FR2750504A1 - Analysis of nucleic acids captured on immobilised oligo:nucleotide(s) - Google Patents

Abstract

Nucleic acid assay comprises contacting nucleic acids with oligonucleotides immobilised on a support, subjecting the resulting duplexes to a denaturation gradient, and detecting the nucleic acids progressively released from the support. Also claimed is a device for performing an assay as above, comprising a stick and a support on which the oligonucleotides are immobilised attached to at least one end of the stick, the support comprising a movable ball, filaments or a pad.

Description

METHOD OF ANALYZING NUCLEIC ACIDS BY
HYBRIDIZATION AND DEVICE FOR ITS IMPLEMENTATION

 The present invention relates to the field of nucleic acid sequence analysis, in single strand or double helix, unknown by hybridization with oligonucleotide probes fixed on a support. This type of analysis finds its application in sequencing, diagnosis or quality control, research or industrial production.

The A-T (or AU) pairing law and GC confers on nucleic acids the property of forming specific hybridization complexes between complementary sequences. This long-known property makes it possible to use a nucleic acid fragment, or oligonucleotide, to demonstrate the presence of a complementary nucleic acid sequence. Analysis of DNA fragments after separation on gel (E. Southern,
J. mol. Biol., 1975, 98, 503-517) is now widely used in both basic research and medical analysis (Caskey, Science, 1987, 236, 1223-1228, Landegrer et al. Science, 1988, 242, 229-237, Arnheim et al., Ann
Rev. Biochem., 1992, 61, 131-156).

 Several nucleic acid analysis techniques, based on their hybridization property with probes, have been developed in particular for the sequencing of unknown DNA or RNA, the detection of sequences associated with a pathology, the search for point mutations. in sequences (S. Ikata et al., Nuclei Acids Res., 1987, 15, 797-811;

Matthews, L.J. Krieka, Analytical Biochemistry, 1988, 169, 1-25).

 More recently, it has been proposed new methods of analysis of unknown DNA fragments, based on hybridization with a series of oligonucleotides comprising from 5 to 9 bases arranged in a known sequence and immobilized on a solid support (E .

Southern, European Patent Publication Number: 0 373 203; KR Khrapko et al., FEBS Letters, 1989, 256, 118-122; R. Drmanac et al., Genomics, 1989, 4, 114-128; R. Drmanac et al., DNA and Cell Biology, 1990, 9.527534; KR Khrapko et al., J. DNA Sequencing Mapp., 1991, 1, 375-388; R. Drmanac et al., Science, 1993, 260, 1649-1652; RJ Lipshutz, J. Biomol. Struct. Dyn., 1993, 11, 637-653; U. Maskos, E. Southern, Nucleic
Acids Res., 1993, 21, 4663-4669; AC Pease et al.
Proc. Natl. Acad. Sci., USA, 1994, 91, 5022-5026; JC

Williams, Nucleic Acids Res., 1994, 22, 1365-1367; E.

M. Southern, Nucleic Acids Res., 1994, 22, 1368-1373).

 These new methods of analysis consist in detecting, after hybridization and washing, the signals emitted by the hybrids possibly formed between the labeled DNA fragment analyzed and one or more oligonucleotides of the series immobilized on the solid support. Each position revealed to be positive on the support corresponds to a complementary sequence thus identified in the analyzed DNA fragment.

 Independently of the difficulties of preparation of the supports on which the synthesis of the oligonucleotides takes place, the major problem of these methods lies in the discrimination between the perfect hybrids and the hybrids comprising one or more mismatches.

 The analysis of the hybridization complexes obtained by the above methods is based on the greater stability of the hybrids without mismatch with respect to hybrids having one or more mismatching. Discrimination between a perfect hybrid and mismatched hybrids can be achieved by, for example, raising the temperature of the medium, thereby dissociating the mismatched complexes before that of the mismatched complex.

It is indeed known that the stability of a DNA duplex is dependent on its length and its sequence in bases. The melting temperature, referred to as
Tm, is the temperature at which the two strands of DNA are at 50% in duplex form.

 For a given sequence and size of a duplex, the Tm varies with the composition of the hybridization medium. Several factors are likely to affect the value of Tm, such as denaturing agents, for example urea or formamide which lower Tm, or changes in ionic strength.

 The stability of the hybrids, and therefore the value of the Tm, is also a function of the base composition.

It is known that the base pair G-C, characterized by three hydrogen bonds, is more stable than the pairs A-T or A-U which have only two hydrogen bonds. For example, in the case of a duplex of 9 base pairs long, the difference of Tm between a sequence composed solely of pairs G-C, and a sequence composed only of pairs A-T, is of the order of 500C.

