FR2648476A1 - NUCLEIC ACID AND OLIGONUCLEOTIDE BY DERIVING THEM, COMPRISING SPECIFIC NUCLEOTIDE PROBES OF PLASMODIUM FALCIPARUM, AND THEIR USE FOR THE HYBRIDIZATION DETECTION OF PLASMODIUM FALCIPARUM DNA - Google Patents

Abstract

The invention relates to a nucleic acid and an oligonucleotide as derivant, as well as the probes constituted by or including said nucleic acid and oligonucleotide, specific to Plasmodium falciparum DNA. The invention also relates to a hybridation process for the hybridation of said probes with Plasmodium falciparum DNA as well as a process for the in vitro detection of Plasmodium falciparum.

Description

NUCLEIC ACID AND OLIGONUCLEOTIDE IN
DERIVANT, CONSTITUTING NUCLEOTIDE PROBES
SPECIFIC PLASMODIUM FALCIPARUM, AND THEIR
APPLICATION FOR HYBRIDIZATION DETECTION
PLASMODIUM DNA FALCIPARUM.

The present invention was made at the Laboratory of Parasitology and Exotic Pathology and at the laboratory of
Plant Molecular Biology of Joseph University
Fourier-Grenoble I, both Research Units associated with the CNRS.

 Malaria is an infectious parasitic disease caused by an infestation of red blood cells by a haematozoan of the genus Plasmodium, transmitted to humans by an insect, the Anopheles.

 Plasmodium falclparum is the most common and most dangerous plasmodial species, causing high morbidity. About 40% of the world's population is exposed to malaria. Considerable efforts have been made to control, treat and possibly eradicate this disease; However, to achieve these objectives, it is necessary to have specific diagnostic means that are simple and inexpensive.

Standard diagnostic techniques rely on microscopic observation of the patient's blood and must be performed by a trained manipulator; the detection sensitivity of these techniques is 10 to 200 parasitic red blood cells / mm3, however the low parasitaemias
(less than 1000 parasitic red blood cells / mm3) require a significant reading time and may give rise to false negatives.

 Although impossible to automate these techniques are commonly used for screening for malaria access.

 Immunological techniques based on the detection of antibodies in the serum of patients have been proposed, but this type of serological analysis is of little interest because the presence of antibodies only indicates previous contact with the parasite and low serum positivity does not occur. can not be concluded with the presence or absence of parasites in the blood. These techniques are, however, used in blood transfusion centers to control particularly exposed subjects.

To overcome these drawbacks, molecular hybridization techniques have been developed in order to detect in the blood of patients the presence of the DNA of
Plasmodium falciparum. The use of specific DNA molecular probes to diagnose malaria has been described for the first time by Franzen, L. et al (The
Lancet, 1984, 1, 525-528).

Except the total genomic DNA used by
Pollack et al (Pollack, Y. et al (1985) Am. J. Trop Med.

Hyg., Li, 663-667), other probes, cloned into different vectors (Barker, RH et al (1986) Science, 231, 14341436, Enea, V. (1986) Mol Cell Biol., 6, 321-324; Zolg,
JW et al (1987) Mol. Biochem. Parasitol., 22, 145-151) or prepared by nucleotide synthesis (Mc Laughlin, GL et al (1987) The Lancet, 714-716) have been developed.

 In parallel, the study of the Plasmodium falciparum genome revealed the presence of highly repeated nucleotide sequences specific to the parasite.

The construction and then the screening of genomic libraries of
Plasmodium falciparum identified and sequenced genomic DNA fragments containing these highly repeated sequences. The DNA clone, called pRep-
Hind described by Aslund, L. and Franzen, L. et al (J. Mol.

Biol. 1985, 185, 509-516) contains 1.7 kb and has a 0.57 kb insert consisting of the repetition of a unit sequence of 21 nucleotides, this unitary sequence was named PFR1; it has a variation rate of 25% and has been identified by the same authors in other DNA clones isolated from the same Plasmodium falclparum genomic library
European Patent Application No. 135 108 in the name of ROCKFELLER UNIVERSITY also discloses fragments of Plasmodium falciparum genomic DNA containing highly repetitive sequences, said fragments making it possible to constitute hybridization probes for the detection of Plasmodium DNA. falciparum. This application notably describes two clones called pPFR1 and pPFR5 respectively containing an insert of 1.2 kb and 0.32 kb. Sequencing of these inserts showed that the repeated sequence of pPFR1 contained 51 nucleotides and that of DPFRS contained 21 nucleotides.

