FR2618159A2 - Process for stabilising a plasmid contained in a bacterial strain and strain obtained - Google Patents
Process for stabilising a plasmid contained in a bacterial strain and strain obtained Download PDFInfo
- Publication number
- FR2618159A2 FR2618159A2 FR8709935A FR8709935A FR2618159A2 FR 2618159 A2 FR2618159 A2 FR 2618159A2 FR 8709935 A FR8709935 A FR 8709935A FR 8709935 A FR8709935 A FR 8709935A FR 2618159 A2 FR2618159 A2 FR 2618159A2
- Authority
- FR
- France
- Prior art keywords
- gene
- dapd
- expression
- strain
- cut
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
- C12N15/68—Stabilisation of the vector
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
La présente addition concerne un perfectionnement du procédé de stabilisation d'un vecteur plasmidique contenu dans une bactérie décrit au brevet principal. The present addition relates to an improvement of the method for stabilizing a plasmid vector contained in a bacterium described in the main patent.
Le brevet principal propose un procédé de stabilisation dans lequel la bactérie comporte une mutation chromosomique dap et le vecteur plasmidique comporte un gène dap+, la mutation chromosomique en cause pouvant être plus ou moins importante et étant située, de préférence, dans le gène dapD. The main patent proposes a stabilization process in which the bacterium comprises a chromosomal mutation dap and the plasmid vector comprises a dap + gene, the chromosomal mutation in question being able to be more or less important and being located, preferably, in the dapD gene.
Afin d'éviter les recombinaisons homologues possibles entre le plasmide dapD+ et le gène dapD muté du chromosome, la présente addition propose une délétion importante du gène dapD du chromosome. In order to avoid possible homologous recombination between the plasmid dapD + and the mutated dapD gene of the chromosome, the present addition proposes an important deletion of the dapD gene of the chromosome.
C'est pourquoi la présente addition concerne un procédé de stabilisation d'un vecteur plasmidique contenu dans une bactérie selon l'une des revendications 1 à 5 du brevet principal, caractérisé en ce que la mutation chromosomique dap est une délétion d'une partie au moins du gène dapD et en ce que le vecteur plasmidique porte un gène dapD intact. This is why the present addition relates to a method for stabilizing a plasmid vector contained in a bacterium according to one of claims 1 to 5 of the main patent, characterized in that the chromosomal mutation dap is a deletion of a part at less of the dapD gene and that the plasmid vector carries an intact dapD gene.
Il est clair qu'affin d'éviter toute recombinaison, une délétion totale du gène dapD sera la solution la plus satisfaisante. It is clear that, in order to avoid any recombination, a total deletion of the dapD gene will be the most satisfactory solution.
Toutefois, un système de sélection si puissant soitil ne peut remédier à l'instabilité propre d'un plasmide. However, such a powerful selection system cannot remedy the specific instability of a plasmid.
C'est pourquoi, afin d'augmenter la stabilité des vecteurs d'expression en cause par des moyens génétiques, il est possible-d'introduire dans lesdits vecteurs une séquence qui les maintient à l'état de monomères, en particulier la séquence cer
Le "cer" (Summers et Sherratt, 1984) est un élément qui ne code pour aucune protéine et dont la présence favorise le maintien monomérique d'un plasmide. Si le plasmide se multimérise, le nombre d'unités distribuables aux cellules filles chute et on obtient plus facilement des cellules dépourvues de plasmide. Indirectement donc, le cer stabilise le plasmide en le maintenant à l'état de monomère.This is why, in order to increase the stability of the expression vectors in question by genetic means, it is possible to introduce into said vectors a sequence which maintains them in the state of monomers, in particular the sequence cer
"Cer" (Summers and Sherratt, 1984) is an element which does not code for any protein and whose presence promotes the monomeric maintenance of a plasmid. If the plasmid becomes multimerized, the number of units distributable to daughter cells drops and cells without plasmid are more easily obtained. Indirectly therefore, the cer stabilizes the plasmid by maintaining it in the state of monomer.
Comme cela a été décrit dans le brevet principal, les vecteurs plasmidiques en cause sont stables sur milieu complet et peuvent être utilisés industriellement pour la préparation de protéines d'intérêt industriel. As described in the main patent, the plasmid vectors in question are stable on complete medium and can be used industrially for the preparation of proteins of industrial interest.
C'est pourquoi la présente addition concerne également des vecteurs plasmidiques qui comportent en outre le gène codant pour une protéine d'intérêt industriel et les éléments assurant son expression dans la bactérie ho te, et, notamment, le gène codant pour une hirudine ou l'un de-ses variants naturels ou synthétiques, le C2130, l'interféron gamma ou l'alpha-antitrypsine par exemple, ainsi que les souches transformées par ces différents vecteurs et les procédés de préparation des protéines industrielles par culture desdites souches transformées sur milieu complet et récupération de la protéine après culture. This is why the present addition also relates to plasmid vectors which additionally comprise the gene coding for a protein of industrial interest and the elements ensuring its expression in the bacteria ho te, and, in particular, the gene coding for a hirudin or l one of its natural or synthetic variants, C2130, gamma interferon or alpha-antitrypsin for example, as well as the strains transformed by these different vectors and the processes for preparing industrial proteins by culture of said strains transformed on medium complete and recovery of the protein after culture.
Les éléments d'expression des protéines industrielles sont connus, il s'agit essentiellement de promoteurs actifs dans les cellules hôtes, par exemple l'un des promoteurs du phage lambda dans E. coli. The expression elements of industrial proteins are known, they are essentially promoters active in host cells, for example one of the promoters of phage lambda in E. coli.
Les exemples ci-après permettront de mettre en évidence d'autres caractéristiques et avantages de la présente addition. The examples below will make it possible to highlight other characteristics and advantages of the present addition.
Les figures suivantes illustrent les exemples. The following figures illustrate the examples.
Figure 1 : Carte de restriction du fragment HindIII-BamHI du
pDB6.Figure 1: Restriction map of the HindIII-BamHI fragment of
pDB6.
Figure 2 : Schéma des inserts PstI du pDB6 dans M13mp8 et
position des sites EcoRI qui y sont introduits.Figure 2: Diagram of the PstI inserts of pDB6 in M13mp8 and
position of the EcoRI sites which are introduced there.
Figure 3 : Carte de restriction du fragment KpnI-BglII du
pTG47.Figure 3: Restriction map of the KpnI-BglII fragment of
pTG47.
Figure 4 : Démonstration de la délétion du gène dap dans les
ADNs chromosomiques de différentes souches, par
autoradiographie de "Southern blots".Figure 4: Demonstration of the deletion of the dap gene in
Chromosomal DNAs of different strains, by
autoradiography of "Southern blots".
Figure 4A : . sonde = gène kanR porté par le fragment EcoRI
du pTG47
bandes 6 à 9 ADs coupé par PstI
10 à 14 ADN coupé par BamHI et HindIII
bandes 6 et 10 = souches GC4540
7 et 11 TGE7213
8 et 12 TGE7214
9 et 13 TGE901
14 pDB6
1, 2, 5, 16 marqueurs de poids
moléculaires
Figure 4B : . sonde = côté 5' du gène dapD porté par le frag
ment EcoRI du M13TG620
. bandes 4 à 7 ADN coupé par PstI
8 à 11 ADN coupé par BamHI et HindIII
. bandes 4 et 8 = souches GC4540
5 et 9 TGE7213
6 et 10 TGE7214
7 et 11 TGE901
. bandes 13 marqueurs de poids molé
culaires
1 et 12 pDB6 coupé par PstI ou
BamHI et HindIII
2 M13TG620 coupé par PstI
3 M13TG597 coupé par PstI
Figure 4C :. sonde = régions flanquantes du gène dapD portées
par le fragment KpnI-BglII du pTG47.Figure 4A:. probe = kanR gene carried by the EcoRI fragment
pTG47
bands 6 to 9 ADs cut by PstI
10 to 14 DNA cut with BamHI and HindIII
lanes 6 and 10 = strains GC4540
7 and 11 TGE7213
8 and 12 TGE7214
9 and 13 TGE901
14 pDB6
1, 2, 5, 16 weight markers
molecular
Figure 4B:. probe = 5 'side of the dapD gene carried by the frag
M13TG620 EcoRI ment
. bands 4 to 7 DNA cut by PstI
8 to 11 DNA cut with BamHI and HindIII
. lanes 4 and 8 = strains GC4540
5 and 9 TGE7213
6 and 10 TGE7214
7 and 11 TGE901
. strips 13 molar weight markers
eyepieces
1 and 12 pDB6 cut by PstI or
BamHI and HindIII
2 M13TG620 cut by PstI
3 M13TG597 cut by PstI
Figure 4C:. probe = flanking regions of the dapD gene carried
by the KpnI-BglII fragment of pTG47.
, ADNs chromosomiques coupés par PstI. , Chromosomal DNAs cut by PstI.
bandes 4 5 souches GC4540
5 TGE7213
6 TGE7214
7 TGE901
, bandes 8 = marqueurs de poids moléculaires
1 fragment BamHI-HindIII de pDB6 coupé
par PstI
2 M13TG620 coupé par PstI
3 M13TG597 coupé par PstI
Figure 4D : . sonde = régions flanquantes du gène dapD portées
par le fragment KpnI-BglII du pTG47.bands 4 5 strains GC4540
5 TGE7213
6 TGE7214
7 TGE901
, bands 8 = molecular weight markers
1 BamHI-HindIII fragment of pDB6 cut
by PstI
2 M13TG620 cut by PstI
3 M13TG597 cut by PstI
Figure 4D:. probe = flanking regions of the dapD gene carried
by the KpnI-BglII fragment of pTG47.