 Consequently, at equal length, a perfect hybrid rich in A-T pairs is likely to have a neighboring or even lower Tm than an imperfect hybrid rich in G-C pairs. In fact, the destabilization due to a mismatch in a duplex rich in G-C pairs may represent a variation of Tm from 20C to more than 250C, depending on the position and the nature of the mismatch.

 It therefore seems impossible to set unique hybridization conditions that make it possible to discriminate perfect duplexes from imperfect duplexes, whatever their sequence. This phenomenon leads to false positive or false negative signals depending on the temperature, hybridization and washing conditions used in the above-mentioned DNA analysis methods.

 These methods for analyzing unknown DNA fragments are advantageously used to sequence said fragments by hybridization with a series of oligonucleotides of the same length covering all the possible sequences for this given length of the oligonucleotides. Thus, for oligonucleotides of 2 bases selected from the four constituting DNA, 16 sequences are possible, for oligonucleotides of 3 bases, 64 sequences are possible, for oligonucleotides of 4 bases, 256 sequences are possible, for oligonucleotides of 5 bases, 1024 sequences are possible, for oligonucleotides of 6 bases, 4096 sequences are possible, etc ...

 Accordingly, for each set of possible sequences, the Tm's of each perfect duplex will be different in a wide temperature range with a discrimination problem for the mismatches. It also appears that the smaller the sequence of the duplexes, the greater the difference in Tm between a perfect hybrid and a hybrid with a mismatch. However, the shorter the sequence of the duplexes, the less informative it is for sequencing; indeed, for a DNA fragment to be sequenced 1000 bases, any sequence of 3 bases will be statistically present at least fifteen times and a sequence of 4 bases will be present statistically probably 4 times, while a sequence of 5 bases should only be statistically present once.

 A compromise must therefore be found to allow to sequence the largest possible fragments with the least possible oligonucleotides.

 In addition, it is obvious that the hybridization temperature is different for each sequence that one seeks to determine or detect with the series of oligonucleotides. To increase the possibilities of discrimination of the mismatches and circumvent the above problem, it is necessary to perform a denaturation or renaturation kinetics of each oligonucleotide sequence of the support in order to determine the highest Tm for each perfect duplex sequence.

The value of the Tm of each possible hybrid on the support is measured in the prior art as follows
the support is brought into contact with a DNA fragment to be analyzed, this bringing into contact being carried out at low temperature, that is to say less than 10 ° C. below the lowest Tm of the series of oligonucleotides, then
the support is washed gradually increasing the temperature, and
for each support oligonucleotide, the duplexes formed throughout the temperature gradient are quantized.

 This last step of quantification is not easy to achieve because at each temperature less than or equal to the Tm of the hybrid considered, the amount of duplex formed varies with the concentration of the DNA fragment brought into contact with the support, as well as with the amount of the oligonucleotide considered per unit area on the support. This quantification is complicated by the fact of the techniques of synthesis of the oligonucleotides on the support, which generate on the one hand a great variation of the quantity of the different oligonucleotides at each position of the support and on the other hand randomness in the uniformity of the sequence of the oligonucleotide synthesized at each position of the support. It will therefore be imperative to perform for each manufactured support and for each oligonucleotide site positioned thereon, a calibration of the denaturation curves.

 In addition, the quantification of the hybrid formed on the support limits the use of the markers and the physical measurement means, because of the interactions between the markers and the support; it is therefore necessary to adapt the markers, and therefore the detection means, to each support.

 The present invention aims to provide a method for overcoming the disadvantages and difficulties of the method described above. This goal is achieved by not detecting the amount of duplex formed, but the amount of DNA released from the hybridization zone during a duplex denaturation step.

 The method of nucleic acid analysis according to the invention consists in bringing said nucleic acids into contact with oligonucleotides fixed on a support so as to form hybridization complexes, then to subject said hybridization complexes to a gradient of denaturation and finally to detect and analyze by any appropriate means the nucleic acids released from the support as the progress of the denaturation gradient.

The method of the invention is more particularly aimed at the analysis of single-stranded nucleic acids, but can also be applied to detect double helix DNA sequences, one of which is rich in purine bases, via triple helix formation (T. Le Doan et al., Nucleic
Acids Res., 1987, 15, 7749-7260; HE Moser, PB

Dervan, Science 1987, 238, 645-650; D. A. Collier et al., J. Am. Soc., 1991, 113, 1457-1458; P. A.

Beal, P. B. Dervan, Science, 1991, 251, 1360-1363; D.

S. Pilch et al., Biochemistry, 1991, 30, 6081-6087; C.

Giovannangeli et al., Proc. Natl. Acad. Sci. USA, 1992, 89, 8631-8635; PJ Bates et al., Nucleic Acids Res., 1995, 23, 3627-3632; Nguyen T. Thuong, C. Helena,
Angew. Chem. Int. Ed., 1993, 105, 666-690). In this case, the term "hybridization complex" should also be understood to mean triple helices, which can also be called triplexes, formed between the double-stranded nucleic acid analyzed and the oligonucleotides fixed on the support.

