ES2961613T3 - Methods and compositions for the regulation of transgene expression - Google Patents

Abstract

Nucleases and methods of using these nucleases to express a transgene from a safe harbor locus in a secretory tissue, and clones and animals derived therefrom. (Automatic translation with Google Translate, without legal value)

Description

DESCRIPTION

Methods and compositions for the regulation of transgene expression

Cross reference to related requests

The present application claims the benefit of US Provisional Application No. 61/537,349 filed on September 21, 2011; US Provisional Application 61/560,506, filed November 16, 2011; and US Provisional Application 61/670,490, filed July 11, 2012.

Technical field

The present disclosure is in the field of genome editing.

Background

Gene therapy has enormous potential for a new era of human therapeutics. These methodologies will allow for the treatment of conditions that have not been addressed by conventional medical practice. Gene therapy can include the many variations of genome editing techniques such as alteration or correction of a genetic locus and insertion of an expressible transgene that can be controlled by a specific exogenous promoter fused to the transgene or by the endogenous promoter that It is located at the insertion site in the genome.

Transgene delivery and insertion are examples of obstacles that must be resolved for any real implementation of this technology. For example, although there are a variety of gene delivery methods potentially available for therapeutic use, all involve important trade-offs between safety, durability, and level of expression. Methods that provide the transgene as an episome (e.g., basic adenovirus, AAV, and plasmid-based systems) are generally safe and can produce high levels of initial expression, however, these methods lack robust episomal replication, which may limit the duration of expression in mitotically active tissues. In contrast, delivery methods that result in random integration of the desired transgene (e.g., lentivirus integration) provide longer-lasting expression but, due to the nontargeted nature of random insertion, may result in deregulated growth in recipient cells, potentially giving rise to neoplasia through the activation of oncogenes in the vicinity of the randomly integrated transgenic cassette. On the other hand, although transgenic integration prevents replication-driven loss, it does not prevent eventual silencing of the exogenous promoter fused to the transgene. Over time, such silencing results in reduced transgene expression for most random insertion events. Furthermore, integration of a transgene rarely occurs in each target cell, which can make it difficult to achieve a sufficiently high level of expression of the transgene of interest to achieve the desired therapeutic effect.

In recent years, a new strategy for transgene integration has been developed that uses site-specific nuclease cleavage to bias insertion at a chosen genomic locus (see, for example, co-owned US Patent 7,888 .121). This approach offers the prospect of improved transgene expression, increased safety and durability of expression, compared to classical integration approaches, as it allows accurate transgene positioning with minimal risk of gene silencing or activation of nearby oncogenes.

One approach involves the integration of a transgene into its cognate locus, for example, the insertion of a wild-type transgene into the endogenous locus to correct a mutant gene. Alternatively, the transgene can be inserted into a non-cognate locus specifically chosen for its beneficial properties. See, for example, US Patent Publication No. 20120128635 which relates to targeted insertion of a factor IX (FIX) transgene. Targeting the cognate locus may be useful if it is desired to replace the expression of the endogenous gene with the transgene while maintaining the expression control exerted by the endogenous regulatory elements. Specific nucleases that cleave within or near the endogenous locus can be used and the transgene can be integrated into the cleavage site by homology-directed repair (HDR) or by end capture during non-homologous end joining (NHEJ). The integration process is determined by the use or non-use of regions of homology in the transgene donors between the donor and the endogenous locus.

Alternatively, the transgene can be inserted into a specific “safe harbor” location in the genome that can use the promoter found at that safe harbor locus or allow regulation of transgene expression by an exogenous promoter that is fused to the transgene before insertion. Several such "safe harbor" loci have been described, including the AAVS1 and CCR5 genes in human cells and Rosa26 in murine cells (see, for example, co-owned US Patent Application Nos. 20080299580; 20080159996 and 201000218264 ). As described above, safe harbor-specific nucleases can be used such that the transgenic construct is inserted by HDR- or NHEJ-driven processes.

A particularly attractive application of gene therapy involves the treatment of disorders that are caused by an insufficiency of a secreted gene product or that can be treated by the secretion of a therapeutic protein. Such disorders are potentially addressable through delivery of a therapeutic transgene to a modest number of cells, with the condition that each recipient cell expresses a high level of the therapeutic gene product. In such a scenario, alleviating the need for gene delivery to large numbers of cells may enable the successful development of gene therapies for otherwise intractable indications. Such applications would require permanent, safe and very high levels of transgene expression. Therefore, the development of a safe harbor that exhibits these properties would provide substantial utility in the field of gene therapy.

A considerable number of disorders are caused by a deficiency of a secreted gene product or can be treated by the secretion of a therapeutic protein. Coagulation disorders, for example, are fairly common genetic disorders where the factors of the coagulation cascade are aberrant in some way, that is, lack of expression or production of a mutant protein. Most bleeding disorders cause hemophilias such as hemophilia A (factor VIII deficiency), hemophilia B (factor IX deficiency), or hemophilia C (factor XI deficiency). Treatment of these disorders is often related to severity. For mild hemophilias, treatments may include therapies designed to increase expression of the underexpressed factor, while for more severe hemophilias, therapy involves regular infusion of the missing clotting factor (often 2-3 times per week) to prevent episodes. hemorrhagic. Patients with severe hemophilia are often discouraged from participating in many types of sports and must take extra precautions to avoid everyday injuries.

Alpha-1 antitrypsin (A1AT) deficiency is an autosomal recessive disease caused by defective production of alpha 1-antitrypsin leading to inadequate levels of A1AT in the blood and lungs. It may be associated with the development of chronic obstructive pulmonary disease (COPD) and liver disorders. Currently, treatment of diseases associated with this deficiency may involve infusion of exogenous A1AT and lung or liver transplantation.

Lysosomal storage diseases (LSDs) are a group of rare monogenic metabolic diseases characterized by the lack of individual functional lysosomal proteins normally involved in the breakdown of lipids, glycoproteins and waste mucopolysaccharides. These diseases are characterized by an accumulation of these compounds in the cell since it is unable to process them for recycling due to the malfunction of a specific enzyme. Common examples include Gaucher (glucocerebrosidase deficiency, gene name: GBA), Fabry (galactosidase a deficiency: GLA), Hunter (iduronate-2-sulfatase deficiency: IDS), Hurler alpha-L iduronidase: IDUA) and Niemann-Pick (sphingomyelin phosphodiesterase 1 deficiency: SMPD1). When grouped together, LSDs have a population incidence of approximately 1 in every 7,000 births. These diseases have devastating effects on the people affected by them. They are usually first diagnosed in infants who may have characteristic facial and body growth patterns and may have moderate to severe mental retardation. Treatment options include enzyme replacement therapy (ERT) where the missing enzyme is given to the patient, usually through intravenous injection in large doses. Such treatment is only to treat symptoms and is not curative, therefore patients must receive a repeated dose of these proteins for the rest of their lives and can potentially develop neutralizing antibodies to the injected protein. These proteins often have a short serum half-life, so the patient must also endure frequent infusions of the protein. For example, patients with Gaucher disease receiving the Cerezyme® (imiglucerase) product should receive infusions three times a week. The production and purification of the enzymes are also problematic, making treatments very expensive (>$100,000 per year per patient).

Type I diabetes is a disorder in which immune-mediated destruction of pancreatic beta cells results in a profound deficiency of insulin, which is the main secreted product of these cells. Restoration of baseline insulin levels provides substantial relief from many of the more serious complications of this disorder, which can include "macrovascular" complications involving the large vessels: ischemic heart disease (angina and myocardial infarction), stroke, and peripheral vascular disease. , as well as "microvascular" complications from damage to small blood vessels. Microvascular complications may include diabetic retinopathy, which affects the formation of blood vessels in the retina of the eye and can lead to visual symptoms, reduced vision and potentially blindness, and diabetic nephropathy, which can involve scarring changes in kidney tissue, loss of of small or progressively increasing amounts of protein in the urine and, eventually, chronic kidney disease requiring dialysis. Diabetic neuropathy can cause numbness, tingling and pain in the feet and, along with vascular disease in the legs, contributes to the risk of diabetes-related foot problems (such as diabetic foot ulcers) that can be difficult to treat and , sometimes requiring amputation as a result of associated infections.

Antibodies are secreted protein products whose binding plasticity has been exploited for the development of a wide range of therapies. Therapeutic antibodies can be used for the neutralization of target proteins that directly cause disease (e.g., VEGF in macular degeneration), as well as for the highly selective destruction of cells whose persistence and replication endanger the host (e.g., cancer cells , as well as certain immune cells in autoimmune diseases). In such applications, therapeutic antibodies take advantage of the body's normal response to its own antibodies to achieve selective destruction, neutralization or elimination of target proteins or cells carrying the antibody's target antigen. Therefore, antibody therapy has been widely applied to many human diseases including oncology, rheumatology, transplantation, and ocular diseases. Examples of antibody therapies include Lucentis® (Genentech) for the treatment of macular degeneration, Rituxan® (Biogen Idec) for the treatment of non-Hodgkin lymphoma, and Herceptin® (Genentech) for the treatment of breast cancer. Albumin is a protein that is produced in the liver and secreted into the blood. In humans, serum albumin comprises 60% of the proteins found in the blood and its function appears to be to regulate blood volume by regulating colloidal osmotic pressure. It also serves as a carrier for molecules with low solubility, for example, lipid-soluble hormones, bile salts, free fatty acids, calcium, and transferrin. Additionally, serum albumin carries therapeutic products, including warfarin, fenobutazone, clofibrate, and phenytoin. In humans, the albumin locus is highly expressed, resulting in the production of approximately 15 g of albumin protein each day. Albumin has no autocrine function and there does not appear to be any phenotype associated with monoallelic inactivations and only mild phenotypic observations are found for biallelic inactivations (see Watkins et al (1994) Proc Natl Acad Sci USA 91:9417).

Albumin has also been used coupled to therapeutic reagents to increase the serum half-life of the therapeutic product. For example, Osborn et al (J Pharm Exp Thera (2002) 303(2):540) disclose the pharmacokinetics of an interferon alpha serum albumin fusion protein and demonstrate that the fusion protein had approximately 140-fold slower elimination, such that the half-life of the fusion was 18 times longer than that of the interferon alpha protein alone. Other examples of recently developed therapeutic proteins that are albumin fusions include Albulin-G™, Cardeva™ and Albugranin™ (Teva Pharmaceutical Industries, fused to Insulin, b-type natriuretic or GCSF, respectively), Syncria® (GlaxoSmithKline, fused to peptide-1 similar to Glucagon) and Albuferon a-2B, fused with IFN-alpha (see Current Opinion in Drug Discovery and Development, (2009), vol 12, No. 2. p. 288). In these cases, Albulin-G™, Cardeva™ and Syncria® are all fusion proteins where albumin is at the N-terminus of the fusion, while Albugranin™ and Albuferon alfa 2G are fusions where albumin is at the C-terminus. of the merger.

Maederet al.(Mol Cell. (2008) 31(2): 294) describe a publicly available strategy for constructing multi-finger arrays.

Li et al (Nature (2011) 475 (7355): 217) report zinc finger nucleases (ZFNs) that can induce double-strand breaks at a target locus when administered directly to the mouse liver.

Therefore, there remains a need for additional methods and compositions that can be used to express a desired transgene at a therapeutically relevant level, while avoiding any associated toxicity, and that can limit expression of the transgene to the desired tissue type, e.g. For example, to treat genetic diseases such as hemophilias, diabetes, lysosomal storage diseases and A1AT deficiency. Additionally, there remains a need for additional methods and compositions to express a desired transgene at a therapeutically relevant level for the treatment of other diseases such as cancers.

Summary

The invention provides a pair of zinc finger nucleases that cleave an albumin gene, wherein the pair of zinc finger nucleases comprises a first and a second zinc finger nuclease, wherein the first zinc finger nuclease comprises multiple engineered zinc finger binding domains that bind to a target site in SEQ ID NO: 127 and the second zinc finger nuclease comprises multiple engineered zinc finger binding domains that bind to a target site in SEQ ID NO: 128, as set forth in the claims.

Cleavage domains and cleavage half-domains used in zinc finger nucleases (ZFNs) can be obtained, for example, from various restriction endonucleases and/or homing endonucleases. In one embodiment, the cleavage half-domains are derived from a Type IIS restriction endonuclease (e.g., Fok I).

Also described herein, but not explicitly claimed, is a transcription activator-like effector (TALE) protein that binds to the target site in a region of interest (e.g., a gene albumin) in a genome, wherein the TALE comprises one or more modified TALE binding domains. The TALE may be a nuclease (TALEN) that cleaves a target genomic region of interest, wherein the TALEN comprises one or more engineered TALE DNA binding domains and a nuclease cleavage domain or half-domain. Cleavage domains and half-domains can be obtained, for example, from various restriction endonucleases and/or homing endonucleases. The cleavage half-domains may be derived from a type IIS restriction endonuclease (e.g., Fok I). The DNA-binding domain of TALE may recognize a target site on an albumin gene, e.g., the DNA-binding domain. of TALE having the target sequence shown in a single row of Table 12.