, ADNs chromosomiques coupés par PstI
bandes 4 = souches RH5345
5 RL58
6 TGE7615
1, 2, 3 (comme en 4C)
Figure 5 : Schéma et carte de restriction du pTG790. , Chromosomal DNAs cut by PstI
bands 4 = strains RH5345
5 RL58
6 TGE7615
1, 2, 3 (as in 4C)
Figure 5: Diagram and restriction map of pTG790.
Figure 6 : Schéma et carte de restriction du pTG792.Figure 6: Diagram and restriction map of pTG792.
Figure 7 : Schéma et carte de restriction du pTG7922.Figure 7: Diagram and restriction map of pTG7922.
Figure 8 : Schéma et carte de restriction du pTG769.Figure 8: Diagram and restriction map of pTG769.
Figure 9 : Schéma et carte de restriction du pTG7406. Figure 9: Diagram and restriction map of pTG7406.
Figure 10 : Electrophorèse sur gel d'acrylamyde-SDS, révélé au
bleu de Coomassie, des protéines synthétisées par TGE7213/pTG7407. Figure 10: Electrophoresis on acrylamide-SDS gel, revealed at
Coomassie blue, proteins synthesized by TGE7213 / pTG7407.
, bandes 1 et 8 = marqueurs de poids moléculaires
, bandes 2 à 5 = culture à 300C, 4 heures (2 et 3)
ou 7 heures (4 et 5)
, bandes 6 à 12 : culture induite à 420C, 4 heures
(6, 11 et 12) ou 7 heures (7, 9 et 10)
C = fraction insoluble ; 20 p1
S = fraction soluble ; 40 l
Figure 11 : Schéma et carte de restriction du pTG7675., bands 1 and 8 = molecular weight markers
, bands 2 to 5 = culture at 300C, 4 hours (2 and 3)
or 7 hours (4 and 5)
, bands 6 to 12: culture induced at 420C, 4 hours
(6, 11 and 12) or 7 hours (7, 9 and 10)
C = insoluble fraction; 20 p1
S = soluble fraction; 40 l
Figure 11: Diagram and restriction map of pTG7675.
Figure 12-: Schéma et carte de restriction du pTG7914. Figure 12-: Diagram and restriction map of pTG7914.
Exemple 1 Délétion du gène dapD du chromosome de la bact-
rie.Example 1 Deletion of the dapD gene from the chromosome of the bacteria
laughs.
sous clonage du gène dapD sur 2 fragments PstI
Le plasmide pDB6 et le M13mp8 sont coupés par PstI et ligués.under cloning of the dapD gene on 2 PstI fragments
Plasmid pDB6 and M13mp8 are cut by PstI and ligated.
On crible les M13 contenant l'extrémité 5' et l'extrémité 3' du gène par des oligonucléotides spécifiques de ces régions, respectivement TG596 (GCGCTTAATAACGAGTTG) et TG598 (TGTGCATACTTTAGTC). Les candidats SB96 et SB98 sont retenus et l'insertion des fragments voulus confirmée par séquençage.The M13 containing the 5 ′ end and the 3 ′ end of the gene are screened with oligonucleotides specific for these regions, respectively TG596 (GCGCTTAATAACGAGTTG) and TG598 (TGTGCATACTTTAGTC). The candidates SB96 and SB98 are retained and the insertion of the desired fragments confirmed by sequencing.
(voir schéma de la figure 1).(see diagram in Figure 1).
Introduction d'un site EcoRI dans les extrémités 5' et 3' du gène dapD
Des sites EcoRI sont introduits dans SB96 et SB98 par mutation ponctuelle - dans SB98 avec l'oligonucléotide TG597
GTACGCAGGAATTCCTTAATGCCG
qui s'apparie avec la région 3' de la fin du gène, mais
avant un terminateur de transcription supposé.Introduction of an EcoRI site into the 5 'and 3' ends of the dapD gene
EcoRI sites are introduced into SB96 and SB98 by point mutation - in SB98 with the oligonucleotide TG597
GTACGCAGGAATTCCTTAATGCCG
which pairs with the 3 'region of the end of the gene, but
before a supposed transcription terminator.
- dans SB96 avec l'oligonucléotide TG620
AGAGGCCCGAATTCCAAACG
qui s'apparie avec la région 5' en amont du promoteur suppo
sé du gène dapD.- in SB96 with the oligonucleotide TG620
AGAGGCCCGAATTCCAAACG
which pairs with the 5 'region upstream of the suppo promoter
the dapD gene.
Les transformants sont analysés avec les mêmes sondes qui ont servi à introduire les sites EcoRI. La présence de ce site
EcoRI est confirmée en minipréparation d'ADN et ensuite par séquençage des candidats M13 retenus (voir schéma figure 2).The transformants are analyzed with the same probes which served to introduce the EcoRI sites. The presence of this site
EcoRI is confirmed by DNA mini-preparation and then by sequencing of the selected M13 candidates (see diagram in Figure 2).
Construction d'un vecteur de délétion
Le gène de résistance à la kanamycine du plasmide pUC-4K (vendu par Pharmacia) est récupéré sous forme de fragment EcoRI. Construction of a deletion vector
The kanamycin resistance gene from the plasmid pUC-4K (sold by Pharmacia) is recovered in the form of an EcoRI fragment.
Les M13TG597 et 620 sont coupés par EcoRI et PstI ce qui libère respectivement l'extrémité 3' du gène dapD (sans le terminateur supposé) et l'extrémité 5' du gène (sans son promoteur supposé).The M13TG597 and 620 are cut by EcoRI and PstI which releases respectively the 3 'end of the dapD gene (without the supposed terminator) and the 5' end of the gene (without its supposed promoter).
Le vecteur de clonage pTG192 (décrit dans le brevet principal) est coupé par PstI.The cloning vector pTG192 (described in the main patent) is cut by PstI.
L'ensemble de ces fragments est ligué. Après transformation de cellules 5K et étalement sur LB + ampicilline 0.1 mg/ml + kanamycine 0.02 mg/ml, on crible les colonies par l'oligonu- cléotide TG596.All of these fragments are ligated. After transformation of 5K cells and plating on LB + ampicillin 0.1 mg / ml + kanamycin 0.02 mg / ml, the colonies are screened with the oligonucleotide TG596.
Une construction a été sélectionnée : pTG47. Sa structure est analysée par minipréparation d'ADN et l'orientation du gène de résistance à la kanamycine et déterminée par digestion du plasmide par Hindili, ce qui libère 2 bandes de tailles 5.3 et 4.0 kb. L'orientation du gène de résistance à la kanamycine dans pTG47 est la même que celle du gène dapD dans pDB6 (dans l'autre orientation on aurait obtenu des bandes de tailles 4.9 et 4.4 kb).A construction has been selected: pTG47. Its structure is analyzed by DNA mini-preparation and the orientation of the kanamycin resistance gene and determined by digestion of the plasmid with Hindili, which releases 2 bands of sizes 5.3 and 4.0 kb. The orientation of the kanamycin resistance gene in pTG47 is the same as that of the dapD gene in pDB6 (in the other orientation, bands of sizes 4.9 and 4.4 kb would have been obtained).
Le schéma du pTG47 est représenté dans la figure 3.The diagram for pTG47 is shown in Figure 3.
Délétion du gène dapD du chromosome
Délétion du gène dapD du chromosome d'une souche intermédiaire
Des cellules RH5345, dont la compétence s'élève à 2.5 10-7 transformants/p g d'ADN de pTG47, sont transformées par le plasmide pTG47 préalablement coupé par KnpI et BglII (voir figure 3).Deletion of the dapD gene from the chromosome
Deletion of the dapD gene from the chromosome of an intermediate strain
RH5345 cells, the competence of which is 2.5 × 10 -7 transformants / μg of pTG47 DNA, are transformed by the plasmid pTG47 previously cut with KnpI and BglII (see FIG. 3).
Cette digestion libère un fragment qui contient les régions flanquantes du gène dapD, le gène lui-même étant remplacé par le gene de résistance à la kanamycine.This digestion releases a fragment which contains the flanking regions of the dapD gene, the gene itself being replaced by the kanamycin resistance gene.
Après étalement sur LB + DAP + kanamycine 0.01 mg/ml on sélectionne 9 candidats- : TGE721 a' TGE729 dont on confirme le phénotype dap-, $kanR. After spreading on LB + DAP + kanamycin 0.01 mg / ml, 9 candidates- are selected: TGE721 to 'TGE729 for which the dap-, $ kanR phenotype is confirmed.
L'absence du gène dapD est confirmée après transformation de ces souches par le pTG764 par leur capacité de se multiplier en milieu LB.The absence of the dapD gene is confirmed after transformation of these strains by pTG764 by their capacity to multiply in LB medium.
Délétion du gène dapD de la souche TGE901 et N5969
La délétion dapD de la souche TGE721 est ensuite transduite dans les souches TGE901 et N5969 par le phage transducteur
Plvir/TGE721 et les recombinants dap sélectionnés par leur résistance à 0.01 mg/ml de kanamycine.Deletion of the dapD gene from the strain TGE901 and N5969
The dapD deletion of the strain TGE721 is then transduced into the strains TGE901 and N5969 by the transducing phage
Plvir / TGE721 and the dap recombinants selected for their resistance to 0.01 mg / ml of kanamycin.
