FR2705349A1 - Characteristic nucleotide sequences of Erwinia carotovora responsible for the blackleg, and their uses for the diagnosis of this pathology. - Google Patents

Abstract

A subject of the present invention is nucleotide sequences characteristic of the genome of Erwinia carotovora bacteria, subsp. atroseptica (Eca), responsible for pathologies such as the blackleg of the potato. The invention is also aimed at the use of these nucleotide sequences for the implementation of methods for identifying and detecting Eca, and for diagnosing pathologies caused by these bacteria.

Description

1 2705349

  NUCLEOTIDE SEQUENCES CHARACTERISTICS OF ERWINIA

  CAROTOVORA RESPONSIBLE FOR THE BLACK LEG, AND THEIR

  USES FOR THE DIAGNOSIS OF THIS PATHOLOGY

  The present invention relates to nucleotide sequences derived from pathogenic Erwinia carotovora bacteria in certain plants, and more particularly Erwinia carotovora responsible for the blackleg, these sequences being usable, in particular as probes and primers, for the detection of these bacteria in hosts susceptible to be infected by these

  or in any environment where these bacteria are likely to survive.

  A study carried out in 1988 indicated that global losses due to

  Plant diseases commonly amounted to $ 60 billion a year.

  This is to say the importance of the rapid and specific detection of phytopathogenic agents, which should condition the cultural practices and the choices of phytosanitary products, their dosage, the timing of their

  application, and to avoid aggression of the environment.

  Prophylactic measures, thus requiring rapid, sensitive and reliable detection, are still today one of the most efficient and cost-effective ways, both financially and environmentally, of disease control, and in particular against bacterioses for which little control is available, the use of antibiotics being prohibited in the majority of countries. These prophylactic measures consist essentially of producing material, in particular of propagation, healthy, and possibly to destroy the contaminated batches, in sterilization or any other method of disinfection of all the materials, premises and substrates of culture likely to be in danger. contact with plants and

  seeds, choosing healthy places of production.

  Screening for bacterial pathologies in plants has not been satisfactory so far, however, and significant losses of mono- and di-cotyledonous plants are frequently observed in the field.

greenhouses or during storage.

  One of the main causes of this problem is the use of seeds, in the broad sense, apparently healthy, but which are in fact carrying bacteria likely to be at the origin of the future development of pathologies in the plants obtained from these seeds. We will then talk about bacterioses in

latent phase of infection.

At - $ 2 2705349

  Many plant pathologies are characterized by a latent phase of infection. During this phase, the level of infection is generally lower than that which could be detected by visual inspection (absence of apparent symptoms) or by current techniques currently available (isolation and microbiological characterization, indexing, immunology ...). Another important source of plant contamination would also come from the natural or man-made environment, including soils and water. It should also be noted that isolation and microbiological characterization are in general long and laborious techniques, which may be too expensive to consider applying on a large scale, whereas immunological methods do not always have the same value.

  specificity and sensitivity desired.

  The pectinolytic bacteria of the genus Erwinia (hereinafter referred to as erwinias) are responsible for a large number of such pathologies, one of the symptoms of which is the maceration of tissues in a large number of plants and seeds. These bacteria are particularly capable of infecting potato, corn, tomato, sugar beet, cabbage, endive, etc., as well as greenhouse plants, such as ornamental plants which are

  commonly traded between countries.

  Among these erwinias, one can quote mainly on the one hand Erwinia carotovora, and more particularly Erwinia carotovora subsp. carotovora

  (Ecc), Erwinia carotovora subsp. atroseptica (Eca), Erwinia carotovora subsp.

  odorifera (Eco) and Erwinia carotovora subsp. wasabiae, and, secondly,

Erwinia chrysanthemi (Ech).

  These bacteria produce several extracellular enzymes capable of attacking the components of the cell wall; pectinases, cellulases, hemicellulases and proteases (for a detailed review, see article by A.

  Kotoujansky appeared in Ann. Rev. Phytopathol. 1987, 25: 405-30).

  Erwinia carotovora has been particularly studied because of its pathogenicity on several plants, and especially in the potato (Pérombelon,

  1989). The species Erwinia carotovora (Ec) is currently divided into five sub-

  species: atroseptica (Eca), carotovora (Ecc), odorifera (Eco) and wasabiae

  (Ecw) previously cited, as well as subspecies betavascularum (Ecb).

  This classification was made on the basis of physiological characteristics

  and biochemicals, as well as their pathogenicity.

  Eca and Ecb have a specificity of neighboring hosts. Ecb is responsible for rotting beet (Thomson et al., 1981). The action of Eca is

3 2705349

  generally limited to the potato in cool temperate climates, at temperatures between about 18 C and about 20 C (Pérombelon, 1980). Some strains, not isolated from the potato, have been described as Eca "atypical" because of the fact that they have some particular physiological characteristics, such as

  ability to grow at 37 C (Lopez et al., 1989). A new sub

  species, called odorifera (Eco) has recently been described as representing "atypical" strains that are pathogenic at least on endive and produce volatile volatile metabolites (Gallois et al., 1992). Other "atypical" Eca strains have been identified as Ecc strains based on phenotypic and genotypic characteristics. Conversely, Ecc is widely distributed around the world and has a wide host specificity (Pérombelon et al.

Kelman 1987, Smith and Bartz 1990).

  The main pathologies of the potato caused by these bacteria, and more particularly by Eca, are the following: lack of emergence, seeding, blackleg, aerial stem rot, tuber drying and rot, and aerial wilting (Pérombelon and Kelman 1987). Diseases associated with non-emergence and blackleg occur mainly from the mother tubers and can cause significant losses in the field. Eca is considered to be the typical Blackleg agent in Europe because of its low temperature pathogenicity, and its ability to induce disease early in vegetation, increasing losses. Most Ecc strains can not produce typical low temperature blackleg symptoms. Ecc is considered an opportunistic agent rather than a primary causative agent of the disease. However, Ecc has increased pathogenicity at temperatures around 25 ° C and is the primary causative agent of the blackleg of the potato in Arizona and Colorado (Stanghellini and Meneley,

1975).

  As we have seen above, the control of these bacterial pathologies relies mainly on prophylactic measures, and the detection means are therefore particularly important (Lelliott and Stead,

1987).

  The present invention aims to provide a reliable method for specific determination of the presence of Erwinia carotovora subsp. atroseptica (Eca) in a host (including plants or seeds) that may be a carrier

  such bacteria, or in soil and water.

4 2705349

  The purpose of the present invention is precisely to provide potential users with reliable methods for the early diagnosis of pathologies caused by Eca, and more particularly of the blackleg of the potato, namely methods making it possible to do so. diagnosis of the risk of occurrence of these pathologies, or to identify bacterial strains. The aim of the invention is more precisely to provide new nucleotide sequences which can be used as probes or primers for the implementation of these diagnostic methods, in particular by techniques proceeding by hybridization between nucleic acids (RNA and / or DNA), possibly followed by the amplification of the number of copies of target sequences to be detected, for example according to the PCR (Polymerase Chain Reaction), LCR (Ligase Chain Reaction) and 3SR (Self-Sustained Sequence Replication) gene amplification techniques. The invention also aims to make available to users

  potential diagnostic kits for the implementation of diag-

  nostic and identification mentioned above.

  The invention is illustrated with reference to FIGS.

  respectively the nucleotide sequences A to F described below.

  The subject of the invention is any nucleotide sequence comprising the nucleotide sequence B shown in FIG. 2, or its complementary sequence, or fragments of these sequences, or any of the abovementioned sequences modified by substitution and / or addition and / or deletion. one or more nucleotides, said fragments or modified sequences being capable, like the aforementioned B sequence, of hybridizing with the

  genome of Eca strains, under stringent conditions.

  The hybridization conditions mentioned above are, for example, the following: hybridization in 6 SSC, 0.1% SDS and 0.01% skimmed milk at 65 ° C. overnight, followed by two 30-minute washes at 65 ° C. in 0, 1 SSC,

0.5% SDS.

  By way of illustration, the expression "modified sequence" in the foregoing and the following is understood to mean any sequence comprising nucleotides such as uracil, inosine, 7-deaza 2 'desoxyguanosine triphosphate (cdGTP) etc., and

  therefore corresponding to either a DNA or a modified RNA.

  Preferably, the modified sequences according to the invention have at least about 60% identity with all or part of the aforementioned B sequence. The invention relates more particularly to the aforementioned nucleotide sequences in labeled form, in particular radioactively,

X 5 2705349

  enzyme, by a fluorescent compound, by binding to an antigenic molecule

  which can be detected directly or indirectly by means of reagents (or radiation), this link possibly being effected by means of a spacer arm, in particular via a nucleotide sequence consisting of at least 5 to 100 nucleotides located at least

  at one end of these sequences.

  As examples of directly or indirectly detectable molecules related to the aforementioned nucleotide sequences, mention may be made of acetylaminofluorene and biotin (detected using avidin, streptavidin).

or digoxigenin.

  The nucleotide sequences according to the invention are advantageously used as nucleotide probes, where appropriate labeled, in particular as indicated above, more particularly for the detection of Eca strains responsible for the blackleg. Like the above-mentioned nucleotide sequences, the probes of the invention are capable of hybridizing with nucleotide sequences contained in the genome of the pathogenic Eca (the latter sequences being further indicated in the foregoing and which follows, by the expression " specific nucleotide sequences "or" specific sequences "), these specific nucleotide sequences not being contained in the genome of Erwinia carotovora other than Eca phatogens. Advantageously, the probes of the invention consist of sequences of about 7 to about 300 nucleotides, chosen from

  the aforementioned nucleotide sequence B.