 Zolg, J.W. et al (Mol Biochem Parasitol.

1987, ZZ, 145-151) also disclose a so-called "26Xt" clone containing a 0.147 kb insert consisting of the repetition of a 21 nucleotide unit sequence identical to that described by Franzen, L. et al.

Hybridization tests carried out on the probes derived from the pReo-Hind and "26" clones allow a satisfactory detection of Plasmodium falciparum DNA, thus the pRep-Hlnd plasmid probe detects 100 μg of genomic DNA after 18 hours. (McC Laughlin, GE et al (1987) J. Clin Microbiol., 25, (5), 791-795))
The present invention relates to a novel nucleic acid and an oligonucleotide derived therefrom, which constitute nucleotide probes specific for Plasmodium falciparum and capable of hybridizing the DNA of strains of different geographical origins. The invention also relates to the method of hybridizing the DNA of
Plasmodium falciparum with the probes of the invention, as well as the method for detecting Plasmodium falciparum in a sample and the kit for carrying out said detection method.

The research work carried out by
Inventors have involved the cloning and sequencing of Plasmodium falciparum genomic DNA fragments comprising highly repetitive sequences. This work made it possible to obtain the nucleic acid of the invention which is represented in FIG. 1, in which the letters indicate the following nucleotides: A for the adenyl residue, C for the cytidyl residue, G for the guanidyl residue, and T for the thymidyl residue; and where (5 ') and (3') indicate the 5 'and 3' ends of said nucleic acid.

 This nucleic acid which has received the name oUF 28 comprises 1,846 kb including 33,15% of G and C. it is constituted by the repetition of a unitary sequence of 21 nucleotides in 87 copies; these differ from each other by 1 to 9 nucleotides but exhibit at least a homology of 55% over the entire sequence of the nucleic acid pUF 28. These variations result from the duplication in numerous copies of a basic sequence, and translate by replacements and / or additions and / or deletions of one or more nucleotides. These modifications appear clearly in FIG. 1, in which the 87 copies of the unitary sequence constituting the nucleic acid pUF 28 are superimposed.

The present invention thus relates to a nucleic acid comprising the nucleotide sequence of FIG. 1 or the corresponding complementary sequence capable of pairing with the same portion of the genomic DNA of
Plasmodium falclparum because of its double-stranded nature.

 The invention also relates to an oligonucleotide which has received the designation Qui 28 and which derives from the nucleic acid of the invention puy 28.

OLI oligonucleotide 28 comprises 20 nucleotides whose sequence is as follows (5 ') TAGGTCTTAAGGTAACTAAT (3')
OLI oligonucleotide 28 is present in nucleic acid pUF 28 in four exemplified copies in FIG.

 The invention naturally also relates to the oligonucleotide complementary to OLI 28 and having the following nucleotide sequence (5 ') ATTAGTTACCTTAAGACCTA (3') capable of pairing with the same portion of genomic DNA of Plasmodium falciparum because of its nature. stranded.

 Also included in the invention are nucleic acids and oligonucleotides in which the thymidine groups are replaced by uracycl groups.

 The oligonucleotide OLI 28 can be prepared by chemical synthesis, the nucleic acid puy 28 is isolated from a recombinant bacterial clone RRlSpUF28 by methods known in the state of the art.

 The nucleic acid puy 28 and OLI oligonucleotide 28 have the characteristic of specifically hybridizing with Plasmodium falciparum DNA.

The invention therefore also relates to the probes for detecting the presence of Plasmodium falciparum in a biological sample, constituted by or comprising all or part of the complementary sequence of a nucleic acid according to the invention, or any probe which differs from the previous ones at level of the nucleotide sequence that by substitutions and / or additions and / or deletions of one or more nucleotides not involving modification of the hybridization properties of said probe with a nucleic acid according to the invention, under the conditions of hybridization defined below
pre-hybridization treatment of the support on which the probe is fixed at 330 ° C. for 30 minutes with a pre-hybridization solution having the following composition
buffer 5 times SSC (1 time SSC = 0.15M NaCl;
Sodium 0.015M)
Ficoll 400 0.1% Weight / Volume
Polyvinylpyrrolidone 0.1 z Weight / Volume
Sodium Phosphate pH 6.5 50 mM
Glycine 0.1% Weight / Volume
SDS (Sodium Dodecyl Sulfate) 0.1% Weight / Volume
Herring sperm DNA denatured 100 Rg / ml in the presence of 50% formamide.