Les candidats retenus sont respectivement TGE7213, 7214 et
TGE7303. Les exigences en ile, val, his de la souche mère,
TGE901, en plus du caractère dap"kanR ont été confirmés sur les milieux appropriés, pour un candidat : TGE7214.The successful candidates are TGE7213, 7214 and
TGE7303. The requirements in ile, val, his of the mother strain,
TGE901, in addition to the character dap "kanR have been confirmed on the appropriate media, for a candidate: TGE7214.
Exemple 2 Confirmation de la délétion du gène dap dans
différentes souches par "blot" chromosomique.Example 2 Confirmation of the deletion of the dap gene in
different strains by chromosomal "blot".
Les différentes souches suivantes ont été analysées - les souches parentales TGE901 et RH5345, dapD+ . les souches délétées TGE7213 et 7214 la souche parentale RL58 qui a été employée pour introduire
la mutation dapD dans TGE901, et le mutant dapD', TGE7615,
qui en dérive . une souche GC4540 qui est résistante à la kanamycine par
intégration du Tn5 alors que dans les souches TG... le gène
de résistance a' la kanamycine dérive du Tn903 (les 2 gènes
ne devraient pas donner d'hybridation croisée par manque
d'homologie - Beck et al. 1982)
Le choix des enzymes de restriction est basé sur la séquence du pDB6 ; une coupure par - BamHI et HindIII libère un fragment chromosomique de 9 kb
contenant le gène dapD et ses régions flanquantes, dans le
cas des souches sauvages ; dans le cas des souches délétées
le gène de résistance devra être libéré par la digestion par
BamHI et coupé en 2 fragments par digestion par HindIII.The following different strains were analyzed - the parental strains TGE901 and RH5345, dapD +. the deleted strains TGE7213 and 7214 the parental strain RL58 which was used to introduce
the dapD mutation in TGE901, and the dapD 'mutant, TGE7615,
that derives from it. a strain GC4540 which is resistant to kanamycin by
integration of Tn5 whereas in TG strains ... the gene
resistance to kanamycin is derived from Tn903 (the 2 genes
should not cross lack hybridization
of homology - Beck et al. 1982)
The choice of restriction enzymes is based on the sequence of pDB6; a cut by - BamHI and HindIII releases a 9 kb chromosomal fragment
containing the dapD gene and its flanking regions, in the
wild strains; in the case of deleted strains
the resistance gene will have to be released by digestion with
BamHI and cut into 2 fragments by digestion with HindIII.
- PstI libère 2 fragments contenant chacun une partie du gène
dapD (2.8 kb de la région 5' et 3.4 kb de la région 3') pour
les souches sauvages ; dans le cas des souches délétées la
digestion par PstI libère le gène de résistance à la kanam-
cine et les 2 régions flanquantes (du côté 5' un fragment de
2.4 kb et du côté 3' un fragment de 2.8 kb) (voir figures 1
et 3).- PstI releases 2 fragments, each containing a part of the gene
dapD (2.8 kb from the 5 'region and 3.4 kb from the 3' region) for
wild strains; in the case of deleted strains the
digestion with PstI releases the kanam resistance gene
cine and the 2 flanking regions (on the 5 'side a fragment of
2.4 kb and on the 3 'side a fragment of 2.8 kb) (see figures 1
and 3).
Les sondes ont été choisies pour allumer le gène dap ou ses régions flanquantes ou le gène kanR - pour sonder le gène de résistance à la kanamycine on isole
un fragment EcoRI du pTG47 qui ne contient que ce gène de
résistance (figure 3).The probes were chosen to turn on the dap gene or its flanking regions or the kanR gene - to probe the kanamycin resistance gene we isolate
an EcoRI fragment of pTG47 which contains only this gene
resistance (Figure 3).
- pour sonder le gène dapD on utilise un fragment EcoRI de
2.4 kb du M13TG620 ne contenant que la région 5' du gène
dapD et qui devrait être entièrement délété dans TGE721,
7213j 7214 (figure 2).- to probe the dapD gene, an EcoRI fragment of
2.4 kb of M13TG620 containing only the 5 'region of the gene
dapD and which should be completely deleted in TGE721,
7213j 7214 (Figure 2).
- pour sonder le chromosome on utilise un fragment KpnI-BglII
de pTG47 qui contient le gène de résistance à la kanamycine
et les 2 régions (le côté 5' et le 3') du chromosome qui
flanquent le gène dapD (figure 3).- to probe the chromosome we use a KpnI-BglII fragment
pTG47 which contains the kanamycin resistance gene
and the 2 regions (the 5 'and the 3' side) of the chromosome which
flank the dapD gene (Figure 3).
On s'attend donc à allumer, - dans les souches sauvages, une bande de 2.8 kb correspondan
à la région 5' du gène dapD et une bande de 3.4 kb corres
pondant à la région 3' de ce gène (figure 1).We therefore expect to light, - in wild strains, a band of 2.8 kb correspondan
to the 5 'region of the dapD gene and a 3.4 kb band corresponding
lying in the 3 'region of this gene (Figure 1).
- dans les souches délétées, le gène de résistance à la kana
mycine, la région 5' flanquante du gène dapD qui subsiste
(2.4 kb) et la région 3' flanquante du gène dapD qui subsis
te (2.8 kb) (figure 3). - in deleted strains, the kana resistance gene
mycine, the 5 'flanking region of the dapD gene that remains
(2.4 kb) and the 3 'flanking region of the dapD gene which remains
te (2.8 kb) (Figure 3).
D'mon.tration de l'incorporation du gne da rôsistance la kanamycine
On a comparé les ADNs chromosomiques de GC4540, TGE7213,
TGE7214 et TGE901, coupés par PstI ou BamHI et HindIII et sondé par le fragment EcoRI du pTG47.Demonstration of the incorporation of the kanamycin resistance gene
The chromosomal DNAs of GC4540, TGE7213, were compared.
TGE7214 and TGE901, cut with PstI or BamHI and HindIII and probed with the EcoRI fragment from pTG47.
PstI libère la bande de 1.3 kb , une restriction BamHI et
HindIII donne 2 fragments de 0.7 et 0.6 kb pour les souches délétées uniquement. Aucune bande ne s'allume dans TGE901 ni dans GC4540 (figure 4A).PstI releases the 1.3 kb band, a BamHI restriction and
HindIII gives 2 fragments of 0.7 and 0.6 kb for deleted strains only. No strip lights up in TGE901 or in GC4540 (Figure 4A).
Ces résultats prouvent que le gène de résistance à la kanamycine est incorporé dans le chromosome des souches délétées et que ce gène provient du pUC-4K.These results prove that the kanamycin resistance gene is incorporated into the chromosome of deleted strains and that this gene comes from pUC-4K.
Démonstration de la délétion du gène dapD du chromosome
Les ADNs chromosomiques de GC4540, TGE7213, 7214 et TGE901 sont comparés avec comme contrôles M13TG620, M13TG5971 le fragment BamHI-HindIII de pDB6 et le même fragment coupé par
PstI (figure 1).Demonstration of the dapD gene deletion from the chromosome
The chromosomal DNAs of GC4540, TGE7213, 7214 and TGE901 are compared with, as controls M13TG620, M13TG5971, the BamHI-HindIII fragment of pDB6 and the same fragment cut by
PstI (Figure 1).
Les ADNs chromosomiques sont coupés par PstI ou BamHI et
HindIII.The chromosomal DNAs are cut by PstI or BamHI and
HindIII.
On isole M13TG620 coupé par EcoRI de la bande contenant spécifiquement le côté 5' du gène dapD pour l'utiliser comme sonde (figure 4B).M13TG620 cut by EcoRI is isolated from the band specifically containing the 5 ′ side of the dapD gene for use as a probe (FIG. 4B).
Après digestion par PstI on voit que dans les souches sauvages on allume une bande de 2.8 kb correspondant å la région 5' du gène dapD, mais aussi une bande inattendue de 1.7 kb.After digestion with PstI we see that in wild strains a 2.8 kb band corresponding to the 5 'region of the dapD gene is ignited, but also an unexpected band of 1.7 kb.
Après digestion par BamHI et HindIII on allume une bande d'environ 12 kb qui est plus grande que la bande (de 9 kb) en provenance de pDB6. En plus une bande supplémentaire de 2.5 kb est aussi présente dans les souches sauvages (figure 4B). After digestion with BamHI and HindIII, a band of approximately 12 kb is ignited which is larger than the band (of 9 kb) originating from pDB6. In addition, an additional band of 2.5 kb is also present in wild strains (Figure 4B).
Aucune homologie significative n'est apparente pour les souches délétées, dans aucun fragment de digestion.No significant homology is apparent for the deleted strains in any digestion fragment.
Ces observations montrent que - une sonde qui couvre la partie 5' du gène dapD n'allume
aucune bande dans le chromosome des souches TGE7213, 7214 ce
qui démontre la délétion du côté 5' de ce gène.These observations show that - a probe which covers the 5 'part of the dapD gene does not switch on
no band in the chromosome of strains TGE7213, 7214 ce
which demonstrates the deletion of the 5 'side of this gene.