As set forth in the claims, the ZFN pair cleaves an albumin gene. Also described herein, but not explicitly claimed, are ZFNs and/or TALENs that bind and/or cleave a safe harbor gene, for example, a CCR5 gene, a PPP1R12C gene (also known as AAVS1) or a genRosa. See, for example, US Patent Publications No. 20080299580; 20080159996 and 201000218264. Also described herein are compositions comprising one or more of the zinc finger nucleases and/or TALE described herein, such as a composition comprising one or more zinc finger nucleases and/or or TALE in combination with a pharmaceutically acceptable excipient.

One or more polynucleotides encoding the ZFN pair are also provided as set forth in the claims. The polynucleotide or polynucleotides may be, for example, mRNA. In some aspects, the mRNA may be chemically modified (see, for example, Kormann et al, (2011) Nature Biotechnology 29(2):154-157).

An isolated cell comprising the ZFN pair is also provided, as set forth in the claims. The cell may be stably transformed or transiently transfected or a combination thereof with one or more ZFN expression vectors. In one embodiment, the host cell is an embryonic stem cell. In another embodiment, the host cell may further comprise an exogenous polynucleotide donor sequence. Non-limiting examples of suitable host cells include eukaryotic cells or cell lines such as secretory cells (for example, liver cells, mucosal cells, salivary gland cells, pituitary cells, etc.), blood cells (red blood cells), stem cells, etc.

In another aspect, provided herein is an in vitro method for cleaving an albumin gene in a cell, as defined in the claims.

In other embodiments, a genomic sequence is replaced in any target gene, for example, using a ZFN (or a vector encoding such a ZFN) as described herein and a "donor" sequence (e.g., transgene) that is inserted into the gene after targeted cleavage with ZFN. The donor sequence may be present in the ZFN vector, present in a separate vector (e.g. Ad or LV vector) or, alternatively, may be introduced into the cell using a different nucleic acid delivery mechanism. Such insertion of a donor nucleotide sequence into the target locus (albumin gene) results in the expression of the transgene carried by the donor under the control of the genetic control elements of the target locus (albumin). In some aspects, insertion of the transgene of interest, for example, into an albumin gene results in the expression of an intact exogenous protein sequence and lacks albumin-encoded amino acids. In other aspects, the exogenously expressed protein is a fusion protein and comprises amino acids encoded by the transgene and by an albumin gene (e.g., from the endogenous target locus or, alternatively from albumin-encoding sequences in the transgene). In some cases, the albumin sequences will be present in the amino (N) terminal part of the exogenous protein, while in others, the albumin sequences will be present in the carboxy (C) terminal part of the exogenous protein. In other cases, the albumin sequences will be present in the N- and C-terminal parts of the exogenous protein. The albumin sequences may include full-length wild-type or mutant albumin sequences or, alternatively, may include partial albumin amino acid sequences. In certain embodiments, the albumin sequences (full or partial length) serve to increase the serum half-life of the polypeptide expressed by the transgene to which it is fused and/or as a carrier. In some embodiments, the albumin-transgene fusion is located at the endogenous locus within the cell. Also described herein, but not explicitly claimed, the coding sequence of the albumin transgene is inserted into a safe harbor within a genome, for example, a safe harbor selected from the AAVS1, Rosa, HPRT or CCR5 locus (see co-owned US Patent Publications Nos. 20080299580; 20080159996 and 201000218264 and US Provisional Patent Application No. 61/556,691).

Also provided are pairs of zinc finger nuclease and one or more polynucleotides for use in a method of treating the human or animal body, where a transgene encoding a therapeutic protein is integrated into the albumin gene, as defined in The claims. The transgene may encode a protein such that methods can be used for the production of deficient or absent protein (e.g., "protein replacement"). In some cases, the protein may be involved in the treatment of a lysosomal storage disease. Other therapeutic proteins may be expressed, including protein therapies for conditions as diverse as epidermolysis bullosa or AAT deficiency emphysema. In other aspects, the transgene may comprise sequences (e.g., modified sequences) such that the expressed protein has characteristics that confer novel and desirable characteristics (increased half-life, modified plasma clearance characteristics, etc.). The modified sequences may also include amino acids derived from the albumin sequence. In some aspects, transgenes encode therapeutic proteins, therapeutic hormones, plasma proteins, antibodies, and the like. In some aspects, transgenes may encode proteins involved in blood disorders, such as coagulation disorders.

In any of the methods or compositions described herein, the cell containing the modified locus (albumin locus) may be a stem cell. Specific stem cell types that can be used with the methods and compositions of the invention include embryonic stem cells (ESCs), induced pluripotent stem cells (iPsCs), and hepatic or liver stem cells. iPSCs can be obtained from patient samples and normal controls where patient-derived iPSCs can be mutated to a normal gene sequence in the gene of interest, or normal cells can be altered to the known disease allele in the gene of interest. Similarly, liver stem cells can be isolated from a patient. These cells are then modified to express the transgene of interest, expanded, and then reintroduced into the patient.

In any of the methods described herein, the polynucleotide encoding zinc finger nucleases may comprise DNA, RNA, or combinations thereof. In certain embodiments, the polynucleotide comprises a plasmid. In other embodiments, the polynucleotide encoding the nuclease comprises mRNA.

A kit, comprising the ZFNs of the disclosure, is also described. The kit may comprise nucleic acids encoding zFn, (e.g., RNA molecules or genes encoding nucleases contained in a suitable expression vector), donor molecules, suitable host cell lines, instructions for performing the methods, and the like.

Brief description of the drawings

Figure 1, panels A and B, are gels representing the results of a Cel-I mismatch assay (Surveyor™, Transgenomic) that quantifies the extent to which ZFN excision from an endogenous chromosomal target, followed by imperfect repair through NHEJ, has produced small insertions or deletions ("indels") of the targeted locus. For a description of the assay see Hortonet al.Methods Mol Biol. (2010) 649:247-56. Figure 1A shows the results using expression constructs for ZFN targeting the mouse albumin gene that were transfected into Neuro2A cells, where the cells were treated for 3 days at 37°C after transfection and then analyzed for the fraction of target sites modified by Cel-I analysis. Figure 1B shows the results for the same ZFNs and cells as Figure 1A except that the cells were subjected to hypothermic shock (30°C) for 3 days of growth post-transfection. The percentage of mismatches, or % indels, shown at the bottom of the lanes, is a measure of ZFN activity and demonstrates that mouse albumin-specific ZFNs are capable of inducing up to 53% indels. after cleavage of its endogenous chromosomal target in Neuro 2A cells.

Figure 2, panels A and B, are gels representing the results of a Cel-I mismatch assay carried out on canine D17 cells transfected with constructs expressing the canine albumin-specific ZFN pair SBS 33115/SBS34077 at two concentrations. of plasmid DNA, 20 or 40 ng. Figure 2A shows the results after 3 days, while Figure 2B shows the results after 10 days. This ZFN pair was able to induce indels in ~25-30% of the target site sequences at day 3.

Figure 3, panels A and B, show alignments of the albumin genes from a variety of species of interest. Figure 3A shows an alignment of exon 1 and the 5' region of intron 1 from human (H. sapiens, SEQ ID NO: 160), Indian macaque monkeys (M. mulatta, SEQ ID NO: 73), marmoset (C. jacchus,SEQ ID N<o>:74), dog (C.familiaris, S<e>Q ID NO:75), rat (R. norvegicus,SEQ ID NO:75) and mouse (M. musculus ,SEQ ID NO:76). 3<b>shows an alignment of the remainder of intron 1 and a small fragment of exon 2. This region includes Locus 1 to Locus 5 of human (SEQ ID NO:161), Indian macaque monkeys (SEQ ID NO:77 ), marmoset (SEQ ID NO:78), dog (SEQ ID NO:79), rat (SEQ ID NO:80) and mouse (M. musculus, SEQ ID NO:81) which are loci in the chosen albumin gene to go to ZFN. The depicted sequences show the ATG start codon (large box in Figure 3A) and the boundaries of exon 1 and intron 1 (Figure 3A) and intron 1 and exon 2 (Figure 3B).

Figure 4, panels A and B, depict the results of a Cel-I mismatch assay performed on genomic DNA from liver tissue biopsied from mice injected with albumin-specific ZFNs expressed from a hepatotrophic AAV8 vector. The results come from 10 wild-type mice (numbers 273-282) that were injected intravenously by tail vein injection with two sets of ZFN pairs (pair 1: SBS30724 and SBS30725 and pair 2: SBS30872 and SBS30873). Figure 4A is a gel quantifying the indels present in the amplicon spanning the pair 1 site and Figure 4B is another gel quantifying the indels present in the amplicon spanning the pair 2 site. The percentage of albumin genes showing z Fn-induced modifications in liver biopsies is indicated at the bottom of the lanes and demonstrates that ZFN albumin pairs are capable of modifying up to 17% of the targets when nucleases are delivered in vivo.

Figure 5, panels A and B, depict the results of a Cel-I mismatch assay performed on genomic DNA from liver tissue biopsied from mice injected with albumin-specific ZFNs expressed from different chimeric AAV vectors. Experimental details are provided in Example 5. Figure 5A demonstrates that ZFNs can cleave the target albumin in the liver in vivo when introduced into the animal via AAV-mediated gene delivery. The percentage of albumin genes carrying ZFN-induced modifications in the liver biopsies was in the range of up to 16 percent. Figure 5B shows a Western blot of liver tissue using anti-Flag or antip65 antibodies. The open reading frames encoding ZFNs were fused to a sequence encoding a polypeptide FLAG tag. Therefore, anti-Flag antibody detected ZFNs and demonstrated ZFN expression in the mice that received ZFN. The anti-p65 antibody served as a loading control in these experiments and indicated that comparable amounts of protein were loaded into each lane.

Figure 6 shows the results of a mouse study in which groups of mice were treated with the mouse albumin-specific ZFN 30724/30725 pair by administering different doses of different AAV serotypes and then genetic modification was evaluated using the assay. Cel-I. The AAV serotypes tested in this study were AAV2/5, AAV2/6, AAV2/8.2, and AAV2/8 (see text for details). Dose levels were in the range of 5e10 to 1e12 viral genomes and three mice per group were injected. The viral genomes present per diploid cell were also calculated and are indicated at the bottom of each lane. The percentage of indels induced by each treatment is also indicated below each lane and demonstrates that this ZFN pair is capable of cleaving the albumin locus. Control mice were injected with phosphate-buffered saline. A non-specific band is also indicated in the figure.

Figure 7 is a graph depicting the expression of human factor IX (F.IX) from a transgene inserted into the mouse albumin locus in vivo. A human F.IX donor transgene was inserted into the mouse albumin locus in the intron 1 or intron 12 after excision with specific ZFNs from mouse albumin in wild-type mice. The graph shows the expression levels of F. IX over a period of 8 weeks after injection of the vectors. Pairs of z>F<n targeting mouse albumin intron 1 or intron 12 were used in>this experiment, as well as ZFNs targeting a human gene as a control. The donor F.IX gene was designed to be used after insertion into intron 1 and is therefore not adequately expressed when inserted into intron 12. The human F.IX transgene is expressed at a robust level for at least least 8 weeks after insertion into the mouse albumin intron 1 locus.

Figure 8, panels A and B, are graphs depicting the expression and functionality of the human F.IX gene in the plasma of hemophilic mice after ZFN-induced F.IX transgene insertion. The experiment described in Figure 7 was repeated in hemophilic mice using the albumin intron 1-specific ZFNs and the human F.IX donor. Two weeks after treatment, the expression level in serum (Figure 8A) and clotting time (Figure 8B) were analyzed. Expression of the human F.IX transgene in hemophilic mice was able to restore clotting time to that of normal mice.

Figure 9 (SEQ ID NO:82) provides a segment of the human albumin gene sequence spanning parts of exon 1 and intron 1. Horizontal bars above the sequence indicate the target sites of zinc finger nucleases.

Figure 10 shows an alignment of a segment of the albumin genes in intron 1 of a variety of primate species including human, Homo sapiens (SEQ ID NO: 154), cynomolgus macaque variants (where the sequences 'C' and ' S' are derived from two different genomic sequence sources):M. fascicularis_c(SEQ<ID NO: 155) and M. fascicularis_s (SEQ ID NO: 156) and Indian macaque, M mulatta>(S<e>Q<ID NO: 157). Figure>shows the DNA target locations of albumin-specific TALENs (indicated by the horizontal bars above the sequence).

