FR2648476A1 - NUCLEIC ACID AND OLIGONUCLEOTIDE BY DERIVING THEM, COMPRISING SPECIFIC NUCLEOTIDE PROBES OF PLASMODIUM FALCIPARUM, AND THEIR USE FOR THE HYBRIDIZATION DETECTION OF PLASMODIUM FALCIPARUM DNA - Google Patents
NUCLEIC ACID AND OLIGONUCLEOTIDE BY DERIVING THEM, COMPRISING SPECIFIC NUCLEOTIDE PROBES OF PLASMODIUM FALCIPARUM, AND THEIR USE FOR THE HYBRIDIZATION DETECTION OF PLASMODIUM FALCIPARUM DNA Download PDFInfo
- Publication number
- FR2648476A1 FR2648476A1 FR8908069A FR8908069A FR2648476A1 FR 2648476 A1 FR2648476 A1 FR 2648476A1 FR 8908069 A FR8908069 A FR 8908069A FR 8908069 A FR8908069 A FR 8908069A FR 2648476 A1 FR2648476 A1 FR 2648476A1
- Authority
- FR
- France
- Prior art keywords
- hybridization
- dna
- probe
- sep
- plasmodium falciparum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
ACIDE NUCLEIQUE ET OLIGONUCLEOTIDE EN
DERIVANT, CONSTITUANT DES SONDES NUCLEOTIDIQUES
SPECIFIQUES DE PLASMODIUM FALCIPARUM, ET LEUR
APPLICATION POUR LA DETECTION PAR HYBRIDATION DE
L'ADN DE PLASMODIUM FALCIPARUM.NUCLEIC ACID AND OLIGONUCLEOTIDE IN
DERIVANT, CONSTITUTING NUCLEOTIDE PROBES
SPECIFIC PLASMODIUM FALCIPARUM, AND THEIR
APPLICATION FOR HYBRIDIZATION DETECTION
PLASMODIUM DNA FALCIPARUM.
La présente invention a été faite au Laboratoire de Parasitologie et Pathologie Exotique et au laboratoire de
Biologie moléculaire Végétale de l'Université Joseph
Fourier-Grenoble I, tous deux Unités de Recherche associées au CNRS.The present invention was made at the Laboratory of Parasitology and Exotic Pathology and at the laboratory of
Plant Molecular Biology of Joseph University
Fourier-Grenoble I, both Research Units associated with the CNRS.
Le paludisme est une maladie infectieuse parasitaire due à une infestation des hématies par un hématozoaire du genre Plasmodium, transmis à l'homme par un insecte, l'anophèle. Malaria is an infectious parasitic disease caused by an infestation of red blood cells by a haematozoan of the genus Plasmodium, transmitted to humans by an insect, the Anopheles.
Plasmodium falclparum est l'espèce plasmodiale la plus répandue et la plus dangereuse, à l'origine d'une morbidité élevée. Environ 40% de la population mondiale est exposée au paludisme. Des efforts considérables ont été entrepris pour contrôler, soigner et éventuellement éradiquer cette maladie; il reste toutefois nécessaire pour atteindre ces objectifs de disposer de moyens de diagnostic spécifiques, simples et peu onéreux. Plasmodium falclparum is the most common and most dangerous plasmodial species, causing high morbidity. About 40% of the world's population is exposed to malaria. Considerable efforts have been made to control, treat and possibly eradicate this disease; However, to achieve these objectives, it is necessary to have specific diagnostic means that are simple and inexpensive.
Les techniques usuelles de diagnostic reposent sur l'observation au microscope du sang du malade et doivent être effectuées par un manipulateur entraîné; la sensibilité de détection de ces techniques est de 10 à 200 hématies parasitées/mm3, cependant les faibles parasitémies
(inférieure à 1000 hématies parasitées/mm3) nécessitent un temps de lecture important et peuvent donner lieu à de faux négatifs.Standard diagnostic techniques rely on microscopic observation of the patient's blood and must be performed by a trained manipulator; the detection sensitivity of these techniques is 10 to 200 parasitic red blood cells / mm3, however the low parasitaemias
(less than 1000 parasitic red blood cells / mm3) require a significant reading time and may give rise to false negatives.
Bien qu'impossible à automatiser ces techniques sont utilisées couramment pour le dépistage de l'accès palustre. Although impossible to automate these techniques are commonly used for screening for malaria access.
Des techniques immunologiques reposant sur la détection d'anticorps dans le sérum de malade ont été proposées mais ce type d'analyse sérologique est peu intéressante car la présence d'anticorps ne témoigne que dXun contact antérieur avec le parasite et une faible positivité du sérum ne permet pas de conclure à la présence ou à l'absence de parasites dans le sang. Ces techniques sont toutefois utilisées dans les centres de transfusion sanguine pour contrôler les sujets particulièrement exposés. Immunological techniques based on the detection of antibodies in the serum of patients have been proposed, but this type of serological analysis is of little interest because the presence of antibodies only indicates previous contact with the parasite and low serum positivity does not occur. can not be concluded with the presence or absence of parasites in the blood. These techniques are, however, used in blood transfusion centers to control particularly exposed subjects.
Pour pallier ces inconvénients, des techniques d'hybridation moléculaire ont été développées afin de détecter dans le sang de patients la présence de l'ADN de
Plasmodium falciparum. L'utilisation de sondes moléculaires d'ADN spécifiques, pour diagnostiquer le paludisme a été décrite pour la première fois par Franzen, L. et al (The
Lancet, 1984, 1, 525-528). To overcome these drawbacks, molecular hybridization techniques have been developed in order to detect in the blood of patients the presence of the DNA of
Plasmodium falciparum. The use of specific DNA molecular probes to diagnose malaria has been described for the first time by Franzen, L. et al (The
Lancet, 1984, 1, 525-528).
Excepté l'ADN génomique total utilisé par
Pollack et al (Pollack, Y. et al (1985) Am. J. Trop. Med.Except the total genomic DNA used by
Pollack et al (Pollack, Y. et al (1985) Am. J. Trop Med.
Hyg., li, 663-667), d'autres sondes, clonées dans différents vecteurs ( Barker, R.H. et al (1986) Science, 231, 14341436; Enea, V. (1986) Mol. Cell. Biol., 6, 321-324 ; Zolg,
J.W. et al (1987) Mol. Biochem. Parasitol., 22, 145-151) ou préparées par synthèse nucléotidique (Mc Laughlin, G.L. et al (1987) The Lancet, 714-716) ont été développées.Hyg., Li, 663-667), other probes, cloned into different vectors (Barker, RH et al (1986) Science, 231, 14341436, Enea, V. (1986) Mol Cell Biol., 6, 321-324; Zolg,
JW et al (1987) Mol. Biochem. Parasitol., 22, 145-151) or prepared by nucleotide synthesis (Mc Laughlin, GL et al (1987) The Lancet, 714-716) have been developed.
Parallèlement, l'étude du génome de Plasmodium falciparum a mis en évidence la présence de séquences nucléotidiques hautement répétées spécifiques du parasite. In parallel, the study of the Plasmodium falciparum genome revealed the presence of highly repeated nucleotide sequences specific to the parasite.
La construction puis le criblage de banques génomiques de
Plasmodium falciparum ont permis d'identifier et de séquencer des fragments d'ADN génomique contenant ces séquences hautement répétées. Le clone d'ADN, dénommé pRep-
Hind décrit par Aslund, L. et Franzen, L. et al ( J. Mol.The construction and then the screening of genomic libraries of
Plasmodium falciparum identified and sequenced genomic DNA fragments containing these highly repeated sequences. The DNA clone, called pRep-
Hind described by Aslund, L. and Franzen, L. et al (J. Mol.
Biol. 1985, 185, 509-516) contient 1,7 kb et présente un insert de 0,57 kb constituée de la répétition d'une séquence unitaire de 21 nucléotides, cette séquence unitaire a été dénommée PFR1; elle présente un taux de variation de 25% et a été identifiée par les mêmes auteurs dans d'autres clones d'ADN isolés de la même banque génomique de Plasmodium falclparum
La Demande de Brevet Européen NO 135 108 au nom de ROCKFELLER UNIVERSITY décrit également des fragments de l'ADN génomique de Plasmodium falciparum contenant des séquences hautement répétées, lesdits fragments permettant de constituer des sondes d'hybridation pour la détection de l'ADN de Plasmodium falciparum. Cette demande décrit notamment deux clones dénommés pPFR1 et pPFR5 contenant respectivement un insert de 1,2 kb.et 0,32 kb. Le séquençage de ces inserts a montré que la séquence répétée de pPFR1 contenait 51 nucléotides et celle de DPFRS contenait 21 nucléotides.Biol. 1985, 185, 509-516) contains 1.7 kb and has a 0.57 kb insert consisting of the repetition of a unit sequence of 21 nucleotides, this unitary sequence was named PFR1; it has a variation rate of 25% and has been identified by the same authors in other DNA clones isolated from the same Plasmodium falclparum genomic library
European Patent Application No. 135 108 in the name of ROCKFELLER UNIVERSITY also discloses fragments of Plasmodium falciparum genomic DNA containing highly repetitive sequences, said fragments making it possible to constitute hybridization probes for the detection of Plasmodium DNA. falciparum. This application notably describes two clones called pPFR1 and pPFR5 respectively containing an insert of 1.2 kb and 0.32 kb. Sequencing of these inserts showed that the repeated sequence of pPFR1 contained 51 nucleotides and that of DPFRS contained 21 nucleotides.