- comme on allume dans les souches sauvages, en plus de la
bande attendue, une deuxième bande, spécifique du gène dapD,
il semble que ce gène soit dupliqué dans ces souches.- as we light in wild strains, in addition to the
expected band, a second band, specific for the dapD gene,
it seems that this gene is duplicated in these strains.
Comme une duplication du gène dapD était inattendue, nous avons confirmé cette duplication dans certaines souches sauvages, et confirmé la délétion du gène dap du côté 3' en plus du côté 5'.As a duplication of the dapD gene was unexpected, we confirmed this duplication in certain wild strains, and confirmed the deletion of the dap gene on the 3 'side in addition to the 5' side.
Les mêmes ADNs chromosomiques et contrôles sont utilisés après digestion avec PstI (figure 3).The same chromosomal and control DNAs are used after digestion with PstI (FIG. 3).
La sonde est le pTG47 coupé par KpnI et BglII.The probe is pTG47 cut by KpnI and BglII.
Cette sonde devrait allumer, en plus des bandes que l'on a prédites plus haut, au moins une bande de 1.7 kb. En effet le pTG47 contient 300 pb et 100 pb homologues au gène dapD, du côté 5' et du côté 3' respectivement, et qui devraient s'allumer dans les souches délétées.This probe should light, in addition to the bands predicted above, at least one band of 1.7 kb. In fact, pTG47 contains 300 bp and 100 bp homologous to the dapD gene, on the 5 'side and on the 3' side respectively, and which should light up in the deleted strains.
La figure 4C montre que - on allume des bandes de 2.8 et 2.4 kb dans les souches délé
tées et des bandes de 3.4 et 2.8 kb dans les souches sauva
ges ; en plus on allume une bande de 1.3 kb correspondant au
gène de résistance à la kanamycine. Ceci prouve la délétion
dans les souches TGE7213 et 7214.Figure 4C shows that - we light bands of 2.8 and 2.4 kb in the strains delé
tees and bands of 3.4 and 2.8 kb in the strains saved
ges; in addition we light a 1.3 kb band corresponding to the
kanamycin resistance gene. This proves the deletion
in strains TGE7213 and 7214.
- on allume aussi des bandes moins intenses, dans les souches
sauvages uniquement, dues au gène dapD dupliqué. Comme on
sait que la bande de 1.7 kb s'allume avec la partie 5', la
bande de 2.1 kb doit provenir du c8té 3'. Ceci prouve que
ces souches contiennent effectivement une duplication qui a
disparu dans les souches délétées.- we also light up less intense bands, in the strains
wild only, due to the duplicated dapD gene. As we
knows that the 1.7 kb strip lights up with the 5 'part, the
2.1 kb band must come from the 3 'side. This proves that
these strains actually contain a duplication which has
disappeared in deleted strains.
Nous avons comparé 1'ADN chromosomique coupé par PstI des souches RH5345 et RL58 ainsi que le mutant dapD' obtenu par conjugaison du RL58 avec TGE901. Ces ADNs sont sondés par le fragment KpnI, BglII isolé de pTG47 qui contient le gène de résistance à la kanamycine (qui ne devrait rien allumer) et les régions flanquantes du gène dapD.We compared the chromosomal DNA cut by PstI from the strains RH5345 and RL58 as well as the mutant dapD 'obtained by conjugation of the RL58 with TGE901. These DNAs are probed by the KpnI, BglII fragment isolated from pTG47 which contains the kanamycin resistance gene (which should ignite nothing) and the flanking regions of the dapD gene.
La figure 4D montre que dans RH5345 on n'allume que les bandes 3.4 et 2.8 kb et pas les bandes dues à la duplication du gène présentes dans GC4540 ou TGE901. De plus on ne remarque qu'une bande de 7 kb pour RL58 et TGE7615, ce qui indique une perte d'un site PstI ; ceci prouve que ces 2 mutants sont identiques et touchés au moins dans le site PstI du gène dapD.Figure 4D shows that in RH5345, only the 3.4 and 2.8 kb bands are turned on and not the bands due to the duplication of the gene present in GC4540 or TGE901. In addition, we only notice a band of 7 kb for RL58 and TGE7615, which indicates a loss of a PstI site; this proves that these 2 mutants are identical and affected at least in the PstI site of the dapD gene.
En conclusion, ces expériences montrent que - les souches TGE7213, 7214 sont délétées pour le gène dapD et
qu'elles contiennent le gène de résistance à la kanamycine.In conclusion, these experiments show that - the strains TGE7213, 7214 are deleted for the dapD gene and
that they contain the kanamycin resistance gene.
- la mutation dapD' de RL58 et TGE7615 se trouve au moins au
niveau du site PstI du gène dapD.- the dapD 'mutation of RL58 and TGE7615 is found at least at
level of the PstI site of the dapD gene.
- certaines souches de E. coli présentent une duplication du
gène dapD et cette duplication n'est pas présente dans les
souches délétées.- certain strains of E. coli show a duplication of
dapD gene and this duplication is not present in
deleted strains.
Comme par transduction on réussit à déléter les 2 gènes dapD de la souche réceptrice, on peut conclure que le gène dupliqué doit se trouver proche (à moins de 2' sur la carte chromosomique de E. coli) du premier gène dapD. As by transduction we succeed in deleting the 2 dapD genes from the receptor strain, we can conclude that the duplicated gene must be close (within 2 'on the chromosomal map of E. coli) to the first dapD gene.
Exemple 3 Clonage du gène cer.Example 3 Cloning of the cer gene.
Le gène cer est récupéré b partir du plasmide ColEl, dont la séquence a été publiée par Chan et al. (1985), sous forme d'un fragment HaeII de 1,85 kb. The cer gene is recovered from the plasmid ColEl, the sequence of which has been published by Chan et al. (1985), in the form of a 1.85 kb HaeII fragment.
Le fragment HaeII est ensuite coupé par HpaII, traité à la Klenow et une bande de 0.4 kb est récupérée. Le M13mpl30 est coupé par EcoRV et traité à la phosphatase. On ligue le fragment de 0.4 kb du ColEl dans le M13mp130 et on l'introduit dans la souche JM103. La présence du fragment cer de ColEl a été confirmée par séquençage de la bande de 0.4 kb libérée par coupure SmaI et HindIII. The HaeII fragment is then cut with HpaII, treated with Klenow and a 0.4 kb band is recovered. The M13mpl30 is cut with EcoRV and treated with phosphatase. The 0.4 kb fragment of ColEl is ligated into M13mp130 and it is introduced into the strain JM103. The presence of the cer fragment of ColEl was confirmed by sequencing the 0.4 kb band released by SmaI and HindIII cleavage.
Le gène cer inséré dans le polylinker du M13mpl31 est ensuite isolé après digestion par SmaI et Hindili et ligué dans le vecteur pTG720 (portant le gène hirudine, figure 2 du brevet principal) coupé par BglII et traité à la Klenow. Le plasmide résultant est le pTG720cer. The cer gene inserted into the polylinker of M13mpl31 is then isolated after digestion with SmaI and Hindili and ligated into the vector pTG720 (carrying the hirudin gene, FIG. 2 of the main patent) cut with BglII and treated with Klenow. The resulting plasmid is pTG720cer.
Exemple 4 Construction de vecteurs de clonage contenant le
gène cer et le gène dapD.Example 4 Construction of Cloning Vectors Containing the
cer gene and dapD gene.
Inversion du sens du polylinker de M13mpl31 dans un vecteur codant pour la résistance & l'ampicilline
Le pTG192 (figure 1 du brevet principal) est coupé par EcoRI et BglII pour libérer le polylinker de M13mpl31 et est raccourci par digestion HaeIII. On utilise un plasmide portant le gène de la résistance à l'ampicilline, par exemple le pTG730 (vecteur d'expression de 1'hirudine décrit dans le brevet français 86.16723) ; ce plasmide est coupé par BglII et EcoRI et ligué au fragment EcoRI-BglII du pTG192. De cette manière on perd le bloc d'expression comprenant le PL et le gène de structure de l'hirudine du pTG730 que l'on remplace par le polylinker-de M13mpl31. On appelle ce nouveau plasmide pTG790 (figure 5). Reversal of the direction of the M13mpl31 polylinker in a vector coding for resistance & ampicillin
PTG192 (Figure 1 of the main patent) is cut with EcoRI and BglII to release the polylinker from M13mpl31 and is shortened by HaeIII digestion. A plasmid carrying the ampicillin resistance gene is used, for example pTG730 (hirudin expression vector described in French patent 86.16723); this plasmid is cut with BglII and EcoRI and ligated to the EcoRI-BglII fragment of pTG192. In this way, the expression block comprising the PL and the hirudin structural gene of pTG730 is lost, which is replaced by the polylinker-of M13mpl31. This new plasmid is called pTG790 (Figure 5).
Introduction du fragment cer dans un- vecteur de clonage
Le pTG790 est coupé par SstI et KpnI et traité a la phosphatase. Le fragment résultant de cette digestion est ligué au pTG720cer, coupé par SstI et KpnI (ce qui libère le fragment cer) et raccourci par digestion BglII. Le vecteur résultant, pTG792, contient le fragment cer (figure 6).Introduction of the cer fragment into a cloning vector
PTG790 is cut with SstI and KpnI and treated with phosphatase. The fragment resulting from this digestion is ligated to pTG720cer, cut with SstI and KpnI (which releases the cer fragment) and shortened by BglII digestion. The resulting vector, pTG792, contains the cer fragment (Figure 6).