Figure 11, panels A to C, shows the results of a Cel-I assay performed on genomic DNA isolated from HepG2 cells treated with TALEN or ZFN targeting human albumin (Figures 11A and B) and the NHEJ activity of TALEN with different gaps. between gaps (Figure 11C). Nucleases were introduced into HepG2 cells by transient plasmid transfection and quantified 3 days later for target modification using the Cel-I assay. Two variations of the TALE DNA-binding domain were used, differing in the location of their C-terminal truncation points, version 17 and version 63 (see text). The pairs used are described in Table 10. Additionally, three pairs of ZFNs were also tested and the % of indels detected by the Cel 1 assay are indicated at the bottom of the lanes. Figure 11C is a graph depicting NHEJ activity in terms of the gap spacing (bp) between TALEN binding sites.

Figure 12, panels A, B, and C depicts the results for ZFN pairs targeting the rhesus macaque albumin locus. Figure 12A shows the percentage of NHEJ activity for the 35396/36806 pair compared to the 35396/36797 pair, tested in RF/6A cells in 3 independent experiments, all performed using a ZFN concentration of 400 ng. Figure 12B represents a dose titration for the two pairs, from 50 ng of each ZFN to 400 ng where samples were analyzed on day 3 post-transduction. The bottom half of Figure 12B shows another experiment comparing the two pairs on day 3 or day 10 using 400 ng ZFN. Figure 12C represents the results of the SELEX analysis (performed at a salt concentration of 100 mM) of the three ZFNs that were being compared where the size of the bar above the midline shows the results for that position that were expected (i.e. , a single bar with a value of 1.0 above the line would mean that every base at that position analyzed in the SELEX analysis was the expected base), while bars below the line indicate the presence of unexpected bases. Divided bars indicate the relative contributions of other bases.

Figure 13, panels A and B, demonstrate the insertion of a donor huGLa transgene (deficient in patients affected by Fabry disease) into the albumin locus in mice. Figure 13A shows a Western blot against the huGLa protein encoded by the transgene, where the arrow indicates the putative protein. Comparison of mouse samples from those mice that received both ZFN and donor (samples 1-1, 1-2, and 1-3) with samples that received only ZFN (4-1, 4-2, 4-3) or those who only received the huGLa donor ("hu Fabry donor"), samples 5-1 and 5-2 lead to the identification of a band matching the human liver lysate control. Figure 13B represents ELISA results using a huGLa-specific ELISA kit, where samples from mice were analyzed 14 or 30 days after virus introduction (see text for more details). Error bars represent standard deviations (n=3). The results demonstrate that mice that received both ZFN and donor had greater amounts of huGLa signal than those that received either ZFN alone or donor alone.

Detailed description

Disclosed herein are compositions and methods for modifying an endogenous albumin gene, for example, to express a transgene in a secretory tissue. In some embodiments, the transgene is inserted into an endogenous albumin gene to allow very high expression levels that are also limited to liver tissue. The transgene can encode any protein or peptide including those that provide therapeutic benefit.

Therefore, the methods and compositions of the invention can be used to express therapeutically beneficial proteins (from a transgene) from highly expressed loci in secretory tissues. For example, the transgene may encode a protein involved in blood disorders, for example, coagulation disorders and a variety of other monogenic diseases. In some embodiments, the transgene may be inserted into the endogenous albumin locus such that expression of the transgene is controlled by albumin expression control elements, resulting in liver-specific expression of the protein encoded by the transgene. in high concentrations. Proteins that may be expressed may include coagulation factors such as Factor VII, Factor VIII, Factor IX, Factor , in fact, any peptide or protein that, when expressed in this way, provides benefits.

Furthermore, any transgene can be introduced into patient-derived cells, for example, patient-derived induced pluripotent stem cells (iPSCs) or other types of stem cells (embryonic, hematopoietic, neural or mesenchymal as a non-limiting set) for use in a final implantation in secretory tissues. The transgene can be introduced into any region of interest in these cells, including, but not limited to, an albumin gene or a safe harbor gene. These altered stem cells can differentiate, for example, into hepatocytes and implant in the liver. Alternatively, the transgene can be targeted to the secretory tissue as desired through the use of viral delivery systems or other systems that target specific tissues. For example, use of the liver trophic adenovirus-associated virus (AAV) AAV8 vector as a delivery vehicle can result in integration of the transgene into the desired locus when specific nucleases are co-delivered with the transgene.

General

The implementation of the methods, as well as the preparation and use of the compositions disclosed herein employ, unless otherwise indicated, conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA and related fields as known within the art. These techniques are fully explained in the bibliography. See, for example, Sambrooket al.MOLECULAR CLONING: A LABO<r>A<t>ORY<m>A<n>UAL, Second Edition, Cold Spring Harbor Laboratory Press, 1989 and Third Edition, 2001; Ausubelet al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the METHODS IN ENZYMOLOGY series, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third Edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, "Chromatin" (P.M. Wassarman and A. P. Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, "Chromatin Protocols" (P.B. Becker, ed.) Humana Press, Totowa, 1999.

Definitions

The terms "nucleic acid", "polynucleotide" and "oligonucleotide" are used interchangeably and refer to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation and in single-stranded or double-stranded form. For the purposes of the present disclosure, these terms should not be construed as limiting the length of a polymer. The terms may encompass known analogues of naturally occurring nucleotides, as well as nucleotides that are modified at base, sugar and/or phosphate residues (e.g., phosphorothioate backbones). In general, an analog of a particular nucleotide has the same base pairing specificity; that is, an analogue of A will pair with T.

The terms "polypeptide", "peptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues. The term also applies to amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of the corresponding naturally occurring amino acids.

"Binding" refers to a sequence-specific, non-covalent interaction between macromolecules (for example, between a protein and a nucleic acid). Not all components of a binding interaction need to be sequence-specific (e.g., contacts with phosphate residues on a DNA backbone), as long as the interaction as a whole is sequence-specific. Such interactions are generally characterized by a dissociation constant (Kd) of 10-6 M-1 or less. "Affinity" refers to the strength of the binding: an increased binding affinity correlating with a lower Kd.

A "binding protein" is a protein that is capable of non-covalently binding to another molecule. A binding protein may bind to, for example, a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein) and/or a protein molecule (a protein-binding protein). ). In the case of a protein-binding protein, it can bind with itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more molecules of a different protein or proteins. A binding protein may have more than one type of binding activity. For example, zinc finger proteins have DNA binding, RNA binding, and protein binding activity.

A "zinc finger DNA binding protein" (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more fingers. zinc, which are regions of the amino acid sequence within the binding domain whose structure is stabilized through the coordination of a zinc ion. The term zinc finger DNA binding protein is frequently abbreviated as zinc finger protein or ZFP.

A "TALE DNA binding domain" or "TALE" is a polypeptide comprising one or more TALE domains/repeat units. The repeat domains are involved in the binding of TALE to its cognate target DNA sequence. A "repeat unit" (also called a "repeat") is typically 33-35 amino acids in length and exhibits at least sequence homology with other TALE repeat sequences within a naturally occurring TALE protein. See, for example, US Patent Publication No. 20110301073.

The zinc finger and TALE binding domains can be "engineered" to bind to a predetermined nucleotide sequence, for example, through engineering (altering one or more amino acids) of the helix region of recognition of a naturally occurring zinc finger or TALE protein. Therefore, engineered DNA binding proteins (zinc fingers or TALE) are proteins that are not naturally occurring. Non-limiting examples of methods for modifying DNA-binding proteins are design and selection. A designed DNA-binding protein is a protein that does not exist in nature and whose design/composition results primarily from rational criteria. Rational criteria for design include the application of substitution rules and computerized algorithms for processing information in a database that stores information from existing ZFP and/or TALE designs and joining data. See, for example, US Patents 6,140,081; 6,453,242; and 6,534,261; see also document WO<98/53058; document>W<o 98/53059; document WO 98/53060; WO 02/016536 and WO 03/016496 and US Publication No. 20110301073.

A "selected" zinc finger or TALE protein is a non-naturally occurring protein whose production results primarily from an empirical process such as phage display, interaction trapping, or hybrid selection. See, for example, US 5,789,538; US 5,925,523; document US 6,007,988; US 6,013,453; US 6,200,759; document WO 95/19431; document WO 96/06166; document WO 98/53057; document WO 98/54311; document WO 00/27878; document WO 01/60970; document WO 01/88197; WO 02/099084 and US Publication No. 20110301073.

"Recombination" refers to a process of exchanging genetic information between two polynucleotides. For the purposes of this disclosure, "homologous recombination (HR)" refers to the specialized form of such exchange that takes place, for example, during the repair of double-strand breaks in cells through homology-directed repair mechanisms. This process requires nucleotide sequence homology, uses a "donor" molecule for the repair of a "target" molecule (i.e., the one that experienced the double-strand break), and is variously known as "noncrossover genetic conversion" or "crossover conversion". short-tract genetics", because it leads to the transfer of genetic information from the donor to the target. Without wishing to be bound by theory, such transfer may involve error correction of the heteroduplex DNA that forms between the cleaved target and the donor and/or "synthesis-dependent strand hybridization," in which the donor is used to resynthesize the genetic information that will become part of the target and/or related processes. Such specialized HR often results in an alteration of the sequence of the target molecule such that part or all of the sequence of the donor polynucleotide is incorporated into the target polynucleotide.

In the methods of the disclosure, one or more targeted nucleases as described herein create a double-stranded break in the target sequence (e.g., cellular chromatin) at a predetermined site, and a "donor" polynucleotide, which has homology to the nucleotide sequence in the region of the break can be introduced into the cell. It has been shown that the presence of the double-strand break facilitates the integration of the donor sequence. The donor sequence may be physically integrated or, alternatively, the donor polynucleotide is used as a template to repair the break through homologous recombination, resulting in the introduction of all or part of the nucleotide sequence as in the donor into cellular chromatin. . Therefore, a first sequence in cellular chromatin can be altered and, in certain embodiments, converted to a sequence present in a donor polynucleotide. Therefore, use of the terms "replace" or "replacement" can be understood to represent the replacement of one nucleotide sequence by another, (i.e., the replacement of a sequence in the informational sense) and does not necessarily require replacement. physical or chemical exchange of one polynucleotide by another.

In any of the methods described herein, additional pairs of zinc finger proteins or TALENs can be used for additional double-stranded cleavage of additional target sites within the cell.

In certain embodiments of methods for targeted recombination and/or replacement and/or alteration of a sequence in a region of interest in cellular chromatin, a chromosomal sequence is altered by homologous recombination with an exogenous "donor" nucleotide sequence. Said homologous recombination is stimulated by the presence of a double-strand break in the cellular chromatin, if sequences homologous to the region of the break are present.

In any of the methods described herein, the first nucleotide sequence (the "donor sequence") may contain sequences that are homologous, but not identical, to the genomic sequences in the region of interest, thereby stimulating homologous recombination. to insert a non-identical sequence into the region of interest. Therefore, in certain embodiments, the portions of the donor sequence that are homologous to the sequences of the region of interest exhibit between about 80 and 99% (or any integer therebetween) of sequence identity with the genomic sequence. that is replaced. In other embodiments, the homology between the donor and genomic sequences is higher than 99%, for example if only 1 nucleotide differs between the donor and genomic sequences by more than 101 contiguous base pairs. In certain cases, a non-homologous part of the donor sequence may contain sequences that are not present in the region of interest, such that new sequences are introduced into the region of interest. In these cases, the non-homologous sequence is generally flanked by sequences of 50-1,000 base pairs (or any integer value in between) or any number of base pairs greater than 1,000, which are homologous or identical to the sequences in the region. of interest. In other embodiments, the donor sequence is not homologous to the first sequence and is inserted into the genome through non-homologous recombination mechanisms.

Any of the methods described herein can be used for partial or complete inactivation of one or more target sequences in a cell by targeted integration of the donor sequence that disrupts the expression of the gene or genes of interest. Cell lines with partially or completely inactivated genes are also provided.

Additionally, targeted integration methods as described herein can also be used to integrate one or more exogenous sequences. The exogenous nucleic acid sequence may comprise, for example, one or more genes or cDNA molecules, or any type of coding or non-coding sequence, as well as one or more control elements (for example, promoters). Furthermore, the exogenous nucleic acid sequence may produce one or more RNA molecules (e.g., small hairpin RNAs), inhibitory RNAs (iRNAs), microRNAs (miRNAs), etc.).

"Cleavage" refers to the breaking of the backbone of a DNA molecule. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-strand cleavage and double-strand cleavage are possible and double-strand cleavage can occur as a result of two single-strand cleavage events. DNA cleavage can result in the production of blunt ends or staggered ends. In certain embodiments, fusion polypeptides are used for targeted cleavage of double-stranded DNA.

A "cleavage half-domain" is a polypeptide sequence that, together with a second polypeptide (whether identical or different) forms a complex that has cleavage activity (preferably double-strand cleavage activity). The terms "first and second cleavage half domains"; "y-cleavage half-domains" and "left and right cleavage half-domains" are used interchangeably to refer to pairs of dimerizing cleavage half-domains.

