ES2917500T3 - Highly Specific Circular Proximity Ligation Assay - Google Patents

Abstract

Provided that a circular proximity ligation assay has been used in the document in which the proximity probes are used as bridges to connect two free oligonucleotides through a double ligation event, resulting in the formation of a circle. The circles are then quantified by, for example, QPCR. The addition of an additional oligonucleotide is believed to improve specificity by decreasing the likelihood of random background ligation events. Furthermore, circle formation may have selective advantages, as non-circularized DNA can be removed by simple exonuclease treatment and has simplified the workflow by eliminating pre-amplification prior to QPCR. (Automatic translation with Google Translate, without legal value)

Description

DESCRIPTION

Highly Specific Circular Proximity Ligation Assay

This invention was made with Government support under contract HG000205 awarded by the National Institutes of Health. The Government has certain rights over the invention.

Background

The quantitative detection of protein biomarkers in biological fluids is essential for the diagnosis, monitoring and personalized treatment of diseases. Despite considerable progress in recent years, the clinical use of validated proteomic biomarkers remains limited (1). The benchmark for affinity-based protein measurements is defined by the enzyme-linked immunosorbent assay (ELISA), in which affinity ligands (eg, antibodies) are used in a sandwich format to detect and quantify the protein of interest. (2. 3). ELISA generally involves several steps beginning with sample incubation, in which the target analyte is captured on a surface pre-coated with primary antibodies, followed by steps of washing and recognition with a secondary antibody, which facilitates detection with a colorimetric, fluorescent or luminescent label. ELISA offers reasonable sensitivity, but requires a large sample volume, has a limited dynamic range, and often suffers from false positives due to nonspecific binding (4, 5). These limitations interfere with the discovery and validation of new biomarker candidates that have the potential to enable early diagnosis and regular molecular monitoring of disease.

Immunoassays combined with nucleic acid-based amplification and detection have facilitated new approaches and extended analytical sensitivity beyond what can be achieved with ELISA (6 to 9). An especially promising approach is the proximity ligation assay (PLA) (10, 11). In PLA, pairs of affinity probes are individually conjugated to short single-stranded DNA molecules to form proximity probes bearing a 5'-phosphorylated end or a 3'-hydroxyl group. When the pairs of probes subsequently bind to their corresponding target analyte in solution, the associated DNA strands approach and align via hybridization to a third bridging oligonucleotide. The free ends of the DNA are ligated to form a new DNA sequence that is amplified and quantified by means of quantitative PCR (qPCR). PLA has previously been shown to provide femtomolar sensitivity and a wide dynamic range of more than 5 orders of magnitude, while consuming as little as 1 pl of sample (12). One of the main advantages of PLA is that it solves the widespread problem of cross-reactivity in antibody-based protein detection. Potential signals from cross-reacting antibodies are eliminated by tailoring the DNA sequences so that binding only occurs when cognate proximity probes bind to the target analyte. This technology has been applied to detect more than 20 different biomarkers in clinical plasma samples using panels of seven multiplex PLA reactions (13, 14). Others have expanded the multiplexing capability even further (15).

One of the limitations of affinity-based immunoassays, including PLA, is the so-called hook effect in which the signal decreases at high antigen concentrations, resulting in incorrectly low signals or even false negatives (16). The hook effect becomes predominant when the concentration of the analyte exceeds the concentration of the proximity probes (>>1 nM) and effectively determines the upper limit of quantitation (17). Proximity probe concentration can potentially be increased, but must be carefully balanced against a deteriorating signal-to-noise ratio due to random background binding events when the probes and the bridging oligo come together by chance. The hook effect can usually be avoided by sample dilution; however, dilution upsets the binding equilibrium. This is not a problem for high-affinity interactions, but it can prevent low-affinity antibodies from binding to their target analytes, thereby limiting the efficacy of PLA to high-affinity capture agents (18). . Although incompatibility with low-affinity antibodies is a major drawback for PLA, it is not limited to this assay alone. The availability of high-affinity antibodies or other capture reagents is a general limitation for all sandwich immunoassays, since sensitivity is ultimately determined by the quality of the reagents used (19).

Numerous approaches have been developed to improve PLA performance, including concentration of trace amounts of analyte on a solid phase prior to ligation (10, 18, 20), use of multivalent proximity probes (21), addition of multiple affinity probes (22, 23), the special design of asymmetric bridging oligos (17), the inclusion of protective oligonucleotides prehybridized to the proximity probes in order to reduce background binding events (22, 24), and the use of new amplification schemes (25-28). Some of the amplification schemes involve enzymatic manipulations in which the ligation products are released from the antibodies and converted to circles used for isothermal rolling-circle amplification (26, 29–31). Many of these approaches have improved assay reproducibility, although accuracy remains a challenge for adaptation to clinical diagnosis.

Proximity detection assays are known in the prior art. US 2004/248103 A1 describes a proximity detection assay based on circularization by ligation of semicircular probes hybridized to first and second antibody-conjugated guide oligonucleotides. WO 2012/152942 A1 describes proximity detection assays based on the formation of RCA circles by ligation of hybridized probes to antibody-conjugated oligonucleotides.

Therefore, there is a need for new assays to detect analytes in a sample, particularly assays that can use lower affinity binding reagents.

Summary

Provided herein, among other things, is a circular proximity ligation assay in which proximity probes are used as bridges to covalently join two free oligonucleotides through a double ligation event, resulting in the formation of a circle. The circles are then quantified, for example, by means of qPCR. In one aspect, the method comprises: incubating a sample comprising a target analyte with: (i) a first conjugate comprising a binding agent and a first splicing oligonucleotide, and (ii) a second conjugate comprising a binding agent and a second splicing oligonucleotide, under conditions suitable for binding the binding agents of the first and second conjugates to the target analyte, to produce a product, wherein the binding agents of the first and second conjugates are selected polyclonal antibodies by affinity, and the affinity-selected polyclonal antibodies are divided into a first portion that conjugates with the first splice oligonucleotide and a second portion that conjugates with the second splice oligonucleotide, to incubate at least part of the product with: (i ) a set of probes that produces a ligatable circle only when the probes hybridize to the first and second splice oligonucleotides and (ii) a ligase, to produce a reaction mixture comprising circular covalently closed molecules, to treat at least part of the reaction mixture with an exonuclease to terminate ligation and degrade any nucleic acid that is not a circular covalently closed molecule; and, after exonuclease treatment, quantify the amount of covalently closed circular molecules produced in the ligation step. A kit for carrying out the procedure is also provided.

Relative to other methods, the addition of an additional oligonucleotide is believed to improve specificity by decreasing the probability of random background binding events. In addition, circling has selective advantages as non-circularized DNA can be removed by simple exonuclease treatment and has streamlined workflow by eliminating pre-amplification prior to qPCR. As a result, this assay is believed to be much simpler not only than previous assays, but most existing protein detection procedures, and can be performed in a single reaction tube with a minute sample volume. (for example, 2 uL). The assay format can use the same proximity probes used in traditional proximity ligation assays, allowing direct comparison of performance between the two procedures. Furthermore, it has been shown that the improved specificity in this assay can be used to increase the proximity probe concentration while maintaining a low probability of background binding events. This results in a better signal-to-noise ratio, better assay performance, and provides a compatibility pathway with low-affinity reagents without the need for solid-phase preconcentration.

Quantitative detection of protein biomarkers over a wide concentration range from minute amounts of blood is essential for clinical diagnosis. The proximity ligation assay combines antibody-oligo conjugates, enzyme ligation, and PCR amplification in a sensitive procedure for the quantitative detection of proteins from small volumes. The procedure described herein is a streamlined and more stringent assay format that takes advantage of DNA circling to remove unwanted DNA molecules. Kinetic analysis of antibody-antigen interactions demonstrates that variation in assay performance between various biomarkers is an effect of antibody quality. This new assay format has been shown to allow compatibility with low-affinity reagents, a major limitation for most protein quantitation procedures, while improving sensitivity and reproducibility.

These and other features of the present teachings are set forth herein.

Brief description of the drawings

Those of experience will understand that the drawings, described below, are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.

FIG. 1. Schematic illustration of some of the features of the probe system used herein.

FIG. 2. Schematic representation of traditional and circular proximity ligation assays. a) The traditional proximity ligation assay (t-PLA) detects proteins using pairs of antibody-DNA conjugates (red and blue) that come into close proximity upon binding to the target analyte. The addition of a bridging oligonucleotide and DNA ligase allows ligation of the antibody-bound oligonucleotides to form a new DNA sequence. Ligation is terminated by selective degradation of the bridging oligonucleotide. The newly formed ligation product is subsequently pre-amplified and quantified by qPCR. b) In the circular proximity ligation (c-PLA) assay, antibody-bound oligonucleotides act as bridges for two ligation events between free oligonucleotides, resulting in the formation of a circular ligation product. The addition of an additional oligonucleotide increases stringency compared to traditional PLA, since it decreases the probability of random background binding events, since four components must be assembled in the absence of the target analyte to generate an independent circular ligation product . Circle formation also allows for exonuclease treatment, which terminates ligation and reduces background by degrading all non-circularized DNA. Background reduction also simplifies your workflow by eliminating the need for preamping. Circular ligation products are quantified by qPCR using primer sites spanning the newly formed junctions (P1 and P2).

FIG. 3. Dose-response curves of traditional and circular PLA for the detection of VEGF (a), GDNF (b), IL-6 (c), MIF (d), TNF-a (e), and IGF-II (f) . The x-axis shows the antigen concentration and the y-axis the estimated number of bound molecules. Higher stringency for c-PLA is demonstrated with fewer counts due to stringency imposed by circling, background reduction by exonuclease treatment, removal of pre-amplification, and tailored qPCR primer sites. Error bars denote standard deviation (n=9) and dashed lines denote detection limit, defined as the mean signal from a 3 SD blank sample.

FIG.4. Isoaffinity analysis and corresponding circular PLA yield for six biomarkers. a) Kinetic analysis reveals two different groups for Kd values, one group with high affinity (single digit pM) and another group with affinity greater than 50 pM. b) The differences in the affinities of the antibodies are directly reflected in the dose-response curves of c-PLA, in which the analytes with low K ^d values show detection limits in the sub-pM interval while the other group shows detection limits in the mid-pM range or higher.

FIG. 5. Comparison of proximity ligation assay procedures at different concentrations of probe for TNF-α. a) The results of the circular proximity ligation assay (c-PLA) offer a higher signal-to-background ratio than traditional PLA (t-PLA). b) Individual components for a signal to noise ratio of 100 pM. The higher signal-to-noise ratio for c-PLa is a consequence of the higher stringency in c-PLA, which produces lower overall signals and larger differences between the positive signal (100 pM) and the negative background noise. c) Dose-response curves demonstrating that higher signal-to-background ratios result in a greater than 10-fold improvement in detection limit (7 pM) for c-PLA when probe concentrations are increased 10 times compared to t-PLA (IX). Error bars denote standard deviation (n=9) and dashed lines denote detection limit, defined as the mean signal from a 3 SD blank sample.

FIG. 6. Performance of proximity ligation assays in human plasma. a) The dose-response curves for the detection of VEGF demonstrate the compatibility of the assay for both PLA procedures in human and chicken plasma. The difference in detection limit between the two arrays is attributed to endogenous levels of VEGF in human plasma that are absent in chicken plasma. b) Dose-response curves for the detection of TNF-α in human plasma demonstrating the improvement in assay performance for c-PLA over t-PLA. A 10-fold increase in probe concentration (10X=2.5 nM) improves reproducibility for c-PLA while there is no improvement for t-PLA. Error bars denote standard deviation (n=9) and dashed lines denote detection limit, defined as the mean signal from a 3 SD blank sample.

FIG. 7. Reaction scheme for conjugation of proximity probes. The antibodies are functionalized with an aromatic hydrazine. Oligonucleotides are functionalized with an aromatic aldehyde via amine modifications at the 5' or 3' ends. The functionalized oligonucleotides are subsequently conjugated to the antibodies in the presence of an aniline catalyst.

