FI118770B - A recombinant DNA method for obtaining in a filamentous fungus host a higher production level of a bacterial carbohydrate degrading (CD) enzyme by introducing the DNA construct into filamentous fungal host - Google Patents

Abstract

A recombinant DNA method for obtaining in a filamentous fungus host a higher production level of a bacterial carbohydrate degrading (CD) enzyme comprising introducing the DNA construct into filamentous fungal host and allowing the construct to express and secrete the truncated bacterial CD enzyme, under the control of the filamentous fungal derived regulatory sequences, is new. A recombinant DNA method for obtaining in a filamentous fungus host a higher production level of a bacterial CD enzyme having in its original full length state a structure consisting of a catalytic module (CAT) and a carbohydrate binding module (CBM) separated by a linker region. The DNA construct comprises regulatory sequences derived from filamentous fungi and a shortened DNA sequence encoding a truncated form of the bacterial CD enzyme, which contains the catalytically active region of CAT, but lacks part or all of the CBM, or all of the CBM and part or all of the linker region. The method comprises: introducing the DNA construct into filamentous fungal host; and allowing the construct to express and secrete the truncated bacterial CD enzyme, under the control of the filamentous fungal derived regulatory sequences, which include a promoter sequence, a signal sequence with or without a carrier sequence, and a terminator sequence derived from a filamentous fungus. The production level obtained with the DNA construct encoding the truncated form of the bacterial CD enzyme measured as an increase of activity from single copy transformants is higher than the production level obtained with another corresponding DNA construct, which is identical with the DNA construct except that it comprises a DNA sequence encoding the corresponding full length bacterial CD enzyme. An independent claim is included for a DNA construct for obtaining in a filamentous fungus host a higher production level of a bacterial CD enzyme having in its original full length state a catalytic module (CAT) and a carbohydrate binding module (CBM) separated by a linker region, characterized in that the DNA construct comprises regulatory sequences derived from filamentous fungi including a promoter, a signal sequence with or without a carrier sequence, and a terminator sequence and a shortened DNA sequence encoding a truncated form of the bacterial CD enzyme, which contains a catalytically active region of CAT but which lacks part or all of the CBM, or all of the CBM part or all of the linker region, where the production level of the DNA construct encoding the truncated bacterial CD enzyme measured as an increase of activity from single copy transformants is higher than the production level obtained with another corresponding DNA construct which is identical with the DNA construct, except that it comprises a DNA sequence encoding the corresponding full length bacterial CD enzyme.

Description

118770

Method and DNA Constructs for Increasing Yield Production of Carbohydrate Degrading Enzymes

TECHNICAL FIELD OF THE INVENTION 5

The present invention relates to molecular biology, and more particularly to methods and DNA constructs used to increase yield in a filamentous fungal host for the production of carbohydrate-degrading (CD) enzymes having a catalytic module in their original, unmodified form with a carbohydrate binding moiety between them. Carbohydrate-degrading enzymes of the above-defined structure are found in filamentous fungi and bacteria such as actinomycete strains, including Nonomuraea flexuosa XynIIA or Xyn10A. For high-yield production, a truncated DNA sequence encoding a truncated form of the desired carbohydrate-degrading enzymes is used.

15

Background of the Invention

Plant cell walls consist mainly of a complex mixture of polysaccharides, most notably cellulose, lignin and hemicellulose. In most plant materials, the major hemicellulose component is xylan, which is a backbone-forming 1,4-linked beta-D-xylopyranosyl moiety that often has acetyl, arabinosyl, and glucuronosyl substituents. Carbohydrate-degrading enzymes are • · · ·; , *, useful as feed additives due to their beneficial effects on the adsorption of feed ingredients, as well as in the pre-bleaching of kraft pulp, where they are used as simple and economical alternatives to toxic chlorinated chemicals, Kraft pulp. the main enzyme is endo-β-1,4-xylanase • · (EC 3.2.1.8), but other enzymes such as mannanase, lipase and α-galactosidase. . presence has been shown to potentiate the effect of enzymatic treatment.

• · ·

In enzyme-assisted bleaching, pretreatment with xylanase removes xylan • m 30 without affecting the cellulose content. Thus, the need for bleaching chemicals is reduced and / or the brightness of the paper is increased. In feed applications, Φ ·· beneficial effects, including increased growth rate and feed efficiency, resulting from reduced enzymatic viscosity and release of ··· ·; ··· grain endosperm and aleurone layer.

2 118770

Utilization of enzymatic treatments in the feed, pulp and paper industries has increased significantly. As a result, the demand for carbohydrate-degrading enzymes has also increased. This puts pressure on the development of new efficient and economical methods that could be used to produce sufficient 5 carbohydrate-degrading enzymes with properties suitable for use in these industries. Xylanases which are active and stable at high temperature and alkaline pH are particularly desirable in many industrial processes due to the high temperatures and basic conditions used in bleaching and the high temperatures used in post-treatment, e.g. pelletization.

Actinomycete strains are known to produce thermostable enzymes with basic optics. In particular, thermophilic strains of actinomycetes are a useful source of xylanases for industrial processes. Their activities and stability at high temperature are suitable for bleaching processes and other applications where high temperature enzyme treatment is preferred. Useful genes have been cloned, for example, from Thermomonospora fusca, Nonomuraea flexuosa DSM43186, formerly known as Actinomadura flexuosa or Microtetraspora flexuosa, and from some Streptomyces species. The cloning of two Nonomuraea flexuosa xylanases * i **: 20 is described in US 5,935,836, US 6,300,114, US 6,506,593 and US 6,667,170.

***: The desired high-temperature-resistant carbohydrate-degrading enzymes with pH-optimum extremes of · · ·· * are derived from relatively little researched bacteria.

···· 25 They typically have low yields and are not suited to industrial production ·· * on a large scale. There is little or no experience with the fermentation reactions of these bacteria. Therefore, the origin of these microbes,. ** ·. the transfer of the gene encoding the desired enzyme to the heterologous host is «·· *. a viable alternative for the production of the desired enzyme.

Bacterial enzymes have been produced in bacterial hosts and yeasts as disclosed, for example, in US 5,306,633 and US 5,712,142. US 5,712,142 discloses a method for increasing the thermostability of bacterial cellulase 118770 3 obtained from Acidothermus cellulyticus, either by proteolytic cleavage or by expression of a truncated or truncated form of the gene encoding full-length cellulase in Pichia pastoris. to increase thermostability.

5

Filamentous fungi, including Aspergillus, Trichoderma and Penicillium, are known to be effective producers of homologous and heterologous proteins. They are by far the most advantageous host organisms for large-scale production of industrial enzymes involving mass production of amylases, glucoamylases, cellulases, xylanases, etc. The first attempts to produce bacterial enzymes in filamentous fungi were not encouraging. The yields of bacterial enzymes were low, not exceeding a few tens of milligrams per liter. In several reports, enzymes were found only intracellularly (Jeenes et al., Biotechnol. Genet. Eng. Rev., 9, 327-367, 1991; van den Hondel et al., In JW Bennet and LL 15 Lasure (eds.), More Genetic Manipulations). in fungi, Academic Press, San Diego, California).

Genetic fusion methods have been developed and used to improve yields of heterologous proteins in filamentous fungi, as disclosed in US 5,364,770 and *: **: WO 94/21785 and Gouka et al. are disclosed in Appl. Microbiol.

: Biotechnol., 47, 1-11, 1997. Production of bacterial carbohydrate-degrading enzymes from filamentous fungi using gene fusions comprising a DNA sequence which: ***: encodes a complete or partial secretory protein (polypeptide) of filamentous fungi • · · ··· as a carrier protein, disclosed in WO 97/27306 and US 2003/0148453. Using the expression cassettes disclosed in the patents mentioned in the said patents, comprising DNA * · · sequences encoding a bacterial carbohydrate-degrading enzyme: .1. Fused to the same reading frame with complete or partial filamentous fungal · et al. (Appl. Environ. Microbiol., 69, 7073-7082, 2003) have shown that levels of production are significantly increased when a gene encoding a bacterial enzyme • · · · ** is fused to a reading frame with a secreted polypeptide of filamentous fungi. with • · * ·; · 'has an intact domain structure.

• · · • · • · · 4 118770

It is a further object of the present invention to improve the production levels of carbohydrate-degrading enzymes, in particular bacterial enzymes produced by recombinant DNA technology from filamentous fungal hosts.

S Summary of the Invention

The invention relates to a method and DNA constructs for increasing the production levels of carbohydrate-degrading enzymes using recombinant DNA techniques and host filamentous fungi.

10

The carbohydrate-degrading enzymes of the present invention are active on carbohydrate substrates and are enzymes in which the complete enzyme in its original (natural or unmodified) form has three characteristic domains or regions, which are the catalytic module containing the i , with a junction area between the modules. Some carbohydrate binding modules, such as the AM50 carbohydrate binding module, may have more than one domain.

The method of achieving an increased level of yield comprises the first step of: ·: **; 20 a DNA construct is constructed. This DNA construct introduced into the filamentous fungal host, •; *; comprises regulatory sequences and a truncated DNA sequence encoding a truncated form of the desired # · * • · * · carbohydrate-degrading enzyme, comprising a catalytic ··· · · ** '. module, and missing CBM module or part of it, or whole CBM and connector area ··· partially or completely. Preferably, the control sequences are derived from filamentous fungi and comprise ···· 25 at least one signal sequence.

· ♦ ·:. ·. The DNA sequence encoding the truncated form of the carbohydrate-degrading enzyme is derived from a bacterial strain that may be an actinomycete strain, such as the xylanases from Nonomuraea flexosa, in particular • ♦ e '···' 30 thermostable xylanases Nf XynllA and Nf XynlOA are examples of carbohydrate • ♦ * ··· * digestive enzymes whose yields can be increased by a combination of *: ###: DNA techniques and truncated DNA sequences that encode a truncated form of the target e 5 118770 carbohydrate-degrading enzyme, which is partially or completely absent or wholly or partially absent of CBM.

A truncated form of said carbohydrate-degrading enzyme is expressed under the control of regulatory sequences derived from the same or different filamentous fungi. The regulatory sequences comprise at least a signal sequence derived from a filamentous fungus. The yield can be further increased when the carbohydrate-degrading enzyme described above is expressed under the control of promoter sequences, terminator sequences and, most importantly, regulatory sequences of DNA sequences encoding a carrier protein (poly ly peptide). The control sequences may be obtained from the same or different filamentous fungi and may be combined in any manner. This means that the origin of the control sequences and their order may vary.

The DNA sequences encoding the carrier protein may contain either the entire coding region for the mature secreted protein or the selected region or domain of the secreted carbohydrate-degrading enzyme, e.g., the Man5A core and / or the hinge region or Cel6A (CBHII) CBD consisting of A, + B or A + B + B ', where A is the carbohydrate binding domain, B is the hinge (linkage) region and B' is the doubled hinge (linkage) region.

*; 1 2: 20 Promoter sequences may be selected from a variety of filamentous fungal promoters, particularly; promoters of the genera Trichoderma and Aspergillus, including the powerful · · · *; *: Trichoderma cel7A (cbhl) promoter. Terminator sequences are also obtained from · · · filamentous fungi, Trichoderma cel7A terminator sequence being particularly preferred.

··· ··· ····. ···, 25 When the truncated DNA sequence is truncated with Nf xynllA (am24 or am242), ··· is expressed and secreted only by the filamentous fungal promoter and ί. ·. controlled by a signal sequence without any carrier protein or domains thereof; ··· · .3. the yield level of truncated Nf Xynl 1 A is at least twice as high in shake flasks and ··· ·. often more than 8-10 times higher in the fermentation culture than the level of production obtained by expression and secretion of full-length XynIIIA under the control of the same promoter and • · 2 ** ·· * signal sequence without carrier protein or portions thereof.

3 • · • · M · 6 118770

When the truncated DNA sequence is truncated by Nf xynIIA (am24 or am24 *, which is expressed and secreted under the control of the promoter, signal sequence, and DNA sequence encoding the carrier protein (polypeptide) or domains thereof, all of which are N regulatory sequences derived from filamentous fungi, S (in shake flasks) is at least twice as high as the level of production by the DNA sequence encoding the corresponding full length Nf XynIIA expressed and secreted under the control of the same promoter and signal sequence as well as the carrier protein sequence or domains thereof. further, when using a DNA sequence encoding a truncated bacterial enzyme, although it was already known to achieve an improved level of yield when the DNA sequences encoding the full length bacterial enzyme were expressed and secreted by intact domains of filamentous fungal secreted carrier protein (Paloheimo et al., Appl. Environ. Microbiol., 69, 7073-7082, 2003).

15

The applicability of the present invention is illustrated by the sequences listed below.

SEQIDNO: Nf jry '77' nucleotide sequence (AJ508952), coding region *: ··: 20 between nt 303 and nt 1337

jj *: SEQIDNO: 2 am35, Nf xynllAm coding region for mature Nf XynllA

for i (AM35) ··· Φ: 1; SEQIDNO: 3 am24, a truncated form of a / w3J, contains the STOP codon ··· · ** SEQIDNO: 4 am35 *, like am35, but 9 codons changed in sequence · »··; 1 · 25 (Example 10) ( the changes do not affect the encoded • · · am amino acid sequence): SEQIDNO: 5 am24 *, like am24, but 9 codons were altered in the sequence while · · · * · ·. as in am3S * (Example 10) *, SEQIDNO: 6 Nf xyn10A nucleotide sequence (AJ508953), coding region is i * · 30 between 194-nt 1672 • f

* "· * SEQIDNO: 7 am50, Nf xynlOA coding region for mature Nf XynlOA

(AM50) Protein · 118770 7 SEQIDNO: 8 The sequence encoding the AM50 core and junction regions contains the STOP codon SEQ ID NO: 9 The sequence encoding the AM50 core region contains the STOP codon SEQIDNO: 10 Nf XynIIA amino acid sequence AJ508952) encoded by the 5 Nfxynl IA gene of SEQ ID NO; 11113,4 kDa = AM35 = full length mature Nf Xynl IA protein encoded by the am35 and am35 * genes of SEQ ID NO: 12 AM24, truncated by AM35 the form encoded by the am24 and am24 * genes SEQIDNO: 13 r23.8 kDa, truncated form AM35 SEQ ID NO: 14 r22.0 kDa, truncated form AM35 SEQIDNO: 15 Nf XynlOA, amino acid sequence (AJ508953), encoded

Nf xynl 0A gene

SEQ ID NO: 16 AM50, full length mature Nf XynlOA

15 SEQ ID NO: 17 AM50 core + splice, truncated form AM50 SEQ ID NO: 18 AM50 core, truncated form AM50 SEQ ID NO: 19 AM50 core + splice + tail α / β domains truncated form AM50: SEQIDNO: 20 AM50 core + junction + tail α domain, truncated form 20 AM50 ♦ ·: · SEQ ID NO: 21 Synthetic junction sequence encoding Kex2-like protease * ·: Lys-Arg cleavage signal contained in all constructs «··! (ii! to ensure cleavage of the fusion protein. polypeptides, designated as M * · r33.4 kDa, r23.8 kDa and r22.0 kDa • · · \ SEQIDNO: 24 Mul-recognition site added to the Kex2 junction • · ♦ "! 30 SEQIDNO: 25 Kex2 junction, which facilitates the construction of fusions • · • · ··· 1 · 8 118770

Brief Description of the Drawings

Figure 1 shows the nucleotide sequence and derived amino acid sequence of the Nonomuraea flexuosa xynlIA gene. The STOP codon is indicated by an asterisk below the sequence. The mature N-terminal amino acid sequence as determined from the purified Xyn11A protein is underlined. The active site glutamic acids are indicated in a box box. The position of the junction and the carbohydrate binding module is indicated by a dashed line below the amino acid sequence. The cleavage sites of the r23.8 kDa and r22.0 kDa polypeptides are indicated by a triangle. Sites for putative N-glycosylation in 10 eukaryotic hosts are shown in bold.

Figure 2A shows the nucleotide sequence and the deduced amino acid sequence of the N. flexuosa xyn10A gene. The STOP codon is indicated by an asterisk below the sequence.

Tryptic peptide sequences obtained from purified Xyn10A protein are indicated by IS underlining the amino acid sequence. The active site glutamic acids are indicated in a box box. The putative location for the junction and the carbohydrate binding module consisting of the α, β and γ subdomains (Fujimoto et al., J. Mol. Biol., 300, 575-585, 2000) is indicated by a dashed line below the amino acid sequence. QxW repeats occurring in the "ricin" superfamily "CBM (Fujimoto et al., J. Mol. Biol., 300, 575-585, 11-10002000; Hirabayashi, et al., J. Biol. Chem., 273, 14450-14460, 1998), is in bold.

· ·: The nucleotide sequence continues in Figure 2B.

• ♦ • · · • «· ··· · ···

Figure 2B shows a continuation of the nucleotide sequence depicted in Figure 2A.

Figure 3 shows the construction of the expression cassette pALK945 engineered to produce recombinant mature N. flexuosa Xynl IA protein using I reesei: ManSA core / hinge as carrier polypeptide. Gene fusion was expressed from the cel7A promoter and transcription termination was confirmed using the t'.t ce / 74 terminator sequence. The inserted mani ^ sequence encoded the amino acids * "1M1-G406 (Stälbrand et al., J. Biotechnol., 29, 229-242, 1993). The amdS · gene was included as a · · transformation marker and the 3 'flanking region of cel7A was incorporated together. with the cel7A promoter O · · • · to target the expression cassette to the ce / 7 / t locus by homologous recombination 1. The synthetic fusion sequence encoding the additional Arg was included to confirm the digestion of the 1887709 fusion protein. in the normal font, the equivalents of xynIIA are in italics and the synthetic amino acid for proteolytic cleavage is in bold.

Figure 4A shows a sample I of a reesei medium from which recombinant xylanase polypeptides (Example 7) were purified when run on SDS polyacrylamide gel (lane 2) and after Western blot analysis (lane 3). The positions of the r33.4 kDa and r23.8 kDa polypeptides and the fusion protein are indicated by arrows. The r22.0 kDa form did not appear in the gel shown / Westem blot due to its low content in culture supernatant. The sizes of the molecular weight markers (in lane 1) were from top to bottom: 104, 80, 46.9, 33.5, 28.3, 19.8 kDa. Purified polyclonal antibody against Nf XynIIA was used to detect heterologous forms of xylanase in Western blot.

Figure 4B shows the r33.4 kDa polypeptide (lane 3), r23.8 kDa polypeptide (lane 4) and r22.0 kDa polypeptide (lane 5) of purified native Nf Xyn11A (lane 2) and recombinant xylanase forms. samples run on an SDS polyacrylamide gel. The molecular weight markers (lane 1) are the same as in Figure 4A.

*! * "Figure 5A shows the temperature profiles of purified XynIIA xylanases at pH 5.

