ES2905713A1 - New biomaterial for tissue engineering (Machine-translation by Google Translate, not legally binding) - Google Patents

Abstract

New biomaterial for tissue engineering. The present invention relates to a new biomaterial for use as scaffolding (matrix, frame or scaffold) in regenerative medicine, to the method of obtaining, and its therapeutic uses, mainly in tissue engineering. (Machine-translation by Google Translate, not legally binding)

Description

DESCRIPTION

NEW BIOMATERIAL FOR TISSUE ENGINEERING

TECHNIQUE FIELD

The present invention is within the field of biomedicine and tissue engineering. Specifically, it refers to a new biomaterial and an in vitro method of preparing it. It also refers to its uses in regenerative medicine.

PRIOR STATE OF THE ART

Cartilage is a specialized connective tissue that has a special type of cell, called a chondrocyte, responsible for synthesizing a dense extracellular matrix (ECM) composed mainly of collagen fibers, or collagen and elastin, and proteoglycans. There are three types of cartilage in the human body (hyaline, elastic and fibrous) that differ mainly in the composition and structure of the ECM, resulting in different properties and functions. Common problems associated with cartilage are age-related degeneration of this tissue, traumatic injury, or tumor formation. Cartilage has limited self-healing capacity due to the lack of blood vessels and nerves, and in most cases fibrocartilage is generated instead of native functional tissue. For this reason, surgical correction of the defect or damage may be necessary, although the outcome is often suboptimal.

Tissue engineering has emerged as a potential tool for tissue and organ repair through the use of cells, biomaterials, and growth factors. In cartilage repair, various natural and synthetic frameworks, matrices or scaffolds have been studied, such as polyglycolic acid, polylactic acid, PEGDA, collagen, chitosan, hyaluronan, alginate, fibrin-agarose, etc. These scaffolds must be capable of promoting cell differentiation, migration and proliferation and must also be degradable, biocompatible and non-toxic. However, most biomaterials are not capable of fully reproducing the ECM microenvironment of native cartilage. Due to these limitations, natural biomaterials obtained from decellularized tissues are currently being studied and used. Decellularization is a process that allows obtaining a product composed of ECM that maintains the structure, composition and original mechanical properties, providing all the necessary stimuli for cell proliferation and differentiation, making this material suitable for tissue engineering. In addition, the structural and functional proteins of the ECM are highly conserved between species, allowing its implantation with very little chance of immunological rejection. Several decellularized tissues have already been studied for cartilage generation, including adipose tissue, umbilical cord, cartilage itself, and others.

Cartilage tissue characteristically shows a low regenerative potential in vivo, and new replacement technologies capable of repairing cartilage injuries are needed. Although numerous cell therapies and tissue engineering strategies have been proposed, long-term results remain poor. None of these biomaterials were able to fully mimic the microenvironment of this tissue, so new biomaterials need to be developed.

The sturgeon is an ancient fish belonging to the order Acipenseriformes. The skeleton of the sturgeon is composed mainly of cartilage, being a good source of this tissue for use in research. Some previous works have studied the collagen and chondroitin sulfate molecules of this animal, although the structure and general composition of this cartilage is poorly understood. No studies using sturgeon cartilage in tissue engineering have been previously reported.

DESCRIPTION OF THE FIGURES

Fig. 1. Histological analysis of native and decellularized sturgeon cartilage. A: Hematoxylin-eosin (H-E) staining; B: toluidine blue staining for the detection of sulfated proteoglycans (TB); C: DAPI fluorescence labeling to detect cell nuclei (DAPI). The results obtained in both native (Native) and decellularized (DC) control cartilage (CTR) are shown, as well as in recellularized cartilage with mesenchymal cells of different origin (ADSCinvitro, BMSCinvitro, DPSCinvitro, WSCinvitro) and with elastic cartilage cells. human (HECinvitro) between 15 and 21 days and between 30 and 35 days. All images have the same scale. The scale bar shown in the upper left image represents 300 pm.

Fig. 2. Histological analysis of native and decellularized sturgeon cartilage. A: Alcian blue staining to detect acid proteoglycans and polysaccharides (AB); B: red staining picrosirius for detection of collagen fibers (P). The results obtained in both native (Native) and decellularized (DC) control cartilage (CTR) are shown, as well as in recellularized cartilage with mesenchymal cells of different origin (ADSCinvitro, BMSCinvitro, DPSCinvitro, WSCinvitro) and with elastic cartilage cells. human (HECinvitro) between 15 and 21 days and between 30 and 35 days. All images have the same scale. The scale bar shown in the upper left image represents 300 pm.

Fig. 3. Histograms depicting tissue structure preservation for RCDinvitro as determined by toluidine blue (A), Alcian blue (B), and Picrosirius red staining (C). Structure conservation was also determined for RCDinvivo by staining with toluidine blue (D), alcian blue (E) and Picrosirius red (F). The bars correspond to the mean ± standard deviation. (a) represents significant differences with NCTR. (b) represents significant differences with DCD.

Fig. 4. Hematoxylin-eosin (H-E), toluidine blue (TB), alcian blue (AB), and picrosirius red (P) staining of DCDinvivo (A) and ADSCinvivo (B) at 12, 30, and 60 days. All images have the same scale. The scale bar shown in the upper left image represents 300 pm.

Fig 5. Hematoxylin-eosin (H-E), toluidine blue (TB), alcian blue (AB), and picrosirius red (P) staining of BMSCinvivo (A) and DPSCinvivo (B) at 12, 30, and 60 days. All images have the same scale. The scale bar shown in the upper left image represents 300 pm.

Fig. 6. Hematoxylin-eosin (H-E), toluidine blue (TB), alcian blue (AB), and picrosirius red (P) staining of WSCinvivo (A) and HECinvivo (B) at 12, 30, and 60 days. All images have the same scale. The scale bar shown in the upper left image represents 300 pm.

