FR2749308A1 - NUCLEOTID PROBES AND METHOD FOR DETERMINING THE HLA DQB1 TYPING - Google Patents

Abstract

Nucleotide probe selected in particular among the following: TG <u>CGT TAT GTG ACC AGA</u>, GT<u>G CGT CTT GTG ACC AGA</u>, GT <u>CTT GTA ACC AGA CAC</u> AT, CG<u>T CTT GTA ACC AGA TAC</u> AT, CG<u>T CTT GTG AGC AGA AGC</u> AT, CG <u>ACC GAG CTC GTG CGG CG</u>T G, G T<u>AC CGG GCA GTG AC</u>G C, G A<u>CG CCG CTG GGI CCG CCT G</u>, G A<u>CG CCG CTG GGG CCG CCT G</u>, G G<u>AG GGI ACC CIG GCI GA</u>G T, G G<u>AG GGG ACC CGG GCG GA</u>G T, TC<u>G GTG GAC ACC GTA TGC AG</u>A C, GG <u>ACG GAG CGC GTG </u>CG, C <u>ATC TAT AAC CGA GA</u>, and their complementary sequences, being understood that the said probes have at least the underlined sequence, and can further contain one or two bases selected, respecting the sequence continuity, among the non-underlined bases. These probes are useful for determining a person's HLA DQ beta genotype. They have in particular the advantage of being useable at a single hybridization temperature, in particular 37 DEG C.

Description

The present invention relates to a method, probes and kits for determining the HLA DQ beta (DQB) genotype of an individual.

The methods, probes and kits of the invention relate more particularly to the detection of polymorphic HLA DQB i genes. These method, probes and kits of the invention are particularly applicable to HLA typing in transplantation, medical diagnosis, forensic medicine, but the presence or absence of EA DQBI alleles can also serve as an indicator of the sensitivity to certain types. diseases, such as insulin-dependent diabetes.

The HLA (human lymphocyte antigen) system is encoded by the major histocompatibility complex in humans. It constitutes a very important constraint during organ transplants between individuals by making a distinction between self and non-self. WA system antigens have therefore been used in typing methods to determine donor-recipient characteristics during organ transplants, as well as an individual's predisposition to certain diseases.

From a genetic point of view, the HLA system is well characterized and consists of a set of more or less polymorphic loci located in an interval of about 2 centimorgans on the short arm of chromosome 6. Three loci in this system (HLA- A, B and C) encode a class of alloantigens expressed in a co-dominant manner (Class I). Another region (HLA-D) which in fact contains several genes encodes a second class of alloantigens expressed in a co-dominant manner with a significant degree of polymorphism (Class II).

Several other loci which control in particular the components C 2, C 4 and factor Bf of the complement cascade also belong to the HLA system (Class III). The success of organ transplants depends to a large extent on the HLA (Class I and II) identity between recipient and donor. Consequently, the fILA typing must be as exact as possible. This need mainly concerns kidney transplants and bone marrow transplants. In the context of bone marrow transplantation, the perfect identity at the level of HLA Class II antigens represents a determining factor for the success of the transplant, that is to say to avoid a rejection of the transplant or the development of a disease. graft versus host.

The polymorphism of the expression products of the HLA-D region genes was usually defined by serological techniques based on the analysis by allo-antisera of the products of the HLA genes expressed on the surface of the cells. However, even under the best conditions, a large number of existing alleles are not detectable by these serological techniques.

Polymorphisms at the HLA DQBI locus were detected using serologic typing reagents that define DQ specificities w1, 2, 3 and 4 (WHO
Nomenclature Committee, 1990). DQ wl specificity was then subdivided into DQ wS and 6 serological subtypes, and DQ w3 was subdivided into DQ w7, 8 and 9. However, with the serotyping techniques used routinely, only DQ wl, DQ specificities w2 and
DQ w3 can be distinguished.

Thanks to molecular biology, we now know that there are more HLA genes than previously assumed and, above all, many more different alleles.

This diversity is now characterized at the level of the DNA sequences of the various genes and alleles. The structures, sequences and polymorphisms known in the HLA-D region have been listed by TROWSDALE et al., 1985. Immunol. Rev. 85: 5-43.

Genotypic analysis is a new approach for analyzing the diversity of the HLA Class II system, and in particular HLADQ, directly at the gene level.

Genotypic analysis is based on the principle of molecular hybridization and the first approach which was proposed is the so-called "RFLP" technique which consists in fragmenting the DNA by use of restriction enzymes and in analyzing the size of the fragments obtained. ; see, for example, U.S. Patent 4,582,788.

The RFLP approach can be used for the identification of 7 DQ specificities. However, RFLP analysis can only recognize some of the allelic differences undetectable by serology, and the possibilities offered by this technique are limited. Indeed, an allele is identifiable only if the mutation which characterizes it is located in the recognition site of the restriction enzyme used and thus a large number of alleles are not recognized by this analysis. In addition, RFLP analysis rarely demonstrates a change in a coding sequence and does not provide information on the exact nature of the change. Finally, this technique is long and difficult to implement.

Another technique for genotypic analysis of HLA Class II has been proposed, which is the so-called “oligonucleotide typing” method: thanks to the knowledge of the DNA sequences of the HLA Class II genes and in particular of the DQ B genes, it is possible to uses as tracers for the analysis of the polymorphism of oligonucleotides which hybridize specifically at a given site of the gene sequence. These oligonucleotides are chosen so that their hybridization or their absence of hybridization provides the greatest possible amount of information and allows the identification of the various alleles, on the basis of their differences in sequence. Any difference in sequence, even those relating to a single nucleotide, must be able to be detected.

The oligonucleotide typing technique can be applied to DNA as well, as described in the publication by ANGELINI et al. Proc. Nat. Acad. Sci. USA vol. 83: 44894493 (1986), than with RNA (see C. UCLA, J. J. VAN ROOD, J. GORSKI, B. MACH (1987) J.

Clin. Invest. 80, 1155).

Nucleic acid amplification methods, such as PCR, have facilitated the analysis of an individual's HLA Class II DNA. The first oligonucleotide typing application for HLA Class II was presented by ANGELINI et al in the previously cited publication, with use of the so-called "SOUTHERN" technique according to which the target DNA is deposited on a nylon membrane and the detection is carried out using a labeled oligonucleotide probe. The technique was then applied to the detection of HLA alleles
Class II not identifiable by routine serology (See JM TIERCY, J. GORSKI, M.

JEANNET and B. MACH (1988) Proc. Natl. Acad Sci. USA 85, 198 and J.M. TIERCY, J.

GORSKI, H. BETUEL, AC FREIDEL, L. GEBUHRER, M. JEANNET and B. MACH (1989)
Human Immunol. 24, 1). Another direct application to HLA Class II typing is that described in PCT patent application WO 89/11547 using the so-called “Dot Blot” technique. The so-called "Reverse Dot" method, which consists in fixing a nucleotide probe on a paper or nitrocellulose membrane and in carrying out the detection of a hybridization with a labeled target, was applied to the HLA DQ A typing and to the detection. mutations in Mediterranean beta-thalassemia (RKSAIKI et al. Proc. Nat. Acad. Sci. USA vol: 86, p. 6230-6234; (1989)).

Cell typing requires the detection of point mutations in the genome and involves the development of probes sensitive enough to detect and differentiate homologous sequences down to one nucleotide. Short probes are used for this, generally less than 30 nucleotides, which give the test high specificity, while retaining good sensitivity. The use of oligonucleotides of short size makes it possible to have a wide range of selectivity.

Moreover, it is desirable to develop a typing method which not only has great specificity and good sensitivity, but which is also simple to implement, to perform quickly, inexpensively and easily automate.

The present invention relates to a method, as well as probes and kits for HLA DQB 1 typing which meet these requirements.

The method of the invention can be used to type heterozygous samples of various origins, including cDNA templates, and can be used to detect allelic variants which cannot be distinguished by conventional serological methods.

The probes of the invention which will be defined below can be used in the form of detection probes (labeled with a usual tracing agent) in techniques of the type
Southern, or, preferably, in the form of capture probes (Sandwich technique or
Reverse Dot Blot) immobilized on a solid support.

The typing system of the present invention preferably uses the so-called "sandwich" protocol, as originally described by DUNN AR, HASSEL JA (Cell, 12, 23, 1977) and which consists in using a first nucleotide probe, called capture probe, fixed on a solid support, and specific for the target gene of the sample, as well as a second probe, labeled, called detection probe, complementary to another region of the target and allowing the detection of hybridization by visualization using the marker. In the system of the present invention, the label is for example an enzyme such as horseradish peroxidase, it being understood that any other suitable label can be used.

The method of the invention is based on the selection of oligonucleotide probes whose length and composition have been chosen not only to give them the necessary specificity and sensitivity, but also so as to allow their use at a determined temperature. Thus, the typing system of the present invention has the particular advantage of making it possible to operate at a single temperature of 37 "C + 20C.

It is however obvious that, even in the case of probes intended to detect point mutations at a given temperature, it is possible to envisage the use of probes whose length can vary to a certain extent, thanks in particular to the 'use of buffer solutions favoring more or less the stability of the hybridization complexes. The probes of the invention are therefore defined by a sequence whose length can generally be considered as maximum, in particular if it is desired to work at a temperature of around 37 "C, but different from 37" C (which is often the case in practical taking into account temperature calibration errors), with the addition of the indication of an optimum sequence for a temperature of 37 "C.

It is obvious to those skilled in the art that each particular oligonucleotide probe corresponds to a complementary probe which, of course, is capable of playing the same role as a capture or detection probe. The invention therefore extends to probes having a sequence complementary to that of the probes described below, and to methods using these complements.