An "engineered cleavage half-domain" is a cleavage half-domain that has been modified to form obligate heterodimers with another cleavage half-domain (e.g., another engineered half-domain). See also US Patent Publications Nos. 2005/0064474, 20070218528, 2008/0131962 and 2011/0201055.

The term "sequence" refers to a nucleotide sequence of any length, which may be DNA or RNA; It can be linear, circular or branched and can be single-stranded or double-stranded. The term "donor sequence" refers to a nucleotide sequence that is inserted into a genome. A donor sequence may be of any length, for example between 2 and 10,000 nucleotides in length (or any integer value thereof or greater than these), preferably between approximately 100 and 1,000 nucleotides in length (or any integer value thereof), more preferably between about 200 and 500 nucleotides in length.

"Chromatin" is the nucleoprotein structure that comprises the cellular genome. Cellular chromatin comprises nucleic acid, primarily DNA, and proteins, including histones and non-histone chromosomal proteins. The majority of eukaryotic cellular chromatin exists in the form of nucleosomes, where a nucleosome core comprises approximately 150 base pairs of DNA associated with an octamer comprising two each of histones H2A, H2B, H3 and H4; and linker DNA (of variable length depending on the organism) extends between nucleosome cores. A histone H1 molecule is usually associated with the linker DNA. For the purposes of the present disclosure, the term "chromatin" is intended to encompass all types of cellular nucleoprotein, both prokaryotic and eukaryotic. Cellular chromatin includes chromosomal and episomal chromatin.

A "chromosome" is a chromatin complex that comprises all or part of a cell's genome. The genome of a cell is often characterized by its karyotype, which is the collection of all the chromosomes that comprise the cell's genome. The genome of a cell may comprise one or more chromosomes.

An "episome" is a replicating nucleic acid, nucleoprotein complex or other structure comprising a nucleic acid that is not part of the chromosomal karyotype of a cell. Examples of episomes include plasmids and certain viral genomes.

A "target site" or "target sequence" is a nucleic acid sequence that defines a part of a nucleic acid to which a binding molecule will bind, provided that sufficient conditions exist for binding.

An "exogenous" molecule is a molecule that is not normally present in a cell, but can be introduced into a cell by one or more genetic, biochemical, or other methods. The "normal presence in the cell" is determined with respect to the developmental phase and the particular environmental conditions of the cell. Therefore, for example, a molecule that is present only during embryonic muscle development is an exogenous molecule with respect to an adult muscle cell. Similarly, a heat shock-induced molecule is an exogenous molecule with respect to a non-heat-shocked cell. An exogenous molecule may comprise, for example, a functional version of a malfunctioning endogenous molecule or a malfunctioning version of a normally functioning endogenous molecule.

An exogenous molecule may be, among other things, a small molecule, such as that generated by a combinatorial chemistry process, or a macromolecule such as a protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide, any modified derivative of the above molecules, or any complex comprising one or more of the above molecules. Nucleic acids include DNA and RNA, they can be double-stranded or single-stranded; They can be linear, branched or circular; and can be of any length. Nucleic acids include those capable of forming duplexes, as well as triplex-forming nucleic acids. See, for example, US Patent Nos. 5,176,996 and 5,422,251. Proteins include, but are not limited to, DNA binding proteins, transcription factors, chromatin remodeling factors, methylated DNA binding proteins, polymerases, methylases, demethylases, acetylases, deacetylases, kinases, phosphatases, integrases, recombinases, ligases, topoisomerases, gyrases and helicases.

An exogenous molecule may be the same type of molecule as an endogenous molecule, for example, an exogenous protein or nucleic acid. For example, an exogenous nucleic acid may comprise an infecting viral genome, a plasmid or episome introduced into a cell, or a chromosome that is normally present in the cell. Methods for introducing exogenous molecules into cells are known to those skilled in the art and include, but are not limited to, lipid-mediated transfer (i.e., liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion. , particle bombardment, calcium phosphate coprecipitation, DEAE dextran-mediated transfer, and viral vector-mediated transfer. An exogenous molecule can also be the same type of molecule as an endogenous molecule but derived from a different species from which the cell is derived. For example, a human nucleic acid sequence can be introduced into a cell line originally derived from a mouse or hamster.

In contrast, an "endogenous" molecule is one that is normally present in a particular cell at a particular developmental phase under particular environmental conditions. For example, an endogenous nucleic acid may comprise a chromosome, the genome of a mitochondria, a chloroplast or other organelle, or a naturally occurring episomal nucleic acid. Additional endogenous molecules may include proteins, for example, transcription factors and enzymes.

A "fusion" molecule is a molecule where two or more subunit molecules are linked, preferably covalently. The subunit molecules may be the same chemical type of molecule, or they may be different chemical types of molecules. Examples of the first type of fusion molecule include, but are not limited to, fusion proteins (e.g., a fusion between a DNA binding domain of ZFP or TALE and one or more activation domains) and fusion nucleic acids. (for example, a nucleic acid encoding the fusion protein described above). Examples of the second type of fusion molecule include, but are not limited to, a fusion between a triplex-forming nucleic acid and a polypeptide, and a fusion between a minor groove binding ligand and a nucleic acid.

Expression of a fusion protein in a cell may result from administration of the fusion protein to the cell or from administration of a polynucleotide encoding the fusion protein to a cell, wherein the polynucleotide is transcribed and the transcript is translates, to generate the fusion protein. Trans-splicing, polypeptide cleavage, and polypeptide ligation may also be involved in the expression of a protein in a cell. Methods for administering polynucleotides and polypeptides to cells are presented elsewhere in this disclosure.

A "gene", for the purposes of the present disclosure, includes a region of DNA that encodes a gene product (see below), as well as all regions of DNA that regulate the production of the gene product, regardless of whether such sequences regulatory elements whether or not adjacent to the coding and/or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translation regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, chromatin, origins of replication, array binding sites and locus control regions.

"Gene expression" refers to the conversion of the information, contained in a gene, into a gene product. A gene product can be the direct transcriptional product of a gene (for example, mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA, or any other type of RNA) or a protein produced by the translation of an mRNA. Gene products also include RNAs that are modified, by processes such as cap addition, polyadenylation, methylation and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation. and glycosylation.

"Modulation" of gene expression refers to a change in the activity of a gene. Modulation of expression may include, but is not limited to, gene activation and gene repression. Genome editing (e.g., excision, alteration, inactivation, random mutation) can be used to modulate expression. Gene knockout refers to any reduction in gene expression compared to a cell that does not include a ZFP or TALEN as described herein. Therefore, gene inactivation can be partial or complete.

A "region of interest" is any region of cellular chromatin, such as, for example, a gene or a non-coding sequence within or adjacent to a gene, to which it is desirable to bind an exogenous molecule. The joining may be for the purposes of directed DNA cleavage and/or directed recombination. A region of interest may be present on a chromosome, an episome, an organelle genome (e.g., mitochondrial, chloroplast), or an infecting viral genome, for example. A region of interest may be within the coding region of a gene, within transcribed non-coding regions such as, for example, leader sequences, trailer sequences or introns, or within non-transcribed regions, either in the 5' or 3' of the coding region. A region of interest can be as small as a single nucleotide pair or up to 2,000 nucleotide pairs in length, or any integral value of nucleotide pairs.

"Eukaryotic" cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells, and human cells (e.g., T lymphocytes).

"Secretory tissues" are those tissues that secrete products. Examples of secretory tissues located in the gastrointestinal tract include the cells that line the intestine, pancreas, and gallbladder. Other secretory tissues include the liver, eye-associated tissues, and mucous membranes such as salivary glands, mammary glands, prostate gland, pituitary gland, and other members of the endocrine system. Additionally, secretory tissues include individual cells of a tissue type that are capable of secreting.

The terms "operational link" and "operationally linked" (or "operationally linked") are used interchangeably with reference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged in a manner that both components function normally and allows the possibility that at least one of the components can mediate a function that is exerted on at least one of the other components. By way of illustration, a transcription regulatory sequence, such as a promoter, is operably linked to a coding sequence if the transcription regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcription regulatory factors. A transcription regulatory sequence is generally operably linked to a coding sequence, but need not be directly adjacent to it. For example, an enhancer is a transcription regulatory sequence that is operatively linked to a coding sequence, even though they are not contiguous.

With respect to fusion polypeptides, the term "operably linked" may refer to the fact that each of the components performs the same function when linked to the other component as it would if it were not so linked. For example, with respect to a fusion polypeptide in which a DNA binding domain of ZFP or TALE is fused to an activation domain, the DNA binding domain of ZFP or TALE and the activation domain are in operative union. whether, in the fusion peptide, the DNA binding domain part of ZFP or TALE can bind to the target site and/or its binding site, while the activation domain is able to positively regulate gene expression. When a fusion polypeptide in which a DNA binding domain of ZFP or TALE is fused to a cleavage domain, the DNA binding domain of ZFP or TALE and the cleavage domain are in operative union if, in the peptide fusion, the DNA binding domain part of ZFP or TALE can bind to the target site and/or its binding site, while the cleavage domain is capable of cleaving DNA in the vicinity of the target site.

A "functional fragment" of a protein, polypeptide or nucleic acid is a protein, polypeptide or nucleic acid whose sequence is not identical to that of the full-length protein, polypeptide or nucleic acid, although it still maintains the same function as the full-length protein, polypeptide or nucleic acid. A functional fragment may possess more, fewer, or the same number of residues as the corresponding native molecule and/or may maintain one or more amino acid or nucleotide substitutions. Methods for determining the function of a nucleic acid (e.g., coding function, ability to hybridize with another nucleic acid) are well known in the art. Similarly, methods for determining protein function are well known. For example, the DNA binding function of a polypeptide can be determined, for example, by filter binding, electrophoretic mobility shift, or immunoprecipitation assays. DNA cleavage can be assayed by gel electrophoresis. See Ausubelet al., cited above. The ability of a protein to interact with another protein can be determined, for example, by coimmunoprecipitation, two-hybrid assays, or complementation, both genetic and biochemical. See, for example, Fieldset al. (1989) Nature 340:245-246; US Patent No. 5,585,245 and PCT document WO 98/44350.

A "vector" is capable of transferring gene sequences to target cells. Typically, "vector construct", "expression vector" and "gene transfer vector" mean any nucleic acid construct capable of directing the expression of a gene of interest and which can transfer gene sequences to target cells. Therefore, expression includes cloning and expression vehicles as well as integration vectors.

A "reporter gene" or "reporter sequence" refers to any sequence that produces a protein product that is easily measurable, preferably but not necessarily in a routine assay. Suitable reporter genes include, but are not limited to, sequences encoding proteins that mediate antibiotic resistance (e.g., ampicillin resistance, neomycin resistance, G418 resistance, puromycin resistance), sequences encoding colored proteins or fluorescent or luminescent (e.g., green fluorescent protein, enhanced green fluorescent protein, red fluorescent protein, luciferase) and proteins that mediate enhanced cell growth and/or gene amplification (e.g., dihydrofolate reductase). Epitope tags include, for example, one or more copies of FLAG, His, myc, Tap, HA, or any detectable amino acid sequence. "Expression tags" include sequences that encode indicators that can be operatively linked to a desired genetic sequence to control the expression of the gene of interest.

Nucleases

Disclosed herein are compositions, particularly nucleases, that are useful for targeting a gene for insertion of a transgene, for example, albumin-specific nucleases. As set forth in the claims, the invention relates to zinc finger nucleases and methods involving said nucleases. Also described herein, but not explicitly claimed, are other nucleases including meganucleases and TALENs.

A. DNA binding domains

A meganuclease (settlement endonuclease) is described herein. Natural meganucleases recognize cleavage sites of 15-40 base pairs and are commonly grouped into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family, and the HNH family. Illustrative settling endonucleases include I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-7evI, I-7evII and I-7evIII. Their recognition sequences are known. See also US Patent No. 5,420,032; US Patent No. 6,833,252; Belfortet al.(1997) Nucleic Acids Res. 25:3379-3388; Dujonet al.(1989) Gene 82:115-118; Perleret al.(1994) Nucleic Acids Res. 22, 1125-1127; Jasin (1996) Trends Genet. 12:224-228; Gimbleet al.(1996) J. Mol. Biol. 263:163-180; Argastet al. (1998) J. Mol. Biol. 280:345-353 and the New England Biolabs catalog.