DESCRIPTION OF THE INVENTION

The authors of the present invention have demonstrated the use of sturgeon cartilage as a new scaffold for cartilage tissue engineering. First, a decellularized cartilage-derived (DCD) scaffold was generated. The scaffold was then recellularized with four different types of human mesenchymal stem cells (MSCs) derived from adipose tissue (ADSC), bone marrow (BMSC), dental pulp (DPSC), and Wharton's jelly from cord. umbilical (WSC) and with human elastic chondrocytes (HEC). In vitro and in vivo studies were performed to histologically analyze the structure and integration of the different cartilage substitutes. DCD preserved the fundamental properties of native cartilage after being subjected to the decellularization method, and biosafety studies demonstrated that decellularized and recellularized cartilage were highly biocompatible in vivo , and the grafts were accepted by all animals in the complete absence of histological alterations.

BIOMATERIAL OF THE INVENTION

Therefore, a first aspect of the invention relates to cartilage from organisms of the Chondrostei subclass, hereinafter "cartilage of the invention", for use as a medicine or, alternatively, for use in medicine.

Preferably, this aspect of the invention relates to cartilage from organisms of the order Acipenseriformes , hereinafter cartilage of the invention, for use as a medicament or, alternatively, for use in medicine.

Preferably, the cartilage of the invention is from an organism of the Acipenseridae family, even more preferably, from the Acipenser genus, and even more preferably, from the Acipenser naccarii species.

In this specification, "organisms of the genus Arcipenser" are understood to mean cellular organisms of the superkingdom Eukariota, clade Opisthokonta, Kingdom Metazoa, Phylum Chordata, subphylum Craniata, superclass Actinopteri, subclass Chondrostei, Order Acipenseriformes, suborder Acipenseroidei, family Acipenseridae, subfamily Acipenserinae, Acipenserini tribe; genus Acipenser.

Numerous species have been described within this genus. By way of non-limiting example: A. baerii (Siberian sturgeon), A. brevirostrum (short-nosed sturgeon), A. dabryanus (Yangtze sturgeon), A. fulvescens (lake sturgeon), A. gueldenstaedtii (Russian sturgeon ), A. meterostris (green sturgeon), A. mikadoi (Sakhali sturgeon), A. naccarii (Adriatic sturgeon), A. nudiventris (fringed beard sturgeon), A. oxyrinchus (Atlantic sturgeon), A. oxyrinchus desotoi (Gulf sturgeon), A.oxyrinchus oxyrinchus, A.persicus (Persian sturgeon), A. ruthenus (sterlet), A. schrenckii (Amur sturgeon), A. sinensis (Chinese sturgeon), A. stellatus (Sturgeon stellate), A. sturio (common sturgeon), A. transmontanus (white sturgeon).

Alternatively, "Acipenser" also refers to the genus of an organism having a nucleotide sequence homologous to the cytochrome b region of mitochondrial DNA with at least 70% identity to SEQ ID NO. 1, and more preferably an identity of at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% with SEQ ID NO: 1. More preferably, the Homologous sequence of mitochondrial DNA cytochrome b has 100% identity with SEQ ID NO: 1.

SEQ ID NO: 1

Acipenser naccarii cytochrome c oxidase subunit II gene, partial cds (GenBank: AY547412.1)

tggcacatccatcacaattaggattccaagacgcggcctcacctgtaatagaagaacttctccacttccatgaccacacactaatg attgtcttcctaatcagcactctagtactttacattattgtggccatggtgtcaactaaactaacaaacaaatatgtactggattcccaa gaaattgaaattgtatgaacagtactcccagcagtaattttaatcttaattgccctaccttcccttcgaattctttacctaatagacgaga ttaatgacccccacctgacaattaaagctataggacaccaatgatactgaagttatgaatatacggactatgaagacctgggcttc gactcctacataatccctacacaagacctcgccccagggcaattccgactcctagaagcagaccatcgaatggtagtgcccata gaatccccaattcgagttctagtttccgcagaagacgtactccactcctgagcggtgccagccctgggcatcaaaatagacgcag tgcccggacgcctaaatcaaacagcctttattacctcacgaccgggagtctattatggccaatgttctgaaatctgcggagctaacc acagcttcatgccaattgtagttgaagcagtccccctagaacactttgaaaactgat

The term "identity" as used herein refers to the proportion of identical nucleotides between two nucleotide sequences when compared. Sequence comparison methods are known in the art, and include, but are not limited to, BLASTP, BLASTN, and FASTA (SF Altschul etal., "Basic Local Alignment Search Tool", J. MolBiol. 1990, 215, 403-410).

The term "homologous nucleotide sequence", as used herein, refers to a sequence that is equivalent to the mitochondrial cytochrome b fragment of sequence SEQ ID NO: 1 from Acipenser, preferably Acipenser naccarii. The term "a sequence that is equivalent" means a nucleotide sequence that is within the cytochrome bo equivalent region in that particular Acipenser species, and performs the same function. The skilled person is able to identify these equivalent regions with routine protocols.

The term "% identity", as understood in this invention, refers to the percentage (%) identity between two or more nucleotide or amino acid sequences. % Identity is a count of the number of positions along the length of the alignment of two sequences where all of the nucleotides or amino acids at that position are identical. % Identity is calculated based on homologous sequences of the same length.

Another aspect of the present invention relates to cartilage from organisms of the order Acipenseriformes to increase, restore or replace, partially or completely, the functional activity of a diseased or damaged tissue or organ. In a preferred embodiment, the diseased or damaged tissue is selected from the list consisting of: cartilage found on joint surfaces (articular cartilage), the ear, nose and/or trachea, bronchi, epiglottis, ribs, symphysis of the pubis, intervertebral disc, menisci, or any of their combinations.

The cartilage of the invention can be diluted, for example in acetic acid, and can be resolidified, giving it the desired shape. It can also be found as a lyophilized powder that could be reconstituted in the desired form. Said cartilage will not only have collagen, but all the additional components of cartilage.

Therefore, in another preferred embodiment, the cartilage of the invention is diluted or lyophilized.

The processes for obtaining liquid or lyophilized cartilage are known in the state of the art. For example, but without limitation, cartilage can be subjected to acid hydrolysis using a 0.7M solution of acetic acid (CH3-COOH) at a temperature close to 15°C and with constant agitation, using a cartilage/solution ratio. 1:10 (weight/volume) for 6-12 hours. If desired, the diluted collagen can be further precipitated by addition of 12% sodium chloride (NaCl) solution and subsequent filtering. In the case of lyophilized cartilage, the procedure would consist, for example, but not limited to, freezing the material at -20°C or, preferably, by immersion in liquid nitrogen, subsequently subjecting the frozen product to a vacuum chamber capable of extracting all the water in the cartilage at freezing temperatures.