• · ·, ·; The effect of temperature was determined by incubating the reaction mixture at pH 5 and different temperatures for 60 minutes. The relative (%) activity is expressed as a percentage of the maximum activity at the optimum temperature. The relative activities at pH 6 (not shown) were similar to those obtained at pH 5.

• * · *: ***: 25 * · *

Figure 5B shows the temperature profiles of the purified XynIIA xylanases at pH 7.

•; *; The effect of temperature was determined by incubating the reaction mixture at pH 7 and different ·· * ·: ***. temperatures for 60 minutes. Relative (%) activity is expressed as a percentage · · · '. maximum activity at Optim temperature.

Figure 5C shows the temperature profiles of the purified XynIIA xylanases at pH 8.

The effect of temperature was determined by incubation of the reaction mixture at pH 8 and various temperatures of 1187770 for 60 minutes. The relative (%) activity is expressed as a percentage of the maximum activity at the optimum temperature.

Figure 6A shows the residual activity of the purified enzymes after incubation at 580C at pH 5. Thermostability was determined by incubating Xyn11A polypeptides at pH S in the absence of substrate for a period of 0, 15, 30, 45, 60, 75, 90 , 150 and 245 minutes, after which residual activities were measured at pH 7 and 70 ° C for 5 minutes.

Figure 6B shows the residual activity of the purified enzymes at 80 ° C at pH 7. Thermostability was determined by incubating XynIIA polypeptides at pH 7 in the absence of substrate for 0, 15, 30, 45, 60, 75, 90, 150 and 245 minutes, after which residual activities were measured at pH 7 and 70 ° C for 5 minutes.

15

Figure 7 shows the general structure of expression cassettes constructed to investigate the effect of truncation of the am35 gene on xylanase production levels in Trichoderma reesees.

Gene fusions were expressed from the ce / 7 / i promoter and transcription termination was confirmed using the ce / 7 / i terminator sequence. The carrier polypeptides used were encoded by either the * maw5.4 core / hinge sequence (M1-G410 in pALK1022, pALK1692, pALK1309; and; · · pALK1 in 131), the cel6A CBD sequence (Mi- Sge) in pALK1285 and pALK1502, or the ~ 5/4 sequence encoding a fragment from the man5A core (M1-V227 in pALK1264, pALK1151 and pALK1154). CBD block A encodes the tail and B *: * hinge region of the protein. In plasmids pALK1 118 and pALK1276 the xylanase gene was fused to the manSA signal sequence. Synthetic splice sequence encoding the Kex2-like protease cleavage signal (SEQ. : 18)) were included in all • Λ constructs to ensure cleavage of the fusion protein. Expression cassettes • M t. *** pALK1264, pALKl 131 and pALKl 134 also contained the additional sequence encoding Kex2- * ·· * GQCGG (SEQ ID NO: : 19): am. 35 and am35 * encoded • · "* 30 amino acids are D44-N344 (full length mature protein, Fig. 1) and amino acids encoded by truncated am35 / am354 (am24 and am24 * are D44-L263 (Fig. 1).

• M

am35 *: ss & and am24 * \ ss & nine codons have been modified as described in Example 10. ***! The encoded amino acid sequences are not affected by the changes. The awdS marker gene and the 118770 π cel7A 3 'flanking region (for targeting the expression cassette to the ce / Z4 locus by homologous recombination) were inserted into all constructs after the ce / 74 terminator sequence (similar to the expression cassette pALK945 shown in Figure 3).

S Figure 8 shows a sample of a culture supernatant of a Coomassie Blue-stained SDS polyacrylamide gel run on a culture of T reesei transformant producing NfXynIIA xylanase (AM24) truncated form. Cel6A CBD was used as the carrier polypeptide. The purified r23.8 and r22.0 kDa forms were run in parallel on the gel. The lanes; 1.

molecular weight marker (the molecular weight of the relevant marker proteins is 10 shown), culture supernatant 2 and 3 from the I reesei transformant producing truncated Xyn11A, 3. purified r22.0 kDa xylanase, S. purified r23.8 kDa xylanase.

Figure 9A shows an expression cassette for producing a truncated form of Nf Xyn10AAm, the Nf Xyn10A core, in T. reeseissH. The core contains the amino acids A45-N345 (Figure 2). The ce / Z4 promoter, cel6A signal ipeptide and cel7A terminator sequences (as in constructs pALK1285 and pALK1502, Fig. 7) have been used to generate Nf XynlOA. Cel6 CBD (A + B) (as in pALK1285 and pALK1502, Fig. 7) was used as the carrier polypeptide. The sequence encoding the Kex2 site (RDKR (SEQ ID NO: 18)) is inserted between the carrier and xylanase sequences. As with the constructs Nf *: **: 20 for production of Xyn11A, the a / ntiS marker and the cbhl3 'fragment are included.

• · 4 4 a • · · · * · 4 | j: Figure 9B shows an expression cassette for producing a truncated form of Nf Xyn10AAm:] **: Nf Xyn10A core / junction in I slices. The core / junction contains amino acids

·· * A4S-S367 (Figure 2). Other sequences (ce / 7H promoter, cel6A signal peptide, cel6A

···· 25 CBD coding sequence, ce / Z4 terminator, Kex2 coding sequence, amdS-444 marker and cbhl 3 'fragment) are as in the constructs of Figure 9A.

• 4 • · • a * ·· 4. ***. Figure 9C shows an expression cassette for producing full-length Nf XynlOAm in T rees.

4 ·· *. Full-length xylanase contains Nf XynlOA amino acids A45-A492 (full-length protein N- • · · • 4 ·

Hl 30 at the terminal end, Fig. 2). Other sequences (ce / 7 / ß promoter, cel6A • 4 4 * *; * signal peptide, cel6A CBD coding sequence, ce / Z / f terminator, Kex2 site 444

coding sequence, a / ndS marker and cbhl 3 'fragment) are as in Figure 9A

* in constructs.

12 118770

List of Nucleotide Sequence Numbers AJ508952 N. flexuosa DSM43186 Xytt / L-1 Nucleotide Sequence AJ508953 N Flex Part DSM43186 Xyn / Q ^ Nucleotide Sequence 5

Donor organisms:

Nonomuraea flexuosa DSM43186 (ATCC3 5864) General description of the invention

Abbreviations and nomenclature

Nf Nonomuraea flexuosa 15 xynlOA gene for family 10 xylanase

XynlOA protein for family 10 xylanase xynllA gene for family 11 xylanase

Xynl IA protein for family 11 xylanase CBM, CBD carbohydrate binding module / domain; *: '*: Substructure of 20 Carbohydrate Degrading Enzymes • · 1 /. : CBM carbohydrate binding module; : CBM is referred to as truncated carbohydrate-degrading enzymes ·· · · · CBD carbohydrate binding domain; φφφφ; * * * · 25 here designated CBD of the carrier protein domains • · ♦ cel7A (cbhl) cellobiohydrolase 1 gene in Trichoderma reesees | cel7B (egll) Trichoderma reesem endoglucanase 1 gene ··· e. * * *. ce! 6A (cbh2) Trichoderma reesem cellobiohydrolase 2 gene Φ ΦΦ *. cel5A (egl2) Trichoderma reesei endoglucanase 2 gene man φ Φ φ · φ 30 manSA Trichoderma reesei mannanase gene N · Φ $ "· Nf xynl IA N flexosa xylanase family of 11 ti · •, .. · Nf xynlOA N family, 11 φ 13 118770 am35 NfxynllA gene encoding the full-length form of mature Nf Xynl 1 A protein (amino acids D44-N344) am24 truncated form of NfxynllA encoding truncated form of Nf Xyn 11 A (amino acids D44-L263) 5 am351 am35, but including the following codon changes:

Gly53 GGG GGC, Ala ** GCG -1 GCC, Gly6g GGG -► GGC, Arg85 CGG -► CGC, Glygg GGG -> GGC, Gly100 GGA - »GGC, Argioi CGG - CGC, Argio2 CGG -> CGC and Val104 GT - ► GTC am241 am24, but with the same changes in codons as am351 The 10 am50 NfxynlOA gene encoding the full-length form of Nf XynlOA (amino acids A43-A4492) AM35 is the same as r33.4 kDa, see below, encoded by am35 and am351 AM24 Truncated form of AM3 5 encoded by am24 and am241 (amino acids D44-L263) 15 r33.4kDa full length recombinant NfXynl IA mature protein (amino acids D44-N344) r23.8 kDa truncated form of full length recombinant Nf Xin 1A V260) r22.0kDa truncated form of full length recombinant Nf Xynl IA protein *: ··: 20 (amino acids D44-N236) • j1; AM50 is a full-length recombinant Nf XynlOA mature protein (amino acids ··· · · 1 · A45-A492) encoded by am50.

· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

Information on carbohydrate-degrading enzymes, including cellulases, xylanases, mannanases, etc., can be found in Coutinho, P.M. & Henrissat, B. (1999) from the server • · · 1, · 1 ·, at Carbohydrate-Active Enzymes Internet: • · http://afinb.cnrs-mrs.fr/~cazv/CAZY/index.html.

• 1 1 • · 1 · ** · «• n • · ··· • · · · 1 · · 14 118770

General description of the invention Terminology

In the present invention, most of the terms have the same meaning as they generally have in the corresponding scientific fields. Some terms have been used in slightly different ways. For this reason, they are explained in more detail below.

The term "carbohydrate degrading (CD) enzyme" refers to a carbohydrate substrate active enzyme having a catalytic module and a carbohydrate binding module (CBM) separated by a linking region. The term "module" also uses the terms "domain" or "region". Bacterial carbohydrate-degrading enzymes can be obtained from a variety of bacterial strains, including actinomycete strains Nonomuraea, Thermomonospora, most notably Nonomuraea flexuosa or Thermomonospora fusca. The method appears to be applicable to enzymes obtained from other microorganisms such as xylanases from Chaetomium, most notably C. thermophilum, which is a filamentous fungus. Carbohydrate-degrading enzymes include cellulose and hemicellulose-degrading enzymes, especially certain certain mannan-degrading enzymes. Particularly useful are thermostable xylanases, including Nf XynlOA or NfXynl IA. Knowledge *:*; 20 carbohydrate-degrading enzymes and their structures can be found, for example, in: •: * · in Gilkes et al., Eur. J. Biochem., 202,367-377, 1991, Teeri, et al., J.

Biotech., 24, 169-176, 1992, Stälbrand, et al., Appl. Environ. Microbiol., 61, 1090-1097, * »· ·; ***; 1995, Tomme, et al., 1995, Enzymatic Degradation of Insoluble Polysaccharides (Saddler * ··· | & Penner, ed.), Cellulose-binding domains: classification and properties, pp. 142-163, ····. ***. 25 American Chemical Society, Washington. In most carbohydrate-degrading ·· * enzymes, CBM is located at the C-terminus of the molecule, but for some enzymes, such as T reesei Cel6 (CBHII) and Cel5A (EGII), the CBM is located at the · · · * ·· · N-terminus of the enzyme. . The invention, that is to say, achieving higher levels of production by removing the bacterial carbohydrate-degrading enzyme CBM or * · · ***** 30 parts thereof or CBM and the joint or part thereof, is believed to be successful even if the CBM is not located. ** at the C-terminus of the carbohydrate-degrading enzyme as shown: as an example of the invention.

··· * • · is 118770

The term "truncated form of a carbohydrate-degrading enzyme" means an enzyme, especially a bacterial-derived enzyme, for example, from an actinomycete strain that lacks part of the amino acid sequence. Typically, this means that the truncated form is partially or completely missing, or alternatively, the entire CBM and the joint area S are partially or completely missing. The truncated enzyme is expressed and secreted under the control of appropriate regulatory sequences, including promoters and signal sequences.

The term "DNA construct" refers to an expression or transformation construct. The DNA construct comprises at least a truncated DNA sequence which is bacterial and encodes a truncated form of said carbohydrate-degrading enzyme, preferably in combination with suitable control sequences which include at least a signal sequence derived from a filamentous fungus. The DNA construct contains at least the DNA sequences necessary for the shortened form of the desired carbohydrate-degrading enzyme to be properly expressed and secreted. The DNA constructs can be in two different forms, as an 1S expression cassette or as an expression plasmid.

As an expression plasmid, the DNA construct may further contain plasmid elements and reporter gene sequences for replication and selection in E. coli. Preferably, the expression cassette consists of DNA sequences essential for the expression and secretion of bacterial enzymes in filamentous fungi. The expression cassette does not contain:, ·. plasmid elements and reporter sequences. The selection marker can either be included

• · · S

I expression plasmid / cassette, or it can be separately transformed into the filamentous fungal host by the · · · * ·· ·, ··· co-transformation method. In other words, plasmid elements and reporter sequences are removed from expression plasmids to obtain expression cassettes for transformation.

· #! However, both forms may and preferably include sequences that allow for · locus-directed transformation in the filamentous fungal host. DNA kostruct. . can therefore be targeted to the selected locus in the host genome.

The term "regulatory sequences" refers to DNA sequences that control the expression and secretion of 30 carbohydrate-degrading enzymes of the structure defined above. The regulatory sequences used in the present invention are preferably · *** derived from filamentous fungi such as Aspergillus and Trichoderma, in particular Trichoderma ··· reesei.

The regulatory sequences comprise at least one signal sequence derived from a filamentous fungus, as well as at least one filamentous fungal promoter, including the powerful Trichoderma cel7A (cbhl) promoter. In a preferred embodiment of the invention, the truncated DNA sequence encoding the truncated form of the carbohydrate-degrading enzyme is fused to a reading frame with the DNA sequence encoding the carrier protein (polypeptide). The carrier protein is preferably encoded by DNA sequences which can be obtained and assembled from domains derived from the same or different filamentous fungi and which encode one or more preferentially intact domains of filamentous fungal secretory enzyme. The secreted enzymes used may comprise a core domain containing the active or catalytic site of the enzyme, and a substrate binding domain or a carbohydrate binding domain (CBD) linked in the hinge region, but the carrier protein may also be a secreted enzyme, filamentous fungal xylanases, for example, I reesei XYNI and XYNII. An intact CBD or CBD and joint can also be used to achieve a high level of yield. The different domains or regions of filamentous fungal enzymes derived from different filamentous fungi may be linked together in variable and arbitrary order. DNA sequences encoding regulatory sequences, including the carrier protein, can be constructed by combining DNA sequences from various filamentous fungal sources.

Most preferred combinations include a construct wherein the carrier protein is the Man5A core • · · "V and / or hinge region or Cel6A CBD (A, A + B or A + B + B '), where A means substrate • · «binding domain or tail; B represents a splice (hinge) region; and B 'represents • * a doubled splice (hinge) region. Said DNA polypeptide encoding DNA * *" * 25 sequences are preferably fused to cel7A (cbhl). ) It is possible to construct several other combinations The invention includes but is not limited to the following domains: Trichoderma CBDs from Cel6A (CBHII) and Cel5A (EGII) having · · CBD domain at their N-terminal end, xylanases Trichoderma (XYNI, XYNII) * · "* and Trichoderma CBDs from Cel7A (CBHI), Cel7B (EGI), CelolA (EGIV), Cel45 it ; tl of 30 (EGV) and Cel74 (EGVI) with CBD at their C-terminus, g / aA # · · (glucoamylase) k expected <5perg / V / Uu proteins / polypeptides and xynA. encoding. ···, Pe «/ c / 7 / ww proteins / polypeptides (Alcocer et al. Appl. Microbiol. Biotechnol., 60, 726- * ··· 732, 2003) and similar structures from other organisms.

* · 17 118770

Some other filamentous fungal secretory enzymes having suitable domains exist among the carrier polypeptides described in Gouka et al., Appl. Microbiol. Biotechnol., 47,1-11,1997.

In the present invention, the term "filamentous fungus" is used in a number of contexts, including the host organism and the donor organism of regulatory sequences. Preferred filamentous fungi, including any transformable filamentous fungi in which expression can be achieved, most preferably include, but are not limited to, Trichoderma, Aspergillus and Penicitlium strains. Particularly preferred host and donor organisms are Trichoderma reesei, Trichoderma longibrachiatum, Trichoderma viridae, Trichoderma koningii, Aspergillus niger, Aspergillus sp., Penicillium sp., Humicola sp., Including Humicola insolens, Chrysos sp. . and Emericella sp., etc.

By "increased level of production" is meant that the level of production of truncated enzyme of bacterial origin is higher than the level of full-length enzyme in the corresponding construct. In this case, the increase in yield is measured as the increase in activity (Table 4), since the increase in activity in this case is independent of the specific activity, as can be seen from the results shown in Table 1. It should be noted that the increase in efficiency or production level is defined as the xylanase activity from the medium obtained with isogenic single-copy transformants or host cells containing only one copy of the DNA construct in question. In addition, the isogenic ··· ·:. ·, Single copy is located in the same focus, for example the cf »A7 locus. Thus, • M ·. ···, it is unequivocally ruled out that the increase in the level of yield would be due to the generation of * ··· * multiple copies of the DNA constructs or differences in the integration site. The · · · ·, · · ·, · 25 transformants analyzed differ only in that the DNA constructs of the present invention comprise a truncated DNA sequence encoding a truncated form • · a full length carbohydrate-degrading enzyme, whereas the prior art * ♦ ·] ". * The DNA construct comprises a DNA sequence encoding the corresponding full-length enzyme.

• · * l * Similarly, income levels are based on unambiguous comparisons.

* · · 30 ··· • · · · ··· 1 • · • ♦ ··· * • ♦ 18 118770

Detailed Description of the Invention

The present invention demonstrates that carbohydrate-degrading (CD) enzymes produced in the host Trichoderma reesei, in particular bacterial enzymes, can have increased production levels S except by fusion strategies as described by Paloheimo, et al. Appl. Environ Microb., 69, 7073-7082, 2003, also using truncated DNA sequences derived from actinomycete strains, including Nonomuraea flexosa. Expression of said truncated DNA sequences increases yields of the desired truncated carbohydrate-degrading enzyme. The functions, including the specific activities of the truncated enzymes, are the same or similar to those obtained with the corresponding full-length enzyme. The formulations obtained by the process and constructs of the present invention are useful in industrial processes requiring high temperatures and pH values.

1S The following examples illustrate the invention in more detail.

Example 1

Methods for Analysis and Characterization of Proteins (Polypeptides) 20 a. Protein and Enzyme Assays: Protein concentrations in culture medium and purified enzyme samples were determined after TCA- · · · · · · · · · after precipitation by Lowry et al. (J. Biol. Chem., 193, 265-275, 1951) using the bovine serum albumin as the standard protein. During enzyme purification · (··· (25), proteins were monitored at 280 nm. Xylanase activity was determined using * · 1% (w / v) birch silyl (Roth No. 7,500, Roth, Karlsruhe, Germany) as substrate. 50 mM Mcllvaine citrate phosphate) (Enzyme Microb. Technol., 3: 53-157, 1992). For purification of the enzyme and determination of the specific activity of pure proteins, the assay was performed at pH 760-1C: Otherwise, as described in the captions, 0.1% BSA was added to the buffer to characterize the purified Xynl IA-··· polypeptides, except for the determination of thermostability performed without BSA.