Zolg, J. W. et al ( Mol. Biochem. Parasitol. Zolg, J.W. et al (Mol Biochem Parasitol.
1987, ZZ, 145-151) décrivent également un clone dénommé "26Xt contenant un insert de 0,147 kb constitué de la répétition d'une séquence unitaire de 21 nucléotides identique à celle décrite par Franzen, L. et al.1987, ZZ, 145-151) also disclose a so-called "26Xt" clone containing a 0.147 kb insert consisting of the repetition of a 21 nucleotide unit sequence identical to that described by Franzen, L. et al.
Les tests d'hybridations réalisés à partir des sondes issues des clones pReo-Hind et "26" permettent une détection satisfaisante de l'ADN de Plasmodium falciparum, ainsi la sonde plasmidique pRep-Hlnd détecte 100 pg D'ADN génomique après 18 heures d'exposition (Mc Laughlin, G. E. et al (1987) J. Clin. Microbiol., 25, (5), 791-795))
La présente invention concerne un nouvel acide nucléique ainsi qu'un oligonucléotide en dérivant, lesquelles constituent des sondes nucléotidiques spécifiques de Plasmodium falciparum et pouvant hybrider l'ADN de souches d'origines géographiques différentes. L'invention concerne également le procédé d'hybridation de l'ADN de
Plasmodium falciparum avec les sondes de l'invention, ainsi que le procédé pour détecter Plasmodium falciparum dans un échantillon et le kit pour la mise en oeuvre dudit procédé de détection.Hybridization tests carried out on the probes derived from the pReo-Hind and "26" clones allow a satisfactory detection of Plasmodium falciparum DNA, thus the pRep-Hlnd plasmid probe detects 100 μg of genomic DNA after 18 hours. (McC Laughlin, GE et al (1987) J. Clin Microbiol., 25, (5), 791-795))
The present invention relates to a novel nucleic acid and an oligonucleotide derived therefrom, which constitute nucleotide probes specific for Plasmodium falciparum and capable of hybridizing the DNA of strains of different geographical origins. The invention also relates to the method of hybridizing the DNA of
Plasmodium falciparum with the probes of the invention, as well as the method for detecting Plasmodium falciparum in a sample and the kit for carrying out said detection method.
Les travaux de recherche réalisés par les
Inventeurs ont concerné le clonage et le séquençage de fragments de l'ADN génomique de Plasmodium falciparum comprenant des séquences hautement répétées. Ces travaux ont permis d'obtenir l'acide nucléique de l'invention qui est représenté à la figure 1, dans laquelle les lettres indiquent les nucléotides suivants : A pour le résidu adénylique, C pour le résidu cytidylique, G pour le résidu guanidylique et T pour le résidu thymidylique; et où (5') et (3') indiquent les extrémités 5' et 3' dudit acide nucléique.The research work carried out by
Inventors have involved the cloning and sequencing of Plasmodium falciparum genomic DNA fragments comprising highly repetitive sequences. This work made it possible to obtain the nucleic acid of the invention which is represented in FIG. 1, in which the letters indicate the following nucleotides: A for the adenyl residue, C for the cytidyl residue, G for the guanidyl residue, and T for the thymidyl residue; and where (5 ') and (3') indicate the 5 'and 3' ends of said nucleic acid.
Cet acide nucléique qui a reçu la dénomination oUF 28 comporte 1,846 kb dont 33,15 % de G et C. il est constitué par la répétition d'une séquence unitaire de 21 nucléotides en 87 copies; celles-ci diffèrent entre elles de 1 à 9 nucléotides mais présentent au moins une homologie de 55 % sur toute la séquence de l'acide nucléique pUF 28. Ces variations résultent de la duplication en nombreux exemplaires d'une séquence de base, et se traduisent par des remplacements et/ou des additions et/ou des suppressions de un ou plusieurs nucléotides. Ces modifications apparaissent clairement à la figure 1, dans laquelle les 87 copies de la séquence unitaire constituant l'acide nucléique pUF 28 sont superposées. This nucleic acid which has received the name oUF 28 comprises 1,846 kb including 33,15% of G and C. it is constituted by the repetition of a unitary sequence of 21 nucleotides in 87 copies; these differ from each other by 1 to 9 nucleotides but exhibit at least a homology of 55% over the entire sequence of the nucleic acid pUF 28. These variations result from the duplication in numerous copies of a basic sequence, and translate by replacements and / or additions and / or deletions of one or more nucleotides. These modifications appear clearly in FIG. 1, in which the 87 copies of the unitary sequence constituting the nucleic acid pUF 28 are superimposed.
La présente invention concerne donc un acide nucléique comprenant la séquence nucléotidique de la figure 1 ou la séquence complémentaire correspondante capable de s'apparier avec la même portion de l'ADN génomique de
Plasmodium falclparum en raison de sa nature bicaténaire.The present invention thus relates to a nucleic acid comprising the nucleotide sequence of FIG. 1 or the corresponding complementary sequence capable of pairing with the same portion of the genomic DNA of
Plasmodium falclparum because of its double-stranded nature.
L'invention concerne également un oligonucléotide qui a reçu la dénomination Qui 28 et qui dérive de l'acide nucléique de l'invention puy 28. The invention also relates to an oligonucleotide which has received the designation Qui 28 and which derives from the nucleic acid of the invention puy 28.
L'oligonucléotide OLI 28 comprend 20 nucléotides dont la séquence est la suivante (5' ) TAGGTCTTAAGGTAACTAAT (3')
L'oligonucléotide OLI 28 est présent dans l'acide nucléique pUF 28 en quatre copies soulignées dans la figure 1.OLI oligonucleotide 28 comprises 20 nucleotides whose sequence is as follows (5 ') TAGGTCTTAAGGTAACTAAT (3')
OLI oligonucleotide 28 is present in nucleic acid pUF 28 in four exemplified copies in FIG.
L'invention concerne naturellement, aussi l'oligonucléotide complémentaire de OLI 28 et ayant la séquence nucléotidique suivante (5')ATTAGTTACCTTAAGACCTA(3') capable de s'apparier avec la même portion d'ADN génomique de Plasmodium falciparum en raison de sa nature bicaténaire. The invention naturally also relates to the oligonucleotide complementary to OLI 28 and having the following nucleotide sequence (5 ') ATTAGTTACCTTAAGACCTA (3') capable of pairing with the same portion of genomic DNA of Plasmodium falciparum because of its nature. stranded.
Font également partie de l'invention les acides nucléiques et les oligonucléotides dans lesquels les groupes thymidine sont remplacés par des groupes uracyles. Also included in the invention are nucleic acids and oligonucleotides in which the thymidine groups are replaced by uracycl groups.
L'oligonucléotide OLI 28 peut être préparé par synthèse chimique, l'acide nucléique puy 28 est lui isolé à partir d'un clone bactérien recombinant RRlSpUF28 par des méthodes connues dans l'état de la technique. The oligonucleotide OLI 28 can be prepared by chemical synthesis, the nucleic acid puy 28 is isolated from a recombinant bacterial clone RRlSpUF28 by methods known in the state of the art.
L'acide nucléique puy 28 et 1'oligonucléotide OLI 28 présentent la caractéristique de s'hybrider spécifiquement avec 1'ADN de Plasmodium falciparum. The nucleic acid puy 28 and OLI oligonucleotide 28 have the characteristic of specifically hybridizing with Plasmodium falciparum DNA.
L'invention concerne donc également les sondes pour détecter la présence de Plasmodium falciparum dans un échantillon biologique, constituées par ou comprenant tout ou partie de la séquence complémentaire d'un acide nucléique selon l'invention, ou toute sonde ne se distinguant des précédentes au niveau de ia séquence nucléotidique que par des substitutions et/ou additions et/ou suppressions de un ou plusieurs nucléotides n'entralnant pas de modification des propriétés d'hybridation de ladite sonde avec un acide nucléique selon l'invention, dans les conditions d'hybridation définies ci après
- traitement de pré-hybridation du support sur lequel est fixé la sonde, à 330C pendant 30 minutes avec une solution de pré-hybridation ayant la composition suivante
tampon 5 fois SSC (1 fois SSC=Nacl 0,15M; Citrate de
Sodium 0,015M)
Ficoll 400 0,1 % Poids/Volume
Polyvinylpyrrolidone 0,1 z Poids/Volume
Phosphate de Sodium pH 6,5 50 mM
Glycine 0,1 % Poids/Volume
SDS (Sodium Dodécyl Sulfate) 0,1 % Poids/Volume
ADN de Sperme de Hareng dénaturé 100 Rg/ml en présence de 50 % de formamide.The invention therefore also relates to the probes for detecting the presence of Plasmodium falciparum in a biological sample, constituted by or comprising all or part of the complementary sequence of a nucleic acid according to the invention, or any probe which differs from the previous ones at level of the nucleotide sequence that by substitutions and / or additions and / or deletions of one or more nucleotides not involving modification of the hybridization properties of said probe with a nucleic acid according to the invention, under the conditions of hybridization defined below
pre-hybridization treatment of the support on which the probe is fixed at 330 ° C. for 30 minutes with a pre-hybridization solution having the following composition
buffer 5 times SSC (1 time SSC = 0.15M NaCl;
Sodium 0.015M)
Ficoll 400 0.1% Weight / Volume
Polyvinylpyrrolidone 0.1 z Weight / Volume
Sodium Phosphate pH 6.5 50 mM
Glycine 0.1% Weight / Volume
SDS (Sodium Dodecyl Sulfate) 0.1% Weight / Volume
Herring sperm DNA denatured 100 Rg / ml in the presence of 50% formamide.