Cartilage that has been previously diluted or lyophilized may comprise other ECM components, active ingredients and/or therapeutic agents.

Capsules, reservoirs, liposomes, vesicles, or implants can be incorporated that release the therapeutic agent or active ingredient in situ in a patient.

Therapeutic agents may include small organic molecules, proteins, such as antibodies, hormones, cytokines, chemokines, growth factors, viruses, nucleic acid molecules, such as aptamers or antisense or sense suppressor molecules, vectors, antibiotics, or microorganisms.

In the diluted cartilage of the invention it can also include other elements, such as carbon nanotubes; particles such as metal particles or hard tissue nanoparticles, magnetic particles, and imaging particles, such as radiopaque, ultrasound reflective, or fluorescent particles; fibers, such as hair filaments; and vesicles such as lipid/lipid phosphorus vesicles, liposomes, and slow-release drug vesicles. It may also comprise ECM components such as hyaluronic acid, elastin, oxytalan, elaunin, proteoglycans, glycosaminoglycans, fibrin, fibronectin, silk or other nano-micro fibrous materials, and collagen. It may also include hard tissue particles such as porous ceramics, tricalcium phosphate, silicone, glass, bioglass, phosphate glass, hydroxyapatite, or bone mineral preparations.

METHOD FOR OBTAINING THE BIOMATERIAL OF THE INVENTION

In another preferred embodiment, the cartilage of the invention has been obtained by a method comprising:

a) induce cell lysis of cartilage cells by osmotic shock,

b) remove cytoplasmic and nuclear material,

c) promote lipid dissociation, and

d) dissociate intracellular proteins.

More preferably, the cell lysis of step a) is induced by incubating the cartilage in bidistilled water (bH ² O) at room temperature with agitation. In another preferred embodiment, the elimination of the cytoplasmic and nuclear material in step b) is carried out by incubating the cartilage in a 1% solution of sodium dodecyl sulfate (SDS). In another preferred embodiment, the lipid dissociation of step c) is carried out with a 3% Triton X-100 solution. In another preferred embodiment, the dissociation of the intracellular proteins in step d) is carried out by incubating the cartilage in a 4% sodium deoxycholate (SDC) solution.

ARTIFICIAL FABRIC OF THE INVENTION

The cartilage of the invention can harbor cells. The cells are preferably human, although they may be from any other organism, preferably any other animal (eg, but not limited to, dogs or horses). Furthermore, the cells may be stem cells or differentiated cells. Among the cells that are not stem cells, for example, human hyaline, elastic, or fibrous cartilage chondrocytes, liver cells, epithelial cells (for example, keratinocytes), fibroblasts, or vascular cells, among others, can be used. Between stem cells, mesenchymal stem cells, hematopoietic stem cells, embryonic stem cells, induced pluripotent stem cells, adult stem cells or combinations thereof can be used.

When the cartilage of the invention is diluted, the cells can be interstitially distributed within the biomaterial in any arrangement. For example, the cells may be distributed homogeneously throughout the biomaterial or distributed in defined zones, regions, or layers within the biomaterial. The incorporation of viable cells in the liquid cartilage suspension of the invention is preferably carried out under suitable conditions of temperature, neutral pH, ionic strength and purity to maintain viability.

Hard tissue particles can be incorporated into the biomaterial along with osteoblasts or chondrocytes, to produce an artificial bone or calcified cartilage substitute tissue. The ratio of particles to biomaterial and cells will depend on the particle size and tissue properties required (eg, dense hard tissue or loosely packed).

In some embodiments, the hard tissue particles as described herein may be incorporated into the ends of a linear construct produced from the biomaterial, to facilitate attachment of the construct in vivo, for example by screwing it directly into bone.

Therefore, another aspect of the invention refers to an artificial fabric, hereinafter "artificial fabric of the invention", comprising:

a) the cartilage of the invention, and

b) at least one cell, hereinafter "cell of the invention".

In a preferred embodiment, the cell of the invention is a human cell. In another preferred embodiment, the cell of the invention is selected from: human hyaline, elastic or fibrous cartilage chondrocytes, liver cells, epithelial cells (for example, keratinocytes), fibroblasts or vascular cells, among others, or any of their combinations.

In another preferred embodiment, the cell of the invention is a stem cell. More preferably the stem cell is selected from: mesenchymal stem cells, hematopoietic stem cells, embryonic stem cells, induced pluripotent stem cells, adult stem cells or combinations thereof. Even more preferably, it is a mesenchymal stem cell. More preferably, the mesenchymal stem cell is obtained from bone marrow, adipose tissue, liver, spleen, testicles, menstrual blood, amniotic fluid, pancreas, periosteum, synovial membrane, skeletal muscle, dermis, pericytes, trabecular bone, umbilical cord, lung, dental pulp, and peripheral blood.

Even more preferably, the artificial tissue of the invention comprises a cell population, hereinafter "cell population of the invention".

Both the cell of the invention and the cell population of the invention can be of autologous, allogeneic or xenogeneic origin. Preferably, they are of autologous origin.

Another aspect refers to the artificial tissue of the invention for its use in medicine, or alternatively, for its use as a medicine.

Another aspect of the invention refers to the artificial tissue of the invention to increase, restore or partially or totally replace the functional activity of a diseased or damaged tissue or organ. More preferably, the diseased or damaged tissue is selected from the list consisting of: cartilage found on joint surfaces (articular cartilage), the ear, nose and/or trachea, bronchi, epiglottis, ribs (hyaline cartilage, which is the same type), symphysis pubis, intervertebral disc, menisci, or any of their combinations.

To reduce and/or prevent cell death or damage, a biomaterial comprising viable cells can be stored under conditions that maintain viability but do not support cell growth, until ready for use. For example, the biomaterial can be stored at low temperature, eg, 0 to 10°C, or frozen (<0°C) in the presence of a cryoprotectant. The biomaterial can be stored in cell culture medium at 37°C for short periods of time, or at lower temperatures (eg, 20°C) for longer periods.