The method according to the invention is more particularly characterized in that it comprises the following steps
contacting the single-stranded nucleic acids to be analyzed with a support on which a series of identical or different oligonucleotides is fixed under weak denaturing conditions so as to carry out the hybridization of the nucleic acids to be tested with the majority of the oligonucleotides from the support and then
optionally one or more washings to eliminate unhybridized nucleic acids from the support,
the exposure of the support to a denaturation gradient ensuring the progressive release of the nucleic acids of the support as a function of the level of pairing of each nucleic acid with an oligonucleotide fixed on the support,
detection and analysis by any appropriate means of the nucleic acids released from said support as the denaturation gradient progresses.

 Unlike the methods of the prior art, the method of the invention aims to measure not the amount of duplex formed between the nucleic acids tested and the oligonucleotides of the support, but the amount of nucleic acid released from the support.

 The term "nucleic acid" is intended to mean, according to the invention, single-stranded DNA or double-helix or RNA sequences or these sequences comprising or consisting of modified nucleosides.

 The nucleic acid analysis method according to the invention can be implemented both for the sequencing of said nucleic acid, as for the detection of one or more particular sequences or of one or more mutations possibly present in said nucleic acid. .

In the case of the detection of a particular sequence or of a mutation possibly present in a nucleic acid, the method of the invention is carried out with a support comprising oligonucleotides of identical lengths and sequences corresponding to those of the particular sequence or mutation sought. Depending on whether the sequence or mutation sought is known or not, the sequence of
The oligonucleotide may be chosen perfectly complementary or not to said desired sequence or mutation.

 The method of the invention may also allow the detection of several particular sequences or mutations present in one or more nucleic acids. The process is then carried out with a support comprising oligonucleotides, several of which are of different lengths and sequences in order to cover the different sequences or mutations analyzed. In this case, it is advantageous to carry out, prior to the implementation of the method, the calibration of the Tm of each of the different oligonucleotides fixed on the support.

 In the case of nucleic acid sequencing, the method of the invention is carried out with a support comprising a series of oligonucleotides of identical lengths and of different sequences so as to cover all the sequence possibilities for this length. In this case, it is advantageous to carry out, prior to the implementation of the method, the calibration of the Tm of each of the oligonucleotides attached to the support.

 The process of the invention can be carried out with any type of denaturation gradient, such as gradients of temperature, ionic strength or denaturing agent.

 In the case of temperature gradients, it is advantageous to carry out hybridizations with short oligonucleotides of the order of 5 to 10 bases, to be placed at relatively low temperatures, below room temperature.

 In the case of double-stranded DNA analysis, the hybridization is advantageously carried out with oligonucleotides of 10 to 15 bases.

 The detection of the nucleic acids released from the support can be carried out by any appropriate means.

Generally, the nucleic acids analyzed are labeled, for example with a radioactive, fluorescent, enzymatic or immunological tracer, and thus detected on release from the support by any detection means adapted to the type of marking used.

The support on which the oligonucleotides are attached may have various forms and be made of any material with which it is possible
synthesizing or fixing, after synthesis, said oligonucleotides according to the techniques described in the literature, while making it possible to expose said oligonucleotides to the hybridization solution as well as the hybrids formed in the washing solution and in the denaturation gradient (it is in very important effect of not limiting the hybridization and release reactions between the oligonucleotides and the nucleic acids analyzed),
to release from the support the nucleic acids separated from the hybridization complexes.

 The support must therefore be adapted in particular to the detection technique used.

It can be a flow or liquid vein detection, and the support can then be in the form of beads, fibers, threads and filaments, membranes of various material, placed in a column or in a vein ; the column or vein is loaded with the analyzed nucleic acids, washed and then subjected to a denaturation gradient; the nature and amount of each of the nucleic acids released as a function of
Tm are detected at the exit of the column or the vein by any appropriate means known to those skilled in the art.

 It can also be a step elution. In this case, the hybridization reaction can be carried out in a cup where the support is placed, the washing solution is added at a first temperature or ionic strength or a given denaturant concentration and it is analyzed by any suitable means. the amount of nucleic acid released from the support. The procedure is repeated for a second, third, etc ... temperature or ionic strength or a given denaturant concentration.