The subject of the invention is probes having a nucleotide sequence chosen to meet the aforementioned requirements. More particularly, the present invention relates to new probes, the combined use of which makes it possible to discriminate between different alleles and even to identify, if necessary, the different HLA DQ specificities known to date (Nomenclature for factors of the HLA system, 1995, Bodmer Julia G et al. Tissue Antigens 1995, 46, 1-18).

The nucleotide probes of the invention are chosen in particular from those which are represented below (the sequence read from left to right goes from the 5 'end to the 3' end). The letters represent the nucleotides (or bases) according to the usual nomenclature. The underlined sequence represents the optimum sequence under the operating conditions recommended according to the invention. The probes therefore contain at least the underlined sequence, and can also contain one or two additional bases chosen from the non-underlined bases, that is to say, according to the cases (and while respecting of course the continuity of the sequence) , either one or two additional bases at the 5 'end, or one or two additional bases at the 3' end, or an additional base at the 5 'end and an additional base at the 3' end. in fact, it is possible to modify the length of the probes used as a function of the operating conditions which make it possible to vary the hybridization binding forces, such as the hybridization and washing temperatures, and the nature of the buffers of hybridization and / or washing. The introduction into the probes of modified bases (for example inosine) can play a similar role. The probes of the invention are chosen in particular from the following (for each probe, the recognized specificities have been indicated)
TG CGT TAT GTG ACC AGA (26B), which recognizes the specific features of DQBI 06011, 06012, 0301, 0304,
GTG CGT CTT GTG ACC AGA (26C): specificities DQB1 0602, 0302, 03032
GT CTT GTA ACC AGA CAC AT (26D): specificities DQBI 0603, 0604, 0607, 0608,
CGT CTT GTA ACC AGA TAC AT (26F): specificities DRQBI 06051, 06052, 0606 and 0609,
CGT CTT GTG AGC AGA AGC AT (26E): specificities 0201,0202,
GG ACC GAG CTC GTG CGG GGT G (23A): specificity DQB1 0401,
G TAC CGG GCA GTG ACG C (49A): specificity DQB1 0501,
G ACG CCG CTG GGI CCG CCT G (55A): specificities DQB1 0301, 0302, 03032, 0304, 0305,
G ACG CCG CTG GGG CCG CCT G (55'A): specificities DQB1 0301, 0302, 03032, 0304, 0305,
G GAG GGI ACC CIG GCI GAG T (70A): specificities DQB1 0602, 0603, 0608,
G GAG GGG ACC CGG GCG GAG T (70'A): specificities DQBI 0602, 0603, 0608,
TCG GTG GAC ACC GTA TGC AGA C (70B): specificities DQB1 0401.0402.

Of course, the distinction between certain specificities can be made, if desired, using other probes used as additional probes, as easily shown by examination of the attached Tables 1 and 2.

The new probes of the invention also include the HRP I and HRP 2 probes which will be defined below.

In the sequences of the oligonucleotide probes described above, I symbolizes inosine. Inosine is an unnatural nucleotide used in certain probes of the invention, to increase the discriminating power of a probe by further destabilizing the hybrids formed by this probe with nucleic acid sequences not strictly identical to that of the target sought in the sample with this probe.

In the description of the present application, the arbitrary designations comprising a number followed by a letter, such as 23A, 26A, 26B, etc., or letters followed by a number (such as HRP 1), generally designate all the probes thus defined (those comprising only the underlined sequence and those further comprising one or two additional non-underlined bases), except in the experimental part below and in the appended tables where these names designate only the probes having the optimal underlined sequence.

A subject of the present invention is also a method for at least partially determining the DQB 1 typing of a nucleic acid present in a sample, in which hybridization tests are carried out, according to known methods, of said nucleic acid of the sample. with oligonucleotide probes, and in which the tests for which hybridization is actually observed at a single temperature equal to 37 + 2 C are retained as positive tests, said oligonucleotide probes comprising at least one probe chosen from the group consisting of
TG CGT TAT GTG ACC AGA (26B),
GTG CGT CTT GTG ACC AGA (26C),
GT CTT GTA ACC AGA CAC AT (26D),
CGT CTT GTA ACC AGA TAC AT (26F),
CGT CTT GTG AGC AGA AGC AT (26E),
GG ACC GAG CTC GTG CGG GGT G (23 A),
G TAC CGG GCA GTG ACG C (49A),
G ACG CCG CTG GGI CCG CCT G (55A),
G GAG GGI ACC CIG GCl GAG T (70A), TCG GTG GAC ACC GTA TGC AGA C (70B),
or their complementaries, it being understood that said probes contain at least the underlined sequence and can also contain one or two additional bases chosen, while respecting the continuity of the sequence, from the non-underlined bases.

The invention also relates to a method as defined above, in which further tests are carried out for hybridization of the nucleic acid of the sample with at least one of the following probes
ACC AGA CAC ATC TAT AAC CG (26A), recognized DQBI specificities: 0501, 0502, 05031, 05032, 0603, 0604, 0607, 0608,
GG CCT GTT GCC GAG TAC T (57A), recognized DQBI specificities: 0501, 0604, 06051, 0606, 0608, 0609,
CGG CCT AGC GCC GAG TAC T (57B), DQB1 specificities recognized: 0502, 0504,
CGG CCT GAT GCC GAG TAC (57C); DQBI specificities recognized: 05032, 0602, 0603, 0607, and possibly
GC GAC GTG GAG GTG TAC CG (45A), recognized DQBI specificities: 0301, 0304,
A GAG GAG GAC GTG CGC TT (37A), DQB1 specificities recognized: 06011, 06012, or their complementaries.

Of course, the tests retained as positive are also those indicated above.

In the method of the invention, the hybridization conditions used are obviously predetermined conditions such that hybridization with each probe only occurs, at the single temperature chosen, if the target contains a sequence perfectly complementary to that of said probe. These conditions can be determined by simple routine experiments. The target is of course the nucleic acid present in the sample and containing polymorphic regions of HLA DQ genes of an individual.

Those skilled in the art will easily understand that the various probes which can be used in the method of the invention can be, depending on the techniques chosen, either labeled probes, or probes coupled to a ligand intended to facilitate their attachment to a solid support, or else probes. already fixed on a solid support. In particular, the probes can be either immobilized or immobilized, according to known methods, on solid supports, and can then be used as capture probes.

According to a particular embodiment, the hybridization tests are carried out using the probes indicated above as capture probes, that is to say fixed to a solid support.

To reveal the possible presence of nucleic acid, fixed on the solid support by hybridization with a given capture probe, it is possible to use a labeled detection probe capable of hybridizing with a region of the target other than that recognized by said probe. capture. Detection probes chosen from among the following can be used in particular (the underlined part corresponds as previously to the minimum sequence)
GG ACG GAG CGC GTG CG (HRP1),
C ATC TAT AAC CGA GA (HRP2),
CGC TTC GAC AGC GAC GTG G (HRP3).

Examination of the appended Table I makes it possible to easily determine which, among these detection probes, can be used with a given capture probe.

According to the method of the invention, the identification of an allele can be deduced from a binding model of a set of probes, each individual probe of the set being specific for different parts of the HLA DQ gene. Thanks to the choice of several probes, the oligonucleotide typing method of the present invention makes it possible to identify, if desired, all the DQB 1 alleles. In the event that new alleles are discovered, these would then be listed in an HLA Class sequence register. II, making it possible to update the collection of specific probes using additional probes, and therefore to adapt the methodology to the detection of any new allele.

To rationalize the complete HLA Class II typing, we can first of all perform a first DQB typing step, which makes it possible, with a determined number of probes, to identify the main HLA DQB specificities.

This step is often sufficient for a large number of clinical applications.

However, the present invention also allows a second step of DQB typing which, with a larger number of probes, makes it possible to recognize all the HLA DQB specificities known to date.

Analysis of HLA DQB specificities by the oligonucleotide typing technique of the present invention can be applied in histocompatibility laboratories for routine DQB typing, replacing serology, in particular for performing typing.
DQB of patients on the waiting list for a kidney transplant or the typing of potential kidney donors, the DQB typing of leukemia patients, for whom a bone marrow transplant is considered, as well as the typing of their family members or donors unrelated potentials, large-scale DQB typing for building voluntary bone marrow donor registries, or for determining associations between diseases and the HLA system, for example in insulin-dependent diabetes, for applications in medicine predictive or for paternity searches and other forensic identifications.

Any type of tissue containing FILA DQB nucleic acid can be used as a sample in the method of the invention. It is also possible to use fragments of nucleic acids (DNA or RNA) obtained after chemical, enzymatic or analog cleavage of the nucleic acid present in a sample. However, in practice, a preliminary step of amplifying the DNA or the RNA must be carried out.

A subject of the invention is also a kit for the HLA DQB1 typing of an individual, said kit comprising at least one of the following probes: 26B, 26C, 26D, 26F, 26E, 23A, 49A, 55A, 70A, 70B , HRP1 and HRP2, and may also contain one or more probes selected from 26A, 57B, 57C, 37A, 45A, 57A and HRP3.

The invention relates in particular to a kit comprising the following probes (in particular capture probes): 26B, 26C, 26D, 26E, 26F, 23A, 49A, 55A, 70A, 70B, 26A, 57B, 57C, 37A and optionally the at least one of the probes 45A and 57A. This kit can also contain one or more detection probes chosen from HRPI, HRP2 and HRP3.

The information collected through the use of these probes is then used to determine the typing based on an established typing plan, taking into account the probes used and knowledge of the HLA DQB types and / or associated subtypes listed. This work is simplified by the use of a typing plan, ie a table giving directly the types and / or sub types according to the positive responses (hybridizations) observed. For all the probes of the present invention, such a table is shown in Table 3 attached.