 - Hybridization with the complementary nucleic acid, for 2 hours at 330C in a buffer solution identical to the previous pre-hybridization solution, in the presence of 50% of formamide.

- successive washes with the following solutions
4 4 washes of 5 minutes in a buffer 5 times
SSC in the presence of 0.1% SDS, at room temperature,. 1 wash 20 minutes in buffer 2 times
SSC in the presence of 0.1% SDS at room temperature.

 The invention also relates to probes for detecting the presence of Plasmodium falciparum in a biological sample, constituted by or comprising a sequence of 10 to 450 consecutive nucleotides contained in the complementary sequence of a nucleic acid according to the invention.

The invention relates more particularly to probes for. detecting Plasmodium falclparum in a sample, constituted by or comprising a nucleotide sequence complementary to an oligonucleotide according to the invention, or any probe which is distinguished from the preceding one at the level of the nucleotide sequence only by substitutions and / or additions and / or deletions of one or more nucleotides not leading to a modification of the hybridization properties of said probe with an oligonucleotide according to the invention, under the hybridization conditions defined below:
pre-hybridization treatment of the support on which the probe is fixed at 300 ° C. for 30 minutes with a pre-hybridization solution having the following composition: 5-fold buffer SSC
Ficoil 400 0.1% Weight / Volume
Polyvinylpyrrolidone 0.1% Weight / Volume Sodium Phosphate pH 6.5 50 mM Glycine 0.1% Weight / Volume SDS (Sodium Dodecyl Sulfate) 0.1% Weight / Volume DNA Denatured Herring Sperm 100 Rg / ml
- Hybridization with the complementary oligonucleotide for 4 hours at 300C in a buffer solution identical to the previous pre-hybridization solution.

- successive washes with the following solutions 2 2 washes of 5 minutes in a buffer 5 times
SSC at room temperature,
1 1 washing 5 minutes in a buffer 5 times
SSC in the presence of 0.1% SDS at room temperature.

1 1 washing 20 minutes in a buffer 5 times
SSC in the presence of 0.1% SDS at room temperature.

 The hybridization conditions defined above constitute preferred conditions, but are in no way limiting and may be modified without affecting the recognition and hybridization properties of the probes and the nucleic acids and oligonucleotides according to the invention.

 It is known to those skilled in the art that a nucleotide sequence may present modifications such as substitutions and / or additions and / or deletions of one or more nucleotides which do not entail any modification of the properties, in particular of hybridization of said nucleotide sequence.

 The invention also relates to the probes for detecting Plasmodium falciparum in a sample, consisting of the repetition of the sequence of one or more probes containing from 10 to 450 nucleotides.

Hereinafter denoted by probe pUF 28, the probe corresponding to the nucleic acid pUF 28 and therefore having the sequence of FIG. 1, and by probe OLI 28, the probe corresponding to oligonucleotide OLI 28 and therefore having the sequence next (s ') TAGGTCTTAAGGTAACTAAT (3')
The probes are advantageously labeled by any classically used marker. The probes can be labeled with a radioactive tracer such as 32p, 35S, 125I, 3H, 14C. The radioactive labeling may be carried out according to any method known to those skilled in the art.

The probes can be labeled in 3 'by addition of one or more deoxynucleotides or ribonucleotides or a dideoxynucleotide, labeled alpha by 32p, in the presence of the Deoxynucleotidyl Terminal.
transferase; the probes can also be labeled in 5 'by transfer of a radioactive phosphate group of a deoxynucleotide or a free dideoxynucleotide labeled in the gamma position, in the presence of the T4 polynucleotide kinase, they can be further labeled at each end by addition of any sequence radiolabeled in the presence of T4 DNA ligase.

 The puy probe 28 is advantageously labeled by "Nick Translation" or "Random Priming".

OLI oligonucleotide probe 28 may be labeled during its chemical synthesis by incorporating one or more reactive deoxynucleotides, the OLI probe 28 is advantageously labeled at its 5 'end.

 The method of detection of hybridization will depend on the radioactive label used and may be based on autoradiography, liquid scintillation, gamma counting or any other technique for detecting the emission of radiation emitted by the radioactive marker.