 It may also be a detection on a solid element advantageously flat, such as a membrane, a film or a sheet for example of cellulose, glass, resin, polymer or cotton, treated so as to react with the nucleic acid marker that is used; the nucleic acids released from the hybridization support as the denaturation gradient advances are deposited on the solid element where they are revealed. A very particular embodiment of this type of detection is to use a device in the form of a pen or a brush comprising at least one of its ends a support on which the oligonucleotides are fixed. This support may be a movable ball of the type of a ballpoint pen, filaments braided or not as the bristles of a brush, a stamp of the type of a felt pen, any material allowing, as indicated previously, to set the oligonucleotides and expose them to the hybridization solution and then subject the hybrids formed to the washing solution and the denaturation gradient.

Such a device is used in the context of the method of the invention, as follows
the end of the device is brought into contact with the hybridization solution, for example by simple soaking, for a time sufficient to allow the formation of the duplexes between the analyzed nucleic acids and the oligonucleotides attached to the support at the end of the device,
said medium is optionally washed in order to eliminate the unreacted nucleic acids,
the denaturation gradient is applied to the support carrying the duplexes by displacing the device on a flat solid element subjected to a denaturation gradient; the nucleic acids are then released from the support and deposited on said flat element as the support moves over the denaturation gradient.

 the nucleic acids released and revealed on the solid element are detected and analyzed.

 An alternative to the previous technique is to place on the device a system for applying the denaturation gradient at the support. As before, the deposition of the nucleic acids released as the denaturation gradient is being washed is carried out by displacing the support on a flat solid element.

According to a very particular embodiment, the device comprises
at one of its ends, at least one support, as defined previously, on which the oligonucleotides are attached,
one or more cartridges opening onto the support, said cartridges containing the hybridization solution and optionally a washing solution,
pressure means making it possible to bring the hybridization solution and thus the nucleic acids analyzed into contact with the support for carrying out the hybridization reactions, as well as, optionally, the washing solution.

 The application of the denaturation gradient is carried out as indicated above.

 Other advantages and characteristics of the invention will appear on reading the examples which follow, given in a non-limiting manner, and concerning protocols for implementing the method of the invention and its application to the detection of mutations.

 Example 1 - Application to the diagnosis of sunctual mutations: detection of a mesaparriage at the 5 'position of the duplex.

 Identical oligonucleotides having the formula: ## STR5 ##, designated B02911, were synthesized on a 5.5 mm diameter cellulose membrane.

 This oligonucleotide is homologous to part of the sequence of exon 11 of the CFTR gene that can carry the point mutation R560T.

 In the diagram of the device of FIG. 1, the cellulose membrane comprising the oligonucleotides of formula (I) is placed in a liquid vein or a column (5), a peristaltic pump (2) makes it possible to pass the hybridization solution then the washing solution from the tube (1) in the column (5) and then in the collection tube (6) where are collected and detected the nucleic acids released from the support. The column (5) containing the cellulose membrane and about 60 cm of microtube (3) arriving at the column are placed in a thermostated bath and stirred (4).

 For this example, the hybridization according to the method of the invention was not carried out with a nucleic acid fragment originating from a subject, but with two nucleotide probes, labeled with 32P by kination, corresponding to the portion of the CFTR gene that can carry the R560T mutation. These two nucleic probes correspond to the following formulas: ## EQU1 ## (B02907), 5 'T T C T T A G C A A G G T C A A 3' (B03671).

Two experiments were carried out, each with one of the nucleic probes of the CFTR gene, according to the following modalities
Hybridization is carried out by recirculating the hybridization solution containing the nucleic acid probe for 1 hour at a temperature of 300 ° C. After this contacting step, the hybridization solution is replaced by the elution solution, a 6 ml wash is carried out to remove unhybridized nucleic acids, then the temperature gradient and collection of fractions are started.

 Hybridization solution: 200 pmoles of one of the two labeled nucleic acid probes (1500,000 cpm) in 1.5 ml of 5x SSPE, 0.5% SDS. Composition SSPE 5X 0.9 M NaCl, 50 mM NaH2PO4, pH 7.5.

 - Elution solution: SSPE 5x and 0.5% SDS.

 - Solution flow measured at 300C with water: 1.0 ml / min.

 - Temperature gradient: 300 to 600C in 13 minutes, as shown in the graph of Figure 2.

 - Collection of 42 equal fractions (15 drops of approximately 0.309 ml) over the entire duration of the gradient.

 - Dead volume of the assembly (input / output) of about 1.0 ml.

The B02907 probe, not carrying the mutation, hybridises perfectly with the oligonucleotide B02911 cellulose - 3 'TCGTTCCAC - Acridine 5' 5 'TTCTTTAGCAAGGTGAA 3' (B02907)
While probe B03671 is mesaparated with oligonucleotide B02911 cellulose - 3 'TCGTTCCAC - Acridine 5' TTCTTTAGCAAGGTCAA 3 '(B03671).

