ES2888626T3 - Spatial mapping of nucleic acid sequence information - Google Patents

Abstract

A capture array for the spatial detection and analysis of nucleic acids in a tissue sample, comprising a plurality of capture sites, wherein each capture site comprises a pair of probes immobilized on a surface, wherein one first probe of the pair of probes comprises a first primer binding region sequence and a unique spatial address region sequence and does not comprise a capture region sequence, and wherein a second probe of the pair of probes comprises a second sequence of the primer binding region and the capture region sequence and does not comprise the spatial address region sequence, wherein the capture region sequence comprises a poly-T capture sequence and the sequence of poly-T capture is configured to hybridize to a target nucleic acid comprising a poly-A tail; or the capture region sequence comprises a gene-specific capture sequence and the gene-specific capture sequence is configured to hybridize to a target nucleic acid comprising a gene-specific sequence; or the capture region sequence comprises a random primer capture sequence and the random primer capture sequence is configured to hybridize to a target nucleic acid comprising a sequence complementary to the random primer capture sequence.

Description

DESCRIPTION

Spatial mapping of nucleic acid sequence information

1. Background

Existing techniques for the detection and analysis of nucleic acids (eg, mRNA or genomic DNA) in a tissue sample generally provide spatial or localized information for one or a limited number of genes at a time, or provide information for all genes at once. the sample without the desired positional information. Recent interest has focused on the development of techniques that allow the characterization of transcriptomes and/or genomic variations in tissues while preserving spatial information about the tissue. There is a need for methods to characterize nucleic acids in the context of a tissue sample.

2. Summary

The present description provides methods and compositions that facilitate the characterization of transcriptomes and/or genomic variation in tissues, while preserving spatial information related to the origin of target nucleic acids in the tissue. For example, the methods described herein may allow identification of the location of a cell or group of cells in a tissue biopsy that carries an aberrant mutation. Therefore, the methods provided herein may be useful for diagnostic purposes, eg, for cancer diagnosis, and possibly aid in the selection of targeted therapies.

The present disclosure provides a capture array for the spatial detection and analysis of nucleic acids in a tissue sample, comprising a capture site comprising a pair of capture probes immobilized on a surface, wherein a first capture probe capture of the capture probe pair comprises a first primer binding region and a spatial targeting region, and wherein a second capture probe of the capture probe pair comprises a second primer binding region and a capture region .

The present disclosure also provides a method for the spatial detection and analysis of nucleic acids in a tissue sample including (a) providing a capture array, comprising a capture site comprising a pair of capture probes immobilized to a surface, wherein a first capture probe of the pair of capture probes comprises a first primer binding region and a spatial targeting region, and wherein a second capture probe of the pair of capture probes comprises a second region primer binding and a capture region.

The present disclosure also provides a method for the spatial detection and analysis of nucleic acids in a tissue sample including providing a magnetic nanoparticle comprising an immobilized capture probe comprising a capture region.

The present disclosure also provides a method for the spatial detection and analysis of nucleic acids in a tissue sample including providing a magnetic nanoparticle comprising an immobilized capture probe comprising a capture region.

The present disclosure also provides a capture array for the spatial detection and analysis of nucleic acids in a tissue sample, comprising a capture site comprising a capture probe comprising a spatial address region and an end region of transposon (“transposon end”, TE).

The present disclosure also provides a method for the spatial detection and analysis of nucleic acids in a tissue sample including providing a capture array comprising a capture site comprising a capture probe comprising a spatial targeting region and a transposon end region (TE).

3. Brief description of the drawings

Figure 1A illustrates a plan view of an exemplary embodiment of a capture array for capturing a nucleic acid in a tissue sample.

Figure 1B illustrates a side view of a capture site of the capture array, wherein the single capture site comprises at least one capture probe for capturing a nucleic acid in a tissue sample.

Figure 1C illustrates a side view of an exemplary embodiment of a universal capture bead for capturing a nucleic acid in a tissue sample.

Figure 2 illustrates a flow chart of an exemplary embodiment of a method of spatial detection and analysis of a nucleic acid in a tissue sample.

Figure 3 illustrates a side view of the array of Figure 1A and shows an exemplary embodiment of a process for capturing total mRNA in a tissue sample on the array.

Figure 4 illustrates a side view of the array of Figure 1 and shows an exemplary embodiment of a target mRNA capture process in a tissue sample on the array.

Figure 5 illustrates a flow diagram of an exemplary embodiment of a method for generating cDNA by in situ reverse transcription of RNA in a tissue sample to capture it on an array.

Figure 6 illustrates an exemplary embodiment of the steps of a method of Figure 5.

Figure 7 illustrates another exemplary embodiment of the steps of a method of Figure 5.