 Non-radioactive labeling may also be used, by associating with the probes of the invention groups having immunological properties such as an antigen, a specific affinity for certain reagents such as a ligand, physical properties such as fluorescence or luminescence, properties allowing completion of enzymatic reactions as an enzyme or enzyme substrate. The non-radioactive labeling can be done by incorporation of a nucleotide analog having one of these groups, by "Nick Translation" or by "Random Priming"; or by addition to the 3 'or 5' end of one of these analogs. It can also be done directly by chemical modification of DNA, such as photobiotinylation or sulfonation.

The invention also relates to a method of hybridizing a nucleotide probe with the DNA of
Plasmodium falciparum, characterized in that it comprises the following steps
the prehybridization treatment of a support, such as a nitrocellulose filter or a nylon membrane, on which the DNA extracted from Plasmodium falciparum is fixed with a prehybridization solution,
hybridization in a solution identical to the pre-hybridization solution further comprising a nucleotide probe according to the invention,
- several successive washes.

 The invention also relates to a method for the in vitro detection of Plasmodium falciparum in a biological sample capable of containing it, characterized in that, after rendering Plasmodium faciioarum DNA, optionally contained in the biological sample, accessible and single-stranded, it is contacted with a nucleotide probe according to the invention, under conditions favorable to hybridization and detecting any hybrids possibly formed, the probe having been previously marked or made capable of being detected as has been said previously.

 The probes according to the invention can also be used to detect Plasmodium falciparum DNA present in the sporozoite stage in the anopheles salivary glands.

 The invention further relates to malaria diagnostic kits using the above-mentioned in vitro methods for detecting Plasmodium falciparum.

As examples of such kits include
a determined quantity of a nucleotide probe according to the invention,
a medium suitable for carrying out a hybridization reaction between Plasmodium falciparum DNA and said probe,
reagents allowing the detection of the hybrids formed between the DNA and the probe during said hybridization reaction.

The oligonucleotide probes according to the invention can be used as a primer in an in vitro genetic amplification process of fixing the probe on Plasmodium falclparum DNA by hybridization, and then to carry out an enzymatic extension process on the plasmid. using DNA polymerase, followed by a denaturation process, and to repeat the hybridization-extension-denaturation cycle, known as the PCR ("Polymerase Chain Reaction") cycle described by the company
Cetus Corporation), a number of times sufficient to increase the amount of the target sequence of the starting oligonucleotide probe in an exponential proportion with respect to the number of cycles used.

 In addition to the preceding features, the invention includes other features which will become apparent from the description which follows and which refer to examples of implementation of the present invention, it being understood that these examples can not constitute any limitation. within the scope of the claims.

 I - PREPARATION OF THE PROBE pUF2S.

A) Production of the pUF 28 probe
The nucleic acid puy 28 is introduced into a host cell with the aid of a vector of the plasmid type capable of replicating in said host cell; advantageously the nucleic acid pUF 28 was introduced into the plasmid pUC 19 and amplified in the Escherichia strain
Coli RR1AM15 (K12), derived from HB 101.

From a freeze at -700C, the strain is seeded on solid medium SOB (Bacto Tryptone 2%,
0.5% Yeast Extract, 10mM NaCl, 2.5mM KCl, 10mM MgC12,
10mM MgSO4) in the presence of Ampicillin (50 g / ml) and cultured for 18 hours at 370C.

 10 ml of SOB liquid medium (Ampicillin (50 gSml)) are seeded with a colony and cultured for 16 hours, at 37 ° C., with orbital shaking of 200 rpm. 2 ml of this preculture serve as an inoculum for sowing one liter of SOB liquid medium (Ampicillin 50 Ag / ml).

 The culture is done over 9 hours at 370C and stirring (200rpm).

 The addition of Chloramphenicol (170 g / ml) makes it possible to increase the plasmid copy number per cell by blocking the bacterial division. This amplification step always takes place at 370 ° C., with stirring (200 rpm), for 16 hours.

 The bacteria are recovered by centrifugation at 5000 g for 10 minutes and at 40C.

The plasmid is extracted in a conventional manner using the technique of Birboim and Doly, described by Maniatis et al (1982 "Moiecular cloning, A laboratory manual", Cold
Spring Harbor Laboratory). It is purified in the last step by ultracentrifugation on a CsCl 2 gradient (n = 1.3860, 1.55 mg / ml, 100000 g, 200 ° C., 36 hours, in the presence of 600 g / ml of Ethidium bromide.