This type of mesaparage, placed at the end of the duplex, is the least destabilizing, and therefore the most difficult to detect. Indeed, for the same duplex, a more central mesaparage such as cellulose - 3 'TCGTTCCAC - Acridine 5' 5 'TTCTTTAGCAACGTGAA .3'
produces a destabilization greater than 400C.

 The graph of FIG. 2 represents the denaturation profile of the two probes B02907 and B0371, after hybridization on the membrane. On this graph, we notice a net elution peak, and we observe the destabilization due to mismatch (C / C instead of G / C 5 'of the oligonucleotide attached to the support).

The difference of Tm between the two duplexes is of the order of 4,500C. It is also observed that the two elution peaks overlap a lot, and that no temperature makes it possible to obtain a zero signal for the mesaparrization while maintaining a reasonably positive signal for the perfect duplex.

 Example 2 - Application to the diagnosis of sunctaneous mutations: detection of a mesaparage in the central position of the duplex.

 Identical oligonucleotides having the formula: 3'-G A C T T C C T - 5 'Acridine, designated EC95, were synthesized on a 5.5 mm diameter cellulose membrane.

 This oligonucleotide is homologous to a portion of the exon 11 sequence of the human CFTR gene carrying the S549N (G / A) point mutation. This mutation corresponds to the replacement by the base A, underlined in the fragment hereinafter designated CE90, of the base G in the non-mutated DNA. This portion of the CFTR gene is known to have several possible codon 549 mutations.

In the scheme of the device of FIG. 1, the cellulose membrane comprising the oligonucleotides
CE95 is placed in a liquid vein or a column (5), a peristaltic pump (2) makes it possible to pass the hybridization solution and then the washing solution from the tube (1) in the column (5), then in the collection tube (6), or in a Jasco fluorescence detector FP 920, where the nucleic acid released from the support is detected. The column containing the cellulose membrane and about 60 cm of microtube (3) arriving at the column are placed in a thermostated and stirred bath (4).

For this example, the hybridization according to the method of the invention was not carried out with a nucleic acid fragment originating from a subject, but with 3 fluorescein-labeled 5 'synthetic fragments ( FTC). These fragments correspond to the portion of exon 11 of the human CFTR gene
- The CE90 fragment presents the mutation
S549N, i.e. replacement of base G with base A underlined in the formula below 'FTC - AATCACACTGAATGGAGGT - 3'.

- The CE89 fragment presents the mutation
S549R, i.e. replacement of base A with base C underlined in the formula below 'FTC - AATCACACTGCGTGGAGGT - 3'.

- The fragment CE91 presents the mutation
S549I, i.e. the replacement of base G with base T underlined in the formula below 'FTC - AATCACACTGATTGGAGGT - 3'.

Three experiments were performed, each with one of the following nucleic acid probes:
Hybridization is carried out by recirculating the hybridization solution containing the nucleic acid probe for one hour at a temperature of 280 ° C. After this step of contacting, the pump is stopped, the hybridization solution is replaced by the washing solution, and the output of the detector is directed to the trash. The pump is restarted, and the washing makes it possible to eliminate the unhybridized nucleic acids.

 - The temperature gradient is started when the level of fluorescence approaches the baseline, this corresponds to the passage of 5 to 10 ml of washing solution.

 Hybridization solution: 500 picomoles of each probe in 2 ml of 5X SSPE.

 - Washing solution: SSPE 5X.

 - Solution flow measured at 300C with water: 1 ml / min.

 - Temperature gradient: 280C to 500C in 16 minutes, as shown in the graph of Figure 3.

 - Dead volume of the whole (input / output): about 1.5 ml.

 - Fluorescence detector set excitation at 495 nm and emission at 520 nm, sensitivity 100X.

The CE90 probe hybridizes perfectly with the CE95 oligonucleotide on the membrane
Cellulose --------- 3'- GACTTACCT - Acridine 5 '
5'FTC - AATCACACTGAATGGAGGT - 3 'CE90 while the CE91 probe has a mismatch and the CE89 probe has two mismatches with the CE95 oligonucleotide on the membrane
Cellulose --------- 3'- GACTTACCT - Acridine 5 '
5'FTC - AATCACACTGCGTGGAGGT - 3 'CE89
Cellulose --------- 3'- GACTTACCT - Acridine 5
5'FTC - AATCACACTGATTGGAGGT - 3 'CE91
This type of mismatch is very destabilizing. The graph in FIG. 3 represents the denaturation profile of the three probes CE89, CE90 and
CE91 after hybridization on the membrane. It is observed in the graph of FIG. 3 that an elution peak is duplex. The discrimination of point mismatches in the central position is therefore unambiguous in the method of the invention.

Example 3 - Diacrnostic Asplication of Sunctual Mutations: Mismatch Detection in
Central position of the duplex effect of the probe concentration.