- hybridation avec l'acide nucléique complémentaire, pendant 2 heures à 330C dans une solution tampon identique à la solution de pré-hybridation précédente, en présence de 50 % de formamide. - Hybridization with the complementary nucleic acid, for 2 hours at 330C in a buffer solution identical to the previous pre-hybridization solution, in the presence of 50% of formamide.
- lavages successifs avec les solutions suivantes
4 4 lavages de 5 minutes dans un tampon 5 fois
SSC en présence de SDS 0,1 %, à température ambiante, . 1 lavage de 20 minutes dans un tampon 2 fois
SSC en présence de SDS 0,1 %, à température ambiante.- successive washes with the following solutions
4 4 washes of 5 minutes in a buffer 5 times
SSC in the presence of 0.1% SDS, at room temperature,. 1 wash 20 minutes in buffer 2 times
SSC in the presence of 0.1% SDS at room temperature.
L'invention concerne aussi les sondes pour détecter la présence de Plasmodium falciparum dans un échantillon biologique, constituées par ou comprenant une séquence de 10 à 450 nucléotides consécutifs contenus dans la séquence complémentaire d'un acide nucléique selon l'invention. The invention also relates to probes for detecting the presence of Plasmodium falciparum in a biological sample, constituted by or comprising a sequence of 10 to 450 consecutive nucleotides contained in the complementary sequence of a nucleic acid according to the invention.
L'invention concerne plus particulièrement les sondes pour . détecter Plasmodium falclparum dans un échantillon, constituées par ou comprenant une séquence nucléotidique complémentaire d'un oligonucléotide selon l'invention, ou toute sonde ne se distinguant de la précédente au niveau de la séquence nucléotidique que par des substitutions et/ou additions et/ou suppressions de un ou plusieurs nucléotides n'entraînant pas de modification des propriétés d'hybridation de ladite sonde avec un oligonucléotide selon l'invention, dans les conditions d'hybridation définies ci-après :
- traitement de pré-hybridation du support sur lequel est fixé la sonde, à 300C pendant 30 minutes avec une solution de pré-hybridation ayant la composition suivante tampon 5 fois SSC
Ficoîl 400 0,1 % Poids/Volume
Polyvinylpyrrolidone 0,1 % Poids/Volume Phosphate de Sodium pH 6,5 50 mM Glycine 0,1 % Poids/Volume SDS (Sodium Dodécyl Sulfate) 0,1 % Poids/Volume ADN de Sperme de Hareng dénaturé 100 Rg/ml
- hybridation avec l'oligonucléotide complémentaire, pendant 4 heures à 300C dans une solution tampon identique à la solution de pré-hybridation précédente.The invention relates more particularly to probes for. detecting Plasmodium falclparum in a sample, constituted by or comprising a nucleotide sequence complementary to an oligonucleotide according to the invention, or any probe which is distinguished from the preceding one at the level of the nucleotide sequence only by substitutions and / or additions and / or deletions of one or more nucleotides not leading to a modification of the hybridization properties of said probe with an oligonucleotide according to the invention, under the hybridization conditions defined below:
pre-hybridization treatment of the support on which the probe is fixed at 300 ° C. for 30 minutes with a pre-hybridization solution having the following composition: 5-fold buffer SSC
Ficoil 400 0.1% Weight / Volume
Polyvinylpyrrolidone 0.1% Weight / Volume Sodium Phosphate pH 6.5 50 mM Glycine 0.1% Weight / Volume SDS (Sodium Dodecyl Sulfate) 0.1% Weight / Volume DNA Denatured Herring Sperm 100 Rg / ml
- Hybridization with the complementary oligonucleotide for 4 hours at 300C in a buffer solution identical to the previous pre-hybridization solution.
- lavages successifs avec les solutions suivantes 2 2 lavages de 5 minutes dans un tampon 5 fois
SSC à température ambiante,
1 1 lavage de 5 minutes dans un tampon 5 fois
SSC en présence de SDS 0,1 %, à température ambiante.- successive washes with the following solutions 2 2 washes of 5 minutes in a buffer 5 times
SSC at room temperature,
1 1 washing 5 minutes in a buffer 5 times
SSC in the presence of 0.1% SDS at room temperature.
1 1 lavage de 20 minutes dans un tampon 5 fois
SSC en présence de SDS 0,1 %, à température ambiante.1 1 washing 20 minutes in a buffer 5 times
SSC in the presence of 0.1% SDS at room temperature.
Les conditions d'hybridation définies ci-dessus constituent des conditions préférées, mais ne sont nullement limitatives et peuvent être modifiées sans affecter pour autant les propriétés de reconnaissance et d'hybridation des sondes et des acides nucléiques et des oligonucléotides conformes à l'invention. The hybridization conditions defined above constitute preferred conditions, but are in no way limiting and may be modified without affecting the recognition and hybridization properties of the probes and the nucleic acids and oligonucleotides according to the invention.
I1 est connu de l'homme du métier qu'une séquence nucléotidique peut présenter des modifications comme des substitutions et/ou additions et/ou suppressions de un ou plusieurs nucléotides n'entrainant cependant pas de modification des propriétés, notamment d'hybridation de ladite séquence nucléotidique. It is known to those skilled in the art that a nucleotide sequence may present modifications such as substitutions and / or additions and / or deletions of one or more nucleotides which do not entail any modification of the properties, in particular of hybridization of said nucleotide sequence.
L'invention concerne encore les sondes pour détecter Plasmodium faîciparum dans un échantillon, constituées par la répétition de la séquence d'une ou plusieurs sondes contenant de 10 à 450 nucléotides. The invention also relates to the probes for detecting Plasmodium falciparum in a sample, consisting of the repetition of the sequence of one or more probes containing from 10 to 450 nucleotides.
On désignera ci-après par sonde pUF 28, la sonde correspondant à l'acide nucléique pUF 28 et présentant donc la séquence de la figure 1, et par sonde OLI 28, la sonde correspondant à I'oligonucléotide OLI 28 et présentant donc la séquence suivante (s' ) TAGGTCTTAAGGTAACTAAT (3')
Les sondes sont avantageusement marquées par tout marqueur classiquement utilisé. Les sondes peuvent etre marquées à l'aide d'un traceur radioactif comme 32p, 35S, 125I, 3H, 14C. Le marquage radioactif peut être réalisé selon une méthode quelconque connue de l'homme du métier.Hereinafter denoted by probe pUF 28, the probe corresponding to the nucleic acid pUF 28 and therefore having the sequence of FIG. 1, and by probe OLI 28, the probe corresponding to oligonucleotide OLI 28 and therefore having the sequence next (s ') TAGGTCTTAAGGTAACTAAT (3')
The probes are advantageously labeled by any classically used marker. The probes can be labeled with a radioactive tracer such as 32p, 35S, 125I, 3H, 14C. The radioactive labeling may be carried out according to any method known to those skilled in the art.
Les sondes peuvent être marquées en 3' par addition d'un ou plusieurs déoxynucléotides ou ribonucléotides ou d'un didéoxynucléotide, marqués en alpha par le 32p, en présence de la Terminal Déoxynucléotidyl
Transférase; les sondes peuvent également être marquées en 5' par transfert d'un groupe Phosphate radioactif d'un déoxynucléotide ou d'un didéoxynucléotîde libre marqué en position gamma, en présence de la T4 Polynucléotide Kinase, elles peuvent encore être marquées à chaque extrémité par adjonction d'une séquence quelconque radiomarquée en présence de T4 DNA ligase.The probes can be labeled in 3 'by addition of one or more deoxynucleotides or ribonucleotides or a dideoxynucleotide, labeled alpha by 32p, in the presence of the Deoxynucleotidyl Terminal.
transferase; the probes can also be labeled in 5 'by transfer of a radioactive phosphate group of a deoxynucleotide or a free dideoxynucleotide labeled in the gamma position, in the presence of the T4 polynucleotide kinase, they can be further labeled at each end by addition of any sequence radiolabeled in the presence of T4 DNA ligase.
La sonde puy 28 est marquée de manière avantageuse par "Nick Translation" ou par "Random Priming". The puy probe 28 is advantageously labeled by "Nick Translation" or "Random Priming".
La sonde oligonucléotidique OLI 28 peut être marquée lors de sa synthèse chimique en incorporant un ou plusieurs déoxynucléotides raàioactifs, la sonde OLI 28 est de manière avantageuse marquée à son extrémité 5'.OLI oligonucleotide probe 28 may be labeled during its chemical synthesis by incorporating one or more reactive deoxynucleotides, the OLI probe 28 is advantageously labeled at its 5 'end.