The probes used in the present invention are sequence specific oligonucleotides (OSS) which, under appropriate conditions, can bind specifically to their complementary sequence. If a particular probe can be used to identify only one allele, then the probe is called OSA, ie allele specific oligonucleotide.

As already noted previously, it is possible that a single probe alone will not be able to identify a specific DQ B allele.

Some definitions of terms used in the present application are given below:
"Genotypic" refers to the characteristics of the genome of an individual as opposed to the "phenotype" which is a characteristic of an individual as it emerges from the analysis of the expression products of genes, in particular proteins.

“Alléle” designates the various alternative forms of the same gene which exhibits differences at the level of the nucleic sequence. These differences are manifested in DNA, RNA and their translation into proteins.

"Polymorphism" characterizes the diversity introduced into a population by the existence of different alleles for the same gene.

"Oligonucleotide" as used herein refers to primers, probes or nucleic acid fragments to be detected ... Oligonucleotides can be prepared by any suitable known method.

In the present description and in the experimental part which follows, reference is made to the attached Tables 1 to 4. attention should be drawn to the fact that the same probe designation (such as 26A, HRP3, etc.) can designate not only a sequence making it possible to define several probes with indication of an underlined minimum sequence (such as c 'is the case in the description above), but also a sequence corresponding to the minimum sequence underlined (as is the case in the examples below and in Tables 1 to 4 appended).

The attached table 1 shows the DNA alignments of the various alleles of the DQB gene with the aim of defining the positions of the mutations corresponding to amino acid mutations (designated using the one-letter code) represented in Table 2, relative to the chosen consensus sequence, which is DQBI * 0501. DNA mutations can be non-silent mutations, ie mutations whose translation leads to an amino acid change.

In the case of typing the different alleles, we most often use the mutations on the DNA corresponding to the non-silent mutations, which are obviously the most important, but it is possible to detect a mutation of the silent type, for example with the aim of to differentiate two very close alleles.

Tables 1 and 2 show the nucleotide and amino acid alignments of the DQB I gene for all the alleles known and published in the literature known to date.

Table 3 appended summarizes the correspondence between the probes and the recognized specificities: when a box is blackened in a row, this means that the specificity mentioned in this row is recognized by the probe of the corresponding column.

The attached table 4 shows the correspondence between probe and specificities
HLA DQB 1 with further indication of silent mutations or variant amino acids.

The following examples illustrate the invention.

Erentple 1:
Various probes bound to a ligand have been prepared which promote their attachment to a solid support. The ligand used is a commercially available compound called Aminolink 2, and marketed by the company Applied Biosystems under the reference 400808.

The coupling of the ligand to an oligonucleotide is carried out according to the following general protocol
An oligonucleotide is synthesized on an automatic 381 A device from the company
Applied Biosystems using phosphoramidite chemistry according to manufacturer's protocol. The phosphoramidite ligand dissolved in anhydrous acetonitrile at a concentration of 0.2M is placed in the X position of the synthesizer and the addition of the ligand is done through the 5 'end of the oligonucleotide according to the standard protocol of automatic synthesis. when the synthesis of the oligonucleotide is complete.

After deprotection overnight at 550 ° C. in a 33% ammonia solution, followed by precipitation in ethanol at -20 ° C., the modified oligonucleotide (bound to the ligand) is dried under vacuum and taken up in 1 ml of 'water.

The oligonucleotide modified at its 5 'end is purified by reverse phase high performance liquid chromatography on a Brownlee RP 18 column (10 mm-25 cm).

Conditions: flow rate 4.6 ml / min
Gradient 10% to 35% Buffer A in 30 min.

35% to 100% buffer B in 3 min.

Buffer A: 0.1 molar Triethylammoniumacetate (TEAA), pH 7
Buffer B. 50% Buffer A + 50% CH3CN.

Eveniple 2: Prep

Example 3: Amplification of target DNA.

Amplification is carried out by PCR using the following primers
- primer 1: 5'C ATG TGC TAC TTC ACC AAC GG 3 '
- primer 2: 5 'CTG GTA GTT GTG TCT GCA CAC 3'
These primers are designated in Table 1 by the names DQBAMP-A and
DQBAMP-B.

Example 4:
In the wells of a microtiter plate (Nunc 43454) are deposited 100 l of a solution of a capture oligonucleotide of a given DQ specificity (at the rate of one capture oligonucleotide per well) at a concentration of 10 at 400 nM in 3x PBS (0.45
M NaCl, 0.15 M sodium phosphate, pH 7). As many wells are therefore used as there are capture probes necessary for the typing. The plates are incubated for 2 hours at 37 C or for 15 to 22 hours at room temperature.

In all cases, a positive control is added in order to verify the amplification step and the detection step. The capture probe that is used as a positive control (designated as
C +) is present on all alleles known to date. Its sequence is the following S'GAGTACTGG AACAGCCAGAAGGA3 '.

A capture probe is used as a negative control (designated as C-) and has the following sequence. 5 'TAT GAA ACT TAT GGG GAT AC 3'
The plate is washed three times with 300 µl of PBS Tween (0.15 M NaCl, 0.05 M sodium phosphate, pH 7; 0.5% Tween 20 (Merck 822184). The amplification product is denatured in 10 µl. of 2N NaOH for 5 min at room temperature. 10 μl of 2N acetic acid then 2.3 ml of hybridization buffer (PEG: 0.1M sodium phosphate, pH 7, 0.5M NaCl,
Tween 20 0.65%, DNA from salmon sperm (Sigma D 9156) 0.14 mg / ml, PEG 4000 (Merck 807490 2%) and 0.25 ml of a labeled detection probe (oligonucleotide peroxidase conjugate) are added successively to this solution. The final solution is distributed in each well at the rate of 0.1 ml per well. The plates are incubated for 60 min. at 370C. The plates are washed three times with 300 µl of PBS Tween. 100ol orthophenylenediamine (OPD) substrate (Cambridge Medical Biotechnology ref. 456) in buffer
OPD (0.05 M citric acid, 0.1 M Na2HP04, pH 4.9) at a concentration of 4 mg / ml, to which is added extemporaneously hydrogen peroxide at 30 volumes diluted to 1/1000, are added by well. After 20 min. reaction, the enzymatic activity is blocked by 100 µl of IN 2 SO 4 and the reading is taken at 492 nm.

example 5:
10 DNAs are amplified according to the PCR technique. Typing is then performed. The typing protocol generally conforms to that described above. Hybridizations are carried out according to the sandwich method.

The typing protocol uses the capture probes indicated below and, depending on the case, the HRPI, HRP2 or HRP3 detection probes.

The method described makes it possible to type the 10 DNAs tested. Some typing results are given below by way of illustration.

Case n "1
DO x 1000 probes (492 nm)
26A 15
49A 12
57B 38
57C 12
37A 12
26B 100
26C 1309
26D 10
26F 18
70A 32
26E
55A 316
70B 12
23A 13 **** means: saturation
Result: The patient is DQB1 * 0201 or 0202/0302 or 0303
Case n 2
DO x 1000 probes (492 nm)
26A 887 49A 12 57B 459 57C 11 37A 57 26B 80 26C 10 26D 14 26F 10 70A 14 26E 11 55A 11 70B 688 23A 302
Result: The patient is DQB1 * 0502/0401 Table 1

<tb><SEP> I <SEP>. <SEP>. <SEP>. <SEP>. <SEP>. <SEP>.-F; i. <SEP>, <SEP> I <SEP>! <SEP> I <SEP> i <SEP> i <SEP> i <SEP> I <SEP> i <SEP> ii
<tb><SEP> o <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP><<SEP> i <SEP> i <SEP> $ <SEP> i <SEP>! <SEP> 7 <SEP> i <SEP> i <SEP> i <SEP>
<tb><SEP> g <SEP> Wi <SEP> i <SEP> iiii <SEP> ~ <SEP> fil <SEP> i- <SEP> ii
<tb><SEP>'o<SEP> 20 <SEP> 30
<tb> III <SEP> AGA <SEP> GAC <SEP> Ta <SEP> i <SEP> GAG <SEP> GAT <SEP> TTC <SEP> GTG <SEP> TAC <SEP> CAG <SEP> TTT <SEP > AAG <SEP> i <SEP> TGC <SEP> TAC <SEP> | <SEP> ACG <SEP> GAG <SEP> CGC <SEP> GTG <SEP> CGT. <SEP> GTG <SEP> A <SEP> AGA <SEP> CAC <SEP> ATC <SEP> TAT <SEP> AAC <SEP> CGA
<tb> DQBI * 0S02 <SEP> -.------- <SEP> 26A
<tb> DQBI * 0S031 <SEP> w. <SEP> s <SEP> s
<tb> S <SEP>. <SEP> O <<SEP> i <SEP>i;<SEP> É) GGÉÈ <SEP> T
<tb> o <SEP> - <SEP>; I1
DQI'O5OII <SEP> i <SEP> a <SEP> ~~~~ <SEP> iX <SEP> i
<tb><SEP> 26B
<tb> ZIZI <SEP> C <SEP> A <SEP> --T <SEP> -. <SEP> T
<tb> DQBi <SEP>'0602<SEP> A <SEP> 26C <SEP> --T <SEP> a <SEP> -A - I -----
<tb>DQAI'0003<SEP> A <SEP> --T <SEP> a <SEP> -A <SEP> -.
<tb>