 Identical oligonucleotides having the formula: 3'-G A C T A A C C T-5 'Acridine, designated CE96, were synthesized on a 5.5 mm diameter cellulose membrane.

 This oligonucleotide is homologous to a portion of the exon 11 sequence of the human CFTR gene carrying the S549I (G / T) point mutation. This mutation corresponds to the replacement by the base T, underlined in the designated fragment CE91, of the base G in the non-mutated DNA. This portion of the CFTR gene is known to have several possible codon 549 mutations.

In the scheme of the device of FIG. 1, the cellulose membrane comprising the oligonucleotides
CE96 is placed in a liquid vein or a column (5), a peristaltic pump (2) makes it possible to pass the hybridization solution and then the washing solution from the tube (1) in the column (5), then in the Jasco fluorescence detector FP 920 (6), where the nucleic acids released from the support are detected.

The column containing the cellulose membrane and about 60 cm of microtube (3) arriving at the column are placed in a thermostated and stirred bath (4).

As in the previous examples, the hybridization according to the method of the invention was not carried out with a nucleic acid fragment originating from a subject, but with 2 synthetic fragments labeled 5 'to the fluorescein (FTC). These fragments correspond to the portion of exon 11 of the human CFTR gene
- The fragment CE91 presents the mutation
S549I, i.e. the replacement of base G with base T underlined in the formula below 'FTC - AATCACACTGATTGGAGGT - 3'.

- The CE90 fragment presents the mutation
S549N, i.e. replacement of base G with base A underlined in the formula below 'FTC - AATCACACTGAATGGAGGT - 3'.

Two series of experiments were performed, with one of the nucleic probes according to the following modalities
Hybridization is carried out by recirculating the hybridization solution containing the nucleic acid probe for one hour at a temperature of 280 ° C. After this step of contacting, the pump is stopped, the hybridization solution is replaced by the washing solution, and the output of the detector is directed to the trash. The pump is restarted, and the washing makes it possible to eliminate the unhybridized nucleic acids.

 - The temperature gradient is started when the level of fluorescence approaches the baseline, this corresponds to the passage of 5 to 10 ml of washing solution.

 Hybridization solution: 500 picomoles of each probe in 2 ml of 5X SSPE for the curves designated CE91 / 1 and CE90 / 1 in the graph of FIG. 4, and 1500 picomoles of each probe for the curves designated CE91 / 2 and CE90 / 2 in the graph of Figure 4.

 - Washing solution: SSPE 5X.

 - Solution flow measured at 300C with water: 1 ml / min.

 - Temperature gradient: 280C at 570C in 18 minutes, as shown in the graph of Figure 4.

 - Dead volume of the whole (input / output): about 1.5 ml.

 - Fluorescence detector set excitation at 495 nm and emission at 520 nm, sensitivity 100X.

The probe CE91 hybridises perfectly with the oligonucleotide CE96 on the membrane
Cellulose --------- 3'- GACTAACCT - Acridine 5 '
5 'FTC - AATCACACTGATTGGAGGT - 3', while the CE90 probe shows a mismatch with the CE96 oligonucleotide on the membrane
Cellulose --------- 3'- GACTAACCT - Acridine 5 '
5XFTC - AATCACACTGAATGGAGGT - 3 '.

 This type of mismatch is very destabilizing. The graph of FIG. 4 represents the denaturation profile of the CE90 and CE91 probes after hybridization at different concentrations on the membrane. It can be observed in the graph of FIG. 4 that an elution peak is obtained with the probe CE91 at a temperature of 45.50 ° C. The increase of a factor 3 of the concentration of the probe CE91 does not cause displacement of the peak delution, but only an increase of the surface, therefore the amount of probe eluted. The CE90 probe has a mismatch, and no elution peak is observed; the fluorescence emission remains at the baseline, and represents an extremely low background, even by tripling the probe concentration for hybridization. No hybridization was thus obtained at 28 ° C. with the probe having a mismatch in the central zone of the duplex, even at very high concentration, thus the discrimination of point mismatches in the central position is unambiguous in the method of the invention.

 Example 4 - Sequence detection in Exon 11 of the human CFTR crest.

 Identical oligonucleotides corresponding to the formula: 3'-GACTCACCT-Acridine 5 ', designated FCE93, were synthesized on 40 cm of cotton thread, then 15 cm of this thread is packaged in a tube of 2 mm in diameter and 3 cm. mm long. This tube adapted to the circuit of the device of Figure 1 serves as a column.

 This oligonucleotide is homologous to a portion of the exon 11 sequence of the human CFTR gene carrying the S549I (G / T) point mutation. This mutation corresponds to the replacement by the base T, underlined in the designated fragment CE91, of the base G in the non-mutated DNA. This portion of the CFTR gene is known to have several possible codon 549 mutations.

