FR2622456A1 - Recombinant fowlpox virus, vectors for the expression of heterologous proteins and vaccines for poultry derived from this virus - Google Patents

Abstract

Recombinant fowlpox virus, derived from an attenuated strain which has integrated, in a non-coding intergenic region of its genome, a DNA sequence coding for a heterologous protein. Vaccine containing a recombinant fowlpox virus expressing an antigen of a heterologous virus.

Description

 The present invention relates to recombinant hen pox viruses, commonly referred to as Fowlpox, and their applications in the preparation of vaccines or proteins useful for poultry metabolism.

 Viruses of the family Poxviridae, including Fowlpox virus, are double-bridged DNA viruses that multiply in the cytoplasm of cells and encode a significant portion of the enzymatic machinery required for their replication.

Purified viral DNA is not infectious because enzymes associated with the viral particle are needed to prime its expression and replication. However, it may participate in recombination events with the DNA of an infectious virus introduced into the same cell. This discovery (Sam and Dumbeil, 1981) is the basis for the development of cloning vectors and expression of foreign genes derived from vaccinia virus (Mackett et al., 1982).
Panicali and Paoletti, 1982). Live recombinant vaccinia viruses have made it possible to express foreign antigens and, thus, to obtain immunizations against various viral or parasitic diseases (Smith et al., 1983, Panicali et al., 1983; et al., 1984, Chakrabarti et al., 1986
Hu et al. 1986; Kieny et al. 1986).

 Although recent publications have evoked the use of Fowlpox as a vector (Brown, 1985 and Taylor et al., 1987), no experimental results have been published to date and the molecular biology of Fowlpox virus has not It has been studied extensively, unlike the well-studied vaccinia biology (see Moss review, 1985).

 The subject of the present invention is the use of the Fowlpox virus as an expression vector for heterologous proteins.

 More specifically, the subject of the invention is a recombinant Fowlpox virus which derives from an attenuated strain, that is to say, made artificially non-pathogenic, and comprises, in a non-essential part of its genome, a sequence of DNA encoding all or part of a heterologous protein, as well as elements ensuring its expression by the Fowlpox virus, in a suitable cell.

 In one of its aspects, the invention aims to prepare a vaccine, in particular a vaccine that protects poultry against at least one viral diseases that may affect it. In this case, the heterologous protein is a protein inducing an immune response against a heterologous virus.

Among the heterologous viruses of interest are Newcastle Disease Virus, Infectious Bronchitis Virus, and Viral Disease Virus.

 In another aspect, the invention aims to produce in vivo, in poultry, a factor involved in its metabolism, such as for example a growth hormone or an inducing factor thereof (such as GRF).

In this case, the heterologous protein is said factor and the Fowlpox virus comprises the elements ensuring its expression in vivo. To obtain this production, the animal is administered a Fowlpox virus according to the invention which contains the gene coding for this factor, the virus being alive.

 Finally, the invention allows the preparation of proteins of industrial or therapeutic interest in cell culture, especially in avian cells, in vitro but also in vivo in animals.

The expression of a sequence coding for a foreign protein by a Poxvirus and in particular by Fowlpox virus necessarily involves the following three steps: 1) the coding sequence must be aligned with a promoter of
poxvirus and be inserted into a nonessential segment of
Fowlpox virus DNA cloned into a suitable bacterial plasmid; 2) the DNA sequences of the Fowlpox virus located from and
else of the coding sequence should allow recom
homologous bins between the plasmid and the viral genome
in a receiving cell; a double recombination
leads to a transfer of the plasmid DNA insert into
the viral genome in which it will be propagated and expressed 3) the DNA sequence integrated into the Fowlpox genome recom-
should be expressed in an appropriate cell,
supporting the multiplication of the virus.

 It has previously been stated that the insertion of the foreign DNA must be in a non-essential part of the Fowlpox virus genome, that is, a part which does not prevent its replication. It would have been possible, as in recombinant vaccinia viruses, to introduce the foreign gene into the TK gene. However, since the starting strain is an attenuated strain, it is to be feared that the alteration of a function useful for its replication constitutes an excessive handicap and greatly reduces its immunogenicity and, consequently, that of the antigen. Thus, according to a feature of the present invention, the foreign DNA sequence is introduced into a non-coding intergenic zone of the Fowlpox virus.

This intergenic zone is preferably located between
ORF 7 and 9 of the 1.3 kbp HindIII fragment of the genome, according to
Drillien et al. (1987).