La méthode de détection de l'hybridation dépendra du marqueur radioactif utilisé et pourra reposer sur l'autoradiographie, la scintillation liquide, le comptage gamma ou tout autre technique permettant de détecter l'émission du rayonnement émis par le marqueur radioactif. The method of detection of hybridization will depend on the radioactive label used and may be based on autoradiography, liquid scintillation, gamma counting or any other technique for detecting the emission of radiation emitted by the radioactive marker.
Un marquage non radioactif peut également etre utilisé, en associant aux sondes de l'invention des groupements présentant des propriétés immunologiques comme un antigène, une affinité spécifique pour certains réactifs comme un ligand, des propriétés physiques comme la fluorescence ou la luminescence, des propriétés permettant la complétion de réactions enzymatiques comme une enzyme ou un substrat d'enzyme. Le marquage non radioactif peut être fait par incorporation d'un analogue de nucléotide comportant l'un de ces groupements, par "Nick Translation" ou par "Random Priming"; ou par addition à l'extrémité 3' ou 5' de l'un de ces analogues. I1 peut être fait également directement par modification chimique de 1'ADN, comme la photobiotinylation ou la sulfonation. Non-radioactive labeling may also be used, by associating with the probes of the invention groups having immunological properties such as an antigen, a specific affinity for certain reagents such as a ligand, physical properties such as fluorescence or luminescence, properties allowing completion of enzymatic reactions as an enzyme or enzyme substrate. The non-radioactive labeling can be done by incorporation of a nucleotide analog having one of these groups, by "Nick Translation" or by "Random Priming"; or by addition to the 3 'or 5' end of one of these analogs. It can also be done directly by chemical modification of DNA, such as photobiotinylation or sulfonation.
L'invention concerne également un procédé d'hybridation d'une sonde nucléotidique avec 1'ADN de
Plasmodium falciparum, caractérisé en ce qu'il comprend les étapes suivantes
- le traitement de pré-hybridation d'un support, comme un filtre de nitrocellulose ou une membrane de nylon, sur lequel est fixé 1'ADN extrait de Plasmodium falciparum, avec une solution de pré-hybridation,
- l'hybridation dans une solution identique à la solution de pré-hybridation comprenant en outre une sonde nucléotidique conforme à l'invention,
- plusieurs lavages successifs.The invention also relates to a method of hybridizing a nucleotide probe with the DNA of
Plasmodium falciparum, characterized in that it comprises the following steps
the prehybridization treatment of a support, such as a nitrocellulose filter or a nylon membrane, on which the DNA extracted from Plasmodium falciparum is fixed with a prehybridization solution,
hybridization in a solution identical to the pre-hybridization solution further comprising a nucleotide probe according to the invention,
- several successive washes.
L'invention concerne aussi un procédé de détection in vitro de Plasmodium falciparum dans un prélèvement biologique susceptible de le contenir, caractérisé en ce que après avoir rendu 1'ADN de Plasmodium faîcioarum, éventuellement contenu dans le prélèvement biologique, accessible et monocaténaire, on le met en contact avec une sonde nucléotidique conforme à 11 invention, dans des conditions favorables à l'hybridation et l'on détecte les hybrides éventuellement formés, la sonde ayant été préalablement marquée ou rendue apte à être détectée comme il a été dit précédemment. The invention also relates to a method for the in vitro detection of Plasmodium falciparum in a biological sample capable of containing it, characterized in that, after rendering Plasmodium faciioarum DNA, optionally contained in the biological sample, accessible and single-stranded, it is contacted with a nucleotide probe according to the invention, under conditions favorable to hybridization and detecting any hybrids possibly formed, the probe having been previously marked or made capable of being detected as has been said previously.
Les sondes conformes à l'invention peuvent être également utilisées pour détecter 1'ADN de Plasmodium falciparum présent au stade sporozoïte dans les glandes salivaires de l'anophèle. The probes according to the invention can also be used to detect Plasmodium falciparum DNA present in the sporozoite stage in the anopheles salivary glands.
L'invention a en outre pour objet les kits de diagnostic du paludisme mettant en oeuvre des procédés de détection in vitre de Plasmodium falciparum sus-mentionnés. The invention further relates to malaria diagnostic kits using the above-mentioned in vitro methods for detecting Plasmodium falciparum.
A titre d'exemple de tel kits comprennent notamment
- une quantité déterminée d'une sonde nucléotidique conforme à l'invention,
- un milieu approprié à la réalisation d'une réaction d'hybridation entre 1'ADN de Plasmodium falciparum et ladite sonde,
- des réactifs permettant la détection des hybrides formés entre 1'ADN et la sonde lors de ladite réaction d'hybridation.As examples of such kits include
a determined quantity of a nucleotide probe according to the invention,
a medium suitable for carrying out a hybridization reaction between Plasmodium falciparum DNA and said probe,
reagents allowing the detection of the hybrids formed between the DNA and the probe during said hybridization reaction.
Les sondes oligonucléotidiques conformes à l'invention peuvent être utilisées comme amorce dans un processus d'amplification génétique in vitre consistant à fixer la sonde sur 1'ADN de Plasmodium falclparum par hybridation, puis à mettre en oeuvre un processus d'extension enzymatique à l'aide d'ADN-polymérase, suivi d'un processus de dénaturation , et à répéter le cycle hybridation-extension-dénaturation, connu sous le nom de cycle PCR ("Polymerase Chain Reaction" décrit par la société
Cetus Corporation), un nombre de fois suffisant pour augmenter la quantité de la séquence-cible de la sonde oligonucléotidique de départ dans une proportion exponentielle par rapport au nombre de cycles mis en oeuvre.The oligonucleotide probes according to the invention can be used as a primer in an in vitro genetic amplification process of fixing the probe on Plasmodium falclparum DNA by hybridization, and then to carry out an enzymatic extension process on the plasmid. using DNA polymerase, followed by a denaturation process, and to repeat the hybridization-extension-denaturation cycle, known as the PCR ("Polymerase Chain Reaction") cycle described by the company
Cetus Corporation), a number of times sufficient to increase the amount of the target sequence of the starting oligonucleotide probe in an exponential proportion with respect to the number of cycles used.
Outre les caractéristiques qui précèdent, l'invention comporte d'autres caractéristiques qui apparaîtront au cours de la description qui suit et qui se référent à des exemples de mise en oeuvre de la présente invention , étant entendu que ces exemples ne sauraient constituer une quelconque limitation à la portée des revendications. In addition to the preceding features, the invention includes other features which will become apparent from the description which follows and which refer to examples of implementation of the present invention, it being understood that these examples can not constitute any limitation. within the scope of the claims.
I - PREPARATION DE LA SONDE pUF2S. I - PREPARATION OF THE PROBE pUF2S.
A) Production de la sonde pUF 28
L'acide nucléique puy 28 est introduit dans une cellule hôte à l'aide d'un vecteur, du type plasmide apte à se répliquer dans ladite cellule hôte; de manière avantageuse l'acide nucléique pUF 28 a été introduit dans le plasmide pUC 19 et amplifié dans la souche d'Escherichia
Coli RRlAMl5 (K 12), dérivée de HB 101.A) Production of the pUF 28 probe
The nucleic acid puy 28 is introduced into a host cell with the aid of a vector of the plasmid type capable of replicating in said host cell; advantageously the nucleic acid pUF 28 was introduced into the plasmid pUC 19 and amplified in the Escherichia strain
Coli RR1AM15 (K12), derived from HB 101.
A partir d'un congelat à -700C, la souche est ensemencée sur un milieu solide SOB (Bacto Tryptone 2 %,
Extrait de Levure 0,5 %, NaCl 10mM, KC1 2,5mM, MgC12 10mM,
MgSO4 10mM), en présence d'Ampicilline (50 g/ml) et mise en culture pendant 18 heures à 370C.From a freeze at -700C, the strain is seeded on solid medium SOB (Bacto Tryptone 2%,
0.5% Yeast Extract, 10mM NaCl, 2.5mM KCl, 10mM MgC12,
10mM MgSO4) in the presence of Ampicillin (50 g / ml) and cultured for 18 hours at 370C.
10 ml de milieu liquide SOB (Ampicilline (50 gSml)) sont ensemencés avec une colonie et mis en culture durant 16 heures, à 37 C, sous une agitation orbitale de 200 rpm. 2 ml de cette préculture servent d'inoculum pour ensemencer un litre de milieu liquide SOB (Ampicilline 50 Ag/ml). 10 ml of SOB liquid medium (Ampicillin (50 gSml)) are seeded with a colony and cultured for 16 hours, at 37 ° C., with orbital shaking of 200 rpm. 2 ml of this preculture serve as an inoculum for sowing one liter of SOB liquid medium (Ampicillin 50 Ag / ml).
La culture se fait sur 9 heures, à 370C et sous agitation (200rpm). The culture is done over 9 hours at 370C and stirring (200rpm).