··· ta «« # · 19 118770 b. Protein Electrophoresis Samples were run on 12% polyacrylamide plate gels containing 0.1% SDS in a Mini Protean II electrophoresis system (Bio-Rad Laboratories, Inc., S Hercules, Calif.). and stained with Coomassie Brilliant Blue R250. Detection of xylanase and xylanase polypeptides on Western blots was performed with polyclonal rabbit antibody made against Dfor, Ltd., against purified Nf XynIIA xylanase. (Oulu, Finland) and Protoblot AP System (Promega Corp., Madison, Wise.).

10 e. Production and Sequencing of Peptides

Purified fractions containing xylanase activity were subjected to trypsin digestion as described by Fagerstrom and Kalkkinen (Biotechnol. Appl. Biochem., 21, 223-231, IS 1995). Sequencing was performed by Edman digestion on a gas pulse liquid phase sequencer (Kalkkinen and Tilgmann, J. Protein Chem. 7, 242-243, 1988) and phenylthiohydantoin amino acids were analyzed in-line using small diameter reverse phase HPLC. For N-terminal sequencing, SDS-PAGE gels were blotted onto PVDF membrane and protein spots were directly exposed to Edman digestion as above. Sequencing was performed at the Institute of Biotechnology: (Helsinki, Finland). The C-termini of the purified recombinant polypeptides were determined on a Protein Analysis Center at the Karolinska Institutet (Stockholm, Sweden).

• · »• M« ·· 1 • o • · ··· d. pl estimation and molecular weight determination ···· ... 25 • 1 • a

P1 of purified xylanases was evaluated by chromatofocusing with 4 ml pre-packaged

•. Mono P HR 5/20 column (Amersham Biosciences) equilibrated at 75 mM

• · · "I.1 with Tris-CH3COOH (pH 9.5) and eluted with 10% Polyp Buffer 96 (Amersham * 11 Biosciences) in 75 mM Tris-CH3COOH (pH 6.3). The pH was determined by xylanase activity. 30 The molecular weights of the purified xylanases were determined by Bruker * «·

Biflex Reflector on a MALDI-TOF Mass Spectrometer (Bruker Daltonik GmbH, Bremen,. **).

• M

· 118770 20

Example 2

DNA techniques used to construct plasmids and strains

Conventional DNA techniques were used to construct plasmids, transform E. coli, and Southern blots (Sambrook, et al., Molecular Cloning, a laboratory manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Sring Harbor, 1989). Each enzyme and reagent kit were used according to their supplier's instructions. Enzymes for DNA modifications were purchased from Roche Diagnostics GmbH (Mannheim, Germany), New England Biolabs (Beverly, Mass.) And Finnzymes (Espoo, Finland). Qiagen columns (Qiagen GmbH, Hilden, Germany) or Magic Miniprep kits (Promega, Madison, Wise.) Were used for plasmid isolation. The oligonucleotides were either synthesized using the ABI 38IA DNA synthesizer or ordered from Sigma-Genosys. Sequencing reactions were analyzed using either an ABI 373A or ABI Prism ™ 310 Genetic Analyzer (Applied Biosystems, Foster City, Calif.).

Polymerase Chain Reactions (PCR) were performed using a PTC-100 Programmable Thermal Controller (MJ Research Inc, Watertown, Mass.). DNA fragments for subcloning and transformation were separated from low melting point agarose gels (BioWhittaker Molecular Application Inc., Rockland, Maine) by the freeze-thaw phenol method (Benson, BioTechniques, 2, 66-68, 1984) using β-agarase (New England Biolabs). or using the Qiaex II Gel Extraction kit (Qiagen GmbH).

• · • · «• ·« e · * ·; ., Genomic DNAs were isolated as described (Raeder and Broda, Lett Appl.

• · ·. ···, Microbiol., 1, 17–20, 1985). Digoxigenin-labeled (Roche Diagnostics GmbH) expression cassettes were used as probes for Southern blot hybridizations.

** "25 • ♦ • ·

Example 3. . Microbial strains, media and culture medium used for the construction of plasmids and plasmids were grown in Escherichia co // - XL1-Blue or -XL10-Gold strains ( Stratagene, La · ... · Jolla, Calif.) The main vectors used in plasmid constructs were pUC18 (EMBL-

; ***. database storage number L09136), pUC19 (L09137), pBluescript SK and pBuescript II

«· · • · 118770 21 KS + or KS- (Stratagene). All E. coli cultures were performed overnight at 37 ° C in Luria-Bertani medium supplemented with ampicillin (50 pg / ml).

Trichoderma reesei strains ALKO3620 and ALK04468 were used as transformation hosts.

5 T. reesei-ALYXft 620 is an endoglucanase II negative strain. It was constructed from the low-protease mutant strain ALKÖ2221 obtained from VTT-D-79125 (3) by UV mutagenesis (Mäntylä et al., Abstr. 2nd Eur Conf. Fungal Genetics, abstr.

B52, 1994), as follows. The endoglucanase 2 gene (CelSA or egl2, originally named eg / 3; (Saloheimo, et al., Gene 63, 11-21, 1988)) was replaced by a marker gene encoding phleomycin resistance, derived from Streptoalloteichus hindustanus, Sh ble ( Drocourt, et al., Nucleic Acids Res., 18, 4009, 1990).

A 3.3 kb BglII-Xba I fragment of plasmid pAN8-1 (Matheucci et al., Gene, 8, 103-106, 1995) containing the ble gene flanked by the Aspergillus nidulans gpd promoter and the ftpC terminator Ha was used. . Ce / 5/4 flanking sequences in the replacement cassette (5'-15 region 1.4 kb XhoI-SacI fragment about 2.2 kb upstream of ce / J1 gene and 3 'region 1.6 kb AvA1-SmaI fragment (about 0.2 kb after the end of the CelSA gene) was isolated from the eg / 3 λ clone (Saloheimo, et al., Gene, 63, 11-21, 1988). The replacement strategy was as described in (Suominen, et al., Mol, Gen. Genet., 241, 523-530, 1993). T reesei ALK04468 is an endoglucanase I and II negative strain. It

20 were constructed from the ALKO3620 strain by additionally replacing the endoglucanase 1 gene, cel7B

: (eg / 1 Penttila, et al., Gene, 45, 253-263, 1986), E. coli hygromycin B-: *: with a phosphotransferase gene, hph11a (Gritz, et al., Gene, 45, 179-188). , 1983) which gives: ***; resistance to hygromycin Brlle. The plasmid pRLMEx30 (Mach, et al., Curr.

· · ® ··· Genet., 25, 567-570, 1994), a 1.7 kb Notl-Nsil fragment with the ApA gene · ** 2525 expressed from the T reesei pyruvate kinase (pki) promoter and transcription is decided ·· »using ce / 6/4 terminator sequences. Plasmid pRLMEx30 was kindly provided by: Professor Christian P. Kubicek (Institut för Biochemische Technologie, TU Vienna, ··· ·. ***. Austria). The ce / 7A edge regions were as described in (Suominen, et al., 1993, Gen. Genet. 241, 523-530). Single-copy • · · · I "'30 substitutions of the cel5A and cel7B genes in T Reese / -ALKO3620 and -ALK04468 strains were confirmed by Southern blot analysis as described in Suominen, et al. , O Mol. Genet., 241, 523-530, 1993).

• · 22 118770 T. reesei strains were sporulated on PD agar slides (Potato Dextrose Broth, Difco, Detroit, Mis.) · Transformants were selected from Trichoderma minimal medium containing acetamide as a nitrogen source (Penttilä, et al., Gene, 61, 155- 164, 1987). Fungal mycelia for DNA isolation were obtained after culturing the strains for two days in Trichoderma-5 minimal medium containing 2% proteose peptone (Difco). A complex lactose-based cellulase-inducing medium (Joutsjoki, et al., Curr. Genet., 24, 223-228, 1993) was used for enzyme production in shake flasks and fermentations. Transformants were screened using 50 ml cultures, and for RNA isolation, the fungal mycelium was collected from 200 ml cultures. Shake flask cultures were grown for 7-10 days at 30 ° C, 250 rpm. Laboratory-scale fermenter cultures were run for 5 days in 1L Braun Biostat M fermentors (B. Braun).

Example 4

Cultivation of Nonomuraea flexosa for enzyme production

Nonomuraea </ 7exwosa-DSM43186 (ATCC35864) was cultured on plates made with oatmeal mineral medium (medium # 84, Deutsche Sammlung von Microorganismen und Cellkulturen GmbH Catalog of Strains, 1983) at 50 ° C. The sporulating colony was inoculated with XPYB medium, GPYB medium ·; ··: 20 (Greiner-Mei et al., Syst. Appl., Microbiol., 9, 97-109, 1987) supplemented with 0.5 Oat spelled xylan (Sigma X-0627, Sigma-Aldrich Corp., St. Louis, Mo.) Glucose · ♦ · e 1 · 2 3; instead, as described in Holtz et al. (Antonie Leeuwenhoek, 59, 1-7, 1991) and ··· · were incubated in a shaker flask for 2 or 3 days (250 rpm, 50-55 ° C), after which the ··· flask flask culture was used as inoculum for fermentation.

• · e · .1 · 1. 25 Laboratory-scale fermentor cultures were performed for 3 days at 50 ° C in 1 liter ·· ·

In Braun Biostat M fermentors (B. Braun, Melsungen AG, Melsungen, Germany), supra: in the medium described.

I · »· · · · · · · · · · ·

EXAMPLE 5 Heterologous Production of the Thermostable Nonomuraea flexuosa-XNUS Xylanase • 2 · • · · · · · · · · · 231 87770

The gene encoding NfXynllA (AM35) xylanase (am35 or NfxynllA, EMBL accession no. AJ508952) was isolated from the lambda ZAP Express® library produced from partially digested (5Ifl3A) and full fractionated Actinomadura (Nonomuraea) (Nonomuraea) ATCC35864) from chromosomal DNA as described in U.S. Patent No. 6,300,113. The nucleotide sequence and the deduced amino acid sequence of the gene are shown in Figure 1.

The recombinant Nf Xynl 1A-producing T reesei transformant strain ALK04396 was constructed by transforming the expression cassette pALK945 (Fig. 3) into the I reesei-ALKO3620-10 strain. The? / w35 gene is expressed from the c? g / g promoter fused to a polypeptide carrier encoded by the mo / g S-core / hinge sequence. Construction of the pALK945 plasmid and strain was performed as described (Paloheimo, et al., Appl. Environ. Microbiol., 69, 7073-7082, 2003).

15 T. reesei transformant strain ALK04396 was sporulated on Potato Dextrose Broth (PD) agaric surfaces (Difco, Detroit, Mis.) At 30 ° C. For enzyme production, a complex lactose-based cellulose-inducing medium was used in a laboratory-scale fermenter (Joutsjoki et al., Curr. Genet., 24, 223-228, 1993). Fermentations were performed for 5 days in 1L Braun Biostat M fermentors.

·: ··: 20 • · j In addition to the full-length protein, the medium of the recombinant T ree5e / -ALK04396 strain: # ϊ * ϊ was found to contain shorter forms of Xyn11A and small amounts of unprocessed Man5A-Xyn11A fusion protein in Western blot. ).

m • · · • * · ·: ***; EXAMPLE 6 Purification of N. flexuosa-XynIIA peptide and recombinant -XynIIA polypeptides

MS

. ***. Purification of the original NfXynIIA xylanase from N. flexuosa-OSMAl 186 strain

• M

*, medium and purification of recombinant XynIIA xylanases from T reesei-ALK04396- * · · · · · *** 30 strains were performed by combining ion exchange chromatography, HIC and gel filtration * * * ”as follows. The 1 L fermentation broth was centrifuged at 8,000 x g for 30 minutes at ··· 4 ° C. The supernatant was adjusted to pH 9.1 with 1 M NaOH and diluted with distilled water (until conductivity was 4 mS / cm). This sample was taken from DEAE Sepharose Fast Flow 24 118770 (Amersham Biosciences AB, Uppsala, Sweden) - ion exchanger (SR column, 5 x 15.5 cm diameter, 300 mL) equilibrated with 20 mM Na 2 HPO 4 (pH 9.1) using Fast Protein Liquid Chromatography (FPLC) (Amersham Biosciences) At 4. The flow rate was 20 mL / min The column was washed with 400 mL of 20 mM Na 2 HPO 4 (pH 9.1).

Flow-through proteins were collected in 100 mL fractions. Elution of the bound proteins from the DEAE column was accomplished by a linear gradient from 20 mM Na2HPO4 buffer (pH 9.1) to 20 mM Na2HPO4 buffer (pH 9.1) containing 0.5 M NaCl at a rate of 20 ml / min. for 5 minutes, 5 ml fractions were collected. Finally, the column was washed with 300 ml of 20 mM Na 2 HPO 4 buffer (pH 9.1) containing 0.5 M NaCl. Fraction xylanase activity was analyzed and protein purity was determined by SDS-PAGE and Western blots.

The effluent fractions containing xylanase activity were pooled (to a final volume of 500-600 ml) and adjusted to 2 M NaCl and taken up in Phenyl Sepharose 6.

On a Fast Flow (Amersham Biosciences) column (XR50 / 30 column, 5x11 cm, 215 mL) equilibrated with 40 mM Na 2 HPO 4 buffer (pH 9.1) containing 2 M NaCl. After washing with 400 mL of 40 mM Na 2 HPO 4 buffer (pH 9.1) containing 2 M NaCl, elution was performed at 20 mL / min with a two-step gradient. First, the proteins were separated: using a linear gradient (400 mL) of decreasing NaCl (2-0 M)

j., 40 mM Na 2 HPO 4 in buffer (pH 9.1). After washing with 200ml 40mM NajHPCV

• · * • aa a, ·· *. buffer (pH 9.1), the proteins were eluted with a growing gradient (600 mL) of 0-60% ethylene glycol in 40 mM Na 2 HPO 4 buffer (pH 9.1). Finally, the column was washed with 200 ml of 60% ethylene glycol in 40 mM Na 2 HPO 4 (pH 9.1). 10 ml fractions were collected and analyzed for xylanase activity and purity.

The combined H1C fractions containing xylanases of different molecular weights were concentrated in an Amicon ultrafiltration unit (Millipore Corp., Billerica, Mass.) Diaflo® a 30 (PM10 62 mm 10 PK). ) membrane, bounded at 10 kDa A concentrated sample (10 mL) of aaa was subjected to gel exclusion chromatography on a HiLoad 26/60 Superdex 75 prep, grade column a (2.6 x 61 cm, 320 mL) equilibrated with 40 mM Na 2 HPO 4 ( pH 9.1) containing aa aaaa 25 118770 0.1 M NaCl Elution was carried out with 400 ml of 40 mM Na 2 HPO 4 (pH 9.1) containing 0.1 MNaCl 6 ml: n fractions were analyzed for xylanase activity and purity.

On N. flexuosa medium, roughly half of the 5 xylanase activity loaded on a DEAE Sepharose FF column was detected in flow-through and half was bound to a DEAE column. In T reesei medium, xylanase activity was in the flow-through. Most of the native T. reesei proteins, e.g., cellulases, and the mannanase core / hinge region used as a fusion partner were bound to a DEAE column.

The flow-through fractions containing xylanase activity were pooled for HIC run. After the Phenyl Sepharose 6 FF column, three different forms were isolated from the recombinant Xyn11A xylanase (Figure 4B). The 37 kDa form (SDS-PAGE, lane 3) corresponds to the original Nf Xyn11a purified from N. flexuosa medium. Shorter forms had molecular weights of 30 kDa (lane 4) and 27 kDa (lane 5) by SDS-PAGE. These shorter forms eluted from the Phenyl Sepharose 6 FF column with OM NaCl, first in the 30 kDa form and 27 kDa in the following fractions. The 37 kDa polypeptide eluted at a concentration of 15-30% ethylene glycol. The 30 kDa xylanase was further purified using Superdex 75 gel filtration.

***** 20 Example 7 • »*: f Characterization of the Original XynllA Polypeptide and Recombinant XynllA Polypeptides • *: * It * j * Original Nf XynllA Polypeptide and Three Recombinant XynllA The molecular weights estimated from SDS-PAGE were significantly higher than those derived from the amino acid sequence or determined by mass spectrometry; The molecular weight of the original NfXynIIA: ***; was determined to be 32857 Da, corresponds to the calculated molecular weight of the mature enzyme · «· (32876 Da) and represents a full-length protein composed of a catalytic domain • · **! 30 and CBM separated by a linker. The molecular weight of recombinant full-length Xyn11a •» *! 'was 33429 Da, 572 Da higher than the original Nf Xynl 1A molecular weight * ... · and 553 Da higher than the calculated value for 30 kDa and 27 kDa polypeptides * ** *** molecular weights were determined to be 23769 Da and 21974 Da, respectively. Recombinants 26 118770

XynIIA polypeptides were named r33.4 kDa, r23.8kDa and r22.0 kDa polypeptides (Table 1) based on molecular weights determined by mass spectrometry. The N-terminus of all four polypeptides was DTTITQ (SEQ ID NO: 20), indicating a different C-terminal processing in the r23.8 kDa and r22.0 kDa polypeptides. The processing locations of the C-5 terminal are shown in Figure 1.

The specific activities of the Nf Xyn11 polypeptide and the recombinant Xyn11A polypeptides were similar on the birch silyl substrate (15568-17367 nkat / mg) (Table 1). Also, the full-length proteins, NfXynIIA and r33.4 kDa polypeptide, had very similar pI (8.5 vs. 8.6), but both differed from the calculated value in the amino acid sequence (7.9). The r23.8 kDa and r22.0 kDa polypeptides lacking CBMs had lower pIs (7.6 and 8.2 vs. 8.5-8.6) than full-length enzymes.

Example 8 Temperature and pH dependence of purified Xyn11A xylanases

The optimum pH and temperature of the xylanase activity was determined by incubating Xynl 1A samples at various pH values (pH 5-8) at 60-80 ° C for 60 minutes.

At both pH 5 (Figure 5A) and pH 6 (data not shown), maximal activity was achieved at 80 ° C and pH 7 at 70 ° C (Figure 5B). At all pHs ·. in the values, the original Nf Xynl IA was the most thermophilic. This was seen in particular at pH 8, ··· · · · · · · · · · · · · · · · · · · · ·, with the optimum of NfXynllA at 70 ° C and the recombinant Xyn11AA polypeptides

♦ ·· S

··· at 60 ° C (Figure 5C). The thermostability of the enzymes was determined in the absence of BSA. At 70 ° C, ·, ·, no decrease in enzyme activity was observed even after several hours of incubation.

| ·· *% 25 At 80 ° C, the reduction was dependent on pH and enzyme form. At pH 5, the r22.0 • · kDa and r23.8 kDA polypeptides were more stable (123 minutes and 157 minutes. half-life) than the full-length XynllA polypeptides r33.4kDa and Nf Xynl IA (13 ♦ · · “*, * minutes and 32 minutes half-life) (Figure 6, Table 1). Enzymes behaved similarly at pH 7, albeit at shorter half-lives, 63-95 30 minutes for r22.0 kDa and r23.8 kDa polypeptides and 17-31 minutes for full-length polypeptides. for enzymes.