FIG. 8. Comparison of preamplification between circular and traditional PLA for VEGF. The difference in counts (estimated number of bound molecules) between preamplified c-PLa and t-PLA reflects the greater rigor in assay design for c-PLA.

FIG. 9. Schematic of the Biacore CAP biotin chip (a) and the Fortebio G-protein sensor (b).

FIG. 10. 1:1 binding model fitted to SPR data in Table 3.

FIG. 11. Kinetic analysis by means of BLI. 1:1 binding model fitted to BLI data in Table 4(a). Isoaffinity plot for six analytes determined by BLI (b). Isoaffinity lines for various values of K ^d are shown as diagonal lines.

FIG. 12. Modeling of the formation of antibody-antigen-antibody complexes in equilibrium. Equations used to determine the number of complexes formed (a). Fraction of antigens that form Ab-Ag-Ab complexes in equilibrium. Ab-Ag-Ab complexes formed after incubation of the proximity probes (2.5*10.1° M) with the antigen in a volume of 4 pl (b) and after the addition of the ligation cocktail containing the oligos linkers and ligase in a volume of 124 pl (c). Ab-Ag-Ab complexes formed after incubation of the proximity probes (2.5*10.8 M, 100-fold magnification) with the antigen in a volume of 4 pl (d) and after the addition of the ligation cocktail containing the linker oligos and ligase in a volume of 124 pl (e).

Definitions

Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as is commonly understood by a person of ordinary skill in the art to which this invention pertains. Although any procedures and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, preferred procedures and materials are described.

Numeric ranges include the numbers that define the range. Unless otherwise indicated, nucleic acids are written from left to right in the 5' to 3' orientation; amino acid sequences are written from left to right in the amino to carboxy orientation, respectively.

The headings provided herein are not limitations on the various aspects or embodiments of the invention. Therefore, the terms defined immediately below are more fully defined by reference to the specification as a whole.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as is commonly understood by a person of ordinary skill in the art to which this invention pertains. Singleton, et al., DDICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2ND ED., John Wiley and Sons, New York (1994), and Hale and Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide experts the general meaning of many of the terms used herein. However, some terms are defined below for clarity and ease of reference.

The term "sample" refers to a sample of organic material from a biological source and, as such, may comprise proteins, nucleic acids, carbohydrates, small molecules, etc. A sample may come from an animal, including human, fluid, solid (eg, feces), or tissue, as well as liquid and solid food products and ingredients, such as dairy products, vegetables, meat and meat by-products, and waste. Biological samples can include materials taken from a patient, including, but not limited to cultures, blood, saliva, cerebrospinal fluid, pleural fluid, milk, lymph, sputum, semen, needle aspirates, and the like. Biological samples can be obtained from all the various families of domestic animals, as well as feral or wild animals, including but not limited to ungulates, bears, fish, rodents, etc. Environmental samples include environmental material such as surface matter, soil, water, and industrial samples, as well as samples obtained from disposable and non-disposable food and dairy processing instruments, appliances, equipment, and utensils. These examples should not be construed as limiting the types of samples applicable to the present invention.

The term "specific binding" refers to the ability of a binding reagent to bind preferentially to a particular analyte that is present in a homogeneous mixture of different analytes. In certain embodiments, a specific binding interaction will discriminate between desirable and undesirable analytes in a sample, in some embodiments more than about 10 to 100-fold or more (eg, more than about 1,000 or 10,000-fold).

The term "affinity" refers to the binding force between two entities. The affinity between two proteins (for example, a capture agent and an analyte) when specifically bound in a capture agent/analyte complex can be characterized by a ^Kd (equilibrium dissociation constant) of less than 10-6 M , less than 10-7 M, less than 10-8 M, less than 10-9 M, less than 10-10 M, less than 10-11 M, or less than about 10-12 M.

The term "epitope", as used herein, is defined as a site on an antigen molecule that binds to an antibody or non-antibody scaffold. An antigen may have one or more epitopes. In some cases, an epitope can be a linear sequence of at least five amino acids. In some cases, an antibody will only bind to an antigen molecule if the epitope has a specific three-dimensional structure.

A "subject" of diagnosis or treatment is a plant or animal, including a human. Non-human animals subject to diagnosis or treatment include, for example, livestock and companion animals.

As used herein, the term "incubate" refers to maintaining a sample and a binding agent under conditions suitable for specific binding of the binding agent to the sample molecules. Such conditions typically include a period of time, a temperature, and a suitable binding buffer (eg, PBS or the like). These conditions are well known for antibodies, aptamers, and other binding agents.

The term "nucleotide" is intended to include those molecules that contain not only the known purine and pyrimidine bases, but also other heterocyclic bases that have been modified. These modifications include methylated purines or pyrimidines, acylated purines or pyrimidines, alkylated riboses, or other heterocycles. Furthermore, the term "nucleotide" includes those molecules that contain hapten or fluorescent tags and may contain not only conventional ribose and deoxyribose sugars, but other sugars as well. Modified nucleosides or nucleotides also include modifications to the sugar moiety, for example, in which one or more of the hydroxyl groups are replaced by halogen atoms or aliphatic groups, functionalized as ethers, amines, or the like.

The terms "nucleic acid" and "polynucleotide" are used interchangeably herein to describe a polymer of any length, for example, greater than about 2 bases, greater than about 10 bases, greater than about 100 bases, greater than about 500 bases. bases, greater than about 1,000 bases, up to about 10,000 or more bases composed of nucleotides, eg, deoxyribonucleotides, ribonucleotides, or a combination thereof, and may be produced enzymatically or synthetically (eg, PNA as described in U.S. Patent No. 5,948,902 and references cited therein) and that can hybridize with natural nucleic acids in a sequence-specific manner analogous to that of two natural nucleic acids, for example, can participate in pairing interactions of Watson-Crick bases. Natural nucleotides are guanine, cytosine, adenine, thymine, and uracil (G, C, A, T, and U, respectively). DNA and RNA have a deoxyribose and ribose sugar backbone, respectively, while the PNA backbone is composed of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. In PNA, various purine and pyrimidine bases are attached to the backbone by methylene-carbonyl bonds. A locked nucleic acid (LNA), often referred to as inaccessible RNA, is a modified RNA nucleotide. The ribose moiety of an LNA nucleotide is modified with an additional bridge connecting the 2' oxygen and the 4' carbon. The bridge "locks" the ribose into the 3'-endo (North) conformation, which is usually found in Form A duplexes. The LNA nucleotides can be mixed with DNA or RNA residues in the oligonucleotide whenever desired. The term "unstructured nucleic acid", or "UNA", is a nucleic acid that contains non-natural nucleotides that bind to each other with reduced stability. For example, an unstructured nucleic acid may contain a G' residue and a C' residue, where these residues correspond to non-natural forms, ie analogs, of G and C that pair with each other with reduced stability, but they retain the ability to pair with natural C and G residues, respectively. Unstructured Nucleic Acid (UNA) is described in US20050233340.

The term "oligonucleotide" as used herein denotes a single-stranded multimer of nucleotides from about 2 to 200 nucleotides, up to 500 nucleotides in length. The oligonucleotides can be synthetic or enzymatically made and, in some embodiments, are from 30 to 150 nucleotides in length. The oligonucleotides may contain ribonucleotide monomers (ie, they may be oligoribonucleotides) or deoxyribonucleotide monomers. An oligonucleotide can be 10 to 20, 21 to 30, 31 to 40, 41 to 50, 51 to 60, 61 to 70, 71 to 80, 80 to 100, 100 to 150 in length. or from 150 to 200 nucleotides, for example. The oligonucleotides may have nucleotide analogs, and in some embodiments, at least some of the bonds between the nucleotides need not be phosphates. In some embodiments, an oligonucleotide may have a phosphorothioate linkage, particularly at the 3' and/or 5' end of the oligonucleotide.

The term "primer", as used herein, refers to an oligonucleotide that is capable of acting as a synthesis initiation point when placed under conditions that induce the synthesis of a primer extension product. , which is complementary to a nucleic acid strand, that is, in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH. The primer can be single stranded and must be long enough to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer will depend on numerous factors, including temperature, source of the primer, and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15-25 nucleotides or more, although it may contain fewer nucleotides. The primers present herein are selected to be substantially complementary to different strands of a particular target DNA sequence. This means that the primers must be complementary enough to anneal to their respective strands. Therefore, the primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment can be attached to the 5' end of the primer, with the rest of the primer sequence being complementary to the strand. Alternatively, non-complementary bases or longer sequences may be inserted into the primer, provided that the primer sequence has sufficient complementarity with the strand sequence to hybridize to it and thus form the template for extension product synthesis.

The term "hybridization" or "hybridization" refers to a process in which one nucleic acid strand binds together and forms a stable duplex, either a homoduplex or a heteroduplex, under normal hybridization conditions with a second nucleic acid strand. complementary, and does not form a stable duplex with unrelated nucleic acid molecules under the same normal hybridization conditions. The formation of a duplex is achieved by annealing of two complementary nucleic acid strands in a hybridization reaction. The hybridization reaction can be made highly specific by adjusting the hybridization conditions (often called hybridization stringency) under which the hybridization reaction takes place, such that hybridization between two nucleic acid strands will not form a stable duplex, eg, a duplex that retains a double-stranded region under normal stringency conditions, unless the two nucleic acid strands contain a certain number of nucleotides in specific sequences that are substantially or completely complementary. "Normal or stringent hybridization conditions" are readily determined for any hybridization reaction. See, eg, Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Inco Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press. As used herein, the term "hybridization" or "hybridization" refers to any process by which one strand of nucleic acid joins a complementary strand via base pairing.

The term "binding agents" refers to any member of a pair of molecules that specifically bind to each other. For example, an antibody (a type of capture agent) binds to an antigen. In this example, both the antibody and the antigen can be a binding agent. The complex containing a pair of binding agents contains a capture agent (eg, an antibody or a non-antibody scaffold) and a moiety that is not a capture agent, eg, a protein, a metabolite, a small molecule , a carbohydrate, a drug, etc.

The term "capture agent" refers to proteins that have a domain that specifically binds other molecules. For example, antibodies and non-antibody binding scaffolds that have the ability to specifically bind to another moiety. Antibody binding proteins include aptamers and non-antibody proteins such as those described in Binz et al. ( Curr Opin Biotechnol. 2005 16:459-469), Binz et al. ( Nat. Biotechnol. 2005 23:1257-1268), Forrer et al. ( Chembiochem. 2004 5:183-189), Gronwall et al. ( J. Biotechnol. 2009 140:254-269), Hosse et al. ( Protein Sci. 2006 15:14-27) and Skerra et al. ( Curr. Opin. Biotechnol. 2007 18:295-304).

The terms "antibody" and "immunoglobulin" include antibodies or immunoglobulins of any isotype, antibody fragments that retain specific binding to antigen, including, but not limited to, Fab, Fv, scFv, and Fd fragments, chimeric antibodies, humanized antibodies, single chain antibodies, polyclonal antibodies (which may or may not be affinity purified), monoclonal antibodies, and fusion proteins comprising an antigen-binding portion of an antibody and a non-antibody protein. This term encompasses antibody fragments (for example, Fab', Fv, F(ab') ² , etc.) that maintain a specific binding with the antigen. An antibody can be monovalent or bivalent.

A nucleic acid is considered to be "selectively hybridizable" to a nucleic acid sequence if the two sequences specifically hybridize to each other under moderate to high stringency hybridization and wash conditions. Hybridization conditions of moderate and high stringency are known (see, for example, Ausubel et al., Short Protocols in Molecular Biology, 3rd ed., Wiley and Sons 1995 and Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition , 2001 Cold Spring Harbor, NY). An example of high stringency conditions includes hybridization at approximately 42°C in 50% formamide, 5X SSC, 5X Denhardt's solution, 0.5% SDS, and 100 ug/mL denatured carrier DNA, followed by a two-fold wash. times in 2X SSC and 0.5% SDS at room temperature and an additional two times in 0.1* SSC and 0.5% SDS at 42 °C.