DQBI'O6O4 <SEP> A <SEP> - <SEP> --T <SEP> a <SEP> --A <SEP>
<tb>DQSI'O6O.'I<SEP> A <SEP> -. <SEP> T <SEP>
<tb>DQ9I'o6O.<SEP> z <SEP> z <SEP> zz <SEP> -. <SEP> z <SEP> | 6 <SEP> 6 <SEP>><SEP> 2 <SEP> a
<tb> 0 <SEP> Z <SEP> F <SEP> F <SEP> e <SEP>><SEP> A <SEP> Lw <SEP> T <SEP> the <SEP> e <SEP>
<tb> s ~ <SEP> A <SEP> -. <SEP> 26D - T <SEP> a <SEP> -A <SEP> - <SEP>
<tb>DQBI'06O<SEP> A <SEP> -. <SEP> - <SEP> -T <SEP> a <SEP> -A <SEP> -. <SEP> 26A
<tb> Xi <SEP> i <SEP> -. <SEP> 2 <SEP> B <SEP> ~ r <SEP> i <SEP> 0 <SEP> Z <SEP> |
<tb> g <SEP> E <SEP> i <SEP>"<SEP> é <SEP> i <SEP> |
<tb> i! iiiiiiiiiiiiii
<tb>DQBI'030I<SEP> -. <SEP> C <SEP> A <SEP> - <SEP> 26B <SEP> -T <SEP> TA
<tb>DQBl'0302<SEP> - <SEP> A- <SEP> -Ta <SEP> - <SEP> - <SEP> T <SEP> -. <SEP> - <SEP> - <SEP>
<tb><SEP> 26C
<tb> 21 <SEP><SEP>!<SEP> i <SEP> i <SEP>! <SEP>! <SEP> i <SEP> i <SEP> i <SEP> i <SEP> .5 <SEP>.: <SEP> i <SEP> I <SEP> i <SEP> i <SEP> I <SEP> I <SEP> i <SEP> i <SEP> i <SEP> I <SEP> i <SEP> i
<tb>e;<SEP>;<SEP> - <SEP> A <SEP> i <SEP> I <SEP>;<SEP> i <SEP> i <SEP> i <SEP> T <SEP> i <SEP> -. <SEP> .-- <SEP> -
<tb> DQBIO2 <SEP> i <SEP> i <SEP> i <SEP> i-. <SEP> i, <SEP> i <SEP> i <SEP> i <SEP> i: <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i, <SEP> i
<tb><SEP> L! <SEP> 1 t <SEP><<SEP><<SEP><<SEP><<SEP><<SEP><<SEP><<SEP><<SEP><<SEP><<SEP><<SEP><<SEP><<SEP><
<tb><SEP> E <SEP> i <SEP> i <SEP> Z <SEP>! <SEP> i <SEP> i <SEP> i <SEP> i <SEP>! <SEP>. <SEP>. <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i, <SEP> i <SEP>"<SEP>"
<tb><SEP> W <;;<SEP>!<SEP> EJ <SEP>. <SEP> é <SEP> g <SEP> i <SEP> i <SEP>. <SEP>! <SEP> i <SEP> E <SEP> i <SEP> i <SEP> é <SEP> é
<tb><SEP> R <SEP> R <SEP> R <SEP> R <SEP> R <SEP><SEP> oe <SEP> eo <SEP> Fo <SEP> o, <SEP>> o, <SEP><SEP> Fo <SEP> o <SEP> XoO <SEP> o <SEP> 2 <SEP> 2 <SEP> R <SEP> e <SEP> R <SEP><SEP><SEP><SEP>
<tb><SEP> F <SEP> F <SEP> P <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP> iF
<tb><SEP> g <SEP> m <SEP> m <SEP> m <SEP> m <SEP> m <SEP> m <SEP> m <SEP> m <SEP> m <SEP> m <SEP> m <SEP> m <SEP> m <SEP> m <SEP> g <SEP> g <SEP> g <SEP> g <SEP> g <SEP> g <SEP> g <SEP> g
<tb> Table 1 - continued -

<tb><SEP> 5 <SEP> 1 <SEP>: <SEP> 57A
<tb> 5 <SEP> O <SEP> G <SEP> GAG <SEP> TAC <SEP> y <SEP> COC <SEP> | <SEP> OAC <SEP> GTO <SEP> 000 <SEP> aTO <SEP> C <SEP> CaO <SEP>, <SEP> OTO <SEP> AC <SEP> CCG <SEP> CAG <SEP> CCT <SEP > OTT <SEP> Oc <SEP> C <SEP> T <SEP> TOc <SEP> AAC <SEP> AOC <SEP> CAO <SEP> AAO <SEP> O <SEP> GTC <SEP> ao
<tb><<SEP> i <SEP> i: <SEP> t <SEP> t <SEP> t <SEP> i <SEP> i <SEP> i <SEP> I <SEP> t <SEP> i <SEP>.<SEP>!:<SEP> i <SEP> i <SEP> i <SEP> I <SEP> i <SEP>l;<SEP> i <SEP> I
<tb> DQBI.o3031 <SEP> - <SEP> - <SEP> -T <SEP> -G <SEP> AC <SEP>
<tb> DOS! <SEP> * 03032 <SEP> - <SEP> T <SEP> --- <SEP> 5? C
<tb> DQBI * 06OII <SEP> G-. <SEP> - <SEP> -T <SEP> --G <SEP> - <SEP> -AC <SEP> - <SEP>
<tb> DQBI <SEP> t <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP > i:
<tb><SEP> J <SEP> Iol
<tb><SEP> 5 <SEP>, <SEP> F <SEP> ~ <SEP> i <SEP>. <SEP> t <SEP> i <SEP> t <SEP> C <SEP> AC <SEP> | <SEP> i <SEP> - <SEP><<SEP> i <SEP> | <SEP> A <SEP> t
<tb> DOSIO2 <SEP> C- <SEP> -. <SEP> -C <SEP> - <SEP> - <SEP> A
<tb> DOS! * 0504 <SEP> C- <SEP> - <SEP> - <SEP> -G <SEP> 57A <SEP> - <SEP>
<tb> DOB! w) 603 <SEP> -C <SEP> --C <SEP> --G <SEP> 57c <SEP> --- <SEP>
<tb> DOB! * 050 <SEP> i <SEP> ... <SEP> i <SEP> i <SEP> t <SEP> --- <SEP> - <SEP> t <SEP> t <SEP > i <SEP> t <SEP> i <SEP> I <SEP> i
<tb> DOI * 05O9 <SEP>. <SEP>. <SEP> G <SEP> - <SEP> 5? A <SEP>
<tb> DQSI * 0201 <SEP> AT <SEP> -A <SEP> -T <SEP> z <SEP> z <SEP> g <SEP> i <SEP> CC <SEP>;<SEP> 4 <SEP>! <SEP> i <SEP> w <SEP> 9 <SEP> y <SEP> ti <SEP>;<SEP> tt
<tb> DOS! * 0202 <SEP> AT <SEP> i <SEP> CC <SEP> i <SEP> i <SEP> --- <SEP>! <SEP> i <SEP> t <SEP> t <SEP> é <SEP>
<tb> DOB! * 0304 <SEP> CA <SEP> - <SEP> - <SEP> - <SEP> 5A <SEP> - <SEP> -. <SEP> c <SEP> 5A <SEP>
DOBI * 030I <SEP> A <SEP> 0 <SEP> n <SEP> - ~~~~~ <SEP> the <SEP> v <SEP> w <SEP> w <SEP> w <SEP> v <SEP >;<SEP> s
<tb><SEP> DOBI * 0302 <SEP>! <SEP>! <SEP> i <SEP> i <SEP>} <SEP> t <SEP> i <SEP> I <SEP> t <SEP> i <SEP> i <SEP> i
<tb> DOBI * 03032 <SEP> -CA <SEP> - <SEP> T <SEP> --- <SEP> c <SEP>: <SEP> -.
<tb>