 In the diagram of the device of FIG. 1, the cotton thread comprising the oligonucleotides FCE93 is placed in a column (5), a peristaltic pump (2) makes it possible to pass the hybridization solution and then the washing solution from the tube (1) in column (5), then in the Jasco fluorescence detector FP 920 (6), where the nucleic acid released from the support is detected. The column containing the cotton thread and about 60 cm of microtube (3) arriving at the column are placed in a thermostatically controlled bath (4).

 For this example, the hybridization according to the method of the invention was carried out with 5 'fluorescein-labeled single-stranded nucleic acid fragments from a subject. This DNA does not carry a mutation in this region.

These 5 'fluorescein labeled single-stranded nucleic acid fragments were prepared as follows
A polymerase chain reaction (PCR) with primers flanking the region of exon 11 to be analyzed is carried out on human genomic DNA
5'GATTGAGCATACTAAAAGTGACTCTCTAATTTTCTATTTTTGGTAATAG
GAC ATC TCC AAG TIT GCA GAG AAA GAC AAT GTT CTT GGA GAA
Asp Fle Ser Lys Phe Ala Asp Glu Lys Asp Asn 11th Val Leu Gly Glu

<tb><SEP> Mutations <SEP> of the <SEP> CTG-Mutations <SEP> of the <SEP> codon <SEP> 549 <SEP>: <SEP> S549R, <SEP> S549N, <SEP> S549I
<tb> GGT <SEP> GGA <SEP> ATC <SEP> ACA <SEP> CTGt1GGA <SEP> GGT <SEP> CAA <SEP> CGA <SEP> GCA <SEP> AGAATlrCTTT
<tb> Gly <SEP> Gly <SEP> Ile <SEP> Thr <SEP> Leu <SEP> Ser <SEP> Gly <SEP> Gly <SEP> Gln <SEP> Arg <SEP> Ala
<tb> AGCAAGGTGAATAACTAATTATTGGTCTAGCAAGCATTTGCTGTAAATG
TCATTCATGTAAAAAAATTACAGACATTTCTCTATGCTTTATA3 '
This first PCR is carried out with 1250 ng / ml of DNA, 1250 pmol / ml of primers and 6.25 U / ml of Taq polymerase enzyme.

A second PCR is performed on a product fraction from the first PCR, with one of the primers carrying a 5 'biotin. This second
PCR is performed with 50 μl / ml of the first PCR products, 125 pmole / ml of primers and 6.25 U / ml of Taq polymerase enzyme.

 The product of this second PCR is brought into contact for 15 minutes while stirring with "Dynabeads M280 streptavidin" beads marketed by the Dynal Company. 50 l of Dynabeads are washed four times with 50 l of 0.1% BSA PBS buffer, then 50 μl of 1 × B & W buffer and 50 μl of the products of the second PCR are added. It is stirred slowly for 15 minutes (vortex) and the supernatant is removed. 50 l of 0.1 N NaOH are then added, the mixture is stirred slowly for 10 minutes and the supernatant is removed. The beads are washed with B & W 1X twice.

B & W 2X: 10 mM Tris HCl (pH 7.5); 1 mM EDTA
2M NaCl.

 PBS 10X pH 7.4: 0.58M Na2HPO4; 0.17 M Na2H2PO4; 0.68 M NaCl.

The beads are washed twice with 50 l of 1 × radom mix buffer, and the reaction mixture of the following random priming is then added to the beads.
hexameter FTC (0.3mg: ml) 7 7 tLl
Mix random 10 X: 2 l
. dATP (1 mM): 1 l
. dTTP (1 mM): 1 l
. dGTP (1 mM): 1 l
. dCTP (1 mM): 1 l
. Klenow (2.5 U / l): 2 l
. H2O QSP 20 l: 5 l
After incubation for 2 hours at 37 ° C., the supernatant is removed, the beads are washed twice with BxIx, denatured with 50 l of 0.1 N NaOH for 10 minutes at room temperature, and the mixture is washed for 10 minutes with 25 l. 0.1 N NaOH. The supernatants are pooled and neutralized with 30 μl of 0.2 N HCl and 10 × SSPE 5 × are added.

 This neutralized DNA solution is diluted in 300 microliters of 5X SSPE.

The process was then carried out as follows:
Hybridization is carried out by contacting the cotton yarn bearing the oligonucleotide FCE93 with the 5 'fluorescein-labeled single-stranded DNA solution in an eppendorf-type tube. This hybridization is carried out at room temperature for 1 hour. Rapid washing in the tube is then carried out with 2 times 1 ml of SSPE 5X, then the column containing the wire is installed in the device of Figure 1 and the peristaltic pump is started. The temperature gradient is started when the level of fluorescence approaches the baseline, this corresponds to the passage of 5 to 10 ml of washing solution.

