized in turn by a labeled reagent, more particularly in the case where the polypeptide according to the invention is not labeled, - the where appropriate, a reference biological sample (negative control) free of antibodies recognized by a polypeptide according to the invention, - where appropriate, a reference biological sample (positive control) containing a predetermined quantity

  of antibodies recognized by a polypeptide according to the invention.

  The polypeptides according to the invention make it possible to prepare monoclonal or polyclonal antibodies characterized in that they specifically recognize the polypeptides according to the invention. The monoclonal antibodies may advantageously be prepared from hybridomas according to the technique described by Kohler and Milstein in 1975. The polyclonal antibodies may be prepared, for example by immunization of a () animal, in particular a mouse, with a polypeptide according to the invention is associated with an adjuvant of the immune response, and then purification of the specific antibodies contained in the serum of the immunized animals on an affinity column on which the polypeptide having served as an antigen has been previously fixed. The polyclonal antibodies according to the invention can also be prepared by purification on an affinity column, on which has previously been immobilized a

2767336

  polypeptide according to the invention, antibodies contained in the serum of patients infected with a mycobacterium belonging to the

  Mycobacterium tuberculosis complex.

  The subject of the invention is also monoclonal or polyclonal antibodies or their fragments, or chimeric antibodies, characterized in that they are capable of recognizing

  specifically a polypeptide according to the invention.

  The antibodies of the invention may also be labeled in the same manner as described above for the nucleic acid probes of the invention, such as type-marking.

  enzymatic, fluorescent or radioactive.

  The invention is further directed to a method for the specific detection of the presence of an antigen of a bacterium of the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the following steps: a) contacting the biological sample (tissue or biological fluid) taken from an individual with a monoclonal or polyclonal antibody according to the invention, under conditions allowing an in vitro immunological reaction between said antibodies and Mycobacterium tuberculosis complex specific polypeptides, which may be present in the biological sample, and

  b) Demonstration of the antigen-antibody complex formed.

  Also within the scope of the invention, a kit or kit for the in vitro diagnosis on a biological sample, of the presence of mycobacterial strains belonging to the complex of Mycobacterium tuberculosis, preferably M. tuberculosis, characterized in that comprises: a polyclonal or monoclonal antibody according to the invention, where appropriate labeled; 3 - if necessary, a reagent for the constitution of the environment conducive to carrying out the immunological reaction;

36 2767336

  a reagent allowing the detection of the antigen-complexes

  antibodies produced by the immunological reaction, this reagent may also carry a marker, or may be recognized in turn by a labeled reagent, more particularly in the case where said monoclonal antibody or

polyclonal is not labeled.

  - where appropriate, reagents to perform the lysis of

cells of the sample tested.

  The present invention also relates to a method for the rapid detection and identification of M. tuberculosis in a biological sample, characterized in that it comprises the following steps: a) Isolation of the DNA from the biological sample to be analyzed, or obtaining a cDNA from the RNA of the biological sample; b) specific amplification of the DNA of mycobacteria belonging to the Mycobacterium tuberculosis complex using 2 () primers according to the invention;

  c) Analysis of the amplification products.

  These can be analyzed by different methods.

  Two methods of analysis are given by way of example

  below: - Electrophoretic analysis of agarose gel amplification products. If we observe the presence of a DNA fragment migrating to the expected location, we can conclude that the sample analyzed contained mycobacterial DNA belonging to the tuberculosis complex, or 3 (). molecular hybridization using a nucleic acid probe according to the invention. This probe will advantageously be marked by a non-radioactive element

(cold probe) or radioactive.

  For the purposes of the present invention, the term "DNA of the biological sample" or "DNA contained in the biological sample" means the DNA present in the present invention.

37 2767336

  1 biological sample considered, ie the cDNA obtained after the action of a reverse transcriptase enzyme on RNA

  present in said biological sample.

  Another object of the present invention is a method for the specific detection of bacteria belonging to the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the following steps: a) bringing an oligonucleotide probe into contact with the invention with a biological sample, the DNA contained in the biological sample, or the cDNA obtained by reverse transcription of the RNA of the biological sample, having, where appropriate, previously been made accessible to hybridization, under conditions allowing hybridization of the probe to the DNA or cDNA of a bacterium of the Mycobacterium tuberculosis complex; b) Detection of the hybrid formed between the probe

  oligonucleotide and the DNA of the biological sample.

  2 () The invention also relates to a method for the specific detection of bacteria belonging to the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the following steps: a) bringing an oligonucleotide probe into contact according to invention immobilized on a support, with a biological sample, the DNA of the biological sample having, where appropriate, been previously made accessible to hybridization, under conditions allowing the hybridization of said probe to the DNA of a bacterium of the Mycobacterium tuberculosis complex; 3 () b) contacting the hybrid formed between said immobilized oligonucleotide probe on a support and the DNA contained in the biological sample, where appropriate after removal of the DNA from the biological sample which does not have hybridized with the probe, with an oligonucleotide probe labeled according to

the invention.

38 2767336

  According to an advantageous embodiment of the detection method defined above, it is characterized in that, prior to step a), the DNA of the biological sample is previously amplified using a pair of d primers according to the invention. Another form of implementation of the detection method according to the invention consists of a method for the specific detection of the presence of a bacterium belonging to the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the steps following: a) bringing the biological sample into contact with a pair of primers according to the invention, the DNA contained in the sample having been, where appropriate, previously made accessible to hybridization, under conditions allowing hybridizing said primers to the DNA of a bacterium of the Mycobacterium tuberculosis complex; b) Amplification of the DNA of the Mycobacterium tuberculosis complex bacterium; c) demonstration of the amplification of DNA fragments corresponding to the fragment flanked by the primers, for example by gel electrophoresis or by means of a probe

  oligonucleotide according to the invention.

  The invention also relates to a method for the specific detection of the presence of a bacterium belonging to the Mycobacterium tuberculosis complex in a biological sample by strand displacement, characterized in that it comprises the following steps: contact of the biological sample with two pairs of primers according to the invention specifically intended for the amplification of SDA type described above, the DNA contained in the sample having been, if necessary, previously made accessible to the hybridization, under conditions allowing hybridization of the primers to the DNA of a bacterium of the Mycobacterium tuberculosis complex;

39 2767336

  b) amplification of the DNA of the Mycobacterium tuberculosis complex bacterium; c) demonstration of the amplification of DNA fragments corresponding to the fragment flanked by the primers, for example by gel electrophoresis or by means of a probe

  oligonucleotide according to the invention.

  The invention also relates to a kit or kit for carrying out the method described above, intended for the detection of the presence of a bacterium of the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the elements following: a) an oligonucleotide probe according to the invention; b) The reagents necessary for carrying out a hybridization reaction; c) Where appropriate, a pair of primers according to the invention as well as the reagents necessary for an amplification reaction of DNA (genomic DNA, plasmid DNA or cDNA) of a bacterium

  of the Mycobacterium tuberculosis complex.

  The subject of the invention is also a kit or kit for the detection of the presence of a bacterium of the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the following elements: a) An oligonucleotide probe, called a probe of capture, according to the invention; b) An oligonucleotide probe, called a revelation probe, according to the invention. c) Where appropriate, a pair of primers according to the invention as well as the reagents necessary for an amplification reaction of

  the DNA of a bacterium of the Mycobacterium tuberculosis complex.

  The invention also relates to a kit or kit for the amplification of the DNA of a bacterium of the Mycobacterium tuberculosis complex present in a biological sample, characterized in that it comprises the following elements: a) A pair of primers according to the invention;

2767336

  b) Reagents necessary to perform a DNA amplification reaction; c) Possibly a component making it possible to verify the sequence of the amplified fragment, more particularly a probe

  oligonucleotide according to the invention.

  Another subject of the present invention relates to an immunogenic composition, characterized in that it comprises

polypeptide according to the invention.

  Another immunogenic composition according to the invention is characterized in that it comprises one or more polypeptides according to the invention and / or one or more hybrid proteins

according to the invention.

  According to an advantageous embodiment, the immunogenic composition defined above is constitutive of a vaccine, when it is presented in association with a pharmaceutically acceptable vehicle and optionally one or more adjuvants of the immunity such as alum or a representative of the family of muramyl peptides or the incomplete adjuvant

from Freund.