Introduction du gène dapD dans un vecteur contenant le fragment cer
Le pTG792 est coupé par EcoRI, traité à la Klenow et à la phosphatase. Le fragment résultant est ligué avec le fragment AluI de 1.3 kb issu de pDB6 qui contient le gène dapD (figure 1).Introduction of the dapD gene into a vector containing the cer fragment
PTG792 is cut with EcoRI, treated with Klenow and phosphatase. The resulting fragment is ligated with the 1.3 kb AluI fragment from pDB6 which contains the dapD gene (FIG. 1).
Il en résulte 2 plasmides pTG7922 et pTG7923 qui ne diffèrent que par l'orientation du gène dapD situé entre 2 sites EcoRI. This results in 2 plasmids pTG7922 and pTG7923 which differ only in the orientation of the dapD gene located between 2 EcoRI sites.
Pour le pTG7922 les promoteurs des 3 gènes, origine de réplication, résistance à l'ampicilline et dapD sont orientés de la même manière (figure 7).For pTG7922, the promoters of the 3 genes, origin of replication, resistance to ampicillin and dapD are oriented in the same way (FIG. 7).
Délétion du gène de résistance & l'ampicilline
Les constructions suivantes ont un but multiple - déléter le gène de résistance à l'ampicilline des vecteurs
contenant le gène dapD ; - obtenir un vecteur de clonage dapD contenant le gène cer - obtenir un vecteur de clonage dapD qui contient le polylin
ker de M13mpl31 (moins le site EcoRV, utilisé pour le clona
ge du cer) - obtenir un vecteur dapD avec un seul site EcoRI.Deletion of the resistance gene & ampicillin
The following constructs serve a multiple purpose - deleting the vector ampicillin resistance gene
containing the dapD gene; - obtain a dapD cloning vector containing the cer gene - obtain a dapD cloning vector which contains the polylin
ker of M13mpl31 (minus the EcoRV site, used for clona
age of cer) - obtain a dapD vector with a single EcoRI site.
On récupère un fragment PstI du pTG7922 et du pTG7923 contenant respectivement la partie 3' et 5' du gène dapD ainsi que le gène cer pour l'introduire dans un vecteur dap contenant un fragment analogue mais pas de site EcoRI ou AvaI, ni le cer.A PstI fragment of pTG7922 and pTG7923 containing the 3 ′ and 5 ′ part of the dapD gene and the cer gene are respectively recovered to introduce it into a dap vector containing an analogous fragment but no EcoRI or AvaI site, nor the cer .
Les vecteurs analogues sont respectivement le pTG767 et le pTG766 décrits dans le brevet principal. The analogous vectors are respectively pTG767 and pTG766 described in the main patent.
Le pTG7922 et pTG7923 sont coupes par PstI, raccourcis par digestion BglII et ligués respectivement dans pTG767 et pTG766 coupés par PstI et traités & la phosphatase. Les vecteurs de clonage qui en résultent sont respectivement pTG769 et pTG768 (le pTG769 est représenté dans la figure 8).PTG7922 and pTG7923 are cut by PstI, shortened by BglII digestion and ligated respectively in pTG767 and pTG766 cut by PstI and treated with phosphatase. The resulting cloning vectors are pTG769 and pTG768 respectively (pTG769 is shown in Figure 8).
Exemple 5 Application du modèle dap à la construction de
vecteurs d'expression pour la catéchol 2,3 oxygé
nase (C2 ,3O)
Vecteur sans site BamHI en amont de la C213 O
Le gène de structure de la C2,3 O est récupéré à partir du pTG444 pour être introduit dans le vecteur dap pTG7671 (décrit dans le brevet principal).Example 5 Application of the dap model to the construction of
Expression Vectors for Oxygenated Catechol 2,3
nase (C2, 3O)
Vector without BamHI site upstream of C213 O
The C2.3 O structural gene is recovered from pTG444 to be introduced into the dap vector pTG7671 (described in the main patent).
Le pTG444, est identique au pTG445 décrit par Zukowski et al.PTG444, is identical to pTG445 described by Zukowski et al.
(1984) à l'exception d'un site XmaIII non régénéré. Le pTG444 est coupé par BamHI et HindlII et ligué au pTG769 coupé par
BamHI et HindIII et traité à la phosphatase. Le plasmide résultant, appelé pTG7401 ne contient que le gène de structure de la C2 '30
Le pTG7671 contient 2 sites BglII : un site en amont du PL faisant partie du polylinker et un site en aval du PL situé dans le site d'attachement des ribosomes, en amont du gène de structure de l'interféron gamma. Le pTG7671 est coupé par
BglII et raccourci par digestion KpnI. Le mélange résultant est ligué dans le pTG7401 coupé dans son polylinker par BglII et BamHI et traité à la phosphatase. Par cette ligation on reconstitue le site BglII mais le site BamHI ligué au BglII est perdu.Deux orientations du PL par rapport au gène de structure de la C2,3O sont possibles. Pour distinguer la construction où la C2,3 0 est sous le contrôle du PL, on coupe par BamHI et BglII (en effet pour l'orientation voulue un site BamHI se trouve à proximité du site BglII et la diges tion ne donnera pratiquement qu'une bande de 4.3 kb ; dans l'autre orientation la digestion libère une bande & 3.9 kb et une bande de 0.4 kb).(1984) with the exception of an unregenerated XmaIII site. PTG444 is cut with BamHI and HindIII and ligated to pTG769 cut with
BamHI and HindIII and treated with phosphatase. The resulting plasmid, called pTG7401 contains only the C2 '30 structural gene
PTG7671 contains 2 BglII sites: a site upstream of the PL forming part of the polylinker and a site downstream of the PL located in the ribosome attachment site, upstream of the structural gene of the gamma interferon. PTG7671 is cut by
BglII and shortened by KpnI digestion. The resulting mixture is ligated into pTG7401 cut in its polylinker with BglII and BamHI and treated with phosphatase. By this ligation, the BglII site is reconstituted but the BamHI site ligated to BglII is lost. Two orientations of the PL with respect to the structural gene for C2,3O are possible. To distinguish the construction where the C2.3 0 is under the control of the PL, we cut with BamHI and BglII (indeed for the desired orientation a BamHI site is located near the BglII site and the digestion will give practically only a band of 4.3 kb; in the other orientation the digestion releases a band & 3.9 kb and a band of 0.4 kb).
Le plasmide retenu, pTG7407, ayant la C2,3O 80U8 contrôle du a a une structure voisine du pTG7406 décrit plus loin (comparer à la figure 9) mais il a perdu le site BamHI en amont de la C2,30. The plasmid retained, pTG7407, having the C2,3O 80U8 control of a has a structure similar to pTG7406 described below (compare in FIG. 9) but it has lost the BamHI site upstream of C2.30.
Vecteur avec un site BamHI en amont de la C2,30
Le pTG769 est coupé par BglII et BamHI, traité à la phosphatase et ligué avec un fragment BamHI-BglII d'un plasmide d'expression quelconque (pTG907) qui contient le PL et le gène N complet, de #. Il en résulte une construction, le pTG7400, qui peut être identifiée par une coupure BamHI et BglII qui libère 2 bandes : à 2.6 kb et 1.3 kb. Cette construction contient le
PL et le gène N complet.Vector with a BamHI site upstream of the C2.30
PTG769 is cut with BglII and BamHI, treated with phosphatase and ligated with a BamHI-BglII fragment of any expression plasmid (pTG907) which contains the PL and the complete N gene, from #. The result is a construction, pTG7400, which can be identified by a BamHI and BglII cut which releases 2 bands: at 2.6 kb and 1.3 kb. This construction contains the
PL and the complete N gene.
Le pTG7400 est ensuite coupé par HpaI et on y insère un linker
BamHI (vendu par BRL) CCGGATCCGG, phosphorylé et hybridé. Ceci donne le pTG7402 qui a perdu son site HpaI mais contient 2 sites BamHI.The pTG7400 is then cut by HpaI and a linker is inserted into it
BamHI (sold by BRL) CCGGATCCGG, phosphorylated and hybridized. This gives pTG7402 which has lost its HpaI site but contains 2 BamHI sites.
Le pTG7402 est coupé par BamHI et religué pour donner le pTG7404. Par cette manipulation on a éliminé un site BamHI et tronqué le gène N.PTG7402 is cut with BamHI and religated to give pTG7404. By this manipulation, a BamHI site was eliminated and the N gene was truncated.
Introduction du gène de la C2,3O dans un vecteur dap-cer
Le pTG7402 est coupé par BamHI et HindIII, traité à la phosphatase et le fragment BamHI-HindIII du pTG444 y est introduit pour donner le pTG7406 (voir figure 9). il diffère du pTG7407 par le fait qu'on peut sortir le gène de la C2,3O par une coupure BamHI, HindIII pour récupérer le fragment introduit à partir de pTG444. Introduction of the C2,3O gene into a dap-cer vector
The pTG7402 is cut with BamHI and HindIII, treated with phosphatase and the BamHI-HindIII fragment of pTG444 is introduced therein to give pTG7406 (see FIG. 9). it differs from pTG7407 in that the C2.3O gene can be removed by a BamHI, HindIII cleavage to recover the fragment introduced from pTG444.