··· ♦ «• ♦ ··· ···.! Example 9 • «27 118770

Bleaching Assays Using Purified XynIIA Forms Using N. flexuosa Growth Medium, Purified Original XynIIA and T Recombinant XynIIA Polypeptides produced in Theses were tested in single-step peroxide bleaching on a Finnish softwood kraft pulp of 29% oxygen and 35% ISO %) at a dose of 100 nkat / g pulp solids, N. flexuosa supernatant also 50 nkat / ml). T. reesei medium was added to the pure enzymes to stabilize the enzymes. The amount of medium corresponded to the ratio of thermoxylanase activity to total protein in the original recombinant T. reesei -10 medium used for enzyme purification. After these additions, the mixtures resembled enzyme preparations used for real industrial applications. The pulp treatments were carried out at a consistency of 3% at 80 ° C and pH 8 for one hour. The reference mass was treated in the same manner without addition of enzyme. After the enzyme treatments, the pulp was washed with distilled water.

Chelation was performed by adding EDTA to 0.2% per dry solids and was carried out at 3.0% consistency at pH 5 for one hour. The pulp was bleached at 10% consistency at 80 ° C for 3 hours (H2O2 3%, NaOH 3%, diethylenetriamine pentaacetic acid 0.2%, MgSO4 0.5% v / v), then acidified with H2SO4, washed with distilled water and prepared paper hand sheets.

·: * ··: 20 • * • J: Chelating mass reducing sugars were analyzed by the dinitrosalicylic acid method.

! E · *! The quality of the bleached and washed pulps was analyzed by determining the kappa number TAPPI Test

Method T 236 and viscosity SCAN28 Scandinavian method

• M

···. The brightness of the handsheets was analyzed according to ISO 2470. Peroxide ····: *** · 25 consumption was determined by titration.

• t ί. *. In a one-step peroxide bleaching test performed on N. flexuosa medium,

* 1 «S

. ** ·. lignin depletion was achieved (¢ 0.7-1.1 cup units depending on enzyme dose), and *. increase in brightness (1.0-1.1 ISO units) without loss of pulp strength as determined by viscosity (Table 2). T. reesei medium increased the brightness by 0.9 • · ISO. With purified recombinant Xyn1 ΙΑ polypeptides, with r33.4 kDa and r22.0 ··· kDa - r22.0 kDa polypeptide being ineffective (Table 2), the increase in time yield ** "is still 1.1-1.6 ISO units .

28 118770

Example 10

Construction of expression cassettes for beterological production of NfXynllA (AM35) and truncated NfXynllA (AM24) in T. Theses, 5

To produce NfXynIIA (AM35) and truncated NfXynIIA (AM24), several expression cassettes were constructed which contained either the fungal signal sequence or the fungal signal sequence and the variable carrier polypeptides for these two proteins.

The am35 / am35 * (see below) and am24 / am24 * (see below) genes were expressed from the T. reesei-cel7A-10 promoter. The constructed expression cassettes are listed in Table 3 and their general structure is shown in Figure 6. Table 3 also contains other pertinent information about the constructs. The promoter, the transcription terminator, and the 3 'flanking sequences are similar to those described in (Karhunen, et al., Mol. Gen. Genet., 241, 515-522, 1993). The acetamidase coding gene (amdS) was used as a marker in transformations.

The 15 amdS gene was isolated from p3SR2 (Kelly and Hynes, EMBO J., 4, 75-479, 1985).

The 3.1 kb SpeI-XbaI fragment was ligated between the ce / T1 terminator and the 3 'flanking region.

In addition to the two genes, am35 and am25, using the original codons, some of the constructs underwent the following 9 changes to the codons (see Table 3) to make the codons more favorable T reeseiUe: Glys3 GGG -> GGC, Αΐβββ GCG --► GCC, Glyes' ί ** ί 20 GGG - »GGC, Arggj CGG - * CGC, Glygg GGG --► GGC, Glyioo GGA -» GGC, Argioi jj *: CGG --► CGC, Argio2 CGG -> CGC and Valio4 GTG - ► GTC. Genes containing the above described changes were named am3 5 * and am24 * The changes made did not change the amino acid sequence encoded by the genes compared to am35 and am24.

«· * • il • •• f · * '*; 25 When producing full-length N. flexuosa-XynllA, the am3S and am35 * genes were contained in ··· expression cassettes either as a 1.3 kb fragment terminated at the Mul site after about 250 bps • STOP codon, or as a precise am35 fusion c ^ AZ-terminator. Abbreviated ··· m. ***. The am24 and am24 * genes ended at nucleotide 1091 (Fig. 1) and were fused to M M exactly to the cAAZ terminator containing the STOP codon. All genes were fused to the 30 coding sequence for the N-terminal Aspei (from nucleotide 432, Figure 1), to the man5A • · · signal sequence (pALK1118 and pALK1276, / nano-Nucleotides 1-57), or ··· · ·. ”· Which encodes a carrier polypeptide. The carrier polypeptide sequences contained the manSA-***** core / hinge coding sequence (pALK1022, pALK1309, pALK1131 and pALK1692, 29118770-1-1359), man5A core fragment (pALK1264, pALK1151, and pALK1154, pALK1154 and pALK1154). / hinge (blocks A and B in pALK1285 and pALK1502, 1-306). for the manJji sequence, see p. Stälbrand, et al., (Appl. Environ. Microbiol, 61, 1090-1097, 1995). for the ce / 6 / l sequence, see FIG. (Teeri, et al., Gene, 51, 43-52, 1987). A synthetic sequence encoding the dipeptide Lys-Arg, a Kex2-like protease target (Calmels, et al., J. Biotechnol, 17, 51-66, 1991) was inserted into junctions in all constructs containing the carrier protein, (pK12 in signal sequence) and pK12 in the signal sequence constructs. . In addition, junctions of pALK1264, pALK1151 and pALK1154 were preceded by the sequence encoding the amino acids Gly-Gln-Cys-Gly-Gly (SEQ ID NO: 22). These additional sequences were included to increase the length of the junction between the defective carrier and the recombinant xylanase. An identical sequence naturally occurring in the MmJyt polypeptide precedes the xylanase sequence in pALK1022.

Precise fusions between the ce / Z ^ promoter and the signal sequences, carrier, junction, xyn I / j sequences, and terminator were synthesized by PCR. To facilitate construction of the fusions, the jwrwI recognition site (TCGCGA (SEQ ID NO: 24)) was included in the Kex2 junction encoded by the sequence fCGC GAC AAG CGC (SEQ ID NO: 25). The CGC codon was selected for the arginines in the junction and the third nucleotide of the pre-junction original codon was changed to T, if necessary. The transformations made did not alter the amino acids encoded by the f '· *' · 20 constructs.

(Example 11 ···! I) (Transformation of Trichoderma and analysis of transformants)

• M

··· * 25 T. reesei prototoplasts were transformed with linear expression cassettes isolated from the main vectors with EcoRL. Expression cassettes were transformed into T. reesei strain ALKO3620 • ** · (CeI5A ~) and / or ALK04468 (Cel5A ′, Cel7B "), see Table 4. Transformations were performed as ·· # · *" * · as in Penttilä, et al. (Gene, 61, 155-164, 1987) with the modifications of

• M

described by Karhunen, et al. (Mol. Gen. Genet., 241, 515-522, 1993).

Transformants were purified on screening dishes through individual spores prior to them

'S

'Γ sporulation with PD. Targeting to the ce / Z1 locus was screened for the Ce / 74 negative phenotype using a Minifold I-SRC 96 dot blotter (Schleicher & Schuell, Dassel, "** · Germany). Monoclonal antibody CI-258 or CI-261 (Aho , et al., Eur. J. Biochem., 30, 118770, 200, 643-649, 1991) were used to detect Cel7A in the ProtoBlot Western blot AP system (Promega) .The genotypes of selected transformants were confirmed using Southern blots containing multiple genomic digests, and strains containing the replacement of cel7A by one copy of the expression cassette were selected for further studies.

Example 12 Production of AM35 and AM24 Xylanases by Single-copy T. reesei Transformants

We have previously shown (Paloheimo, et al., Appl. Environ. Microbiol., 69, 7073-7082, 2003) that when using a carrier polypeptide with an intact domain structure, higher levels of AM35 production were obtained in T. reese than with or without the construct. carrier whose domain structure was not intact. The recombinant AM35-15 proteins also had the same thermostability as the xylanase activity in the supernatant of the N. flexuosa culture. Xylanase activities were stable for at least two hours at 70 ° C at pH 7. Also, culture supernatants, as well as culture supernatant from N. flexuosa, were found to increase pulp brightness in kraft pulp laboratory peroxide at high temperature and * ϊ ”ϊ 20.

The expression cassettes now contained either the am35 / am351 gene, which encodes the full length.

Ml ί | ((ί XynllArta, or a truncated version thereof, the am24 / am242 gene encoding the truncated "| j1 XynllA protein. Both of these proteins were produced using three different carrier polypeptides and with no carrier polypeptide included). The carriers had either an intact domain structure, such as the Man5A • · · · core / hinge or Cel6A CBD / hinge, or an incomplete domain structure, such as the ··· · · 3. Man5A core / hinge fragment.

IM

· I

The expression cassettes shown in Table 3 (Figure 6) were isolated from expression plasmids and the 3S 9 * 1 'transformed into T ree.se/-ALKO3620 and / or -ALK04468. Transformants who

IM

*, <t1 contained single copy replication of the cel7A gene in expression cassettes, were screened for further analysis. The amount of culture supernatant proteins from the fermenter cultures and 5 xylanase activity were analyzed (Table 4).

Results from fermenter cultures (Table 4) showed that the best xylanase activities were obtained from T. reesei transformants, including constructs using truncated am24 or am241 genes. An increase in 10 xylanase activity was also observed in all carriers tested even when the carrier protein was not present (e.g., RF5024 vs. RF5724, RF5725 vs. ALKO4405, RF5139 vs. RF5013, RF4861 vs.

ALK04823). Modifications made to the codons had no effect on the level of xylanase production (ALKO4405 vs. RF5510 and RF4861 vs. RF4878). Similar levels of activity were also obtained from a transformant containing a construct in which the xylanase gene was fused exactly to the terminator sequence compared to a transformant containing a construct in which the xylanase gene was fused to the terminator (RFS74S vs.

ALKO5505). A similar level of activity was obtained when, for some unknown reason, the total protein level of the RF5745 culture supernatant containing the exact terminator fusion was lower than that of the corresponding transformant having an inaccurate *** 20 terminator fusion. Both used T. reesei host strains transformed with the same expression cassette produced the same amount of activity 1. · '(RF5725 vs. ALK04812).

* ·· * · * · ··· ,,) · 1 Because the specific activities of AM35 and AM24 are very similar! # Ίιί 25 compared to each other (Table 1, r33.4 and r23.8 kDa), one can conclude that truncation of the IVo «o» H / roeo xylanase gene increases the level of xylanase production in I reesees.

j ϊ * ί When carriers with an intact domain structure (Man5A core / hinge and: ***; Cel6A CBD / hinge) were used, xylanase activity levels measured in culture supernatants were more than three times higher compared to constructs producing AM24 * **** (··· (30 for the corresponding constructs for AM35; for constructs that did not contain the · · * "carrier polypeptide or the carrier was a Man5A fragment (intact domain construct), * · * ··· 1 xylanase activity increase) the culture supernatant was even larger, more than 5-10-1 fold, so even without a carrier or using a carrier with a non-optimal structure of 32118770, the yield of bacterial xylanase could be surprisingly high when expressing the truncated xylanase gene in T reese.

Increased levels of xylanase activity were also observed in shake flask cultures. When no polypeptide carrier was used, the increase in xylanase activity (RFS024 versus RF5724) was about 2.8-fold and reached a level of 4,900 nkat / ml. When the Man5A core / hinge was used as a carrier (RF5725 compared to ALKO4405), the activity increase was about 2.7-fold (RF5725 produced about 21,000 nkat / ml). Using the CelöA CBD carrier (RF5139 vs. RF5013), the increase in activity was even greater, about 10 to 5.6-fold. This large increase was due to the low activity in the shake flasks of strains that produced AM35 with the Cel6A CBD carrier polypeptide (e.g., RF5013 produced about 3000 nkat / ml, and activity from RF5139 cultures was approximately 16,800 nkat / ml).

IS Figure 8 shows the AM24 xylanase product from T reesei transformant (used

CelÖA CBD carrier). In addition to the protein having the expected molecular weight, a lower molecular weight xylanase form (corresponding to r22.0 kDa) can also be detected in the culture supernatant. This form is due to the proteolytic cleavage of AM24.

*! **: 20 ·. · · Example 13 a I! ! Use of T. reesei culture supernatants containing recombinant truncated I * ': Nf XynllA (AM24) xylanase in bleaching ··· a ····: *' * j from recombinant truncated XynllA (AM24) producing I reesei -

• U

the culture supernatant from the transformant was tested on kraft pulp bleaching • · *; (Nordic birch and pine). The results obtained are shown in Tables 5 and 6.

• M «· ***. In both bleaching experiments, the same degree of brightness was obtained with a lower consumption of ClC> 2, # ·· * when using AM24, compared to the reference bleaching without treatment with • «· * · ♦ 30 xylanase.

• * • · · «·

Example 14 • »33 118770

Use of T. reesei culture supernatants containing recombinant AM24 xylanase in feed applications

Two feed trials of AM24 xylanase preparation in broilers were performed. The results of the experiments 5 showed a beneficial effect of AM24 on the eagle. Body weight increased by 3.4% on wheat and barley diets and 3.1-3.7% on wheat and soybean diets compared to control birds not receiving enzyme supplementation. Also, the digestibility of the food had significantly increased in terms of feed utilization rate. The AM24 xylanase preparation was at least as effective as T reesei-XYNII (XYLII) used in animal nutrition for many years. The advantage of AM24-xylanase is its high heat resistance compared to, for example, T, reesei-ΧΥΉΐΙ (XYLII), which is a great improvement on many feed production methods.

Example 15 Production of NfXynlOA (AM50) and two truncated forms of NfXynlOA in T. Theses

The gene encoding NfXynlOA (AM50) xylanase (am50 or NfXynlOA ·, EMBL Accession No. AJ508953) was isolated from the lambda ZAP Express ® library produced by ·; * ·· 20 partially digested (SauiA) and full fractionated Actinomadura ( flexuosa • · *; -DSM43186 (ATCC35864) chromosomal DNA as described in a · * · Ϊ. *. US 6,300,113. The nucleotide sequence of the gene and the deduced amino acid sequence are shown. ·, 25, a kernel (A45-N145) and a kernel / junction lacking all three ··· * subdomains of the tail (A45-S367) · Constructs encoding; Xyn10A polypeptides lacking only the tail γ subdomain or the γ and β subdomains.

, ··· [Estimated molecular weights of the various polypeptides would be (from the N-terminal A45, • · * · * without any added sugar moieties): 34.0 kDa core, 35.9 kDa core junction, · · * · '”· * 30 α subdomain 40.6 kDa, α-β subdomains of core-tongue 44.8 kDa, α-β + γ subdomains of * ·· * ... * tail (full length mature protein) 49.1 kDa. Conventional: ***: Molecular Biology Methods, PCR Reactions, and Oligonucleotide Heat Treatment ·; ··· To make precise fusions between the various sequences encoding the cAW promoter, the ce / divo signal sequence, and the cDNA ( A + B), Kex2 site (RDKR), a sequence encoding NfxynlOA-.Xa (core or core / hinge or full length protein) and cAA / terminator. Restriction sites at the end and beginning of the fragments to be fused are included in the oligonucleotides to facilitate construction of the fusions. Finally, the am ö f marker marker gene and the cAA / -3′ flanking region are included as in constructs made to express the am35 / am24 genes. Expression cassettes are isolated from the parent vectors using Eco RI digestion and transformed into a T. reesei host strain. Transformants are transformed, processed and selected using the same methods as for constructing strains that produce NfXynIIA: transformants are purified through single spores and screened in shake flask cultures by measuring xylanase activity in culture supernatants. Single copy transformants are selected in which the expression cassette replaces cAAMocus based on results from xylanase production level and Southern genome blot analysis. Increases in xylanase production from strains producing truncated forms of Nf XynlOA compared to strains producing full length NfXyn10A are demonstrated using activity assays, SDS-PAGE and Western blotting.

Application tests use culture supernatant (s) for both bleaching of kraft pulp and feed applications to demonstrate the effect of xylanase (s).

f • 1 • · · · · · · · · · · · · · · · · · · · · · · · · · · · ···

• • M

• · • · ··· •••••••••••

• M

♦ · · * · ·

Ml M · • · • ·

Ml ·· ♦ • · • ♦ ··· · 35 1 1 8770 Λ a. * 1 s ϊ 5 ^ .5 r- »n m iärTö <Λ H φ Ό .S £ s

153 O

Ί30

Ph I ^

'3K

1 ^ 1 a s K S

1p s «- - 34 O U O 00 • o £

S

S

.2 _ m vo vo rs * 5j * 2 λ * λ * 2 Λ 00 00 Γ "- 00 0

S 4% 00 »n r-- O

S to JS VO Q VO VO

S jJ ^ «O O m ON

5 §3 S «« vo r- vo

Ci <CL · 'S' —1 * -1 1—1 1 * Ä 0 11 g g g ί li £ E S £

X v Q Q Q Q

1 z

• I

** · * · a h

* * S S

. .. S> ο. σν ί * oo o:. :: o £ g ci m m es,,> »5S5 tn ro es es

• · · v CO

• · · feSj ::. *. «S • * * ·: · S«

5 O

1 S, S S t- t- o f- ··· m ζ | i γλ m tn m

Jj 2 m z 9 ^ ζ / \

• · S

: ** 3. ** ·. 3

'*: · * «-S

. . .a e • · · H r »• ·· IT >> • * Fn CÄ ... · 3 -g:: ** S, §

• P M S

:. · ·. K Ö <S rt 5! ·: 1 «S i 9 9 9 ·: ··! 3 e g> »oo o

Ξ o Π {Ί N

3 2-¾ <2 a a H Z oi 23 36 1 1 8770 Ί 3 ϊ. 1 8. j3 ä * S '·? q q Ω ^^^

2 '-a C- 2 ä <N ci rl ri {N

'' S

<-g ^ &

β CU

!? .S e • fill

| g J

.5 ti g Λ λ Λ o »- · O« Λ * Λ 1 f & B S θ ^ «Τ. ** 1 <Ί <Η S S. £ οοοοο Οοο 3 I ^ 3 ϊ ί t 59 '3

'S

* 5 * SS t- -k 3 S φ S -¾1¾ o o o n n n o

s "o-> ~~ σ \ t" öcctJK

o. SS oo oo oo

rt o3 S

. «M 'S ** 1' _rt ϊ> {Λ ....: s • ·« J 4 · 4 ® cö • ίϊ K ö * m σ \ o oo Γ «cn r- .. rt oo r— σν oo oo oo on oo • · · 1 w »· * · rt

. ·· *. S cd O

* · *: * S 8 - | ... *: * ^ a 't ^ e- ° i .-. * 15 e. O «v ϊ ¥ ΐ | I l g | a P P P ®l δ 2 st |> S 3 S 3 s: *. «A g .s S) ^ | "S * A 11: ·.: S s a« 3 a o. *: £ -a ig t§ o o ···. P § s ιλ -

! ϊ M 5 ^ 3 a S

*: · O aa g g g .. ·. s M * g li • H 3 1 111 9 3 9 14 il $ I Ί 4 1 s s s s 1 il 37 1 1 8770

S

a ee ca e

/ '' "N V

md mm

o O O S

O o O O

t {N {N «N« S

w · '- * n_ »· 2 lllllllllllll i 1 -a 11 II 11111 S« 1

: «A o E 5 fi g g, 2 S o S E

S> ^ Η ^ ΗΗΗΡηΗΡ ^ ΗΗ i

? I

* 2 5 rt rt rt rt rt s δ f i% i! & 1 f 1% i 1

V

a • m * a

V

9) no

V

> o m »i m i i

H V

S f «a a n • S S * * * * ····· 2; <3 ιλ> Όιλιλι> ιλ> Ό>, ϊ ·

.. & tfSSSSSSSSSSS

: j: a X aöQ <3aa «asa« ·· * · • · C3 • * * vs

»·· I S

··· 2 *** J 1o 'Tn * ϊ * * £> -¾ rt rt «« S -, -, _

* ::: s * s i ΐ I 1 I I I i 1 i 'S

si f | i || iigg lii: ·. il # Ι51θθ | 33 • g · 355 <Λν> ν, »Λ <. <. ιο> / ->« ο: · ": 1 3 ΛλΘ83Θ ^! || · 8Θ;: · I ä ms 2 sss ΰ ö sss • · s, • a »^ • · <,.