  (0 Today, various types of vaccines are available to protect humans against infectious diseases: live attenuated microorganisms (M. bovis - BCG for tuberculosis), inactivated microorganisms (influenza virus), extracts acellular (Bordetella pertussis for whooping cough), recombinant proteins (hepatitis B surface antigen), polysaccharides (pneumococci).

  vaccines prepared from synthetic or microparticles

  Genetically modified organisms expressing heterologous antigens are being tested. More recently, recombinant plasmid DNAs carrying genes encoding protective antigens have been proposed as an alternative vaccine strategy. This type of vaccination is carried out with a particular plasmid derived from an E. coli plasmid which does not replicate in vivo and which codes only for the vaccinating protein. The main functional components of this plasmid are: a strong promoter (for example that of CMV), a suitable cloning site

41 2767336

  to insert the gene of interest, a termination sequence

  polyadenylation, a prokaryotic origin of replication to produce the recombinant plasmid in vitro and a selection marker (e.g. ampicillin resistance gene) to facilitate the selection of bacteria that contain the plasmid. Animals were immunized by simply injecting bare plasmid DNA into the muscle. This technique leads to the expression of the vaccine protein in situ and to a cellular type (CTL) and humoral (antibody) type immune response. This double induction of the immune response is one of the main advantages of the technique of vaccination with naked DNA. Huygen et al. (1996) and Tascon et al. (1996) succeeded in obtaining some protection against M. tuberculosis by injecting recombinant plasmids containing M. leprae genes (hsp65, 36kDa pra) as inserts. M. leprae is the agent responsible for leprosy. The use of a specific insert of M. tuberculosis, for example all or part of the DP428 gene, object of the present invention would probably lead to better protection against tuberculosis. All or part of the DP428 gene, or any polynucleotide according to the invention, can be easily inserted into the V1J vector plasmids (Montgomery et al., 1993), pcDNA3 (Invitrogen, R & D Systems) or pcDNA1 / Neo (Invitrogen) which possess characteristics

  necessary for vaccine use.

  The invention thus relates to an immunogenic composition characterized in that it comprises one or more hybrid polypeptides as previously defined in association with a pharmaceutically compatible vehicle and,

  (Where appropriate, one or more adjuvants of immunity.

  The invention also relates to a vaccine composition intended for the immunization of humans or animals against a bacterial or viral infection, such as tuberculosis or hepatitis, characterized in that it comprises a or more hybrid polypeptides as previously defined in

42 2767336

  combination with a pharmaceutically compatible carrier and,

  where appropriate, one or more adjuvants of immunity.

  Advantageously, in the case of a protein hybrid between a polypeptide according to the invention and the surface antigen of hepatitis B, the vaccine composition will be administered, in humans, at a rate of 0.1 to 1 μg of purified hybrid protein per kilogram of patient weight, preferably 0.2 to 0.5 gg / kg of patient weight, for a dose for a given administration. In the case of patients suffering from disorders of the immune system, in particular immunocompromised patients, each dose injected will preferably contain half the weight of the hybrid protein contained in a dose intended for a patient.

  not affected by immune system disorders.

  Preferably, the vaccine composition will be administered repeatedly, spread over time, intradermally or subcutaneously. By way of example, three doses as defined above will be respectively administered to the patient at time t0, at time t0 + 1 month and at

time tO + 1 year.

  Alternatively, three doses will be administered respectively to the patient at time t0, at time t0 + 1 month and at

time tO + 6 months.

  In the mouse, in which a dose of the vaccine composition comparable to the dose used in humans is administered, the antibody reaction is tested by serum sampling followed by a study of the formation of a complex between the antibodies present. in the serum and antigen of the vaccine composition, according to the techniques

(usual.

  The invention also relates to an immunogenic composition characterized in that it comprises a polynucleotide or an expression vector according to the invention, in combination with a

  vehicle allowing its administration to the man or the animal.

  The subject of the invention is also a vaccine intended for immunization against a bacterial or viral infection, characterized in that it comprises a polynucleotide or

43 2767336

  an expression vector according to the invention, in association with

  a pharmaceutically acceptable vehicle.

  Such immunogenic or vaccine compositions are in particular described in the international application N WO / 11092 (Vical Inc.) and also in the application

  International N WO 95/11307 (Pasteur Institute).

  The constituent polynucleotide of the immunogenic composition or of the vaccine composition according to the invention may be injected into the host after having been coupled to compounds which promote the penetration of this polynucleotide within the cell or its transport to the cell nucleus. The resulting conjugates can be encapsulated in polymeric microparticles as described in International Application No. WO 94/27238 (medisorb Technologies).

International).

  According to another embodiment of the immunogenic and / or vaccine composition according to the invention, the polynucleotide, preferably a DNA, is complexed with DEAE-dextran (Pagano et al., 1967) or with nuclear proteins (Kaneda et al. al., 1989), with lipids (Felgner et al., 1987) or else encapsulated in liposomes (Fraley et al.

al., 1980).

  According to yet another advantageous embodiment of the immunogenic and / or vaccine composition according to the invention, the polynucleotide according to the invention can be introduced under the

  form of a gel facilitating its transfection into the cells.

  Such a composition in the form of a gel may be a poly-Llysine and lactose complex, as described by Midoux in 1993, or also Poloxamer 407TM, as described by Pastore in 1994. The polynucleotide or the vector according to the invention may also be be suspended in a buffer solution or be

associated with liposomes.

  Advantageously, such a vaccine will be prepared according to the technique described by Tacson et al. or Huygen et al. in 1996 due or in accordance with the technique described by Davis et al.

  in the international application N WO 95/11307 (Whalen et al.).

44 2767336

  Such a vaccine will advantageously be prepared in the form of a composition containing a vector according to the invention, placed under the control of regulatory elements allowing its

  expression in humans or animals.

  To produce such a vaccine, the polynucleotide according to the invention is first subcloned into an appropriate expression vector, more particularly an expression vector containing regulation and expression signals recognized by the enzymes of the cells. eukaryotes and also containing an active origin of replication in prokaryotes, for example in E. coli, which allows its prior amplification. The purified recombinant plasmid obtained is then injected into the host, for example intramuscularly. For example, the plasmid pcDNA3 or the plasmid pcDNA1 / neo, both commercially available from Invitrogen (R & D Systems, Abingdon, United Kingdom), may be used as an in vivo expression vector for the antigen of interest. It is also possible to use the plasmid VlJns.tPA, described by Shiver et al.

in 1995.

  Such a vaccine will advantageously comprise, in addition to the recombinant vector, a saline solution, for example a solution of

sodium chloride.

  A vaccine composition as defined above will for example be administered parenterally or intramuscularly. Other features and advantages of the invention appear in the following examples and figures:

FIGURES

  Figure 1: lA. the construction pJVED: Plasmid shuttle (which can be

  i5 multiply in mycobacteria as well as in E. coli).

  with a kanamycin resistance gene (from Tn903)

2767336

* as a selection marker The truncated phoA gene (A phoA)

  and the luc gene form a synthetic operon.

  LB. Sequence of the junction between phoA and luc.

  Figure 2: Luc and PhoA activities of recombinant M. smegmatis containing pJVED with different fragments

  nucleotides as exemplified.

  Figure 3: Genomic hybridization (Southern blot) of genomic DNA of different mycobacterial species using the

  probe corresponding to XXXXX fragments of the ID sequence.

  FIG. 4: Representation of the hydrophobicity (Kyte and Doolitle) of the coding sequence of DP428 with its schematic representation. The LPISG pattern immediately precedes the hydrophobic C-terminal region. The sequence ends with

two arginines.

  Figure 5: Illustrates the sequence SEQ ID N01 corresponding to the insert

  of the vector pDP428 (deposited at the CNCM under N 1-1818).

  Figure 6: Illustrates the sequence SEQ ID N 2 corresponding to the region

  including the gene encoding DP428 (underlined region).

  The figure shows that DP428 is probably part of an operon comprising at least three genes. The doubly framed region probably includes the promoter regions. The simply framed region corresponds to the LPISG motif recalling the LPXTG pattern described in positive gram

  as permitting anchoring to peptidoglucons.

  Figure 7: Illustrates the sequence SEQ ID N 3 corresponding to the insert

  p6D7 vector (deposited at the CNCM under N 1-1814).

  A, B and C represent the three possible reading phases.

Fictre 8:

46 2767336

  Illustrates the sequence SEQ ID N 4 corresponding to the insert

  p5A3 vector (deposited at the CNCM under the N 1-1815).

  A, B and C represent the three possible reading phases. Figure 9: Illustrates the sequence SEQ ID N 5 corresponding to the insert

  of the vector p5F6 (deposited at the CNCM under N 1-1816).

  A, B and C represent the three possible reading phases. Figure 10: Illustrates the sequence SEQ ID N 6 corresponding to the insert

  p2A29 vector (deposited at the CNCM under N 1-1817).

  A, B and C represent the three possible reading phases. Fiqure: Illustrates the sequence SEQ ID N 7 corresponding to the insert

  p5B5 vector (deposited at the CNCM under N 1-1819).