Expression de la C2,3O dans les souches de E. coli dap transformées par le plasmide pTG7407
L'expression du gène C2,30 dans les bactéries TGE7213/ pTG7407 a été mesurée & 30eC après 4 h et 7 h de culture et au cours de l'induction & 42C après 4 h et 7 h.Expression of C2,3O in E. coli dap strains transformed by the plasmid pTG7407
The expression of the C2.30 gene in TGE7213 / pTG7407 bacteria was measured at 30 ° C. after 4 h and 7 h of culture and during induction at 42 ° C. after 4 h and 7 h.
Pour chaque détermination, un échantillon de la culture est récolté et centrifugé ; le culot est lavé et repris en tampon phosphate (comme décrit par Zukowski et al. 1983) puis traité aux ultra-sons pendant 3 fois 20 secondes.For each determination, a sample of the culture is collected and centrifuged; the pellet is washed and taken up in phosphate buffer (as described by Zukowski et al. 1983) then treated with ultrasound for 3 times 20 seconds.
Après centrifugation 10 min. à 10.000 g, on considère le culot comme la fraction insoluble (C) et le surnageant comme la fraction soluble (S).After centrifugation 10 min. at 10,000 g, the pellet is considered as the insoluble fraction (C) and the supernatant as the soluble fraction (S).
Les protéines présentes dans chaque fraction sont analysées par électrophorèse sur gel de polyacrylamide-SDS. Les bandes sont révélées par coloration au bleu de Coomassie.The proteins present in each fraction are analyzed by electrophoresis on polyacrylamide-SDS gel. The bands are revealed by coloring with Coomassie blue.
Les résultats sont présentés dans la figure 10. On remarque l'intensité de la bande de PM 35.000, en particulier après 7 h d'induction à 420C.The results are presented in FIG. 10. The intensity of the PM 35,000 band is noted, in particular after 7 h of induction at 420C.
Le "scanning" du gel donne environ 64 % et 75 % de C2,30 dans les fractions S et C respectivement.The "scanning" of the gel gives approximately 64% and 75% of C2.30 in the S and C fractions respectively.
Dans l'échantillon le plus riche (S, 7 h à 4.2'C), on a déterminé l'activité spécifique de la C2,3O (selon la méthode décrite par Zukowski et al. 1983), par addition de catéchol comme substrat. On mesure une activité spécifique de 28 à 35 U/mg
L'activité spécifique d'une préparation d'enzyme pure étant de
280 U/mg, les extraits analysés contiennent environ 12 % de C2 ,3O active.In the richest sample (S, 7 h at 4.2 ° C), the specific activity of C2.3O was determined (according to the method described by Zukowski et al. 1983), by addition of catechol as substrate. We measure a specific activity of 28 to 35 U / mg
The specific activity of a pure enzyme preparation being
280 U / mg, the analyzed extracts contain approximately 12% of active C2, 3O.
Exemple 6 Introduction du fragment cer dans un vecteur
d'expression de l'interféron gamma.Example 6 Introduction of the Cer Fragment into a Vector
expression of gamma interferon.
Le pTG7671 décrit précédemment est coupé au niveau de son polylinker par SstI (identique à 8ace) et KpnI puis traité à la phosphatase et ligué aux fragments de pTG720cer coupé par
SstI et KpnI, Après transformation dans TGE7615 on retient un candidat, pTG7675, qui libère 2 fragments de 400 pb et de 3.4 kb après digestion par SstI et KpnI (figure 11). The pTG7671 described above is cut at its polylinker with SstI (identical to 8ace) and KpnI then treated with phosphatase and ligated to the fragments of pTG720cer cut with
SstI and KpnI, After transformation in TGE7615, a candidate, pTG7675, is retained which releases 2 fragments of 400 bp and 3.4 kb after digestion with SstI and KpnI (FIG. 11).
Exemple 7 Mise en évidence de la stabilité des plasmides
au cours de l'induction de l'expression de l'in-
terféron gamma.EXAMPLE 7 Demonstration of the Stability of the Plasmids
during induction of expression of the in-
gamma terferon.
a) induction de l'expression de l'interféron gamma en milieu
LB à 420C pour un vecteur portant le gène de résistance à
l'ampicilline : TGE901/pTG40.a) induction of the expression of gamma interferon in the medium
LB at 420C for a vector carrying the resistance gene
ampicillin: TGE901 / pTG40.
Les résultats sont repris dans le tableau I. On mesure les cellules totales/unité de DO/ml afin de déterminer que la perte de la viabilité est un phénomène réel et non un changement de volume des cellules, par exemple. Ces données sont aussi reprises dans le tableau I. Le Fp a été défini dans le brevet-principal et relie le nombre de cellules p au nombre total de cellules présentes à un moment donné.The results are shown in Table I. The total cells / unit of OD / ml are measured in order to determine that the loss of viability is a real phenomenon and not a change in cell volume, for example. These data are also shown in Table I. The Fp was defined in the main patent and relates the number of p cells to the total number of cells present at a given time.
On remarquera que le Fp après 7h30 d'induction atteint une valeur de près de 2 %. I1 est donc moins élevé que dans l'expérience précédente (voir brevet principal exemple 10), ce qu'on ne peut attribuer qu'à une différence dans la structure du plasmide pTG40 dans ces 2 expériences : en effet, quoique la quantité de plasmide soit équivalente à différents moments de l'induction, dans la première expérience le plasmide était sous forme dimérique alors que dans l'expérience décrite ici il est principalement sous forme monomérique (comme le montre une analyse sur gel). L'état du plasmide n'influence pas la production en interféron gamma mais illustre de manière concrète la perte de stabilité si la forme monomérique d'un plasmide n'est pas maintenue. It will be noted that the Fp after 7:30 of induction reaches a value of almost 2%. I1 is therefore lower than in the previous experiment (see main patent example 10), which can only be attributed to a difference in the structure of the plasmid pTG40 in these 2 experiments: indeed, although the quantity of plasmid or equivalent at different times of induction, in the first experiment the plasmid was in dimeric form whereas in the experiment described here it is mainly in monomeric form (as shown by an analysis on gel). The state of the plasmid does not influence the production of gamma interferon but concretely illustrates the loss of stability if the monomeric form of a plasmid is not maintained.
b) Induction de l'expression de l'interféron gamma dans une
souche mutée pour le gène dap et transformée par un vecteur
contenant le gène dapD et le gène cer, TGE7615/pTG7675
Les résultats sont repris dans le tableau II. On mesure les cellules totales/unité de DO/ml t il n'y a pas de différence notable avec TGE901/pTG40. On confirme donc une réelle perte de la viabilité : après 7h30 d'induction, seulement 0.02 % de la culture reste viable. Ceci est à comparer avec le TGE901/ pTG40 où la valeur obtenue est de 2.4 %. Ceci se traduit au niveau du Fp- qui, dans le cas de TGE7615/pTG7675, est diminué d'un facteur 1000 par rapport au TGE9011pTG40. Pourtant il reste toujours quelques cellules p qui apparaissent en fin d'induction.Le contenu plasmidique présente les mêmes caractéristiques qu'avant, c'est-à-dire augmentation du nombre de copies en fin de croissance mais les formes multimériques présentes en plus ou moins grand nombre avec les plasmides sans cer, sont quasi absentes ici. La production en interféron gamma est légèrement supérieure à celle obtenue avec le pTG40.b) Induction of the expression of gamma interferon in a
strain mutated for the dap gene and transformed by a vector
containing the dapD gene and the cer gene, TGE7615 / pTG7675
The results are shown in Table II. Total cells / OD unit / ml are measured t there is no significant difference with TGE901 / pTG40. We therefore confirm a real loss of viability: after 7:30 of induction, only 0.02% of the culture remains viable. This is to be compared with the TGE901 / pTG40 where the value obtained is 2.4%. This is reflected in the Fp- which, in the case of TGE7615 / pTG7675, is reduced by a factor of 1000 compared to TGE9011pTG40. However, there are always a few p cells which appear at the end of induction. The plasmid content has the same characteristics as before, that is to say an increase in the number of copies at the end of growth but the multimeric forms present in addition or fewer with plasmids without cer, are almost absent here. The production of gamma interferon is slightly higher than that obtained with pTG40.
c) induction de l'expression de l'interféron gamma dans une
cellule hôte délétée pour le gène dapD et transformée par
un vecteur contenant le gène dapD et le cer, TGE7213/
pTG7675
Les résultats sont repris dans le tableau III. Les conclusions sont identiques à celles tirées de la comparaison entre
TGE901/pTG40 et TGE7615/pTG7675 : la mortalité atteint un facteur 3.5 10-4, la quantité de cellules totales/unité de
DO/ml ne change pas de manière significative durant l'inducti- on. Par contre même après 7h30 d'induction il n'y a pas d'apparition de cellules p (après 24h toute la culture est devenue p pour TGE901/pTG40 et est restée 100 t p+ pour TGE7213/ pTG7675).Le contenu plasmidique est comparable à celui de TGE7615/.pTG7675 par l'absence de multimères. La production en interféron gamma est légèrement supérieure à celle obtenue avec TGE7615/pTG7675. c) induction of the expression of gamma interferon in a
host cell deleted for the dapD gene and transformed by
a vector containing the dapD gene and the cer, TGE7213 /
pTG7675
The results are shown in Table III. The conclusions are identical to those drawn from the comparison between
TGE901 / pTG40 and TGE7615 / pTG7675: mortality reaches a factor of 3.5 10-4, the quantity of total cells / unit of
DO / ml does not change significantly during induction. On the other hand, even after 7 h 30 of induction there is no appearance of p cells (after 24 h the entire culture has become p for TGE901 / pTG40 and has remained 100 t p + for TGE7213 / pTG7675). The plasmid content is comparable to that of TGE7615 / .pTG7675 by the absence of multimers. The production of gamma interferon is slightly higher than that obtained with TGE7615 / pTG7675.