Described herein is a nuclease comprising a genetically engineered (non-naturally occurring) settling endonuclease (meganuclease). Settlement endonuclease and meganuclease recognition sequences such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, /-PanI, I-SceII, I-PpoI, I- SceIII, I-CreI, I-7evI, I-7evII and I-TevIII are known. See also US Patent No. 5,420,032; US Patent No. 6,833,252; Belfortet al.(1997) Nucleic Acids Res. 25:3379-3388; Dujonet al.(1989) Gene 82:115-118; Perleret al.(1994) Nucleic Acids Res. 22, 1125-1127; Jasin (1996) Trends Genet. 12:224-228; Gimbleet al.(1996) J. Mol. Biol. 263:163-180; Argastet al. (1998) J. Mol. Biol. 280:345-353 and the New England Biolabs catalog. Furthermore, the DNA binding specificity of settling endonucleases and meganucleases can be engineered to bind to unnatural target sites. See, for example, Chevalieret al. (2002) Molec. Cell 10:895-905; Epinatet al.(2003) Nucleic Acids Res. 31:2952-2962; Ashworth et al.(2006) Nature 441:656-659; Paqueset al.(2007) Current Gene Therapy 7:49-66; US Patent Publication No. 20070117128. The DNA binding domains of settling endonucleases and meganucleases can be altered in the context of the nuclease as a whole (i.e., such that the nuclease includes the cognate cleavage domain) or can merge to a heterologous cleavage domain.

Also described herein is a DNA binding domain comprising a naturally occurring or engineered (non-naturally occurring) TALE DNA binding domain. See, for example, US Patent Publication No. 2011/0301073. Plant pathogenic bacteria of the genus Xanthomonas are known to cause many diseases in important crop plants. The pathogenicity of Xanthomonas depends on a conserved type III secretion system (T3S) that injects more than 25 different effector proteins into the plant cell. Among these injected proteins are transcription activator-like effectors (TALE) that mimic plant transcriptional activators and manipulate the plant transcriptome (see Kay et al. (2007) Science 318:648-651). These proteins contain a DNA binding domain and a transcription activation domain. One of the best characterized TALE is AvrBs3 from Xanthomonas campestgrispv.Vesicatoria (see Bonas et al (1989) Mol Gen Genet 218: 127-136 and WO2010079430). TALEs contain a centralized domain of tandem repeats, each repeat containing approximately 34 amino acids, which are key to the DNA-binding specificity of these proteins. In addition, they contain a nuclear localization sequence and an acidic transcription activation domain (for a review see Schornack S, et al (2006) J Plant Physiol 163(3): 256-272). Furthermore, in the phytopathogenic bacterium Ralstonia solanacearum, two genes have been discovered, designated brg11 and hpx17, which are homologous with the AvrBs3 family of Xanthomonas in the GMI1000 deR strain. solanacearumbiovar 1 and in strain RS1000 biovar 4 (See Heuer et al (2007) Appl and Envir Micro 73(13): 4379-4384). These genes are 98.9% identical in nucleotide sequence to each other, but differ in a 1,575 bp deletion in the hpx17 repeat domain. However, both gene products have less than 40% sequence identity with Xanthomonas AvrBs3 family proteins.

Described herein is a DNA binding domain that binds to a target site at a target locus (e.g., albumin or safe harbor) and is a domain engineered from a TALE similar to those derived from the plant pathogens 4384); US Patent Publication No. 2011/0301073 and US Patent Publication No. 20110145940.

As set forth in the claims, the DNA binding domain comprises a zinc finger protein that binds to a target site on an albumin. The zinc finger protein is a non-naturally occurring protein in the sense that it is modified to bind to a target site of choice. See, for example, See, for example, Beerliet al.(2002) Nature Biotechnol. 20:135-141; Paboet al.(2001) Ann. Rev. Biochem. 70:313-340; Isalanet al.(2001) Nature Biotechnol. 19:656-660; Segalet al.(2001) Curr. Opinion. Biotechnol. 12:632-637; Chooet al.(2000) Curr. Opinion. Struct. Biol. 10:411-416; US Patents No. 6,453,242; 6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,030,215; 6,794,136; 7,067,317; 7,262,054; 7,070,934; 7,361,635; 7,253,273; and US Patent Publications No. 2005/0064474; 2007/0218528; 2005/0267061.

An engineered zinc finger or TALE binding domain may have novel binding specificity, compared to a naturally occurring zinc finger protein. Genetic engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using databases comprising triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more zinc finger amino acid sequences that bind to the particular triplet or quadruplet sequence. See, for example, co-owned US Patents 6,453,242 and 6,534,261.

Illustrative selection methods, including phage display and two-hybrid systems, are disclosed in US Patents 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; as well as in document WO 98/37186; document WO 98/53057; document WO 00/27878; document WO 01/88197 and document GB 2,338,237. Furthermore, improvement of binding specificity for zinc finger binding domains has been described, for example, in co-proprietary document WO 02/077227.

Furthermore, as disclosed in these and other references, DNA binding domains (e.g., multi-finger zinc finger proteins or TALE domains) can be linked to each other using any suitable linker sequence, including, for example, linkers. 5 or more amino acids in length. See also US Patent Nos. 6,479,626; 6,903,185; and 7,153,949 for illustrative linker sequences of 6 or more amino acids in length. The DNA binding proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein. Furthermore, improvement of binding specificity for zinc finger binding domains has been described, for example, in co-proprietary document WO 02/077227.

The selection of target sites; DNA binding domains and methods for the design and construction of fusion proteins (and polynucleotides encoding the same) are known to one skilled in the art and are described in detail in US Patents Nos. #6,140,0815; 789,538; 6,453,242; 6,534,261; 5,925,523; 6,007,988; 6,013,453; 6,200,759; document WO 95/19431; document WO 96/06166; document WO 98/53057; document WO 98/54311; document WO 00/27878; document WO 01/60970; document WO 01/88197; document WO 02/099084; document WO 98/53058; document WO 98/53059; document WO 98/53060; WO 02/016536 and WO 03/016496 and US Publication No. 20110301073.

Furthermore, as disclosed in these and other references, DNA binding domains (e.g., multi-finger zinc finger proteins) can be linked together using any suitable linker sequence, including, for example, linkers of 5 or more. amino acids in length. See also US Patent Nos. 6,479,626; 6,903,185; and 7,153,949 for illustrative linker sequences of 6 or more amino acids in length. The proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein.

B. Cleavage domains

Any suitable cleavage domain can be operably linked to a DNA binding domain to form a nuclease. For example, the DNA-binding domains of ZFP have been fused with nuclease domains to create ZFN, a functional entity that is capable of recognizing its intended nucleic acid target through its engineered DNA-binding domain ( ZFP) and cause DNA to be cleaved near the ZFP binding site through nuclease activity. See, for example, Kimet al.(1996) Proc Nat'l Acad Sci USA 93(3):1156-1160. More recently, ZFNs have been used for genome modification in a variety of organisms. See, for example, US Patent Publications 20030232410; 20050208489; 20050026157; 20050064474; 20060188987; 20060063231; and International Publication WO 07/014275. Likewise, the DNA binding domains of TALE have been fused with nuclease domains to create TALEN. See, for example, US Publication No. 20110301073.

As noted above, the cleavage domain may be heterologous to the DNA binding domain, for example, a zinc finger DNA binding domain and a nuclease cleavage domain or a zinc finger DNA binding domain. TALEN and a cleavage domain, or a meganuclease DNA binding domain and a cleavage domain from a different nuclease. Heterologous cleavage domains can be obtained from any endonuclease or exonuclease. Examples of endonucleases from which a cleavage domain may be derived include, but are not limited to, restriction endonucleases and settling endonucleases. See, for example, Catalog 2002-2003, New England Biolabs, Beverly, MA; and Belfortet al. (1997) Nucleic Acids Res. 25:3379-3388. Additional enzymes that cleave DNA are known (e.g., S1 Nuclease; mung bean nuclease; pancreatic DNase I; micrococcal nuclease; yeast HO endonuclease; see also Linnet al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993 ). One or more of these enzymes (or functional fragments thereof) can be used as a source of cleavage domains and cleavage half-domains.

Similarly, a cleavage half-domain may be derived from any nuclease or part thereof, as set forth above, that requires dimerization for cleavage activity. In general, two fusion proteins are required for cleavage if the fusion proteins comprise cleavage half-domains. Alternatively, a single protein comprising two cleavage half-domains can be used. The two cleavage half-domains may be derived from the same endonuclease (or functional fragments thereof), or each cleavage half-domain may be derived from a different endonuclease (or functional fragments thereof). Furthermore, the target sites for the two fusion proteins are preferably arranged, relative to each other, such that binding of the two fusion proteins to their respective target sites places the cleavage half-domains in a spatial orientation relative to each other that allows cleavage half-domains to form a functional cleavage domain, for example, by dimerization. Therefore, in certain embodiments, the near edges of the target sites are separated by 5-8 nucleotides or by 15-18 nucleotides. However, any integer number of nucleotides or nucleotide pairs can intervene between two target sites (e.g., 2 to 50 nucleotide pairs or more). In general, the cleavage site is located between the target sites.

Restriction endonucleases (restriction enzymes) are present in many species and are capable of binding sequence-specific DNA (at a recognition site) and cleaving DNA at or near the binding site. Certain restriction enzymes (e.g., Type IIS) cleave DNA at sites removed from the recognition site and have separable binding and cleavage domains. For example, the Type IISFokI enzyme catalyzes the double-stranded cleavage of DNA, 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, for example, US Patents 5,356,802; 5,436,150 and 5,487,994; as well as Liet al.(1992) Proc. Natl. Academic Sci USA 89:4275-4279; Liet al.(1993) Proc. Natl. Academic Sci USA 90:2764-2768; Kimet al.(1994a) Proc. Natl. Academic Sci USA 91:883-887; Kimet al.(1994b) J. Biol. Chem. 269:31978-31982. Therefore, in one embodiment, the fusion proteins comprise the cleavage domain (or cleavage half domain) of at least one type IIS restriction enzyme and one or more zinc finger binding domains, which may be modified by genetic engineering or not.

An example of a Type IIS restriction enzyme, whose cleavage domain is separable from the binding domain, is FokI. This particular enzyme is active as a dimer. Bitinaite et al.(1998) Proc. Natl. Academic Sci. USA 95: 10,570 10,575. Accordingly, for the purposes of the present disclosure, the part of the FokI enzyme used in the described fusion proteins is considered a cleavage half-domain. Therefore, for targeted double-strand cleavage and/or targeted replacement of cellular sequences using zinc finger-Fok I fusions, two fusion proteins, each comprising a FokI cleavage half-domain, can be used to catalytically reconstitute a domain. catalytically active cleavage. Alternatively, a single polypeptide molecule containing a zinc finger binding domain and two FokI cleavage half-domains can also be used.

A cleavage domain or cleavage half-domain can be any part of a protein that retains cleavage activity or that retains the ability to multimerize (e.g., dimerize) to form a functional cleavage domain.

Illustrative Type IIS restriction enzymes are described in International Publication WO 07/014275. Additional restriction enzymes also contain separable binding and cleavage domains, and these are contemplated in the present disclosure. See, for example, Robertset al. (2003) Nucleic Acids Res. 31:418-420.

In certain embodiments, the cleavage domain comprises one or more engineered cleavage half-domains (also called dimerization domain mutants) that minimize or prevent homodimerization, as described, for example, in US Patent Publications. US No. 20050064474; 20060188987; 20080131962 and 20110201055. The amino acid residues at positions 446, 447, 479, 483, 484, 486, 487, 490, 491, 496, 498, 499, 500, 531, 534, 537, and 538 are all targets for influence on the dimerization of the FokI cleavage half-domains.

Illustrative modified FokI cleavage half-domains that form obligate heterodimers include a pair in which a first cleavage half-domain includes mutations at amino acid residues at positions 490 and 538 of FokI and a second cleavage half-domain includes mutations at amino acid residues 486 and 499.

Therefore, in one embodiment, a mutation at 490 replaces Glu (E) with Lys (K); the mutation at 538 replaces Iso (I) with Lys (K); the mutation at 486 replaces Gln (Q) with Glu (E); and the mutation at position 499 replaces Iso (I) with Lys (K). Specifically, the engineered cleavage half-domains described herein were prepared by mutating positions 490 (E^K) and 538 (I^K) in a cleavage half-domain to produce a modified cleavage half-domain designated "E490K:I538K." " and mutating positions 486 (Q ^E ) and 499 (I^-L) into another cleavage half-domain to produce a modified cleavage half-domain designated "Q486E:I499<l>". The engineered cleavage half-domains described herein are obligate heterodimeric mutants in which aberrant cleavage is minimized or eliminated. See, for example, US Patent Publication No. 2008/0131962.