  A, B and C represent the three possible reading phases. Figure 12: Illustrates the sequence SEQ ID N 8 corresponding to the insert

  of the vector plC7 (deposited at the CNCM under the N 1-1820).

  A, B and C represent the three possible reading phases. Figure 13: Illustrates the sequence SEQ ID N 9 corresponding to the insert

  p2D7 vector (deposited at the CNCM under the N 1-1821).

  A, B and C represent the three possible reading phases. 3 () Figure 14: Illustrates the sequence SEQ ID N 10 corresponding to the insert

  of the plB7 vector (deposited at the CNCM under N 1-1843).

  A, B and C represent the three possible reading phases. Fiqure 15:

Illustrates the sequence SEQ ID N 11.

47 2767336

  A, B and C represent the three possible reading phases. Fiqure 16:

Illustrates the sequence SEQ ID N 12.

  A, B and C represent the three possible reading phases. Fiqure 17:

Illustrates the sequence SEQ ID N 13.

  A, B and C represent the three reading phases

possible.

Fiqure 18:

Illustrates the sequence SEQ ID N 14.

  A, B and C represent the three possible reading phases. Fictre 19:

Illustrates the sequence SEQ ID N 15.

  A, B and C represent the three possible reading phases. Fictre 20:

Illustrates the sequence SEQ ID N 16.

  A, B and C represent the three possible reading phases. Fiqure 21:

Illustrates the sequence SEQ ID N 17.

  A, B and C represent the three possible reading phases. Fiqure 22:

Illustrates the sequence SEQ ID N 18.

  A, B and C represent the three reading phases

possible.

Fiqure 23:

Illustrates the sequence SEQ ID N 19.

  A, B and C represent the three possible reading phases. Fictre 24:

Illustrates the sequence SEQ ID N 20.

48 2767336

  A, B and C represent the three possible reading phases. Fictre 25:

Illustrates the sequence SEQ ID N 21.

  A, B and C represent the three possible reading phases. Figure 26:

Illustrates the sequence SEQ ID N 22.

  A, B and C represent the three reading phases

possible.

Fictre 27:

Illustrates the sequence SEQ ID N 23.

  A, B and C represent the three possible reading phases. Fiqure 28:

Illustrates the sequence SEQ ID N 24.

  A, B and C represent the three possible reading phases. FIG. 29: Illustrates the sequences SEQ ID No. 25 and SEQ ID No. 26 representing a pair of primers used to specifically amplify by PCR the region corresponding to the

  nucleotides 964 to 1234 included in the sequence SEQ ID No. 01.

EXAMPLES

  Materials and Methods 3 (Bacterial cultures, plasmids and culture media The bacterial cultures and plasmids used in these examples are summarized in Table 1. E. coli was cultured on Luria-Bertani liquid or solid medium (LB) M. smegmatis was grown on Middlebrook 7H9 (Difco) supplemented with dextrose albumin (ADC), 0.2%

492767336

  glycerol and 0.05% Tween, or on solid medium L. If necessary, the antibiotic kanamycin was added at a concentration of 20 μg / ml1. Bacterial clones exhibiting PhoA activity were detected on LB agar containing 5-bromo-4-chloro-3-indolyl phosphate (X-P, at 40 μg / ml-1). DNA manipulation and sequencing DNA manipulations and Southern blot analyzes were performed using standard techniques (Sambrook, 1989). The double-brown DNA sequences were determined with a Taq Dye Deoxy Terminator Cycle Sequencing Kit (Applied Biosystems), in a 9600 GeneAmp PCR System (Perkin-Elmer), and after migration to a DNA analysis system

Model 373 (Applied Biosystems).

  Plasmid Constructs The plasmid pJVEDa was constructed from pLA71, a transfer plasmid comprising the truncated phoA gene and placed in phase with BlaF. pLA71 was cut with restriction enzymes KpnI and NotI, thus removing phoA without affecting the BlaF promoter. The luc gene encoding firefly luciferase was amplified from pGEM-luc and a ribosome binding site was added. phoA was amplified from pJEM11. The amplified fragments were cut with PstI and ligated together. The oligodeoxynucleotides used are the following: pPV.luc.Fw: 5'GACTGCTGCAGAAGGAGAAGATCCAAATGG3 'luc.Bw: 5'GACTAGCGGCCGCGAATTCGTCGACCTCCGAGG3' pJEM.phoA.Fw: 5'CCGCGGATCCGGATACGTAC3 '

  phoA.Bw: 5'GACTGCTGCAGTTTATTTCAGCCCCAGAGCG3 '.

  The fragment thus obtained was reamplified using the oligonucleotides complementary to its ends, cut with KpnI and NotI, and integrated into pLA71 cut with the same

2767336

  enzymes. The resulting construct was electroporated into E. coli DH5c and M. smnegmatis mc2155. A light emitting M. smegmatis clone exhibiting phoA activity was selected and named pJVED / blaF. The insert was removed using BamHI and the construct closed on itself, thus reconstructing the pJVEDa. In order to obtain pJVEDb, c, the cloning multisite was cut with ScaI and KpnI and closed by removing one (pJVEDb) or two (pJVEDc) nucleotides from the SnaBI site. After fusion, six reading frames could be obtained. The pJVED / hsp18 insert was obtained by polymerase chain reaction (PCR) of pPM1745 (Servant, 1995) using oligonucleotides of the sequence: 18.Fw: 5'GTACCAGTACTGATCACCCGTCTCCCGCAC3 '18.Back: AGTCAGGTACCTCGCGGAAGGGGTCAGTGCG3' The product was cut with KpnI and ScaI, and ligated to pJVEDa, cut with the same enzymes, thus leaving the pJVED / hspl8. PJVED / P19kDa and pJVED / erp were constructed by cutting the insert of pExp410 and pExp53 2) with BamHI, and inserting them into the BamHI site of

multisite cloning of pJVEDa.

  Measurement of alkaline phosphatase activity M. smegmatis were cultured in LB medium supplemented with 0.05% Tween 80 (Aldrich) and kanamycin (20 μg / ml-1) at 370 ° C. for 24 hours. Alkaline phosphatase activity was measured by the Brockman method

  () and Heppel (Brockman, 1968) in a sonicated extract, with p.

  nitrophenyl phosphate as a substrate for the reaction. The amount of protein was measured by Bio-Rad assay. The alkaline phosphatase activity is expressed in arbitrary units (density

  optic at 420 nm x Mg protein-1 x minutes -1).

  Measurement of luciferase activity M. smegmatis was cultured in LB medium supplemented with 0.05% Tween 80 (Aldrich) and kanamycin (20 kg / ml-1) at 37 ° C. for 24 hours and used in full exponential growth (OD 600 nm between 0.3 and 0.8). Aliquots of bacterial suspensions were briefly sonicated and the cell extract was used to measure luciferase activity. 25 μl of the sonicated extract were mixed with 100 μl of substrate (Promega luciferase assay system) automatically in a luminometer and the emitted light expressed in ULR (Relative Bright Units). The bacteria were counted by serial dilutions of the original suspension on LB agar medium kanamycin and the activity of luciferase expressed in ULR / lg of proteins

  bacterial or ULR / 103 bacteria.

  Construction of genomic libraries of M. tuberculosis The banks were obtained using

  essentially pJVEDa, b, c previously described.

  Preparation of bone marrow macrophages and recombinant M. smegmatis infection Macrophages derived from the bone marrow were prepared as described by Lang, 1991. In summary, bone marrow cells were removed from the C57BL mouse femur. 6 from 6 to 12 weeks old (Iffa-Credo, France). Suspended cells were washed and resuspended in DMEM enriched with 10% fetal calf serum, 10% medium

  L-cell conditioned and 2 mM glutamine, without antibiotics.

  106 cells were inoculated on flat-bottomed Costar 24-well plates in 1 ml. After four days at 37 ° C. in a humid atmosphere at 10% CO 2 content, the macrophages were rinsed and reincubated for two to four days

52 2767336

  additional. Control well cells were lysed with 0.1% triton x 100 in water and nuclei

  listed. About 5 x 105 adherent cells were counted.

  For infection, M. smegmatis carrying the different plasmids was cultured in full exponential phase (OD600nm between 0.4 and 0.8) and diluted to an OD of 0.1 and then 10 times in a macrophage medium. 1 ml was added to each well and the

  plates were centrifuged and incubated four hours at 37 C.

  After three washes, the cells were incubated in medium containing amykacin for two hours. After three more washes, the infected, adherent cells were incubated in macrophage medium overnight. The cells were then lysed in 0.5 ml of lysis buffer (Promega). 100 4l were sonicated and the light emitted was measured on 25 Hm. Simultaneously, the bacteria were enumerated by L-agar-kanamycin (20 μg / ml-1). The

  Emitted light is expressed in ULR / 103 bacteria.