L'addition de Chloramphénicol (170 g/ml) permet d'amplifier le nombre de copies du plasmide par cellule en bloquant la division bactérienne. Cette étape d'amplification se déroule toujours à 370C, sous agitation (200 rpm), durant 16 heures. The addition of Chloramphenicol (170 g / ml) makes it possible to increase the plasmid copy number per cell by blocking the bacterial division. This amplification step always takes place at 370 ° C., with stirring (200 rpm), for 16 hours.
Les bactéries sont récupérées par centrifugation à 5000 g, pendant 10 minutes et à 40C. The bacteria are recovered by centrifugation at 5000 g for 10 minutes and at 40C.
Le plasmide est extrait de manière classique selon la technique de Birboim et Doly, décrite par Maniatis et al (1982 "Moiecular cloning, A laboratory manual", Cold
Spring Harbor Laboratory) . Il est purifié, en dernière étape, par ultracentrifugation sur gradient de CsCl2 (n = 1,3860; 1,55mg/ml; 100000 g; 200C; 36 heures; en présence de 600 g/ml de Bromure d'Ethidium. The plasmid is extracted in a conventional manner using the technique of Birboim and Doly, described by Maniatis et al (1982 "Moiecular cloning, A laboratory manual", Cold
Spring Harbor Laboratory). It is purified in the last step by ultracentrifugation on a CsCl 2 gradient (n = 1.3860, 1.55 mg / ml, 100000 g, 200 ° C., 36 hours, in the presence of 600 g / ml of Ethidium bromide.
Le Bromure d'Ethidium est éliminé par 6 ex-ractions au n-Butanol et 3 extractions au Diéthyl-Oxyde. Ethidium bromide is removed by 6 n-butanol reactions and 3 diethyl ether extractions.
B) Purification de la sonde pUF 28
Après précipitation dans l'éthanol 70 %, l'ADN plasmidial est déssiqué sous vide puis solubilisé dans l'eau et dosé par mesure au spectrophotomètre de la D.O. de la solution à 260 nm.B) Purification of the pUF 28 probe
After precipitation in 70% ethanol, the plasmid DNA is desiccated under vacuum and then solubilized in water and assayed by measurement with the spectrophotometer of the OD of the solution at 260 nm.
La purification de l'insert pUF 28 se fait par une double digestion enzymatique du plasmide par 2 enzymes
Sst I (ou Sac I) et Xba I dont les sites de coupure se situent de part et d'autre de l'insert, dans la séquence polylinker du plasmide pUC 19. Purification of the insert pUF 28 is by double enzymatic digestion of the plasmid by 2 enzymes
Sst I (or Sac I) and Xba I whose cleavage sites are located on either side of the insert, in the polylinker sequence of plasmid pUC 19.
De manière préparative, 100 g de plasmide sont digérés dans 200 1ll au moins de tampon Sac I (Tris-HCl pH 8, 50mM; NaCl 50mM; MgCl2 10mM) à raison de 1 unité/llg de chaque enzyme. Les deux digestions sont simultanées et sont incubées à 37 OC, pendant au moins 3 heures. In a preparative manner, 100 g of plasmid are digested in at least 200 μl of Sac I buffer (Tris-HCl pH 50mM, 50mM NaCl, 10mM MgCl 2) at a rate of 1 unit / μg of each enzyme. Both digests are simultaneous and are incubated at 37 ° C for at least 3 hours.
L'insert pUF 28 (1,846 kb) et le plasmide pUC 19
(2,686 kb) sont séparés par électrophorése sur gel à 0,8 % d'agarose, (gel de 20 cm par 20 cm; deux puits de 7 cm de longueur par 1,5 mm de largeur par 0,8 cm de profondeur), dans un tampon TAE (0,5 g/ml de Bromure dEthidium). The insert pUF 28 (1.846 kb) and the plasmid pUC 19
(2,686 kb) were separated by 0.8% agarose gel electrophoresis (20 cm by 20 cm gel, two wells 7 cm long by 1.5 mm wide by 0.8 cm deep) in a TAE buffer (0.5 g / ml Ethidium Bromide).
La bande inférieure est découpée et la sonde DUF 28 est électro-éluée dans un appareil BIOTRAP (dénomination commerciale), dans le tampon TAE (0,5 g/ml de Bromure d'Ethidium). L'insert ainsi purifié est prêt à l'emploi après 6 extractions du Bromure d'Ethidium au n-Butanol et 3 extractions au Diéthyl-Oxyde et précipitation dans l'éthanol 70 %. Après remise en solution dans l'eau, la qualité de la sonde est contrôlée par électrophorèse analytique et la concentration en ADN est déterminée par la mesure de la D.O. à 260nm. The lower band is cut out and the DUF probe 28 is electroeluted in a BIOTRAP apparatus (trade name), in the TAE buffer (0.5 g / ml Ethidium bromide). The insert thus purified is ready for use after 6 extractions of Ethidium bromide with n-butanol and 3 extractions with diethyl-oxide and precipitation in 70% ethanol. After redissolving in water, the quality of the probe is monitored by analytical electrophoresis and the DNA concentration is determined by the measurement of the D.O. at 260 nm.
C) Marquage de la sonde pUF 28
Les résultats rapportés ci-dessous ont été obtenus par marquage de la sonde puy 28 au 32p, par l'intermédiaire d'un nucléotide triphosphate marqué en position alpha; par exemple le alpha 32P dTTP (800 Ci/mmol;
AMERSHAM FRANCE (dénomination commerciale)). Un microgramme d'insert est ainsi marqué avec 140 Ci par nick translation, l'activité spécifique est alors de 1 à 5.108 cpm/ g. On peut aussi marquer l'insert par la technique du "Random Priming", l'activité spécifique est alors de 1 à 2.109 cpm/g. C) Marking of the pUF 28 probe
The results reported below were obtained by labeling the probe puy 28 to 32p via an alpha-labeled nucleotide triphosphate; for example, alpha 32P dTTP (800 Ci / mmol;
AMERSHAM FRANCE (trade name)). A microgram of insert is thus labeled with 140 Ci per nick translation, the specific activity is then 1 to 5.108 cpm / g. We can also mark the insert by the technique of "Random Priming", the specific activity is then 1 to 2,109 cpm / g.
II - PREPARATION DE LA SONDE OLI 28. II - PREPARATION OF THE OLI PROBE 28.
A) Production de la sonde OLI 28
La séquence oligonucléotidique OLI 28 de 20 bases est produite par synthèse chimique sur un appareil automatique (synthétiseur d'APPLIED BIOSYSTEM (dénomination commerciale)). 300 g ont ainsi été synthétisés sous forme monocaténaire en une seule fois. A) Production of the OLI probe 28
The oligonucleotide sequence OLI 28 of 20 bases is produced by chemical synthesis on an automatic device (APPLIED BIOSYSTEM synthesizer (trade name)). 300 g were thus synthesized in single-stranded form at one time.
Les sels présents à haute concentration sont éliminés après précipitation de l'ADN monobrin dans l'éthanol 70 %. The salts present at high concentration are removed after precipitation of the single-stranded DNA in 70% ethanol.
B) Marquage de la sonde OLI 28
L'oligonucléotide OLI 28 est marqué à l'extrémité 5' par la T4 Polynucléotide Kinase, en présence de gamma ATP. 50 pmoles de sonde OLI 28 (330 ng) sont incubées en présence de 7 Unités de T4 Polynucléotide Kinase et 150 pCi de gamma 32P ATP dans un volume final de 50 ,
L'activité spécifique moyenne est de l'ordre de 2 à 5.i08 cpm/ g
III - PREPARATION DES ECHANTILLONS A
ANALYSER
A) Préparation des échantillons
Le protocole de préparation des échantillons décrits ci-dessous a été mis au point par J. W. Zolg et al, et décrit dans Am. J. Trop. Med. Hyg. (1987), ;5, 33-41.B) Marking the OLI probe 28
OLI oligonucleotide 28 is labeled at the 5 'end by T4 polynucleotide kinase, in the presence of gamma ATP. 50 pmol of OLI probe 28 (330 ng) are incubated in the presence of 7 units of T4 polynucleotide kinase and 150 pCi of 32 P ATP in a final volume of 50,
The average specific activity is of the order of 2 to 5.i08 cpm / g
III - PREPARATION OF SAMPLES A
ANALYZE
A) Sample preparation
The sample preparation protocol described below was developed by JW Zolg et al, and described in Am. J. Trop. Med. Hyg. (1987), 5, 33-41.
Cette technique comporte 5 étapes et permet de manipuler des échantillons de sang parasité d'au moins 50W1. This technique has 5 steps and allows to handle parasitized blood samples of at least 50W1.
- première étape : Lyse des hématies parasitées en ajoutant 2 volumes (100 pL1) d'eau bidistillée, stérile. - First step: Lyse parasitized red blood cells by adding 2 volumes (100 μl) of bidistilled, sterile water.
Incuber pendant 20 minutes.Incubate for 20 minutes.
- deuxième étape : Lyse des parasites en ajoutant 0,33 volume (50 ptl) de tampon LE (Lauryl Sarcosine 1 %; EDTA pH8, 50 mM). L'EDTA inhibe l'activité enzymatique des DNAases. second step: lysis of the parasites by adding 0.33 volumes (50 μl) of LE buffer (Lauryl Sarcosine 1%, EDTA pH8, 50 mM). EDTA inhibits the enzymatic activity of DNAases.