Figure 8 illustrates a flow diagram of an exemplary embodiment of a DNA amplicon capture method on an array, in which the DNA amplicons are generated by in situ amplification of the target nucleic acid. Figure 9 illustrates an exemplary embodiment of the steps of a method of Figure 8.

Figure 10 illustrates a flow diagram of an exemplary embodiment of a DNA amplicon capture method on an array, in which the DNA amplicons are generated by in situ amplification of the target nucleic acid. Figure 11 illustrates the steps of a method of Figure 10.

Figure 12 illustrates a flow diagram of an exemplary embodiment of a method of capturing cDNA on an array by single-stranded coupling, in which cDNA is generated by in situ reverse transcription of target RNA molecules.

Figures 13A and 13B illustrate the steps of a method of Figure 12.

Figure 14 illustrates a flow diagram of an exemplary embodiment of a DNA amplicon capture method on an array, in which the DNA amplicons are generated by in situ amplification of the target nucleic acid. Figures 15A, 15B and 15C illustrate the steps of a method of Figure 14.

Figure 16 illustrates a side view of a portion of an electrophoretic blotting system that is configured for spatial detection and analysis of a nucleic acid in a tissue sample.

Figure 17 illustrates a side view of a capture site on a capture array (eg, the capture array of Figure 1A), where a capture site comprises two separate sets of immobilized capture probes.

Figure 18 illustrates a flow chart of one embodiment of a method of transferring nucleic acids from a tissue sample to a capture array for generation of a spatially addressed sequencing library, wherein the capture array comprises sites capture probes that include separate pairs of immobilized capture probes, for example , as shown in Figure 17.

Figures 19A, 19B, 19C and 19D illustrate the steps of the method of Figure 18.

Figure 20 shows an example of a process for capturing a nucleic acid in a tissue sample for its subsequent anchoring on a matrix.

Figures 21A and 21B illustrate a one-dimensional indexing scheme grid array and a two-dimensional indexing scheme grid array, respectively, for spatial detection and analysis of nucleic acids in a tissue sample.

Figure 22 illustrates a flow diagram of an exemplary embodiment of a method of using a combinatorial indexing system for the generation of a spatially addressed cDNA sequencing library.

Figures 23A and 23B illustrate the steps of a method of Figure 21.

Figure 24 illustrates a flow diagram of an exemplary embodiment of an alternative method of using a combinatorial indexing system for the generation of a spatially addressed cDNA sequencing library.

Figures 25A, 25B and 25C illustrate the steps of a method of Figure 24.

Figure 26A illustrates a plan view of an exemplary embodiment of an array for transporting reverse transcription ("RT") primers to a tissue sample for in situ cDNA synthesis.

Figure 26B illustrates a side view of a portion of a delivery site of the array of Figure 26A, wherein the portion of the delivery site comprises at least one RT primer for cDNA synthesis from mRNA in a tissue sample.

Figure 27A illustrates a plan view of an exemplary embodiment of a capture array for capturing cDNA synthesized in situ using the RT primers of Figure 26B.

Figure 27B illustrates a side view of a capture site portion of the capture array of Figure 27A, wherein the capture site portion comprises at least one capture probe for capture of synthesized cDNA.

Figure 28 illustrates a flowchart of an exemplary embodiment of a method for generating a spatially addressed sequencing library, wherein a first template is used for in situ synthesis of first-strand cDNA and a second template is used to capture the cDNA for subsequent library generation.

Figures 29A and 29B illustrate the steps of a method of Figure 28.

Figure 30 illustrates a flow diagram of an exemplary embodiment of a method for generating a spatially targeted cDNA library using releasable capture probes.

Figures 31A and 31B illustrate exemplary schematic diagrams of a spatially directed capture probe comprising a 5' disulfide modification and a spatially directed capture probe comprising a 5' photoscleavable linker, respectively.

Figures 32A, 32B and 32C illustrate an exemplary embodiment of a process of reversibly anchoring the spatially directional capture probe of Figure 31A onto the surface of a glass coverslip.

Figures 33A, 33B and 33C illustrate an exemplary embodiment of a process of reversibly anchoring the spatially directional capture probes of Figure 31B onto the surface of a glass coverslip.

Figures 34A and 34B illustrate the steps of the method of Figure 30.

Figure 35 illustrates a schematic diagram of an exemplary embodiment of a capture probe pair for capturing a region of genomic DNA of interest.

Figure 36 illustrates a flow chart of an exemplary embodiment of a method for generating a spatially addressed genomic amplicon library using releasable capture probes.

Figure 37 illustrates the steps of a method of Figure 36.