  Data Bank Analyzes The nucleotide sequences were compared to EMBL and GenBank using the FASTA algorithm and the protein sequences were analyzed by similarity using the PIR and Swiss Prot databases using the BLAST algorithm. Example 1: Vectors pJVED The pJVED vectors (FIG. 1A) are plasmids carrying a truncated E. coli phoA gene lacking an initiation codon, a signal sequence and a regulatory sequence. The multiple cloning site (SMC) allows the insertion of fragments of genes coding for possible

  exported proteins as well as their regulatory sequences.

  Therefore, the fusion protein can be produced and have alkaline phosphatase activity if exported. Only phased mergers can be productive. Thus, the MSC

53 2767336

  has been modified so that mergers can be obtained in six reading phases. Downstream of phoA, the luc gene of firefly luciferase was inserted. The complete gene with the initiation codon but without any promoter has been used should thus be expressed with phoA as in a synthetic operon. A new ribosome binding site has been

  inserted eight nucleotides upstream of the luc initiation codon.

  Two transcriptional terminators are present in the

  pJVED vectors, one upstream of the SMC and a second downstream of luc.

  These vectors are E. coli transfer plasmids

  mycobacterium with a kanamycin resistance gene as

selection marker.

  phoA and luc work as part of an operon, but

  the export is necessary for phoA activity.

  Four plasmids were constructed by insertion into the SMC of DNA fragments of various origin: In the first construct named pJVED / blaF, the 1.4 kb fragment originates from the plasmid already described pLA71 (Lim, 1995). This fragment derived from the M. fortuitum D216 β-lactamase (blaF) gene (Timm, 1994) includes the hyperactive mutated promoter, the segment encoding 32 amino acids of the signal sequence and the first 5 amino acids of the mature protein. Thus, this construct includes the strongest known promoter in mycobacterium and the elements necessary for the export of the phoA fusion protein. Therefore, one can expect from this construction a strong emission of

  light and good phoA activity.

  In a second construct named pJVED / hspl8, a 1.5 kb fragment was cloned from the previously described plasmid pPM1745 (Servant, 1995). This fragment includes the nucleotides coding for the first ten amino acids of the 18 kb heat shock protein derived from Streptomyces albus (heat shock protein 18, HSP 18), the ribosome binding site, the promoter and, upstream, the regulatory sites controlling its

54 2767336

  expression. This protein belongs to the family of alpha-

  HSP crystalline low molecular weight (Verbon, 1992).

  Its counterpart from M. leprae, the 18 kDa antigen, is already known to be induced during phagocytosis by a murine macrophage of the J-774 cell line (Dellagostin, 1995). Under standard culture conditions, the pJVED / hspl8, shows a

  low luc activity and no phoA activity.

  In a third construct, named pJVED / Pl9kDa, the insert from pExp410 (Lim, 1995) was cut and cloned into 1) the SMC of pJVEDa. This fragment includes the nucleotides coding for the first 134 amino acids of the known 19 kDa M. tuberculosis protein and its regulatory sequences. As has been demonstrated, this protein is a glycosylated lipoprotein (Garbe 1993, Herrmann 1996). Part of this lipoprotein was fused to a surface protein A from Borrelia burgdorferi to construct a recombinant M. bovis BCG vaccine capable of inducing a strong immune response (Stover, 1993). In FIG. 2, good luc 2 activity is observed for this construct (0 corresponding to a strong promoter, but the phoA activity is by far the strongest of the four constructs.) The high phoA activity of this protein of fusion with a lipoprotein is explained by the fact that it remains attached to the wall

  cell by its N-terminal end.

  In the fourth and last construct named pJVED / erp the insert comes from pExp53 (Lim, 1995) and was cloned into the SMC of pJVEDa. pExp53 is the initial plasmid selected for its phoA activity and containing a portion of the M. tuberculosis erp gene that encodes a 28 kDa antigen. The latter includes the signal sequence, a portion of the mature protein and, upstream of the initiation codon, the ribosome binding site. The promoter has been mapped. A putative box iron iron type fur is present in this

  region and supervises the promoter's region -35 (Berthet, 1995).

2767336

  As expected (Figure 2) this construction has good light emission and good phoA activity. The fact that this fusion protein, unlike the fusion with the 19 kDa lipoprotein, does not appear to be attached to the cell wall does not exclude that the native protein is associated therewith. Moreover, the C-terminal end of erp is absent from the

fusion protein.

  Example 2 Construction of a genomic DNA library of M. tuberculosis in the pJVED vectors and identification of one of the members of these libraries, (DP428), induced during phagocytosis by murine macrophages derived from the bone marrow . The different constructs are tested for their ability to evaluate the intracellular expression of genes identified by phoA expression. For this purpose, the activity luc is expressed in URL for 103 bacteria in

  axenic culture under intracellular conditions.

  The induction or repression following phagocytosis by murine macrophages derived from the bone marrow may be

  adequately assessed by the measurement of specific activities.

  The results of two separate experiments are presented

in Table 2.

  Plasmid pJVED / hspl8 was used as a positive control for induction during the intracellular growth phase. Although the induction of the promising by heating the bacterium to 42 C was not conclusive the phagocytosis of the bacterium clearly leads to an increase in the activity of the promoter. In all experiments, intracellular luc activity was strongly induced, increasing basal activity by 20 to 100-fold.

  initially weak (Servant, 1995).

  Plasmid pJVED / blaF was used as a control of nonspecific modulation during phagocytosis. Small variations could be detected, probably due to changes in crop conditions. Whatever it is

56 2767336

  either, these small variations are not comparable to

  the induction observed with the plasmid pJVED / hspl8.

  All members of the DNA library were tested by measuring promoter activity during intracellular growth. Among them, the DP428 is strongly induced at

  during phagocytosis (Table 1).

  TABLE 1 (see following examples).

  Example 3: The complete sequence of the DP428 gene and its

flanking regions.

  A probe of the DP428 coding region was obtained by PCR, and used to hybridize the genomic DNA of different species of mycobacteria. From the results of Figure 3, the gene is present only in the

  mycobacteria of the M. tuberculosis complex.

  The analysis of the sequence shows that DP428 is part of an operon. The coding sequence and the flanking regions show no homology with known deposited sequences

in the databases.

  According to the coding sequence, this gene encodes a

  10 kDa protein with a signal peptide, a C-terminus

  hydrophobic terminal terminated by two arginines and preceded by an LPISG pattern similar to the known pattern LPXTG. These two arginines could correspond to a retention signal and the DP428 protein could be attached by this motif to peptidoglycans as has already been described in others.

Gram + bacteria.

  The mechanism of survival and intracellular growth of mycobacteria is complex and the intimate relationship between the bacterium and the host cell remains unexplained. Whatever the mechanism, growth and intracellular survival of mycrobacteria depends on factors produced by the bacterium and able to modulate the response of the host. These factors may be molecules exposed to the cell surface such as LAM or surface-associated proteins

  cell, or actively secreted molecules.

57 2767336

  On the other hand, intracellularly, the bacteria

  they themselves have to deal with a hostile environment.

  They seem to respond by means close to those used under stress conditions, by induction of heat shock proteins (Dellagostin, 1995), but also by induction or repression of different proteins (Lee, 1995). Using a methodology derived from PCR, Plum and Clark-curtiss (Plum, 1994) have shown that a M. avium gene included in a 3 kb DNA fragment is induced after phagocytosis by human macrophages. This gene codes for an exported proteinputative comprising a leader sequence but not showing significant homology with the sequences proposed by the databanks. Induction during the intracellular growth phase of a low molecular weight heat shock protein from M. leprae has also been demonstrated (Dellagostin, 1995). In another study, M. tuberculosis bacterial proteins were metabolically labeled during the intracellular growth phase or under stress conditions and separated by two-dimensional gel electrophoresis:

  M. tuberculosis proteins were induced and 28 repressed.

  The same proteins are involved during stress caused by low pH, heat shock, H202, or during

  of phagocytosis by human monocytes of the THP1 line.

  Be that as it may, the behavior of the induced and repressed proteins was unique in each condition (Lee, 1995). Taken together, these results indicate that a subtle molecular dialogue is established between bacteria and their cellular hosts. From this dialogue probably depends the fate of

the intracellular organism.