The term "duplex" or "duplexed," as used herein, describes two complementary polynucleotides that are base-paired, ie, hybridized together.

The terms "determine", "measure", "evaluate", "test" and "analyze" are used interchangeably herein to refer to any form of measurement, and include determining the presence or absence of an element. These terms include quantitative and/or qualitative determinations. The evaluation can be relative or absolute. "Assessing the presence of" includes determining the amount of something present, as well as determining whether it is present or absent.

The term "ligation", as used herein, refers to the enzymatically catalyzed attachment of the terminal nucleotide at the 5' end of a first nucleic acid molecule to the terminal nucleotide at the 3' end of a second nucleic acid molecule. nucleic.

The terms “plurality”, “set” and “population” are used interchangeably to refer to something that contains at least 2 members. In certain instances, a plurality may have at least 10, at least 100, at least 10,000, at least 100,000, at least 106, at least 107, at least 108, or at least 109 or more members.

The term "strand" as used herein refers to a nucleic acid made up of nucleotides covalently linked by covalent bonds, eg, phosphodiester bonds.

The term "covalent bond" refers to the production of a covalent bond between two separate molecules. Ligation produces a covalent bond.

As used herein, the term "ligably adjacent" in the context of two oligonucleotide sequences that are ligably adjacent to each other means that there are no intervening nucleotides between two oligonucleotides and that they can be ligated together.

As used herein, the term "splicing oligonucleotide" as used herein refers to an oligonucleotide that, when hybridized to two or more other polynucleotides, acts as a "splice" to position polynucleotides. 5' and 3' ends of two other polynucleotides next to each other so they can be ligated together, as illustrated in Fig. 1.

The terms "ligable circle" and "ligable circular complex" refer to a circular complex in which the various oligonucleotides are ligatable and adjacent to each other in a circle, held together by splint oligonucleotides, as illustrated in Fig. 1.

As used herein, the term "a set of probes that produces a ligatable circle only when the probes hybridize to the first and second splice oligonucleotides" encompasses a pair of probes that (a) contain ends that hybridize to different splice oligonucleotides (i.e., a first splice oligonucleotide) splice and a second splice oligonucleotide) and (b) hybridize to the first and second splice oligonucleotides to form a ligatable circle. In a complex comprising a first probe molecule and a second probe molecule, the 5' end of the first probe molecule is ligably adjacent to the 3' end of the second probe molecule and the 3' end of the first probe molecule. probe is ligably adjacent to the 5' end of the second probe molecule. In this example, two binding events are required for circularization. The term "only" in this phrase is intended to mean that the probes do not produce a ligatable circle if they hybridize to only one of the first and second splice oligonucleotides (ie, only one but not the other). Illustrated in Fig. 1 is a set of "probes that produce a ligatable circle only when the probes hybridize to the first and second splice oligonucleotides."

As used herein, the term "covalently closed circular molecule" refers to a chain having the shape of a closed circle having no free 3' or 5' ends.

The term "corresponds to" and its grammatical equivalents, eg, "corresponding", as used herein, refers to a specific relationship between the items to which the term refers. For example, an RCA product corresponds to an analyte if the RCA product can be used to quantify that analyte in a sample.

As used herein, the term "rolling circle amplification" or "RCA" for short refers to an isothermal amplification that generates concatenated linear copies of a circular nucleic acid template through the use of a strand displacement polymerase. . RCA is well known in the molecular biology arts and is described in a variety of publications including, but not limited to Lizardi et al. ( Nat. Genet.

1998 19:225-232), Schweitzer et al. ( Proc. Natl. Acad. Sci. 2000 97:10113-10119), Wiltshire et al. ( Clin. Chem.

200046:1990-1993) and Schweitzer et al. ( Curr. Opin. Biotech 2001 12:21-27). This term includes linear ACR and exponential ACR (which may use random primers in some cases).

As used herein, the term "rolling circle amplification products" refers to the concatamerized products of a rolling circle amplification reaction.

As used herein, the term "count" refers to determining the number of individual objects in a larger collection. "Counting" requires detecting separate signals from individual objects in a plurality (not a collective signal from the plurality of objects) and then determining how many objects are in the plurality by counting the individual signals. In the context of the present method, "counting" is performed by determining the number of individual signals in a set of signals.

Other definitions of terms may appear throughout the specification.

Description of Exemplary Embodiments

This specification provides a method for the analysis of samples. In one aspect, the method comprises: (a) incubating a sample comprising a target analyte with: (i) a first conjugate comprising a binding agent and a first splicing oligonucleotide, and (ii) a second conjugate comprising a binding agent and a second splicing oligonucleotide, under conditions suitable for binding the binding agents of the first and second conjugates to the target analyte, to produce a product, wherein the binding agents of the first and second conjugates are affinity-selected polyclonal antibodies, and the affinity-selected polyclonal antibodies are divided into a first portion that conjugates with the first splice oligonucleotide and a second portion that conjugates with the second splice oligonucleotide, (b) incubating at least part of the product with: (i) a set of probes that produces a ligatable circle only when the probes hybridize to the first and second splice oligonucleotides and (ii) a ligand a, to produce a reaction mixture comprising circular covalently closed molecules, (c) treating at least part of the reaction mixture with an exonuclease to terminate ligation and degrade any nucleic acid that is not a circular covalently closed molecule; and, (d) after step (c), quantifying the amount of covalently closed circular molecules produced in the ligation step, ie, the covalently closed circular molecules comprising the probes of step (b).

Fig. 1 schematically illustrates some of the components used in the present process. Fig. 1 shows: a first conjugate 2 comprising a binder 4 and a first splice oligonucleotide 6 , and (ii) a second conjugate 8 comprising a binder 10 and a second splice oligonucleotide 12 . As shown, the first conjugate 2 and the second conjugate 8 are different molecules. As illustrated, probe set 14 comprises a first probe 16 and a second probe 18 , the ends of which hybridize to first splice oligonucleotide 6 and second splice oligonucleotide 12 to produce a ligatable circle 19 containing two nicks, 20 and 22 . In this complex, the 5' end of the first probe is linked to the 3' end of the second probe and the 3' end of the first probe is linked to the 5' end of the second probe. Grooves 20 and 22 can be sealed by ligase, thereby producing a covalently circular molecule 24 having ligation bonds 26 and 28. As shown, two ligation events are required for circularization. As noted above, ligatable circle 19 can only be produced when probes 16 and 18 hybridize to first splice oligonucleotide 6 and second splice oligonucleotide 12 , meaning no a ligatable circle when hybridized to only one or none of the splice oligonucleotides. Since the ligatable circle can only occur when both splicing oligonucleotides are physically close to each other, the ligatable circle should only be formed when one molecule of the first conjugate 2 and one molecule of the second conjugate 8 bind to the same target analyte molecule. . Some of the principles of other proximity ligation assays are described in Fredriksson ( Nat. Biotechnol. 2002-2020: 473-477 ) and Gullberg ( Proc. Natl. Acad. Sci. 2004, 20: 8420-8424 ).

In some embodiments, the binding agents of the first and second conjugates are capture agents. In these embodiments, the method for sample analysis may comprise: (a) incubating a sample comprising a target analyte with: (i) a first conjugate comprising a capture agent and a first splicing oligonucleotide, and (ii) ) a second conjugate comprising a capture agent and a second splicing oligonucleotide, under conditions suitable for binding the capture agents of the first and second conjugates to the target analyte, to produce a product, in which the binding agents of the first and second conjugates are affinity-selected polyclonal antibodies, and the affinity-selected polyclonal antibodies are divided into a first portion that conjugates with the first splice oligonucleotide and a second portion that conjugates with the second splice oligonucleotide, ( b) incubating at least part of the product of step (a) with: (i) a set of probes that produces a ligatable circle only when the probes hybridize n with the first and second splice oligonucleotides and (ii) a ligase, to produce a reaction mixture comprising covalently closed circular molecules, (c) treating at least part of the reaction mixture from step (b) with an exonuclease to terminate ligation and degrade any nucleic acid that is not a covalently closed circular molecule; and (d) after step (c), quantifying the amount of covalently closed circular molecules produced in step (b).

The proteins of the first and second conjugates are affinity-selected polyclonal antibodies, ie, antibodies that have been obtained from an animal that has been immunized with the target analyte, or a portion thereof. In this embodiment, two portions of the same polyclonal antibody stock may be linked to different splice oligonucleotides, as described below.

In some embodiments, the binding agent may have a low affinity for the target analyte, and some embodiments may have a K ^d in the range of 10-5 M to 10-9 M, 10-5 M to 10-8 M, or 10 -5 M to 10 -7 M. In these embodiments, the binding agent is a polyclonal antibody.

The antibody may be a "natural" antibody in which the heavy and light chains have been naturally selected for by the immune system of a multicellular organism. These antibodies have a stereotyped Y-shaped molecule consisting of four polypeptide chains: two identical heavy chains and two identical light chains connected by disulfide bonds. If polyclonal antibodies are used, an animal can be immunized with a single analyte (for example, a protein) or a portion thereof and a polyclonal population of antibodies can be affinity purified from the animal using the analyte or portion thereof. . Affinity purified antibodies can be partitioned and a first portion of the population of antibodies can be conjugated to the first splice oligonucleotide and a second portion of the population of antibodies can be conjugated to the second splice oligonucleotide.

In a conjugate, the binding agent and the splicing oligonucleotide may be linked non-covalently (for example, through a streptavidin/biotin interaction) or covalently (for example, through a cycloaddition reaction or alternative chemistry). . The splice oligonucleotide and linker can be joined via a number of different methods, including those using a maleimide or halogen-containing group, which are reactive to cysteine. Oligonucleotides can be linked to agents, eg, antibodies, using any convenient method (see, eg, Gong et al., Bioconjugate Chem. 2016-2720:217-225 and Kazane et al., Proc Natl Acad Sci 2012 109: 3731-8423736). There are a variety of bonding procedures. For example, splice oligonucleotides can be attached to capture agents directly through the use of any suitable chemical moiety on the capture agent (eg, a cysteine residue or through a designated site). In other embodiments, the splicing oligonucleotides may be attached to the capture agents directly or indirectly through a non-covalent interaction, for example, through a biotin/streptavidin or equivalent thereof, through an aptamer, or a secondary antibody, or through a protein-protein interaction, such as a leucine tag interaction or the like. The linker and oligonucleotide may be attached at a site proximal to or at the 5' end of the oligonucleotide, proximal or at the 3' end of the oligonucleotide, or anywhere in between.

In some embodiments, each end of the probes is perfectly complementary to at least 6 contiguous nucleotides (eg, 6 to 50 or 8 to 30 contiguous nucleotides, eg, 6, 7, 8 or more nucleotides) of the oligonucleotides. splicing, although the procedure is expected to work if there are some mismatches that do not significantly interfere with hybridization or ligation. In some embodiments, the oligonucleotides may be attached to the agents by a linker that spaces the oligonucleotide from the agents, if necessary.