- troisième étape : Addition de 0,25 volume (50 pl) de trifluoroacétate de césium 5 M. Le trifluoroacétate de Césium est un sel fortement chaotropique qui dénature les protéines et les dissocie des acides nucléiques. Step 3: Addition of 0.25 volume (50 μl) of 5 M cesium trifluoroacetate Cesium trifluoroacetate is a highly chaotropic salt that denatures proteins and dissociates them from nucleic acids.
- quatrième étape : Extraction des protéines par addition de 0,33 volume (83 Al) d'un mélange organique
(éthanol 2,5 volumes /chloroforme 1 volume /alcool isoamylique 0,04 volume).fourth step: Protein extraction by adding 0.33 volumes (83 Al) of an organic mixture
(2.5 volume ethanol / 1 volume chloroform / 0.04 volume isoamyl alcohol).
- cinquième étape : Centrifugation à 12000 g pendant 5 minutes et récupération de la phase aqueuse supérieure. fifth step: Centrifugation at 12000 g for 5 minutes and recovery of the upper aqueous phase.
Toutes les solutions mères peuvent être conservées à température ambiante. Les ADN extraits selon cette méthode peuvent être conservés à 370C, pendant plusieurs mois. All stock solutions can be stored at room temperature. DNAs extracted by this method can be stored at 370C for several months.
B) Dénaturation de l'ADN
L'ADN est dénaturé en ajoutant 0,25 volume (62,5 pl) de soude 2,5 N (20 minutes à température ambiante).B) Denaturation of DNA
The DNA is denatured by adding 0.25 volume (62.5 μl) of 2.5 N sodium hydroxide (20 minutes at room temperature).
La solution est neutralisée avec 0,5 volume (156 l) de tampon Tris-HCL (pH8, 3M) et incubée dans la glace pour éviter la renaturation de l'ADN. The solution is neutralized with 0.5 volume (156 l) of Tris-HCL buffer (pH8, 3M) and incubated in ice to avoid renaturation of the DNA.
C) Dépôt des échantillons
Les échantillons sont déposés en duplica sur un support comme un filtre de nitrocellulose à l'aide d'un appareil de filtration 8 fois 12 puits, sous vide (appareil
HYBRI-DOT MANIFOLD de BRL (dénomination commerciale)).C) Filing of samples
The samples are deposited in duplicate on a support such as a nitrocellulose filter using a filtration apparatus 8 times 12 wells, under vacuum (apparatus
HYBRI-DOT MANIFOLD from BRL (trade name)).
Le filtre est préalablement mouillé dans le tampon 2 fois SSC (1 fois SSC = NaC1 0,15 M; Citrate de
Sodium 0,015M) avant d'être placé dans l'appareil. Chaque échantillon est déposé sous vide. Avant et après chaque dépôt, le puits est rincé avec 200 Al de tampon 2 fois SSC.The filter is pre-wetted in 2-fold SSC buffer (1x SSC = 0.15 M NaCl;
Sodium 0.015M) before being placed in the apparatus. Each sample is vacuum deposited. Before and after each deposition, the well is rinsed with 200 Al buffer 2 times SSC.
Après séchage à température ambiante pendant 30 minutes, le filtre est incubé à 800C pendant 2 heures, entre deux feuilles de papier WHATMAN 3MM (dénomination commerciale) pour fixer les ADN sur la membrane.After drying at room temperature for 30 minutes, the filter is incubated at 800C for 2 hours, between two sheets of WHATMAN 3MM paper (trade name) to fix the DNAs on the membrane.
IV - HYBRIDATION
L'hybridation se déroule en trois étapes la préhybridation, l'hybridation, les lavages.IV - HYBRIDIZATION
Hybridization takes place in three stages: prehybridization, hybridization, washing.
A) La tréhvbridation
Le filtre sec est placé dans un sac plastique soudé et incubé dans un tampon d'hybridation, à raison de 75 CLl/cm2. A) Treblinging
The dry filter is placed in a welded plastic bag and incubated in hybridization buffer at 75 CLl / cm 2.
Le tampon d'hybridation a la composition suivante - Tampon 5 fois SSC - Ficoll 400 0,1 % Poids/Volume - Polyvinylpyrrolidone 0,1 % Poids/Volume - Phosphate de Sodium pH 6,5 50 mM - Glycine 1 % Poids/Volume - SDS (Sodium Dodécyl Sulfate) 0,1 % Poids/Volume - ADN de sperme de Hareng dénaturé 100 EgXml
La préhybridation avec la sonde pUF 28 est effectuée pendant 30 minutes à 330C en présence de 50 % de formamide.The hybridization buffer has the following composition - 5-fold buffer SSC - Ficoll 400 0.1% Weight / Volume - Polyvinylpyrrolidone 0.1% Weight / Volume - Sodium Phosphate pH 6.5 50 mM - Glycine 1% Weight / Volume - SDS (Sodium Dodecyl Sulfate) 0.1% Weight / Volume - Denatured Herring Sperm DNA 100 EgXml
Prehybridization with the pUF 28 probe is carried out for 30 minutes at 330 ° C in the presence of 50% formamide.
La préhybridation avec la sonde PLI 28 est éffectuée pendant 1 heure à 300C, en absence de formamide. Prehybridization with the PLI probe 28 is performed for 1 hour at 300C, in the absence of formamide.
B) L'hybridation
Après dénaturation de la sonde pUF 28 par chauffage à 1000C pendant 10 minutes puis refroidissement dans la glace fondante (OOC) pendant 10 minutes, l'hybridation avec la sonde tUF 28 monocaténaire se fait dans le même tampon que la préhybridation; le filtre est hybridé avec 80 ng/ml de sonde pUF 28 pendant 2 heures à 330C, pour une activité spécifique de 108 cpmXllg au moins.B) Hybridization
After denaturation of the pUF 28 probe by heating at 1000C for 10 minutes and then cooling in the melting ice (OOC) for 10 minutes, the hybridization with the single-stranded tUF 28 probe is in the same buffer as the prehybridization; the filter is hybridized with 80 ng / ml of pUF 28 probe for 2 hours at 330 ° C., for a specific activity of at least 108 cpm / ml.
L'hybridation avec la sonde OLI 28 se fait dans le même tampon que la préhybridation ; le filtre est hybridé avec 100 ng/ml de sonde OLI 28 pendant 4 heures à 300C, pour 1 1 lavage de 5 minutes dans un tampon 5 fois
SSC en présence de SDS 0,1 %, à température
ambiante.Hybridization with OLI probe 28 is in the same buffer as prehybridization; the filter is hybridized with 100 ng / ml of OLI probe 28 for 4 hours at 300 ° C., for 1 1 washing of 5 minutes in a buffer 5 times
SSC in the presence of 0.1% SDS, at room temperature
room.
1 1 lavage de 20 minutes dans un tampon 5 fois
SSC en présence de SDS 0,1 %, à température
ambiante.1 1 washing 20 minutes in a buffer 5 times
SSC in the presence of 0.1% SDS, at room temperature
room.
D) Révélation de l'hybridation
Les filtres sont séchés à la température ambiante pendant 30 minutes, enveloppés dans un film plastique, et exposés à un film d'autoradiographie, à -700C, pendant 24 heures.D) Revelation of hybridization
The filters are dried at room temperature for 30 minutes, wrapped in a plastic film, and exposed to an autoradiography film at -700C for 24 hours.
V - SENSIBILITE DE DETECTION
A) Sensibilité de la détection d'ADN
La sonde pUF28, radiomarquée au 32P peut détecter 1100 pg d'ADN purifié de Plasmodium falclparum, après 24 heures d'exposition du film d'autoradiographie.V - SENSITIVITY OF DETECTION
A) Sensitivity of DNA detection
The 32P-radiolabelled pUF28 probe can detect 1100 μg of purified Plasmodium falclparum DNA after 24 hours of exposure of the autoradiography film.
La sonde OLI 28 radiomarquée peut détecter 1 ng d'ADN après. 24 heures d'exposition. The radiolabeled OLI probe can detect 1 ng of DNA after. 24 hours of exposure.
B) Sensibilité de la détection d'hématies parasitées
Afin de retrouver les conditions physiopathologiques, les tests de détection ont été réalisés sur des hématies parasitées invitro, synchrones au stade ring.B) Sensitivity of detection of parasitized red blood cells
In order to recover the physiopathological conditions, the detection tests were carried out on invitro parasitic red cells, synchronous at the ring stage.
La sonde puy 28 marquée au 32P détecte 50 hématies parasitées par mm3 de sang de culture à 50 % d'hématocrite, après 24 heures d'exposition du film, soit une parasitémie de 0,001 % de façon reproductible. The 32 P-labeled puy probe detects 50 parasitized red blood cells per mm 3 of 50% hematocrit culture blood after 24 hours of film exposure, a reproducible parasitaemia of 0.001%.
La sonde OLI 28 radiomarquée détecte 500 hématies parasitées par mm3 soit une parasitémie de 0,01 % dans les mêmes conditions. The radiolabelled OLI probe detects 500 parasitized red blood cells per mm3, ie a parasitaemia of 0.01% under the same conditions.