 Ethidium bromide is removed by 6 n-butanol reactions and 3 diethyl ether extractions.

B) Purification of the pUF 28 probe
After precipitation in 70% ethanol, the plasmid DNA is desiccated under vacuum and then solubilized in water and assayed by measurement with the spectrophotometer of the OD of the solution at 260 nm.

Purification of the insert pUF 28 is by double enzymatic digestion of the plasmid by 2 enzymes
Sst I (or Sac I) and Xba I whose cleavage sites are located on either side of the insert, in the polylinker sequence of plasmid pUC 19.

 In a preparative manner, 100 g of plasmid are digested in at least 200 μl of Sac I buffer (Tris-HCl pH 50mM, 50mM NaCl, 10mM MgCl 2) at a rate of 1 unit / μg of each enzyme. Both digests are simultaneous and are incubated at 37 ° C for at least 3 hours.

The insert pUF 28 (1.846 kb) and the plasmid pUC 19
(2,686 kb) were separated by 0.8% agarose gel electrophoresis (20 cm by 20 cm gel, two wells 7 cm long by 1.5 mm wide by 0.8 cm deep) in a TAE buffer (0.5 g / ml Ethidium Bromide).

 The lower band is cut out and the DUF probe 28 is electroeluted in a BIOTRAP apparatus (trade name), in the TAE buffer (0.5 g / ml Ethidium bromide). The insert thus purified is ready for use after 6 extractions of Ethidium bromide with n-butanol and 3 extractions with diethyl-oxide and precipitation in 70% ethanol. After redissolving in water, the quality of the probe is monitored by analytical electrophoresis and the DNA concentration is determined by the measurement of the D.O. at 260 nm.

C) Marking of the pUF 28 probe
The results reported below were obtained by labeling the probe puy 28 to 32p via an alpha-labeled nucleotide triphosphate; for example, alpha 32P dTTP (800 Ci / mmol;
AMERSHAM FRANCE (trade name)). A microgram of insert is thus labeled with 140 Ci per nick translation, the specific activity is then 1 to 5.108 cpm / g. We can also mark the insert by the technique of "Random Priming", the specific activity is then 1 to 2,109 cpm / g.

 II - PREPARATION OF THE OLI PROBE 28.

A) Production of the OLI probe 28
The oligonucleotide sequence OLI 28 of 20 bases is produced by chemical synthesis on an automatic device (APPLIED BIOSYSTEM synthesizer (trade name)). 300 g were thus synthesized in single-stranded form at one time.

 The salts present at high concentration are removed after precipitation of the single-stranded DNA in 70% ethanol.

B) Marking the OLI probe 28
OLI oligonucleotide 28 is labeled at the 5 'end by T4 polynucleotide kinase, in the presence of gamma ATP. 50 pmol of OLI probe 28 (330 ng) are incubated in the presence of 7 units of T4 polynucleotide kinase and 150 pCi of 32 P ATP in a final volume of 50,
The average specific activity is of the order of 2 to 5.i08 cpm / g
III - PREPARATION OF SAMPLES A
ANALYZE
A) Sample preparation
The sample preparation protocol described below was developed by JW Zolg et al, and described in Am. J. Trop. Med. Hyg. (1987), 5, 33-41.

 This technique has 5 steps and allows to handle parasitized blood samples of at least 50W1.

 - First step: Lyse parasitized red blood cells by adding 2 volumes (100 μl) of bidistilled, sterile water.

Incubate for 20 minutes.

 second step: lysis of the parasites by adding 0.33 volumes (50 μl) of LE buffer (Lauryl Sarcosine 1%, EDTA pH8, 50 mM). EDTA inhibits the enzymatic activity of DNAases.

 Step 3: Addition of 0.25 volume (50 μl) of 5 M cesium trifluoroacetate Cesium trifluoroacetate is a highly chaotropic salt that denatures proteins and dissociates them from nucleic acids.

fourth step: Protein extraction by adding 0.33 volumes (83 Al) of an organic mixture
(2.5 volume ethanol / 1 volume chloroform / 0.04 volume isoamyl alcohol).

 fifth step: Centrifugation at 12000 g for 5 minutes and recovery of the upper aqueous phase.

 All stock solutions can be stored at room temperature. DNAs extracted by this method can be stored at 370C for several months.