In some embodiments, the initial steps of the procedure may comprise combining a volume of a liquid sample with the conjugates in a suitable binding buffer, incubating the mixture for a period of time, and then adding the probes and adding the conjugates. ligase to the mixture. This initial stage can be carried out by adding a relatively small volume of sample (eg 1 to 5 uL) directly to a larger volume of the first and second conjugates in binding buffer (eg 10 uL to 50 uL buffer) . In these embodiments, the sample can be diluted at least 2x, at least 3x, at least 4x, at least 5x, or at least 10x. In the ligation step, the ligase used may be a ligase that has a substrate preference for sealing nicks in double-stranded DNA molecules, rather than ligating single-stranded DNA molecules together, thereby reducing the background ties. Once the circular covalently closed molecules are produced, the method may comprise treating at least a portion of the reaction mixture with an exonuclease to terminate ligation and degrade any nucleic acid that is not a circular covalently closed molecule. In some cases, the exonuclease may comprise both exonuclease I and exonuclease III, although in some cases one or more other exonucleases could be used instead, for example, exonuclease T, exonuclease V, exonuclease VII, exonuclease T5 or T7 exonuclease. In some embodiments, the exonuclease treatment step can be implemented by directly adding the one or more exonucleases to the ligation. The exonuclease treatment step should terminate the ligation and degrade any nucleic acid that is not a covalently closed circular molecule. This step cannot be incorporated into other methods in which the binding agents bind to oligonucleotides that are primers used because, as would be apparent, the primers would be destroyed by the exonuclease. In the present method, the first and second splice oligonucleotides are used only as splices to ligate the probes. The method does not comprise the use of the splicing oligonucleotides as primers to amplify the covalently closed circular molecules. After treatment with exonucleases, these can be inactivated by any convenient method. In some embodiments, the exonucleases can be inactivated by heat treatment, eg, by heating the reaction to a temperature of at least 60°C for an extended period of time, eg, at least 10 minutes. The conditions used to inactivate the exonuclease may depend on the exonucleases used.

After the circular covalently closed molecules are made, the method comprises quantifying the amount of circular covalently closed molecules. This can be done in different ways, with or without a pre-amplification step, for example, by means of quantitative PCR or end-point PCR (for example, digital PCR, which can be implemented in plates or in spots), by means of the use of microarrays, or through sequencing. In performing sequencing, one or more of the probes may be indexed, allowing the molecules to be counted after sequencing.

In some embodiments, circular covalently closed molecules can be quantified by quantitative PCR (qPCR), which assay can employ a double-stranded DNA-specific dye or hydrolysis probe (eg, a TaqMan assay or the like). These quantitative PCR assays typically use a first primer that hybridizes to the covalently closed circular molecule and a second primer that hybridizes to the complement of the covalently closed circular molecule, thereby allowing part of the circular molecule sequence to covalently closed is amplified by PCR. In some embodiments, the first and second primers used for quantitative PCR can be targeted to the ligation junctions on the covalently closed circular molecules, thereby making the qPCR more specific. In these embodiments, the first primer anneals to a sequence spanning one of the ligation junctions, and the second primer anneals to the complement of a sequence spanning the other of the ligation junctions. In these embodiments, the 3' end of the first and second primers can extend one, two, three, or, in some cases, four or more nucleotides beyond the ligation junction. In some embodiments, pre-amplification of the covalently closed circular molecule is not required before performing qPCR. These pre-amplification procedures typically use primers that bind to sites that are outside the sites bound by the qPCR primers (so that the pre-amplification primers and the qPCR primers have a nested relationship). Thus, qPCR can be carried out without a pre-amplification step. Alternatively, circular covalently closed molecules can be quantified by amplifying the circular covalently closed molecules by rolling circle amplification (RCA) to produce RCA products, and counting the RCA products. These procedures can be adapted from Larsson et al. ( Nature Methods 2004 1:227-232) among others. Other methods for quantifying circular nucleic acid molecules are known or would be apparent to those of skill in the art.

In some embodiments, the initial steps of the procedure (up to the quantification step) can be implemented in a "single-tube" format, in which the reagent (eg, enzyme, probes, etc.) is added directly to the the pre-reaction (after the reaction is complete). In these embodiments, the binding, probe hybridization/ligation, and exonuclease reactions (ie, steps (a) through (c)) can be carried out in the same vessel. Specifically, the probe hybridization/ligation step (step (b)) may comprise the addition of reagents (the probes and the ligase) to the container comprising the product of the ligation step (step (a)), and the Exonuclease treatment (step (c)) may comprise adding reagents (one or more exonucleases) to the vessel comprising the ligation product (from step (b)).

The method can be multiplexed by using different sets of first and second conjugates for each target analyte. In these embodiments, the splicing oligonucleotides of the conjugates that bind a first analyte, as well as the probes that hybridize with those splicing oligonucleotides, may be different from the splicing oligonucleotides of the conjugates that bind a second analyte, as well as probes that hybridize to those splice oligonucleotides. Since the different sets of probes have different sequences, they can be assayed approximately independently of one another by means of qPCR. As such, in some embodiments the sample may comprise a plurality of analytes, step (a) of the method may comprise incubating the sample with multiple pairs of said first and second conjugates, wherein each pair of conjugates binds to a different analyte; and step (d) comprises quantifying the number of covalently closed circular molecules corresponding to each analyte. In some embodiments, the analytes can be quantified in the same reaction, for example, by using multiplex qPCR. In other embodiments, the analytes can be quantified in different assays. In some embodiments, analytes can be quantified in different assays, where each assay is itself a multiplex assay containing an internal control (which can be used to, for example, normalize the amount of the target analyte in the samples). samples). At least 2, at least 5, or at least 10 or more analytes can be quantified in a multiplexed manner using the present method.

The target analyte detected by the method can be any type of biological molecule to which antibodies can bind at different sites. Proteins are one type of target analyte. In some embodiments, both conjugates can be bound to a single protein. In other embodiments, the analyte can be a protein complex. In these embodiments, the first and second binding agents can bind to different proteins in the complex.

In some embodiments, the sample is a body fluid or a processed form thereof. Bodily fluids of interest include plasma, saliva, and urine, although other bodily fluids may be used in the present method. Body fluids include, but are not limited to, amniotic fluid, aqueous humor, vitreous humor, blood (for example, whole blood, fractionated blood, plasma, serum, etc.), breast milk, cerebrospinal fluid (CSF), cerumen, chyle, endolymph, perilymph, faeces, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheumatism, saliva, sebum (skin oil), semen, sputum, sweat, synovial fluid, tears, vomit, and urine. In some embodiments, a sample may be obtained from a subject, eg, a human, and may be processed prior to use in testing the subject. For example, prior to analysis, protein can be extracted from a tissue sample prior to starting the present procedure. In some embodiments, the sample may be a clinical sample, eg, a sample collected from a patient.

The present method can have a sensitivity of at least 5 fM, 10 fM, 50 fM, 100 fM, 0.5 pM, 1 pM, 5 pM, 10 pM, 50 pM, 100 pM, 0.5 nM, 1 nM, 5 nM, 10 nM, 50 nM or 100 nM depending on the target analyte.

Without wishing to be bound by any particular use, the present method has particular utility in the analysis of blood plasma. Blood plasma can be obtained noninvasively and contains a variety of different and low-abundance proteins that are diagnostic, prognostic, or theranostic (see generally Anderson et al., Molecular & Cellular Proteomics 2002 1:845-867 and Anderson et al., Clinical Chemistry 2010 56: 177-842185). As such, in some embodiments, the present method can be used to quantitate one or a combination (eg, 2, 3, 4, 5, or more) of the following proteins in plasma: acid phosphatase, IgG, alanine aminotransferase (ALT or SGPT), IgM, albumin, inhibin-A, aldolase, insulin, alkaline phosphatase (ALP), insulin-like growth factor-I (IGF-I), α-1-acid glycoprotein (orosomucoid), growth factor-like insulin-II (IGF-II), a-1-antitrypsin, IGFBP-1, a-2-antiplasmin, IGFBP-3, a-2-HS-glycoprotein, interleukin-2 receptor (IL-2R), a-2-macroglobulin, isocitric dehydrogenase, a-fetoprotein (tumor marker), K light chains, amylase, cardiac fraction of lactic acid dehydrogenase (LDH-1), amylase, hepatic fraction of lactic acid dehydrogenase (LLDH), ACE, lactoferrin , antithrombin III (ATIII), A light chains, apolipoprotein A1, lipase, apolipoprotein B, Lp(a), aspartate aminotransferase (AST or SGOT), phospholipase A2 associates gives lipoproteins (LP-PLA2), microglobulin 3-2, LH, 3-thromboglobulin, lysozyme, biotinidase, macrophage migration inhibitory factor (MIF), myeloperoxidase (MPO), cancer antigen 125 (CA 125), myoglobin, cancer antigen 15-3 (CA 15-3), osteocalcin, cancer antigen, human epididymis protein (HE4), parathyroid hormone, carcinoembryonic antigen (CEA), phosphohexose isomerase, ceruloplasmin, plasminogen, cholinesterase, plasminogen activator inhibitor (PAI) ), complement C1, prealbumin, complement C1 inhibitor, NTproBNP, complement C1Q, procalcitonin (PCT), complement C3, prolactin, complement C4, properdin factor B, complement C5, prostatic acid phosphatase (PAP), CRP, prostate-specific antigen (PSA), creatine kinase-B (CKBB), protein C, creatine kinase-MM (CKMM), protein S, cystatin C, pseudocholinesterase, erythropoietin, pyruvate kinase, factor IX antigen, renin, factor X, binding protein retinol (RBP), fac thor XIII, sex hormone binding globulin, ferritin, soluble mesothelin-related peptide, fibrinogen, sorbital dehydrogenase (SDH), fibronectin, thyroglobulin, FSH, TSH, GGT, thyroxine binding globulin (TBG), haptoglobin, tissue plasminogen activator (T-PA), human chorionic gonadotropin (hCG), transferrin, hemopexin, transferrin receptor ( ^t F ^r ), her-2/neu protein, troponin T (TnT), human growth hormone (HGH), TnI (cardiac ), human placental lactogen (HPL), trypsin, IgA, urokinase, IgD, von Willebrand factor, IgE, nucleotidase, IgG subclass 4, ADAMTS 13 activity and inhibitor, inhibin B (infertility), adenosine deaminase, IGFBP-2, adiponectin , intercellular adhesion molecule 1, pituitary glycoprotein hormone subunit, interferon-y, a-galactosidase, interferon-a, EIA, aN-acetylglucosaminidase, interleukin-1 receptor antagonist, amyloid protein 13, soluble interleukin-1 receptor type II, angiotens inogen, interleukin-1a, anti-müllerian hormone (AMH), interleukin-113, 3-glucuronidase, interleukin-2, 3-N-acetylglucosaminidase, interleukin-3, calprotectin, interleukin-4, cancer antigen 72-4, interleukin-5 cholecystokinin, interleukin-6, complement C2, interleukin-7, complement C4 binding protein, interleukin-8, complement C6, interleukin-9, complement C7 level, interleukin-10, complement C8 level, interleukin-11, level complement C9, interleukin-12, corticosteroid binding globulin (transcortin), interleukin-13, CYFRA 21-1 (soluble cytokeratin fragment), interleukin-14, dopa decarboxylase, interleukin-15, elastase, interleukin-16, eosinophil cationic protein, interleukin-17, epidermal growth factor, interleukin-18, growth factor receptor epidermal growth hormone (EGFR), kallikrein, factor II, leptin, factor V, leucine aminopeptidase, factor VII, mannose-binding lectin, factor VIII, neuron-specific enolase (NSE), factor XI, neurophysin, factor XII, pancreastatin, Fibroblast growth factor (FGF2), pepsinogen I, gastric inhibitory polypeptide (GIP), pepsinogen II, glial cell-derived neurotrophic factor (GDNF), glutathione peroxidase, proteasome activity, plasma Leumeta, granulocyte colony-stimulating factor, protein S-100B, granulocyte-macrophage colony-stimulating factor, soluble cD30, growth hormone-binding protein, squamous cell carcinoma antigen, hemoglobin, releasing hormone thyrotropin (TRH), heparin cofactor II, transforming growth factor-131, hexosaminidase A and total hexosaminidase, tumor necrosis factor receptor 1, high molecular weight kininogen, tumor necrosis factor receptor 2, heparin-releasing hormone human growth hormone (HGH-RH), tumor necrosis factor-a, IgG subclass 1, tumor necrosis factor-13, IgG subclass 2, vascular endothelial growth factor (VEGF), IgG subclass 3, and a-binding protein vitamin d

As would be apparent, the method can also be used to identify a microbial (eg, bacterial or viral) pathogen in a clinical sample, eg, a cell surface protein or a secreted protein. In these embodiments, the capture agents can target proteins or other molecules of a pathogen. If circles are detected, the subject can be diagnosed as being infected by that pathogen. Microbes that can be identified by the present methods, compositions, and kits include, but are not limited to, the following: viruses, yeasts, Gram (+) bacteria, Gram (-) bacteria, bacteria of the family Enterobacteriaceae, bacteria of the genus Enterococcus , bacteria of the Staphylococcus genus and bacteria of the Campylobacter genus, Escherichia coli ( E. coli), E. coli of various strains such as, K12-MG1655, CFT073, 0157:H7EDL933, 0157H7 VT2-Sakai, etc, Streptococcus pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, coagulase-negative staphylococci, a plurality of Candida species including C. albicans, C. tropicalis, C. dubliniensis, C. viswanathii, C. parapsilosis, Klebsiella pneumoniae, a plurality of Mycobacterium species such as M. tuberculosis , M. bovis, M. bovis BCG, M. scrofulaceum, M. kansasii, M. chelonae, M. gordonae, M. ulcerans, M. genavense, M. xenoi, M. simiae, M. fortuitum, M. malmoense, M. celatum, M. haemophilum and M. af ricanum , Listeria species, Chlamydia species, Mycoplasma species, Salmonella species, Brucella species, Yersinia species, etc. Thus, the procedure in question allows the identification of microbes down to the level of the genus, species, subspecies, strain or variant of the microbe.