  Fragments of the aforementioned nucleotide sequences of the invention may advantageously be used in pairs to form what will be called in the rest of this text pairs of primers, these pairs of primers being used for the amplification of the number of copies of the aforementioned nucleotide sequences, or specific nucleotide sequences

  contained in the genome of Eca strains responsible for the blackleg.

  These primers allow the amplification (or multiplication) of the number of copies of all or part of the specific nucleotide sequences of the genomes of Eca responsible for the blackleg, in particular according to the PCR technique which will be detailed later, these primers being the case. marked,

  especially as indicated above.

  Advantageously, the primers according to the invention consist of approximately at about 100 nucleotides, and preferably of about 15 to about 30 nucleotides.

6 2705349

  nucleotides, and are capable of hybridizing with a region of a nucleotide sequence according to the invention, or of a nucleotide sequence according to the invention, or of a specific nucleotide sequence of the genome of Eca, this region being different according to the primers within the same pair, so as to allow the amplification of all or part of the sequences

nucleotides mentioned above.

  These primers advantageously consist of about 7 to 30 nucleotides derived from the sequence B shown in FIG. 2, and in particular allow the amplification of fragments from about 100 to about 300 nucleotides contained in nucleotide sequences specific for the Eca responsible for

the black leg.

  The aforementioned primer pairs are selected so that they hybridize to the 3 'side of each of the strands of the aforementioned nucleotide sequences, the 3' ends of each of the primers being directed to

  inside the sequences to be amplified.

  The invention also relates to a method for identifying and detecting Eca that may be present in a host, in particular in plants and seeds, this method comprising the following steps: treating a sample taken from this host so as to to make the genome of these Eca accessible to the probes and / or the primers defined above, and where appropriate to any DNA or RNA polymerase which makes it possible to replicate the two strands of the genomic or RNA DNA deriving therefrom, this treatment being especially carried out by boiling, maceration (in a liquid such as water), grinding or sonication, - bringing the sample thus treated into contact with probes such as

  described above, and where appropriate with primers as described above.

  above, in particular under the hybridization conditions defined below in the context of carrying out the method by PCR technique, - where appropriate, the amplification using the abovementioned pairs of primers of the number of copies of the sequences. specific nucleotides contained in the genomes of Eca likely to be present in this biological sample, and with which are likely to hybridize the aforementioned probes or primers, and / or the amplification of the number of copies of probes mentioned above, - the detection the possible presence of said specific nucleotide sequences contained in the genomes of Eca, said specific sequences being hybridized with the aforementioned probes, and therefore the presence of Eca

in the sample studied.

7 2705349

  The identification and detection method of the invention can be carried out from a host having pathological signs, or advantageously from a host that is likely to be an apparently healthy carrier of such

  bacteria and in the latent phase of infection.

  The method of identification and detection of Eca according to the invention can also be carried out from any medium in which these bacteria are

  likely to survive, especially in water or soil.

  Preferably, the identification method according to the invention comprises a step of amplifying the number of copies of all or part of the specific nucleotide sequences contained in the genomes of the Eca responsible for

  the blackleg, or corresponding RNAs.

  This gene amplification step can be carried out in vitro or in vivo by any method using the standard enzymatic DNA or RNA amplification techniques, such as the LCR (Ligase Chain Reaction) technique described in particular in the review. PNAS, USA, 88, pp. 189-193 (1991), or the technique "QP Replicase" described in the journal Biotechnology (Vol.6, October 1988), or advantageously the PCR technique as described in particular in the European patent applications of Cetus (n 200 362, 201 184, 229 701 and 258 017), or the 3SR technique described by Fahy et al. PCR Meth Appl 1,

  25-33 (1991), or the techniques derived from these and any method

  to amplify in vitro the nucleic acids.

  According to a preferred embodiment of the method described above according to the invention, the amplification by PCR technique of the number of copies of the

  nucleotide sequences contained in the genomes of Eca, and / or the

  The preparation of the number of copies of the probes defined above comprises the following steps: the predenaturation of double-stranded DNA into single-stranded DNA, preferably in a buffer consisting of 10 mM Tris-HCl pH 8.3, 50 mM KCl ,

  1.5 mM MgCl2, 0.01% gelatin, cofactors of DNA (or RNA) -

  polymerase, in particular of Mg2 + and K + ions, of the 4 constituent deoxynucleotides of the DNAs (dCTP, dATP, dGTP, dTTP), or of the RNAs (dCTP, dUTP, dGTP, dTTP), and pairs of primers as defined above. above, by heating between about 80 ° C. and about 110 ° C., advantageously at 100 ° C., the amplification proper by addition to the medium obtained in the preceding step of heat-resistant DNA or RNA polymerase or heat-resistant ligase (in the case where these enzymes were not initially present in the aforementioned predenaturation buffer), and

8 2705349

  heating (in particular for about 1 minute) at about 94 ° C., which corresponds to the actual denaturation step, then heating (especially for about 1 minute) between about C and about 76 ° C., which corresponds to step of hybridization of the pairs of primers with the sequences or probes mentioned above, and finally heating (in particular for about 1 minute) between about C and about 76 C, which corresponds to the step of elongation of the primers, hybridized to the preceding step, towards each other, thus producing nucleotide sequences complementary to all or part of the genomic sequences of the aforementioned Eca or probes, these sequences or probes being delimited by the nucleotides hybridizing with the abovementioned primers, the repetition of the preceding amplification step between about 20 and about 50 times, advantageously between 25 and 35 times, the whole procedure can be repeated one or more times from all or part of the middle

obtained in the previous step.

  According to a preferred embodiment of the invention, the sensitivity of the detection can be improved by continuing the method described above by amplification of the "nested PCR" type, described in "PCR A Practical Approach" edited by MJ McPherson, P. Quirke, GR Taylor, (1991) Oxford University Press, using primers internal to the previously amplified fragment, which leads to the amplification of the copy number of a DNA fragment or

  RNA shorter than the one whose copy number was initially amplified.

  it goes without saying that all the time intervals specified in the methods detailed above, may vary among others depending on the equipment (said

cycler or thermocycler) used.

  it is also obvious that if other amplification methods are used

  than that by PCR, and / or other enzymes, another suitable buffer will be chosen.

  In the case where the identification and detection method of the invention is carried out simply by means of probes as described above, the detection of the specific nucleotide sequences is advantageously carried out in the following manner: a solid support (such as a membrane or wells of microtitration plates such as those commonly used in the ELISA technique, and adapted or not to nucleic acids) of a nucleotide sequence according to the invention, hereinafter referred to as "sequence trap, with which the aforementioned specific nucleotide sequences, or fragments of these sequences, are capable of hybridizing, especially under the conditions

9 2705349

  defined above, this fixation being carried out according to usual techniques described in particular by Maniatis et al., 1982, and by Ausubel et al., 1987, - rinsing of the solid support, - saturation of the free reactive sites of the support, - incubation of the trapped nucleotide sequences, thus fixed, with the DNA or genomic RNA originating from the biological sample previously treated in the manner indicated above, under conditions allowing the hybridization of the specific nucleotide sequences with said trap sequences, in particular under the conditions of hybridization defined above, - rinsing of the solid support optionally with the aid of 3 x SSC at 65 ° C. (or 0.1 × SSC if necessary, at 68 ° C.) for 15 minutes twice, - incubation of the specific sequences hybridized in the preceding step with the trap sequences, with one or more probes according to the invention, under conditions allowing the hybridization of the specific sequences above. mentioned with said probes, in particular under the hybridization conditions defined above, these probes being chosen so that they are not complementary to the aforementioned trap sequences, - rinsing of the solid support, in particular with the aid of 3 × SSC (or 0.1 x SSC if necessary, at 68 ° C.) at 65 ° C. for 15 minutes twice, detection of any probes remaining fixed on the solid support

  after the previous step, thus testifying to the presence of specific sequences

  or fragments of these sequences in the biological sample, this detection being carried out either directly when the aforesaid probes are labeled radioactively or fluorescently, or indirectly via reagents themselves capable of recognizing these probes, in particular to with the help of antibodies or other reagents described above, in the case where these probes are labeled with antigens or molecules likely to

  to be respectively recognized by these antibodies or reagents.

  The detection of the specific nucleotide sequences likely to be present in the sample studied, can also be carried out as follows: - Fixing on a solid support of the genomic DNA or RNA from the previously treated sample as indicated above, - rinsing of the solid support, - saturation of the free reactive sites of the support, - incubation of the DNA or RNA thus fixed with a probe, according to the invention, this incubation being carried out under conditions allowing

2705349

  hybridization of the probes with the genomic material fixed on the solid support, in particular under the above-defined hybridization conditions, rinsing of the solid support, in particular with the aid of 3 × SSC (or 0.1 × SSC if necessary at 68 ° C.), 65 C for 15 minutes twice, - detection of any probes remaining fixed on the solid support

  after the previous step, thus testifying to the presence of specific sequences

  or fragments of these sequences in the biological sample, this detection being carried out either directly when the aforesaid probes are labeled radioactively or fluorescently, or indirectly via reagents themselves capable of recognizing these probes, in particular to with the help of antibodies or other reagents described above, in the case where these probes are labeled with antigens or molecules likely to

  to be respectively recognized by these antibodies or reagents.

  In the case where the method for identifying and detecting the invention

  comprises a gene amplification step using the primers described above.

  above, the detection of specific nucleotide sequences or fragments of these sequences can be carried out by gel electrophoresis of all or part of the reaction medium in which the amplification has been carried out. The visualization of a large cluster (more or less individualized) of sequences at a specific point of the gel, and corresponding to the number of copies of all or part of the specific nucleotide sequences thus amplified, is correlated with the

  presence of these specific sequences in the sample studied.