 The invention also relates to eukaryotic cell cultures which are infected with the recombinant virus according to the invention and which allow its replication. Among the conceivable cells, mention may be made in particular of avian cells.

 The subject of the invention is also vaccines obtained from these recombinant viruses, in the form of live or inactivated viruses. Vaccine preparation methods are known to those skilled in the art and will not be repeated here.

 The invention also relates to live recombinant viruses whose administration can allow the production in vivo, during viral multiplication, of a factor useful for the metabolism of poultry.

 Finally, the invention relates to DNA sequences comprising at least one heterologous gene for Fowlpox virus, under the control of a poxvirus promoter, flanked on either side of the 3 'end of ORF 7 and the 5 'end of ORF 9, as well as plasmids carrying these DNA sequences.

 These plasmids are useful in particular in the context of a process for obtaining a recombinant virus according to the invention, characterized in that a competent cell culture is transfected with the DNA of a plasmid according to the invention. invention, said culture having been previously infected with a Fowlpox virus optionally comprising a selection element.

Other features and advantages of the invention will become apparent from the following detailed description. The following 2 figures illustrate the examples
Figure 1: schematic representation of plasmid pTG1170 and
of the insert carrying the 7.5 Kd promoter that was
introduced in the "polylinker", to give the pTG1171.

Figure 2: Photograph of a fibroblast culture dish
of chicken showing Fowlpox virus beaches
recombinant expressing -galactosidase and which
appear blue in the presence of X
Gal.

Example 1 Selection and Characterization of Thermo Mutants
sensitive (ts) of the Fowlpox virus.

A vaccine strain of chickenpox virus, or Fowlpox, is used, for example the vaccine produced by Salsbury Laboratories (PoxineR, Laboratoire Salsbury, France).
Rue Delprier, 37000 TOURS, France).

The multiplication of the virus is measured at 3 temperatures
title after 6 days
330C 4.1.105 ufp / ml
37 C 4.1.105 cfu / ml
39.5 "C 4.2.105 cfu / ml
The unmutated virus also multiplies efficiently at 3 temperatures.

 A virus stock cloned and amplified at 39.5 C is treated with nitrosoguanidine at 10 or 20 μg / ml.

After this mutagenic treatment, the virus is spread, at a suitable dilution to obtain well-established ranges, on chicken embryo fibroblast cultures. The cultures are incubated at 33 ° C. (permissive temperature) for 6 or 7 days and then stained with neutral red to reveal the ranges of virus.

 The cultures are then incubated at 39.5 C (restrictive temperature) for 2 days. Beaches whose size has not increased are considered heat-sensitive. Viruses from a few ranges are picked up and amplified at 33 ° C and then renamed at 33 and 39.5 ° C to confirm their ts character.

The following table shows the titles obtained in the two periods.

<tb><SEP> Titration <SEP> to <SEP>: <SEP> 330C <SEP>39.5'C<SEP>
<tb> Virus <SEP> Fowlpox <SEP> control <SEP> 1.105 <SEP> 1.105 <SEP> ufp / ml
<tb><SEP> mutant <SEP> tsl <SEP> 2.105 <SEP><<SEP> 10 <SEP> ufp / ml
<tb><SEP> mutant <SEP> tsll <SEP> 2.i05 <SEP><10<SEP> ufp / ml
<tb><SEP> mutant <SEP> ts24 <SEP> 2.105 <SEP><<SEP> 10 <SEP> ufp / ml
<Tb>

Example 2 Development of the recombination conditions
between mutated viruses ts and purified DNA of viruses nos
mutated.

 Under restrictive conditions, ts mutants do not multiply anymore.

Purified DNA of viruses of the family Poxviridae is not infectious.

If the introduction into the same cell of a ts and us virus
Purified DNA gives rise to a multiplication of viruses, these result from an in vivo complementation or recombination between the 2 genomes.

 Chick embryo fibroblast mats are infected with ts viruses (4.104 pfu / 106 cells). After 1 hour of adsorption, the cultures are renewed in fresh medium and incubated for 2 hours at a permissive temperature (33-370 ° C.).

Subsequently, the medium is removed and purified DNA is adsorbed from the unmutated virus as a precipitate of calcium phosphate (1 μg of DNA in 5 μl of buffer for 4 culture dishes).

After 1 hour of adsorption is renewed in fresh medium and incubated for 2 hours at non-permissive temperature (39.5 "2: then a shock is made glycerol (10%).

Then the cultures are incubated for 5 days at 39, 50C.

The virus beaches are counted, half, directly on the boxes where the manipulation was performed, and half, after amplification (that is to say after freezing the first boxes followed by a second cycle of multiplication).