DOBI * 0303 <SEP> C <SEP> T <SEP> - <SEP> c <SEP> - <SEP> C- <SEP> C <SEP> - <SEP> -.
<tb>

<SEP> iiiii <SEP> C- <SEP> - <SEP> i <SEP> S <SEP> 0 <SEP> i <SEP> i <SEP> é <SEP> T- <SEP> é <SEP> é <SEP> é <SEP> é <SEP> é <SEP> é <SEP> é <SEP> é
<tb>'<SEP> C- <SEP>'<SEP> - <SEP> é <SEP> - <SEP> é <SEP> - <SEP> T <SEP> E <SEP> s <SEP > T- <SEP> E <SEP> s <SEP> -T- <SEP> -AC <SEP> s <SEP> - <SEP> - <SEP> - <SEP> -T <SEP> - <SEP> - <SEP> - <SEP> A- <SEP>
<tb><SEP> s <SEP> S <SEP> iD <SEP> i <SEP>;<SEP>;<SEP> i <SEP> i <SEP> i
<tb><SEP> 2 <SEP><SEP> LS <SEP> i <SEP>;;<SEP>;<SEP> i <SEP> i, <SEP> i <SEP>bl;<SEP> i <SEP> i <SEP> i
<tb><SEP><SEP> S <SEP> y <SEP> O <SEP> y <SEP> 7 <SEP> y <SEP> l <SEP><SEP> S <SEP> F <SEP> F <SEP>'<SEP>''.<SEP> F <SEP> 7 <SEP> Y <SEP> Y <SEP> Y <SEP> Y <SEP> Y <SEP> Y <SEP> Y <SEP> Y <SEP> Y
<tb><SEP> t} <SEP> i <SEP> i <SEP> i <SEP> i <SEP> 9, <SEP> 8 <SEP>. <SEP> i <SEP> i <SEP> W
<tb><SEP> s <SEP> g <SEP> Ie <SEP> e <SEP> E <SEP> e <SEP> e, <SEP> S <SEP> é <SEP> é <SEP> ~ <SEP > e <SEP> e. <SEP> ~ <SEP> e <SEP> e, <SEP> e
<tb><SEP> c <SEP><<<SEP> i <SEP> ii <SEP> i <SEP> iii
<tb><SEP><<SEP> i <SEP><<SEP> i <SEP> i <SEP> i
<tb><SEP><SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i
<tb><SEP> t <<SEP> g <SEP>! <SEP>. <SEP> i <SEP> i <SEP>. <SEP> i <SEP> i <SEP> i
<tb><SEP><SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> t <SEP>! <SEP> i <SEP> iW <SEP> i
<tb><SEP><SEP>!<SEP> i <SEP> i <SEP> i <SEP> i <SEP> Wi <SEP> i <SEP> i <SEP>: <SEP> i <SEP>} <SEP> i
<tb><SEP> 5 <SEP> QY <SEP> i <SEP>&verbar;<SEP> i <SEP> i <SEP> i <SEP> t <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i
<tb><SEP> t) <SEP> i <SEP>;<SEP> i <SEP> Z <SEP> i <SEP> i <SEP>! <SEP> i <SEP> i <SEP> i
<tb><SEP> O <SEP> E <SEP>. <SEP> Q <SEP>'J<SEP>'<SEP><;<SEP><<SEP><<SEP> y <SEP> tJ <SEP> 9 <SEP> 9
<tb><SEP><<SEP> jm <SEP>. <SEP>. <SEP> F <SEP> 1 <SEP>. <SEP> i <SEP> i
<tb><SEP> e <SEP> i <SEP> s
<tb><SEP>!<SEP>'<SEP>'<SEP><<SEP>><SEP>&verbar;<SEP> f <SEP> 0 <SEP>&verbar;<SEP>&verbar;<SEP> 2 <SEP>, <SEP>, <SEP>! <SEP> I <SEP>! <SEP>! <SEP>! <SEP>! <SEP>!
<tb><SEP> F <SEP> F <SEP> F <SEP> F <SEP><SEP> F <SEP> F <SEP> F <SEP> 3 <SEP> F <SEP> g <SEP> g <SEP> F <SEP> F <SEP> F <SEP> F <SEP> P <SEP> i <SEP><SEP> P <SEP> 33 <SEP> iF <SEP> 35
<tb><SEP> 8 <SEP> 8 <SEP> g <SEP> 8 <SEP> g <SEP> 8 <SEP> 8 <SEP> g <SEP> 8 <SEP> 8 <SEP> 8 <SEP> 8 <SEP> 8 <SEP> 8 <SEP> g <SEP> 8 <SEP> g <SEP> g <SEP> g <SEP> m <SEP> ID <SEP> m <SEP> m <SEP> m <SEP> m
<tb> Table 1 - continued -

<tb><SEP> i <SEP> i <SEP> i <SEP> i <SEP> ii <SEP> i <SEP>! <SEP> 1 <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP > i <SEP> i <SEP> i <SEP> i
<tb><SEP><SEP> y <SEP> I <SEP> 70 <SEP> CGG <SEP> i <SEP> TTC <SEP> i <SEP> I <SEP> BAMP-B <SEP> I <SEP > I <SEP>I;<SEP>!
<tb> y <SEP> i <SEP> t <SEP> 5 <SEP> OTO <SEP> TOC <SEP> AOA <SEP> CAC <SEP> AAC <SEP> TAC <SEP> OAO <SEP> GTG <SEP > 5 <SEP> TAC <SEP> t <SEP>! <SEP> i <SEP> CTG <SEP> i <SEP> AGG <SEP> AGA <SEP> OTO <SEP> r <SEP> i <SEP> I
<tb> 5 <SEP> i <SEP> i <SEP> E <SEP> E <SEP> r <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> 5
<tb> V <SEP> A <SEP> -
<tb> DOBI * 03032 <SEP> -
<tb> DOSI * 0304
<tb> DOBI * 06O11 <SEP> A <SEP> i <SEP> A <SEP>. <SEP> i <SEP> T <SEP> T <SEP> 5 <SEP> i <SEP> -
<tb> DOBI * 06O12 <SEP> A <SEP> A <SEP> A <SEP> i <SEP> 5CA <SEP> T <SEP> 5 <SEP> i
<tb> DOBI * 0602 <SEP> A <SEP> i <SEP> O <SEP> T <SEP> T <SEP> 5 <SEP> i <SEP> t) <SEP> t) <SEP> Ú <SEP > tl) <SEP>t;
<tb> DOBI0603 <SEP> A <SEP> i <SEP> C <SEP> T <SEP> 5, <SEP> T <SEP> U <SEP> U <SEP> ú <SEP> t <SEP> -
<tb> DOBI0604 <SEP> A <SEP> A <SEP> 70A <SEP> CA <SEP> T <SEP> G <SEP> - <SEP>
<tb> DOBî.O603I <SEP> A <SEP> A <SEP> GA <SEP> T <SEP> - <SEP> -
<tb> DOBI * 05032 <SEP> A <SEP> A <SEP> GA <SEP> T <SEP>
<tb><SEP> DOBI * 0606 <SEP> i <SEP> A <SEP>! <SEP> 5
<tb> DOBIC? <SEP> A <SEP> A <SEP> 5 <SEP> 5 <SEP> 5 <SEP> 5CA <SEP> T <SEP> Fe <SEP> Fe
<tb> CQBI0608 <SEP> A <SEP> O <SEP> T <SEP>
<tb> DQBI * 06O9 <SEP> A <SEP> A <SEP> 7OA <SEP> CA <SEP> T <SEP>
<tb> DOBI * O2OI <SEP> A <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> 5 <SEP> - <SEP> C <SEP> T <SEP> i <SEP> i <SEP> i <SEP> i <SEP> w <SEP> 9 <SEP> zzT <SEP> 9 <SEP> y <SEP> 3 <SEP> - <SEP>
<tb> DOBI * 02O2 <SEP> - <SEP> A <SEP> AAA <SEP> O <SEP> - <SEP> - <SEP> C <SEP> T <SEP> A <SEP> a <SEP> AC <SEP> C <SEP> T <SEP> C <SEP> C <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP>
<tb> O <SEP> i <SEP> i <SEP> A <SEP> CA <SEP> i <SEP> i <SEP> i <SEP> 5 <SEP> i <SEP> AC <SEP> 5 <SEP > i <SEP> i <SEP> r <SEP> i <SEP> 1 <SEP> y <SEP> y <SEP> y <SEP> 4 <SEP> y <SEP> y <SEP> y
<tb> Y <SEP> i <SEP> r <SEP> A <SEP> A <SEP> CA <SEP> T <SEP> 5 <SEP> i <SEP> --- <SEP> i <SEP> i <SEP>! <SEP> 5 <SEP> AC <SEP> 5 <SEP> T <SEP>! <SEP> i <SEP> i <SEP> i <SEP> i
<tb> F <SEP>! <SEP> 5 <SEP> 5 <SEP> é <SEP> A <SEP> A <SEP> OA <SEP> T <SEP>! <SEP> 5 <SEP> 5 <SEP> 5 <SEP> C <SEP> T <SEP> -A <SEP> a <SEP> AC <SEP> i <SEP> 1, <SEP> l, <SEP> b <SEP> b
<tb><SEP> i <SEP> A <SEP> A <SEP> OA <SEP> T <SEP> C <SEP> C <SEP> T <SEP> -A <SEP> a <SEP>'<SEP> AC <SEP> -. <SEP> C <SEP> zzT <SEP> S <SEP> zz <<SEP><
<tb> DQBI * 03O3 <SEP> - <SEP> A <SEP> A <SEP> OA <SEP> T <SEP> - <SEP> -C- <SEP> C <SEP> T <SEP> -A <SEP> a <SEP> - <SEP> AC <SEP> C <SEP> T <SEP> - <SEP> C- <SEP> C- <SEP> -
<tb> DQBO4O <SEP> - <SEP> - <SEP> CC <SEP> -A <SEP> - <SEP> - <SEP> C <SEP> T <SEP> -A <SEP> a <SEP> AC <SEP> C <SEP> T <SEP> - <SEP> C- <SEP> C
<tb><SEP> i <SEP> CC <SEP> 5 <SEP> 5 <SEP> i <SEP> T <SEP> í <SEP> i <SEP> i <SEP> i <SEP> 5 <SEP> 5 <SEP> zT <SEP> z5 <SEP>i;<SEP> Fe <SEP> -
<tb><SEP><SEP> 5 <SEP>5;<SEP>.<SEP> i <SEP> S <SEP> i <SEP> i <SEP> i5 <SEP> 5 <SEP>. <SEP>. <SEP> E <SEP> ú <SEP> ú <SEP> ú <SEP> u <SEP> tl <SEP> t) <SEP>t;<SEP> Q <SEP> tl}
<tb><SEP> F <<SEP> z <SEP> i <SEP> i <SEP> i <SEP> 5 <SEP> 5 <SEP>. <SEP>. <SEP>! <SEP>i;;<SEP> i <SEP>i;<SEP> I <SEP>{;
<tb><SEP><Y<SEP> Z <SEP>! <SEP> 5 <SEP> Z <SEP> Z <SEP> 5 <SEP> s <SEP> 5 <SEP> 3 <SEP> i <SEP> E
<tb><SEP> t0, <SEP> i <SEP>! <SEP> 5 <SEP> i <SEP> i <SEP> 5 <SEP> ≈ <SEP> 5 <SEP> 5 <SEP> i <SEP>
<tb><SEP> a <SEP>O;<SEP> i <SEP> Z <SEP> i <SEP> i <SEP> 5 <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP > e
<tb><SEP> 2 <SEP> Fa <SEP> i <SEP> i <SEP> 5 <SEP> s <SEP> X <SEP> t
<tb><SEP> ZC <SEP>Fo;;<SEP>5;<SEP>!<SEP> i <SEP> i <SEP> E <SEP> i <SEP>! <SEP> i <SEP> i <SEP> t <SEP> i <SEP>&verbar;<SEP><<SEP><
<tb><SEP> ~ <SEP><o<SEP> 5 <SEP> S <SEP> Y <SEP> Y <SEP> y <SEP> y <SEP> 9 <SEP> 9 <SEP> y <SEP > i <SEP> y <SEP> 9 <SEP> y <SEP> i <SEP>! <SEP> 9 <SEP> y <SEP> y <SEP> y <SEP> y <SEP> YX <SEP> YX
<tb><SEP><SEP> i <SEP> i <SEP> 5 <SEP> E <SEP> i <SEP>! <SEP> Z <SEP> i
<tb><SEP><SEP> s <SEP> s <SEP> 5 <SEP> i <SEP> F <SEP>><SEP> F <SEP> 1 <SEP> F <SEP> F <SEP> F <SEP> i <SEP> 1 <SEP> 1 <SEP> F- <SEP> i <SEP> i <SEP> F <SEP> F <SEP> ss <SEP> F <SEP> F- <SEP> I
<tb><SEP> y <SEP> s <SEP> i <SEP> 5 <SEP> S <SEP><SEP><SEP> r <SEP> O <SEP> o <SEP> o <SEP>'<SEP><SEP> t <SEP> czi <SEP><SEP><SEP><SEP><SEP> o <SEP><SEP><SEP> i <SEP>!
<tb><SEP> 8 <SEP> i <SEP> i <SEP> 5 <SEP> i <SEP> S <SEP> m! <SEP>! <SEP> i <SEP>! <SEP> m <SEP>
<tb><SEP><SEP>!<SEP>!<SEP> X <SEP>! <SEP><.<SEP><,<SEP> i <SEP> i <SEP> i <SEP>&verbar;<SEP> i <SEP> i <SEP>! <SEP>! <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP>
<tb><SEP> R <SEP> i <SEP> i <SEP> 5 <SEP>;<SEP> é <SEP> i <SEP><<SEP><<SEP><<SEP><<SEP>
<tb><SEP><SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> i <SEP> + <SEP> i
<tb><SEP><SEP> S <SEP><SEP><SEP> z <SEP> Ns <SEP><SEP> z <SEP> ^ <SEP> 2 <SEP> S <SEP> 8 <SEP><SEP> o <SEP><SEP> o <SEP> Z <SEP> S <SEP><SEP> o
<tb><SEP> F <SEP> F <SEP> F <SEP> F <SEP> F <SEP><SEP> i: <SEP> vS <SEP> F <SEP> F <SEP><SEP> S <SEP> S <SEP> F <SEP> S <SEP> S <SEP>"<SEP> pjpjp <SEP> Rjp <SEP> ^ <SEP> z
<tb><SEP> g <SEP> 8 <SEP> 8 <SEP> g <SEP> g <SEP> m <SEP> m <SEP> g <SEP> 8 <SEP> 8 <SEP> 8 <SEP> 8 <SEP> g <SEP> g <SEP> g <SEP> g <SEP> g <SEP> g <SEP> g <SEP> g <SEP> g <SEP> g <SEP> g <SEP> g <SEP> g
<tb> Table 2