In certain embodiments, the modified cleavage half domain comprises mutations at positions 486, 499, and 496 (numbered relative to wild-type Fokl), for example, mutations that replace the wild-type Gln(Q) residue at position 486. with a Glu (E) residue, the wild-type Iso (I) residue at position 499 with a Leu (L) residue and the wild-type Asn (N) residue at position 496 with an Asp (D) residue or Glu (E) (also called "ELD" and "ELE" domains, respectively). In other embodiments, the modified cleavage half domain comprises mutations at positions 490, 538 and 537 (numbered relative to wild-type Fokl), for example mutations that replace the wild-type Glu (E) residue at position 490 with a Lys (K) residue, the wild-type Iso (I) residue at position 538 with a Lys (K) residue and the wild-type His (H) residue at position 537 with a Lys (K) residue or a Arg(R) residue (also called "KKK" and "KKR" domains, respectively). In other embodiments, the modified cleavage half domain comprises mutations at positions 490 and 537 (numbered relative to wild-type Fokl), for example, mutations that replace the wild-type Glu (E) residue at position 490 with a residue Lys (K) and the wild-type His (H) residue at position 537 with a Lys (K) residue or an Arg (R) residue (also called "KIK" and "KIR" domains, respectively). (See US Patent Publication No. 20110201055). The modified cleavage half-domains described herein can be prepared using any suitable method, for example, by site-directed mutagenesis of wild-type cleavage half-domains (FokI) as described in US Patent Publications No. ° 20050064474; 20080131962 and 20110201055.

Alternatively, live nucleases can be assembled at the target site of the nucleic acid using so-called "split enzyme" technology (see, for example, US Patent Publication No. 20090068164). The components of such cleaved enzymes can be expressed in separate expression constructs or can be linked in an open reading frame where the individual components are separated, for example, by a self-cleavable 2A peptide or an IRES sequence. The components may be individual zinc finger binding domains or domains of a meganuclease nucleic acid binding domain.

Nucleases can be screened for activity before use, for example, in a yeast-based chromosome system as described in WO 2009/042163 and 20090068164. Nuclease expression constructs can be easily designed using methods known in the art. . See, for example, US Patent Publications 20030232410; 20050208489; 20050026157; 20050064474; 20060188987; 20060063231; and International Publication WO 07/014275. Expression of the nuclease may be under the control of a constitutive promoter or an inducible promoter, for example, the galactokinase promoter which is activated (derepressed) in the presence of raffinose and/or galactose and repressed in the presence of glucose. .

Target sites

As described in detail above, DNA domains can be engineered to bind to any sequence of choice at a locus, for example, an albumin or a safe harbor gene. An engineered DNA binding domain may have novel binding specificity, compared to a naturally occurring DNA binding domain. Genetic engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using databases comprising individual triplet (or quadruplet) nucleotide sequences and amino acid (e.g., zinc finger) sequences, in which each triplet or quadruplet nucleotide sequence is associates with one or more DNA binding domain amino acid sequences that bind to the particular triplet or quadruplet sequence. See, for example, co-owned US Patents 6,453,242 and 6,534,261. Rational design of TAL effector domains can also be performed. See, for example, US Patent Publication No. 20110301073.

Illustrative selection methods applicable to DNA binding domains, including phage display and two-hybrid systems, are disclosed in US Patents 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; as well as in document WO 98/37186; document WO 98/53057; document WO 00/27878; document WO 01/88197 and document GB 2,338,237.

The selection of target sites; Nucleases and methods for the design and construction of fusion proteins (and polynucleotides encoding the same) are known to one skilled in the art and are described in detail in Patent Application Publications Nos. 20050064474 and 20060188987.

Furthermore, as disclosed in these and other references, DNA binding domains (e.g., multi-finger zinc finger proteins) can be linked together using any suitable linker sequence, including, for example, linkers of 5 or more. amino acids. See, for example, US Patent Nos. 6,479,626; 6,903,185; and 7,153,949 for illustrative linker sequences of 6 or more amino acids in length. The proteins described herein may include any combination of suitable linkers between the individual DNA binding domains of the protein. See also US Publication No. 20110301073.

Donors

As indicated above, the insertion of an exogenous sequence (also called "donor sequence" or "donor"), for example, for the correction of a mutant gene or for the increase of the expression of a wild-type gene. It will be readily apparent that the donor sequence is typically not identical to the genomic sequence into which it is placed. A donor sequence may contain a non-homologous sequence flanked by two regions of homology to allow efficient HDR at the location of interest. Additionally, the donor sequences may comprise a vector molecule that contains sequences that are not homologous to the region of interest in cellular chromatin. A donor molecule may contain several discontinuous regions of homology with cellular chromatin. For example, for targeted insertion of sequences that are not normally present in a region of interest, such sequences may be present in a donor nucleic acid molecule and flanked by regions of homology to the sequence in the region of interest.

The donor polynucleotide can be DNA or RNA, single-stranded or double-stranded, and can be introduced into a cell in a linear or circular form. See, for example, US Patent Publications. <No. 20100047805 and 20110207221. ) by methods known to those skilled in the art. For example, one or more dideoxynucleotide residues are added to the 3' end of a linear molecule and/or self-complementary oligonucleotides are ligated at one or both ends. See, for example, Changet al. (1987) Proc. Natl. Academic Sci USA 84:4959-4963; Nehlset al.(1996) Science 272:886-889. Additional methods of protecting exogenous polynucleotides from degradation include, but are not limited to, the addition of terminal amino group(s) and the use of modified internucleotide linkages such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose residues. deoxyribose.

A polynucleotide can be introduced into a cell as part of a vector molecule that has additional sequences such as, for example, origins of replication, promoters and genes that encode antibiotic resistance. On the other hand, the donor polynucleotides can be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or a poloxamer or can be delivered by viruses (for example, adenovirus, AAV, herpesviruses, retroviruses, lentiviruses and defective lentiviruses). in integrase>(IDL<v>)).

The donor is usually inserted such that its expression is driven by the endogenous promoter at the integration site, namely the promoter that drives expression of the albumin gene. However, it will be apparent that the donor may comprise a promoter and/or enhancer, for example, a constitutive promoter or an inducible or tissue-specific promoter.

The donor molecule can be inserted into an endogenous gene such that all, part or none of the endogenous gene is expressed. For example, a transgene as described herein may be inserted into an albumin locus such that some or none of the endogenous albumin sequences are expressed, for example, as a fusion with the transgene. See, for example, US patent publications 20080299580; 20080159996 and 201000218264.

When albumin sequences (endogenous or part of the transgene) are expressed with the transgene, the albumin sequences can be full-length sequences (wild type or mutant) or partial sequences. Preferably the albumin sequences are functional. Non-limiting examples of the function of these full-length or partial albumin sequences include increasing the serum half-life of the polypeptide expressed by the transgene (e.g., therapeutic gene) and/or acting as a carrier.

Additionally, although not required for expression, exogenous sequences may also include transcription or translation regulatory sequences, for example, promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides and/or signals. of polyadenylation.

Supply

The nucleases, the polynucleotides encoding these nucleases, the donor polynucleotides and the compositions comprising the proteins and/or polynucleotides described herein can be delivered in vivo or ex vivo by any suitable means.

Methods for delivering nucleases as described herein are described, for example, in US Patent Nos. 6,453,242; 6,503,717; 6,534,261; 6,599,692; 6,607,882; 6,689,558; 6,824,978; 6,933,113; 6,979,539; 7,013,219; and 7,163,824.

Nuclease and/or donor constructs as described herein can also be delivered using vectors containing sequences encoding one or more of the zinc finger or TALEN protein(s). Any vector system can be used including, but not limited to, plasmid vectors, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors; herpesvirus vectors and adeno-associated virus vectors, etc. See also US Patent Nos. 6,534,261; 6,607,882; 6,824,978; 6,933,113; 6,979,539; 7,013,219; and 7,163,824. Additionally, it will be evident that any of these vectors may comprise one or more of the sequences necessary for the treatment. Therefore, when one or more nucleases and a donor construct are introduced into the cell, the nucleases and/or the donor polynucleotide can be carried on the same vector or on different vectors. When multiple vectors are used, each vector may comprise a sequence encoding one or multiple nucleases and/or donor constructs.

Conventional viral and non-viral gene transfer methods can be used to introduce nucleic acids encoding nucleases and donor constructs into cells (e.g., mammalian cells) and target tissues. Nonviral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer. Viral vector delivery systems include DNA and RNA viruses, which have episomal or integrated genomes after delivery to the cell. For a review of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel and Felgner, TIBTECH 11:211-217 (1993); Mitani and Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10): 1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology Doerfler and Bohm (eds.) (1995); and Yuet al., Gene Therapy 1:13-26 (1994).

Nonviral delivery methods of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced DNA uptake. Sonoporation using, for example, the Sonitron 2000 system (Rich-Mar) can also be used for nucleic acid delivery.

Additional illustrative nucleic acid delivery systems include those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland), BTX Molecular Delivery Systems (Holliston, MA) and Copernicus Therapeutics Inc, (see, for example , document US6008336). Lipofection is described in, for example, US Patent Nos. 5,049,386; 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam™ and Lipofectin™). Cationic and neutral lipids that are suitable for efficient lipofection of receptor-recognizing polynucleotides include those from Felgner, WO 91/17424, WO 91/16024.

The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one skilled in the art (see, for example, Crystal, Science 270:404-410 (1995); Blaese et al. ., Cancer Gene Ther. 2:291-297 (1995); Behret al., Bioconjugate Chem. 5:382-389 (1994); ,Gene Therapy 2:710-722 (1995); Ahmadet al.,Cancer Res.

52:4817-4820 (1992); Pat. US Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028 and 4,946,787).

Additional delivery methods include the use of packaging the nucleic acids to be delivered in EnGeneIC delivery vehicles (EDVs). These E<d>V<s are specifically delivered to the target tissues using bispecific antibodies where one arm of the antibody has specificity for the target tissue and the other has specificity for the EDV. The antibody brings the EDVs to the surface of the target cell and then the EDV enters the cell by endocytosis. Once in the cell, the contents are released (see MacDiarmid et al (2009) Nature Biotechnology 27(7):643).

The use of RNA or DNA virus-based systems for the delivery of engineered ZFP-encoding nucleic acids takes advantage of highly evolved processes to target a virus to specific cells in the body and transport the viral cargo to the nucleus. Viral vectors can be administered directly to patients (in vivo) or can be used to treat cells in vitro and the modified cells are administered to patients (ex vivo). Conventional virus-based systems for delivery of ZFP include, but are not limited to , retroviral, lentivirus, adenoviral, adeno-associated, vaccinia virus and herpes simplex virus vectors for gene transfer. Integration into the host genome is possible with retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different types of target cells and tissues.

The tropism of a retrovirus can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that are capable of transducing or infecting cells that do not divide and normally produce high viral titers. The selection of a retroviral gene transfer system depends on the target tissue. Retroviral vectors are composed of long, cis-acting terminal repeats with the capacity to package up to 6-10 kb of foreign sequence. Minimal cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibbon leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, for example, Buchscheret al., J. Virol. 66:2731-2739 (1992); Johannet al., J. Virol. 66: 1635-1640 (1992); Sommerfeltet al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); .

In applications where transient expression is preferred, adenovirus-based systems can be used. Adenovirus-based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, a high titer and high levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system. Adeno-associated virus ("AAV") vectors are also used to transduce cells with target nucleic acids, for example, in the in vitro production of nucleic acids and peptides and for in vivo and ex vivo gene therapy procedures (see, for example, West et al., Virology 160:38-47 (1987); US Patent No. 4,797,368; Kotin, Human Gene Therapy 5:793-801 (1994); Invest. 94:1351 (1994). :3251-3260 (1985); Tratschin, et al., Mol. Biol. 4:2072-2081 (1984); Virol. 63:03822-3828 (1989).

At least six viral vector approaches are currently available for gene transfer in clinical trials, using approaches that involve complementation of defective vectors by genes inserted into helper cell lines to generate the transducing agent.

pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (Dunbaret al., Blood 85:3048-305 (1995); Kohnet al., Nat. Med. 1:1017-102 (1995); Malechet al., PNAS 94:22 12133-12138 (1997)). PA317/pLASN was the first therapeutic vector used in a gene therapy trial. (Blaeseet al., Science 270:475-480 (1995)). Transduction efficiencies of 50% or more have been observed in vectors packaged in MFG-S. (Ellemet al., Immunol Immunother. 44(1): 10-20 (1997); Dranoffet al., Hum. Gene Ther. 1:111-2 (1997).

Recombinant adeno-associated virus (rAAV) vectors are promising alternative gene delivery systems based on the defective and non-pathogenic parvovirus type 2 adeno-associated virus. All vectors are derived from a plasmid that retains only the 145-bp inverted terminal repeats of AAV flanking the transgene expression cassette. Efficient gene transfer and stable delivery of transgenes due to integration into the genomes of the transduced cell are key features for this vector system. (Wagneret al., Lancet 351:9117 1702-3 (1998), Kearnset al., Gene Ther. 9:748-55 (1996)). Other AAV serotypes, including AAV1, AAV3, AAV4, AAV5, AAV6, AAV8, AAV 8.2, AAV9, AAV rh10 and pseudotyped AAVs such as AAV2/8, AAV2/5 and AAV2/6 may also be used in accordance with the present invention. .