  Advantageously, the amplification of all or part of the aforementioned specific sequences can be detected using probes as described above, in particular according to one of the methods described above. Other methods of detection or determination, in solid or liquid phase,

  can of course be considered in the context of the present invention.

  These methods are described in particular in the article by Bloch, 1991, which

  deals with the PCR technique in general and a method of assaying

  amplification, these methods can be applied to the quantification of pectinolytic erwinias present in the sample studied, or in the article by Barany, 1991, dealing with CSF and PCR, or in the article by Gilliland et al. , 1990, dealing with a competitive PCR method for mRNA quantification also applicable in the context of the present invention. The subject of the invention is more particularly the application of the aforementioned identification and detection methods to the diagnosis of the eventual

  appearance of a pathology, in particular of the black leg, caused by the Eca.

  The result of these diagnostic methods mentioned above makes it possible to evaluate the risk posed by a host that may carry Eca, to develop and, if necessary, to transmit, or not, a pathology caused by

  these bacteria, especially the black leg.

  By Eca detected as part of the aforementioned diagnostic and detection methods, we must understand both the natural strains of these bacteria,

  as well as modified strains, in particular by genetic engineering.

  The diagnostic methods according to the invention are carried out by detecting Erwinia carotovora subsp. atroseptica responsible in particular for the kennel in Europe, or any species or subspecies subsequently derived by

  modification of the current taxonomy.

  The polymorphism of the specific nucleotide sequences of pathogenic Eca, or fragments of these sequences, may be representative of different groups within these erwinias, such as ecotypes, pathotypes (or pathovars) or biotypes of Erwinia carotovora, the polymorphism being notably demonstrated either by the action of restriction enzymes, by temperature gradient electrophoresis or denaturants, or after hybridization with an RNA fragment by action with RNase A, or by any other method aimed at highlight the polymorphism of acids

  nucleic acid in solid or liquid phase.

  The invention also relates to kits for implementing a diagnostic method as described above, characterized in that they comprise at least one probe as defined above, and, where appropriate, the minus one

  pair of primers as described above.

  Advantageously, the kits according to the invention comprise: a heat-resistant DNA or RNA polymerase, a reaction medium advantageously constituted, in the case of the use of the PCR technique, of 10 mM Tris-HCl pH 8.3, 50 mM KC1, 1.5 mM MgCl2, 0.01% gelatin, cofactors of the DNA or RNA polymerase, in particular of Mg2 + and K + ions, and of the 4 deoxynucleotides constituting the

  DNA (dCTP, dATP, dGTP, dTTP) or RNAs (dCTP, dATP, dGTP, dUTP).

  The kits according to the invention may also comprise: one or more restriction enzymes, and, where appropriate, reference restriction fragments characteristic of each of the ecotype, pathotypes (or pathovars) or biotypes of Eca,

12 2705349

  and / or a ligase and one (or more) pair (s) of oligonucleotide sequences capable of hybridizing on either side of one (or more) nucleotide (s) located in genes or fragment characteristic gene (s) of an Eca strain, and advantageously one (or more) oligonucleotide probe (s) specific (s) of a characteristic region of a

  determined strain of Eca, in the current state of taxonomy.

  The invention also relates to the use of the nucleotide sequences defined above for the implementation of a method of detection, where appropriate for the purpose of diagnosis, in a host or in a medium as defined above, of any microorganism or any cell, in the genomes of which the nucleotide sequences according to the invention have been introduced transiently or definitively. Such a process is advantageously carried out

  following one of the methods described above.

  In this respect, the subject of the invention is also the use of the sequences

  nucleotides above, as cell markers or micro-organisms

  genetically modified organisms by introducing or not into their genome these nucleotide sequences, or cellular hosts infected (or transformed) by such microorganisms, in particular for monitoring the evolution of these cells, microorganisms and cellular hosts in an environment

determined.

  The invention particularly relates to plant cells (for example protoplasts) transformed with a vector chosen from those derived from the Ti and Ri plasmids of Agrobacterium tumefaciens and Agrobacterium rhizogenes respectively, these plasmids containing at one of their non-specific sites. essential for their replication and transformation of plant cells, a sequence

nucleotide according to the invention.

  The invention also relates to the plants regenerated from these transformed cells. The invention also relates to animal cells transformed with a vector derived from retroviruses and containing a nucleotide sequence of the invention. The invention also relates to any method for obtaining sequences

nucleotides mentioned above.

  The preparation of these nucleotide sequences can be carried out either by a chemical process or by other methods, such as amplification by

  LCR or PCR or other method of gene amplification.

  An appropriate method of preparation of these nucleotide sequences (with a maximum of 200 nucleotides, or base pairs when

13 2705349

  double-stranded nucleic acid) of the invention chemically comprises the following steps:

  - DNA synthesis using, for example, the automated method n

  cyanethyl phosphoramidite described in Bioorganic Chemistry 4; 274-325, 1986, the cloning of the DNAs thus obtained in a suitable vector (plasmid, phage or cosmid) and the recovery of the DNAs by hybridization with a probe

  appropriate, or by electrophoresis, usually after restriction.

  A mode of preparation, by chemical means, of nucleic acids longer than 200 nucleotides or base pairs (in the case of double-stranded nucleic acids) comprises the following steps: assembly, for example by finger-jointing (or ligation, by action of a ligase) of chemically synthesized oligonucleotides, provided at their ends with different restriction sites, according to for example the principle described in Proc. Nat. Acad. Sci. USA, 80; 7461- 7465, 1983, the cloning of the DNAs thus obtained into an appropriate vector (plasmids, phages or cosmids), and the recovery of the DNAs by hybridization with a

  probe, or by electrophoresis, usually after restriction.

  The preparation of the nucleic acids of the invention can also be carried out biologically, in particular after cloning of cellular hosts whose genome is likely to contain these nucleotide sequences, if appropriate, after transformation of the genome of these hosts using appropriate vectors

  containing these nucleotide sequences.

  As such, the subject of the present invention is any vector, in particular plasmidic, containing at one of its non-essential sites for its replication,

  a nucleotide sequence according to the invention.

  The subject of the invention is also any cellular host transformed with a vector according to the invention, and in which said vector, or the nucleotide sequence according to the invention, integrated into the genome of the host, is

likely to replicate.

  The invention relates more particularly to the strain Escherichia coli DH5cC transformed by the plasmid pPMV176 itself obtained by insertion of the nucleotide sequence B shown in FIG. 2, in the BamHI site of

  plasmid pTZ19R described in the article by Mead et al., (1985).

  Thus the present invention aims at a process for obtaining the aforementioned nucleotide sequences, carried out by: - culturing a cellular host as described above, transformed by a vector according to the invention,

14 2705349

  recovery of the vectors from this cellular host, in particular by an appropriate cell lysis treatment; recovery of the nucleotide sequences of the invention by treatment of the abovementioned vectors with the aid of appropriate restriction enzymes (using example of BamHll in the case of the abovementioned plasmid pPMV176), - purification of the nucleotide sequences thus obtained, in particular by

  gel electrophoresis followed by elution.

  Another particularly advantageous process for obtaining the nucleotide sequences according to the invention comprises the following steps: bringing together vectors containing the aforementioned nucleotide sequences, with pairs of primers as described above, under conditions allowing the amplification of the number of copies of these nucleotide sequences, especially under the conditions described above, - purification of the nucleotide sequences thus obtained, in particular by

gel electrophoresis.

  The invention also more particularly relates to the sequences E and F respectively represented in FIGS. 5 and 6, as well as their use for the implementation of a method of specific identification of different

  strains or pathovars of Eca, in particular according to the techniques described above.

  The present invention will be further illustrated with the aid of the description

  following description of obtaining the nucleotide sequence B according to the invention,

  and its specificity with respect to Eca strains responsible for the blackleg.

I - MATERIALS AND METHODS

  a) Bacterial Strains and Plasmids The bacterial strains and the plasmids used for the implementation of the genomic subtraction method used to obtain the B sequence are described in Table 1. The microorganisms tested in the context of FIG. Dot-blot hybridization experiments (stain deposits) with the probes obtained are shown in Table 2. The strains of Erwinia and Escherichia coli were cultured on Luria medium (Miller 1972) at 30 ° C. and 37 C respectively. Antibiotics were used at the following concentrations:

  ampicillin 50 / g / ml and streptomycin 100 / g / ml. X-gal (O-nitrophenylpD)

  galactopyranoside, Sigma) was used at the concentration of 40 / g / ml.

b) Preparation of the DNA

2705349

  The total genomic DNA was extracted and purified by the Klotz method and

Zimm (1972).

  The target DNA was digested with Sau3A1 according to the manufacturer's recommendations (Boehringer Mannheim). After digestion, the DNA was extracted once with the phenol-chloroform mixture, precipitated, washed and resuspended at 0.1 μg / l.

  in the buffer pH 8.0 [10 mM N- (2-hydroxyethyl) -piperazine-N '- (3-

propanesulfonic acid), 1 mM EDTA].

  Two hundred μg of trap DNA was fragmented by sonication in 3 ml

  EE buffer. The average size of the DNA fragments is 1000 bp.

  The sonicated DNA is concentrated with 7.5 ml of 2-butanol, precipitated with ethanol

  absolute (2 volumes), washed and resuspended at 1 / g / gl in water.

  The genomic DNA concentrations used for subtraction are measured very accurately with the spectrophotometer (at 260 nm, 1 OD = 50 Ag / ml DNA), and by comparing the intensity of the bands against a standard after gel electrophoresis. 0.8% agarose for 1 hour 30 minutes at 75 V in TBE buffer (Tris Borate EDTA), and staining with ethidium bromide

(Maniatis et al., 1982).