Figure 38 illustrates a flow diagram of an exemplary embodiment of a method for generating a spatially addressed sequencing library using magnetic nanoparticles to capture a nucleic acid from a tissue sample.

Figure 39 illustrates the steps of a method of Figure 38.

Figures 40A and 40B illustrate an example of a process of using a capture probe to form complementary nucleic acid in a tissue sample and subsequently immobilize the complementary nucleic acid on a nanoparticle.

Figures 41A and 41B illustrate schematic diagrams of an example of a particle-associated capture probe comprising a first partial spatial address region and a second array capture probe comprising a second partial address region, respectively, for Spatial detection and analysis of nucleic acids in a tissue sample.

Figures 42A and 42B illustrate schematic diagrams of an example of a particle-associated capture probe and a second array capture probe comprising a spatial address region, respectively, for the spatial detection and analysis of nucleic acids in an array. tissue sample.

Figures 43A and 43B illustrate schematic diagrams of an example of a particle-associated capture probe and a second array capture probe, respectively, for spatial detection and nucleic acid analysis of a tissue sample.

Figure 44 illustrates a perspective view of a magnetism-based transfer system that is configured for spatial detection and analysis of a nucleic acid in a tissue sample.

Figure 45 illustrates a side view of a capture site on the capture array of Figure 44, where a capture site includes a plurality of capture probes.

Figure 46 illustrates a flowchart of an exemplary method of transferring cDNA from a tissue sample to a capture array for generation of a spatially addressed sequencing library using the magnetism-based transfer system of the matrix. figure 44 and figure 45.

Figures 47A, 47B and 47C graphically show the steps of the method of Figure 46.

Figure 48 illustrates a flowchart of an exemplary method of transferring RNA from a tissue sample to a capture array for generation of a spatially addressed sequencing library using the magnetism-based transfer system of the matrix. figure 44.

Figures 49A, 49B and 49C graphically show the steps of the method of Figure 48.

Figure 50 illustrates a flowchart of an example of a method for profiling genomic DNA in a tissue sample.

Figure 51 illustrates a diagram of a spatially targeted PCR primer for pre-amplification and spatial indexing of whole genomic DNA.

Figures 52A and 52B graphically show the steps of the method of Figure 50.

Figure 53 illustrates a perspective view of an example of a microwell reactor overlay.

Figure 54 illustrates a perspective view of a single microwell from Figure 53.

Figures 55A and 55B illustrate an example of a manufacturing process for the microwell substrate of Figure 53. Figure 56 illustrates a side view of an example of a microwell structure for the capture and spatial compartmentalization of nucleic acids from a microwell. tissue sample.

Figure 57 illustrates a flow diagram of an exemplary method of capturing nucleic acids from a tissue section using the microwell structure of Figure 56 for preparation of a sequencing library.

Figure 58A illustrates a side view of an exemplary pin system for excision of tissue and preparation of a spatially directional nucleic acid library.

Figure 58B illustrates examples of different cleavage surfaces for the pins on the pin structure of Figure 58A.

Figure 59 illustrates a flow chart of an exemplary method of capturing nucleic acids from a tissue section using the pin system of Figure 58 for preparation of a sequencing library.

Figure 60 illustrates side views of the plug system of Figure 58 and graphically shows steps 5910 and 5915 of the method of Figure 59.

Figure 61 illustrates a flow chart of another example of a method for capturing nucleic acids from a tissue section using the pin system of Figure 58 for preparation of a sequencing library.

Figure 62 illustrates side views of the plug system of Figure 58 and graphically shows steps 6110 and 6115 of the method of Figure 61.

Figure 63 illustrates a perspective view of a capillary "microreactor" system for capturing nucleic acids from a tissue section for the preparation of a spatially addressed nucleic acid library.

Figure 64 illustrates a flow chart of an exemplary method of capturing nucleic acids from a tissue section using the capillary microreactor system of Figure 63 for preparation of a sequencing library.

Figure 65 illustrates a side view of a portion of a droplet actuator that is configured for spatial detection and analysis of nucleic acids in a tissue sample.

Figure 66 illustrates a side view of the pore sheet of Figure 65.

Figures 67A and 67B illustrate side views of the droplet actuator of Figure 65 and show a process of isolating a nucleic acid in a tissue sample for detection and spatial analysis.

Figure 68 illustrates exemplary embodiments of a method for generating a spatially addressed genomic amplicon library using labeling of whole genomic DNA.

Figures 69A, 69B and 69C illustrate the steps of a method of Figure 68.

Figure 70 illustrates a plan view of a spatial direction overlay.

Figure 71 illustrates a plan view of a single spatial feature on the substrate of Figure 70.