Le tableau I ci-dessous rapporte la durée de manipulation et la sensibilité des sondes puy 28 et PLI 28 ainsi que de différentes sondes connues à ce jour.
Table I below reports the handling time and the sensitivity of the puy 28 and PLI probes 28 as well as various probes known to date.
<tb><Tb>
<SEP> AUTEUR <SEP> SO@D@ <SEP> <SEP> DUREF <SEP> DE <SEP> DUR@@ <SEP> <SEP> DE <SEP> DORER <SEP> DE <SEP> QUANTITE <SEP> D' <SEP> PARASITEMIE
<tb> <SEP> FREPARATION <SEP> L'MYBRIDATION <SEP> LA <SEP> REVELATION <SEP> AD@ <SEP> DETECTE
<tb> <SEP> DES <SEP> EC@A@TILLONS
<tb> <SEP> pRep-Hind
<tb> <SEP> FRANLE@ <SEP> (1,7 <SEP> Kbp) <SEP> 4 <SEP> h <SEP> 30 <SEP> 6 <SEP> h <SEP> 10 <SEP> h <SEP> 25pg <SEP> 0,001 <SEP> %
<tb> <SEP> 1984
<tb> <SEP> DNA
<tb> <SEP> POLLACE <SEP> qesenique <SEP> 3 <SEP> h <SEP> 22 <SEP> h <SEP> 12 <SEP> h <SEP> ? <SEP> 0,0001 <SEP> %
<tb> <SEP> 1985
<tb> <SEP> pFR1
<tb> <SEP> McLAUGELIN <SEP> (21 <SEP> pb) <SEP> 2 <SEP> h <SEP> 3C <SEP> 14 <SEP> h <SEP> 18 <SEP> h <SEP> 100pg <SEP> ?
<tb> <SEP> 1985
<tb> <SEP> pFR1
<tb> <SEP> McLAUGRLIE <SEP> marqué <SEP> au <SEP> 2 <SEP> h <SEP> 4 <SEP> h <SEP> 45 <SEP> 48 <SEP> h <SEP> 100 <SEP> pg <SEP> 0,1 <SEP> %
<tb> <SEP> 1987
<tb> <SEP> 32p
<tb> <SEP> CLONE <SEP> 26
<tb> <SEP> @OLG <SEP> <SEP> (147 <SEP> pb) <SEP> ? <SEP> 20 <SEP> h <SEP> 2 <SEP> h <SEP> 25,0 <SEP> pg <SEP> ?
<tb> 1987
<tb> PUF <SEP> 28 <SEP> 50 <SEP> mm <SEP> 2 <SEP> h <SEP> 24 <SEP> h <SEP> 100 <SEP> pg <SEP> 0,001 <SEP> %
<tb> <SEP> OLI <SEP> 28 <SEP> 50 <SEP> mm <SEP> 4 <SEP> h <SEP> 24 <SEP> h <SEP> 1 <SEP> ng <SEP> 0,01 <SEP> %
<tb>
Comme l'indique le tableau I, les sondes pUF 28 et OLI 28 ont une sensibilité de détection au moins équivalente à celle de pRep-Hind et PFR1 et qui est tout à fait reproductible.<SEP> AUTHOR <SEP> SO @ D @ <SEP><SEP> DUREF <SEP> FROM <SEP> DUR @@ <SEP><SEP> FROM <SEP> DORER <SEP> FROM <SEP> QUANTITY <SEP><SEP> PARASITEMY
<tb><SEP> FREPARATION <SEP> MYBRIDATION <SEP><SEP> REVELATION <SEP> AD @ <SEP> DETECTED
<tb><SEP> FROM <SEP> EC @ A @ TILLONS
<tb><SEP> pRep-Hind
<tb><SEP><SEP> (1.7 <SEP> Kbp) <SEP> 4 <SEP> h <SEP> 30 <SEP> 6 <SEP> h <SEP> 10 <SEP> h <SEP > 25pg <SEP> 0.001 <SEP>%
<tb><SEP> 1984
<tb><SEP> DNA
<tb><SEP> POLLACE <SEP> qesenic <SEP> 3 <SEP> h <SEP> 22 <SEP> h <SEP> 12 <SEP> h <SEP>? <SEP> 0.0001 <SEP>%
<tb><SEP> 1985
<tb><SEP> pFR1
<tb><SEP> McLAUGELIN <SEP> (21 <SEP> pb) <SEP> 2 <SEP> h <SEP> 3C <SEP> 14 <SEP> h <SEP> 18 <SEP> h <SEP> 100pg <SEP>?
<tb><SEP> 1985
<tb><SEP> pFR1
<tb><SEP> McLAUGRLIE <SEP> Labeled <SEP> at <SEP> 2 <SEP> h <SEP> 4 <SEP> h <SEP> 45 <SEP> 48 <SEP> h <SEP> 100 <SEP> pg <SEP> 0.1 <SEP>%
<tb><SEP> 1987
<tb><SEP> 32p
<tb><SEP> CLONE <SEP> 26
<tb><SEP> @OLG <SEP><SEP> (147 <SEP> pb) <SEP>? <SEP> 20 <SEP> h <SEP> 2 <SEP> h <SEP> 25.0 <SEP> pg <SEP>?
<tb> 1987
<tb> PUF <SEP> 28 <SEP> 50 <SEP> mm <SEP> 2 <SEP> h <SEP> 24 <SEP> h <SEP> 100 <SEP> pg <SEP> 0.001 <SEP>%
<tb><SEP> OLI <SEP> 28 <SEP> 50 <SEP> mm <SEP> 4 <SEP> h <SEP> 24 <SEP> h <SEP> 1 <SEP> ng <SEP> 0,01 <SEP>%
<Tb>
As shown in Table I, the pUF 28 and OLI 28 probes have a detection sensitivity at least equivalent to that of pRep-Hind and PFR1 and which is quite reproducible.
En outre, les conditions d'hybridation mises au point spécifiquement pour ces sondes, ont permis d'atteindre ces performances après seulement 2 heures d'hybridation pour la sonde pUF 28 et 4 heures pour la sonde OLI 28. In addition, the hybridization conditions developed specifically for these probes, have achieved these performances after only 2 hours of hybridization for the pUF 28 probe and 4 hours for the OLI probe 28.
Les sondes pUF 28 et OLI 28 sont spécifiques de l'ADN de Plasmodium falciparum; ainsi, en hybridation de "Southern Blots" elles ne reconnaissent pas l'ADN génomique humain, ni l'ADN des trois autre espèces plasmodiales
Plasmodium malariae, Plasmodium ovale et Plasmodium vivax ainsi que Plasmodium cvnomolai bastianell11 qui infeste le singe. Elles reconnaissent l'ADN des souches de Plasmodium falciparum d'origine géographique différente suivantes - souche CAM du Sénégal - souche SGE-1 de Gambie - souche JEAN de Centrafrique - souche KENYA du Kenya - souche LILLY de Centrafrique - souche NF7 d'Afrique (aéroport d'Amsterdam) - souche NF 54 de Tanzanie - souche UPA d'Ouganda - souche HONDURAS du Honduras - souche INDOCHINA-1 du Vietnam The pUF 28 and OLI 28 probes are specific for Plasmodium falciparum DNA; thus, in hybridization of "Southern Blots" they do not recognize the human genomic DNA, nor the DNA of the other three plasmodial species
Plasmodium malariae, Plasmodium ovale and Plasmodium vivax as well as Plasmodium cvnomolai bastianell11 which infests the monkey. They recognize the DNA of strains of Plasmodium falciparum of different geographical origin - CAM strain from Senegal - strain SGE-1 from Gambia - strain JEAN from Central Africa - strain KENYA from Kenya - strain LILLY from Central African Republic - strain NF7 from Africa ( Amsterdam Airport) - strain NF 54 from Tanzania - strain UPA from Uganda - strain HONDURAS from Honduras - strain INDOCHINA-1 from Vietnam
Claims (12)
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR8908069A FR2648476B1 (en) | 1989-06-16 | 1989-06-16 | NUCLEIC ACID AND OLIGONUCLEOTIDE DERIVATIVE THEREOF, CONTAINING SPECIFIC NUCLEOTIDE PROBES OF PLASMODIUM FALCIPARUM, AND THEIR APPLICATION FOR THE DETECTION BY HYBRIDIZATION OF THE DNA OF PLASMODIUM FALCIPARUM |
PCT/FR1990/000435 WO1990015882A1 (en) | 1989-06-16 | 1990-06-15 | Nucleic acid and nucleotidic probes for plasmodium falciparum, and their application in the detection of plasmodium falciparum |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR8908069A FR2648476B1 (en) | 1989-06-16 | 1989-06-16 | NUCLEIC ACID AND OLIGONUCLEOTIDE DERIVATIVE THEREOF, CONTAINING SPECIFIC NUCLEOTIDE PROBES OF PLASMODIUM FALCIPARUM, AND THEIR APPLICATION FOR THE DETECTION BY HYBRIDIZATION OF THE DNA OF PLASMODIUM FALCIPARUM |
Publications (2)
Publication Number | Publication Date |
---|---|
FR2648476A1 true FR2648476A1 (en) | 1990-12-21 |
FR2648476B1 FR2648476B1 (en) | 1993-07-16 |
Family
ID=9382846
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
FR8908069A Expired - Fee Related FR2648476B1 (en) | 1989-06-16 | 1989-06-16 | NUCLEIC ACID AND OLIGONUCLEOTIDE DERIVATIVE THEREOF, CONTAINING SPECIFIC NUCLEOTIDE PROBES OF PLASMODIUM FALCIPARUM, AND THEIR APPLICATION FOR THE DETECTION BY HYBRIDIZATION OF THE DNA OF PLASMODIUM FALCIPARUM |
Country Status (2)
Country | Link |
---|---|
FR (1) | FR2648476B1 (en) |
WO (1) | WO1990015882A1 (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU640745B2 (en) * | 1990-03-30 | 1993-09-02 | Astra Aktiebolag | A novel procedure for the detection of pathogens using dna probes |