If desired, the cells of any aspect of the invention can be genetically modified by any conventional method including, by way of illustration, without limitation, transgenesis processes, deletions or insertions in their genome that modify the expression of genes that are important for their basic properties (proliferation, migration, differentiation, etc.), or by inserting nucleotide sequences that encode proteins of interest, such as proteins with therapeutic properties. Therefore, in another preferred embodiment, the cells of any aspect of the invention have been genetically modified.

In certain cases, the progeny of a single clonal cell can be expanded by multiple passages without apparently suffering from any chromosomal abnormality, or loss of growth and differentiation properties.

Thus, if desired, cells of any aspect of the invention may be clonally expanded using any method suitable for cloning cell populations. For example, a proliferating population of cells can be physically harvested and plated onto a separate plate (or into the wells of a "multi-well" plate). Another option is that cells can be subcloned into a "multi-well" plate in a statistical ratio to facilitate placing a single cell in each well (eg, from about 0.1 to about one cell/well or even about 0.25 to 0.5 cells/well, such as 0.5 cells/well). Cells can, of course, be cloned at low density (eg, into a Petri dish or other suitable substrate) and isolated from other cells using devices such as cloning rings. The production of a clonal population can be expanded in any suitable culture medium. In either case, the isolated cells can be cultured to a suitable point where their developmental phenotype can be assessed. Another aspect of the invention relates to an artificial tissue of the invention comprising a population of isolated cells, comprising at least one cell of the invention, which is preferably an adult cell. In a preferred embodiment, the cell population used in the invention comprises at least 20%, preferably 40% and even more preferably 50%, 60%, 80%, 90%, 95% or 99% of cells of the invention. . In a preferred embodiment, the cell population used in the invention comprises at least 20%, preferably 40% and even more preferably 50%, 60%, 80%, 90%, 95% or 99% of cells of the invention. .

The term "adult stem cell" means that the stem cell is isolated from a tissue or organ of a person or animal in a state of growth after the embryonic state. Preferably, the stem cells of the invention have been isolated in a postnatal state. Preferably, they have been isolated from a mammal, and more preferably from a human, including neonates, juveniles, adolescents, and adults.

The term "subject" includes any animal, in particular, vertebrate animals, preferably mammals, such as mice, rats, horses, pigs, rabbits, cats, sheep, dogs, cows, humans, etc. The term mammal, as understood herein, refers to any organism of the superkingdom Eukaryota, kingdom Metazoa, Phylum Chordata, class Mammalia. Therefore, the cells used in the artificial tissue of the invention they can belong to any animal, preferably a mammal. In another even more preferred embodiment, the mammal is human.

The term "biomaterial" used in the present invention refers to materials suitable for coming into contact with the tissues of a subject for specific therapeutic, diagnostic, or preventive purposes. These materials must be biocompatible, that is, they must not cause any significant adverse response of the living organism after the interaction of the biomaterial with body tissues and fluids and, on occasion, must biodegrade, either chemically or physically, or by a combination of both. processes, to give rise to non-toxic components.

The term "chondrocyte" used in the present invention refers to a cell type present in cartilage, responsible for the production and maintenance of the cartilage matrix, which mainly comprises proteoglycans, glycosaminoglycans with low osmotic potential and fibers (especially collagen). ). The organization of this cell type in cartilage differs depending on the type of cartilage and the tissue where it is found. In reference to bone or cartilage, mesenchymal stem cells (of mesodermal origin) have the capacity to differentiate towards the osteochondrogenic lineage. During the process of cartilage formation (chondrogenesis), mesenchymal stem cells proliferate and accumulate into a dense array of chondrogenic cells in the chondrification center. These chondrogenic cells subsequently differentiate into chondroblasts capable of synthesizing the extracellular matrix of cartilage, which mainly comprises proteoglycans, glycosaminoglycans with low osmotic potential, and fibers. The chondroblasts are then confined to a small space or lacuna that is no longer in contact with the newly created matrix and contains extracellular fluid. The chondroblast at this stage has very little metabolic activity and is called a chondrocyte, which is generally inactive but can still secrete and degrade the extracellular matrix, depending on conditions.

The term "culture" or "cell culture" used in the present invention refers to the growth of cells or tissues in a suitable medium. In the present invention, said cell culture refers to growth of cells in vitro or ex vivo. In such cell culture, cells proliferate, but do not organize into tissues per se.

The term "stem cell" refers to a cell with clonogenic capacity, self-renewal and differentiation into multiple cell lineages. In particular, mesenchymal stem cells have the ability to proliferate extensively and form colonies of cells with an elongated or spindle-shaped morphology. As used in the present invention, the The expression "stem cell" refers to a pluripotent or multipotent cell, capable of generating one or more types of differentiated cells, and which, in addition, has the ability to self-regenerate, that is, to produce more stem cells. "Totipotent stem cells" can give rise to both embryonic components (such as the three embryonic layers, the germinal lineage, and the tissues that will give rise to the yolk sac), as well as extra-embryonic components (such as the placenta). That is, they can form all cell types and give rise to a complete organism. "Pluripotent stem cells" can form any type of cell corresponding to the three embryonic lineages (endoderm, ectoderm and mesoderm), as well as the germinal and yolk sac. They can, therefore, form cell lineages but from them a complete organism cannot be formed. "Multipotent stem cells" are those that can only generate cells of the same layer or embryonic lineage of origin. Bone marrow harbors at least two distinct stem cell populations: mesenchymal stem cells (MSCs) and hematopoietic stem cells (HSCs). In the context of the present invention, stem cells are selected from the group comprising mesenchymal stem cells, hematopoietic stem cells, embryonic stem cells, induced pluripotent stem cells, adult stem cells, or combinations thereof. In a particular embodiment, the stem cells are mammalian stem cells, preferably human. In a particular embodiment, the stem cells are mesenchymal stem cells, preferably human mesenchymal stem cells.

The term "adult stem cell" refers to that stem cell that is isolated from a tissue or an organ of an animal in a state of growth subsequent to the embryonic state. Preferably, the stem cells of the invention are isolated in a postnatal state. They are preferably isolated from a mammal, and more preferably from a human, including neonates, juveniles, adolescents, and adults. Adult stem cells can be isolated from a wide variety of tissues and organs, such as bone marrow (mesenchymal stem cells and hematopoietic stem cells), adipose tissue, cartilage, epidermis, hair follicle, skeletal muscle, heart muscle, intestine, liver, nervous tissue , etc.