B) Denaturation of DNA
The DNA is denatured by adding 0.25 volume (62.5 μl) of 2.5 N sodium hydroxide (20 minutes at room temperature).

 The solution is neutralized with 0.5 volume (156 l) of Tris-HCL buffer (pH8, 3M) and incubated in ice to avoid renaturation of the DNA.

C) Filing of samples
The samples are deposited in duplicate on a support such as a nitrocellulose filter using a filtration apparatus 8 times 12 wells, under vacuum (apparatus
HYBRI-DOT MANIFOLD from BRL (trade name)).

The filter is pre-wetted in 2-fold SSC buffer (1x SSC = 0.15 M NaCl;
Sodium 0.015M) before being placed in the apparatus. Each sample is vacuum deposited. Before and after each deposition, the well is rinsed with 200 Al buffer 2 times SSC.

After drying at room temperature for 30 minutes, the filter is incubated at 800C for 2 hours, between two sheets of WHATMAN 3MM paper (trade name) to fix the DNAs on the membrane.

IV - HYBRIDIZATION
Hybridization takes place in three stages: prehybridization, hybridization, washing.

A) Treblinging
The dry filter is placed in a welded plastic bag and incubated in hybridization buffer at 75 CLl / cm 2.

The hybridization buffer has the following composition - 5-fold buffer SSC - Ficoll 400 0.1% Weight / Volume - Polyvinylpyrrolidone 0.1% Weight / Volume - Sodium Phosphate pH 6.5 50 mM - Glycine 1% Weight / Volume - SDS (Sodium Dodecyl Sulfate) 0.1% Weight / Volume - Denatured Herring Sperm DNA 100 EgXml
Prehybridization with the pUF 28 probe is carried out for 30 minutes at 330 ° C in the presence of 50% formamide.

 Prehybridization with the PLI probe 28 is performed for 1 hour at 300C, in the absence of formamide.

B) Hybridization
After denaturation of the pUF 28 probe by heating at 1000C for 10 minutes and then cooling in the melting ice (OOC) for 10 minutes, the hybridization with the single-stranded tUF 28 probe is in the same buffer as the prehybridization; the filter is hybridized with 80 ng / ml of pUF 28 probe for 2 hours at 330 ° C., for a specific activity of at least 108 cpm / ml.

Hybridization with OLI probe 28 is in the same buffer as prehybridization; the filter is hybridized with 100 ng / ml of OLI probe 28 for 4 hours at 300 ° C., for 1 1 washing of 5 minutes in a buffer 5 times
SSC in the presence of 0.1% SDS, at room temperature
room.

1 1 washing 20 minutes in a buffer 5 times
SSC in the presence of 0.1% SDS, at room temperature
room.

D) Revelation of hybridization
The filters are dried at room temperature for 30 minutes, wrapped in a plastic film, and exposed to an autoradiography film at -700C for 24 hours.

V - SENSITIVITY OF DETECTION
A) Sensitivity of DNA detection
The 32P-radiolabelled pUF28 probe can detect 1100 μg of purified Plasmodium falclparum DNA after 24 hours of exposure of the autoradiography film.

 The radiolabeled OLI probe can detect 1 ng of DNA after. 24 hours of exposure.

B) Sensitivity of detection of parasitized red blood cells
In order to recover the physiopathological conditions, the detection tests were carried out on invitro parasitic red cells, synchronous at the ring stage.

 The 32 P-labeled puy probe detects 50 parasitized red blood cells per mm 3 of 50% hematocrit culture blood after 24 hours of film exposure, a reproducible parasitaemia of 0.001%.

 The radiolabelled OLI probe detects 500 parasitized red blood cells per mm3, ie a parasitaemia of 0.01% under the same conditions.

Table I below reports the handling time and the sensitivity of the puy 28 and PLI probes 28 as well as various probes known to date.