·· ·: i «« * ·· e t * • H «··· M 2 ΟΟΌΝΜφΗΐηΜ ^" ^ ϊ · * Π g. * JX -ΝΟΌ ^ μΝΙΛΜήη

_ lTH t 1- ^ Ψ ** 1- * l-H i-H i-H

i I 5393113 ^ 33 P M aap.p.p.a & aaac.

38 1 1 8770

Table 4. Production of xylanase by single-copy Trichoderma reesei transformants in laboratory-scale fermentations.

Expression Xylanase

Kanta_kasetti_T. reesei host Prot. (mg / ml) _ (nkat / ml) 1. T. reesei host strains ALKO3620 No cassette 14.4 1490 ALK04468 No cassette 9.3 430 2. No carrier (Man5a signal sequence): ALK04766 pALK1118 ALK04468 8.8 2,460 RF5724 pALK1118 ALKO3620 11.3 3 870 RF5024 pALK1276 ALKO3620 7.7 31 830 3. Man5A core / hinge carrier ALKO4405 pALK1022 ALKO3620 12.3 14 400 RF5745 pALK1692 ALKO3620 4.3 13 800 RF5510 pALK1309 ALKO3620 11.9 14 600 RF5725 pALK1131 1,45,940. ALK04812 pALKl 131 ALK04468 12.3 42 980 • ·: 4. Cel6A CBD (A + B) as carrier ··· i • RF5013 pALKl 285 ALKO3620 7.5 10 750 RF5139 pALKl 502 ALKO3620 8.8 37 140 • · ·· * > t * i * 5. Man5A fragment as carrier ALK04823 pALK1264 ALK04468 8.8 4,940 RF4861 pALKl 151 ALKO3620 7.8 26,400 RF4878 pALKl 154 ALKO3620 9.8 29,600 • · · * · · «M • · • * • aa • · · · · * * * • O O 1 1 39 39 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 39 1 1 8770

Table 5. Termoxylanase in Industrial Birch Kraft Bleaching The sequence used was X / D-EO-D, the original birch kraft pulp used (measured by hand) was 14.4 and the brightness was 44.1%. The activity of the enzyme preparation used was 187,000 nkat / ml (measured at pH 7.70 ° C for 5 min reaction time). ND = not specified. All pH values were measured from the stock slurry at the reaction temperature. Before the sheet was made, the pulp samples were acidified to pH 4.5 with water to remove residual chemicals. The pulp properties were measured according to ISO standard methods: brightness ISO 2470 (split pulp sheet), kappa number ISO 302.

Bleaching No. 1717 1718 1719 1720 1721 _Verified_ X-Phase Enzyme

Consistency8% Enzyme dose, 1 / t no 0.3 0.15 0.3 0.15 Temperatures. 82 ° C H 2 SO 4, kg / tp (for pH adjustment) 6.9 7.3 7.3 9.9 9.9

Time 20 min pH start / end_7.0 / 7.6 7.0 / 7.9 7.0 / 7.9 6.0 / 6.3 6.0 / 6.3 ____ no wash after enzyme treatment D0 step

Consistency9% C102 dose, aCl kg / tp 47.0 41.0 41.0 41.0 41.0 Temp. 70 ° C C102 consumption, aCl kg / tp 47.0 41.0 41.0 41.0 41.0

Time 30 min End-pH__2j6_10_2j4_2.5 (EO) Step NaOH Dose, kg / hr 21.0 21.0 21.0 21.0 21.0

Consistency 10% Final pH 10.3 10.2 10.3 10.3 10.3 Temperatures. 85 ° C Brightness,% 79.3 79.1 78.9 80.3 79.6 h * Time 60 min Track number 2.5 2.5 2.9 2.4 2.6: 4 bar 02 XD (EO) yield,% _93.4 93.2 93.9 91.3 92.5 ·: D2-step C102 dose, aCl kg / tp 17.0 15.0 15.0 14.0 14.5

Consistency 9% C102 Consumption, aCl kg / tp 15.6 14.4 14.4 13.2 13.2 Temp. 75 ° C NaOH kg / tp (for pH adjustment) 2.5 2.2 2.2 2.1 2.1 * · "Time 110 min End pH 4.3 4.6 4.6 4.3 4 , 3

Lightness,% 90.1 90.2 90.1 90.7 90.3

Number of pieces 0.6 0.6 ND ND ND

D2 Yield,% 98.7 98.6 97.8 99.0 98.5 • Total Bleaching Yield,% 92.2 91.9 91.8 90.4 91.1

Kokko. C102 dose, aCl kg / tp 64.0 56.0 56.0 55.0 55.5 • t Kokon. C102 consumption, aCl kg / t 62.6 55.4 55.4 54.2 54.2

Kokko. NaOH kg / tp 23.5 23.2 23.2 23.1 23.1. ** ·. Kokko. H2S04, kg / tp 6.9 7.3 7.3 9.9 9.9 »* · • ___ • I * • i • t M» • · 118770 40

Table 6. Thermoxylanase in bleaching of softwood kraft pulp. The sequence used was X / D-E-D-E-D. The original mass had a Body Number of 28.9 (measured by hand sheet), a brightness of 28.2%, and a viscosity of 1180 ml / g. The activity of the enzyme preparation used was 187,000 nkat / ml (measured at pH 7.70 ° C for 5 min reaction time). ND = not done. All pH values were measured from the stock slurry at the reaction temperature. Prior to the weekday, pulp samples were acidified to pH 4 with SSO2 water to remove residual chemicals. The pulp properties were measured according to ISO standard methods: brightness ISO 2470 (split pulp sheet), kappa number ISO 302, viscosity ISO 5351/1.

Bleaching No. 1627 1692 1698 __Value X Phase Enzyme

Consistency 8% Enzyme dose, 1 / t no 0.3 0.3 Temp. 70 ° C H 2 SO 4, kg / tp (for pH adjustment) 2.7 2.7 2.7

Time 60 min pH start / end_7.0 / 7.4 7.0 / 7.3 7.0 / 7.3 D0 phase

Consistency 9% C102 dose, aCl kg / tp 60.0 54.0 54.0 Temp. 50 ° C CIO 2 Consumption, aCl kg / tp 60.0 54.0 54.0 • Time 45 min End-pH_ 1.7_L9_1.9 • · · ··· *: E1-phase dose of NaOH, kg / t 27, 0 27.0 27.0; *** · Consistency 10% End pH 10.9 11.1 11.1 Temp. 60 ° C Lightness,% 49.5 49.6 49.4. · * ·, Time 60 min Kappaluku_64_6j2_6.5 • · ·

D1 Step C102 Dose, aCl kg / tp 24.5 20.0 20.0: Consistency 10% C102 Consumption, aCl kg / tp 24.5 19.8 20.0 O Temp. 70 ° C NaOH kg / tp (for pH adjustment) 3.4 3.0 2.7, · Time 240 min End pH 3.6 4.2 4.1

Brightness,% 78.9 ND 77.2

** "* _Count_L__ND_ND

··· • · • »· * · • * 41 118770 E2 phase NaOH dose, kg / t 8.0 8.0 8.0

Consistency 10% End pH 10.6 10.6 10.6

Temp. 70 ° C Brightness,% ND 77.5 ND

Time 60 min Track number_ND_L5_ND

D2-Stage C102 dose, aCl kg / tp 9.0 8.0 9.5

Consistency 10% CIO2 consumption, aCl kg / tp 7.9 7.6 9.3 Temp. 70 ° C NaOH kg / tp (for pH adjustment) 1.1 0.9 1.1

Time 240 min End pH 4.6 4.4 4.2

Lightness,% 90.0 89.4 89.9

Part number 0.7 0.7 0.6 Viscosity ml / g_1030.0_ND_1050.0

Kokko. C102, aCl kg / tp 93.5 82.0 83.5

Kokko. NaOH kg / tp 39.5 38.9 38.8

Kokko. H2SO4, kg / tp 2.7 2.7 2.7 * a * · • a · • · 1 tea · • · * 1 · • · 1 tae · ·· 1 * · • a a1 · a • a «a aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

Claims (30)