  In this context, the induction of DP428 expression could be of major importance, indicating an important role of this protein in survival and intracellular growth. The method used in these experiments to evaluate

58 2767336

  the intracellular expression of genes has the advantage of being simple compared to other techniques such as the technique described by Mahan et al. (Mahan, 1993) adapted to mycobacteria and proposed by Bange et al. (Bange, 1996), or the ACP-based substractive method described by Plum and Clark-curtiss (Plum, 1994). There is indisputably a variability as shown by the comparison of different experiences. Although inducing induction or repression is sufficient it is now possible to evaluate it thus providing an additional tool for physiological studies of exported proteins identified by fusion.

with phoA.

Example 4

  Search for Modulation of Promoter Activity in Intramacrophagic Phases Mouse bone marrow macrophages are prepared as described by Lang and Antoine (Ref 13). The recombinant M. segmentis bacteria, whose luciferase activity was determined by 103 bacteria as previously, are incubated at 37 ° C. in a humidified atmosphere and enriched with 5% CO 2 for 4 hours in the presence of these macrophages in such a way. they are phagocytosed. After rinsing to remove remaining extracellular bacteria, amikacin (100 g / ml) was added to the culture medium for two hours. After a new rinse, the medium is replaced by a culture medium (DMEM enriched with 10% calf serum and 2mM glutamine) without antibiotics. After a night of incubation as before, the macrophages are cold lysed (4 C) using a lysis buffer (cell lysis buffer, Promega), and the determined luciferase activity by 103 bacteria. The report of the activities to the cultivation and after a night gives the

induction coefficient.

  (D collItuct /% recovery RLU / 1031bacteria RLU / 103bacteria indluction ecxtrnacclluIlair intracellular pJVED / blaF * 0.5 1460 1727 1.2 pJVED / hIspl 8 0.6 8 57 7.1 pJVED / DI'428 0.7 0.06 18 300 colistrUlCt (Yo recovexcry RLU / 103bacteria RLLU / 103bacteria extracellular intracellular induction C5713L / 6 Bialb / C C5713L / 6 Balb / C C5713L / 6 Balb / C pJVED / bl! al: 7 1.1 662 250 911 0.54 1.4 pJVED / hsp18 6.7 1.7 164 261 325 1.6 2 pJ VED / Dl'128 1.6 2.1 0.08 1.25 3.3 15.6 41

2767336

Bibliographical references

  AIDS therapies, 1993, in Mycobacterial infections, ISBN 0-

9631698-1-5, pp. 1-11.

  Barany F., 1911, Proc. Natl. Acad. Sci. USA, 88: 189-193.

  Bates J. et al., 1986, Am. Respir. Dis., 134: 415-417.

  Bates, J. 1979. Chest. 76 (Suppl.): 757-763.

  Bates, J. et al., 1986. Am. Respir. Dis. 134: 415-417.

  Bourgoin, A., G. Agius. 1994. Rev. Fr. Lab. 273: 21-26.

  Bouvet, E. 1994. Rev. Fr. Lab. 273: 53-56.

  Burg J.L. et al., 1996, Mol. and Cell. Probes, 10: 257-271.

  Ji Chevrier D. et al., 1993, Mol. and Cell. Probes, 7: 187-197.

  Chu B.C.F. et al., 1986, Nucleic Acids Res., 14: 5591-5603.

  Daniel, T.M. et al. 1987. Am. Rev. Respir. Dis. 135: 1137-1151).

  Drake, T.A. et al. 1987. J. Clin. Mocrobiol. 25: 1442-1445.

  Duck P. et al., 1990, Biotechniques, 9: 142-147.

  Dunn A. R. et al., 1977, Cell. 12:23.

  Erlich, H.A. 1989. In PCR Technology. Principles and

  Applications for DNA Amplification. New York: Stockton Press.

  Felgner et al., 1987, Proc. Natl. Acad. Sci., 84: 7413.

  Fraley et al., 1980, J. Biol. Chem., 255: 10431.

  Guateli J.C. et al., 1990, Proc. Natl. Acad. Sci. USA, 87: 1874-

  1878. Houbenweyl, 1974, in Meuthode der Organischen Chemie, E. Wunsch

  Ed., Volume 15-I and 15-II, Thieme, Stuttgart.

  Huygen K. et al., 1996, Nature Medicine, 2 (8): 893-898.

  Innis, M.A. et al. 1990. in PCR Protocols. A guide to Methods

  and Apllications. San Diego: Academic Press.

  Kaneda et al., 1989, Science, 243: 375

61 2767336

  Kent P.T. et al., 1985, Public Health Mycobacteriology: A Guide for Level III Laboratory. Center for Disease Control Ed.,

Atlanta, USA.

  Kiehn, T.E., et al. 1987. J. Clin. Microbiol. 25: 1551-1552.

  Kievitis T. et al., 1991, J. Virol. Methods, 35: 273-286.

  Kohler G. et al., 1975, Nature, 256 (5517): 495-497.

  Kwoh D.Y. et al., 1989, Proc. Natl. Acad. Sci. USA, 86: 1173-

1177.

  Landegren U. et al., 1988, Science, 241: 1077-1080.

  Lizardi P.M. et al., 1988, Bio / technology, 6: 1197-1202.

  Matthews J.A. et al., 1988, Anal. Biochem., 169: 1-25.

  Merrifield R.D., 1966, J. Am. Chem. Soc., 88 (21): 5051-5052.

  Midoux, 1993, Nucleic Acids Research, 21: 871-878 /

  Miele E.A. et al., 1983, J. Mol. Biol., 171: 281-295.

  Ji Milstein C., 1981, Annu. Rev. Biochem., 50: 657-680.

  Milstein C., 1981, Sci. Am., 243 (4): 66-74.

  Minton N.P., 1984, Gene, 31, 269-273.

  Montgomery et al., 1993, DNA Cell Biol., 12: 777-783.

  Pagano et al., 1967, J. Virol., 1: 891

  Palva A. et al., 1984, FEMS Microbiol. Slow., 23:83.

  Pastore, 1994, Circulation, 90: I-517.

  Patel et al. 1990. J. Clin. Microbiol. ?: 513-518.

  Pelicic V. et al., 1996, FEMS Microbiol. Letters, 144: 161-166.

  Pelicic V. et al., 1996, J. Bact., 178 (4): 1197-1199.

  Polsky-Cynkin R. et al., 1985, J. Clin. Chem., 31: 1438.

Ranki M. et al., 1983, Gene, 21:77.

  Roberts, M.C., et al. 1987. J. Clin. Microbiol. 25: 1239-1243.

  Rolfs, A. et al. 1991. In PCR Topics. Usage of Polymerase Chain

  reaction in Genetic and Infectious Disease. Berlin: Springer-

Verlag.

  Saiki R.K. et al., 1988, Science, 239: 487-491.

  Saiki, R.K. et al. 1985. Science. 230: 1350-1354.

62 2767336

  Sambrook, J. et al. 1989. In Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

  Sanchez-Pescador R., 1988, J. Clin. Microbiol., 26 (10): 1934-

  1938. Segev D., 1992, in "Non-radioactive Labeling and Detection of Biomolecules". Kessler C. Springer Verlag, Berlin, New York,

197-205.

  Shinnick T.M., 1987, J. Bacteriol., 169: 1080-1088.

  Shiver J.W., 1995, in Vaccines 1995, Eds Chanock, R.M. Brown, F. Ginsberg, H.S. & Norrby, E.), pp.95-98, Cold Spring Harbor

  Laboratory Press, Cold Spring Harbor, New York.

  Spargo C.A. et al., 1996, Mol. and Cell. Probes, 10: 247-256

* Stone B.B. et al., 1996, Mol. and Cell. Probes, 10: 359-370.

  Tascon R.E. et al., 1996, Nature Medicine, 2 (8): 888-892.

  Oligonucleotide assembly technique, 1983, Proc. Natl. Acad.

Sci. USA, 80: 7461-7465.

  Technic of beta-cyanethylphosphoramidites, 1986, Bioorganic

Chem., 4: 274-325.

  2 () Thierry D. et al. 1990. Nucl. Acid Res. 18: 188.

  Tuberculosis Prevention Trial, 1980, Mendis, "Trial of BCG Vaccines in South India for Tuberculosis Infection," Indian

  Journal of Medical Research, 1972 (Suppl.): 1-74.

  Urdea M. S. et al., 1991, Nucleic Acids Symp. Ser., 24: 197-200.

  Urdea M.S., 1988, Nucleic Acids Research, 11: 4937-4957.

  Vega-Lopez F. et al., 1993, Infect. Immun., 61 (5): 2145-2153.

  Walker G.T. et al., 1992, Nucleic Acids Res., 20: 1691-1696.

  Walker G.T. et al., 1992, Proc. Natl. Acad. Sci. USA, 89: 392-

396.