In some embodiments, the results of the procedure may be diagnostic (eg, may provide a diagnosis of a disease or condition or the type or stage of a disease or condition, etc.), prognostic (eg, indicate a clinical outcome , for example, survival or death within a time frame) or theranostic (for example, indicating which treatment would be most effective). In some embodiments, the method can be used to analyze a group of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more analytes that are independently present at a higher or lower concentration relative to with a control (eg, an internal control), where collectively the identity of the analytes and their abundance correlate with a phenotype.

The procedure can be used to analyze a patient sample. In this embodiment, the method may comprise: (a) quantifying, via the method described above, one or more analytes in a sample and (b) providing a report indicating a correlation with phenotype. This embodiment may further comprise making a diagnosis, prognosis or theranosis based on the report. The report may indicate the normal range of the analyte.

In some embodiments, the procedure may involve creating a report as described above (an electronic form of which may have been forwarded from a remote location) and sending the report to a physician or other medical professional to determine if a patient has a phenotype (eg, cancer, etc.) or to identify an appropriate therapy for the patient. The report can be used diagnostically to determine if the subject has a disease or condition, such as cancer. In certain embodiments, the method can be used to determine the stage or type of cancer, to identify metastatic cells, or to monitor a patient's response to treatment, for example.

In any embodiment, the report may be forwarded to a "remote location", where "remote location" means a location other than the location where the image is examined. For example, a remote location can be another location (for example, an office, a laboratory, etc.) in the same city, another location in a different city, another location in a different state, another location in a different country, etc. . Therefore, when it is stated that one item is “away” from another, what is meant is that the two items may be in the same room but separate, or at least in different rooms or different buildings, and may be separate. at least a mile, ten miles, or at least a hundred miles. “Communicating” information refers to the transmission of the data representing that information as electrical signals through an appropriate communication channel (for example, a private or public network). “Transmitting” an item refers to any means of getting that item from one place to another, whether by physical transportation of that item or otherwise (where possible) and includes, at least in the case of data , the physical transport of a support that carries the data or the communication of the same. Some examples of communication media are radio or infrared transmission channels, as well as a network connection to another computer or networked device, and the Internet or email transmissions and information recorded on websites and the like. In certain embodiments, the report may be reviewed by a physician or other qualified medical professional, and a report based on the results of the image analysis may be sent to the patient from whom the sample was obtained.

kits

Also provided in the present disclosure are kits containing reagents for practicing the subject methods, as described above. The kits in question contain one or more of the components described above. In one aspect, a kit comprises: (i) a first splice oligonucleotide, (ii) a second splice oligonucleotide, (iii) a set of probes that produces a ligatable circle only when the probes hybridize to the first and second oligonucleotides splicing oligonucleotides, and (iv) one or more exonucleases, (v) a binding agent to which the first and second splicing oligonucleotides can be conjugated, wherein the binding agent is affinity-selected polyclonal antibodies, wherein the Affinity-selected polyclonal antibodies are divided into a first portion that is conjugated to the first splice oligonucleotide and a second portion that is conjugated to the second splice oligonucleotide. In these embodiments, the splicing oligonucleotides can have reactive ends that can react with/bind to a binding agent, as discussed above. In some embodiments, a kit may further comprise a ligase and/or primers for performing quantitative PCR analysis, as described above. In some embodiments, the primers target the ligation junctions in the ligatable circles produced by hybridization of the splice oligonucleotides with the probes. In these embodiments, one primer can hybridize to a sequence spanning one of the ligation junctions, and the other primer hybridizes to the complement of a sequence spanning the other of the ligation junctions.

The various components of the kit may be present in separate containers or certain compatible components may be pre-combined in a single container, as desired.

In addition to the components listed above, subject kits may further include instructions for using the kit components to practice subject procedures, ie, instructions for sample analysis. The instructions for the practice of the procedures in question are generally recorded on a suitable recording medium. For example, the instructions can be printed on a substrate, such as paper or plastic, etc. As such, the instructions may be present on the kits as a package insert, on the kit container or kit component labeling (i.e., associated with the package or subpackage), etc. In other embodiments, the instructions are present as an electronic storage data file present on a suitable computer-readable storage medium, eg, CD-ROM, diskette, etc. In other embodiments, the actual instructions are not present in the kit, but means are provided to obtain the instructions from a remote source, eg, over the Internet. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As in the case of the instructions, the means to obtain them are recorded on a suitable substrate.

examples

Aspects of the present teachings can be better understood in light of the following examples, which should not be construed as limiting the scope of the present teachings in any way.

Presented herein is a highly specific protein detection procedure, called the circular proximity ligation assay (c-PLA), that outperforms traditional PLA in terms of stringency, ease of use, reproducibility, and compatibility with low-affinity reagents. . In c-PLA, two proximity probes bind to an analyte, providing a scaffold that positions two free oligonucleotides so that they can bind to a circular DNA molecule. This assay format stabilizes antigen proximity-probe complexes and improves stringency by reducing the probability of random background binding events. Circle formation also increases selectivity, since non-circularized DNA can be removed enzymatically. This procedure has been compared to traditional PLA on various biomarkers and demonstrates that the higher stringency of c-PLA improves reproducibility and increases sensitivity in both buffer and human plasma. The detection limit ranges from femtomolar to nanomolar concentrations for both procedures. Kinetic analysis using surface plasmon resonance (SPR) and bilayer interferometry (BLI) reveals that the variation in detection limit is due to variation in antibody affinity, and that c-PLA outperforms traditional PLA for low affinity antibodies. The lower background signal can be used to increase the proximity probe concentration while maintaining a high signal-to-noise ratio, allowing low-affinity reagents to be used in a homogeneous assay format. The advantages of c-PLA are expected to be useful in a variety of clinical protein detection applications where high affinity reagents are lacking.

c-PLA a highly specific, sensitive and convenient assay for the quantitative detection of proteins. The procedure is based on existing PLA, but also benefits from the formation of circular DNA molecules. Proximity ligation assays combined with circling have traditionally been used for rolling circle amplification and have shown impressive results for in situ detection and digital quantification. Circle formation has been shown to increase reproducibility by noise minimization throughout the linear dynamic range. This is facilitated by the inclusion of exonuclease treatment, which hydrolyzes non-circular DNA. This design also simplifies workflow as it eliminates the need for pre-amplification prior to qPCR quantification without any loss in assay performance. Both procedures were compared using six commonly used biomarkers and demonstrated equal or better performance for circular PLA.

Kinetic analysis of the required antibody-antigen interactions, an essential precaution rarely taken during assay development for protein detection, demonstrates a direct correlation between kinetic constants and assay performance. The value of kinetic information for searching for suitable antibodies prior to proximity probe conjugation and for optimizing proximity probe concentrations as well as assay procedures has been established. This work therefore indicates that the regular use of kinetic analysis will be highly beneficial in improving assay performance on a wide variety of analytes.

The advantages of c-PLA over t-PLA for low-affinity interactions are aided by the suppressed dissociation provided by longer DNA duplexes. It has been shown that the additional proofreading step facilitated by the extra oligo in the circular PLA can be exploited to increase the proximity probe concentration without a concomitant increase in background binding. This improves the signal to noise ratio and detection limit compared to t-PLA and allows the use of low affinity reagents. This is an important advantage, as low-affinity antibodies and variation in antibody specificity often contribute to systematic errors in research and clinical diagnosis (51). The advantages of c-PLA over t-PLA have also been shown to persist in complex media such as human plasma. This will facilitate new applications when high affinity reagents are not available, allowing not only detection of new analytes, but also higher sensitivity for protein detection. These advantages are reinforced by the ease of application of the test, as well as its automation capacity and the variety of quantification procedures (digital, fluorescent, electrical, etc.). The formation of circular DNA also allows detection by rolling-circle amplification and other isothermal amplification procedures that can be performed in low-cost point-of-care devices (52, 53). An assay of this versatility and throughput is anticipated to help pave the way for much broader adoption of protein quantitation in clinical and even resource-poor settings.

Results

Circular proximity ligation assay workflow. Workflows for the traditional proximity ligation assay (t-PLA) and the circular proximity ligation assay (c-PLA) are shown in Fig. 2. Both assays use the same set of proximity probes that are prepared by bioconjugating polyclonal antibodies with amine-modified oligonucleotides via aromatic hydrazone chemistry (details are provided in Figure 7 and in Materials and Methods). . Polyclonal antibodies are cost-effective, since a single batch of antibodies is split into two portions and coupled to oligonucleotides that are terminated by a phosphorylated 5' end or a 3' end, respectively. This produces two heterogeneous mixtures of proximity probes against several different epitopes of the same target antigen. During sample incubation, the antibody portions of these proximity probes bind to different epitopes on the target analyte. Next, a ligation step is carried out in which a solution containing DNA ligase is added to the incubation mixture. In t-PLA this ligation mix contains a third bridging oligonucleotide complementary to the ends of the proximity probes, thereby facilitating ligation to form a new DNA sequence. Ligation is terminated by the addition of a uracil cleavage mixture, which selectively degrades the bridging oligonucleotide. The ligation mix is subsequently pre-amplified through the newly formed DNA ligand to increase signal-to-background ratio and reproducibility (12, 35) prior to qPCR quantification. In c-PLA, ligation products are not formed by direct binding of proximity probes, but rather by the formation of a circle when two free linker oligonucleotides join in two different ligation events facilitated by bound proximity probes. to the target the uracil cleavage step is replaced by exonuclease treatment, which has the selective advantage of enriching circularized DNA (32). Consequently, the background decreases dramatically, since all non-circularized nucleic acids are degraded, unlike the bridging oligo in t-PLA. This allows pre-amplification to be skipped prior to qPCR analysis without any loss in signal-to-noise ratio or reproducibility.

Characteristics of the test. c-PLA was designed from existing traditional PLA probes that have been optimized to minimize heteroduplex formation (12). This allowed the two procedures to be compared by using the same set of proximity probes. In the case of c-PLA, the ligation conditions were relaxed to account for the requirement of two ligation events and to accommodate Ampligase efficiency at higher temperature. Consequently, ligation was carried out for 30 minutes at 45°C instead of 15 minutes at 30°C. A comparable modification of t-PLA did not produce any improvement.