  Genomic DNA for dot-blot assays was extracted as described above with reduced volumes of 10-fold. Each DNA was monitored by UV spectrophotometry and electrophoresis after digestion with

EcoRI (Boehringer Mannheim).

  Large-scale preparations of plasmid DNA were made from clear lysates followed by two density gradient centrifugations.

  cesium chloride with ethidium bromide (Maniatis et al., 1982).

  Small scale preparations were carried out by the rapid method of

Holmes and Quigley (1981).

  c) DNA labeling with (a 32 p) dATP The DNA was labeled using Boehringer Mannheim DNA random primer labeling kit according to the manufacturer's instructions, 4 hours to

ambient temperature.

  Removal of unincorporated triphosphate deoxyribonucleotides was performed by chromatography on 0.5 ml of a Sepharose CL-6B column (Pharmacia). 50 ng of DNA were used per probe, while 1, g was

  labeled to track total genomic DNA.

d) Biotinvlation of DNA

16 2705349

  The reaction is carried out on microtiter plates placed on ice in a dark chamber. 50 μl of sonicated DNA at a concentration of 1 μg / μg are mixed with 50 μl of photobiotin acetate (Sigma) at a concentration of 2 μg / l per well. The mixture is photoactivated by a UV lamp, 10 minutes at 360 nm. After addition of 1M Tris pH 9 for a final concentration of 100 mM, the biotinylated DNA is extracted four times with 1-butanol (saturated with water), precipitated with ethanol, washed and resuspended at a concentration of 2. , 5 / g // l in the

buffer 2.5 EE, pH 8.

  e) Genomic subtraction The nucleotide sequences A to F shown respectively in FIGS. 1 to 6 are obtained by genomic subtraction between two strains of Erwinia carotovora, one of these two strains being pathogenic, while the other is not pathogenic (at least under the conditions, especially

  climatic, o the previous strain is pathogenic).

  The pathogenic Erwinia carotovora strain is a strain of Erwinia carotovora subsp. atroseptica (Eca) responsible for the blackleg in certain plants (particularly potato) in climates where, for at least some time, a temperature of about 15 C to about 25 C prevails, and the strain of Erwinia carotovora non-pathogenic, at least under the conditions of

  above-mentioned temperature, is a strain of Erwinia carotovora subsp.

carotovora (Ecc).

  The aforementioned genomic subtraction between the two strains of Erwinia carotovora is carried out according to the method of Straus and Ausubel described

  in European Patent Application No. 372,524 filed December 6, 1989.

  This genomic subtraction method is preferably carried out as follows: The DNA of the Eca strain, or target DNA, is cut into small fragments, from about 100 to about 1000 nucleotides, by the action of enzymes restriction, the DNA of the Ecc strain, or DNA trap, is cut into fragments, from about 1000 to about 10 000 nucleotides, by sonication, these fragments being subsequently labeled, for example with biotin or other molecule allowing the detection of nucleic acids (for example by trapping), the aforementioned fragments of target DNA and trap DNA are mixed in such proportions that the trap DNA is in excess of the target DNA , in particular in a range of DNA trap / target DNA ratios of approximately 2 to 100, and advantageously in a ratio of approximately 40,

At 17

* 17 2705349

  the fragments of target and trap DNA thus mixed are denatured by heating, in particular at a temperature of approximately 100 ° C., which leads to the formation of target DNA fragments and single-strand trap, and then the DNA fragments single strand obtained in the previous step are placed under hybridization conditions such that they allow the formation of double-stranded DNA fragments consisting of two strands of target DNA (homoduplex target), or two strands of DNA trap (homoduplex trap), or a strand of target DNA and a strand of trap DNA (heteroduplex), in particular under hybrid conditions relatively low stringency (low stringency) at a temperature of about 65 C in the presence of 1M NaCl, the double-stranded DNA fragments obtained in the preceding hybridization step, are then placed in the presence of a reagent having an affinity for the aforementioned marker, for example avidin or streptavidin having an affinity for biotin (const dissociation ante of about 10-15M), this reagent being immobilized on a solid support (such as beads), so that homoduplex traps and labeled heteroduplexes, in particular biotinylated, remain fixed on the solid support by bonding between the marker used to label the trap DNA and the aforementioned reagent, especially on the avidin or streptavidin-coupled beads, - recovery, in particular by filtration or sedimentation of the solid support, of the unlabeled target homoduplex constituting the nucleotide sequences specific for the strain of pathogenic Erwinia carotovora, - advantageously, repetition of the preceding steps between about 3 and 5 times, from the solution obtained in the previous step as the target DNA solution, so as to eliminate the homoduplex trap and heteroduplexes likely to be present in said solution, if appropriate, ligating oligonucleotide adapters, of sequences known, on both sides of the specific nucleotide sequences (homoduplex targets), this ligation being carried out in particular by the action of a ligase-type enzyme, and amplification of the number of these specific nucleotide sequences by implementation of a method for amplifying (or multiplying or replicating) the number of copies of said specific nucleotide sequences, in particular according to PCR (Polymerase Chain Reaction), 3SR (Self-Sustained Sequence Replication) techniques or any other technique using hybridization between nucleic acids and making it possible to detect an initially small number of nucleic acids determined by

  multiplication of the number of copies of these.

18 2705349

  The abovementioned amplification method can be carried out according to the PCR and 3SR procedures described below. As an illustration, the adapters used may have the following nucleotide sequence:

'CACTCTCGAGACATCACCG 3'.

  The homoduplex fragments of target DNA obtained and amplified by the above methods can be isolated and multiplied in pure form,

  especially by cloning into a suitable vector.

  the strain of Eca is the strain 86.20 deposited in the National Collection of Culture of Microorganisms (C.N.C.M.) of the Institut Pasteur in Paris on March 30, 1993 under the number 11295, and the strain of Ecc is the strain CH26

  deposited at the C.N.C.M. March 30, 1993 under number I1294.

  To perform this genomic subtraction, 10 μg of biotinylated trap DNA

  and 250 ng of digested target DNA were used for the first round of subunit.

  genomic traction according to the protocol of Straus and Ausubel.

  The procedure was not changed except that the screening DNA and yeast tRNA were not added to the reaction mixture. Binding of biotinylated DNA was performed with a 5% streptavidin solution (Dynabeads ™ M-280, Dynal A.S., Oslo, Norway). At each successive round of hybridization, 10 μg of biotinylated trap DNA were added to the samples. At the end of the last cycle, the resulting samples were precipitated with ethanol and resuspended in 5/1 of TE buffer.

  pH 8 (Tris EDTA, Maniatis et al., 1982).

Protocol: Ten μg of biotinylated trap DNA and 250 μg of digested target DNA are mixed with 3 ml of EE buffer, pH 8.0. The whole is boiled for 1 min. The whole is then dried by evaporation and resuspended in 4 ml of sterile distilled water. One μl of 5M NaCl solution is added, mixed and pulsed. The sample is then covered with 20 μl of mineral oil (Sigma) and placed in a thermal incubator at 65 ° C. for 17 minutes.

hours.

  The hybridization mixture is then taken up in 100 μl of EEN buffer, pH 8.0 (0.5 M NaCl, 10 mM N- (2-hydroxyethyl) -piperazine-N '- (3-propane)

  sulfonic acid) (EPPS), 1 mM EDTA) and vigorously mixed (Vortex).

  The mineral oil is removed gently, and 100 μl of a 5% solution of streptavidin-coated magnetic beads, washed and resuspended in EEN buffer (Dynabeads, Dynalabs), are added. The mixture is left to

  incubate 30 min at room temperature.

19 2705349

  The mixture is then placed on a filter adapted to the Eppendorf tube, and filtered by centrifugation for 6000 g, 15 s. The hybridization tube is rinsed with 200 μl of EEN buffer, and the rinsing liquid is placed on the filter and centrifuged under the same conditions. The whole filtrate is precipitated with 1 ml of absolute ethanol, 5 min at -80 ° C., centrifuged for 30 min at 10,000 g. The nerve

  (invisible) is rinsed with absolute ethanol and dried.

  The pellet is then resuspended in 4 μl of biotinylated trap DNA (10 μg).

  The resuspension must be thorough and be performed all along the wall of the tube (outer side, centrifugal force). The resuspended DNA is boiled for 1 min. And 11 μl of 5 M NaCl are added. The mixture is placed at 65 C

  for 17 hours for a new subtractive hybridization cycle.

  After four cycles of subtraction, the precipitated DNA is resuspended in ml of sterile distilled water. f) Ligation of Adapters for PCR Amplification The following oligonucleotide primer:

'GACACTCTCGAGACATCACCGTCC3'

  and the complementary 5 'phosphorylated primer

'GATCGGACGGTGATGTCTCGAGAGTG3'

  are mixed in equal proportion, 100 ng // ul each, brought to boiling point

  1 minute in a bain-marie. The primers are allowed to hybridize in the bath-

  marry until it has returned to room temperature.

  Two-and-one-half of the DNA resulting from the genomic subtraction is mixed with 50 ng (2 / l of the above mixture) of the adapter solution, with 1 μl of ligation buffer, 1 μl of ligase (Stratagene ) and 3.5 Al of distilled water

  sterile. The reaction mixture is placed at 16 ° C. for 12 hours.