Tableau I
induction de TGE901/pTG40 à 42 C en milieu LB
D.O. 600 nm c/ml/D.O. c totales/ml/D.O. Fp0 h 00 0.370 3.9 108 < 1.4 % 1 h 00 1.29 3.8 108 6.5 108 2 h 00 1.67 3.0 107 7.2 108 0.03 % 3 h 00 2.13 2.7 106 0.11 % 4 h 00 2.42 2.8 106 6.7 108 0.23 % 6 h 15 2.89 7.0 106 6.5 108 0.70 % 7 h 30 3.08 9.5 106 1.73 %
NOTE : Fp- est le pourcentage des p- sur la totalité des cellules présentes à un moment donné. Table I
induction of TGE901 / pTG40 at 42 C in LB medium
DO 600 nm c / ml / DO total c / ml / DO Fp0 h 00 0.370 3.9 108 <1.4% 1 h 00 1.29 3.8 108 6.5 108 2 h 00 1.67 3.0 107 7.2 108 0.03% 3 h 00 2.13 2.7 106 0.11% 4 h 00 2.42 2.8 106 6.7 108 0.23% 6 h 15 2.89 7.0 106 6.5 108 0.70% 7 h 30 3.08 9.5 106 1.73%
NOTE: Fp- is the percentage of p- over all the cells present at a given time.
Tableau II
TGE7615/pTG7675 à 42 C en milieu LB
D.O. 600 nm c/ml/D.O. c totales/ml/D.O. Fp0 h 00 0.310 3.5 108 1 h 00 1.07 3.3 108 4.7 108 2 h 00 1.64 1.5 107 5.1 108 3 h 00 2.31 1.44 107 4 h 00 2.67 7.1 106 7.9 108 6 h 15 3.26 6.1 106 6.1 108 0.0017 % 7 h 30 3.44 6.4 106 0.0018 % Tableau III
Induction de TGE7214/pTG7675 à 42 c en milieu LB
D.O. 600 nm c/ml/D.O. c totales/ml/D.O. Fp0 h 00 0.400 3.4 108 < 1.1 % 1 h 00 1.25 3.7 108 5.8 108 2 h 00 1.71 3.8 107 7.1 108 3 h 00 2.45 3.0 105 4 h 00 3.32 6.6 104 12.8 108 6 h 15 4.25 7.3 104 5.8 108 7 h 30 4.21 1.2 105 < 6 10-4 %
Exemple 8 Application du modèle dap a la construction d'un
vecteur d'expression pour l'alpha-l antitrypsine.Table II
TGE7615 / pTG7675 at 42 C in LB medium
DO 600 nm c / ml / DO c total / ml / DO Fp0 h 00 0.310 3.5 108 1 h 00 1.07 3.3 108 4.7 108 2 h 00 1.64 1.5 107 5.1 108 3 h 00 2.31 1.44 107 4 h 00 2.67 7.1 106 7.9 108 6.15 am 3.26 6.1 106 6.1 108 0.0017% 7.30 am 3.44 6.4 106 0.0018% Table III
Induction of TGE7214 / pTG7675 at 42 c in LB medium
DO 600 nm c / ml / DO total c / ml / DO Fp0 h 00 0.400 3.4 108 <1.1% 1 h 00 1.25 3.7 108 5.8 108 2 h 00 1.71 3.8 107 7.1 108 3 h 00 2.45 3.0 105 4 h 00 3.32 6.6 104 12.8 108 6.15 4.25 7.3 104 5.8 108 7.30 4.21 1.2 105 <6 10-4%
Example 8 Application of the dap model to the construction of a
expression vector for alpha-1 antitrypsin.
Le fragment PstI contenant le bloc d'expression de l'alpha-l antitrypsine c'est-à-dire le promoteur PL du phage lambda, le gène N tronqué, un site d'attachement des ribosomes et le gène de structure de l'alpha-l antitrypsine (Arg358) provenant du pTG2901 (dérivé tronqué du pTG983, décrit dans le brevet 85.07393) est introduit dans le pTG792 (décrit plus haut) coupé par PstI et traité à la phosphatase. The PstI fragment containing the expression block of alpha-1 antitrypsin, ie the PL promoter of phage lambda, the truncated N gene, a ribosome attachment site and the structural gene for alpha-1 antitrypsin (Arg358) from pTG2901 (truncated derivative of pTG983, described in patent 85.07393) is introduced into pTG792 (described above) cut with PstI and treated with phosphatase.
Le vecteur d'expression résultant, pTG7913, est ensuite coupé par BglII et SstI et le bloc d'expression contenant l'alpha-l antitrypsine et le gène cer est introduit dans le pTG767 coupé par BglII et SstI et traité à la phosphatase. The resulting expression vector, pTG7913, is then cut with BglII and SstI and the expression block containing alpha-1 antitrypsin and the cer gene is introduced into pTG767 cut with BglII and SstI and treated with phosphatase.
Le plasmide résultant, pTG7914, contient le gène dapD1 le gène cer et le bloc d'expression de l'alpha-l antitrypsine (Arg358) (figure 12). The resulting plasmid, pTG7914, contains the dapD1 gene, the cer gene and the alpha-1 antitrypsin expression block (Arg358) (Figure 12).
Dépôt des souches représentatives de l'invention
Les souches suivantes ont été déposées à la Collection Nationale de Cultures des Microorganismes (25 Rue du Dr.Deposit of strains representative of the invention
The following strains have been deposited in the National Collection of Cultures of Microorganisms (25 Rue du Dr.
Roux, Paris) le 10 mars 1987.Roux, Paris) March 10, 1987.
. TGE7214, souche de coli délétée du gène dapD, sous le
n' I652.. TGE7214, coli strain deleted from the dapD gene, under the
n 'I652.
. TGE7303, souche de coli délétée du gène dap D, sous le
ne I653.. TGE7303, coli strain deleted from the dap D gene, under the
no I653.
(les 2 souches sont transformées par le plasmide pTG768 qui
porte le gène dapD et cer).(the 2 strains are transformed by the plasmid pTG768 which
carries the dapD gene and cer).
. TGE7214/pTG7407, souche dapD transformée par le plasmide
d'expression de la C2 ,3O, sous le n I655. . TGE7214 / pTG7407, dapD strain transformed by the plasmid
of expression of C2, 3O, under the number I655.
REFERENCES
Beck, E., Ludwig, G., Auerswald, E.A., Reiss, B. & Schaller,
M. Gene 19, 327-336 (1982).REFERENCES
Beck, E., Ludwig, G., Auerswald, EA, Reiss, B. & Schaller,
M. Gene 19, 327-336 (1982).
Bendiak, D.S. & Friesen, J.D. Mol. Gen. Genet. 181, 356-362
(1981).Bendiak, DS & Friesen, JD Mol. Gen. Broom. 181, 356-362
(nineteen eighty one).
Bollen, A., Lathe, R., Herzog, A., Denicourt, D., Lecocq,
J.P., Desmarez, L. & Lavallé, R. J. Mol. Biol. 132, 219-233
(1979).Bollen, A., Lathe, R., Herzog, A., Denicourt, D., Lecocq,
JP, Desmarez, L. & Lavallé, RJ Mol. Biol. 132, 219-233
(1979).
Bukhari, A.I. & Taylor, A.L. J. Bacteriol. 105, 844-854
(1971).Bukhari, AI & Taylor, ALJ Bacteriol. 105, 844-854
(1971).
Chan, P.T., Ohmori, H., Tomizawa, J.I & Lebowitz, J. J. Biol.Chan, P.T., Ohmori, H., Tomizawa, J.I & Lebowitz, J. J. Biol.
Chem. 260, 8925-8935 (1985). Chem. 260, 8925-8935 (1985).
D'Ari, R. & Huisman, O. J. Bacteriol. 156, 243-250 (1983).D'Ari, R. & Huisman, O. J. Bacteriol. 156, 243-250 (1983).
Richaud, C., Richaud, F., Matin, C., Haziza, C. & Patte, J.C.Richaud, C., Richaud, F., Matin, C., Haziza, C. & Patte, J.C.
J. Biol. Chem. 259, 14824-14828, 1984. J. Biol. Chem. 259, 14824-14828, 1984.
Summers, D.K. & Spherratt, Cell 36, 1097-1103 (1984). Summers, D.K. & Spherratt, Cell 36, 1097-1103 (1984).
Zukowski, M.M., Gaffney, D.F., Speck, D., Kauffmann, M.,
Findeli, A., Wisecup, A. & Lecocq, J.P. Proc. Natl. Acad.Zukowski, MM, Gaffney, DF, Speck, D., Kauffmann, M.,
Findeli, A., Wisecup, A. & Lecocq, JP Proc. Natl. Acad.
Sci. USA 80, 1101-1105 (1983). Sci. USA 80, 1101-1105 (1983).
Zukowski, M.M., Speck, D., Kauffmann, M. & Lecocq, J.P. Gene
tics and Biotechnology of Bacilli 309-319 (1984). Zukowski, MM, Speck, D., Kauffmann, M. & Lecocq, JP Gene
tics and Biotechnology of Bacilli 309-319 (1984).