A direct comparison between traditional and circular PLA for six biomarkers is shown in Fig. 3 and the results are summarized in Table 1. These experiments were carried out with three biological replicates and quantified in triplicate qPCR experiments for Generate nine data points for each concentration. For vascular endothelial growth factor (VEGF), a dose-dependent response by almost 5 orders of magnitude is demonstrated for both procedures (Fig. 3a). The difference of almost 4 orders of magnitude in the counts (estimated number of bound molecules) generated by the two methods is due to both the elimination of pre-amplification and the increased stringency of c-PLA. For comparison, pre-amplification was carried out in c-PLA and it was found that omitting this step accounts for approximately 3 orders of magnitude of difference in signal, while rigor in assay design accounts for the rest (Fig. 8). ). Preamplification was originally introduced to improve signal-to-background ratio and accuracy, although t-PLA continues to be hampered by a relatively high CV (coefficient of variation), an obstacle to its standard use in clinical diagnosis. t-PLA variation has traditionally been addressed by adding internal controls and normalizing the data, allowing for relative biomarker profiling (13, 15). Background signals for PLA are generated from random binding events, nonspecific binding of two cognate proximity probes, or nucleic acid amplification artifacts. In c-PLA, random binding events are minimized by stringency in assay design, since four molecules and two binding events are required for signal generation. Non-specific binding effects are addressed by adding excess IgG molecules of the same species as the proximity probes (12). Nucleic acid amplification artifacts are minimized in c-PLA, since double ligation events result in two new DNA sequences at the binding sites. Multiple primers targeting different sites on the newly formed circular DNA were tested and it was found that a pair of primers spanning both junctions produced the lowest background. Exonuclease treatment in c-PLA also reduces background, which improves signal-to-noise ratio and assay performance. This improves accuracy within the linear dynamic range, as evidenced by the decrease in average CVs from 29% for t-PLA to less than 16% for c-PLA (Table 1). The accuracy of PLA is generally limited by the qPCR readout, and variation at low counts can be further decreased with digital quantification procedures (31, 36).

Table 1. Comparison of detection limit and dynamic range of six biomarkers measured by circular and traditional PLA.

c-PLA was compared with traditional PLA for five additional biomarkers, glial cell line-derived neurotrophic factor (GDNF), interleukin 6 (IL-6), macrophage migration inhibitory factor (MIF), tumor necrosis factor alpha (TNF-a) and insulin-like growth factor II (IGF-II) (Fig. 3b–f, raw data provided in Tables 5–10). Higher stringency for c-PLA was found to result in improvements in precision, signal-to-background ratio, and equal or better assay performance in terms of detection limit and dynamic range for all analytes except GDNF. Average CVs over the entire linear range were all less than 20% for c-PLA, with the exception of IL-6 (28%), while CVs for t-PLA ranged from 24% to 48%. Reproducibility is generally better at higher concentrations, while precision deteriorates at lower concentrations. This represents a common problem for PLA and other highly sensitive procedures for protein quantification (37-39).

A notable observation is that the detection limit for analytes varies by more than 5 orders of magnitude from low femtomolar to nanomolar concentration and that the dynamic range is confined by the detection limit at the lower end and the probe concentration of proximity at the top end where the hook effect begins to interfere. Consequently, IGF-II, which exhibits the worst detection limit (1 nM) among the analytes tested, also exhibits a restricted dynamic range of approximately 2 orders of magnitude. Assay performance for the same biomarkers in t-PLA generally follows the same trend as that found for c-PLA, albeit with a slightly higher detection limit. It should be noted that previous proximity ligation studies of the same analytes have reported the limit of detection using various definitions (12, 15). In this case the detection limit is strictly defined as the mean signal corresponding to a blank sample plus three standard deviations (40). Discrepancies in the reported detection limit may be affected by the use of alternative definitions, differences in protocol, or by batch-to-batch variation in proximity probe conjugation, since affinity probes without conjugated oligonucleotides are they can bind target analytes and interfere with the ability to facilitate binding. One of the advantages of using the same batch of proximity probes for both traditional and circular proximity ligation is that these effects are eliminated, making comparison between the two procedures easier. Furthermore, keeping the oligonucleotide sequences constant for all analytes removes any variation that may arise from sequence specificity, although this limits the ability to perform multiplexing for the purposes of this investigation. The similarities in performance between the two methods indicate that the variation in detection limit between analytes is intrinsically an effect of the quality of the proximity probes and their ability to allow for antibody-antigen interactions.

Kinetic analysis of affinity reagents. Knowledge of the binding kinetics between antibodies and antigens is important for all immunoassays (3, 19). The relationship between kinetics and assay performance was explored. An earlier report showed a good correlation in traditional EPL between detection limit and theoretical affinity, but did not determine equilibrium dissociation constants (Kd) for the antibodies used (11). Furthermore, no analysis has been reported on association rate constants, ka (activation rates), or dissociation rate constants, kd (deactivation rates), and their importance in proximity ligation assays. For this, surface plasmon resonance (SPR) (41) was used to determine the Kd values, as well as the rates of activation and deactivation of the investigated antibody-antigen interactions. The kinetic parameters are listed in Table 2 and the SPR sensorgrams for individual analytes fitted to a 1:1 binding model are provided in Figure 10. The results are also synthesized in an isoaffinity plot (Fig. 4a) where the two rate constants are plotted against each other to give the Kd values along the diagonal lines of isoaffinity (42). Activation rates varied 30-fold, from 4.9*105 M-1s-1 for IGF-II to 1.6*107 M 'V for VEg F. Deactivation rates varied from 1.6*10- 4 s-1 for TNF-α to exceptionally slow inactivation rates below the sensitivity range of the Biacore T200 instrument (1.0*10-5 s-1) for both GDNF and IL-6. The software used to fit the data continued to provide deactivation rates beyond the instrument limit (results in Table 3), but due to uncertainty in accuracy, deactivation rates were limited to no less than 1.0* 10' 5 s-1 in the calculation of K ^d . The resulting K ^d values spanned more than 2 orders of magnitude, from 2.8*10-10 M for TNF-α to less than 7.1*10-13 M for GDNF.

Table 2. Summary of data from the kinetic analysis of six biomarkers using SPR.

Because some of the deactivation rates determined by SPR were found to be below the sensitivity range of the Biacore instrument, a complementary analysis was performed using biofilm interferometry (BLI) (43). These measurements corroborated the results of the SPR; deactivation rates for GDNF and IL-6 were also beyond the sensitivity of the Fortebio Octet RED instrument. Presented in Figure 11 are the kinetic data from the BLI measurements, the binding curves of the individual analytes fitted to a 1:1 binding model, and an isoaffinity plot for all analytes. BLI-determined Kd values ranged over 3 orders of magnitude, from 6.4*10-9 M for TNF-α to less than 2.5*10-12 M for GDNF and IL-6. These values are approximately one order of magnitude higher than the corresponding SPR data, largely due to differences in the determination of activation rates. SPR is a flow cell-based procedure with a three-dimensional dextran matrix, while BLI uses fiber-optic planar sensors in a well-plate format. The BLI system has previously been reported to underestimate fast activation rates due to mass transfer limitations, which is consistent with previous findings (44). Numerical values of kinetic constants determined by surface-based methods are likely to differ from solution-based values, which are presumably more applicable to homogeneous PLA. However, the relative rankings between the two procedures show good agreement and are important indicators of the comparative quality of the antibodies.

All the proximity probes described in this work come from polyclonal antibodies purified by affinity. These antibodies are mixtures derived from different cell lineages that produce antibodies that recognize different epitopes of the antigen, each with its own individual kinetic characteristics. Due to this heterogeneity, the kinetic properties of polyclonal antibodies are inherently difficult to accurately characterize and the derived kinetic constants and affinities are considered to be an average for the different subpopulations in a batch of antisera. One prospective effect is that the long incubation time between the sample and the proximity probes will allow continuous exchanges moving towards higher affinity interactions.

Utilization of kinetic data to improve the performance of c-PLA. The isoaffinity plot of Fig. 4a it includes the kinetic information of all the investigated antibody-antigen interactions, which reveals a clear differentiation of affinities. Antibodies with the highest affinity are located in the upper left corner, since they are characterized by low rates of deactivation and high rates of activation that give rise to low Kd values. Antibodies against GDNF, VEGF, and IL-6 have high affinity with Kd values less than 5 pM. Consequently, these analytes provide sub-pM detection limits in c-PLA and wide dynamic ranges of at least 4 orders of magnitude, as observed in the dose-response curves (Fig. 4b, dose-response curves derived from the same antibody and antigen pools as used in Fig. 4a but not completely the same pools as used in Fig. 3). The remaining analytes, MIF, TNF-a, and IGF-II cluster with Kd values greater than 50 pM. Consequently, c-PLA for these analytes does not perform as well, showing detection limits in the pM range (or higher) and narrower dynamic ranges that are restricted by the lower affinity of the antibodies. This comparison demonstrates that the inherent difference in sensitivity and dynamic range between the six analytes is not entirely dependent on assay design, but is due to the quality of the affinity reagents used. It is noted that the only biomarker for which c-PLa did not improve assay performance compared to t-PLA is GdNf, the analyte with the highest affinity. Improvements in detection limit of c-PLA over t-PLA are also greater for lower affinity interactions (see Tables 1 and 2), indicating a trend of increasing benefits of c-PLA. when only low affinity reagents are available.

The detailed information obtained by kinetic analysis is beneficial for assay development, as it suggests modifications that may lead to better signals. The kinetic constants were used to predict the number of complexes formed at equilibrium during sample incubation, and the new equilibrium that is established when the volume is increased by addition of the ligation mixture. Details are provided in the section entitled “Modelling of equilibrium antibody-antigen-antibody complex formation” and in Figure 12. Calculations suggest that approximately 50% of the antigens present in solution are captured in an equilibrium complex. during sample incubation when the K ^d value of an interaction is equal to 1 ^x 10'10 M (comparable to MIF and TNF-a, 8.3x10'11 M and 2.8x10'10 M respectively), ( Fig. 12b). However, subsequent addition of the ligation mixture triggers dissociation of the complex until a new equilibrium is established. Modeling using K ^d = 1 ^x 10.10 M indicates that at the new equilibrium essentially no antigen would remain in a complex, resulting in no circle formation and consequently no detectable qPCR signal (Fig. 12c). However, the assay still works for analytes with these Kd values, and the discrepancy is explained by dissociation suppression, as predicted by low deactivation rates. The half-life of the complex (t-io) is defined as ln2/kd, which indicates that for both MIF and TNF-a (which have deactivation rates of approximately 1*10.4 s_1) approximately 2 hs for half of the complexes to dissociate. This duration is sufficient to avoid significant losses during a ligation step of 30 minutes (or 15 minutes in the case of t-PLA). Furthermore, these calculations do not take into account any added advantage that the two circle-forming linker oligos have over t-PLA in delaying diffusion of the proximity probe away from the analyte, thereby facilitating reconnection. of the antibody. DNA duplexes can be remarkably stable, as exemplified by SPR measurements, which employ DNA-directed immobilization of capture agents. Previous studies have determined that the deactivation rates of short oligonucleotides range between 10.4 s_1 and less than 10.5 s-1, values that are comparable or lower than the deactivation rates of antibody-antigen interactions described in this work. (45, 46). The above calculations highlight not only the advantages of high-affinity probes in proximity ligation assays, but also the importance of slow quenching rates or other means of slowing dissociation, especially when large volume additions are involved to the ligature.

Ligation-associated bulk addition was originally introduced to minimize background ligation in t-PLA (12). Background binding events in t-PLA occur when the affinity probes and the bridging oligo randomly approach each other. In the case of c-PLA, the probability of background binding is lower, since this complex requires an additional linker oligo and two binding events before producing a detectable signal. This results in less background and a better signal-to-noise ratio. Additional modeling studies presented in Fig. 12e also indicate that higher proximity probe concentrations lead to more complex formation, which may further increase the signal-to-noise ratio. This is analogous to solid-phase experimental findings, in which higher densities of surface-bound capture antibodies have been shown to improve both detection limit and dynamic range (47). Therefore, the combination of a more stringent assay format such as c-PLA with higher concentrations of proximity probes should improve assay performance with low-affinity antibodies.