The term "embryonic stem cell" or "ESC" refers to cells derived from the inner cell mass of embryos at the blastocyst stage, with the capacity for self-renewal and pluripotent differentiation into all types of adult cells. Embryonic stem cells are capable of indefinite proliferation in vitro, remaining in an undifferentiated state and with a normal karyotype through prolonged culture. They also have the ability to differentiate into cells of all three embryonic germ layers (mesoderm, endoderm, and ectoderm) (Itskovitz-Eldor, et al., Mol. Med. 6:88-95, 2000) and to the germinal lineage.

Methods for obtaining embryonic stem cells are widely known and can be put into practice by the expert without the need for excessive experimentation.

In another preferred embodiment, the stem cells of the invention are not embryonic stem cells.

The term "hematopoietic stem cell" or "HSC" refers to an adult stem cell with the capacity to give rise to hematopoietic lineages, both myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells) and lymphoid (T lymphocytes, B cells, NK cells). This cell type is mainly found in the bone marrow.

The term "mesenchymal stem cell" or "MSC" as used herein refers to a multipotent stromal cell, originating from the mesodermal germ layer, that can differentiate into a variety of cell types, including osteocytes (bone cells), chondrocytes (cartilage cells) and adipocytes (fat cells), among others. Markers expressed by mesenchymal stem cells include CD105 (SH2), CD73 (SH3/4), CD44, CD90 (Thy-1), CD71, and Stro-1 as well as the adhesion molecules CD106, CD166, and CD29. Among the negative markers for MSCs (not expressed) are the hematopoietic markers CD45, CD34, CD14, and the co-stimulatory molecules CD80, CD86 and CD40 as well as the adhesion molecule CD31. MSCs can be obtained from, but not limited to, bone marrow, adipose tissue (such as subcutaneous adipose tissue), liver, spleen, testes, menstrual blood, amniotic fluid, pancreas, periosteum, synovial membrane, skeletal muscle, dermis, pericytes, trabecular bone, human umbilical cord, lung, dental pulp, and peripheral blood. MSCs, according to the invention, can be obtained from any of the above tissues, such as from bone marrow, dental pulp, subcutaneous adipose tissue or umbilical cord. MSCs can be isolated from bone marrow by methods known to those of skill in the art. In general, such methods consist of isolating cells from bone marrow aspirates, and subsequently seeding the isolated cells in tissue culture plates in medium containing fetal bovine serum. These methods are based on the ability of MSCs to adhere to plastic, so that while non-adherent cells are removed from culture, adhered MSCs can be expanded in culture dishes. MSCs can also be isolated from subcutaneous adipose tissue following a similar procedure, known to those skilled in the art. A method to isolate MSCs from bone marrow or subcutaneous adipose tissue has been previously described (De la Fuente et al., Exp. Cell Res. 2004, Vol. 297: 313:328). In a particular embodiment of the invention, the mesenchymal stem cells are obtained from umbilical cord, preferably from human umbilical cord, as well as from dental pulp, preferably human.

The terms "pluripotent stem cell" or "pluripotent stem cell" and grammatical equivalents are used interchangeably in the context of the present invention to refer to undifferentiated or poorly differentiated cells, of any species, with the ability to divide indefinitely without losing their properties and capable of forming any cell of the three embryonic lineages (mesoderm, endoderm, ectoderm), as well as the germinal lineage when cultured under certain conditions. The invention contemplates the use of any type of pluripotent stem cell that is capable of generating progeny from any of the three germ layers including cells derived from embryonic tissue, fetal tissue, adult tissue, and other sources. Pluripotent cells suitable for use in the present invention include embryonic stem cells, embryonal carcinoma cells, induced pluripotent cells (iPS), and primordial germ cells. Also, the invention contemplates the use of pluripotent stem cells from any species including, without limitation, human, mouse, rat, bovine, sheep, hamster, pig cells and the like.

The term "induced pluripotent stem cell" or "iPS", as used in the present invention, refers to cells that are substantially identical genetically to a differentiated somatic cell from which they are derived, but that show similar characteristics in terms of differentiation and proliferative capacity of pluripotent embryonic stem cells.

As used herein, the term "active ingredient", "active substance", "pharmaceutically active substance", "active ingredient" or "pharmaceutically active ingredient" means any component that potentially provides a pharmacological activity or other different effect in the diagnosis or cure or that mitigates, treats or prevents a disease, or that affects the structure or function of the human body or other animals. Examples of biologically derived active ingredients include growth factors, hormones, and cytokines. A variety of therapeutic agents are known in the art and can be identified by their effects. Certain therapeutic agents are capable of regulating cell proliferation and differentiation. Examples include chemotherapeutic nucleotides, drugs, hormones, etc.

The term "drug" as used herein refers to any substance used for the prevention, diagnosis, alleviation, treatment, or cure of disease in man and animals.

Throughout the description and claims, the word "comprise" and variants thereof are not intended to exclude other technical features, supplements, components or steps. Other objects, advantages, and features of the invention will be understood in part from the description and in part from the practice of the invention to those skilled in the art. The following examples and drawings are provided by way of illustration and are not intended to limit the present invention.

EXAMPLES OF THE INVENTION

The following specific examples provided in this patent document serve to illustrate the nature of the present invention. These examples are included for illustrative purposes only and should not be construed as limiting the invention claimed herein. Therefore, the examples described below illustrate the invention without limiting its field of application.

Materials and methods.

Obtaining cartilage from the sturgeon ( Acipenser naccarii) and decellularization

This study was conducted using cartilage obtained from the head region of Acipenser naccarii (sturgeon) that was provided by the fish farm located in Riofrío, Granada, Spain. Sturgeons were slaughtered, cartilage was removed, cleaned and immediately frozen at -20 °C until processing.