Claims (13)
Priority Applications (13)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR8709935A FR2618159B2 (en) | 1987-07-15 | 1987-07-15 | PROCESS FOR STABILIZING A PLASMID CONTAINED IN A BACTERIAL STRAIN AND STRAIN OBTAINED |
| ES87401815T ES2079348T3 (en) | 1986-08-05 | 1987-08-05 | STABILIZATION PROCEDURE OF A PLASMIDE CONTAINED IN A BACTERIAL STRAIN AND STRAIN OBTAINED. |
| AU76589/87A AU616637B2 (en) | 1986-08-05 | 1987-08-05 | Method for the stabilization of a plasmid contained in a bacterial strain and strain obtained |
| CA000543797A CA1340903C (en) | 1986-08-05 | 1987-08-05 | Process for stabilizing a plasmid present in a bacterial strain and strain thus obtained |
| DE3751564T DE3751564T2 (en) | 1986-08-05 | 1987-08-05 | Process for stabilizing a plasmid contained in a bacterial strain and the strain obtained. |
| AT87401815T ATE129285T1 (en) | 1986-08-05 | 1987-08-05 | METHOD FOR STABILIZING A PLASMID CONTAINED IN A BACTERIAL STRAIN AND THE OBTAINED STRAIN. |
| DK408687A DK408687A (en) | 1986-08-05 | 1987-08-05 | PROCEDURE FOR STABILIZING A PLASMID |
| JP62196154A JP2772793B2 (en) | 1986-08-05 | 1987-08-05 | Method for stabilizing plasmid contained in bacteria and strain obtained thereby |
| EP87401815A EP0258118B1 (en) | 1986-08-05 | 1987-08-05 | Process for stabilizing a plasmid contained in a bacterial strain, and strain obtained |
| US07/387,017 US5198343A (en) | 1986-08-05 | 1989-07-31 | Method for expressing a heterologous protein in a dapD- mutant of E. coli and the strain obtained |
| GR950403414T GR3018296T3 (en) | 1986-08-05 | 1995-12-05 | Process for stabilizing a plasmid contained in a bacterial strain, and strain obtained. |
| JP9046186A JP2905921B2 (en) | 1986-08-05 | 1997-02-28 | Method for stabilizing plasmid contained in bacteria |
| JP9207898A JP2844191B2 (en) | 1986-08-05 | 1997-08-01 | Method for producing protein using bacteria stably carrying exogenous plasmid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR8709935A FR2618159B2 (en) | 1987-07-15 | 1987-07-15 | PROCESS FOR STABILIZING A PLASMID CONTAINED IN A BACTERIAL STRAIN AND STRAIN OBTAINED |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| FR2618159A2 true FR2618159A2 (en) | 1989-01-20 |
| FR2618159B2 FR2618159B2 (en) | 1990-02-02 |
Family
ID=9353122
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| FR8709935A Expired - Lifetime FR2618159B2 (en) | 1986-08-05 | 1987-07-15 | PROCESS FOR STABILIZING A PLASMID CONTAINED IN A BACTERIAL STRAIN AND STRAIN OBTAINED |
Country Status (1)
| Country | Link |
|---|---|
| FR (1) | FR2618159B2 (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0086139A2 (en) * | 1982-02-01 | 1983-08-17 | Transgene S.A. | Expression vectors for catechol-2,3-dioxygenase, enzymes obtained and their uses |
| EP0106542A2 (en) * | 1982-09-16 | 1984-04-25 | A/S Alfred Benzon | Plasmid stabilization |
| EP0146642A1 (en) * | 1983-11-22 | 1985-07-03 | LUDWIG HEUMANN & CO GMBH | Process for the preparation of 4-amino-6,7-dimethoxy-2-(4-(furoyl-2)-piperazin-1-yl)-quinazoline and its physiologically acceptable salt |
| EP0169114A2 (en) * | 1984-06-19 | 1986-01-22 | Transgene S.A. | Human alpha-1-antitrypin derivatives and process for their preparation |
| EP0185512A1 (en) * | 1984-12-12 | 1986-06-25 | Novo Nordisk A/S | Method for stabilizing extra-chromosomal elements in bacteria during cultivation, extra-chromosomal elements, transformed bacteria and a method of producing a desired product in transformed bacteria |
| GB2177097A (en) * | 1985-06-18 | 1987-01-14 | Genencor Inc | Stable maintenance of nucleic acid in recombinant cells |
| EP0158564B1 (en) * | 1984-03-27 | 1992-07-15 | Transgene S.A. | Expression vectors for hirudin, transformed cells and process for the preparation of hirudin |
-
1987
- 1987-07-15 FR FR8709935A patent/FR2618159B2/en not_active Expired - Lifetime
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0086139A2 (en) * | 1982-02-01 | 1983-08-17 | Transgene S.A. | Expression vectors for catechol-2,3-dioxygenase, enzymes obtained and their uses |
| EP0106542A2 (en) * | 1982-09-16 | 1984-04-25 | A/S Alfred Benzon | Plasmid stabilization |
| EP0146642A1 (en) * | 1983-11-22 | 1985-07-03 | LUDWIG HEUMANN & CO GMBH | Process for the preparation of 4-amino-6,7-dimethoxy-2-(4-(furoyl-2)-piperazin-1-yl)-quinazoline and its physiologically acceptable salt |
| EP0158564B1 (en) * | 1984-03-27 | 1992-07-15 | Transgene S.A. | Expression vectors for hirudin, transformed cells and process for the preparation of hirudin |
| EP0169114A2 (en) * | 1984-06-19 | 1986-01-22 | Transgene S.A. | Human alpha-1-antitrypin derivatives and process for their preparation |
| EP0185512A1 (en) * | 1984-12-12 | 1986-06-25 | Novo Nordisk A/S | Method for stabilizing extra-chromosomal elements in bacteria during cultivation, extra-chromosomal elements, transformed bacteria and a method of producing a desired product in transformed bacteria |
| GB2177097A (en) * | 1985-06-18 | 1987-01-14 | Genencor Inc | Stable maintenance of nucleic acid in recombinant cells |
Non-Patent Citations (1)
| Title |
|---|
| CHEMICAL ABSTRACTS, vol. 104, no. 9, 3 mars 1986, page 165, no. 63013t, Columbus, Ohio, US; D.W.LEUNG et al.: "Nucleotide sequence of the partition function of Escherichia coli plasmid ColEl" & DNA 1985, 4(5), 351-5 * |
Also Published As
| Publication number | Publication date |
|---|---|
| FR2618159B2 (en) | 1990-02-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Berger et al. | The Agrobacterium tumefaciens virB4 gene product is an essential virulence protein requiring an intact nucleoside triphosphate-binding domain | |
| Okada et al. | Evolutionary adaptation of plasmid-encoded enzymes for degrading nylon oligomers | |
| Kostriken et al. | Transposon Tn3 encodes a site-specific recombination system: identification of essential sequences, genes, and actual site of recombination. | |
| de Lorimier et al. | Genetic analysis of a 9 kDa phycocyanin-associated linker polypeptide | |
| JPH0258917B2 (en) | ||
| JP2006068019A (en) | EXPRESSION PLASMIDS REGULATED BY osmB PROMOTER | |
| HU204565B (en) | Process for the synthesis of hybride dns of ripe insuline-like growth factor | |
| CA1341490C (en) | Dna functional group and plasmid coding for hirudine, transformed yeast, preparation process for hirudine, resulting hirudine, and its pharmaceutical use | |
| EP0258118B1 (en) | Process for stabilizing a plasmid contained in a bacterial strain, and strain obtained | |
| Lévq̂ue et al. | Design and characterization of Escherichia coli mutants devoid of Ap4N-hydrolase activity | |
| JP3009679B2 (en) | Pectin lyase expression system | |
| JPH02501108A (en) | Production of human parathyroid hormone by microorganisms | |
| EP0599971B1 (en) | Yeast promoter and use thereof | |
| JP3593125B2 (en) | Recombinant cells that highly express heterologous genes integrated into chromosomes | |
| FR2618159A2 (en) | Process for stabilising a plasmid contained in a bacterial strain and strain obtained | |
| US5198343A (en) | Method for expressing a heterologous protein in a dapD- mutant of E. coli and the strain obtained | |
| JPS62502025A (en) | DNA sequences useful for secreting peptides and proteins from yeast | |
| US4784952A (en) | Conferred susceptibility to lambda phage in non-coliform procaryotic hosts | |
| Graham et al. | The pyruvate dehydrogenase multi-enzyme complex of Escherichia coli: genetic reconstruction and functional analysis of the lipoyl domains | |
| EP0146462A2 (en) | Cloning and expression vectors for gamma interferon, transformed bacterias and process for the preparation of gamma-interferon | |
| EP1029063B1 (en) | Non rcr leuconostoc plasmid capable of being transferred into lactic acid bacteria; use as cloning and expressing tool | |
| FR2642767A1 (en) | Vectors for expressing heterologous proteins in eucaryotic cells, cell lines obtained and process for preparing them | |
| Greenfield et al. | High–Level Expression of Diphtheria Toxin Peptides in Escherichia coli | |
| Hartley | The structure and control of the pentitol operons | |
| EP0261009B1 (en) | DNA sequence exercizing a function characterized by an overproduction of extracellular proteins from different bacillus strains, and vectors containing this sequence |