<SEP>, <SEP> rl.l
<tb><SEP>><SEP> - <SEP>. <SEP> wwl- <SEP>. <SEP>
<tb>

<SEP> 0
<tb><SEP>><SEP> w
<tb><SEP> a
<tb><SEP> o <SEP>
<tb> DaS105O2 <SEP>
<tb> gL ............... I,
<tb> Do905o3 <SEP>
<tb> OO6105o4 <SEP> Y
<tb> 0091000 <SEP> - <SEP> - <SEP> P <SEP> L <SEP> - <SEP> - <SEP> - <SEP> A <SEP> M <SEP> - <SEP> 209 <SEP > - <SEP> - <SEP> - <SEP> -v <SEP> - <SEP> 37A0 <SEP> --- <SEP>: <SEP>
<tb> ,,,, <SEP> A <SEP> M <SEP> z <<SEP><<SEP><<SEP><<SEP> zzzzz <SEP>
<tb> 00910002 <SEP> F <SEP> - <SEP> - <SEP> - <SEP> - <SEP> M <SEP> 0cj7LET2ffiÉJY <SEP> A <SEP>
<tb>, <SEP> ..............
<tb>

009ro8o4 <SEP> M <SEP> - <SEP> - <SEP> 1. &num; DO {LL '<SEP> - <SEP> - <SEP> A <SEP>
<tb> 0091000S <SEP> c <SEP> A <SEP>
<tb> 009oW5 <SEP> - <SEP> - <SEP> 2CÊL11 <SEP> - <SEP> ... <SEP> - <SEP> A <SEP>
<tb>0091'OS06<SEP> - <SEP> - <SEP> -. <SEP> - <SEP> A <SEP>
<tb>! Z <SEP> r <SEP> M <SEP> - <SEP> A <SEP>
<tb>., .... <SEP> M <SEP> - <SEP> A <SEP>
<tb> 0091OO <SEP> M <SEP> 2SF <SEP> - <SEP> - <SEP> - <SEP> A <SEP>
<tb><SEP> j ~ ,, <SEP> M <SEP>! <SEP> ... <SEP> .. <SEP> I <SEP> E <SEP> F
<tb> ~ <SEP> A <SEP> M <SEP> r
<tb>0091'0202<SEP> M <SEP> - <SEP> -Y-. <SEP> $ <SEP> - <SEP> A <SEP> EF
<tb> ia <SEP> M <SEP> - <SEP> -.- <SEP>. <SEP> LT-.T) <SEP>: <SEP> A <SEP> - <SEP>
<tb> I <SEP> li <SEP> M <SEP> 1 <SEP> t, <SEP> s <SEP> i <SEP>. <SEP>. <SEP>. <SEP> j
<tb> 00S1004 <SEP> A <SEP> M <SEP>'lito
<tb> di <SEP> M <SEP> v <SEP> A <SEP>
<tb>. <SEP>. <SEP>. <SEP> 4, <SEP> i <SEP> M <SEP>t;<SEP>.
<tb>

0091-0402 <SEP> F <SEP> J <SEP> j <SEP> tJ <SEP> X <SEP> zz., <SEP> v <SEP> A <SEP>
<tb><SEP>, O <SEP> S <SEP>&commat;<SEP> F
<tb><SEP>'lU<SEP> 7 <SEP> j
<tb><SEP> J <SEP>'<SEP>'<SEP>'<SEP>ZS> iSS <SEP>'<SEP>SSS> SSSSSSSS
<tb><SEP><SEP> O <SEP> s <SEP> s <SEP><SEP> eO <SEP> eO <SEP> eO <SEP><SEP> Oe <SEP> Oe <SEP> eO <SEP ><SEP> Oe <SEP>> 0 <SEP> 0 <SEP> 0 <SEP> 2 <SEP> 2 <SEP><SEP> 0 "<SEP> z <SEP> t
<tb><SEP> XmmXx <SEP> th <SEP> mXX &commat; emmm
<tb><SEP> OQQQOooooooOosooosooovooo
<tb><SEP> u <SEP> O <SEP> O <SEP> cJ <SEP> O <SEP> O <SEP> O <SEP> O <SEP> O <SEP> o <SEP> o <SEP> o <SEP> o <SEP> o <SEP> o <SEP> o <SEP> o <SEP> o <SEP> o <SEP> o <SEP> o <SEP> o <SEP> o <SEP> o <SEP> O
<tb> Table 2 - continued -