Before the decellularization process, the cartilage was thawed at room temperature (RT). Cartilage discs (n = 40) with a diameter of 8 mm and an approximate thickness of 1 mm were obtained using a biopsy punch (Kay Medical) and #10 surgical blades. These discs were immersed in a solution consisting of 10 ml of phosphate buffered saline (PBS; Sigma-Aldrich; D8662) with antibiotics/antimycotics (Sigma-Aldrich; A5955) [Pu L et al. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 2018;106(2):619-31] for 10 minutes. Some of these discs (n = 7) were stored as native controls (NCTR). The rest of the discs started the decellularization process.

The decellularization protocol used was a combination of several previously described protocols [Vinatier C et al. Trends in Biotechnology. 2009;27(5):307-14, Oliveira et al. PLOS ONE. 2013;8(6):e66538, Philips C et al. Annals of Biomedical Engineering. 2018;46(11):1921-37] optimized for cartilage decellularization based on the use of different types of detergents and enzymatic treatment. First, the discs were incubated in bidistilled water (bH2O) at room temperature with shaking for 24 h to induce cell lysis by osmotic shock [Pu L et al. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 2018;106(2):619-31]. The discs were then transferred to 1% sodium dodecyl sulfate (SDS) solution (Invitrogen; 24730020) [Zhang X et al. Gene.

2016;579(1):8-16] to remove cytoplasmic and nuclear material. To remove SDS, 3 washes of 30 min each with bH2O at 4°C were performed and then the discs were transferred to a 3% Triton X-100 solution (Sigma-Aldrich; X100-500ML) [Philips C et to the. Annals of Biomedical Engineering. 2018;46(11):1921-37] to promote lipid dissociation. Subsequently, the 3 washes were repeated and the discs were incubated in a 4% sodium deoxycholate (SDC) solution (Sigma-Aldrich; D6750-100G) [Philips C et al. Annals of Biomedical Engineering. 2018;46(11):1921-37] to dissociate intracellular proteins. Finally, the 3 washes were repeated and the enzymatic treatment was carried out in duplicate. In this treatment, 100 mg/L of DNase (Sigma-Aldrich; DN25-1G) and 20 mg/L of RNase (Sigma-Aldrich; R4875-500MG) were used [Philips C et al. Annals of Biomedical Engineering.

2018;46(11):1921-37] in PBS at pH 7.5 and 37 °C for 45 minutes. To stop the reaction, cold PBS was used. Then, 5 washes with PBS were performed for 15 minutes each to remove detergent and enzyme residues [Pu L et al. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 2018;106(2):619-31]. Decellularized cartilage discs (DCD) were stored in PBS at 4°C for later use. All detergents were diluted in bH2O to avoid water loss during the process, since the fabric structure can be affected [Badylak SF et al. Biomaterials Act.

2009;5(1):1-13]. All the incubations with the detergents were carried out at RT, with agitation and for 24 h.

Evaluation of residual DNA in decellularized cartilage discs ( DCD)

To test the efficiency of the decellularization process, DNA from NCTR and DCD was extracted using QlAamp DNA Mini Kit (Qiagen), following the manufacturer's instructions, in triplicate and quantified by measuring absorbance at 260/280 nm using a NanoDrop 2000 spectrophotometer (Thermo Scientific).

MSC and HEC culture

MSC (human mesenchymal cells) and HEC (human elastic cartilage chondrocytes) were previously obtained from primary cultures that were available in the Tissue Engineering Group of the Histology Department of the University of Granada. ADSC (adipose-derived stem cells), BMSC (bone marrow-derived stem cells), and DPSC (dental pulp-derived stem cells) were cultured using Dulbecco's modified Eagle's culture medium (DMEM) (Sigma-Aldrich; D6429) supplemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich; F7524) and 1% antibiotics/antimycotics. WSCs (umbilical cord Wharton's jelly stem cells) were cultured in AmnioMAX™ medium (Gibco; 17001-074) as previously described [Horvai A. Anatomy and Histology of Cartilage. In: LinkTM, editor. Cartilage Imaging: Significance, Techniques, and New Developments. New York, NY: Springer New York; 2011. p. 1-10]. HECs were grown with expansion medium composed of 10% FBS, 2 mM L-glutamine (Sigma-Aldrich; G7513), 88% Dulbecco's Modified Eagle's Medium/F-12 HAM Nutrient Mix (DMEM-F12) ( Sigma-Aldrich; D8437) and 1% antibiotics/antifungals. Cultures were incubated at 37°C and 5% CO2 and the medium was changed 3 times per week. Cells were dissociated before reaching confluency using 0.05% trypsin-ethylenediaminetetraacetic acid solution (Gibco; 25300062).

Recellularization of cartilage

For recellularization of DCD, it was necessary to create templates based on 3.5% type I agarose (Sigma-Aldrich; A4718) in PBS in 24-well plates (Sigma-Aldrich; CLS3527) using a biopsy punch to obtain the size of the DCDs, and a DCD was placed in each of these molds. After that, 30,000 cells of each type were cultured per DCD (n = 7 for each cell type) to generate recellularized DCD (RCD), which were renamed RCD-ADSC, RCD-BMSC, RCD-DPSC, RCD-WSC and RCD-HEC, depending on the cell type used for recellularization. RCDs were incubated at 37°C with 5% CO2 for 2-3 h to allow cell adhesion. Then, 1 mL of each specific medium was added to each well and the RCDs were incubated for 24 h. A non-recellularized DCD was used as a negative control. All these samples were cultured until 15-21 days (t1) and 30-35 days (t2), changing the medium twice a week.

In vivo evaluation

For in vivo analysis, 3 DCDs and 3 RCDs of each cell type ( in vivo RCDs) (n = 18) were grafted onto laboratory animals. Each specimen was cut in half prior to surgery and grafted onto six 6-week-old male immunodeficient athymic nude Foxnlnu mice (n = 6 specimens per mouse). Briefly, the animals were deeply anesthetized with ketamine and acepromazine and the different cartilage substitutes were grafted subcutaneously into the dorsal area of each animal. Each mouse was grafted with one sample of each type (in vivo DCD, in vivo ADSC, in vivo BMSC, in vivo DPSC, in vivo WSC, and in vivo HEC ). After 12, 30 or 60 days, the animals were sacrificed and the different implants were collected for histological analysis.

histological analysis

All samples (NCTR, DCD, RCD in vitro, DCD in vivo and RCD in vivo) were fixed in 4% formaldehyde for 24 hours at RT and shaking for histological analysis. The samples were then dehydrated using a series of alcohols (70-100%) and xylol and embedded in paraffin. The samples were sectioned at 5 µm thickness using a microtome, rehydrated and stained with hematoxylin-eosin (HE) to assess the general structure of the different cartilage samples. To detect the presence of cell nuclei, samples were stained with 4',6-diamidino-2-phenylindole (DAPI) (Vector Laboratories). To evaluate the presence of collagen fibers, the samples were stained with picrosirius red (P). Alcian blue (AB) histochemistry [Alfonso-Rodríguez CA et al. PLOS ONE.