  After ligation, the mixture is taken up in 20 μl of TE buffer pH 8.0 (Tris EDTA) and filtered through a minicolumn of Sepharose CL-6B by centrifugation for 5 min at 2,000 g. The filtrate is extracted once with phenol-chloroform and precipitated at

  absolute ethanol, the dried pellet is resuspended in 5/1 of TE buffer.

  g) Amplification of the subtractive library by PCR The assembly of the DNA bound to the adapters is mixed with 5 ml of PCR buffer (Boehringer Mannheim), 100 pmol of the primer 5'CACTCTCGAGACATCACCG3, 200 mM of each dNTP, with 2.5 units of Taq polymerase (Boehringer Mannheim) in a volume supplemented to 50 / l with sterile distilled water. The mixture is covered with 50 Al mineral oil. The amplification is carried out in a thermocycler (Pharmacia): 1

2705349

  min at 94 ° C., 1 min at 65 ° C. and 1 min at 72 ° C. for 25 cycles. An aliquot of / l is taken after these 25 cycles and amplified again 25 times in

identical conditions.

  Ten μl per sample are analyzed by electrophoresis in 6% acrylamide gel (Ausubel et al., 1987), 200 V for 1 hour, and staining with

ethidium bromide (2 mg / l).

  h) Cloning of fragments from PCR

  The plasmids used for cloning are those described in Table 1.

  The ligation procedure is the same as that described above, with a 1: 1 ratio. The DH5a strain of Escherichia coli has been transformed by

  electroporation (Ausubel et al., 1987).

  Cloning of the fragment mixture and colony hybridization protocol. A first cloning on all the fragments was carried out in the plasmid pUBS-3 carrying the resistance to ampicillin. The plasmid is restriction-opened with the BamHI enzyme, generating cohesive ends compatible with the palindromic sequences of the Sau3Al site. The different fragments resulting from the PCR are stripped of their adapters by digestion with the enzyme Sau3A1. This allows to obtain prominent Sau3A1 ends. The plasmid and the fragments are mixed in equal amount (200 ng of DNA in total) and ligated according to the above protocol in 10 / l of reaction volume. The mixture is used to transform the strain DH5ax

Escherichia coli.

  One hundred and fifty-one of a suspension of competent cells of Escherichia coli (20 ml of culture in exponential growth phase in medium L, at 37 ° C., with stirring, or at OD 0.5 at 600 nm, are incubated. min on ice, washed in sterile distilled water at 4 ° C., centrifuged at 4000 g for 20 minutes and incubated for 10 minutes on a bed of ice, twice, and the final residue is resuspended in 0.5 ml of sterile distilled water at 4 ° C.) are mixed with 2.5 μl of the ligation mixture (50 μg of DNA) in an electroporation vat. The tank is immediately placed in the apparatus and the solution is subjected to an electric current (set at 2.5 KV, 25 mF and 400 W). One ml of SOC medium (0.5% yeast extract, 2% tryptone, 2 mM NaCl, 2.5 mM KCl, 10 mM MgCl 2, 10 mM MgSO 4, 20 mM glucose) is added immediately, the mixture transferred to Eppendorf tube. 1.5 ml and incubated for 30 minutes at 37 C. Four transformations

are thus realized.

21 2705349

  Ten to 100 μl of the transformation mixtures are plated on L agar medium containing 100 μg / ml of ampicillin. The dishes are incubated at 37 ° C

  for one night. The rest of the mixture is kept at 4 C.

  Antibiotic resistant colonies are counted, and dilutions are made on the mixtures to obtain a concentration of 300 bacteria per 100 μl, knowing that about half of the bacteria will be dead during storage at 4 ° C. All the mixtures of transformation is spread out, per agri plate on agar medium containing the antibiotic and the plates incubated at 37 ° C. for 24 to 48 hours (to obtain colonies of 1 mm of

diameter).

  Nylon membranes (Hybond N +, Amersham), cut to the size of the boxes, are gently applied to the colonies, and membrane / box position marks are marked. The membranes are then carefully removed and placed on blotting paper impregnated with lysis solution (50 mM Tris HCl pH 8.0, 25% sucrose, 10 mM EDTA, lysozyme 1.5 g / ml), 5 min, side contact. with the bacteria up. The membranes are then transferred to blotting paper impregnated with denaturing solution (0.5 N NaOH, 1.5 M NaCl, 0.2% Triton X100), 5 min, and then with neutralizing solution, twice 5 min (Tris HCl). 5 M pH 8.0, 2.5 M NaCl). The membranes are then dried and cooked for 1 hour in the oven at 80 ° C. under vacuum to fix the DNA. The

  boxes containing the bacteria are stored at 4 C.

  The membranes are prehybridized and hybridized, using as ct32P-labeled probe all the fragments derived from PCR. The radioactive labeling and hybridization protocols are described below. After autoradiography of the membranes, the colonies showing a hybridization signal are identified by the orientation of the membranes, autoradiographs and culture dishes. These colonies are taken with a toothpick, inoculated with 10 ml of L medium, with ampicillin and incubated at 37 ° C.

with stirring overnight.

  The cultures are centrifuged for 10 minutes at 6000 g. The pellet is taken up in ml of 50 mM Tris buffer pH 8.0, containing 25% sucrose. A volume of 400 ml of MSTET (5% sucrose, 5% Triton X100, 50 mM EDTA, 10 mM Tris HCl pH 8.0), added with 7, 1 of lysozyme at 40 mg / ml are added and the whole is carried boiling 45 seconds and dipped in ice. The mixture is centrifuged at 4 ° C. for 30 minutes at 10,000 g. The supernatant is then gently removed, the DNA extracted once with the phenol-chloroform-alcohol mixture

  isoamyl, precipitated and resuspended in 20 μl of TE buffer pH 8.0.

22 2705349

  Five μl of each preparation is digested in the presence of 1 μg of boiled RNAse, the restrictions are analyzed by acrylamide gel electrophoresis. Clones containing an insert are identified by comparison of

  electrophoretic profiles with the starting plasmid.

  Cloning of pre-purified fragments by electroelution and selection of

clones on X-gal medium.

  The PCR fragments, freed of their adapters (100 ng of each fragment), are separated by electrophoresis on acrylamide gel. Each band is delicately cut with a scalpel and recovered (some close bands can not be separated and are collected together). Each acrylamide strip is placed in a dialysis coil (Spectrapore) in distilled water. The tubes are placed in a horizontal electrophoresis tank containing half-diluted TBE buffer. The acrylamide strips are oriented in the direction of the length of the flange, anode side. Two hundred volts are applied for 1 hour. The current is then reversed 10 s, to take off the DNA from the dialysis membrane. It is verified under UV lamp that the DNA is well out of acrylamide. The solution is then homogenized, recovered and the DNA is extracted once with phenol-chloroform-isoamyl alcohol, precipitated and

  resuspended in 5 l of distilled water.

  The electroeluted purified DNAs are mixed with an equal amount of vector (50 ng each). In this case, it is the plasmid pTZ19R, carrying the resistance to ampicillin and the ca fragment of the P3galactosidase (lacZ) gene. The plasmid is open by restriction with the enzyme BamHI, whose site

  is located in lacZ. Ligation and transformation are performed as above

  above. The bacteria are then plated on medium containing ampicillin (100 μg / ml), IPTG (Isopropylthiogalactoside, inducer) and the substrate of the enzyme, X-gal (O-nitrophenyl-13D-galactopyranoside , 100, g / ml). Plasmid-containing colonies are selected by ampicillin, colonies

  containing a plasmid with insert are identified by the absence of P3-activity

  galactosidase: the white colonies are mutated by insertion in lacZ, the blue colonies have a functional P3-galactosidase system. Colonies

  white are selected and analyzed as above.

  i) Hybridations Marking A32P Probes by Random Priming Hybridization

or "Random priming".

  Fifty ng of insert purified from the cloning plasmid by digestion, electrophoresis in acrylamide gel and electroelution are used

23 2705349

  as a probe. The labeling is carried out with the "Random primed DNA labeling kit" (Boehringer Mannheim). Fifty ng of DNA is mixed with 2/1 of buffer containing hexanucleotide primers, 1/1 of each dNTP (except dATP). The volume is completed to 14/1 with sterile distilled water, boiled for 3 minutes, and the tube immersed in ice. Polymerase gl (Klenow fragment) and 5 μl of (α32P) dATP (50 μCi) are

  added. The mixture is allowed to incubate for 4 hours at room temperature.

  The labeled probe is then purified (stripped of unincorporated labeled nucleotides and short non-specific oligonucleotides) by filtration on Sepharose CL-6B in a pierced 0.5 ml Eppendorf tube placed in a 1.5 ml tube, in vacuo. centrifuging for 5 minutes at 2,000 g. The effectiveness of the marking is verified at the p3 detector. The probe is distorted just

  before hybridization by boiling for 3 minutes, and the tube immersed in ice.

  Hybridization of dot-blot DNAs: The DNAs of different microorganisms (Table 2) were denatured and fixed by the proposed alkaline method for Hybond N + membranes (Amersham). Genomic DNA for the Southern method was treated with several endonucleases according to the manufacturer's instructions (Boehringer, Mannheim). The reaction mixtures were passed on 0.8% agarose gel

  using 1 / g size marker (1 kb of BRL ladder).

  The Southern method was carried out on Hybond N + membranes

  according to the manufacturer's instructions.

Preparation of the membranes.

  membranes for hybridization in "dot blot" Two g of DNA per sample, in a volume of 1.5 / l, are mixed with an equal volume of a sodium hydroxide solution (0.4 M NaOH, 1 mM EDTA) and deposited on a nylon membrane (Hybond N +, Amersham). When all the samples are deposited, the membrane is placed on the DNA side upwards for 5 minutes on a blotting paper impregnated with a denaturing solution (0.5 M NaOH, 1.5 M NaCl) and then 1 min. neutralization solution (0.5M Tris HCl, pH 7.2, 1.5M NaCl, 1mM EDTA), 20min on a fixing solution (0.4M NaOH) and rinsed for 1min in 2X SSC (Citrate Citrate). 0.03 M sodium, 3 M NaCl). The

  The membrane is then dried and can be stored at room temperature.

  membrane for Southern hybridization.