<Tb>

<SEP> Number <SEP> of <SEP> ranges <SEP> of <SEP> virus
<tb><SEP> without <SEP> amplification <SEP> after <SEP> amplification
<tb><SEP> without <SEP> DNA <SEP> + <SEP> DNA <SEP> without <SEP> DNA <SEP> + <SEP> DNA
<tb> tsl <SEP> 0 <SEP> 15 <SEP> 10 <SEP> 3.104
<tb> tsll <SEP> 0 <SEP> 2 <SEP> 10 <SEP> 1.104
<tb> ts24 <SEP> 0 <SEP> 3 <SEP> 10 <SEP> 1.1or <SEP>
<Tb>
Experience shows that the purified DNA of the
Wild Fowlpox can be reactivated by polishing mutants to give an infectious progeny.

The ts1 mutant was retained for the following experiments,
Example 3 Construction of a Vector for Transfer
of heterologous DNA in Fowlpox virus.

 To transfer a foreign DNA sequence into the genome of a virus, this sequence must be integrated in the middle of intact virus sequences so as to allow double homologous recombination.

 Foreign DNA must be inserted into a non-essential area of the virus so as not to prevent its multiplication.

 A vector was constructed to promote the insertion of foreign DNA into a non-coding intergenic region of the Fowlpox virus.

a) Insertion of a Fowlpox DNA fragment into a plasmid
bacterial: construction of pTG1170.

A DNA fragment of Fowlpox with a significant
homology with vaccinia virus DNA has been described
by Drillien et al. (1987).

This fragment (homologous to the HindIII J fragment of the virus of 1
vaccine) carries 5 open reading sequences (ORF) and
distinguished from vaccinia by the absence of the F8 gene which is
replaced by a non-coding intergenic zone of 32 pairs
basic.

Vac e
Fcs
This intergenic zone was chosen as the insertion site of the foreign DNA.

A large DNA fragment that surrounds this area has been recovered to serve as a homologous sequence allowing recombination and integration into the Fowlpox viral genome.

This fragment was obtained after digestion with EcoRI and PstI.

The EcoRI site is located upstream of ORF6 and the PstI site is located in ORF9 (see diagram above). The Shard
EcoRI-PstI was integrated into a M13TG131 vector (Kieny et al., 1983), to give M13TG188.

Introduction into M13 allows for localized mutagenesis, to introduce recognition sites for restriction enzymes that will allow the insertion of foreign DNA.

Three sites were created: XhoI, BamHI and EcoRI, in the 32 bp intergenic region, using the following synthetic oligonucleotide
5 'TTAAAAAGGAATTGACTCGAGGGATCCGAATTCAAGAAAATATTTAT 3'
The construction bearing the synthetic insert is called
M13TG195. The presence of restriction sites has been verified
with the corresponding enzymes.

The DNA sequence of the mutated Fowlpox was recovered from
M13TG195 as a BglII-PstI fragment (the site
BglII is located at the beginning of ORF6, Drillien et al. 1987)
and introduced into a cloning vector derived from pML2
wearing a synthetic adapter with several
restriction sites, POLYII described by Lathe et al.

 (1987).

The insertion of the BglII-PstI fragment of Fowlpox in the vec
BamHI and PstI open POLYII donor gives the plasmid
pTG1170, which is shown schematically in FIG.

b) insertion of a poxvirus promoter into the pTG1170 vector.

To obtain the expression of a foreign gene by a poxvi
rus it is necessary to place this gene under control
of a poxvirus promoter.

At first, we used a good promoter
characterized by vaccinia virus, the promoter of the
the 7.5 K protein, abbreviated as "7.5 K promoter". We have
introduced into the vector pTG1170, the promoter 7.5 K of the
vaccinia virus, recovered as SalI fragment
EcoRI from a vector M13TG7.5K described by Kieny and
al. (1984).

This promoter sequence was introduced between the sites
XhoI and EcoRI of the pTG1170 synthetic adapter (see
figure 1).

The resulting construct, pTG1171 therefore carries the promoter
7.5K inserted between the ORF6-7 and the Fowlpox ORF9, with a
BamHI site (provided by the sequence P7.5K) and EcoRI immé
diatement downstream.

Example 4 Insertion of a foreign gene into the vector pTG1171.

 A model gene was used to demonstrate the utility of the Fowlpox virus recombinant vector and selection system: the E. coli ss-galactosidase gene.