2014;9(11):e112457] and toluidine blue (TB) was used to identify cartilage proteoglycans. After staining, light microscopy images were obtained using an Eclipse 90i microscope (Nikon) at 100x magnification. Images were further processed with ImageJ to quantify the staining signal for TB, AB, and P.

Statistic analysis

For each specific and global sample group, means ± standard deviation were calculated. In addition, when several study times (two in vitro times and three in vivo times) were considered, the means ± standard deviation were calculated for the global group of samples corresponding to the same type of tissue in different periods of time (for example, samples ADSCinvitro corresponding to t1 and t2). Statistical analysis was performed using SPSS Statistics 23 software (IBM). The Shapiro-Wilk test was used to determine the normality of each distribution and the Mann-Whitney test was used to detect specific differences between two groups. P<0.0001 defined differences statistically significant, adjusted by the Bonferroni p-value correction since in this study more than 300 comparisons were made simultaneously.

RESULTS

Cartilage decellularization

The efficiency of decellularization was evaluated by quantifying residual DNA in decellularized tissues and with H-E and DAPI. The DNA content obtained for DCD was 19.92 ± 5.79 ng/mg tissue, which is consistent with the requirements of decellularized tissues [Crapo PM. Biomaterials. 2011;32(12):3233-43]. H-E and DAPI showed that the process was able to remove all nuclei from the tissue compared to NCTR (Fig. 1A and 1C), thus confirming the quantification result and showing that the decellularization process was carried out successfully. Furthermore, H-E revealed that cartilage retains its general structure after decellularization. Analysis of ECM composition in DCD revealed that TB and AB remained stable after decellularization, although P showed a significant decrease in staining in DCD (p<0.0001) (Fig. 1A-B, 2, 3A- C).

Histological analysis of recellularized DCD samples maintained in vitro

In vitro RCDs were analyzed histochemically to determine if the cells were capable of adhering to decellularized cartilage at t1 and t2. H-E and DAPI showed that in all in vitro RCD samples the cells were adherent to the surface and tended to grow and form a thin irregular layer. In vitro RCD with ADSC (ADSCinvitro) was the one that presented the highest number of cells at t1 and in vitro RCD with DPSC (DPSCinvitro) at t2, while in vitro RCD with BMSC (BMSCinvitro) was the one that had fewer cells on the surface at t1 and in vitro RCD with HEC (HECinvitro) at t2 (Fig. 1A and 1C).

Possible variations in RCD in vitro ECM were analyzed using TB, AB and P stains. TB showed that NCTR did not present significant differences in proteoglycan content when compared to the rest of the global groups (ADSCinvitro, BMSCinvitro, DPSCinvitro, WSCinvitro and HECinvitro). ) (Table 1). However, it was observed that there were some differences if compared with each specific group (Fig. 1B). DPSCinvitro-t2 showed the greatest reduction in the amount of proteoglycans compared to NCTR (p<0.0001) (Fig. 3A). An overall comparison was also made for DCD, revealing that there was a significant decrease in ADSCinvitro, DPSCinvitro, WSCinvitro and HECinvitro (Table 1). In this case, DPSCinvitro-t2 also had the lowest proteoglycan content (Fig. 3A).

Variations in proteoglycan composition with AB were also measured. In general, no statistical differences were found when overall groups were compared with NCTR or DCD (Table 1). However, some specific groups were statistically different from controls, with WSCinvitro-t2 showing the greatest significant reduction in these molecules and HECinvitro-t1 the greatest increase (p<0.0001) (Fig. 2A and 3B).

Quantification of collagen fibers by P staining revealed that the overall WSCinvitro and HECinvitro groups had significantly less collagen staining than NCTR (p<0.0001) (Table 1). However, the comparison with specific groups showed that BMSCinvitro-t2 was the one with the lowest P signal (p<0.0001). On the other hand, it was observed that the overall ADSCinvitro, WSCinvitro and HECinvitro groups had a significantly higher collagen content than the DCD (p<0.0001) (Table 1). Specifically, HECinvitro-t2 showed the greatest increase in collagen intensity (Fig. 2B and 3C).

Finally, a comparison was also made between the times within each group. In general, the amount of proteoglycans determined by TB tended to fall between t1 and t2 except for ADSCinvitro in which there was an increase. For HECinvitro, the content of these molecules did not alter over time (Fig. 1B). For AB staining, all results also tended to decrease, except for DPSCinvitro, which showed increased proteoglycans (Fig. 2A). No significant differences were observed in the content of collagen present in ADSinvitro, WSCinvitro and HECinvitro between t1 and t2, but there was a decrease in the case of BMSCinvitro and DPSCinvitro (Fig. 2B) (p<0.0001).

Histological analysis of recellularized DCD samples grafted in vivo

After 12, 30 and 60 days in vivo, the biocompatibility, integration and structural alterations in DCD in vivo and RCD in vivo were evaluated. None of the animals showed signs of necrosis or inflammation. HE revealed that none of the constructs presented histological alterations (oncogenesis, inflammation, hemorrhage, fibrosis, etc.). Furthermore, there was no infiltration of host cells into the constructs. Instead, the tissues tended to be encapsulated by host connective tissue. No vascularization of the tissue was observed (fig. 4, 5 and 6).

For all constructs in vivo , an analysis of ECM alteration in global and specific groups was also performed. TB determined that only the overall BMSC in vivo group had a significant decrease in proteoglycan content compared to NCTR (p<0.0001) (Table 1). For specific groups, we found that DCD in vivo-12d was the group with the largest increase in proteoglycans, while BMSC in vivo-60d showed the largest decrease. The overall groups BMSC in vivo, WSC in vivo and HEC in vivo exhibited a significant reduction with respect to DCD (Table 1). Specifically, DCD in vivo-12d and BMSC in vivo-60d also showed the greatest increase and decrease in proteoglycans (Fig. 3D, 4A and 5A).