Replication-deficient recombinant adenoviral (Ad) vectors can be produced at a high titer and easily infect several different cell types. Most adenovirus vectors are genetically engineered such that a transgene replaces the Ad E1a, E1b, and/or E3 genes; The replication-defective vector is subsequently propagated into human 293 cells that supply the function of the deleted gene entrans. Ad vectors can transduce multiple types of tissues in vivo, including non-dividing, differentiated cells, such as those found in the liver, the kidney and muscle. Conventional Ad vectors have a large loading capacity. An example of the use of an Ad vector in a clinical trial involved polynucleotide therapy for antitumor immunization with intramuscular injection (Stermanet al., Hum. Gene Ther. 7:1083-9 (1998)). Additional examples of the use of adenovirus vectors for gene transfer in clinical trials include Roseneckeret al., Infection 24:1 5-10 (1996); Stermanet al., Hum. Gene Ther. 9:7 1083-1089 (1998); Welshet al., Hum. Gene Ther. 2:205-18 (1995); Alvarezet al., Hum. Gene Ther. 5:597-613 (1997); Topfet al.,Gene Ther. 5:507-513 (1998); Stermanet al., Hum. Gene Ther. 7:1083-1089 (1998).

Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenoviruses, and ^2 cells or PA317 cells, which package retroviruses. Viral vectors used in gene therapy are typically generated by a producer cell line that packages a nucleic acid vector into a viral particle. Vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable), other viral sequences being replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are supplied internally by the packaging cell line. For example, AAV vectors used in gene therapy typically possess inverted terminal repeat (ITR) sequences of the AAV genome that are required for packaging and integration into the host genome. The viral DNA is packaged into a cell line, which contains a helper plasmid that encodes the other AAV genes, specifically repycap, but lacks the ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant quantities due to the lack of ITR sequences. Adenovirus contamination can be reduced by, for example, heat treatment to which adenovirus is more sensitive than AAV.

In many gene therapy applications, it is desirable that the gene therapy vector be delivered with a high degree of specificity to a particular tissue type. Consequently, a viral vector can be modified to have specificity for a given cell type by expressing a ligand such as a fusion protein with a viral envelope protein on the outer surface of the virus. The ligand is chosen such that it has affinity for a receptor known to be present on the cell type of interest. For example, Hanet al.,Proc. Natl. Academic Sci. USA 92:9747-9751 (1995) report that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells that express the factor receptor. human epidermal growth. This principle can be extended to other virus-target cell pairs, in which the target cell expresses a receptor and the virus expresses a fusion protein comprising a ligand for the cell surface receptor. For example, filamentous phages can be engineered to display antibody fragments (e.g., FAB or Fv) that have specific binding affinity for virtually any chosen cellular receptor. Although the above description applies primarily to viral vectors, the same principles can be applied to non-viral vectors. Such vectors can be modified to contain specific uptake sequences that promote uptake by specific target cells.

Gene therapy vectors may be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application, as described below. Alternatively, the vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or hematopoietic stem cells from universal donors, followed by reimplantation of the cells into a patient, usually after selection of cells that have incorporated the vector.

Vectors (e.g., retroviruses, adenoviruses, liposomes, etc.) containing nucleases and/or donor constructs can also be administered directly to an organism for transduction of cells in vivo. Alternatively, naked DNA can be administered. Administration is carried out by any of the routes normally used to introduce a molecule into final contact with blood or tissue cells including, but not limited to, injection, infusion, topical application and electroporation. Suitable methods for administering such nucleic acids are available and well known to those skilled in the art and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective route than another way.

Vectors suitable for the introduction of polynucleotides described herein include non-integrating lentivirus (IDLV) vectors. See, for example, Oryet al.(1996) Proc. Natl. Academic Sci USA 93:11382-11388; Dullet al. (1998) J. Virol. 72:8463-8471; Zufferyet al.(1998) J. Virol. 72:9873-9880; Follenziet al.(2000) Nature Genetics 25:217-222; US Patent Publication No. 2009/054985.

Pharmaceutically acceptable carriers are determined, in part, by the particular composition being administered, as well as the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions available, as described below (see, for example, Remington's Pharmaceutical Sciences, 17th ed., 1989).

It will be apparent that the nuclease encoding sequences and the donor constructs can be delivered using the same or different systems. For example, a donor polynucleotide may be carried by a plasmid, while one or more nucleases may be carried by an AAV vector. Additionally, the different vectors can be administered by the same or different routes (intramuscular injection, tail vein injection, another intravenous injection, intraperitoneal administration and/or intramuscular injection). The vectors can be supplied simultaneously or in any sequential order.

Formulations for ex vivo and in vivo administrations include suspensions in liquids or emulsified liquids. Active ingredients are often mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol or the like and combinations thereof. In addition, the composition may contain minor amounts of auxiliary substances, such as wetting or emulsifying agents, pH buffering agents, stabilizing agents or other reagents that improve the effectiveness of the pharmaceutical composition.

Applications

The methods and compositions of the invention can be used in any circumstance where it is desired to deliver a transgene encoding one or more proteins such that the protein or proteins are secreted from the targeted cell. Therefore, this technology is of use in a condition where a patient is deficient in some proteins due to problems (for example, problems at the expression level or problems with the expressed protein being subfunctional or non-functional). Particularly useful with this invention is the expression of transgenes to correct or restore functionality in coagulation disorders. Additionally, A1AT deficiency disorders, such as COPD or liver damage, or other disorders, conditions or diseases that can be mitigated by the delivery of exogenous proteins by a secretory organ can be successfully treated by the methods and compositions of this invention. Lysosomal storage diseases can be treated by the methods and compositions of the invention, as well as metabolic diseases such as diabetes.

Proteins that are therapeutically useful and that are typically delivered by injection or infusion are also useful with the methods and compositions of the invention. By way of non-limiting examples, the production of a C-peptide (e.g., Ersatta™ by Cebix) or insulin for use in diabetic therapy. An additional application includes the treatment of epidermolysis bullosa through the production of collagen VII. Expression of IGF-1 in secretory tissue as described herein can be used to increase levels of this protein in patients with liver cirrhosis and lipoprotein lipase deficiency through expression of lipoprotein lipase. Antibodies can also be secreted for therapeutic benefit, for example, for the treatment of cancers, autoimmune diseases, and other diseases. Other coagulation-related proteins may be produced in secretory tissue, including fibrinogen, prothrombin, tissue factor, Factor V, Factor XI, Factor , high molecular weight kininogen (Fitzgerald factor), fibronectin, antithrombin III, heparin cofactor II, protein C, protein S, protein Z, protein Z-dependent protease inhibitor, plasminogen, alpha 2-antiplasmin, activator tissue plasminogen, urokinase, plasminogen activator inhibitor-1 and plasminogen activator inhibitor-2.

Examples

Example 1: Design, construction and characterization of zinc finger nuclease (ZFN) proteins targeting the mouse albumin gene

Zinc finger proteins were designed to target cleavage sites within introns 1, 12, and 13 of the mouse albumin gene. The corresponding expression constructs were assembled and incorporated into plasmids, AAV or adenoviral vectors essentially as described in Urnovet al.(2005) Nature 435(7042):646-651, Perez et al (2008) Nature Biotechnology 26(7) :808-816 and as described in US Patent No. 6,534,261. Table 1 shows the recognition helices within the DNA binding domain of illustrative mouse albumin-specific ZFPs while Table 2 shows the target sites for these ZFPs. Nucleotides in the target site that are in contact with the ZFP recognition helices are indicated in capital letters; non-contacting nucleotides are indicated in lower case.

T l 1: Di ñ h li n l in ífi r l min m rin

continuation

Table 2: ZFN target sites specific to murine albumin

Example 2: Activity of albumin-specific murine ZFNs

The ZFNs from Table 1 were tested for their ability to cleave their endogenous target sequences in mouse cells. To perform this, the constructs expressing the ZFNs in Table 1 were transfected into Neuro2A cells in the pairs indicated in Figure 1. The cells were then maintained at 37 °C for 3 days or subjected to hypothermic shock (30 ° C, see co-owned US Patent Publication No. 20110041195). Genomic DNA was then isolated from Neuro2A cells using the DNeasy kit (Qiagen) and subjected to the Cel-I assay (Surveyor™, Transgenomics) as described in Perez et al, (2008) Nat. Biotechnol. 26: 808-816 and in Guschin et al, (2010) Methods Mol Biol. 649:247-56), to quantify chromosomal modifications induced by ZFN cleavage. In this assay, PCR is used to amplify a DNA fragment carrying the ZFN target site and then the resulting amplicon is digested with the mismatch-specific nuclease Cel-I (Yang et al, (2000) Biochemistry 39, 3533- 3541), followed by resolution of intact and cleaved amplicon on an agarose gel. By quantifying the degree of amplicon cleavage, one can calculate the fraction of mutated alleles in the amplicon and thus in the original cell assembly. In these experiments, all ZFN pairs were ELD/KKRFokl mutation pairs (described above).

The results of the Cel-I assay are shown in Figure 1 and demonstrate that ZFNs are capable of inducing cleavage and consequent mutations at their respective target sites. The “percent indel” value shown below each lane indicates the fraction of ZFN targets that were successfully cleaved and subsequently mutated during cellular double-strand break repair via NHEJ. The data also demonstrate greater activity when the transduction procedure incorporates hypothermic shock.

Example 3: Canine albumin-specific ZFNs

A pair of ZFNs targeting the canine albumin locus was constructed for use in in vivo models. The pair was constructed as described in Example 1 and is shown below in Table 3. The target for each ZFN is provided in Table 4.

T l : Di ñ h li n l in ífi r l min nin

Table 4: ZFN target sites specific to canine albumin

Canino-specific ZFNs were tested in vitro for activity essentially as described in Example 2, except that the canine D17 cell line was used. As shown in Figure 2, ZFNs were shown to generate ~30% indels in this study.

Example 4: Non-human primate albumin-specific ZFNs

ZFNs targeting the albumin locus were also made in Indian macaque monkeys (Macaca mulatta). The pairs were constructed as described above and are shown below in Table 5. The targets of the ZFNs are shown in Table 6. As shown below, the human (SEQ ID NO:92) and macaque macaque (SEQ ID NO:93) sequences for the binding site for SBS #35396 (see below, Tables 7 and 8) They are perfectly preserved. Differences between the human and rhesus macaque sequences are boxed.

35396

HUMAN ATTGAATTCA TAAC1TATCCC AAAÍ.GACCTAT CCATTGCACT ATGCTTTATT TAAAAACCAC MACACO DE LA IN D IA ATTGAATTCA TAACÍgtfCCC KAAGACCTAT CCATTGCACT ATGCTTTATT TAAAAGCCAC

G (NOTE: IN SOME CASES)

Therefore, for the development of the rhesus macaque albumin-specific pair, 35396 was paired with a series of partners that were designed to replace the human rhesus macaque partner 35364. These proteins are shown below (Table 5) along with their target sequences (Table 6).

T l : Di ñ h li n l in ífi r l min m l In i

Table 6: Specific ZFN target sites of rhesus macaque albumin

The rhesus macaque albumin-specific ZFNs were tested in pairs to determine the pair with the highest activity. In each pair, SBS #35396 was tested with the potential partners shown in Tables 5 and 6 in the rhesus macaque RF/6A cell line using the methods described above.

The resulting activity, determined by the percentage of discrepancy detected using the Cel-I assay is shown in the body of the array (Table 7) and demonstrates that the ZFN pairs have activity against the rhesus macaque albumin locus.

Table 7: A ivi n l l l min m India

Two pairs were examined more extensively, comparing sequence specificity by SELEX analysis and by titration of each pair for in vitro activity. The results demonstrate that the pair 35396/36806 was the most desirable parent pair (see Figure 12).

Comparison of the human albumin locus sequence with sequences from other non-human primates demonstrates that similar pairs can be developed to work in other primates such as cynomolgus macaques (see, Figure 3A and 3B).