  Two to three μg of DNA per sample were digested with restriction enzymes and separated by electrophoresis on a large 0.8% agarose gel (300 ml). After reading, the gel is processed to transfer the DNA to a nylon membrane. The gel is treated twice in 15 min in 0.25 M HC1, rinsed with water

24 2705349

  distilled, incubated twice for 15 minutes in denaturing solution (1M NaOH, 1.5 M NaCl), rinsed with distilled water and 30 minutes in neutralizing solution (Tris HCl 0.5

M, 1.5 M NaCl pH 7.5).

  The following assembly is then carried out: 6 sheets of Whatmann 3M paper cut to the exact size of the gel and soaked with 20X SSC (0.3M sodium citrate, 3M NaCl) are deposited at the bottom of a tray. The electrophoresis gel is then superimposed on these sheets, then covered with the membrane cut to the size of the gel. A sheet of Whatmann paper and a stack of dry "cloths" (15 to cm thick), also gel-sized, are placed on top. Finally a glass plate and a weight not exceeding one kg are added. The DNA is transferred by capillary action for at least 6 hours. The membrane

  is then recovered, dried and baked at 80 ° C under vacuum.

- Hybridization and washes.

  The membranes are prehybridized, at 65 C, with stirring, at least

  one hour in a solution of 6X SSC, SDS 0.5%, skimmed milk 0.05%.

  The hybridization is carried out in a volume of 10 ml, in a welded plastic bag, in a solution of 6X SSC, 0.1% SDS, 0.1% skimmed milk containing the

  denatured probe, 17 hours at 65 C.

  After hybridization, the membrane is washed once in 3X SSC, 0.1% SDS, at 65 ° C., twice at 0.3 × SSC, 0.1% SDS at 65 ° C., and for conditions

  stringent twice in 0.1X SSC, 0.1% SDS at 68 C.

  The membrane is then slightly wiped and placed under plastic film.

  The membrane as a function of the number of counts / min observed on the counter of

  P-ray is placed for a longer or shorter time in the presence of a film of

  diography in a cassette at -80 C. The autoradiography is then developed. j) Direct Sequencing on a Plasmid Sequencing is carried out directly on a double-stranded plasmid with two primers chosen from the sequence of the lacZ gene 150 nucleotides apart from the cloning site. The sequence reaction is carried out by the "dideoxychain termination" method of Sanger et al. (1977) using the SequenaseTM kit (United States Biochemical Corporation). For each sample, the forward primer and the reverse primer are used separately. For each sample, a first step of elongation from the primer is performed by DNA polymerase (sequenase) in the presence of a limiting amount of dNTP and (ao32P) dATP for 5 min at room temperature. The reaction mixture is then divided, for each sample, into four wells

* 25 2705349

  containing dNTPs in non-limiting quantity and for each of these wells one of the dideoxynucleotides (ddATP, ddCTP, ddGTP or ddTTP). This reaction is carried out for 5 minutes at 37 ° C. and is then stopped by addition of EDTA. The samples can be stored at -20 ° C and boiled for 2 minutes just before being deposited on gel, their deposit always being done in the order

ddATP, ddCTP, ddGTP and ddTTP.

  The separation of the different fragments is carried out by electrophoresis in acrylamide gel (6%, urea 460 g / l in TBE buffer), 80 cm long, at a temperature of

  constant power of 100 W (duration 3-6h).

  The gel is then demolded and fixed in 10% methanol, 10% acetic acid, transferred onto Whatmann 3M paper, covered with a plastic film, and the whole is dried by heat and under vacuum in a gel dryer. The gel is then placed with an autoradiography film in a cassette, for a variable duration, according to the number of counts / min at the P-ray counter. The sequences are then read and recorded on a computer for analysis. The programs used are those of GCG (University of Wisconsin, Genetics Computer Group, Devereux et al., 1984). Sequence homology searches are carried out in databases

Genbank and EMBL.

  II) Results a) Determination of the subtraction conditions The conditions for biotinylation of the DNA and streptavidin binding were tested at the same time: 1 / g DNA of the 397 strain of Erwinia chrysanthemi cut with a32P have were mixed with 49 μg of the cut strain 3937 DNA. The mixture was biotinylated as previously described in the Materials and Methods chapter. Ten μg of biotinylated DNA were incubated with different concentrations of streptavidin coated beads (0.5%, 1%, 2.5% and 5%). For solutions of 0.5, 1 and 2.5%, some radioactivity remains in the free fraction. The 5% solution has been

  determined to be the most effective link condition.

  The number of subtraction cycles was determined using the following two criteria: homologous sequence binding and non-homologous sequence enrichment. Two libraries were obtained with the following pairs: (i) 100 ng of Sau3Al-digested Q fragment labeled with a32P, 2 kb of the Smr / Spcr DNA fragment (Prentki and Krisch 1984), were

26 2705349

  mixed with 150 ng of genomic DNA of Sau3Al-digested strain 3937, and subtracted with biotinylated DNA of strain 3937, (ii) 250 ng of Sau3A1-digested strain 3937 DNA and labeled with a32P a was subtracted with the biotinylated DNA of 3937. The recovery at each cycle of non-homologous sequences (control Q fragment (i)) in the free fraction and the binding of homologous sequences (control 3937 DNA (ii)) were estimated by counting the distribution of radioactivity in free and bound fractions. After four cycles of subtraction, the enrichment factor (ratio between the isolated heterologous sequences and the losses in sequences

  homologues) is 14 and homologous sequence binding of 99%.

  However some losses occurred at each cycle for the heterologous sequences (approximately 40%), and after 4 cycles the losses are 80%. For this reason, 4 cycles have been estimated to be sufficient to allow enrichment in heterologous sequences and to avoid losses.

too important.

  b) Generic subtraction Four cycles of subtraction hybridization were performed for each of the following pairs (target DNA / trap DNA): (i) positive control strain PMV 4071 / strain 3937 (omega (Qf) insertion fragment of mutant 4071 in Ech 3937 strain as target DNA and strain 3937 as trap DNA), (ii) the library subtracted between 8620 and CH126 (Eca strain 8620 as probe source and Ecc CH26). as a trap DNA) and (ii) a CH126-CH126 negative control. The results of the subtraction are shown in Figure 1. The positive control shows two amplified fragments of approximately 230 and 300 bp. Treatment with the restriction enzyme Sau3A1 of the Q fragment generated eight main fragments of 460, 300, 230, 190, 150, 80 and 60 bp. Of all these fragments, only a part (33% of the fragment) was reisolated by genomic subtraction. The differential library between Eca and Ecc has 6 main DNA fragments (190, 200, 250, 300, 400 and

  410 bp) and a double band of about 450 bp less clear than the others.

  No amplified fragments are present in either the Negative Negative Control or the Negative PCR Control. In all genomic subtraction samples, cut DNA was observed on gels

Electrophoresis.

A 27 2705349

  c) Cloning Probes from the Subtracted Library Samples from the PCR were treated with Sau3Al before cloning to remove the adapters and have compatible BamHI ends. First, the entire library was used for global cloning with BamHI-treated pUBS-3 as a vector. Colony hybridization (Maniatis et al., 1982) after cloning the entire library, isolated two inserts containing clones using the entire library as a probe. A second approach was cloning, after separation of the library into four 6% polyacrylamide gel fractions and purification by electroelution (Maniatis et al., 1982). The cloning vector used in this case was pTZ-19R treated with BamHI, the colonies

  White E. coli DH5α transformed were selected on Xgal medium.

  This second strategy led to the production of 4 clones containing inserts.

  The six clones were named respectively A, B, C, D, E and F in

  the order of decreasing size (see Figure 2, and Table 1).

  d) Hybridization Experiments The hybridizations were carried out with the six probes. For most strains, the hybridizations were performed at least twice on separate membranes. Table 2 illustrates the results. Probes E and F give a signal only for a limited number of Eca strains. The

  Probe A gives a positive signal for most of the tested strains

  Ecc, and is absent in some strains and in that of the trap DNA.

  The results obtained with probe B are shown in FIG. 3. Under stringent washing conditions, only the typical Eca strains are hybridized, and under less stringent washing conditions a few cross hybridizations were observed with strains of ecb. For probe C, all typical Eca strains have a positive signal and some Ecc strains as well. Regarding probe D, all strains of Eca

  ("atypical and typical") and some strains of Ecc were hybridized.