The results corresponding to the AB staining revealed that there were no differences between NCTR and DCD with the rest of the groups in general. In vivo DCD-12d showed the greatest decrease in AB intensity compared to NCTR and DCD, while in vivo BMSC-12d showed the greatest increase in proteoglycans compared to NCTR (p<0.0001) (Fig. 3E, 4A and 5A).

Similar results were found in collagen staining between NCTR and global groups, with no statistically significant differences (Table 1). However, there was an increase in collagen content in the overall DPSC in vivo, WSC in vivo and HEC in vivo groups compared to DCD (p<0.0001) (Table 1). For specific groups, ADSC in vivo-12d showed a greater reduction in collagen content compared to NCTR (p<0.0001). ADSC in vivo-12d and HEC in vivo-60d showed increased and decreased P signal compared to DCD, respectively (p<0.0001) (Fig. 3F, 4B and 6B).

A comparison of the time course of the samples in vivo showed some differences between the groups. In general, a significant increase in collagen content as determined by P was found between the 12 and 60-day samples (p<0.0001), but this trend was not clear for proteoglycans (Fig. 4-6). .

NCTR 146.5 ± 19.07 135.7 ± 8.26 156.9 ± 6.44

DCD 145.7 ± 8.43 148.1 ± 16.6 139.4 ± 3.47ab

ADSCinvitro 116.45 ± 21b 136 ± 13.44 149.95 ± 1.20b

BMSCinvitro 122.2 ± 27.72 138.9 ± 23.48 146.25 ± 13.22 5

DPSCinvitro 117.95 ± 26.09b 129.3 ± 16.97 147.55 ± 9.69

In vitro WSC 125.8 ± 10.75b 129.85 ± 23.97 147.7 ± 3.39ab

HECinvitro 117.6 ± 8.49b 157.05 ± 3.23 155.8 ± 0.57ab

DCDinvivo 135.8 ± 39.52 126.17 ± 28.24 153.67 ± 17.44

ADSCinvivo 126.2 ± 22.54 130.13 ± 5.73 156.5 ± 24.19 10

BMSCinvivo 101.63 ± 5.84ab 149.2 ± 1.22 148.87 ± 17.86

DPSCinvivo 148.83 ± 2.52 137.6 ± 34.05 155.93 ± 10.57b

In vivo WSC 115.8 ± 21.17b 141.27 ± 2.10 163.63 ± 4.20b

HICinvivo 119.3 ± 19.30b 141.2 ± 15.06 161 ± 10.45b

Table 1. Analysis of extracellular matrix components determined by staining with toluidine blue (TB), alcian blue (AB) and picrosirius red (P) in each global group of samples. The values correspond to means ± standard deviations. a: differences with NCTR are statistically significant. b: differences with DCD are statistically significant.

Claims (18)

1. - Cartilage of organisms of the order Acipenseriformes for use as medicine. - The cartilage for use according to the preceding claim, where the organism belongs to the Acipenseridae family. 3. - The cartilage for use according to any of claims 1-2, where the organism belongs to the genus Acipenser and more preferably is the species Acipenser naccarii. 4. - The cartilage for use according to any of claims 1-3, to increase, restore or partially or totally replace the functional activity of a diseased or damaged tissue or organ. 5. - The cartilage for use according to claim 4, wherein the diseased or damaged tissue or organ is selected from the list consisting of: cartilage found in the joint surfaces (articular cartilage), the ear, the nose and /or the trachea, bronchi, epiglottis, ribs, pubic symphysis, intervertebral disc, menisci, or any combination thereof. 6. The cartilage for use according to any of claims 1-5, which is diluted or lyophilized. 7. - The cartilage for use according to any of claims 1-6, which has been obtained by a process comprising: a) induce cell lysis of cartilage cells by osmotic shock, b) remove cytoplasmic and nuclear material, c) promote lipid dissociation, and d) dissociate intracellular proteins. 8. - The cartilage obtained by the method according to claim 7, wherein the cell lysis of step a) is induced by incubating the cartilage in bidistilled water (bH2O) at room temperature with agitation. 9. - The cartilage obtained by the method according to any of claims 7-8, wherein the removal of cytoplasmic and nuclear material in step b) is performed by incubating the cartilage in a 1% solution of sodium-dodecyl-sulfate (SDS) . 10. - The cartilage obtained by the method according to any of claims 7-9, where the lipid dissociation of step c) is performed with a 3% Triton X-100 solution. 11. - The cartilage obtained by the method according to any of claims 7-10, wherein the dissociation of intracellular proteins in step d) is performed by incubating the cartilage in a 4% sodium deoxycholate (SDC) solution. 12. - Artificial tissue comprising: a) cartilage as described in any of claims 1-11, and b) at least one cell. 13. The artificial tissue according to claim 12, wherein the cell is a stem cell selected from: mesenchymal stem cells, hematopoietic stem cells, embryonic stem cells, induced pluripotent stem cells, adult stem cells or combinations thereof. 14. - The artificial tissue according to any of claims 12-13, wherein the stem cell is a mesenchymal stem cell. 15.- The artificial tissue according to any of claims 12-14, where the mesenchymal stem cell is obtained from bone marrow, adipose tissue, liver, spleen, testicles, menstrual blood, amniotic fluid, pancreas, periosteum, synovial membrane, skeletal muscle, dermis, pericytes, trabecular bone, umbilical cord, lung, dental pulp, and peripheral blood. 16. The artificial tissue according to any of claims 12-15, for use as a medicine. 17. The artificial tissue according to any of claims 12-15, to increase, restore or partially or totally replace the functional activity of a diseased or damaged tissue or organ. 18. The artificial tissue according to claim 17, wherein the diseased or damaged tissue or organ is selected from the list consisting of: cartilage found on the joint surfaces (articular cartilage), the ear, the nose and/or the trachea, bronchi, epiglottis, ribs, pubic symphysis, intervertebral disc, menisci, or any combination thereof.