A recombination DNA method for achieving a higher level of production of a carbohydrate digesting bacterial enzyme in a sponge host, wherein in its original full-length form it has a structure consisting of a catalytic module and a carbohydrate binding module (CBM). , which are separated by a linker region, characterized in that a DNA construct comprising regulatory regulatory sequences and an abbreviated DNA sequence encoding an abbreviated form of said carbohydrate cleavage bacterial enzyme is transmitted to the canopy. contains the catalytic module but which completely or partially lacks CBM, or CBM in whole and the linker region, in whole or in part, and allows the DNA construct to express and secrete said abbreviated carbohydrate digesting bacterial enzyme under the control of said regulatory sequences derived from the sponge fungus; which comprises a promoter derived from the sponge sequence, a signal sequence joined to a carrier sequence or without a carrier sequence, and a terminator sequence; and wherein the higher level of production, measured as an increase in activity of single copy transformants obtained by the said DNA construct, which encodes the abbreviated form of carbohydrate digesting bacterial enzyme, is higher than the level of production obtained. with another corresponding DNA construct similar to the said DNA construct, except that it comprises • φ * • · * ··· 'the DNA sequence encoding the corresponding carbohydrate digesting bacterium. the full-length enzyme. • · • · • · ·. . Method according to claim 1, characterized in that the DNA sequence encoding the 1.1 abbreviated form of the carbohydrate digesting bacterial enzyme is derived from an actinomycet. The method according to claim 2, characterized in that the DNA sequence encoding the abbreviated form of the carbohydrate digesting bacterial enzyme is derived from ··· •. .,. · From a Nonomuraea. 48 118770 Method according to claim 3, characterized in that the DNA sequence encoding the abbreviated form of the carbohydrate digesting bacterial enzyme is derived from Nonomuraea flexuosa. Process according to claim 1, characterized in that the carbohydrate digesting bacterial enzyme is an abbreviated form of a xylan digesting enzyme. Process according to claim 5, characterized in that the carbohydrate digesting bacterial enzyme is an abbreviated form of thermostable xylanase. 10 Process according to claim 6, characterized in that the carbohydrate digesting bacterial enzyme is an abbreviated form of Nf Xynl IA. Process according to claim 6, characterized in that the carbohydrate digesting bacterial enzyme is an abbreviated form of Nf Xyn 10A. Method according to claim 7, characterized in that the abbreviated form of the carbohydrate digesting bacterial enzyme is AM24 (SEQ ID NO: 12), r23.8 kDa * · * ···: polypeptide (SEQ ID NO: 13) or r22.0 kDa polypeptide (SEQ IDNO: 14). The method according to claim 8, characterized in that the abbreviated form of the carbohydrate digestive bacterial enzyme is an AM50 core. and linker region (SEQ ID ···· NO: 17), an AM50 core region (SEQ ID NO: 18), an AM50 core and linker region • *****, and a tail a / p region (SEQ ID) NO: 19) or an AM50 core and linker region t> 25 and a tail α region (SEQ ID NO: 20). • · · · · · · φ * · φ # • # 11. A method according to claim 1, characterized in that the DNA sequences encoding carrier polypeptides are derived from the sponge fungus and encode selected regions or domains of the carbohydrate digesting enzyme secreted. : ** .. 3 0 φ • · φ Method according to claim 11, characterized in that the DNA sequence encodes a carrier polypeptide which is a Man5A core or core / ganglion region, or Cel6A 49 118770 CBD, which consists of A, A + B or A + B + B 'regions where A is a carbohydrate binding domain, B is a hinge region and B' is a duplicate hinge region. Method according to claim 1, characterized in that the promoter sequences comprise Trichoderma or Aspergillus promoters. Method according to claim 13, characterized in that the Trichoderma promoter is a cell 7A (cbh 1j promoter. 10). Method according to claim 1, characterized in that the higher level of production achieved by the DNA structure encoding the abbreviated form of the carbohydrate digesting bacterial enzyme is at least 2 times higher than the production level achieved by another corresponding DNA construct, similar to said DNA construct, except that it comprises a DNA sequence encoding the corresponding full length carbohydrate digesting enzyme. 16. A DNA construct which achieves a higher level of production of a carbohydrate digesting bacterial enzyme which, in its original full-length form, has a catalytic module and a carbohydrate binding module. * ··. * (CBM) separated by a linker region, characterized in that said DNA • · · ···! construction comprises regulatory sequences derived from the sponge, ··· • · * ··· * comprising a promoter, a signal sequence associated with a carrier sequence 2. or without carrier sequence, a terminator sequence, and an abbreviated DNA sequence encoding an abbreviated form of said carbohydrate digesting bacterial enzyme, φ · • · *** which contains a catalytic module, but which completely or partially lacks CBM, or: "which completely lacks CBM and all or part of the linker region, where production level ·" The DNA construct encoding the abbreviated form of said carbohydrate digesting bacterial enzyme, measured as activity increase with single copy transformants, is higher than the production level attached with a other corresponding DNA construct which is similar to said DNA construct, except that it contains a DNA sequence encoding the corresponding carbohydrate cleavage enzyme m of full length. 17. DNA construct according to claim 16, characterized in that the DNA sequence 5 encoding the abbreviated form of the carbohydrate digesting enzyme originates from an actinomycet. The DNA construct of claim 17, characterized in that the DNA sequence encoding the abbreviated form of the carbohydrate digesting bacterial enzyme 10 is derived from a Nonomuraea. 19. DNA construct according to claim 18, characterized in that the DNA sequence encoding the abbreviated form of the carbohydrate digesting bacterial enzyme is derived from Nonomuraea flexuosa. 15 20. DNA construct according to claim 16, characterized in that the DNA sequence encoding the carbohydrate digesting enzyme is a DNA sequence encoding an abbreviated form of a xylan digesting enzyme. The DNA construct of claim 20, characterized in that the DNA sequence encoding the carbohydrate digesting bacterial enzyme is a DNA sequence that encodes ... , thermostable xylanase. 22. DNA construct according to claim 21, characterized in that the DNA sequence encoding the carbohydrate digesting bacterial enzyme is a DNA sequence which is »» 23. A DNA construct according to claim 21, characterized in that the DNA sequence encoding it is encoded in an enclosed form of Nf Xynl 1 A. the carbohydrate digesting bacterial enzyme is a DNA sequence encoding an abbreviated form of Nf Xyn10A. • a · • · • · · · · 51 118770 DNA construct according to claim 22, characterized in that the abbreviated DNA sequence encodes AM24 polypeptide (SEQ ID NO: 12), r23.8 kDa polypeptide (SEQ ID NO: 13) or r22.0 kDa polypeptide (SEQ ID NO: 14). DNA construct according to claim 23, characterized in that the abbreviated DNA sequence encodes an AM50 core and linker region (SEQ ID NO: 17), an AM50 core region (SEQ ID NO: 18), an AM50 core and linker region and a tail α / β region (SEQ ID NO: 19) or an AM50 core and linker region and a tail α region (SEQ ID NO: 20). 10 The DNA construct of claim 16, characterized in that the DNA sequences encoding a carrier polypeptide or portions thereof are DNA sequences derived from the same sponge or another sponge and encode the carbohydrate digesting enzyme secreted. 15 27. DNA construct according to claim 26, characterized in that a DNA sequence encodes a carrier polypeptide which is a Man5A nucleus or a core / ganglia region or Cel6A CBD consisting of an A, A + B or A + B + B 'region, where A is a ***' carbohydrate-binding domain, B is a gangrene domain and B 'is a duplicate * · ί.ί ϊ 20 gangrene domain. 28. DNA construct according to claim 16, characterized in that the promoter sequences comprise Trichoderma or Aspergillus promoters, • a • · ♦ ·· . . 29. DNA construct according to claim 28, characterized in that the Trichoderma. The promoter is a cell 7A (cbhI) promoter. The DNA construct of claim 16, characterized in that the higher level of production achieved by the DNA construct encoding the abbreviated form of the carbohydrate digesting bacterial enzyme, is at least two a ** times higher than the level of production achieved with another corresponding DNA construct, which is similar to said DNA construct, except that it contains a DNA sequence which encodes the full-length carbohydrate digesting enzyme. Use of a process according to claims 1 to 15 to prepare an enzyme preparation, which enzyme preparation is suitable for use in industrial processes where high temperatures are required. Use of a DNA construct according to claims 16 to 30 to produce an enzyme preparation, which enzyme preparation is suitable for use in industrial processes where high temperatures are required. · · · · · · · · · ··· 1 2 3 · · · · · · · · ··· 1 ·· «· · · · · · · · · ··· ·· # »• · · · · · · · 1 · • · · · ··· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · SEQUENCE LISTING <120> Method and DNA constructs for increasing the Production Level of Carbohydrate Degrading Enzymes in Filamentous Fungi <130> A3834PFI <160> 25 <170> Patent Version 3.2 <210> 1 <211> 1375 <212> DNA <213> Nonomuraea flexuosa <220> <221> Nf xynllA nucleotide sequence (AJ508952), the coding region is from nt 303 to nt 1337 <222> (15 .. (1375) <400> 1 cccgggtatt catgtgaatg attagcaaca gttatgttac ggagatctt ctgagagtgtg cgagctagct ccgatagttt tcgatacgcc 120 ggcacatcga gcacgtcgga cgagtcacgc gccacgtcgg ttttccgccg cacgccgcgc 180 agagcggccg gagaaccccc gcgtgtccgc ggcatcggtg ccggtccgtc gc 40 gaccgcgcgc cgggtcgcga cacgccagcc cccatcggcc cttcttcacg aggaagccgt 300 acatgaacga acccctcacc atcacgcagg ccaggcgccg cagacgcctc ggcctccggc 360 gcatcgtcac cagtgccttc gccctggcac tcgccatcgc cggtgcgctg ctgcccggca 420 cggcccacgc cgacaccacc atcacccaga accagaccgg gtacgacaac ggctacttct 480 * · *: actcgttctg gaccgacgcg cccgggaccg tctccatgac cctccactcg ggcggcagct 540 II *: acagcacctc gtggcggaac accgggaact tcgtcgccgg caagggctgg tccaccggcg 600 gacggcggac cgtgacctac aacgcctcct tcaacccgtc gggtaacgcc tacctcacgc 660 tctacggctg gaccaggaac ccgctcgtcg agtactacat cgtcgagagc tggggcacct 720 <# * j * accggcccac cggcacctac aagggcaccg tcaccaccga cggcggcaeg tacgacatct 780 acgagacctg gcggtacaac gcgccgtcca tegagggeae ccggaccttc cagcagttct 840 ggagcgtccg gcagcagaag cggaccagcg gcaccatcac catcggcaac cacttcgacg 900 φφ * ϊ · cctgggcccg cgccggcatg aacctgggca gccacgacta ccagatcatg gcgaccgagg 960: [φ [: gctaccagag cagcggtagc tccaccgtct ccatcagcga gggtggcaac cccggcaacc 1020.:. cgggtaaccc cggcaacccc ggcaaccccg gtaacccggg taaccccggc ggtggctgcg 1080 ····. ···. tcgcgaccct ctccgccggc cagcagtgga gcgaccgcta caacctcaac gtctcggtca 1140 * * · · · *, geggetegaa caactggacg gtccggatgg acgtgcccta cccggcccgc atcatcgcca 1200 • · · cctggaacat ccacgcccag tggcccgagt cccaggtgct catcgccaga cccaacggca 1260 acggcaacaa ctggggcgtg acgatccagc acaacggcaa ctggacctgg ccgacggtca 1320 Page 1 AB_Enzymes.ST25 118770 cctgtaccgc gaactgagtt cccgccccca aaggtggcgc ggcggctccc ggccg 1375 <210> 2 <211> 906 <212> DNA <213> Nonomuraea flexuosa <220> <221> am35, Nf xynllA coding region for the mature Nf xynllA (AM35) protein <222> CD. (906) <400> 2 gacaccacca tcacccagaa ccagaccggg tacgacaacg gctacttcta ctcgttctgg 60 accgacgcgc ccgggaccgt ctccatgacc ctccactcgg gcggcagcta cagcacctcg 120 tggcggaaca ccgggaactt cgtcgccggc aagggctggt ccaccggcgg acggcggacc 180 gtgacctaca acgcctcctt caacccgtcg ggtaacgcct acctcacgct ctacggctgg 240 accaggaacc cgctcgtcga gtactacatc gtcgagagct ggggcaccta ccggcccacc 300 ggcacctaca agggcaccgt caccaccgac ggcggcacgt acgacatcta cgagacctgg 360 cggtacaacg cgccgtccat cgagggcacc cggaccttcc agcagttctg gagcgtccgg 420 cagcagaagc ggaccagcgg caccatcacc atcggcaacc acttcgacgc ctgggcccgc 480 gccggcatga acctgggcag ccacgactac cagatcatgg cgaccgaggg ctaccagagc 540 agcggtagct ccaccgtctc catcagcgag ggtggcaacc ccggcaaccc gggtaacccc 600 ggcaaccccg gcaaccccgg taacccgggt aaccccggcg gtggctgcgt cgcgaccctc 660 tccgccggcc agcagtggag cgaccgctac aacctcaacg tctcggtcag cggctcgaac 720 aactggacgg tccggatgga cgtgccctac ccggcccgca tcatcgccac ctggaacatc 780 cacgcccagt ggcccgagtc ccaggtgctc atcgccagac ccaacggcaa cggcaac aac 840 • · · j .:: tggggcgtga cgatccagca caacggcaac tggacctggc cgacggtcac ctgtaccgcg 900 • »· ··· · aactga 906 ··· · * ♦ ·· ♦.:. <210> 3 ···· <211> 663; ** ·. <212> DNA * ··· * <213> Nonomuraea flexuosa. * .. <220> ♦ ··· <221> am24, shortened form of am35, includes a STOP codon <222> (1) .. (663) «·· *. <400> 3 gacaccacca tcacccagaa ccagaccggg tacgacaacg gctacttcta ctcgttctgg 60 accgacgcgc ccgggaccgt ctccatgacc ctccactcgg gcggcagcta cagcacctcg 120. . *. tggcggaaca ccgggaactt cgtcgccggc aagggctggt ccaccggcgg acggcggacc 180 ·· * ....: gtgacctaca acgcctcctt caacccgtcg ggtaacgcct acctcacgct ctacggctgg 240 Page 2 118770 AB_Enzymes.ST25 accaggaacc cgctcgtcga gtactacatc gtcgagagct ggggcaccta ccggcccacc 300 ggcacctaca agggcaccgt caccaccgac ggcggcacgt acgacatcta cgagacctgg 360 cggtacaacg cgccgtccat cgagggcacc cggaccttcc agcagttctg gagcgtccgg 420 cagcagaagc ggaccagcgg caccatcacc atcggcaacc acttcgacgc ctgggcccgc 480 gccggcatga acctgggcag ccacgactac cagatcatgg cgaccgaggg ctaccagagc 540 agcggtagct ccaccgtctc catcagcgag ggtggcaacc ccggcaaccc gggtaacccc 600 ggcaaccccg gcaaccccgg taacccgggt aaccccggcg gtggctgcgt cgcgaccctc 660 TAA 663 <210> 4 <211> 906 <212> DNA <213> Nonomuraea flexuosa <220> < 221> am35 *, like am35 but 9 codons are changed in the sequence (Example 10) (the changes do not alter the encoded amino acid sequence) <222> (1) .. (906) <400> 4 gacaccacca tcacccagaa ccagaccggc tacgacaacg gctacttcta ctcgttctgg 60 accgacgcc c ccggcaccgt ctccatgacc ctccactcgg gcggcagcta cagcacctcg 120 tggcgcaaca ccggcaactt cgtcgccggc aagggctggt ccaccggcgg ccgccgcacc 180 gtcacctaca acgcctcctt caacccgtcg ggtaacgcct acctcacgct ctacggctgg 240 accaggaacc cgctcgtcga gtactacatc gtcgagagct ggggcaccta ccggcccacc 300 ggcacctaca agggcaccgt caccaccgac ggcggcacgt acgacatcta cgagacctgg 360 * * cggtacaacg cgccgtccat cgagggcacc cggaccttcc agcagttctg gagcgtccgg 420 • * • * * ί · Ϊ! cagcagaagc ggaccagcgg caccatcacc atcggcaacc acttcgacgc ctgggcccgc 480 «· • · · ·:: gccggcatga acctgggcag ccacgactac cagatcatgg cgaccgaggg ctaccagagc 540 ··· • · '···' agcggtagct ccaccgtctc catcagcgag ggtggcaacc ccggcaaccc gggtaacccc 600 • · · ...: ggcaaccccg gcaaccccgg taacccgggt aaccccggcg gtggctgcgt cgcgaccctc 660 ··· ··· • · * 'tccgccggcc agcagtggag cgaccgctac aacctcaacg tctcggtcag cggctcgaac 720 aactggacgg tccggatgga cgtgccctac ccggcccgca tcatcgccac ctggaacatc 780 ··· cacgcccagt ggcccgagtc ccaggtgctc atcgccagac ccaacggcaa cggcaacaac 840 ··· · ^ •' ... 