KR20020028385A (en) * | 2000-10-09 | 2002-04-17 | 박제철 | Detect method of plasmodium vivax infected in mosquito by gene markers |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0135108A2 (en) * | 1983-08-12 | 1985-03-27 | Rockefeller University | Nucleotide hybridization assay for protozoan parasites |
-
1989
- 1989-06-16 FR FR8908069A patent/FR2648476B1/en not_active Expired - Fee Related
-
1990
- 1990-06-15 WO PCT/FR1990/000435 patent/WO1990015882A1/en unknown
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0135108A2 (en) * | 1983-08-12 | 1985-03-27 | Rockefeller University | Nucleotide hybridization assay for protozoan parasites |
Non-Patent Citations (10)
Title |
---|
BIOLOGICAL ABSTRACTS, vol. 83, no. 11, 1987, resumé no. 110658, Biological Abstracts Inc., Philadelphia, PA, US; J.W. ZOLG et al.; "Detection of Plasmodium falciparum DNA using repetitive DNA clones as species specific probes", & MOL. BIOCHEM. PARASITOL. 22(2/3): 145-152. 1987 * |
BIOLOGICAL ABSTRACTS, vol. 84, no. 2, 1987, resumé no. 18004, Biological Abstracts Inc., Philadelphia, PA, US; G.L. MCLAUGHLIN et al.: "Comparison of genomic, plasmid, synthetic, and combined DNA probes for detecting Plasmodium falciparum DNA", & J. CLIN. MICROBIOL. 25(5): 791-795. 1987 * |
BIOLOGICAL ABSTRACTS, vol. 85, no. 1, 1988, resumé no. 7679, Biological Abstracts Inc., Philadelphia, PA, US; M. HOLMBERG et al.; "Use of a DNA hybridization assay for the detection of Plasmodium falciparum in field trials", & AM. J. TROP. MED. HYG. 37(2): 230-234. 1987 * |
BIOLOGICAL ABSTRACTS, vol. 87, no. 1, 1989, resumé no. 8439, Biological Abstracts Inc., Philadelphia, PA, US; O. SETHABUTR et al.: "A comparative field study of radiolabeled and enzyme-conjugated synthetic DNA probes for the diagnosis of falciparum malaria", & AM. J. TROP. MED. HYG. 39(3): 227-231. 1988 * |
CHEMICAL ABSTRACTS, vol. 104, no. 11, 17 mars 1986, page 167, resumé no. 83015y, Columbus, Ohio, US; P. OQUENDO et al.: "Characterization of a repetitive DNA sequence form the malaria parasite, Plasmodium falciparum", & MOL. BIOCHEM. PARASITOL. 1986, 18(1), 89-101 * |
CHEMICAL ABSTRACTS, vol. 106, no. 17, avril 1987, page 178, resumé no. 132851v, Columbus, Ohio, US; J. ZOLG et al.: "Detection of Plasmodium falciparum DNA using repetitive DNA clones as species specific probes", & MOL. BIOCHEM. PARASITOL. * |
CHEMICAL ABSTRACTS, vol. 109, no. 11, 12 septembre 1988, page 343, resumé no. 89035e, Columbus, Ohio, US; S. FUCHAROEN et al.: "Differentiation of Plasmodium falciparum clones by means of a repetitive DNA probe", & TRANS. R. SOC. TROP. MED. HYG. 1988, 82(2), 209-11 * |
CHEMICAL ABSTRACTS, vol. 110, no. 1, 2 janvier 1989, page 364, resumé no. 3901v, Columbus, Ohio, US; O. SETHABUTR et al.: "A comparative field study of radiolabeled and enzyme-conjugated synthetic DNA probes for the diagnosis of falciparum malaria", & AM. J. TROP. MED. HYG. 1988, 39(3), 227-31 * |
CHEMICAL ABSTRACTS, vol. 110, no. 17, 24 avril 1989, page 229, resumé no. 149150w, Columbus, Ohio, US; C.J. DELVES et al.: "Identification of Plasmodium falciparum-infected mosquitoes using a probe containing repetitive DNA", & MOL. BIOCHEM. PARASITOL. 1989, 32(2-3), 105-12 * |
CHEMICAL ABSTRACTS, vol. 110, no. 17, 24 avril 1989, page 378, resumé no. 150678f, Columbus, Ohio, US; V.S. FRANCIS et al.: "Development of a DNA diagnostic probe for the detection of the human malarial parasite Plasmodium falciparum", & INDIAN J. BIOCHEM. BIOPHYS. 1988, 25(6), 537-41 * |
Also Published As
Publication number | Publication date |
---|---|
WO1990015882A1 (en) | 1990-12-27 |
FR2648476B1 (en) | 1993-07-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Fandeur et al. | Monkeys of the rainforest in French Guiana are natural reservoirs for P. brasilianum/P. malariae malaria | |
Morrison | The aetiology, pathogenesis and control of theileriosis in domestic animals | |
Hamaguchi et al. | Perkinsus protozoan infection in short-necked clam Tapes (= Ruditapes) philippinarum in Japan | |
Sitt et al. | Exposure of vaccinated and naive cattle to natural challenge from buffalo-derived Theileria parva | |
Stokes et al. | Molecular diagnostics, field validation, and phylogenetic analysis of Quahog Parasite Unknown (QPX), a pathogen of the hard clam Mercenaria mercenaria | |
Robledo et al. | Species-specificity and sensitivity of a PCR-based assay for Perkinsus marinus in the eastern oyster, Crassostrea virginica: a comparison with the fluid thioglycollate assay | |
Snowden et al. | Isolation and characterization of an avian isolate of Encephalitozoon hellem | |
EP0461045B1 (en) | Specific detection of mycobacterium tuberculosis | |
Small et al. | Molecular detection of Hematodinium sp. infecting the blue crab, Callinectes sapidus | |
Tůmová et al. | Unequal distribution of genes and chromosomes refers to nuclear diversification in the binucleated Giardia intestinalis | |
CN110129343B (en) | Eimeria tenella superoxide dismutase and application thereof | |
Heath et al. | Monitoring Piscirickettsia salmonis by denaturant gel electrophoresis and competitive PCR | |
FR2648476A1 (en) | NUCLEIC ACID AND OLIGONUCLEOTIDE BY DERIVING THEM, COMPRISING SPECIFIC NUCLEOTIDE PROBES OF PLASMODIUM FALCIPARUM, AND THEIR USE FOR THE HYBRIDIZATION DETECTION OF PLASMODIUM FALCIPARUM DNA | |
Báez-Camargo et al. | Entamoeba histolytica: gene linkage groups and relevant features of its karyotype | |
Sallenave-Sales et al. | Plasmodium falciparum: limited genetic diversity of MSP-2 in isolates circulating in Brazilian endemic areas | |
CA2173957C (en) | Novel trypanosoma cruzi antigen, and gene coding therefor; their application to the detection of chagas' disease | |
EP0504253A1 (en) | DNA PROBES SPECIFIC FOR $i(PLASMODIUM VIVAX) | |
EP1254253B1 (en) | Single stranded oligonucleotides, probes, primers and method for detecting spirochetes | |
EP0720660B1 (en) | METHOD OF $i(IN VITRO) POLYMERASE CHAIN REACTION OF A DNA FRAGMENT WITH STAIR PRIMERS | |
EP1390509B1 (en) | Sequence of the tropheryma whippelii bacteria rpob gene and oligonucleotide for molecular diagnosis of whipple's disease | |
FR2645173A1 (en) | CLONING AND EXPRESSION OF GENES ENCODING PEPTIDES AND / OR FRAGMENTS OF PEPTIDES OF MOKOLA VIRUS, APPLICATION TO THE PREPARATION OF A V | |
Kornalíková | Analyses of Monocercomonoides genome sizes, ploidies and karyotypes | |
WO1992001067A1 (en) | Genetic probes specific for toxoplasma gondii and their uses in in vitro detection of toxoplasma gondii and the typing of toxoplasma strains | |
WO2000037673A1 (en) | METHOD AND KIT FOR IDENTIFYING $i(PLASMODIUM FALCIPARUM) | |
Darnall | Extranuclear DNA in Polytomella Parva |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
ST | Notification of lapse |