<tb><SEP> a. - ....................
<tb>

<SEP><3<SEP> R <SEP> À <SEP> V <SEP> T <SEP> P <SEP> a <SEP> G <SEP> R <SEP> j <SEP> P <SEP> k <SEP> - <SEP> É <SEP> J <SEP> v <SEP> W <SEP> N <SEP> S <SEP> a <SEP> K <SEP> E <SEP> V <SEP> L <SEP> E <SEP> G <SEP> A <SEP> R <SEP> A <SEP> S <SEP> V <SEP> O <SEP> R <SEP> V <SEP> -C) -tCt) -tC
<tb><SEP> (L <SEP> 49ÀJ <SEP>: <SEP> - <SEP> - <SEP> z <SEP> z <SEP> II <SEP> z: <SEP>: <SEP> I <SEP> 1 <SEP>) <SEP> 1
<tb><SEP> 00a1o5o3 <SEP> 67C <SEP> - <SEP>
<tb><SEP> tu <SEP> 57 <SEP> - <SEP> - <SEP> - <SEP> z <SEP> -I-1J-llllll <SEP> DI - ED <SEP>
<tb><SEP> 00e1oeoi <SEP> O <SEP> - <SEP> - <SEP> R <SEP> T <SEP> - <SEP> E <SEP> L <SEP> - <SEP> T <SEP> N <SEP>
<tb><SEP> 00B1osoi <SEP> -.-. <SEP> o <SEP> O <SEP> I <SEP> - <SEP> - <SEP> R <SEP> T <SEP> - <SEP> E <SEP> L <SEP> - <SEP> T
<tb><SEP>><SEP>. ,, <SEP> JJ <SEP> 70A7T <SEP> - <SEP> E <SEP> L <SEP> - <SEP> T <SEP> F <SEP>
<tb> w. <SEP> ~~ <SEP> - <SEP> .. <SEP>: <SEP> T- <SEP> -EL-T <SEP> F <SEP>
<tb> 00B1O% 4 <SEP> --...-: - <SEP> R <SEP> T <SEP> E <SEP> L <SEP> - <SEP> T <SEP> G <SEP>
<tb> 0061oeo5 <SEP> - <SEP> RT- <SEP> EL <SEP> - <SEP> T <SEP> G <SEP>
<tb> 00B1Ooo5 <SEP> .- <SEP> R <SEP> T <SEP> - <SEP> E <SEP> L <SEP> - <SEP> T <SEP>
<tb>0061'Osoo<SEP> 57A <SEP>: <SEP>: <SEP> -
<tb><SEP> il <SEP> 570 <SEP> I <SEP> R <SEP> T <SEP> - <SEP> A <SEP> - <SEP> - <SEP>
<tb>><SEP> - <SEP> R <SEP> T <SEP>. <SEP>J>> JJJJ <SEP> E <SEP> L <SEP> - <SEP> T <SEP>
<tb><SEP>,<SEP> 5-7A <SEP> - <SEP>. <SEP> - <SEP> r7 <SEP> - <SEP> 70A <SEP> 7ffEJ <SEP> L <SEP> - <SEP> T <SEP>
<tb><SEP>:<SEP> - <SEP>: <SEP>. <SEP> - <SEP> - <SEP> - <SEP> - <SEP> - <SEP> -RT. <SEP> -EL-T <SEP> G <SEP>
<tb> DQe1ooi <SEP> - <SEP> - <SEP> - <SEP> - <SEP> L <SEP> L <SEP> -L7W7- <SEP> - <SEP>. <SEP> - <SEP> - <SEP> - <SEP> -01 <SEP> - <SEP> -RK- <SEP> -A <SEP> OLEL-TT <SEP> - <SEP>
<tb> Do61O2o2 <SEP> - <SEP> - <SEP> - <SEP> - <SEP> L <SEP> L ~ <SEP> - <SEP> L <SEP> - <SEP> A <SEP> O <SEP> I <SEP> - <SEP> - <SEP> R <SEP> K <SEP> - <SEP> A <SEP> O <SEP> L <SEP> E <SEP> L <SEP> - <SEP> T <SEP> T <SEP> - <SEP>
<tb> 00a10301 <SEP> L <SEP> -PD-- <SEP> R <SEP> T <SEP> - <SEP> E <SEP> L <SEP> - <SEP> T <SEP> O <SEP> L <SEP> E <SEP> L <SEP> - <SEP> T <SEP> T <SEP> - <SEP>
<tb> OoBl-0302 <SEP> - <SEP> - <SEP> -....- <SEP> - <SEP> L <SEP> -PA-- <SEP>: .. <SEP> RT <SEP > - <SEP> EL <SEP> - <SEP> T <SEP> OLEL <SEP> TT <SEP> - <SEP>
<tb> 00B10303 <SEP> - <SEP> - <SEP> SSA} <SEP> - <SEP> L <SEP> -PO-. <SEP> RRT <SEP> EL <SEP> - <SEP> T <SEP> OLEL <SEP> - <SEP> TT <SEP> - <SEP>
<tb> 00B1O3o4 <SEP> ... L.;. jA.î <SEP> EL <SEP> - <SEP> T <SEP> OLEL <SEP> - <SEP> TT <SEP>
<tb> 00a1030s <SEP> L <SEP> ---. - .--- <SEP> OLEL-TT-
<tb> m <SEP>. <SEP> - <SEP> - <SEP> W <SEP>W'Et<SEP> Wltlit <SEP> W <SEP> W <SEP><* twelat, jw <SEP><<SEP><<SEP> W <SEP> W <SEP> W <SEP> W <SEP> W <SEP>j;<SEP> t <SEP> e
<tb><<SEP>'<SEP> L <SEP> - <SEP> O <SEP> L <SEP> O <SEP> O <SEP> I <SEP> j <SEP> F <SEP> E <SEP > O <SEP> te <SEP> T <SEP>; F <SEP> Y <SEP> O <SEP> L <SEP> E <SEP> L <SEP> - <SEP> T <SEP> T <SEP> - <SEP>
<tb><SEP> roct * ^ - U <L;zz;z; zz <SEP>; YK <SEP> wEt
<tb><SEP> 2 <SEP>><SEP>
<tb><SEP>.<SEP> F <SEP> i <SEP> ini
<tb><SEP> w <SEP> b, o.,; oojjcsc <SEP> 1. <SEP>. <SEP>;<SEP> u <SEP> i <<<<<o
<tb><SEP> o <i <SEP> jl <SEP> i <SEP> IL <SEP> J <SEP> Hi <SEP> i <SEP>. <SEP>. <SEP> ij.
<tb>

<SEP> o <SEP> J
<tb><SEP> g <SEP><SEP> oR <SEP> g <SEP> g <SEP> 0 <SEP> 0 <SEP> g <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> g <SEP> g <SEP> 0i <SEP> g <SEP> g <SEP> 0 <SEP> g <SEP> g <SEP> g <SEP> g <SEP> 0o <SEP> g <SEP > g
<tb>
Table 3

<tb><SEP> 2 <SEP> 2 <SEP> 2 <SEP> 2 <SEP> 21 <SEP> 7171
<tb><SEP> 223445555 <SEP> 0 <SEP> 0
<tb><SEP> 36666667595777
<tb><SEP> AABCDEFAAAAABCAB
<tb>DQB1'0501<SEP>
<tb> oasl <SEP> tos0 <SEP> I
<tb>DQB1'05031
<tb>DQB1'05032<SEP> ~~
<tb>DQB1'0504
<tb> DQB <SEP>1'06011<SEP> I <SEP> I ~
<tb> DOB <SEP>1'06012
<tb>DQB1'0602<SEP> I <SEP> II ~
<tb> 1 <SEP>DQB1'0603<SEP> L1 ~~ 1 <SEP> I
<tb> 1 <SEP>DQB1'0604<SEP> LZ
<tb><SEP> I ~~ <SEP> IZI
<tb> IUUt <SEP> I <SEP> VOVY
<tb> I <SEP>DQB1'0201<SEP> - = <SEP> I
<tb> I <SEP>oas1'0202
<tb><SEP>> QB <SEP>1'0301
<tb><SEP>L>QB1'0302<SEP> C <SEP> I ~~~ I
<tb>DQB1'03032<SEP>
<tb>DQB1'0304<SEP> ~ <SEP> ~~
<tb> DQB1 * 0305
<tb> oasl0401 <SEP> I
<tb> DQB1 <SEP> * 0401 <SEP> l <SEP>
<tb> DOBI <SEP> * 0402
<tb> Table 4

Oligoprobes <SEP> Amino acids <SEP><SEP> Nucleotide <SEP> sequences <SEP> 5 '>3'<SEP> Specificities
<tb> variants
<tb> 23A <SEP> sil21L23 <SEP> ACC <SEP> GAG <SEP> CTC <SEP> GTG <SEP> CGG <SEP> GG <SEP> DQB1 * 0401
<tb> 26A <SEP> H30 <SEP> C <SEP> AGA <SEP> CAC <SEP> ATC <SEP> TAT <SEP> AAC <SEP> DQB1 * 0501 + 0502 + 05031 + 05032 + 0603 + 0604 + 0607 +0608
<tb> 26B <SEP> sil25Y26 <SEP> CGT <SEP> TAT <SEP> GTG <SEP> ACC <SEP> AGA <SEP> DQB1 * 06011 + 06012 + 0301 + 0304
<tb> 26C <SEP> sil25L26 <SEP> G <SEP> CGT <SEP> CTT <SEP> GTG <SEP> ACC <SEP> AGA <SEP> DQB1 * 0602 + 0302 + 03032
<tb> 26D <SEP> L26sil27 <SEP> CTT <SEP> GTA <SEP> ACC <SEP> AGA <SEP> CAC <SEP> DQB1 * 0603 + 0604 + 0607 + 0608
<tb> 26E <SEP> L26S28S30 <SEP> T <SEP> CTT <SEP> GTG <SEP> AGC <SEP> AGA <SEP> AGC <SEP> DQB1 * 0201 + 0202
<tb> 26F <SEP> sil25L26sil27Y30 <SEP> T <SEP> CTT <SEP> GTA <SEP> ACC <SEP> AGA <SEP> TAC <SEP> DQB1 * 06051 + 06052 + 0606 + 0609
<tb> 37A <SEP> D37 <SEP> AG <SEP> GAG <SEP> GAC <SEP> GTG <SEP> CGC <SEP> DQB1 * 06011 + 06012
<tb> 45A <SEP> E45 <SEP> GAC <SEP> GTG <SEP> GAG <SEP> GTG <SEP> TAC <SEP> DQB1 * 0301 + 0304
<tb> 49A <SEP> A49 <SEP> AC <SEP> CGG <SEP> GCA <SEP> GTG <SEP> AC <SEP> DOB1 * 0501
<tb> 55A <SEP> L53P55 <SEP> CG <SEP> CCG <SEP> CTG <SEP> GGI <SEP> CCG <SEP> CCT <SEP> G <SEP> DQB1 * 0301 + 0302 + 03032 + 0304 + 0305
<tb> 57A <SEP> V57 <SEP> CCT <SEP> GTT <SEP> GCC <SEP> GAG <SEP> TA <SEP> DQB1 * 0501 + 0604 + 06051 + 0606 + 0608 + 0609
<tb> 57B <SEP> S57 <SEP> G <SEP> CCT <SEP> AGC <SEP> GCC <SEP> GAG <SEP> TA <SEP> DQB1 * 0502 + 0504
<tb> 57C <SEP> D57 <SEP> G <SEP> CCT <SEP> GAT <SEP> GCC <SEP> GAG <SEP> T <SEP> DQB1 * 05032 + 0602 + 0603 + 0607
<tb> 70A <SEP> T71E74 <SEP> AG <SEP> GGI <SEP> ACC <SEP> CIG <SEP> GCI <SEP> GA <SEP> DQB1 * 0602 + 0603 + 0608
<tb> 70B <SEP> T77sil78 <SEP> G <SEP> GTG <SEP> GAC <SEP> ACC <SEP> GTA <SEP> TGC <SEP> AG <SEP> DQB1 * 0401 + 0402
<tb> C + <SEP> - <SEP> GAG <SEP> TAC <SEP> TGG <SEP> AAC <SEP> AGC <SEP> CAG <SEP> AAG <SEP> GA <SEP>
C- <SEP> - <SEP> TAT <SEP> GAA <SEP> ACT <SEP> TAT <SEP> GGG <SEP> GAT <SEP> AC <SEP>
HRP1 <SEP> - <SEP> ACG <SEP> GAG <SEP> CGC <SEP> GTG <SEP>
HRP2 <SEP> - <SEP> ATC <SEP> TAT <SEP> AAC <SEP> CGA <SEP> GA <SEP>
HRP3 <SEP> - <SEP> CGC <SEP> TTC <SEP> GAC <SEP> AGC <SEP> GAC <SEP> GTG <SEP> G <SEP> C +: positive control C-: negative control sil: silent mutation
Variant amino acids are indicated by the one-letter code followed by their position