This gene was chosen because its efficient expression can easily be detected by the addition of X-Gal (5-bromo-4-chloro-3-indolyl-D-galactopyranoside) which gives rise to blue staining under the action of β-galactosidase.

 The lacZ gene encoding E. p-galactosidase.

coli can be recovered, for example, from plasmid pCH110 (Hall et al., 1983). The lacZ gene was excised by BamHI and HindIII and inserted into the POLYII cloning vector (cited above) and then taken back as a BglII-BamHI fragment to be inserted into BamHI-opened and phosphatase-treated pTG1171.

 The construct carrying the lace gene downstream of the 7.5 K promoter is called pTG1177.

Example 5 Expression of a foreign gene by a virus
combining Fowlpox.

 Plasmid pTG1177 DNA (100 ng / 10 6 cells) was transfected into chicken embryo cells previously infected with Fowlpox ts1 virus, according to the protocol described in Example 2.

 After 5 days of incubation at 39.50C, harvest the recombinant viruses after lysing the cells by leave the tion.

 Viruses are titrated on chicken embryo fibroblast cultures under agar medium. After 5 days, the virus plaques are exposed to X-Gal (30 mg / ml solution diluted 1/100 in PBS + 1% agarose).

 The virus plaques are stained blue, indicating the presence of functional F-galactosidase.

Example 6 Construction of a second vector for
heterologous DNA transfer in the
Fowlpox.

a) Another vector allowing the transfer of heterologous DNA
in the Fowlpox virus was built keeping a
greater intergenic region between F7 and F9 ORFs.

To achieve this goal a first local mutagenesis
was carried out on phage M13TG188 (described in
Example 3) with the following synthetic oligonucleotide
5 'AACAACCTAATATCACTATAGGATCCTTGTTAAAAAGGAAT 3'
This gives phage M13TG2123 and results in intro
to obtain a BamHI site in the coding 3 'part of ORF F7.

A second mutagenesis was then performed on
M13TG2123 with the following oligonucleotide
5 'CCTAATATCACTACTGAAGCGCAACTAGGATCCTTGTTAA 3'
In the resulting phage, M13TG2125, the intergenic distance
that between ORF F7 and ORF F9 is increased by one
Nucleotides and codons located 3 'of ORF F7
are replaced by equivalent codons, coding for the
same amino acids.

The DNA sequence of the mutated Fowlpox was recovered from
M13TG2125 as a BglII-PstI fragment and introduced
in the vector POLYII as in example 3 to generate
plasmid pTG2l34.

b) insertion of a poxvirus promoter into the vector
pTG2134.

The promoter of the 7.5 K protein gene of the
vaccinia recovered as an 8glII-BamHI fragment of a
M13TG2119 vector (derived from M13TG7.5K described in the exem
3) was inserted into the BamHI site of plasmid pTG2134.

This gave rise to two vectors pTG2135 and pTG2136
that stand out from each other by the orientation of the promo
tor. In the plasmid pTG2135 the promoter is oriented
in the same sense as the F7 and F9 ORFs while in the
Plasmid pTG2136 the orientation is reversed.

Example 7 insertion of a foreign gene into the vectors
pTG2135 and pTG2136.

As in Example 4, the β-galactosidase gene, in the form of a BglII-BamHI fragment, was inserted into the vectors pTG2135 and pTG2136 previously opened by
BamHI and treated with phosphatase. These manipulations gave rise to the vector pTG2137 in which the β-galactosidase gene is oriented in the same direction as the genes of the F7 and F9 ORFs and to the vector pTG2138 in which the orientation of the β-galactosidase gene is reversed. .

 The pTG2137 DNA was transfected into chicken embryo cells infected with Fowlpox ts1 virus, as in Example 5.

Recombinant virus plaques are observed after 5 days and stain blue after addition of
X-Gal.

REFERENCES
Brown, TDK Span 28, 68-70 (1985).

Chakrabarti, S., Robert-Uroff, M., Wong-Staal, F., Gallo,
RC and Moss, B. Nature 320, 535-540 (1986).

Drillien, R., Spehner, D., Villeval, D. and Lecocq, J.P.

 Virology 160, in press (1987).

Hall, C.V., Jacob, P.E., Ringold, G.M. and Lee, F.J. Mol.

 Appl. Gen. 2, 101-109 (1983).

Hu, SL, Kosowsi, SG and Dabrymple, JM Nature 320, 537
549 (1986).

Kieny, M.P., Lathe, R. and Lecocq, J.P. Gene 26, 91-99 (19831.