<Tb>

<SEP> AUTHOR <SEP> SO @ D @ <SEP><SEP> DUREF <SEP> FROM <SEP> DUR @@ <SEP><SEP> FROM <SEP> DORER <SEP> FROM <SEP> QUANTITY <SEP><SEP> PARASITEMY
<tb><SEP> FREPARATION <SEP> MYBRIDATION <SEP><SEP> REVELATION <SEP> AD @ <SEP> DETECTED
<tb><SEP> FROM <SEP> EC @ A @ TILLONS
<tb><SEP> pRep-Hind
<tb><SEP><SEP> (1.7 <SEP> Kbp) <SEP> 4 <SEP> h <SEP> 30 <SEP> 6 <SEP> h <SEP> 10 <SEP> h <SEP > 25pg <SEP> 0.001 <SEP>%
<tb><SEP> 1984
<tb><SEP> DNA
<tb><SEP> POLLACE <SEP> qesenic <SEP> 3 <SEP> h <SEP> 22 <SEP> h <SEP> 12 <SEP> h <SEP>? <SEP> 0.0001 <SEP>%
<tb><SEP> 1985
<tb><SEP> pFR1
<tb><SEP> McLAUGELIN <SEP> (21 <SEP> pb) <SEP> 2 <SEP> h <SEP> 3C <SEP> 14 <SEP> h <SEP> 18 <SEP> h <SEP> 100pg <SEP>?
<tb><SEP> 1985
<tb><SEP> pFR1
<tb><SEP> McLAUGRLIE <SEP> Labeled <SEP> at <SEP> 2 <SEP> h <SEP> 4 <SEP> h <SEP> 45 <SEP> 48 <SEP> h <SEP> 100 <SEP> pg <SEP> 0.1 <SEP>%
<tb><SEP> 1987
<tb><SEP> 32p
<tb><SEP> CLONE <SEP> 26
<tb><SEP> @OLG <SEP><SEP> (147 <SEP> pb) <SEP>? <SEP> 20 <SEP> h <SEP> 2 <SEP> h <SEP> 25.0 <SEP> pg <SEP>?
<tb> 1987
<tb> PUF <SEP> 28 <SEP> 50 <SEP> mm <SEP> 2 <SEP> h <SEP> 24 <SEP> h <SEP> 100 <SEP> pg <SEP> 0.001 <SEP>%
<tb><SEP> OLI <SEP> 28 <SEP> 50 <SEP> mm <SEP> 4 <SEP> h <SEP> 24 <SEP> h <SEP> 1 <SEP> ng <SEP> 0,01 <SEP>%
<Tb>
As shown in Table I, the pUF 28 and OLI 28 probes have a detection sensitivity at least equivalent to that of pRep-Hind and PFR1 and which is quite reproducible.

 In addition, the hybridization conditions developed specifically for these probes, have achieved these performances after only 2 hours of hybridization for the pUF 28 probe and 4 hours for the OLI probe 28.

The pUF 28 and OLI 28 probes are specific for Plasmodium falciparum DNA; thus, in hybridization of "Southern Blots" they do not recognize the human genomic DNA, nor the DNA of the other three plasmodial species
Plasmodium malariae, Plasmodium ovale and Plasmodium vivax as well as Plasmodium cvnomolai bastianell11 which infests the monkey. They recognize the DNA of strains of Plasmodium falciparum of different geographical origin - CAM strain from Senegal - strain SGE-1 from Gambia - strain JEAN from Central Africa - strain KENYA from Kenya - strain LILLY from Central African Republic - strain NF7 from Africa ( Amsterdam Airport) - strain NF 54 from Tanzania - strain UPA from Uganda - strain HONDURAS from Honduras - strain INDOCHINA-1 from Vietnam

Claims (12)