  Yuen L.K.W. et al., 1993, J. Clin. Microbiol., 31, 1615-1618.

63 2767336

  1. Bange, F. C., A. M. Brown, and W. R. Jacobs JR. 1996.

  Leucine auxotrophy restricts growth of Mycobacterium bovis BCG

  in macrophages. Infect. Immun. 64: 1794-1799.

  2. Berthet, F.X., J. Rauzier, E. M. Lim, W. Philipp, B. Gicquel, and D. Portnoy. 1995. Characterization of the M. tuberculosis erp gene encoding a potential cell surface protein with repetitive structures. Microbiology. In press: 3. Boquet, P.L., C. Manoil, and J. Beckwith. 1987. Use of TnphoA to detect genes for Escherichia coli: identification of the plasmid-encoded gene for a

  periplasmic phosphatase. J. Bacteriol. 169: 1663-1669.

  4. Brockman, R.W. and L. A. Heppel. 1968. On the localization of alkaline phosphatase and cyclic phosphodiesterase

  Escherichia coli. Biochemistry. 7: 2554-2561.

  5. Clemens, D.L. 1996. Characterization of the Mycobacterium

  phagosome tuberculosis. Trends Microbiol. 4: 113-118.

  6. Clemens, D.L. and M.A. Horwitz. 1995. Characterization of the Mycobacterium tuberculosis phagosome and evidence

  phagosomal maturation is inhibited. J. Exp. Med. 181: 257-270.

  7. Dellagostin, O.A., G. Esposito, L.-J. Eales, J.W. Dale, and J.J. McFadden. 1995. Activity of mycobacterial promoters during intracellular and extracellular growth. Microbiol. 141:

2123-2130.

  8. Gaillard, J. L., P. Berche, C. Frehel, E. Gouin, and P. Cossart. 1991. Entry of L. monocytogenes into cells is mediated by internalin, a repeat protein reminiscent of

  Antigens surface from Gram-positive cocci. Cell. 65: 1127-

1141.

64 2767336

  9. Garbe, T., Harris D., Vordermeir M., Lathigra R., Ivanyi J., and Young D. 1993. Expression of the Mycobacterium tuberculosis 19-kilodalton antigen in Mycobacterium smegmatis:

  immunological analysis and evidence of glycosilation. Inf.

Immun. 61: 260-267.

  10. Herrmann, J.L., P. O'Gaora, A. Gallagher, J.E.R. Thole, and D.B. Young. 1996. Bacterial glycoproteins: a link between glycosylation and proteolytic cleavage of a 19 kDa antigen

  from Mycobacterium tuberculosis. EMBO J. 15: 3547-3554.

  11. Hoffman, C.S. and A. Wright. 1985. Fusion of secreted proteins to alkaline phosphatase: an approach for studying

  protein secretion. Proc. Natl. Acad. Sci. USA. 82: 5107-5111.

  12. Isberg, R. R., D. L. Voorhis, and S. Falkow. 1987.

  Identification of invasin: a protein that allows enteric

  bacteria to penetrate cultured mammalian cells. Cell. 50: 769-

  778. 13. Lang, T. and J.-C. Antoine. 1991. Localization of MHC

  classII molecules in murine bone marrow-derived macrophages.

Immunology. 72: 199-205.

  14. Lee, B.Y. and M.A. Horwitz. 1995. Identification of macrophage and stress-induced proteins of Mycobacterium

  tuberculosis. J. Clin. Invest. 96: 245-249.

  15. Lim, E. M., J. Rauzier, J. Timm, G. Torrea, A. Murray, B. Gicquel, and D. Portnoi. 1995. Identification of Mycobacterium tuberculosis DNA sequences encoding exported proteins, using

  phoA gene fusions. J. Bacteriol. 177: 59-65.

2767336

  16. Mahan, M.J., J.M. Slauch, and M. J.J. 1993. Selection of bacterial virulence genes that are conventionally induced

  host tissues. Science. 259: 686-688.

  17. Pelicic, V., J. M. Reyrat, and B. Gicquel. 1996.

  Generation of unmarked directed mutations in mycobacteria, using sucrose counterselectable suicide vectors. Mol. Microbiol. In press: 18. Pettersson, J., R. Nordfelth, E. Dubinina, T. Bergman, M. Gustafsson, K. E. Magnusson, and H. Wolf-Watz. 1996. Modulation of virulence factor expression by pathogen target cell

contact. Science. 273: 1231-1233.

  19. Plumn, G. and J. E. Clark-Curtiss. 1994. Induction of Mycobacterium avium gene expression following phagocytosis by

  human macrophages. Infect. Immun. 62: 476-483.

  20. Sambrook, J., F. F. Fritsch, and T. Maniatis. 1989.

  Molecular cloning. A laboratory manual. 2nd ed., Vol. Cold

  Spring Harbor. New York: Cold Spring Harbor Laboratory Press.

  21. Servant, P. and P. Mazodier. 1995. Characterization of Streptomyces albus 18-kilodalton heat shock-responsive

  protein. J. Bacteriol. 177: 2998-3003.

  22. Stover, C. K., G. P. Bansal, M. S. Hanson, S. R. Burlein, S. R. Palaszynski, J. F. Young, S. Koenig, D. B. Young, A. Sadziene, and A. G. Barbour. 1993. Protective immunity elecited by recombinant Bacillus Calmette-Guerin (BCG) expressing outer surface protein A (OspA) lipoprotein: a candidate Lyme disease

vaccinated. J. Exp. Med. 178: 197-209.

  23. Sturgill-Koszycki, S., P. H. Schlesinger, P. Chakroborty, P. L. Haddix, H. L. Collins, A. K. Fok, R. D. Allen, S. L. Gluck,

66 2767336

  J. Heuser, and D. G. Russell. 1994. Lack of acidification in

  Mycobacterium phagosomes by exclusion of the vesicular proton

ATPase. Science. 263: 678-681.

  24. Timm, J., M. G. Perilli, C. Duez, J. Trias, G. Orefici, L. Fattorini, G. Amicosante, A. Oratore, B. Boris, J. M. Frere, A. P. Pugsley, and B. and Gicquel. 1994. Transcription and expression analysis, using lacZ and phoA gene fusions, of Mycobacterium fortuitum B-lactamase genes cloned from a natural isolate and a high-level beta-lactamase producer. Mol.

Microbiol. 12: 491-504.

  25. Verbon, A., R. A. Hartskeerl, A. Schuitema, A.H. Kolk, D.B. Young, and R. Lathigra. 1992. The 14,000-molecular-weight

  antigen of Mycobacterium tuberculosis is related to the alpha-

  crystallin family of low-molecular-weight heat shock proteins.

J Bacteriol. 174: 1352-1359.

  26. Xu, S., Cooper, S. Sturgill-Koszycki, T. van Heyningen,

  D. Chatterjee, I. Orme, P. Allen, and D. G. Russel. 1994.

  Intracellular trafficking in Mycobacterium tuberculosis and

  Mycobacterium avium-infected macrophages. J. Immunol. 153: 2568-

2578.

67 2767336

Claims (65)