  The DNA of Eca strain 86.20 was digested with several endonucleases (BamHI, ClaI and Sau3Al) and transferred after electrophoresis to membranes (Southern technique). The hybridization results with the six probes are shown in FIG. 4. Different DNA fragments obtained with different endonucleases were hybridized with the 6 probes, thus indicating that the probes are not grouped in the genomic DNA (cluster). of the Eca strain 86.20. In addition, the lack of hybridization signal with Ecc CH26 DNA and the

28 2705349

  presence of this signal with Eca DNA 86.20 indicates that the probes

  correspond to the subtraction library.

  e) Sequencing of the DNA The sequences of the probes A, B, C, D, E and F were obtained. The results are shown in FIG. 5. For each probe, homologies were searched for on the Genbank and EMBL databases. No significant homology was observed for the sequences except for probe A, which has significant homology with the putP gene of Salmonella typhimurium and E. coli. This gene codes respectively for a proline permease (73.8% homology) and a proline transporter (73.2% homology). TABLE 1: Bacterial strains and source plasmids source or reference E. coli DH5ca endA1 hsdR17 (rK-mK +) supE44 Bethesda Research thi-1 X7 recAl gyrA {80dlacZAM15 Laboratories A (lacZYA-argF) U169 Eca 86.20 strain isolated from apple B. Jouan (Earth Station (France, 1986) Plant Pathology, INRA, Le Rheu, France) Ecc C1126 strain isolated from O. Cazelles earth apple (Switzerland, 1985) (Changins, Switzerland) Ech 3937 strain isolated at from Saintpaulia Kotoujansky et al. ionantha (1982) PMV 3937 pelE-, fragment Q Smr-Spcr M. Boccara 4071 of R100.1 in the restriction site (Bglll Laboratory Plant Pathology,

INRA INA P-G,

Paris, France)

29 2705349

  TABLE 1 (cont'd): Bacterial strains and plasmids characteristic source or reference plasmids pUBS-3 pUC derivative containing G. Murphy (IPS, pBLUESCRIPT Norwich, UK) pIP450 pUC derivative containing a fragment Prentki and Krish Smr-Spcr of R100.1 (1984) pTZ19R pUC derivative with a promoter from Mead et al. (1985) T7 pPMV174 RNA polymerase pUBS-3 derivative containing probe A Collection of in BamHI site (Apr) INRA laboratory (Plant Pathology, Paris) pPMV176 derivative pTZ19R containing probe B in BamHI site (Apr) pPMV177 derived pTZ19R containing Probe C in BamHI site (Apr) pPMV175 derived pUBS-3 containing Probe D in BamHI site (Apr) pPMV178 derivative pTZ19R containing probe E in BamHI site (Apr) pPMV179 derivative pTZ19R containing Probe F in the BamHl site (Apr)

2705349

  TABLE 2. Results of Hybridization Host Strains Country Results of Year Hybridization with Probes

A B C D E F

Eca

88.33 France, + + + + + -

of land 19881

88.45 "France, + + + + + -

88.1 "France, + + + + - -

88.22a "France, + + + + + +

88.24 "France, + + + + - -

88.30a "France, + + + + + -

87.7 "France, + + + + - -

87.13 "France, + + + + + +

87.16a "France, + + + + + -

87.16b "France, + + + + + -

  86.14.11 "France, + + + + - + 86.20" France, + + + + + +

511 "France, + + + + + -

SF1. l, Germany3 + + + + + -

  161 "Holland4 + + + + + + Cip114" Peru, + + + + + +

Cipl25 "Peru, + + + + - -

Cipl31 "Peru, + + + + - -

  CipO26 "Peru, + + + ++ + SH164.4" Reunion, + + + + + +

CH3 "Switzerland, + + ++ - -

31 2705349

TABLE 2 (continued 1)

CH5 "Switzerland, + + + + - -

CH6 "Switzerland, + + + + + -

SF18.296 "Switzerland, + + + + + +

1329 "UK, 19672 + + + + - +

1330 "UK, 19672 + + + + - -

SCRI1043 "UK, 19857 + + + + + +

1526 "UK, 19572 + + + + - +

1527 "USA, 19732 + + + + + +

1525 "USA, 19692 + + + + + +

1453 tomato France, + + + + - -

1546 "France, + + + + - -

89.19 * Argentine apple, + - - + - -

from 19891 earth

1H * water Spain, + - - + - -

H1 * Spain, + - - + - -

ecb

  2121 beetroot USA, 19722 + - - - - -

2122 "USA, 19722 + - - - - -

1520 sunflower Mexico2 -

Ecc

SH230.134 banana Cuba3 +.

CM1 Malawi cabbage, +.

798 carrot USA2 -

(ATCC 495)

CH15 celeri Switzerland, - - - + -

1489 chrys- France, -

anthem 19712

1458 "USA, 19712 + - + - - -

SH230.115 but Cuba3 + -.

1350 con Italy2 + - + -

Combre

1285 Cycla- Greece2 + -

leads SE99.1 chicory France,

32 2705349

TABLE 2 (continued 2)

1488 iris France, - -

SB89.7 leek France, - -

2046T apple Denmark + -

from 19522 earth

88.22c "France, - -

88.29al "France, + -

88.44 "France, - -

87.25 "France, -

86.14.51 "France, -

S99 "France, - - - + -

S101 "France, - - -

76.26 "France, - - -

PM2 "Malawi, + - - +

194 "Morocco, - -

Cip360 "Peru, + - + -

Cip361 "Peru, + - + -

CipOO9 "Peru, - - + -

CH24 "Switzerland, - -

CH26 "Switzerland, - -

SCRI193 "USA7 + - - -

1336 "UK, 19672 - -

Si82.1 "Vietnam, + -

SG162.6 sunflower France, - -

33 2705349

TABLE 2 (continued 3)

1403 Yougo- - - - - - -

slavia, 797 tobacco USA, 19512 + - +

SG39.1? Reunion, + - - -

The meeting,

SG39.3? 19873 + - + - - -

Eco 1893 celeri France,

CHll "Switzerland, + - -

2155 endive France, + - -

2154 "France, + - -

1892 "France, + - -

1959 "France, + - -

1878 "France, -

1879 "France, +

1880 "France, -

  1646.2 leek France, + 1654 "France, + - - - - +

CH4 Swiss Lettuce, -

  Ech 3716 kalen- France, + choe 19789 1596 corn France, + EP22 philoMartinique + dendron 198710 1271 but Egypt SH1230-C94 tobacco Cuba3 3665 diffenba- France + chia 19749 TABLE 2 (continued 4) 3937 saint-France + paulia 19779 1499 but France 1888 apple France + soil 19782 CH29 apple Swiss earth 19886 2267 apple Australia earth 19782 1871 banana Ivory Coast

CH36 Swiss apple -

  19876 1275 carnation USA + 3805 philo- France + dendron 19769 2015 apple France + earth 19752

1236 parth- USA + - - - - -

Enium 19452

B374 pelar- Comoros + - - - - -

gonium 19602

* 2013 dalhia France + - - - - -

2051 diffenba- USA + - - - - -

chia 19572

Erwinia hawthorn France 1.

  amylovora [11 Erwinia no Francel 1 +

herbicola [1] patho-

  Erwinia rhubarb gene Suisse6 + rhapontici [1] Pseudomonasjfluore ail 19763 pv. lomagnae [1] Pseudomonas apple from USA, 19703 marginalis [1] soil Pseudomonas apple from Costa Rica3 solanacearum [1] earth

2705349

  TABLE 2 (continued 5) Pseudomonas France 11

syringae pv.

phaseoli-

  cola [1] Pseudomonas Netherlands4 + sp. [2] Pseudomonas chicory Switzerland6 viridiflava [1] Rhizobium France meliloti [21 Azorhizobium Sesbania Senegal10 caulinodens rostrata [1] Klebsiella France10 pneumoniae [1] Agrobacterium France i tumefaciens ['i Xanthomonas France campestris [2] Clavibacter apple USA, michiganensis de terre 19763 [1] Brucella Francel melitensis [1] Yarrovia France i lipolytica [11 Yersinia salmo France, ruckeri [1] 1982 "1

Yersinia patho- ATCC- + -

  pseudo gene 23207 human tuberculosis -29833 [11 apple bacteria Spain8 saprophytes of soil [8]

Escherichia + -

  coli [1] Bacillus apple France, polymixa earth 19793 [11]

36 2705349

  (.) Not done. (*) Atypical Eca strain, recently identified as Ecc strain by their phenotypic and genotypic characteristics. (T) Type strain of the species. [n] Number of strains tested. (1) Bernard Jouan, National Institute of Agronomic Research, Rennes, France, personal collection. (2) CFBP, French Collection of Phytopathogenic Bacteria, INRA, Angers, France. (3) Régine Samson, National Institute of Agronomic Research, Angers, France. (4) IPO, Research Institute for Plant Protection, Wageningen, The Netherlands. (5) CIP, International Potato Center, Lima, Peru. (6) Olivier Cazelles, Federal Agricultural Research Station, Changins,

  Switzerland, personal collection. (7) SCRI, Scottish Crop Research Institute, UK.

  (8) Maria Lopez, Instituto Valenciano De Investigaciones Agrarias, Spain, personal collection. (9) Monique Lemattre, National Institute of Agronomic Research, Versailles, France, personal collection. (10) Claudine Elmerich, Pasteur Institute, Paris, France, personal collection. (11) CFISM, French Computerized Collection of Microbial Strains, National Institute of

Agronomic Research, France.

BIBLIOGRAPHY

  Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G.

  Smith, J.A., and Struhl, K. 1987. Current protocols in molecular biology.

Greene / Wiley, New York.

  Barany, 1991, Biochemistry, vol. 30, No. 11, 2735.

  Bloch, 1991, Proc.Natl. Acad. Sci. USA, vol. 88, 189-193.

  Devereux, J., Haeberli, P., and Smithies, O. 1984. A comprehensive set of

  sequence analysis programs for the VAX. Nucleic Acids Research. 12: 387-

395.

  Welsh, A., and Samson, R. 1992. Erwinia carotovora subsp. odoriferous subsp.

  Nov., associated with odorous soft rot of chicory, Cichorium intybus L.

  International Journal of Systematic Bacteriology. 42: 582-588.

  Gilliland et al., 1990, PCR Protocols. A guide to Methods and Applications.

  Edited by Innis, Gelfand, Sninsky, White. Academic Press Inc.

37 2705349

  Holmes, D.S., and Quigley, M. 1981. A rapid boiling method for the

  preparation of bacterial plasmids. Analytical biochemistry. 114: 193-197.

  Klotz, L., and Zimm, B.H. 1972. Size of DNA determined by viscoelastic measurments: Results on bacteriophage, Bacillus subtilis and Escherichia

coli. J. Mol. Biol. 72: 779-800.

  Kotoujansky, A., Lemattre, M., and Boistard, P. 1982. Utilization of a thermosensitive episome bearing transposon Tn 10 to isolate Hfr donor strains

  of Erwinia carotovora subsp. chrysanthemi. J. Bacteriol. 150: 122-131.