 1 - Nucleic acid characterized in that it comprises the nucleotide sequence of Figure 1 or the corresponding complementary sequence.  2 - Oligonucleotide derived from a nucleic acid according to claim 1, characterized in that it comprises the following sequence (5 ') TAGGTCTTAAGGTAACTAAT (3') or the following corresponding complementary sequence (5 ') ATTAGTTACCTTAAGACCTA (3').  3 - Probe for detecting the presence of Plasmodium falcitarum in a sample, characterized in that it consists of or comprises all or part of the complementary sequence of the nucleic acid of claim 1, or any nucleotide probe differing from the preceding one at the level of the nucleotide sequence only by substitutions and / or additions and / or deletions of one or more nucleotides not resulting in modification of the hybridization properties of said probe with the nucleic acid of claim 1.  4 - Probe for detecting the presence of Plasmodium falciparum in a sample according to Claim 3, characterized in that it consists of or comprises a sequence of 10 to 450 consecutive nucleotides contained in the complementary sequence of the nucleic acid according to Claim 1.  5 - Probe for detecting the presence of Plasmodium falciparum in a sample according to claim 4, characterized in that it consists of or comprises a nucleotide sequence complementary to the oligonucleotide of claim 2, or any nucleotide probe differing from the preceding one at the level of the nucleotide sequence only by substitutions and / or additions and / or deletions of one or more nucleotides not resulting in modification of the hybridization properties of said probe with the oligonucleotide of claim 2.  6 - Probe for detecting the presence of Plasmodium falclparum in a sample, characterized in that it consists of the repetition of the sequence of one or more probes according to any one of claims 4 or 5.  7 - Probe according to any one of claims 1 to 6, characterized in that it is radioactively labeled or with a marker of the enzymatic, antigenic, ligand, luminescent or fluorescent type.  8 - A method for hybridizing a nucleotide probe according to any one of claims 3 to 6 with Plasmodium falciparum DNA, characterized in that it comprises the following steps  the pre-hybridization treatment of a support, such as a nitrocellulose filter or a nylon membrane, on which the DNA extracted from Plasmodium falcitarum is fixed with a pre-hybridization solution,  hybridization in a solution identical to the pre-hybridization solution further comprising a nucleotide probe according to any one of claims 3 to 6,  - several successive washes.  9 - hybridization method of a nucleotide probe according to claim 3 with the DNA of Plasmodium falciparum, characterized in that it comprises the following steps  the pre-hybridization treatment of the filter. The filter on which the DNA extracted from Plasmodium falcitarum is fixed is placed in a welded plastic bag and incubated for 30 minutes at 330 ° C. with a prehybridization solution having the following composition: - 5-fold buffer SSC - Ficoll 400 0.1% Weight / Volume - Polyvinylpyrrolidone 0.1% Weight / Volume - Sodium Phosphate pH 6.5 50 mM - Glycine 1% Weight / Volume - SDS (Sodium Dodecyl Sulfate) 0.1% Weight / Volume - Denatured Herring Sperm DNA 100 llg / ml in the presence of 50% of formamide,  the hybridization in a buffer solution identical to the prehybridization solution, further comprising the nucleotide probe according to claim 3 marked in particular radioactively, in the presence of 50% of formamide, for 2 hours at 330 ° C.,  successive successive washes 4 4 washes of 5 minutes in a buffer 5 times SSC in the presence of 0.1% SDS, at room temperature,  1 1 20 minutes washing in a buffer 2 times SSC in the presence of 0.1% SDS at room temperature.  10 - A method of hybridizing a nucleotide probe according to claim 5 with the DNA of Plasmodium falciparum. characterized in that it comprises the following steps  the pre-hybridization treatment of the filter. The filter on which the DNA extracted from Plasmodium falciparum is fixed is placed in a welded plastic bag, and incubated for 1 hour at 300C with a pre-hybridization solution having the following composition - 5-fold buffer SSC - Ficoll 400 0.1 % Weight / Volume - Polyvinylpyrrolidone 0.1% Weight / Volume - Sodium Phosphate pH 6.5 50 mM - Glycine 1% Weight / Volume - SDS (Sodium Dodecyl Sulfate) 0.1% Weight / Volume - Herring Sperm DNA denatured 100 Rg / ml  the hybridization in a buffer solution identical to the prehybridization solution, further comprising the nucleotide probe according to claim 5 labeled in particular radioactively, for 4 hours at 300 ° C.,  the following successive washes 2 2 washes of 5 minutes in a buffer 5 times SSC, at room temperature,  1 1 washing 5 minutes in a buffer 5 times SSC in the presence of 0.1% SDS, at room temperature,  1 1 washing 20 minutes in a buffer 5 times SSC, in the presence of 0.1% SDS, at room temperature.  11 - Method for in vitro detection of Plasmodium falciparum in a biological sample that may contain it, characterized in that after having made the DNA of Plasmodium falciparum optionally contained in the biological sample, accessible and single-stranded, it is brought into contact with a nucleotide probe according to any one of claims 3 to 6, under conditions favorable to hybridization and the optionally formed hybrids are detected .  12 - Kit for carrying out an in vitro detection method of Plasmodium falciparum according to claim 7, characterized in that it comprises  a determined quantity of a nucleotide probe according to one of claims 3 to 6,  a medium suitable for carrying out a hybridization reaction between Plasmodium falciparum DNA and said probe,  reagents allowing the detection of the hybrids formed between the DNA and the probe during said hybridization reaction.