The stringency of c-PLA improves the signal-to-background ratio and detection limit. Based on the simulations described above, the impact of increasing proximity probe concentration was tested for both traditional and circular PLA. The TNF-α assay was chosen because it showed the highest K ^d and k d , providing a good example of low affinity reagents with fast quenching rates. Both assay formats were performed at the standard concentration of the affinity probe (1X=0.25 nM), as well as at ten-fold magnification. The results are shown in Fig. 5a and demonstrate a consistently higher signal-to-background ratio for c-PLA compared to t-PLA. The increased signal-to-background ratio between the 10X and 1X affinity probe instances for the two procedures is an extension of previous findings that probe concentration can be increased for low-affinity interactions (12), although it is a complex issue that must be carefully balanced between antibody affinity and a higher probability of random background binding (48). The higher signal-to-noise ratio of c-PLA is explained by the reduction in background noise, as seen in Fig. 5b. This is a consequence of rigorous assay design in combination with exonuclease treatment, which effectively removes background noise. Note that the higher stringency of c-PLA also decreases the signal, but that the stability of the circling complexes, combined with even lower background noise, more than compensates for this decrease. The higher signal-to-background ratio of the 10X c-PLA improves the detection limit by approximately one order of magnitude compared to the original t-PLA (Fig. 5c). Other experiments suggest that the probe concentration can be further increased for low-affinity interactions, although it must be accompanied by an increase in the number of linker oligonucleotides to ensure efficient circle formation.

c-PLA efficiently detects proteins in human plasma. The results described so far have all been carried out in buffer solutions, since the aim was to investigate the relationship between affinity and assay performance. Affinity analysis by means of sPr is not well suited to complex mixtures such as plasma, and although bilayer interferometry is less sensitive to matrix effects (43), both procedures require pure ligands for accurate determination of the constants. kinetic. The correlation between rate constants and assay performance is established in Fig. 4 and provides valuable information for assay development. However, assay performance is known to differ greatly between different matrices and assay compatibility with complex mixtures is essential for diagnostic and clinical relevance (1).

Multiplexed t-PLA has previously been shown to allow quantification of biomarkers in plasma samples (12–14). To determine the performance of c-PLA in a complex matrix, two analytes were tested: VEGF, as an example of a high-affinity interaction (low Kd and slow deactivation rates), and TNF-a, as an example of a high-affinity interaction (low Kd and slow deactivation rates). low affinity interaction (high Kd and fast deactivation rates). VEGF was efficiently detected in human plasma by c-PLA down to single digit pM physiological concentrations (12, 49) (Fig. 6a). The detection limit is multiplied by 100 from the fM concentration in the buffer to 1 pM for c-PLA and 2 pM for t-PLA in human plasma. The dynamic range is correspondingly reduced by two orders of magnitude for both procedures. The mean CVs were lower for c-PLA than for t-PLA, at 11% and 22%, respectively, which is consistent with the findings in buffer solutions. These results confirm that c-PLA provides less variation in a simplified assay format without the need for pre-amplification. Additional experiments with VEGF in chicken plasma (in which human VEGF is absent) were carried out to verify that changes in detection limit and dynamic range are not hampered by the assay format, but rather are a effect of natural background levels of VEGF in human plasma (Fig. 6a). In chicken plasma, the fM detection limit and more than four orders of magnitude of dynamic range were reached, more closely reflecting the original measurements in buffer. Therefore, both PLA procedures are compatible with complex mixtures such as human plasma, with additional assay performance benefits for c-PLA.

The assay performance advantages of c-PLA over t-PLA for TNF-α (a low-affinity interaction) also persist in human plasma (Fig. 6b). The detection limit of c-PLA is approximately 10 pM for the 1X and 10X proximity probe concentrations, with lower CVs for the higher probe concentration (8% for 10X vs. 16% for IX), presumably due to more efficient capture of antigens at the highest concentration. The detection limit of t-PLA is approximately one order of magnitude higher than that of c-PLA, reducing the dynamic range accordingly. The CVs remain around 30% throughout the linear range for both proximity probe concentrations. In contrast to c-PLA, a 10-fold increase in proximity probe concentration for t-PLA did not improve sensitivity (detection limit around 700 pM), underscoring the challenges when using this method. procedure with low-affinity antibodies. The ability to increase the concentration of the probe in c-PLA also partially addresses the hook effect, as it results in a later onset of proximity probe saturation. Furthermore, statistical analysis of the CVs for plasma TNF-α reveals that the lower CVs for 10X c-PLA are significantly different from the CVs for 1X c-PLA as well as 1X and 10X t-PLA. (p<0.001). The CV difference between 1X c-PLA and 1X t-PLA is also significant (p<0.001). This is encouraging, given that the generally accepted precision requirement for clinical immunoassays is less than 20% (40, 50). These results indicate that the higher stringency of c-PLA provides advantages over t-PLA in terms of ease of use and sensitivity, while reducing variation. Most importantly, the opportunity remains to improve the performance of low-affinity antibodies simply by increasing their c-PLA concentration in complex matrices such as plasma and serum.

Materials and Procedures

Materials. Affinity purified polyclonal antibodies and target antigens were from R&D Systems. Product numbers are listed in the section labeled “Antibodies and Antigens”. All oligonucleotides were from Integrated DNA Technologies. Sequences are listed in the section labeled “DNA Sequences” and were kept the same for all analytes to allow for an unbiased comparison. The oligonucleotides used for proximity probe conjugation were purified by HPLC and designed to minimize probe-probe heteroduplex formation. All other reagents are from Sigma-Aldrich, unless otherwise noted.

Conjugation with proximity probe. Antibody-oligonucleotide conjugation was performed by hydrazone chemistry (Solulink) followed by purification according to the manufacturer's protocol (FIG. 7). A pool of polyclonal antibodies was divided into two portions and coupled to amine-modified oligonucleotides containing either a free phosphorylated 5' end or a free 3' end. Antibody-oligonucleotide conjugates were analyzed on an Agilent 2100 bioanalyzer using the 80 protein kit under reducing conditions following the manufacturer's protocol. Estimated yield for all conjugates ranged from 0.65 to 1.35 oligonucleotides per antibody. Final antibody-oligonucleotide concentration was determined using a Bradford protein assay (Bio-Rad) according to the manufacturer's specifications. Antibody-oligo probes were diluted to 5 nM in 1X PBS supplemented with 2 mM EDTA (Thermo Fisher Scientific); 0.10% BSA; 0.02% NaN ³ and stored at 4 °C.

Incubation of targets with proximity probe. 2 µl of sample (diluted in 1X PBS with 0.1% BSA or pure chicken or human plasma (Sigma)) was added to 2 µl of proximity probe mix and incubated for 2 hours at 37 °C to establish the formation of complexes between the target analyte and the proximity probe antibodies. The 4 pl pooled incubation mixture contained a final concentration of 250 pM for each proximity probe and was supplemented with 0.35 mg/mL polyadenylic acid potassium salt; 1% BSA; 0.1% Triton X-100; 0.05% IgG; 0.01% aprotinin; 1 mM phenylmethanesulfonyl fluoride; and 4 mM EDTA (Thermo Fisher Scientific) in PBS 0.375X.

Ligation stage for circular PLA. 120 pL of ligation mix was added to each 4 pL sample and incubated for 30 min at 45°C. The ligation mix contained 100 nM of each of the two circle-forming linker oligos; 0.025 U/pL ampligase (Epicentre); 0.5mM NAD; 1mM DTT (Sigma-Aldrich); 0.01% Triton X-100; and 0.01% BSA in 20 mM Tris pH 8.4, 10 mM MgCh, and 50 mM KCl, (Thermo Fisher Scientific). Ligation was terminated by the addition of 10 µl of the exonuclease mixture and incubation for 30 minutes at 37°C, followed by heat inactivation of the exonuclease enzymes for 20 minutes at 80°C. The exonuclease mix contained 2 U/pL of exonucleases I (New England Biolabs) and 2 U/pL of exonucleases III (New England Biolabs) in 1X NEBuffer 1, containing 10 mM Bis-Tris-Propane-HCl, pH 7 .0; 10 mM MgCh and 1 mM DTT (New England Biolabs).

Ligation stage for traditional PLA. 120 μl of ligation mix was added to each 4 μl sample and incubated for 15 min at 30°C. The ligation mixture contained 100 nM of bridging oligo t-PLA; 0.025 U/pL of Ampligase (Epicentre); 0.25mM NAD; 10mM DTT; 0.02% Triton X-100; and 0.01% BSA in 20 mM Tris pH 8.4, 1.5 mM MgCh, and 50 mM KCl, (Thermo Fisher Scientific). Ligation was terminated by the addition of 2 μl of ligation stop mix, followed by a 5 minute incubation at room temperature. The ligation stop mix contained 0.125 U/pL Uracil-DNA Excision Mix (Epicentre) in 20 mM Tris pH 8.4, 50 mM KCl (Thermo Fisher Scientific).

Pre-amplification stage for traditional PLA. 25 μl of the finished ligation mix was added to 25 μl of pre-amp mix and cycled with the following conditions: 95 °C for 3 min (1 cycle); 95 °C for 30 s and 60 °C for 4 min (13 cycles) and a final hold at 4 °C. The preamp mix contained 20 nM preamp primers; 0.06 U/pL Platinum Taq DNA Polymerase (Thermo Fisher Scientific); and 1.6 mM mixture of dNTPs (Agilent Technologies) in 20 mM Tris pH 8.4, 6 mM MgCh and 50 mM KCl, (Thermo Fisher Scientific). After pre-amplification, the product was diluted 10-fold in TE buffer and stored at 4°C until qPCR quantification.

qPCR quantification and data analysis. 2 pl of exonuclease-treated ligation product (for circular PLA) or diluted pre-amplification product (for traditional PLA) was added to the qPCR master mix to a final volume of 10 pl containing 400 nM primers and 1X Power SYBR. Green PCR Master Mix (Thermo Fisher Scientific). The samples were quantified by real-time qPCR (ABI 7900 HT) with the following thermal cycling conditions: 95 °C for 10 minutes (1 cycle); 95 °C for 15 s and 60 °C for 60 s (40 cycles). Ct values were converted to an estimated number of bound molecules using the formula 10'0301x ct ii,439 as described previously (13). Experiments were carried out with three biological replicates that were quantified in triplicate qPCR experiments generating nine data points per concentration tested. The detection limit was obtained relative to the blank sample where the dose-response curve and the dotted line (mean signal of a blank sample 3 standard deviations) intersect (40). Statistical analysis was performed by bootstrapping (random sampling with replacement on independent measurements of biological replicates 1000 times).

Kinetic analysis using SPR. SPR analysis was carried out at 25 °C using a Biacore T200 instrument and biotin capture kit (GE Healthcare, Fig. 9a). All antibodies were biotinylated using the EZ-Link NHS-PEO4-Biotin kit (Thermo Fisher Scientific) according to the manufacturer's recommendations, using a 1:1 molar ratio of biotin to antibody. Excess biotin was removed by using Zeba spin columns to avoid interference with the binding of biotinylated antibodies to the CAP chip surface. Antibody immobilization was tailored to a level that resulted in a maximum analyte binding capacity (Rmax) of 25 to 50 RU:s. The analytes were diluted in HBS-EP+ buffer and run on the chip at a speed of 30 pl/min. Association was measured for 120 s and dissociation for 1800 s. Sensors were regenerated using a solution containing 6M Guanidine-HCl and 0.25M NaOH. The constants of velocity ( ka and kd) were determined using BIAevaluation software version 4.1 (Biacore) with a 1:1 model and a global fit of at least five concentrations in two-fold dilution series ranging from 200 to 0 nM (Table 3 and Fig.10). The affinity constants (Kd) were subsequently derived from the relationship between ka and kd.

Table 3. Summary of the kinetic constants obtained by the SPR analysis.