'tggggcgtga cgatccagca caacggcaac tggacctggc cgacggtcac ctgtaccgcg 900 • J * aactga 906 ···· tt · • · **: ** <210> 5. . ·. <211> 663 *.:. <212> DNA ....: <213> Nonomuraea flexuosa • · page 3 <220> 118770 AB_Enzymes.ST25 <221> am24 *, as am24 but 9 codons are changed in sequence like in am35 * (Example 10) <222> (1) .. (663) <400> 5 gacaccacca tcacccagaa ccagaccggc tacgacaacg gctacttcta ctcgttctgg 60 accgacgccc ccggcaccgt ctccatgacc ctccactcgg gcggcagcta cagcacctcg 120 tggcgcaaca ccggcaactt cgtcgccggc aagggctggt ccaccggcgg ccgccgcacc 180 gtcacctaca acgcctcctt caacccgtcg ggtaacgcct acctcacgct ctacggctgg 240 accaggaacc cgctcgtcga gtactacatc gtcgagagct ggggcaccta ccggcccacc 300 ggcacctaca agggcaccgt caccaccgac ggcggcacgt acgacatcta cgagacctgg 360 cggtacaacg cgccgtccat cgagggcacc cggaccttcc agcagttctg gagcgtccgg 420 cagcagaagc ggaccagcgg caccatcacc atcggcaacc acttcgacgc ctgggcccgc 480 gccggcatga acctgggcag ccacgactac cagatcatgg cgaccgaggg ctaccagagc 540 agcggtagct ccaccgtctc catcagcgag ggtggcaacc ccggcaaccc gggtaacccc 600 ggcaaccccg gcaaccccgg taacccgggt aaccccggcg gtggctgcgt cgcgacc ctc 660 taa 663 <210> 6 <211> 1864 <212> DNA <213> Nonomuraea flexuosa <220> <221> Nf xynlOA nucleotide sequence (AJ508953), the coding region is from nt 194 to nt 1672 ....: <222> (1) .. (1864) aa:. *. <400> 6. · Ttcggcagcc tattgacaaa tttcgtgaat gtttcccaca cttgctctgc agacggcccc 60 A · «· *:.:: Gccgatcatg ggtgcaccgg tcggcgggac cgtgctccga cgccattcgg gggtgtgcgc 120 • · * ··· * ctgcgggcgc ggcgtcgatc ccgcggggac tcccgcggtt ccctttccgt gtccctctaa 180 aaaa ...: tggaggctca ggcatgggcg tgaacgcctt ccccagaccc ggagctcggc ggttcaccgg ·· 240 a * a '··. * cgggctgtac cgggccctgg ccgcggccac ggtgagcgtg gtcggcgtgg tcacggccct 300 gacggtgacc cagcccgcca gcgccgcggc gagcacgctc gccgagggtg ccgcgcagca 360 A a · ·· .: caaccggtac ttcggcgtgg ccatcgccgc gaacaggctc accgactcgg tctacaccaa 420 aaa • A' « · «* Catcgcgaac cgcgagttca actcggtgac ggccgagaac gagatgaaga tcgacgccac 480 cgagccgcag caggggcggt tcgacttcac ccaggccgac cggatctaca actgggcgcg ccgcgcgcgcgcgcgcgcgcgcgcc . *. gatgcagaac ctcagcggcc aggcgctgcg ccaggcgatg atcaaccaca tccagggggt 660 aa * ....: catgtcctac taccggggca agatcccgat ctgggacgtg gtgaacgagg cgttcgagga 720 Page 4 118770 AB_Enzymes.ST25 cggaaactcc ggccgccggt gcgactccaa cctccagcgc accggtaacg attggatcga 780 ggtcgcgttc cgcaccgccc gccaggggga cccctcggcc aagctctgct acaacgacta 840 caacatcgag aactggaacg cggccaagac ccaggcggtc tacaacatgg tgcgggactt 900 caagtcccgc ggcgtgccca tcgactgcgt gggcttccag tcgcacttca acagcggtaa 960 cccgtacaac ccgaacttcc gcaccaccct gcagcagttc gcggccctcg gcgtggacgt 1020 cgaggtcacc gagctggaca tcgagaacgc cccggcccag acctacgcca gcgtgatccg 1080 ggactgcctg gccgtggacc gctgcaccgg catcaccgtc tggggtgtcc gcgacagcga 1140 ctcctggcgc tcgtaccaga acccgctgct gttcgacaac aacggcaaca agaagcaggc 1200 ctactacgcg gtgctcgacg ccctgaacga gggctccgac gacggtggcg gcccgtccaa 1260 cccgccggtc tcgccgccgc cgggtggcgg ttccgggeag atccggggcg tggcctccaa 1320 ccggtgcatc gacgtgccga acggcaacac cgccgacggc acccaggtcc agctgtacga 1380 ctgccacagc ggttccaacc agca gtggac ctacacctcg tccggtgagt tccgcatctt 1440 cggcaacaag tgcctggacg cgggcggctc cagcaacggt gcggtggtcc agatctacag 1500 ctgctggggc ggcgccaacc agaagtggga gctccgggcc gacggcacca tcgtgggcgt 1560 gcagtccggg ctgtgcctcg acgcggtggg tggcggcacc ggcaacggca cgcggctgca 1620 gctctactcc tgctggggcg gcaacaacca gaagtggtcc tacaacgcct gatccccggc 1680 tgatcgaccc tagttgaggc cgtctccggt acggcaccgt cggaccggag gcggtccctt 1740 gttcgtccag gacggaagga ccggtctgag caggcgcggc gatcggacac catggtggga 1800 ggcacgaaag cgggaggggg tcgtattccg agactccggg aagtggaggt gttcctccac 1860 ctga 1864 ....: <210> 7 '' <211> 1347:. ·. <212> DNA ί · ϊ ί <213> Nonomuraea flexuosa • * • * · • · · * · »·. ***. <220> * ··· * <221> am50, Nf xynlOA coding region for the mature Nf xynlOA (AM50).:. protein <222> (1) .. (1347) • Φ ·: ...! <400> 7 gcggcgagca cgctcgccga gggtgccgcg cagcacaacc ggtacttcgg cgtggccatc 60.:. gccgcgaaca ggctcaccga ctcggtctac accaacatcg cgaaccgcga gttcaactcg 120 ····. "·. gtgacggccg agaacgagat gaagatcgac gccaccgagc cgcagcaggg gcggttcgac 180« · «*. ttcacccagg ccgaccggat ctacaactgg gcgcgccaga acggcaagca ggtccgcggc 240« · * * "* cacaccctgg cctggcactc gcagcagccg cagtggatgc agaacctcag cggccaggcg 300 * · • · "* ctgcgccagg cgatgatcaa ccacatccag ggggtcatgt cctactaccg gggcaagatc 360 .i .: ccgatctggg acgtggtgaa cgaggcgttc gaggacggaa actccggccg ccggtgcgac 420 tccaacctcc agcgcaccgg taacgattgg atcgaggtcg cgttccgcac cgcccgccag 480 Page 5 118770 AB_Enzymes.ST25 ggggacccct cggccaagct ctgctacaac gactacaaca tcgagaactg gaacgcggcc 540 aagacccagg cggtctacaa catggtgcgg gacttcaagt cccgcggcgt gcccatcgac 600 tgcgtgggct tccagtcgca cttcaacgcgcccgcgccgccgcgccgcgccgcgccgcgccgcgccgcgccgccgccgccgccgcgcccc cgtA ccagaacccg 840 ctgctgttcg acaacaacgg caacaagaag caggcctact acgcggtgct cgacgccctg 900 aacgagggct ccgacgacgg tggcggcccg tccaacccgc cggtctcgcc gccgccgggt 960 ggcggttccg ggcagatccg gggcgtggcc tccaaccggt gcatcgacgt gccgaacggc 1020 aacaccgccg acggcaccca ggtccagctg tacgactgcc acagcggttc caaccagcag 1080 tggacctaca cctcgtccgg tgagttccgc atcttcggca acaagtgcct ggacgcgggc 1140 ggctccagca acggtgcggt ggtccagatc tacagctgct ggggcggcgc caaccagaag 1200 tgggagctcc gggccgacgg caccatcgtg ggcgtgcagt ccgggctgtg cctcgacgcg 1260 gtgggtggcg gcaccggcaa cggcacgcgg ctgcagctct actcctgctg gggcggcaac 1320 aaccagaagt ggtcctacaa cgcctaa 1347 <210> 8 <211> 972 <212> DNA <213> Nonomuraea flexuosa ....: <222> (1) .. (972):. ·. <400> 8! * · *: Gcggcgagca cgctcgccggggggccgcg cagcacaacc ggtacttcgg cgtggccatc 60 • «· 1 gccgcgacggcgccgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgg : ttcacccagg ccgaccggat ctacaactgg gcgcgccaga acggcaagca ggtccgcggc 240 • * · ··· 'cacaccctgg cctggcactc gcagcagccg cagtggatgc agaacctcag cggccaggcg 300 ctgcgccagg cgatgatcaa ccacatccag ggggtcatgt cctactaccg gggcaagatc 360 • · · · ..: ccgatctggg acgtggtgaa cgaggcgttc gaggacggaa actccggccg ccggtgcgac 420 • t * ···' tccaacctcc agcgcaccgg taacgattgg atcgaggtcg cgttccgcac cgcccgccag 480 ..I ** ggggacccct cggccaagct ctgctacaac gactacaaca tcgagaactg gaacgcggcc 540 aagacccagg cggtctacaa catggtgcgg gact . ·. tgcgtgggct tccagtcgca cttcaacagc ggtaacccgt acaacccgaa cttccgcacc 660 ·· «....: accctgcagc agttcgcggc cctcggcgtg gacgtcgagg tcaccgagct ggacatcgag 720 Page 6 118770 AB_Enzymes.ST25 aacgccccgg cccagaccta cgccagcgtg atccgggact gcctggccgt ggaccgctgc 780 accggcatca ccgtctgggg tgtccgcgac agcgactcct ggcgctcgta ccagaacccg 840 ctgctgttcg acaacaacgg caacaagaag caggcctact acgcggtgct cgacgccctg 900 aacgagggct ccgacgacgg tggcggcccg tccaacccgc cggtctcgcc gccgccgggt 960 ggcggttcct aa 972 <210> 9 <211> 906 <212> DNA <213> Nonomuraea flexuosa <220> <221> The sequence encodes the AM50 core region, including a stop codon ..C906) <400> 9 gcggcgagca cgctcgccga gggtgccgcg cagcacaacc ggtacttcgg cgtggccatc 60 gccgcgaaca ggctcaccga ctcggtctac accaacatcg cgaaccgcga gttcaactcg 120 gtgacggccg agaacgagat gaagatcgac gccaccgagc cgcagcaggg gcggttcgac 180 ttcacccagg ccgaccggat ctacaactgg gcgcgccaga acggcaagca ggtccgcggc 240 cacaccctgg cctggcactc gcagcagccg cagtggatgc agaacctcag cggccagg cg 300 ctgcgccagg cgatgatcaa ccacatccag ggggtcatgt cctactaccg gggcaagatc 360 ccgatctggg acgtggtgaa cgaggcgttc gaggacggaa actccggccg ccggtgcgac 420 tccaacctcc agcgcaccgg taacgattgg atcgaggtcg cgttccgcac cgcccgccag 480 ggggacccct cggccaagct ctgctacaac gactacaaca tcgagaactg gaacgcggcc 540 aagacccagg cggtctacaa catggtgcgg gacttcaagt cccgcggcgt gcccatcgac 600 tgcgtgggct tccagtcgca cttcaacagc ggtaacccgt acaacccgaa cttccgcacc 660 • · · j *: ,: accctgcagc agttcgcggc cctcggcgtg gacgtcgagg tcaccgagct ggacatcgag 720 • · · ···· aacgccccgg cccagaccta cgccagcgtg atccgggact gcctggccgt ggaccgctgc 780 · * ··· 'accggcatca ccgtctgggg tgtccgcgac agcgactcct ggcgctcgta ccagaacccg 840 • · · ctgctgttcg acaacaacgg caacaagaag caggcctact acgcggtgct cgacgccctg 900 • * · · ·· * aactaa 906.:. <210> 10 ···· <211> 344. ·· *. <212> PRT * ··· * <213> Nonomuraea flexuosa ··· * ::: <22o>, ί <221> Nf xynllA amino acid sequence (A3508952) encoded by the Nf xynllA. gene. <222> (1) .. (344) • · · ....: <400> ίο • · Page 7 118770 AB_Enzymes.ST25 With Asn Glu Pro Leu Thr lie Thr Gin Ala Arg Arg Arg Arg Arg Leu 1 5 10 15 Gly Leu Arg Arg He Val Thr Ser Ala Phe Ala Leu Ala Leu Ala lie 20 25 30 Ala Gly Ala Leu Leu Pro Gly Thr Ala His Ala Asp Thr Thr lie Thr 35 40 45 Gin Asn Gin Thr Gly Tyr Asp Asn Gly Tyr Phe Tyr Ser Phe Trp Thr 50 55 60 Asp Ala Pro Gly Thr Val Ser With Thr Leu His Ser Gly Gly Ser Tyr 65 70 75 80 Ser Thr Ser Trp Arg Asn Thr Gly Asn Phe val Ala Gly Lys Gly Trp 85 90 95 Ser Thr Gly Gly Arg Arg Thr Thr Thr Asn Al Phe Asn Pro 100 105 110 ser Gly Asn Ala Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Asn Pro Leu 115 120 125 Val Glu Tyr Tyr lie Val Glu Ser Trp Gly Thr Tyr Arg Pro Pro Thr Gly 130 135 140 Thr Tyr Lys Gly Thr Val Thr Thr Asp Gly Gly Thr Tyr Asp lie Tyr 145 150 155 160 Glu Thr Trp Arg Tyr Asn Ala Pro Ser lie Glu Gly Thr Arg Thr Phe .... I 165 170 175 • · • ·:.:: Gin Gin Phe Trp sees choice Arg Gin Gin Lys Arg Thr Ser Gly Thr lie:. ·. 180 185 190 • · · «·· * ···: ... s Thr lie Gly Asn His Phe Asp Ala Trp Ala Arg Ala Gly With Asn Leu.:. 195 200 205 · »·· ··· Gly ser His Asp Tyr Gin lie With Ala Thr Glu Gly Tyr Gin Ser ser 210 215 220 Gly Ser Ser Thr Val Ser lie ser Glu Gly Gly Asn Pro Gly Asn Pro. 225 230 235 240 • ♦ ··· ··· Gly Asn Pro Gly Asn Pro Gly Asn Pro Gly Asn Pro Gly Asn Pro Gly 245 250 255 • v Λ «··· Gly Gly Cys falls Ala Thr Leu ser Ala Gly Gin Gin Trp Ser Asp Arg: .ϊ 260 265 270 t • «Page 8 118770 AB_Enzymes.ST25 Tyr Asn Leu Asn Vai ser vai Ser Gly ser Asn Asn Trp Thr Vai Arg 275 280 285 With Asp Vai Pro Tyr Pro Ala Arg He lie Ala Thr Trp Asn lie His 290 295 300 Ala Gin Trp Pro Glu Ser Gin val Leu lie Ala Arg Pro Asn Gly Asn 305 310 315 320 Gly Asn Asn Trp Gly fall Thr lie Gin His Asn Gly Asn Trp Thr Trp 325 330 335 Pro Thr val Thr Cys Thr Ala Asn 340 <210> 11 <211> 301 <212> PRT <213> Nonomuraea flexuosa <220> <221> r33.4 kDa = AM35 «full length mature Nf XynllA protein encoded by am35 and am35 * genes <222> (I) .. C301) <400> 11 Asp Thr Thr lie Thr Gin Ash Gin Thr Gly Tyr Asp Asn Gly Tyr Phe 15 10 15 Tyr Ser Phe Trp Thr Asp Ala Pro Gly Thr Val Ser With Thr Leu His 20 25 30 ....: Ser Gly Gly looking Tyr Ser Thr ser Trp Ar g Asn Thr Gly Asn Phe val 35 40 45 ♦ · • · · • · · • • t ·: A ^ a G] v List TrP Ser Thr Gly Gly Arg Arg Thr Thr Thr Tyr Asn ·· * * 50 55 60 • · · Wv • · • I ··· ·; · A] a Ser Asn Pro ser Gly Asn Ala Tyr Leu Thr Leu Tyr Gly Trp 65 70 75 80 • • · · »· Thr Arg Asn Pro Leu Val Glu Tyr Tyr lie Val Glu sees Trp Gly Thr. 85 90 95 ··· ····. · * ·. Tyr Arg pro Thr Gly Thr Tyr Light Gly Thr Val Thr Thr Asp Gly Gly *: * 100 105 110 • · · ..... Τ * ΊΓ Tvr A? P Tyr G ^ u Thr Trp Arg Tyr Asn Ala Pro ser lie Glu * ... · US 120 125 • · · ***. Gly Thr Arg Thr Phe Gin Gin Phe Trp Ser Val Arg Gin Gin Lys Arg ·: ··: 1; i0 i35 140 Page 9 AB_Enzymes.ST25 118770 Thr Ser Gly Thr lie Thr lie Gly Asn His Phe Asp Ala Trp Ala Arg 145 150 155 160 Ala Gly With Asn Leu Gly Ser His Asp Tyr Gin lie With Ala Thr Glu 165 170 175 Gly Tyr Gin Ser Ser Gly Ser Ser Thr val ser lie lie Glu Gly Gly 180 185 190 Asn Pro Gly Asn Pro Gly Asn Pro Gly Asn Pro Gly Asn Pro Gly Asn 195 200 205 Pro Gly Asn Pro Gly Gly Gly Cys Val Ala Thr Leu Ser Ala Gly Gin 210 215 220 Gin Trp Ser Asp Arg Tyr Asn Leu Asn Val Ser Val Gly Ser Asn 225 230 235 240 Asn Trp Thr Val Arg With Asp Val Pro Tyr Pro Ala Arg lie lie Ala 245 250 255 Thr Trp Asn lie His Ala Gin Trp pro Glu Ser Gin val Leu lie Ala 260 265 270 Arg Pro Asn Gly Asn Gly Asn Asn Trp Gly val Thr lie Gin His Asn 275 280 285 Gly Asn Trp Thr Trp Pro Thr val Thr Cys Thr Ala Asn 290 295 300, ...: <210> 12 * * <211> 220:. ·. <212> PRT:.:: <213> Nonomuraea flexuosa • · • · · • · · ··· ·. ···. <220> * ... * <221> AM24, truncated form from AM35, encoded by am24 and am24 * genes.:. <222> Cl) .. (220). ···. <400> 12 • · ··· Asp Thr Thr lie Thr Gin Asn Gin Thr Gly Tyr Asp Asn Gly Tyr Phe 15 10 15 ··· ···. * ··. Tyr Ser Phe Trp Thr Asp Ala Pro Gly Thr Val Ser With Thr Leu His * · .. * 20 25 30 ** · * ;; * ser Gly Gly ser Tyr ser Thr ser Trp Arg Asn Thr Gly Asn Phe Val :: 35 40 45 * · · Ala Gly Lys Gly Trp Ser Thr Gly Gly Arg Arg Thr Thr Thr Asn ....: 50 55 60 • «Page 10 Ala Ser Phe Asn Pro Ser Gly Asn Ala Tyr Leu Thr Leu Tyr Gly Trp 65 70 75 7 80 118770 AB_Enzymes.ST25 Thr Arg Asn Pro Leu val Glu Tyr Tyr lie Val Glu ser Trp Gly Thr 85 90 g5 Tyr Arg Pro Thr Gly Thr Tyr Lys Gly Thr Val Thr Thr Asp Gly Gly 100 105 110 Thr Tyr Asp lie Tyr Glu Thr Trp Arg Tyr Asn Ala Pro Ser lie Glu 115 120 125 Gly Thr Arg Thr Phe Gin Gin Phe Trp Ser Val Arg Gin Gin Lys Arg 130 135 140 Thr Ser Gly Thr He Thr lie Gly Asn His Phe Asp Ala Trp Ala Arg 145 150 155 160 Ala Gly With Asn Leu Gly Ser His Asp Tyr Gin lie With Ala Thr Glu 165 K 170 175 Gly Tyr Gin Ser Ser Gly Ser Ser Thr Val Ser Lie Ser Glu Gly Gly 180 185 190 Asn Pro Gly Asn Pro Gly Asn Pro Gly Asn Pro Gly Asn Pro Gly Asn 195 200 205 Pro Gly Asn pro Gly Gly cly cys val Ala Thr Leu 210 215 220 ....: <210> 13 * * <211> 217:. ·. <212> PRT:.:: <213> Nonomuraea flexuosa • * • * »• * · ··· ·. ***, <220> <221> r23.8 kDa, truncated form from AM35.:. <222> CD .. (217), · * ·. <400> 13 • · Asp Thr Thr lie Thr Gin Asn Gin Thr Gly Tyr Asp Asn Gly Tyr Phe 1 K 5 10 15 * ·· jyr ser Phe Trp Thr ASp Ala Pro Gly Thr val Ser With Thr Leu His * ... · 20 25 30 *** · Ser Gly Gly Ser Tyr Ser Thr Ser Trp Arg Asn Thr Gly Asn Phe val J 35 40 45 ·· «:.: /. Ala Gly Lys Gly Trp ser Thr Gly Gly Arg Arg Thr choice Thr Tyr Asn ....: 50 55 60 • · page 11 Aja ser Phe Asn pro ser Gly Asn Ala Tyr Leu Thr Leu Tyr Gly Trp 65 70 3 75 80 AB "Enzymes.ST25 118770 Thr Arg Asn Pro Leu v Glu Tyr Tyr He Selects Glu Ser Trp Gly Thr 85 90 K 95 Tyr Arg Pro Thr Gly Thr Tyr Lys Gly Thr Selects Thr Thr Asp Gly Gly 100 105 110 Thr Tyr Asp lie Tyr Glu Thr Trp Arg Tyr Asn Ala pro ser lie Glu 115 120 125 Gly Thr Arg Thr phe Gin Gin Phe Trp ser choice Arg Gin Gin Lys Arg 130 135 140 Thr ser Gly Thr lie Thr lie Gly Asn His Phe Asp Ala Trp Ala Arg 145 150 155 160 Ala Gly With Asn Leu Gly Ser His Asp Tyr Gin lie With Ala Thr Glu 165 170 175 Gly Tyr Gin Ser Ser Gly Ser Ser Thr Val Ser lie Ser Glu Gly Gly 180 185 190 Asn Pro Gly Asn Pro Gly Asn Pro Gly Asn Pro Gly Asn Pro Gly Asn 195 200 205 Pro Gly Asn Pro Gly Gly Gly Cys Val 210 215 <210> 14 • * <211> 193:. ·. <212> PRT: <213> Nonomuraea flexuosa • · * · • · · ··· e. · * ·. <220> * ... · <221> r22.0 kDa, truncated form from AM35.:. <222> (1) .. ¢ 193) ^ ·. ···. <400> 14 • * Asp Thr Thr lie Thr Gin Asn Gin Thr Gly Tyr Asp Asn Gly Tyr Phe 15 10 15 ··· * · ”, Tyr sees Phe Trp Thr Asp Ala Pro Gly Thr Val Ser With Thr Leu His%. . * 20 25 30 ··· ser Gly Gly Ser Tyr ser Thr Ser Trp Arg Asn Thr Gly Asn Phe Val f *: 35 40 45 ··· Ala Gly Lys Gly Trp Ser Thr Gly Gly Arg Arg Thr val Thr Tyr Asn. ...: 50 55 60 • · Page 12 AB_.Enzymes.ST2 5 Ala ser Phe Asn Pro Ser Gly Asn Ala Tyr Leu Thr Leu Tyr Gly Trp 65 70 75 80 118770 Thr Arg Asn Pro Leu vai Glu Tyr Tyr ne vai Glu Ser Trp Gly Thr 85 90 95 Tyr Arg Pro Thr Gly Thr Tyr Light Gly Thr of Thr Thr Asp Gly Gly 100 105 no Thr Tyr Asp He Tyr Glu Thr Trp Arg Tyr Asn Ala Pro ser He Glu 115 120 125 Gly Thr Arg Thr Phe Gin Gin Phe Trp Ser Vai Arg Gin Gin Lys Arg 130 135 140 Thr Ser Gly Thr Ile Thr Ile Gly Asn His Phe Asp Ala Trp Ala Arg 145 150 155 160 Ala Gly With Asn Leu Gly Ser His Asp Tyr Gin Ile With Ala Thr Glu 165 170 175 Gly Tyr Gin Ser Ser Gly Ser Ser Thr vai ser Ile ser G lu Gly Gly 180 185 190 Asn <210> 15 <211> 492 <212> PRT, <213> Nonomuraea flexuosa • · • **; <220> lv <221> Nf xynlOA, the amino acid sequence (AJ508953) encoded by the Nf::: xynlOA gene <222> Cl) .. (492) • · '**: * <400> 15 • · · **** With Gly Val Asn Ala Phe Pro Arg Pro Gly Ala Arg Arg Phe Thr Gly:: 15 10 15 · «· Gly Leu Tyr Arg Ala Leu Ala Ala Ala Thr Val Ser Val Gly Val ·; · 20 25 30 «· · ♦ ♦ · · * · * ·: ** Val Thr Ala Leu Thr val Thr Gin Pro Ala Ser Ala Ala Ala ser Thr .:. 