 - Washing solution: SSPE 5X.

 - Solution flow measured at 300C with water: 1 ml / min.

 - Temperature gradient: 280C to 550C in 15 minutes, as shown in the graph of Figure 5.

 - Dead volume of the whole (input / output): about 1.5 ml.

 - Fluorescence detector set excitation at 495 nm and emission at 520 nm at 1000X sensitivity.

The probe hybridises perfectly with the oligonucleotide FCE93 on the membrane
Cellulose --3'- GACTCACCT - Acridine 5 '5'Fluo -XXXXXXXMkTCACA CTGAGTGGA GGTXDXXX - 3'
The graph of FIG. 5 represents the denaturation profile of the wild-type single wild-type genomic DNA after hybridization on the column. It is seen from the graph of FIG. 5 that an elution peak of the DNA is obtained at a 44.5 ° C, which confirms the interest of the process of the invention.

Claims (14)

 A method of nucleic acid analysis comprising contacting said nucleic acids with supported oligonucleotides to form hybridization complexes, characterized in that said hybridization complexes are subjected to denaturation gradient and in that one detects and analyzes by any suitable means the nucleic acids released from the support as the denaturation gradient.  2) Method according to claim 1, characterized in that it comprises the following steps  contacting the single-stranded nucleic acids to be tested with a support to which oligonucleotides are attached under weak denaturing conditions so as to carry out the hybridization of the nucleic acids to be tested with the majority of the oligonucleotides of the support,  optionally, one or more washings to eliminate unhybridized nucleic acids,  the exposure of the support to a denaturation gradient ensuring the progressive release of the nucleic acids of the support as a function of the level of pairing of each nucleic acid with an oligonucleotide fixed on the support,  detection and analysis by any appropriate means of the nucleic acids released from said support as the denaturation gradient progresses.  3) Process according to any one of claims 1 and 2, characterized in that the oligonucleotides attached to the support are identical sequences and lengths.  4) Process according to any one of claims 1 and 2, characterized in that all or part of the oligonucleotides attached to the support are of different lengths and sequences.  5) Method according to claim 4, characterized in that the oligonucleotides attached to the support are of identical length and different sequences so as to cover all the possibilities of sequences for this length.  6) Process according to any one of claims 4 and 5, characterized in that it comprises a prior step of calibration of the Tm of each different oligonucleotide.  7) Method according to any one of the preceding claims, characterized in that the gradient to which the support carrying the hybridization complexes is subjected is selected from the gradients of temperature, ionic strength, denaturing agent.  8) Method according to any one of the preceding claims, characterized in that the nucleic acids analyzed are DNA or RNA sequences or sequences comprising or consisting of modified nucleosides, labeled with a radioactive tracer, fluorescent, enzymatic or immunoassay.  9) Process according to any one of the preceding claims, characterized in that the support on which the oligonucleotides are attached has a shape and consists of a material allowing  to synthesize or fix after synthesis said oligonucleotides  exposing said oligonucleotides to the hybridization solution and the hybridization complexes formed in the washing solution as well as to the denaturation gradient,  to release the nucleic acids separated from the hybridization complexes.  10) Method according to any one of the preceding claims, characterized in that the support is selected from beads, fibers, son or filaments, one or more membranes, placed in a column or in a liquid vein, which after loading with the hybridization solution is washed and then subjected to a denaturation gradient, so as to detect as and when leaving the column or the vein, the nucleic acids released from the support.  11) Device for carrying out a method according to any one of the preceding claims, characterized in that it is in the form of a stick the size of a pen or a brush, comprising at least one of its ends a support on which the oligonucleotides are attached, said support consisting of a movable ball, or filaments, or a buffer.  12) A method for analyzing single-stranded nucleic acids using a device according to claim 11, characterized in that it comprises the following steps  contacting an end of the device with a hybridization solution containing the nucleic acids to be analyzed, for a time sufficient to allow the formation of hybridization complexes between the analyzed nucleic acids and the oligonucleotides fixed on the support to be analyzed. the end of the device,  the optional washing of said support in order to eliminate the unreacted nucleic acids,  contacting and displacing the support carrying the hybridization complexes on a flat solid element subjected to a denaturation gradient, so as to release and deposit the nucleic acids on said flat element as the support moves on the denaturation gradient,  detection and analysis of the nucleic acids deposited on the flat element.  13) Device according to claim 11, characterized in that it comprises a denaturation gradient system at the support, for releasing the nucleic acids of said support as the progress of said denaturation gradient.  14) Device according to one of claims 11 or 13, characterized in that it comprises one or more cartridges opening on the support, said cartridges containing the hybridization solution and optionally a washing solution, and pressure means allowing to first bring the hybridization solution in contact with the support to allow the formation of hybridization complexes, then the washing solution.