claims   A recombinant vector for screening, cloning and / or expression, characterized in that it replicates in mycobacteria and in that it contains: 1) a functional replicon in mycobacteria; 2) a selection marker; 3) a reporter cassette comprising: a) a multiple cloning site (polylinker), b) optionally an active transcription terminator in mycobacteria, upstream of the polylinker, c) a nucleotide sequence coding from a gene coding for a marker for expressing, exporting and / or secreting protein, said nucleotide sequence being devoid of its initiation codon and its regulatory sequences, and d) a coding nucleotide sequence derived from a gene coding for a marker of promoter activity contained in the same fragment, said nucleotide sequence being provided of his initiation codon.   2. Recombinant vector according to claim 1, characterized in that the coding nucleotide sequence derived from a gene coding for an expression, export and / or protein secretion marker is a coding sequence derived from the phoA gene of the alkaline phosphatase.   Recombinant vector according to one of claims 1 and 2,   characterized in that the coding nucleotide sequence derived from a gene coding for an expression, export and / or protein secretion marker is a coding sequence of the gene   5-agarase, the nuclease of a staphylococcus or lactamase of a mycobacterium.   4. Recombinant vector according to one of claims 1 to 3,   characterized in that the coding nucleotide sequence derived from a gene encoding a promoter activity marker 68 2767336   contained in the same fragment is a coding sequence   luc gene of firefly luciferase.   Recombinant vector according to one of claims 1 to 4,   characterized in that the coding nucleotide sequence derived from a gene coding for a promoter activity marker contained in the same fragment is a coding sequence resulting from   of the GFP gene of the Green Fluorescent Protein.   Recombinant vector according to one of claims 1 to 5,   characterized in that the active transcription terminator in mycobacteria is the terminator of coliphage T4 (tT4).   Recombinant vector according to one of claims 1 to 6,   characterized in that it is a plasmid chosen from the following plasmids deposited at the CNCM (National Collection of Cultures of Microorganisms, Paris, France): a) pJEVDa deposited at the CNCM under N 1-1797, 12/12 1996   b) pJEVDb filed with the CNCM under N 1-1906, on July 25, 1997, c) pJEVDc filed with the CNCM under N 1-1799, on 12/12/1996,   d) pJEVD / M. tuberculosis deposited at the CNCM under N 1- 1907, July 25, 1997.   Recombinant vector according to one of claims 1 to 7,   characterized in that it comprises at one of the cloning sites of the polylinker a mycobacterial nucleic acid sequence in which a polypeptide capable of being exported and / or secreted is detected, and / or of being induced or repressed during the infection with said mycobacterium or constitutively produced, as well as the associated promoter and / or regulatory sequences likely to allow or promote the export and / or the secretion of said polypeptide,   or all or part of the gene encoding said polypeptide. 69 2767336   Recombinant vector according to one of claims 1 to 8,   characterized in that the mycobacterium nucleic acid sequence it contains is obtained by enzymatic digestion of the genomic DNA or DNA complementary to an RNA of a pathogenic mycobacterium.   Recombinant vector according to one of claims 1 to 9,   characterized in that said pathogenic mycobacterium is M. tuberculosis.   Recombinant vector according to one of claims 1 to 9,   characterized in that said pathogenic mycobacterium is selected from M. africanum, M. bovis, M. avium or M. leprae   Recombinant vector according to claim 10,   characterized in that it is a plasmid chosen from the following plasmids deposited at the CNCM: a) p6D7 deposited on January 28, 1997 at the CNCM under N I-1814, b) p5A3 filed January 28, 1997 at the CNCM under the N I-1815, c) p5F6 filed on January 28, 1997 with the CNCM under the N I-1816, d) p2A29 deposited on January 28, 1997 with the CNCM under N I-1817, e) pDP428 deposited on January 28, 1997 with the CNCM under N I-1818, f) p5B5 filed on January 28th, 1997 with the CNCM under N I-1819, g) plC7 deposited on January 28th, 1997 with the CNCM under N I-1820, h) p2D7 deposited the January 28, 1997 at the CNCM under the N I-1821,   i) plB7 filed on 31 January 1997 at the CNCM under No. I-1843.   13. Recombinant vector according to claim 12, characterized in that it is the plasmid pDP428 filed January 28, 1997 at the CNCM under N I-1818.   14. A method for screening nucleotide sequences derived from mycobacteria to determine the presence of sequences corresponding to exported and / or secreted 3 'polypeptides that may be induced or repressed during infection, their associated promoter and / or regulatory sequences likely to include to allow or promote 2767336   the export and / or the secretion of said polypeptides of interest, or all or part of genes of interest coding for said polypeptides, characterized in that it implements a   vectors according to one of claims 1 to 13.   15. Screening method according to claim 14, characterized in that it comprises the following steps: a) the digestion of the DNA sequences of mycobacteria by at least one specific enzyme and the recovery of the resulting digestion fragnents; b) insertion of the digestion fragments into a cloning site compatible with the enzyme of step a) of the polylinker   vector according to one of claims 1 to 13;   c) if necessary, the amplification of the digestion fragment contained in the vector, for example by replication of the latter after insertion of the vector thus modified in a specific cell, preferably E coli; d) the transformation of host cells by the vector amplified in step c), or in the absence of amplification, with the vector of step b); e) culturing transformed host cells in a medium that makes it possible to detect the export and / or secretion marker, and / or the promoter activity marker contained in the vector; f) detecting positive host cells (positive colonies) for expression of the export and / or secretion marker, and / or the promoter activity marker; g) isolating the DNA from the positive colonies and inserting this DNA into a cell identical to that of step c); h) selecting the insertions contained in the vector, to obtain positive clones for the export and / or secretion marker, and / or for the promoter activity marker; i) the isolation and characterization of the mycobacterial DNA fragments contained in these inserts, and the step i) of the process may further comprise a step of sequencing the 71 2767336 selected insertions.   16. A genomic DNA or cDNA library complementary to mycobacterium mRNA, characterized in that it is obtained by a method according to claim 14 and / or a process comprising steps a) and b), or a) , (b) and (c) of the process according to claim 15.   17. A genomic DNA library or complementary mycobacterium mRNA cDNA according to claim 16, characterized in that   said mycobacterium is a pathogenic mycobacterium.   18. A genomic DNA or cDNA complementary library of mycobacterium mRNA according to claim 17, characterized in that said mycobacterium is a mycobacterium belonging to the group.   of the Mycobacterium tuberculosis complex.   19. A genomic DNA or cDNA library complementary to mycobacterium mRNA according to claim 18, characterized in that   said mycobacterium is Mycobacterium tuberculosis.   20. Nucleotide sequence of mycobacteria likely to be   selected by a process according to one of claims 14 and 15.   21. Nucleotide sequence of mycobacterium according to claim 20, characterized in that it is chosen from the sequences of mycobacterial DNA fragments of sequence SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9 or SEQ ID No. 10, contained respectively in the vectors p6D7 (CNCM, N I-1814), p5A3 (CNCM, N I-1815), p5F6 (CNCM, N I-1816), p2A29 (CNCM, N, I-1817),   p5B5 (CNCM, N I-1819), pIC7 (CNCM, N I-1820), p2D7 (CNCM, N I-   1821) and pBI7 (CNCM under N I-1843). 3- 72 2767336   22. Mycobacterium nucleotide sequence according to claim 20, characterized in that it is chosen from the DNA fragment sequences of mycobacteria.   nucleic acid sequence SEQ ID N 11 and SEQ ID N 24.   23. Polypeptide that can be encoded by a sequence   nucleotide of mycobacterium according to one of claims 20   at 22. 24. Recombinant mycobacterium characterized in that it is transformed by a recombinant vector according to one of the Claims 1 to 13.   25. Polynucleotide of sequence SEQ ID N01 or SEQ ID N 2.   26. A polynucleotide characterized in that it comprises a polynucleotide chosen from: a) a polynucleotide of sequence SEQ ID N01 or SEQ ID N 2, b) a polynucleotide whose sequence is complementary to the sequence of the polynucleotide defined in a), c ) a polynucleotide whose sequence comprises at least 80% homology with a polynucleotide defined in a) or b), d) a polynucleotide hybridizing under conditions of high stringency with a polynucleotide sequence defined in a), b) or c ), e) a fragment of at least 8 consecutive nucleotides of a   polynucleotide defined in a), b), c) or d).   27. Polynucleotide according to one of claims 25 and 26,   3 () characterized in that its nucleic sequence is specific for mycobacterial sequence belonging to the complex of Mycobacterium tuberculosis.   28. Amino acid sequence polypeptide SEQ ID N01 or SEQ ID N 2. 73 2767336   29. A polypeptide characterized in that it comprises a polypeptide chosen from: a) a polypeptide of amino acid sequence SEQ ID No. 01 or SEQ ID N 2,   b) a polypeptide homologous to the polypeptide defined in a), c) a fragment of at least 5 amino acids of a polypeptide defined in a) or b), d) a biologically active fragment of a polypeptide defined in a), b), or c).   30. A polynucleotide characterized in that it encodes a   polypeptide according to one of claims 28 and 29.   31. A nucleic acid sequence which can be used as a primer, characterized in that said sequence is chosen from the polynucleotide nucleic acid sequences according to one of the Claims 25 to 27, and 30.   32. Nucleic acid sequence according to claim 31, characterized in that said sequence is chosen from the   following sequences: SEQ ID N 25 and SEQ ID N 26.   33. Sequence of nucleic acid according to one of the claims   31 and 32 for the detection and / or amplification of sequences Nucleic.   34. Nucleic acid sequence for use as a probe, characterized in that said sequence is chosen from the   nucleic acid sequences according to one of claims 25 to (0 27, and 30.   Nucleic acid sequence according to claim 34, characterized in that it is labeled with a compound   radioactive material or a non-radioactive compound. lQ 74 2767336   36. Nucleic acid sequence according to one of the claims   34 and 35, characterized in that it is immobilized on   a carrier, covalently or non-covalently.   