Kinetic analysis by means of BLI. BLI analysis was carried out on a Fortebio Octet RED instrument by using G-protein biosensors (Fortebio, Fig. 9b). All antibodies and analytes were diluted in assay buffer (0.1 mg/mL bSa and 0.13% Triton X-100 in 10 mM Tris pH 7.5, 1 mM CaCh and 150 mM Tris). NaCl). Antibody immobilization was tailored to a binding level of approximately 3.6 nm by varying the loading time of the antibody. All measurements were carried out at 30 °C in a total of 200 pL with constant stirring. Association was measured for 120 s and dissociation for 1200 s. The sensors were regenerated with a 10 mM glycine solution at pH 1.7. For each analyte, three replicates covering full kinetic cycles were carried out and resulted in identical binding curves in all cycles. Rate constants (ka and kd) were determined using data analysis software version 8.2 (Fortebio) with a 1:1 model and a global fit of at least five concentrations in three-fold dilution series ranging from 500 to 0nM. The affinity constants (K ^d ) were subsequently derived from the relationship between ka and kd. The results of the kinetic analysis by BLI are presented in Table 4 and Fig. 11.

Table 4 . Summary of the kinetic constants obtained by the BLI analysis.

Antibodies and antigens. The affinity reagents used were from R&D Systems and had the following product numbers for antibodies and antigens: GDNF: AF-212-NA and 212-GD-010; IL-6 AF-206-NA and 206-IL-010; VEGF: AF-293-NA and 293-VE-010; TNF-a: AF-210-NA and 210-TA-005; IGF-II: AF-292-NA and 292-G2-050; MIF: AF-289-PB and 289-MF-002.

DNA sequences.

Proximity probes used for both circular and traditional PLA

Ab probe with phosphorylated 5' end

5’-/5Phos/TCACGGTAGCATAAGGTGCACGTTACCTTGATTCCCGTCC/3AmMO/-

3' (SEQID NO: 1)

Ab probe with tip 3'

5’-/5AmMC6/CATCGCCCTTGGACTAGCATACCCATGAACACAAGTTGCGTC ACGATGAGACTGGATGAA-3' (SEQ ID NO: 2)

Connector oligos used for the formation of circles in circular PLA

Connector-57

5'-/Phos/TGCTACCGTCTTACCGAGCTTCTGTGATGATGAGGATGCTCACAT CGAGCAACTTGT-3' (SEQ ID NO: 3)

Connector-105

5’-/Phos/GTTCATGGGATCCTTCATTCCACCGGTCCTTCATTCCACCGGTACGAGA

CGTGACGACTGCATTCCTTCATTCCACCGGTCCTTCATTCCACCGGTTGCACC

TTA-3' (SEQ ID NO: 4)

qPCR primers used for circular PLA

Forward Primer (P1):

5'-GCTCACATCGAGCAACTTGTGTT-3' (SEQ ID NO: 5)

Reverse Primer (P2):

5'-AGCTCGGTAAGACGGTAGCATAA-3' (SEQ ID NO: 6)

Note: A number of different primer pairs were tested and the primers spanning the ligation binding sites were found to work best. These primers were also used for c-PLA pre-amplification comparison.

Oligo bridge used for ligation in traditional PLA

5'-CUACCGUGAUUCAUCCAG-3' (SEQ ID NO: 7)

Preamp primers used for traditional PLA

Direct Primer:

5'-CATCGCCCTTGGACTAGCAT-3'(SEQ ID NO: 8)

Reverse Primer:

5'-GGACGGGAATCAAGGTAACG-3' (SEQ ID NO: 9)

qPCR primers used for traditional PLA

Direct Primer:

5'-ACCCATGAACACAAGTTGCG-3'(SEQ ID NO: 10)

Reverse Primer:

5'- GGACGGGAATCAAGGTAACG -3' (SEQ ID NO: 11)

Modeling of the formation of antibody-antisen-antibody complexes in equilibrium.

Using parameters derived from kinetic analysis, the formation of antibody-antigen-antibody (Ab-Ag-Ab) complexes under various conditions used in the proximity ligation assay was modeled. This information is valuable to gain a better understanding of the assay and to support the development of assays for equilibrium and pre-equilibrium conditions, which often exist in cases of low analyte concentration and high affinity interactions. Using the equations described in Fig. 12, the fraction of antigens forming Ab-Ag-Ab complexes at equilibrium was modelled. This allows estimating the number of ligation events that can take place when the equilibrium dissociation constants (K ^d ) vary from 10.13 to 10.8 M.

It is noted that these calculations only consider complex formation and do not take into account whether it will lead to a binding event. For example, binding events will not occur in complexes formed between analogous proximity probes or when one of the antibodies in the complex lacks an oligo conjugate. Free oligonucleotides that may contribute to background binding or stabilize the complexes formed are also not considered in the calculations.

The following tables provide supporting data for the graphs shown in the figures.

Table 5 . Data from Figure 3a.

Table 6 . Data from Figure 3b.

Table 7 . Data from Figure 3c.

Table 8 . Figure 3d data.

Table 9 . Data from Figure 3e.

Table 10. Data from Figure 3f.

Table 14 . Figure 8 data.

References

1. Landegren U, et al. (2012) Opportunities for sensitive plasma proteome analysis. Anal Chem 84(4):1824 to 1830.

2. Kingsmore SF (2006) Multiplexed protein measurement: technologies and applications of protein and antibody arrays. Nat Rev Drug Discov 5(4):310-321.

3. Wild D ed (2013) The Immunoassay Handbook (Elsevier, Oxford).

4. Zhang HQ, Zhao Q, Li XF, and Le XC (2007) Ultrasensitive assays for proteins. Analyst 132(8):724-737.

5. Spengler M, Adler M, and Niemeyer CM (2015) Highly sensitive ligand-binding assays in pre-clinical and clinical applications: immuno-PCR and other emerging techniques. Analyst 140(18):6175-6194.

6. Sano T, Smith CL, and Cantor CR (1992) Immuno-PCR: Very sensitive antigen detection by means of specific antibody-DNA conjugates. Science 258 (October 2, 1992): 120-122.

7. Nam JM, Thaxton CS, and Mirkin CA (2003) Nanoparticle-Based Bio-Bar Codes for the Ultrasensitive Detection of Proteins. Science 301:1884 to 1886.

8. Schweitzer B, et al. (2002) Multiplexed protein profiling on microarrays by rolling-circle amplified. Nat Biotechnol 20(4):359-365.

9. Xie S and Walton SP (2010) Development of a dual-aptamer-based multiplex protein biosensor. Biosens Bioelectron 25(12):2663-2668.

10. Fredriksson S, et al. (2002) Protein detection using proximity-dependent DNA ligation assays. Nat Biotechnol 20(4):473-477.

11. Gullberg M, et al. (2004) Cytokine detection by antibody-based proximity ligation. Proc Natl Acad Sci USA 101(22):8420-8424.

12. Fredriksson S, et al. (2007) Multiplexed protein detection by proximity ligation for cancer biomarker validation. Nat Methods 4(4):327-329.

13. Fredriksson S, et al. (2008) Multiplexed Proximity Ligation Assays to Profile Putative Plasma Biomarkers Relevant to Pancreatic and Ovarian Cancer. Clin Chem 54(3):582-589.

14. Chang S, et al. (2009) Identification of a biomarker panel using a multiplex proximity ligation assay improves accuracy of pancreatic cancer diagnosis. J Transl Med 7(1): 105.

15. Lundberg M, et al. (2011) Multiplexed homogeneous proximity ligation assays for high throughput protein biomarker research in serological material. Mol Cell Proteomics 10(4):1 to 10.

16. Tate J and Ward G (2004) Interferences in Immunoassay. Clin Biochem Rev 25(2):105-120.

17. Kim J, Hu J, Sollie RS, and Easley CJ (2010) Improvement of sensitivity and dynamic range in proximity ligation assays by asymmetric connector hybridization. Anal Chem 82(16):6976-6982.

18. Zhu L, et al. (2006) A sensitive proximity ligation assay for active PSA. BiolChem 387(6):769-772.

19. Xie S, Moya C, Bilgin B, Jayaraman A, and Walton SP (2009) Emerging affinity-based techniques in proteomics. Expert Rev Proteomics 6(5):573-583.

20. Castro-López V, Elizalde J, Pacek M, Hijona E, and Bujanda L (2014) A simple and portable device for the quantification of TNF-a in human plasma by means of a magnetic bead-based proximity ligation assay on a chip Biosens Bioelectron 54(0):499-505.

21. Pai S, Ellington AD, and Levy M (2005) Proximity ligation assays with peptide conjugate 'burrs' for the sensitive detection of spores. Nucleic Acids Res 33(18):e162.

22. Schallmeiner E, et al. (2007) Sensitive protein detection via triple-binder proximity ligation assays. Nat Methods 4(2): 135-137.

23. Tavoosidana G, et al. (2011) Multiple recognition assay reveals prostasomes as promising plasma biomarkers for prostate cancer. Proc Natl Acad Sci USA 108(21):8809-8814.

24. Zhang H, Li XF, and Le XC (2012) Binding-induced DNA assembly and its application to yoctomole detection of proteins. Anal Chem 84(2):877-884.

Claims (11)

1. A sample analysis procedure comprising: (a) incubating a sample comprising a target analyte with: (i) a first conjugate comprising a binder and a first splice oligonucleotide, and (ii) a second conjugate comprising a binder and a second splice oligonucleotide, under conditions suitable for binding the binding agents of the first and second conjugates to the target analyte, to produce a product, wherein the binding agents of the first and second conjugates are affinity-selected polyclonal antibodies, and the affinity-selected polyclonal antibodies are divided into a first portion that conjugates with the first splice oligonucleotide and a second portion that conjugates with the second splice oligonucleotide; (b) incubating at least a part of the product of step a) with: (i) a set of probes that produces a ligatable circle only when the probes hybridize to the first and second splice oligonucleotides; Y (ii) a ligase; to produce a reaction mixture comprising covalently closed circular molecules; (c) treating at least part of the reaction mixture from step b) with an exonuclease to terminate ligation and degrade any nucleic acid that is not a covalently closed circular molecule; Y (d) after step (c), quantifying the amount of covalently closed circular molecules produced in step (b). 2. The method of claim 1, wherein the first and second conjugates bind to the target analyte with low affinity. 3. The method of any preceding claim, in which the quantification step (d) is carried out by quantitative PCR, digital PCR, by hybridization to a microarray or by sequencing. 4. The method of claim 3, wherein the primers used for quantitative PCR target the ligation junctions on the covalently closed circular molecules of (d). 5. The process of any preceding claim, wherein the reactions of steps (a) to (c) are carried out in the same vessel. 6. The method of claim 5, wherein step (b) comprises adding the set of probes and ligase to the container comprising the product of step (a), and step (c) comprises adding one or more exonucleases to the container comprising the ligation product of step (b). 7. The method of any of the preceding claims, wherein: (i) the sample comprises a plurality of target analytes, (ii) step a) comprises incubating the sample with multiple pairs of said first and second conjugates, wherein each pair of conjugates binds to a different target analyte; Y (iii) step d) comprises the quantification of the number of covalently closed circular molecules corresponding to each target analyte. 8. The method of any preceding claim, wherein the sample is from a body fluid. 9. The method of claim 8, wherein the body fluid is blood plasma, saliva, or urine. 10. The method of any preceding claim, wherein the target analyte is a protein. 11. A kit consisting of: (i) a first splice oligonucleotide, and (ii) a second splice oligonucleotide; (iii) a set of probes that produces a ligatable circle only when the probes hybridize to the first and second splice oligonucleotides; (iv) one or more exonucleases, (v) a binding agent to which the first and second splice oligonucleotides can be conjugated, wherein the binding agent is affinity-selected polyclonal antibodies, wherein the affinity-selected polyclonal antibodies are divided into a first portion that is conjugated to the first splice oligonucleotide and a second portion that is conjugated to the second splice oligonucleotide splice.