Example 5: In vivo cleavage by ZFN in mice

To deliver the albumin-specific ZFNs to the liver in vivo, the normal site of albumin production, the present inventors generated a hepatotropic adeno-associated virus vector, serotype 8 that expresses the albumin-specific ZFNs from a liver-specific enhancer and promoter ( Shenet al, ib idy Miaoet al, ibid).Adult C57BL/6 mice underwent genomic editing in the albumin gene as follows: Adult mice were treated by i.v. (intravenous) with 1 * 1011 v.g. (viral genomes)/mouse from ZFN pair 1 (SBS 30724 and SBS 30725) or ZFN pair 2 (SBS 30872 and SBS 30873) and were sacrificed seven days later. The region of the albumin gene encompassing the target site for pair 1 was amplified by PCR for the Cel-I mismatch assay using the following 2 PCR primers:

Cel1 F1: 5' CCTGCTCGACCATGCTATACT 3' (SEQ ID NO:69)

Cel1R1: 5' CAGGCCTTTGAAATGTTGTTC 3' (SEQ ID NO:70)

The region of the albumin gene encompassing the target site for pair 2 was amplified by PCR for the Cel-I assay using these PCR primers:

mAlb set4F4: 5' AAGTGCAAAGCCTTTCAGGA 3' (SEQ ID NO:71) mAlb set4R4: 5' GTGTCCTTGTCAGCAGCCTT 3' (SEQ ID NO:72)

As shown in Figure 4, ZFNs induce indels at up to 17% of their target sites in vivo in this study.

The mouse albumin-specific ZFNs SBS30724 and SBS30725 that target a sequence in intron 1 were also tested in a second study. The genes for expressing ZFNs were introduced into an AAV2/8 vector as described previously (Liet al(2011)Nature475 (7355): 217). To facilitate AAV production in the baculovirus system, a baculovirus containing a chimeric serotype 8.2 capsid gene was used. The serotype 8.2 capsid differs from the serotype 8 capsid in that the phospholipase A2 domain in the AAV8 capsid protein VP1 has been replaced by the comparable domain of the AAV2 capsid creating a chimeric capsid. Production of ZFN-containing virus particles was carried out by preparation using a HEK293 system or a baculovirus system using conventional methods in the art (See Liet al, ibid, see, for example, US6723551). The virus particles were then administered to normal male mice (n=6) using a single 200 microliter dose of 1.0e11 total vector genomes of either AAV2/8 or AAV2/8.2 encoding the mouse albumin-specific ZFN. . 14 days after administration of rAAV vectors, mice were sacrificed, livers harvested and processed for total DNA or proteins using conventional methods known in the art. Detection of AAV vector genome copies was performed by quantitative PCR. Briefly, qPCR primers were made specific for bGHpA sequences within AAV as follows:

Oligo200 (Direct) 5'-GTTGCCAGCCATCTGTTGTTT-3' (SEQ ID NO: 102) Oligo201 (Reverse) 5'-GACAGTGGGAGTGGCACCTT-3' (SEQ ID NO: 103) Oligo202 (Probe) 5'-CTCCCCCGTGCCTTCCTTGACC-3'(SEQ ID NO:104)

ZFN cleavage activity was measured using a Cel-I assay performed using an LC-GX apparatus (Perkin Elmer), according to the manufacturer's protocol. The expression of live ZFNin was measured using a FLAG tag system according to conventional methods.

As shown in Figure 5 (for each mouse in the study) ZFNs were expressed and cleaved the target gene in the mouse liver. The % of indels generated in each mouse sample is provided at the bottom of each lane. The vector type and its content are displayed above the rails. Mispair repair after ZFN cleavage (% indels indicated) was detected in almost 16% in some of the mice.

Mouse-specific albumin ZFNs were also analyzed for in vivo activity when delivered using a variety of AAV serotypes including AAV2/5, AAV2/6, AAV2/8, and AAV2/8.2. In these AAV vectors, the entire ZFN coding sequence is flanked by the AAV2 ITRs, contained and then encapsulated using AAV5, 6, or 8 capsid proteins, respectively. The 8.2 designation is the same as described above. ZFNs SBS30724 and SBS30725 were cloned into AAV as described previously (Liet al, ibid) and viral particles were produced using baculovirus or transient transfection purification in HEK293 as described above. Dosing was carried out in normal mice in a volume of 200 μl per mouse by injection into the tail, at doses of 5e10 to 1e12 vg per dose. Viral genomes per diploid mouse genome were analyzed at days 14 and analyzed at days 30 and 60. Additionally, ZFN-directed excision of the albumin locus was analyzed by the Cel-I assay as described earlier in day 14 and is analyzed on days 30 and 60.

As shown in Figure 6, cleavage was observed at a level of up to 21% indels. Also included in the Figure are samples from the previous study for comparison (far right, "mini-mouse" study-D14 and a background band ("non-specific band").

Example 6: In vivo co-delivery of a donor nucleic acid and albumin ZFN.

Human Factor IX Insertion: ZFNs were used to target the integration of the coagulation protein Factor IX (F.IX) gene into the albumin locus in adult wild-type mice. In these experiments, mice were treated by intravenous injection with either 1 x 1011 v.g./pair 1 of mouse albumin-specific ZFN targeting donor intron 1 ("mAlb(intron1)"), Mouse albumin-specific ZFN targeting donor intron 12 ("mAlb(intron12)") or a set of ZFNs targeting a human plus donor gene as a control ("Control"). Pair<z>F<n>#1 was 30724/30725, targeting intron 1, and ZFN pair 2 was 30872/30873, targeting exon 12. In these experiments, the F.IX donor transgene was integrated by terminal capture after ZFN-induced cleavage. Alternatively, the F.IX transgene was inserted into a donor vector such that the transgene was flanked by arms with homology to the cleavage site. In any case, the F.IX transgene was the "SA - exons 2-8 of wild type hF9" cassette (see co-owned US patent application 61/392,333).

The transduced mice were then sampled for serum levels of human F.IX, which were elevated (see Figure 7, which shows stabilized expression of human F.IX for at least eight weeks after insertion into the intron 1). The expressed human F.IX is also functional, as evidenced by the reduction in clotting time in hemophilic mice with a human F.IX transgene targeting the albumin locus (see Figure 8). Notably, within two weeks after transgene insertion, clotting time is not significantly different from clotting time in a wild-type mouse. When the specific donor of intron 1 was inserted into the intron 12 locus, correct splicing cannot occur resulting in the expression of huF.IX. The lack of signal in this sample verifies that the intron 1 donor signal that integrates into the intron 1 site actually comes from correct transgenic integration and not from random integration and expression at another nonspecific site.

Insertion of human alpha galactosidase (huGLa): Similar to the insertion of the human F.IX gene, the gene encoding human alpha galactosidase (deficient in patients with Fabry disease) was inserted into the mouse albumin locus. The ZFN 30724/30725 pair was used as described above using an alpha galactosidase transgene instead of the F.IX transgene. In this experiment, 3 mice were treated with an AAV2/8 virus containing the ZFN pair at a dose of 3.0e11 viral genomes per mouse and an AAV2/8 virus containing the huGLa donor at a dose of 1.5e12 viral genomes. per mouse. Control animals were administered either the ZFN-containing virus alone or the huGLa donor virus alone. Western blots performed on liver homogenates showed an increase in alpha-galactosidase-specific signal, indicating that the alpha-galactosidase gene had integrated and was being expressed (Figure 13A). Additionally, an ELISA of the liver lysate was performed using a human alpha galactosidase assay kit (Sino) according to the manufacturer's protocol. The results, shown in Figure 13B, demonstrated an increase in signal in mice that had been treated with both ZFN and the huGLa donor.

Example 7: Design of human albumin-specific ZFNs.

To design ZFN with specificity for the human albumin gene, the DNA sequence of human albumin intron 1 was analyzed using methods described above to identify target sequences with the best potential for binding to ZFN. Regions were chosen throughout the intron (loci 1-5) and several ZFNs were designed to target these regions (for example, see Figure 9 showing the binding sites of ZFNs from loci 1-3). In this analysis, five loci were identified to target albumin intron1 (see Figure 3B). The target and helices are shown in Tables 8 and 9.

T l : Di ñ hli n l in ífi r l min h mn

Table 9: ZFN target sites specific to human albumin

These nucleases were tested in pairs to determine the pair with the highest activity. The resulting matrices of the tested pairs are shown in Tables 10 and 11, below, where the ZFN used for the right side of the dimer is shown at the top of each matrix and the ZFN used for the left side of the dimer is shown on the left side of each matrix. The resulting activity, determined by the percentage of discrepancy detected by the Cel-I assay, is shown on the body of both matrices:

Table 10: ZFN activity is specific for human albumin (% of mutated targets)

Table 11: ZFN activity is specific for human albumin (% of mutated targets)

Therefore, highly active nucleases have been developed that recognize target sequences in intron 1 of human albumin.

Example 8: Design of albumin-specific TALENs

TALENs were designed to target sequences within intron 1 of human albumin. Base recognition was achieved using the canonical correspondences of the RVD base (the “TALE code”: NI for A, HD for C, NN for G (NK in half repeat), NG for T). TALENs were constructed as previously described (see co-owned US Patent Publication No. 20110301073). Targets for a subset of TALENs were conserved in the cynomolgus macaque and rhesus macaque albumin genes (see Figure 10). The TALENs were built on the main TALEN structures "+17" and "+63" as described in document US20110301073. The targets and numerical identifiers of the tested TALENs are shown below in Table 12.

Table 12: TALEN is specific for albumin

The TALENs were then tested in pairs in HepG2 cells to determine their ability to induce modifications in their endogenous chromosomal targets and the results showed that many proteins carrying truncation point 17 were active. Similarly, many TALENs carrying truncation point 63 were also active (see Table 13 and Figure 11). Note that the pair numbers shown in Table 13 correspond to the pair numbers shown above the lanes in Figure 11. Side-by-side comparisons with three sets of non-optimized albumin ZFNs showed that the TALENs and ZFNs have activities that fall in the same approximate range.

T l 1 : M ifi i n i n in i r TALEN n l l H 2-

continuation

As noted previously (see co-owned US Patent Publication No. 20110301073), C17 TALENs have greater activity when the gap size between the two TALEN target sites is approximately 11-15 bp, while that C63 TALENs maintain activity with gap sizes of up to 18 bp (see Figure 10, 11C and Table 13).

Claims (15)

1. A pair of zinc finger nucleases that cleave an albumin gene, wherein the pair of zinc finger nucleases comprises a first and a second zinc finger nuclease, wherein the first zinc finger nuclease comprises multiple engineered zinc finger binding domains that bind to a target site in SEQ ID NO: 127 and the second zinc finger nuclease comprises multiple engineered zinc finger binding domains that bind to a target site in SEQ ID NO: 128. 2. The zinc finger nuclease pair of claim 1, wherein the first and second zinc finger nucleases each comprise 4, 5, or 6 zinc finger binding domains. 3. One or more polynucleotides encoding the pair of zinc finger nucleases of claim 1 or 2. 4. An isolated cell comprising the pair of zinc finger nucleases according to claim 1 or 2 and/or one or more polynucleotides according to claim 3. 5. The cell of claim 4, wherein the cell is a stem cell, optionally wherein the stem cell is selected from the group consisting of an embryonic stem cell (ESC), an induced pluripotent stem cell (iPSC), a cell liver stem and a liver stem cell. 6. A kit comprising the zinc finger nuclease pair according to claim 1 or 2, the one or more polynucleotides according to claim 3 and/or the cell of claim 4 or 5. 7. An in vitro method of cleaving an endogenous albumin gene in a cell, the method comprising: introducing, into the cell, one or more expression vectors comprising one or more polynucleotides encoding a pair of zinc finger nucleases that bind to target sites on an albumin gene, under conditions such that the zinc finger nuclease pair is expressed and the albumin gene is cleaved, wherein the zinc finger nuclease pair comprises a first nuclease with zinc finger nuclease that binds to SEQ ID NO: 127 and a second zinc finger nuclease that binds to SEQ ID NO: 128. 8. The method of claim 7, wherein separate polynucleotides encode the first and second zinc finger nucleases. 9. The method of claim 7 or 8, wherein the one or more polynucleotides are carried by AAV vectors. 10. The method of any of claims 7 to 9, wherein the cell is a liver cell. 11. The pair of zinc finger nucleases of claim 1 or 2 for use in a method of treating the human or animal body, the method comprising introducing the pair of zinc finger nucleases and a donor polynucleotide comprising a transgene which encodes a therapeutic protein, where the transgene is integrated into the albumin gene after cleavage of the albumin gene by the pair of zinc finger nucleases. 12. The one or more polynucleotides of claim 3 for use in a method of treating the human or animal body, the method comprising introducing the one or more polynucleotides and a donor polynucleotide comprising a transgene encoding a therapeutic protein, wherein The transgene integrates into the albumin gene following cleavage of the albumin gene by the pair of zinc finger nucleases. 13. The pair of zinc finger nucleases for use according to claim 11 or one or more polynucleotides for use according to claim 12, wherein the treatment method is a method of treating a lysosomal storage disease , epidermolysis bullosa, emphysema due to AAT deficiency or a blood disorder. 14. The pair of zinc finger nucleases or one or more polynucleotides for use according to claim 13, wherein the blood disorder is a coagulation disorder. 15. The pair of zinc finger nucleases or one or more polynucleotides for use according to claim 13 or 14, wherein expression of the transgene is directed by endogenous albumin control sequences.