  Lelliott, R.A., and Dickey, R.S. 1984. Genus VII: Erwinia. Bergey's Manual

  of Systematic Bacteriology. Williams and Wilkins, Baltimore, MD. 469,473.

  Lelliott, R.A., and Stead, D.E. 1987. Methods for the diagnosis of bacterial

  diseases of plants. British Society for Plant, Blackwell Scientific publications.

  Maniatis, T., Fritsch, E.F., Sambrook, J. 1982. Molecular cloning: a

  laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

  545 pp. Marti, R., Lopez, M.M., Morente, C., and Alarçon, B. 1989. Incidence of erwinia-induced disease in Valencia (Spain). In Pro. 7th Int.

  conf. Plant Path. Bact., Budapest, Hungary, Eds: Z. Klement. 755-760.

  Miller, J.H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 466 pp. Pérombelon, M.C.M. 1989. Ecology and pathogenicity of soft rot erwinias: an overview. in. Proc. 7th Int. Conf. Plant Path. Bact., Budapest, Hungary, Eds:

Z. Klement. 745-751.

  Pérombelon, M.C.M., and Kelmnan, A. 1987. Blackleg and other potatoes diseases caused by soft rot erwinias: proposal for revision of terminology. seedling

diseases. 71: 283-285.

38 2705349

  Pérombelon, M.C.M. 1980. Ecology of the soft rot erwinias. Ann. Rev.

Phytopathol. 18: 361-387.

  Prentki, P., and Krisch, H.M. 1984. In vitro insertional mutagenesis with a selectable DNA fragment. Gene. 29: 303-309. Smith, C., and Bartz, J.A. 1990. Variation in the Pathogenicity and Aggression of strains of Erwinia carotovora subsp. carotovora isolated from

  different host. Plant disease. 74: 505-509.

  Stanghellini, M.E. 1982, and Meneley, J.C. 1975. Identification of soft rot

  Erwinia associated with blackleg of potato in Arizona. Phytopathology. 65: 86-

  87. Thomson, S.V., Hildebrand, D.C., and Schroth, M.N. 1981. Identification and nutritional differentiation of the erwinia sugar beet pathogen of members

  Erwinia carotovora and Erwinia chrysanthemi. Phytopathology. 71: 1037-

1042.

39 2705349

Claims (15)

  A nucleotide sequence characterized in that it comprises the nucleotide sequence B shown in FIG. 2, or its complementary sequence, or fragments of these sequences, or any of the abovementioned sequences modified by substitution and / or addition and / or deletion of one or more nucleotides, said fragments or modified sequences being capable, like the aforementioned B sequence, of hybridizing under conditions   stringent with the genome of Erwinia carotovora strains, subsp.   pathogenic atroseptica (Eca), especially under the following conditions: hybridization in 6 SSC, 0.1% SDS and 0.01% skimmed milk at 65 C overnight, followed by two washes for 30 minutes at 65 C in 0, 1 SSC, 0, 5% of SDS.   2. Nucleotide sequence according to claim 1, characterized in that it is labeled, in particular radioactively, enzymatically, by a fluorescent compound, by binding to an antigenic molecule (capable of being recognized by antibodies) or at any other time. another molecule capable of being directly or indirectly detected using reagents, this binding possibly being effected via a spacer arm, in particular via a nucleotide sequence consisting of approximately 5 to 100   nucleotides located at least at one end of these sequences.   3. Nucleotide sequence according to claim 1 to claim 2, characterized in that it is used as a nucleotide probe for the   detection of Eca strains responsible for the blackleg.   4. Primer couples used for amplification of the number of copies   nucleotide sequences according to one of claims 1 to 3, or   specific nucleotide sequences contained in the genome of Eca strains responsible for the blackleg, with which said sequences   nucleotides according to one of claims 1 to 3, are capable of   hybridize, especially under the conditions defined in claim 1, these primers being advantageously constituted of about 7 to about   nucleotides derived from the nucleotide sequences according to one of the claims 1 to 3. 2705349   5. A method for detecting and identifying Eca that may be present in the soil or water, or in a host, in particular in plants and seeds, which may be an apparently healthy carrier of such bacteria and found in latent phase of infection, this method comprising the following steps: the treatment of a sample taken from the soil or water or from this host so as to make the genome of these Eca accessible to the probes and / or   primers defined in claims 3 and 4, and where appropriate any DNA   or RNA polymerase for replicating the two strands of the genomic DNA or RNA derived therefrom, this treatment being carried out in particular by boiling, maceration (in a liquid such as water), grinding, or sonication, - contacting of the sample thus treated with probes according to claim 3, and if appropriate with primers according to claim 4, in particular under the hybridization conditions defined in claim 6, where appropriate, the amplification at the using pairs of primers according to claim 4, the number of copies of the nucleotide sequences specific pathogenic Eca, responsible in particular for the black leg, and contained   in the genomes of these bacteria that may be present in this sample.   Biological sample, and with which are susceptible to hybridize the aforementioned probes or primers, and / or the amplification of the number of copies of probes according to claim 3, - the detection of the possible presence of said specific nucleotide sequences contained in the genomes Eca, said sequences being hybridized with the aforementioned probes, and therefore the presence of Eca   responsible for this pathology in the sample studied.   6. Method according to claim 5, characterized in that the amplification of the number of copies of the specific nucleotide sequences contained in the genomes of Eca, and / or the amplification of the number of copies of the probes according to claim 3, comprises the steps following: - the predenaturation of double-stranded DNA into single-stranded DNA,   preferably, in the case of the PCR technique, in a buffer consisting of Tris   10 mM HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, cofactors of the DNA (or RNA) polymerase, in particular of Mg2 + and K + ions, of the 4 constituent deoxynucleotides DNAs (dCTP, dATP, dGTP, dTTP), or RNAs (dCTP, dUTP, dGTP, dTTP), and primer pairs as defined in claim 4, by heating between approximately 80 ° C. and approximately C, advantageously at 100 C, 41 2705349   the amplification proper by addition to the medium obtained in the preceding step of DNA polymerase, or RNA polymerase, or heat-resistant ligase, and heating to about 94 ° C., which corresponds to the denaturation step properly said, * then heating between about 35 C and about 76 C, which corresponds to the step of hybridization of the pairs of primers with the aforementioned sequences or probes, * and finally heating between about 50 C and about 76 C, this which corresponds to the step of elongation of the primers, hybridized in the preceding step, towards each other, thus producing nucleotide sequences complementary to all or part of the genomic sequences of the aforementioned Eca or probes, these sequences or probes being delimited by the nucleotides hybridizing with the abovementioned primers, the repetition of the preceding amplification step between approximately 20 and approximately 50 times, advantageously between 25 and 35 times, the whole the procedure that can be repeated one or more times from all or part of the medium obtained in the previous step.   7. Method according to claim 5 or claim 6, characterized in that it is carried out using all or part of the probe consisting of the nucleotide sequence B shown in Figure 2, where appropriate marked, in particular   as set forth in claim 2.   8. Method according to one of claims 5 to 7, characterized in that it is   applied to the diagnosis of the possible appearance of a pathology, especially of the blackleg, caused by Eca, in a host as defined in the claim 5.   9. Kit for carrying out a method according to one of the claims   at 8, characterized in that it comprises at least one probe according to claim 3, and, where appropriate, at least one pair of primers such as described in claim 4.   10. Kit according to claim 9, characterized in that it comprises: a heat-resistant DNA or RNA polymerase, a reaction medium advantageously constituted, in the case of the PCR technique, 10 mM Tris-HCl, pH 8.3 50 mM KCl, 1.5 mM MgCl 2, 42 2705349   0.01% of gelatin, cofactors of the DNA polymerase, in particular of Mg2 + and K + ions, and of the 4 deoxynucleotides constituting the DNAs (dCTP, dATP,   dGTP, dTTP) or RNAs (dCTP, dATP, dGTP, dUTP).   11. Kit according to claim 10, characterized in that it also comprises: - one or more restriction enzymes, and, where appropriate, reference restriction fragments characteristic of each of the ecotypes, pathotypes (or pathovars) or biotypes of Eca, and / or a ligase and one (or more) pair (s) of oligonucleotide sequences capable of hybridizing on either side of one (or more) nucleotide (s) located in nucleotide sequences or fragment of characteristic sequences (s) of an Eca strain, and advantageously one (or more) oligonucleotide probe (s) specific (s) of a characteristic region for example of a specific strain d'Eca, in the current state of taxonomy.   12. Vector, in particular plasmidic, containing at one of its non-essential sites for its replication, a nucleotide sequence according to claim 1 or 2.   A cellular host transformed with a vector according to claim 12, and wherein said vector, or the nucleotide sequence of claim 1   or 2, integrated into the genome of the host, is likely to replicate.   14. Process for obtaining a nucleotide sequence according to claim 1 or 2, comprising the steps of: - culturing a cell host according to claim 13, transformed with a vector according to claim 12, - recovery of the vectors from this cell host, in particular by an appropriate cell lysis treatment, - recovery of the aforementioned nucleotide sequence by treatment of the vectors recovered in the previous step, using appropriate restriction enzymes, - purification of the sequence nucleotide thus obtained, in particular by gel electrophoresis. 4 * 3 2705349   15. Process for obtaining a nucleotide sequence according to claim 1 or 2, comprising the following steps: - bringing together vectors according to claim 12, with pairs of primers according to claim 4, under conditions allowing amplification of the number of copies of this nucleotide sequence, in particular under the conditions described in claim 6, purification of the nucleotide sequence thus obtained, in particular by gel electrophoresis.