35 40 45 ···· ··· Leu Ala Glu Gly Ala Ala Gin His Asn Arg Tyr Phe Gly Val Ala lie • 50 55 60 * »· • ♦ · · ♦ * Ala Ala Asn Arg Leu Thr Asp Ser val Tyr Thr Asn lie Ala Asn Arg 65 70 75 80 Page 13 A8_Enzymes.ST25 118770 Glu Phe Asn ser val Thr Ala Glu Asn Glu With Lys lie Asp Ala Thr 85 90 95 Glu Pro Gin Gin Gly Arg Phe Asp Phe Thr Gin Ala Asp Arg lie Tyr 100 105 110 Asn Trp Ala Arg Gin Asn Gly List Gin falls Arg Gly His Thr Leu Ala 115 120 125 Trp His Ser Gin Gin Pro Gin Trp Met Gin Asn Leu Ser Gly Gin Ala 130 135 140 Leu Arg Gin Ala Met lie Asn His lie Gin Gly Val With Ser Tyr Tyr 145 150 155 16 ° Arg Gly List lie Pro lie Trp Asp Val Val Asn Glu Ala Phe Glu Asp 165 170 175 Gly Asn Ser Gly Arg Arg Cys Asp Ser Asn Leu Gin Arg Thr Gly Asn 180 185 190 Asp Trp lie Glu val Ala Phe Arg Thr Ala Arg Gin Gl ^ Asp Pro Ser Ala Lys Leu Cys Tyr Asn Asp Tyr Asn lie Glu Asn Trp Asn Ala Ala 210 215 220 Lys Thr Gin Ala val Tyr Asn With Val Arg Asp Phe Lys Ser Arg Gly 2 25 230 235 240. . Val pro lie Asp cys val Gly Phe Gin ser His Phe Asn ser Gly Asn:. *: 245 250 255 · »« • • · «* · • · · Pro Tyr Asn Pro Asn Phe Arg Thr Thr Leu Gin Gin Phe Ala Ala Leu:: 260 265 270 • · · * »Gly Val Asp fall Glu fall Thr Glu Leu Asp lie Glu Asn Ala Pro Ala 275 280 285. Gin Thr Tyr Ala Ser val lie Arg Asp Cys Leu Ala val Asp Arg cys 290 295 300 o. Thr Gly iie Thr val Trp Gly val Arg Asp ser Asp ser Trp Arg ser.:. 305 310 315 320 • * • 2 ·· * Tyr Gin Asn Pro Leu Leu Phe Asp Asn Asn Gly Asn Light List Gin Ala. .. 325 330 335 Tyr Tyr Ala Val Leu Asp Ala Leu Asn Glu Gly Ser Asp Asp Gly Gly 340 345 350 Page 14 AB_Enzymes.ST25 118770 Gly Pro Ser Asn Pro Pro Val Ser Pro Pro Gly Gly Gly Ser Gly 355 360 365 Gin lie Arg Gly Vai Ala Ser Asn Arg Cys Ile Asp Val Pro Asn Gly 370 375 380 Asn Thr Ala Asp Gly Thr Gin val Gin Leu Tyr Asp Cys His Ser Gly 385 390 395 400 ser Asn Gin Gin Trp Thr Tyr Ser Ser Gly Glu Phe Arg lie Phe 405 410 415 Gly Asn Lys Cys Leu Asp Ala Gly Gly ser Ser Asn Gly Ala val val 420 425 430 Gin lie Tyr ser Cys Trp Gly Gly Ala Asn Gin Lys Trp Glu Leu Arg 435 440 445 Ala Asp Gly Thr lie val Gly val Gin ser Gly Leu cys Leu Asp Ala 450 455 460 Val Gly Gly Gly Thr Gly Asn Gly Thr Arg Leu Gin Leu Tyr ser cys 465 470 475 480 Trp Gly Gly Asn Asn Gin Lys Trp ser Tyr Asn Ala 485 490 <210 > 16 <211> 448. <212> PRT ·: **: <213> Nonomuraea flexuosa a · aaa • · · • t · · ^ 220 ^ i <221> AM50, full length mature Nf XynlOA \\ Y <222> (1) .. ( 448) • a '**: * <400> 16 • aa Ala Ala Ser Thr Leu Ala Glu Gly Ala Ala Gin His Asn Arg Tyr Phe:: 1 5 io 15 it *. Glv val Ala lie Ala Ala Asn Arg Leu Thr Asp ser Val Tyr Thr Asn ·; · 20 25 30 a a a a a a a a a a * '! *' Ile Ala Asn Arg Glu Phe Asn Ser val Thr Ala Glu Asn Glu With List.:. 35 40 45 a aaaa a # a lie asp Ala Thr Glu pro Gin Gin Gly Arg phe Asp Phe Thr Gin Ala • 50 55 60 aaaaaaa aaa Asp Arg Ile Tyr Asn Trp Ala Arg Gin Asn Gly List Gin val Arg Gly '* 65 70 75 80 Page 15 AB__Enzymes. st25 118770 His Thr Leu Ala Trp His Ser Gin Gin Pro Gin Trp With Gin Asn Leu 85 90 95 ser Gly Gin Ala Leu Arg Gin Ala Met lie Asn His lie Gin Gly val 100 105 110 With Ser Tyr Tyr Arg Arg Gly Lys lie pro lie Trp Asp val Val Asn Glu 115 120 125 130 G ^ U AS ^ ASn 135 Ar9 Ar ^ C ^ S AS |) SeP ASn LeU G ^ n Arg Thr Gly Asn Asp Trp lie Glu val Ala Phe Arg Thr Ala Arg Gin 145 150 155 160 Gly Asp Pro Ser Ala Lys Leu Cys Tyr Asn Asp Tyr Asn lie Glu Asn 165 170 175 Trp Asn Ala Ala Lys Thr Gin Ala val Tyr Asn With Val Arg Asp Phe 180 185 190 Lys ser Arg Gly val Pro He Asp Cys val Gly Phe Gin ser His Phe 195 200 205 Asn Ser Gly Asn Pro Tyr Asn Pro Asn Phe Arg Thr Thr Leu Gin Gin 210 215 220 Phe Ala Ala Leu Gly val Asp val Glu Val Thr Glu Leu Asp lie Glu 225 230 235 240 • ·. . Asn Ala Pro Ala Gin Thr Tyr Ala Ser Val Lie Arg Asp Cys Leu Ala::. * 245 250 255 »» · «• · • · · *". * Val Asp Arg Cys Thr Gly lie Thr Val Gly Val Arg Asp ser Asp:: 260 265 270 ··· · «" "Ser Trp Arg ser Tyr Gin Asn pro Leu Leu Phe Asp Asn Asn Gly Asn:: 275 280 285 · * ·. List List Gin Ala Tyr Tyr Ala val Leu Asp Ala Leu Asn Glu Gly ser *: * 290 295 300 ·· «· ··· • · T Asp Asp Gly Gly Gly Pro ser Asn Pro Pro val ser Pro Pro pro Gly.:. 305 310 315 320» · * · »· · Gly Gly Ser Gly Gin lie Arg Gly val Ala Ser Asn Arg Cys He Asp • # 325 330 335 * · · φ ® ··· val Pro Asn Gly Asn Thr Ala Asp Gly Thr Gin Val Gin Leu Tyr Asp 340 345 page 16 AB_Enzymes.ST25 118770 Cys His Ser Gly Ser Asn Gin Gin Trp Thr Tyr Thr Ser Gly Glu 355 360 H 365 Phe Arg lie Phe Gly Asn Lys cys Leu Asp Ala Gly Gly Ser Ser Asn 370 375 380 Gly Ala vai Val Gin lie Tyr ser cys Trp Gly Gly Ala Asn Gin Lys 385 390 '395 400 Trp Glu Leu Arg Ala Asp Gly Thr lie val Gly val Gin ser Gly Leu 405 410 415 Cys Leu Asp Ala val Gly Gly Gly Thr Gly Asn Gly Thr Arg Leu Gin 420 425 430 Leu Tyr Ser cys Trp Gly Gly Asn Gin Lys Trp ser Tyr Asn Ala 435 440 445 <210> 17 <211> 323 <212> PRT <213> Nonomuraea flexuosa <220> <221> AM50 core + linker, truncated form from am50 <222> CD- (323) <400> 17 Ala Ala Ser Thr Leu Ala Glu Gly Ala Ala Gin His Asn Arg Tyr Phe 15 10 15 t ·. . Gly val Ala He Ala Ala Asn Arg Leu Thr Asp ser val Tyr Thr Asn ::: 20 25 30 ··· · • · • 9 «He Ala Asn Arg Glu Phe Asn ser Val Thr Ala Glu Asn Glu With List :: 35 40 45 «♦ ·, ll He Asp Ala Thr Glu Pro Gin Gin Gly Arg Phe Asp Phe Thr Gin Ala:.,.: 50 55 60. Asp Arg He Tvr Asn Trp Ala Arg Gin Asn Gly List Gin Val Arg Gly 65 70 75 80 • · • • · T His Thr Leu Ala Tro His Ser Gin Gin Pro Gin Trp With Gin Asn Leu.:. S5 90 95 * ♦ ·· ··: ... · looks Gly Gin Ala Leu Arg Gin Ala With lie Asn His He Gin Gly fall *. 100 105 110 • # · • · · f · »*: * ·: Met ser Tyr Tyr Arg Gly * -ys He Pro He Trp Asp Val Val Asn Glu Page 17 AB_Enzymes.ST25 118770 Ala Phe Glu AsP Qly Asn Ser GTy Ar9 Arg Cys Asp ser Asn Leu Gin 130 135 140 Ara Thr Gly Asn AsP TrP 11e Glu val Ala Phe Arg Thr Ala Arg Gin 14? 150 155 160 Glv asd per Ser Ala Lys Leu cys Tyr Asn Asp Tyr Asn lie Glu Asn Giy asp r 165 170 H 175 τγο Asn Ala Ala Lys Thr Gin Ala Val Tyr Asn With Val Arg Asp Phe µ 180 185 190 Lys sees Arg Gly Val Pro lie Asp Cys val Gly Phe Gin sees His Phe 195 200 205 Asn Ser Gly Asn pro Tyr Asn Pro Asn Phe Arg Thr Thr Leu Gin Gin 210 215 220 phe Ala Ala Leu Gly Asp Asp Glu Fall Thr Glu Le Asp Asp lie Glu 225 250 235 240 Asn Ala Pro Ala Gin Thr Tyr Ala Ser Val lie Arg Asp cys Leu Ala 245 250 255 val asd Arg Cys Thr Gly lie Thr Val Trp Gly Val Arg Asp Ser Asp 260 265 270 ser TrD Arg Ser Tyr Gin Asn pro Leu Leu Phe Asp Asn Asn Gly Asn 275 280 285. . * List List Gin Ala Tyr Tyr Ala val Leu Asp Ala Leu Asn Glu Gly ser ::: 290 295 300 • · • · ♦ * ". * Asp Asp Gly Gly Gly pro Ser Asn Pro Pro val ser Pro Pro Pro Gly: ..,: 305 310 315 320 t ··· Gly Gly Ser I · · * «. <210> 18 <211> 301 ... <212> PRT <213> Nonomuraea flexuosa <220>. ***. < 221> AM50 core, truncated form from AM50 **; · * <222> CD · (301) <400> 18 *: **: Ala Ala ser Thr Leu Ala Glu Gly Ala Ala Gin His Asn Arg Tyr phe 1 5 10 15 Page 18 AB_Enzymes.ST25 118770 Gly trap Ala lie Ala Ala Asn Arg Leu Thr Asp ser val Tyr Thr Asn 20 25 30 lie Ala Asn Arg Glu Phe Asn Ser trap Thr Ala Glu Asn Glu With List 35 40 45 lie Asp Ala Thr Glu Pro Gin Gin Gly Arg Phe Asp Phe Thr Gin Ala 50 55 60 Asp Arg He Tyr Asn Trp Ala Arg Gin Asn Gly List Gin Val Arg Gly 65 70 75 80 His Thr Leu Ala Trp His Ser Gin Gin pro Gin Trp With Gin Asn Leu 85 90 95 ser Gly Gin Ala Leu Arg Gin Ala Met lie Asn His lie Gin Gly val 100 105 HO Met ser Tyr Tyr Arg Gly Lys lie lie A Trp Asp Val Val Asn Glu 115 120 125 Ala Phe Glu Asp Gly Asn Ser Gly Arg Arg cys Asp Ser Asn Leu Gin 130 135 140 Arg Thr Thr Gly Asn Asp Trp lie Glu Val Ala Phe Arg Thr Ala Arg Gin 145 150 155 160 Gly Asp pro Ser Ala Lys Leu Cys Tyr Asn Asp Tyr Asn lie Glu Asn 165 170 175 • ·. . Trp Asn Ala Ala List Thr Gin Ala Val Tyr Asn With Val Arg Asp Phe: ϊ Ϊ 180 185 190 ## aa • a • «« * ". * List Ser Arg Gly Val Pro Lie Asp cys Val Gly Phe Gin Ser His Phe :: 195 200 205 Ml IM 'IV, Asn Ser Gly Asn Pro Tyr Asn Pro Asn Phe Arg Thr Thr Leu Gin Gin:: 210 215 220 Ml phe Ala Ala Leu Gly Val Asp Val Glu Val Thr Glu Leu Asp lie Glu * : * 225 230 235 240 MM • · a at * 1 * Asn Ala Pro Ala Gin Thr Tyr Ala ser val lie Arg Asp cys Leu Ala.: 245 250 255 • • M a ·· val Asp Arg Cys Thr Gly lie Thr val Trp Gly val Arg Asp ser Asp 260 265 270 aaaaaa IM ·: ··· ser Trp Arg Ser Tyr Gin Asn Pro Leu Le Phe Asp Asn Asn Gly Asn 275 280 285 Page 19 AB_Enzymes.ST25 118770 Light List Gin Ala Tyr Tyr Ala val Leu Asp Ala Leu Asn 290 295 300 <210> 19 <211> 406 <212> PRT <213> Nonomuraea flexuosa <220> <221> AM50 core + linker + alpha / beta domains of the tail <222> CD - · C406) <400> 19 Ala Ala Ser Thr Leu Ala Glu Gly Ala Ala Gin His Asn Arg Tyr Ph e 15 10 15 Gly val Ala lie Ala Ala Asn Arg Leu Thr Asp ser val Tyr Thr Asn 20 25 30 lie Ala Asn Arg Glu Phe Asn ser Val Thr Ala Glu Asn Glu Met Lys 35 40 45 lie Asp Ala Thr Glu Pro Gin Gin Gly Arg Phe Asp Phe Thr Gin Ala 50 55 60 Asp Arg lie Tyr Asn Trp Ala Arg Gin Asn Gly List Gin Val Arg Gly 65 70 75 80 His Thr Leu Ala Trp His Ser Gin Gin Pro Gin Trp With Gin Asn Leu 85 90 95 . * * ser Gly Gin Ala Leu Arg Gin Ala With lie Asn His lie Gin Gly val: ioo 105 110 ·· ♦ · • · • · I With Ser Tyr Tyr Arg Gly List lie Pro He Trp Asp Val val Asn Glu j: 1X5 120 125 • t · • · · Ala Phe Glu Asp Gly Asn Ser Gly Arg Arg Cys Asp Ser Asn Leu Gin :: 130 135 140 Arg Thr Gly Asn Asp Trp lie Glu val Ala Phe Arg Thr Ala Arg Gin ··· 145 150 155 160 ···· ·· * • t ***** Gly Asp Pro Ser Ala Lys Leu Cys Tyr Asn Asp Tyr Asn lie Glu Asn.:. 165 170 175 * ··· ·· »Trp Asn Ala Ala List Thr Gin Ala val Tyr Asn With val Arg Asp Phe • 180 185 190 • · * • · * ··· .... Ϊ List Ser Arg Gly val Pro He Asp Cys Val Gly phe Gin Ser His Phe * * 19? 200 205 Page 20 AB_Enzymes.ST25 118770 Asn ser Gly Asn Pro Tyr Asn Pro Asn Phe Arg Thr Thr Leu Gin Gin 210 215 220 Phe Ala Ala Leu Gly vai Asp Vai Glu val Thr Glu Leu Asp lie Glu 225 230 235 240 Asn Ala Pro Ala Gin Thr Tyr Ala Ser Val lie Arg Asp cys Leu Ala 245 250 255 val Asp Arg cys Thr Gly He Thr val Trp Gly Val Arg Asp Ser Asp 260 265 270 Ser Trp Arg ser Tyr Gin Asn Pro Leu Leu Phe Asp Asn Asn Gly Asn 275 280 285 List List Gin Ala Tyr Tyr Ala val Leu Asp Ala Leu Asn Glu Gly ser 290 295 300 Asp Asp Gly Gly Gly Pro Ser Asn Pro Pro Val Ser Pro Pro Pro Gly 305 310 315 320 Gly Gly Ser Gly Gin lie Arg Gly val Ala ser Asn Arg cys lie Asp 325 330 335 Val Pro Asn Gly Asn Thr Ala Asp Gly Thr Gin val Gin Leu Tyr Asp 340 345 350 cys His Ser Gly Ser Asn Gin Gin Trp Thr Tyr Thr Ser Gly Glu 355 360 365 *,. phe Arg lie Phe Gly Asn Lys cys Leu Asp Ala Gly Gly ser $ er Asn ::: 370 375 380 • · · J: .Y Gly Ala val Val Gin lie Tyr ser Cys Trp Gly Gly Ala Asn Gin Lys:: 385 390 395 400 »··« ·· "" Trp Glu Leu Arg Ala Asp:: 405 Ml. <210> 20 *: · <211> 366 * ::: <2i2> prt:: <213> Nonomuraea flexuosa Ml • '<220>. ···. <221> AM50 core + linker + alpha domain of the tail * ... · <222> Cl) .. (366): <400> 20 ··· ·! ··; Ala Ala Ser Thr Leu Ala Glu Gly Ala Ala Gin His Asn Arg Tyr phe 15 10 15 page 21 AB_Enzymes.ST25 118770 Gly Vai Ala Ile Ala Ala Asn Arg Leu Thr Asp Ser vai Tyr Thr Asn 20 25 30 Ile Ala Asn Arg Glu Phe Asn Ser Vai Thr Ala Glu Asn Glu With List 35 40 45 Ile Asp Ala Thr Glu Pro Gin Gly Gly Arg Phe Asp Phe Thr Gin Ala 50 55 60 asp Arg Ile Tyr Asn Trp Ala Arg Gin Asn Gly List Gin vai Arg Gly 65 70 75 80 Hi s Thr Leu Ala Trp Hi s Ser Gin Gin pro Gin Trp Met Gin Asn Leu 85 90 95 ser Gly Gin Ala Leu Arg Gin Ala Met Ile Asn His Ile Gin Gly vai 100 105 110 With Ser Tyr Tyr Arg Gly Lys Ile Pro Ile Trp Asp from Asn Glu 115 120 125 Ala Phe Glu Asp Gly Asn Ser Gly Arg Arg Cys Asp Ser Asn Leu Gin 130 135 140 Arg Thr Gly Asn Asp Trp Ile Glu Vai Ala Phe Arg Thr Ala Arg Gin 145 150 155 160 Gly Asp Pro Ser Ala Lys Leu Cys Tyr Asn Asp Tyr Asn Ile Glu Asn 165 170 175 •. * 'Trp Asn Ala Ala Lys Thr Gin Ala va Tyr Asn With vai Arg Asp Phe •. ·; 180 185 190 »M · · • * · *** * List Ser Arg Gly vai Pro Ile Asp Cys vly Gly Phe Gin Ser His Phe:: 195 200 205 • · · • · · **** Asn Ser Gly Asn Pro Tyr Asn Pro Asn Phe Arg Thr Thr Leu Gin Gin:: 210 215 220 ···. Phe Ala Ala Leu Gly vai Asp vai Glu vai Thr Glu Leu Asp Ile Glu ·: · 225 230 235 240 »* ·· ··· * · *" ** Asn Ala Pro Ala Gin Thr Tyr Ala Ser vai Ile Arg Asp cys Leu Ala 245 250 255 * «« vai Asp Arg Cys Thr Gly Ile Thr vai Trp Gly vai Arg Asp Ser Asp ·, 260 265 270 «· ·« · ··· ·: ··· Ser Trp Arg ser Tyr Gin Asn Pro Leu Leu Phe Asp Asn Asn Gly Asn 275 280 285 Page 22 AB_Enzymes.ST25 118770 L ^ s A ^ a Τ ^ Γ Τ ^ Γ A ^ a Va ^ Leu ASP A3a Leu Asn Glu Gly Ser 290 295 300 Asp Asp Gly Gly Gly pro ser Asn pro Pro vai Ser Pro pro pro Gly 305 310 315 320 Gly Gly Ser Gly Gin He Arg Gly Vai Ala ser Asn Arg Cys lie Asp 323 330 335 val Pro Asn Gly Asn Thr Ala Asp Gly Thr Gin val Gin Leu Tyr Asp 340 345 350 Cys His Ser Gly Ser Asn Gin Gin Trp Thr Tyr Thr Ser Ser 355 360 365 <210> 21 <211> 4 <212> PRT <213> Nonomuraea flexuosa <220> <221> A synthetic linker sequence coding for a Kex2-like protease cleavage signal Lys-Arg included in all the constructs to ens ure cleavage of the fusion protein. <222> Cl) .. (4) <400> 21 Arg Asp List Arg 1 <210> 22 ·: * ·: <2ii> 5 <212> PRT:: * · <213> Nonomuraea flexuosa M · · Λ « • · · <220> ϊ: <221> An additional sequence preceding the Kex2 site in the expression * · * cassette pALKl264, pALKll31 and pALKll34 * ·· <222> (1) .. (5) ···· <400 > 22 • · · Gly Gin cys Gly Gly. 1 5 Mt ····: ***: <2io> 23 *: * <211> 6.:. <212> PRT ...: <213> Nonomuraea flexuosa • · · * · * <220> •: * j <221> The N-terminal sequence of mature Nf XynllA and recombinant ··· XynllA polypeptides, named as r33. 4 kDa, r23.8 koa and r22.0 kDa <222> (1) .. (6) Page 23 118770 AB_Enzymes.ST25 <400> 23 Asp Thr Thr lie Thr Gin 1 5 <210> 24 <211> 6 < 212> DNA <213> Nonomuraea flexuosa <220> <221> An Nrui recognition site introduced into a Kex2 linker <222> CD. · ¢ 6) <400> 24 tcgcga 6 <210> 25 <211> 12 <212> DNA <213> Nonomuraea flexuosa <220> <221> Kex2 linker which facilitates the construction of mergers <222> (I) .. C12 ) <400> 25 cgcgacaagc gc 12 • · • · · · · · · · ·· 1 · · · »· · · · ·· · *** • · • 1 * ·· • t · ···· ··· • · · · ··· · »· ···· ♦ ♦ · · ·« «· <· ··» · * ·· • · • · »I · a 1 I • 1 · · 1 «•« page 24