Kieny, MP, Lathe, R., Drillien, R., Spehner, D., Skory, S.,
Schmitt, D., Wiktor, T., Koprowski, H. and Lecocq, JP

 Nature 312, 163-166 (1984).

Kieny, MP, Rautmann, G., Schmitt, D., Dott, K., Wain-Hobson,
S., Alizon, M., Girard, M., Chamaret, S., Laurent, A.,
Montagnier, L. and Lecocq, JP Biotechnology 4, 790-795
(1986).

Lathe, R., Vilotte, J.L. and Clark, A.J. Gene in press (1987).

Mackett, M., Smith, GL, and Moss, B. PNAS USA 79, 7415
7419 (1982).

Moss, B. In "Virology" (Ed. BN Fields) pp. 685-703 Raven
Press. New York (1985).

Panicali, D., Davis, S.W., Weinberg, R.L., Paoletti, E. Proc.

 Natl. Acad. Sci. USA 80, 5364-5368 (1983).

Sam, CK and Dumbell, KR Ann. Virol. (Pasteur Institute) 132,
135-150 (1981).

Smith, G. L., Mackett, M., Moss, V. Nature 302, 490-495 (1983).

Taylor, J., Weinberg, R., Desmettre, P., Paoletti, E. In:
Modern approaches to new vaccines
AIDS. Cold Spring Harbor. New York. Abstracts of the 1987
meeting (9-13 September) pp. 120.

Claims (22)

 1) recombinant Fowlpox virus, characterized in that it derives from an attenuated strain of Fowlpox virus and comprises, in a non-essential part of its genome, a DNA sequence coding for all or part of a heterologous protein Fowlpox virus and elements likely to ensure the expression of this protein in a cell infected with said recombinant virus.  2) Fowlpox virus according to claim 1, characterized in that the DNA sequence is cloned in a non-coding intergenic zone of Fowlpox virus.  3) Fowlpox virus according to claim 2, characterized in that the non-coding intergenic zone is the zone located between the ORFs 7 and 9 of the 1.3 kbp HindIII fragment of the viral DNA.  4) Fowlpox virus according to one of claims 1 to 3, characterized in that said recombinant virus derived from a vaccine strain Fowlpox virus.  5) Fowlpox virus according to claim 4, characterized in that said recombinant virus is derived from a strain of heat-sensitive Fowlpox virus.  6) Fowlpox virus according to one of claims 2 to 5, characterized in that it comprises a gene coding for a selection marker which is expressed in a cell infected with said recombinant virus.  7) Fowlpox virus according to one of claims 1 to 6, characterized in that the DNA sequence codes for a protein inducing an immune response against a heterologous virus.  8) Fowlpox virus according to claim 7, characterized in that said heterologous virus is selected from the Newcastle disease virus, the infectious bronchitis virus and the Marek's disease virus.  9) Fowlpox virus according to one of claims 1 to 7, characterized in that the ADS sequence codes for a factor involved in the metabolism of poultry.  10) DNA sequence comprising at least one Fowlpox virus heterologous gene, under the control of a poxvirus promoter, flanked on either side of the 3 'end of the ORF 7 and the end 5 'of ORF 9.  11) Sequence according to claim 10, characterized in that the promoter is the promoter of the 7.5 K protein of vaccinia virus.  12) Plasmid characterized in that it comprises a DNA sequence according to one of claims 10 or 11.  13) Process for obtaining a recombinant virus according to one of claims 1 to 9, characterized in that transfects a competent cell culture with the DNA of a plasmid according to claim 12, said culture having been previously infected with a Fowlpox virus.  14) Culture of eukaryotic cells infected with a recombinant Fowlpox virus according to one of claims 1 to 9.  15) Culture of cells according to claim 13, characterized in that it is avian cells.  16) Vaccine characterized in that it contains a Fowlpox virus according to one of claims 1 to 9.  17) Vaccine characterized in that it contains a Fowlpox virus obtained by replication in cell cultures according to one of claims 14 or 15.  18) Vaccine according to one of claims 16 or 17, characterized in that the Fowlpox virus is alive.  19) Vaccine according to one of claims 16 or 17, characterized in that the Fowlpox virus is inactivated.  20) antiserum containing the antibodies raised against the Fowlpox virus according to one of claims 1 to 9.  21) Process for the in vivo preparation of a factor involved in the metabolism of poultry, characterized in that Fowlpox virus according to claim 9, live, is administered to poultry.  22) Process for the preparation of a protein of industrial or therapeutic interest, characterized in that a eukaryotic cell is cultured according to claims 14 or 15 and the protein obtained is recovered.