Claims (18)

1. Nucleotide probe chosen from the following - TGCGTTATGTGACCAGA, - GTG CGT CTT GTG ACC AGA, - GT CTT GTA ACC AGA CAC AT, - CGT CTT GTA ACC AGA TAC AT, - CGT CTT GTG AGC AGA AGC AT, - GG ACC GAG CTC GTG CGG GGT G, - G TAC CGG GCA GTG ACG C, - G ACG CCG CTG GGI CCG CCT G. and their complementaries, it being understood that said probes have at least the underlined sequence, and can also contain one or two bases chosen, while respecting the continuity of the sequence, from the non-underlined bases. - CATCTATAACCGAGA, - GGACG GAG CGC GTG CG, - G GAG GGG ACC CGG GCG GAG T, - TCGGTG TCACACCGTATGCAA C, - G GAG GGI ACC CIG GCI GAG T, - G ACG CCG CTG GGG CCG CCT G, 2. Probe according to claim 1, chosen from those which are defined by the following sequences, and their complements - TGCGTTATGTGACCAGA, - GTG CGT CTT GTG ACC AGA, - GT CTT GTA ACC AGA CAC AT, - CGT CTT GTA ACC AGA TAC AT, - CGTCTTGTGAGCAGAAGCAT, - GG ACC GAG CTC GTG CGG GGT G, - GTACCGGGCAGTGACGC, - G ACG CCG CTG GGI CCG CCT G. - G ACG CCG CTG GGG CCG CCT G. - TCG GTG GAC ACC GTA TGC AGA C. - GGAGGGGACCCGGGCGGAGT, - G GAG GGI ACC CIG GCI GAG T, 3. Probes according to claim 1, chosen from those which are defined by the following sequences, and their complementaries - GG ACG GAG CGC GTG CG, - C ATC TAT AAC CGA GA. 4. Probes according to any one of the preceding claims, the sequence of which corresponds to the underlined sequence, and their complements. 5. Probe according to any one of the preceding claims, characterized in that said probes are either labeled, or coupled to a ligand intended to facilitate their attachment to a solid support, or fixed to a solid support. 6. Method for at least partially determining the HLADQB1 typing of a target nucleic acid present in a sample, in which hybridization tests are carried out, according to known methods, of said nucleic acid of the sample with oligonucleotide probes, and in which the tests for which hybridization is effectively observed at a single temperature equal to 37 + 2 ° C. are retained as positive tests, said oligonucleotide probes comprising at least one probe chosen from those which are defined by the following sequences - TG CGT TAT GTG ACC AGA, - GTGCGTCTTGTGACCAGA, - GT CTT GTA ACC AGA CAC AT, - CGT CTT GTA ACC AGA TAC AT, - CGTCTTGTGAGCAGAAGCAT, - GG ACC GAG CTC GTG CGG GGT G, - G TAC CGG GCA GTG ACG C, - G ACG CCG CTG GGI CCG CCT G, - G GAG GGI ACC CIG GCI GAG T, - TCG GTG GAC ACC GTA TGC AGA C, or their complementaries, it being understood that said probes contain at least the underlined sequence and can also contain one or two additional bases chosen, while respecting the continuity of the sequence, from the non-underlined bases. 7. The method of claim 6, wherein the sample nucleic acid hybridization tests are also carried out with at least one probe chosen from those which are defined by the following sequences. - ACC AGA CAC ATC TAT AAC CG, - GG CCT GTT GCC GAG TAC T, - CGG CCT AGC GCC GAG TAC T, - CGG CCT GAT GCC GAG TAC, or their complementary. 8. Method according to any one of claims 6 and 7, in which further tests are carried out for hybridization of the nucleic target of the sample with at least one probe chosen from those which are defined by the following sequences. - GC GAC.GTG GAG .GTG.TAC CG, - A GAG GAG GAC GTG CGC TT, or their complementary. 9. A method according to any one of claims 6 to 8, wherein said probes are used as capture probes. 10. Method according to the preceding claim, wherein the possible presence of nucleic acid, attached to a solid support by hybridization with a capture probe, using a labeled detection probe capable of hybridizing with is revealed. a region of the target other than that recognized by said capture probe. 11. Method according to the preceding claim, in which the detection probes are chosen from those which are defined by the following sequences, or their complementaries. - GG ACG GAG CGC GTG CG, - C ATC TAT AAC CGA GA, - CGC TTC GAC AGC GAC GTG G. 12. Method according to any one of claims 6 to 11, characterized in that said probes are defined as in claim 4. 13. Kit for HLA DQB 1 typing, comprising at least one probe chosen from among those defined by the following sequences - TG CGT TAT GTG ACC AGA, - GTG CGT CTT GTG ACC AGA, - GT CTT GTA ACC AGA CAC AT, - CGT CTT GTA ACC AGA TAC AT, - CGT CTT GTG AGC AGA AGC AT, - GG ACC GAG CTC GTG CGG GGT G, - G TAC CGG GCA GTG ACG C, - GACG CCGCTGGGI CCGCCTG. - G ACG CCG CTG GGG CCG CCT G. or their complementary. - CGC TTC GAC AGC GAC GTG G, - GC GAC GTG GAG GTG TAC CG, - A GAG GAG GAC GTG CGC TT, - CGG CCT GAT GCC GAG TAC, - CGG CCT AGC GCC GAG TAC T, - GGCCTGTTGCCGAGTACT, - ACC AGA CAC ATC TAT AAC CG, or their complements, and may also contain one or more probes chosen from those which are defined by the following sequences - CATCTATAACCGAGA, - GG ACG GAG CGC GTG CG, - TCG GTG GAC ACC GTA TGC AGA C, - G GAG GGG ACC CGG GCG GAG T, - GGAGGGi ACCCIGGCIGAGT, 14. Kit according to the preceding claim, comprising the probes defined by the following sequences - TGCGTTATGTGACCAGA, - GTG CGT CTT GTG ACC AGA, - GT CTT GTA ACC AGA CAC AT, - CGT CTT GTA ACC AGA TAC AT, - CGT CTT GTG AGC AGA AGC AT, - GG ACC GAG CTC GTG CGG GGT G, - G TAC CGG GCA GTG ACG C, - G ACG CCG CTG GGl CCG CCT G. or their complementary. - GC GAC GTG GAG GTG TAC CG, - A GAG GAG GAC GTG CGC TT, - CGGCCTGATGCCGAGTAC, - CGG CCT AGC GCC GAG TAC T, - GG CCT GTT GCC GAG TAC T, - ACC AGA CAC ATC TAT AAC CG, or their complements, and may also contain one or more probes chosen from those which are defined by the following sequences - TCG GTG GAC ACC GTA TGC AGA C, - G GAG GGG ACC CGG GCG GAG T, - G GAG GGI ACC CIG GCI GAG T, - G ACG CCG CTG GGG CCG CCT G, 15. Kit according to claim 13, comprising the probes defined by the following sequences - TG CGT TAT GTG ACC AGA, - GTGCGTCTTGTGACCAGA, - GT CTT GTA ACC AGA CAC AT, - CGT CTT GTA ACC AGA TAC AT, - CGT CTT GTG AGC AGA AGC AT, - GGACCGAGCTC GTGCGGGGTG, - GTACCGGGCAGTGACGC, - GACGCCGCTGGGICCGCCTG, - G GAG GGI ACC CIG GCI GAG T, - TCG GTG GAC ACC GTA TGC AGA C, - ACC AGA CAC ATC TAT AAC CG, - CGG CCT AGC GCC GAG TAC T, - CGG CCT GAT GCC GAG TAC, - A GAG GAG GAC GTG CGC TT, or their complementary, and possibly - GC GAC GTG GAG GTG TAC CG, - GG CCT GTT GCC GAG TAC T, or their complementary. 16. Kit according to any one of claims 14 and 15, wherein said probes can be used as capture probes. 17. Kit according to any one of claims 14 to 16, further containing at least one labeled detection probe chosen from the following: - GG ACG GAG CGC GTG CG, - C ATC TAT AAC CGA GA, - CGC TTC GAC AGC GAC GTG G. 18. Kit according to any one of claims 13 to 17, wherein said probes are defined as in claim 4.