37. Nucleic acid sequence according to one of the claims   34 to 36 for the detection and / or amplification of nucleic sequences.   38. Nucleic acid sequence according to one of the claims   34 to 37, characterized in that said sequence is chosen from the following sequences: from nucleotide 924 to nucleotide 1234 included in SEQ ID N 01.   39. A recombinant cloning, expression and / or insertion vector characterized in that it contains a polynucleotide nucleic acid sequence according to one of the Claims 25 to 27, and 30.   40. Recombinant vector according to claim 39, characterized in that it is the plasmid pDP428 filed January 28, 1997 at the CNCM under N I-1818.   41. Host cell, characterized in that it is transformed   by a recombinant vector according to one of claims 39 and   40. 42. Host cell according to claim 41, characterized in that it is the strain of E. coli transformed with the plasmid pDP428 filed January 28, 1997 at the CNCM under the N I-1818.   43. A recombinant polypeptide, characterized in that it is obtained from a recombinant hasty cell according to one of the claims 41 and 42. 2767336   44. Hybrid polypeptide, characterized in that it comprises at least the sequence of a polypeptide according to one of the   Claims 28, 29 and 43 and a sequence of a polypeptide   likely to induce an immune response in humans or animals. 45. Hybrid polypeptide according to claim 44, characterized in that the polypeptide capable of inducing an immune response contains at least one antigenic determinant   capable of inducing a humoral and / or cellular response.   46. Hybrid polypeptide according to one of claims 44 and   , characterized in that the antigenic determinant corresponds to an antigenic determinant of immunogenic proteins selected for example from ESAT6 and DES of 45/47 kD of Mycobacterium tuberculosis.   47. Hybrid polypeptide according to one of claims 44 and   characterized in that the antigenic determinant corresponds to an antigenic determinant of the surface or envelope antigen of a hepatitis virus or VP1 antigen. polio virus.   48. Hybrid polypeptide according to one of claims 44 and   45, characterized in that the antigenic determinant consists of all or part of a protein selected from   gag, pol, nef or env proteins of HIV-1 or HIV-2.   49. Polynucleotide encoding a hybrid polypeptide according to one of claims 44 to 48.   50. Hybrid polypeptide according to one of claims 44 to 48   characterized in that it is a recombinant protein obtained by the expression of a polynucleotide according to the claim 49.   51. Process for the in vitro detection of antibodies against a bacterium of the Mycobacterium tuberculosis complex in 76 2767336   a biological sample, characterized in that it comprises the following steps: a) bringing the biological sample into contact with a   polypeptide according to one of claims 28, 29 and 43;   b) Demonstration of the antigen-antibody complex formed. 52. Kit for the in vitro diagnosis of mycobacterium infection belonging to the Mycobacterium tuberculosis complex, comprising:   a) a polypeptide according to one of claims 28, 29   and 43; b) the reagents for the constitution of the environment conducive to the immunological reaction; c) reagents for detecting antigen-antibody complexes produced by the immunological reaction; d) if appropriate, a reference biological sample (negative control) free of antibodies recognized by said polypeptide; (e) where applicable, a reference biological sample (positive control) containing a predetermined quantity   of antibodies recognized by said polypeptide.   53. Mono- or polyclonal antibodies, their fragments, or chimeric antibodies, characterized in that they are capable of specifically recognizing a polypeptide according to one of the claims 28, 29 and 43.   54. The antibody of claim 53, characterized in that that it is a branded antibody.   55. A method for the specific detection of the presence of an antigen of a bacterium of the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the following steps: 3'5 a) Contacting the sample biological with a   antibody according to one of claims 53 and 54;   b) Demonstration of the antigen-antibody complex formed. 77 2767336   56. Kit for the specific detection of the presence of an antigen of a bacterium of the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the following elements: a) A polyclonal or monoclonal antibody according to one of the claims 53 and 54;   b) the reagents for the constitution of the environment conducive to the immunological reaction; (c) reagents for the detection of complexes   antigen-antibodies produced by the immunological reaction.   57. A method for detecting and rapidly identifying M. tuberculosis in a biological sample, characterized in that it comprises the following steps: a) Isolation of the DNA from the biological sample to be analyzed, or obtaining of a cDNA from the RNA of the biological sample; b) Specific DNA amplification of mycobacteria belonging to the Mycobacterium tuberculosis complex using   2 () of primers according to one of claims 31 to 33;   c) Analysis of the amplification products.   58. A method for the specific detection of bacteria belonging to the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the following steps: a) bringing an oligonucleotide probe into contact according to   one of claims 34 to 38 with a sample   biological, the DNA contained in the biological sample having, where appropriate, previously been made accessible to hybridization, under conditions allowing hybridization of the probe to the DNA of a bacterium of the Mycobacterium tuberculosis complex; b) Detection of the hybrid formed between the probe   oligonucleotide and the DNA of the biological sample. 78 2767336   59. A method for the specific detection of bacteria belonging to the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the following steps: a) bringing an immobilized oligonucleotide probe into contact with a support according to claim 36 with a biological sample, the DNA of the sample, having, where appropriate, been previously made accessible to hybridization, under conditions allowing hybridization of the probe to the DNA of a bacterium of the Mycobacterium tuberculosis complex; b) bringing into contact the hybrid formed between the oligonucleotide probe immobilized on a support and the DNA contained in the biological sample, where appropriate after removal of the DNA from the biological sample which has not hybridized with the probe, with an oligonucleotide probe labeled according to claim 35.   60. The detection method as claimed in claim 59, characterized in that, prior to step a), the DNA of the biological sample, or the cDNA obtained by reverse transcription of the RNA of the sample, is amplified using a pair of primers   according to one of claims 31 to 33.   61. A method for the specific detection of the presence of a bacterium belonging to the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the following steps: a) bringing the biological sample into contact with a   primer pair according to one of claims 31 to 33, the DNA   contained in the sample having, where appropriate, been previously made accessible to hybridization, under conditions allowing hybridization of the primers to the DNA of a bacterium of the Mycobacterium tuberculosis complex; b) amplification of the DNA of the Mycobacterium tuberculosis complex bacterium; 79 2767336   c) demonstration of the amplification of DNA fragments corresponding to the fragment flanked by the primers, for example by gel electrophoresis or by means of a probe   labeled oligonucleotide according to claim 35.   62. Process for the specific detection of the presence of a bacterium belonging to the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the following steps: a) bringing the biological sample into contact with two   primer pairs according to one of claims 31 to 33,   the DNA contained in the sample having been, if necessary, previously made accessible to hybridization, under conditions allowing hybridization of the primers to the DNA of a bacterium of the Mycobacterium tuberculosis complex; b) amplification of the DNA of the Mycobacterium tuberculosis complex bacterium; c) demonstrating the amplification of DNA fragments corresponding to the fragment flanked by said primers, by   by gel electrophoresis or by means of a labeled oligonucleotide probe according to claim 35.   63. Kit for the detection of the presence of a bacterium of the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the following elements: a) An oligonucleotide probe according to one of the claims 34 to 38;   b) The reagents necessary for carrying out a hybridization reaction; (c) Where appropriate, a pair of primers according to one of the   claims 31 to 33 and the reagents necessary for   an amplification reaction of the DNA (genomic DNA, plasmid or cDNA) of a bacterium of the Mycobacterium complex tuberculosis. 2767336   64. A kit or kit for detecting the presence of a bacterium of the Mycobacterium tuberculosis complex in a biological sample, characterized in that it comprises the following elements: a) An oligonucleotide probe, called a capture probe, according to claim 36. ; b) an oligonucleotide probe, called a revelation probe,   according to one of claims 34 to 38.   (c) Where appropriate, a pair of primers according to one of the   claims 31 to 33 and the reagents necessary for   a DNA amplification reaction of a bacterium from   Mycobacterium tuberculosis complex.   65. Kit for the amplification of the DNA of a bacterium of the Mycobacterium tuberculosis complex present in a biological sample, characterized in that it comprises the following elements: a) A pair of nucleic acid fragments according to one of claims 31 to 33;   b) Reagents necessary to perform a DNA amplification reaction; c) Possibly a component making it possible to verify the sequence of the amplified fragment, more particularly a probe   oligonucleotide according to one of claims 34 to 38.   66. Immunogenic composition characterized in that it comprises   one or more polypeptides according to one of claims 28,   29 and 43 and / or one or more hybrid polypeptides according to one of claims 44 to 50.   67. Vaccine characterized in that it contains one or more   polypeptides according to one of claims 28, 29 and 43 and / or   one or more hybrid polypeptides according to one of   Claims 44 to 50, in association with a vehicle   pharmaceutically compatible and, where appropriate, an adjuvant the appropriate immunity. 81 2767336   68. Vaccine for immunization against a bacterial or viral infection, such as tuberculosis or   hepatitis, comprising a vector according to claim 39 or a polynucleotide according to claim 49, in association with a pharmaceutically compatible carrier.