4. Detailed description

Described herein are a variety of methods and compositions that allow the characterization of analytes in tissues, while preserving spatial information related to the origin of the target analyte in the tissue. The description comprises the following embodiments and examples. The scope of the invention is defined by the appended claims. In various embodiments, an array includes a substrate on which a plurality of capture probes are immobilized such that each capture probe occupies a distinct position on the array. Each capture probe includes, among other sequences and/or molecules, a unique positional nucleic acid marker (ie, a spatial address or indexing sequence). Each spatial direction corresponds to the position of the capture probe on the array. The position of the capture probe on the array can be correlated to a position in the tissue sample.

Examples of analytes in a tissue sample include genomic DNA, methylated DNA, specific methylated DNA sequences, messenger RNA (mRNA), polyA mRNA, fragmented mRNA, fragmented DNA, mitochondrial DNA, viral RNA, microRNA, intracellularly synthesized PCR products. situ, RNA/DNA hybrids, lipids, carbohydrates, proteins, glycoproteins, lipoproteins, phosphoproteins, a specific phosphorylated or acetylated variant of a viral coat protein(s).

A nucleic acid marker-encoding location (ie, a spatial address or indexing sequence) can be coupled to a capture region of a nucleic acid or any other molecule that binds a target analyte. Examples of other molecules that can be coupled to a nucleic acid tag include antibodies, antigen binding domains, proteins, peptides, receptors, haptens, etc.

Described herein are a variety of methods and compositions that allow the characterization of transcriptomes and/or genomic variation in tissues, while preserving spatial information related to the origin of target nucleic acids in the tissue. For example, the methods described herein may allow identification of the location of a cell or group of cells in a tissue biopsy that carries an aberrant mutation. Therefore, the methods provided herein may be useful for diagnostic purposes, eg, for the diagnosis of cancer, and possibly aid in the selection of targeted therapies.

The present description is based, in part, on the realization that information related to the spatial origin of a nucleic acid in a tissue sample can be encoded in the nucleic acid in the process of preparing the nucleic acid for sequencing. For example, nucleic acids from a tissue sample can be labeled by probes that include location-specific sequence information (a "spatial address"). Nucleic acid molecules with spatial addresses from a tissue sample can then be mass sequenced. Nucleic acid molecules of identical sequence originating from different regions of a tissue sample can be distinguished based on their spatial direction and can be mapped to their regions of origin in the tissue sample.

The present description is further based, in part, on the realization that distinguishing related nucleic acids based on their spatial origin in a tissue sample can increase the sensitivity of detecting rare mutations in a complex tissue. For example, it was discovered that spatial targeting of nucleic acids could increase the sensitivity of detecting single nucleotide variations (SNVs) in a tissue sample.

In some methods described herein, probes for spatial labeling may include, for example, combinations of spatial address regions and gene-specific capture regions. Gene-specific and spatially targeted probes can be contacted with the tissue sample as probes immobilized on a capture matrix. Alternatively, spatially directional probes can be released from the capture matrix and interact with nucleic acids in solution in the tissue sample, eg, in situ.

The present disclosure is further based, in part, on the realization that spatial labeling can be performed using probes that separate spatial address regions from gene-specific capture regions. The ability to separate capture regions from spatial address regions into two or more probes can increase the flexibility of sequencing library designs and library preparation protocols.

The present disclosure is further based, in part, on the realization that the robustness and data quality of spatial transcriptomics experiments can be improved by facilitating the transfer of nucleic acids from a tissue sample to a capture matrix, e.g. , a capture array of capture probes with spatial directions. For example, electrophoretic transfer of nucleic acids can be used to improve transfer yields and transfer kinetics of nucleic acids. High-throughput nucleic acid transfer from tissue samples to capture arrays can facilitate detection of rare SNVs. Fast transfer kinetics can be used to limit the diffusion of nucleic acids during the transfer process and help increase spatial targeting resolution. Other Methods Described herein involve the use of intermediate nucleic acid substrates, such as particles (eg, electromagnetic nanoparticles), membranes (eg, nylon membranes), or microwell plates to facilitate capture of the nucleic acid in the tissue sample, to facilitate transfer of nucleic acid onto capture matrices, and to limit diffusion and improve spatial resolution. Additional methods involving, for example, genomic DNA labeling are described, which can be used to efficiently add spatial addresses to nucleic acids, for example, on the surface of a capture matrix.

The present disclosure is further based on the realization that spatial targeting of nucleic acids from a tissue sample may involve two-dimensional spatial targeting, for example, to correlate the position of a nucleic acid in a two-dimensional capture matrix with the position of nucleic acid in a two-dimensional tissue section. Spatial addressing can also be performed in additional dimensions. For example, spatial address sequences can be added to nucleic acids to describe the relative spatial position of a nucleic acid in a third or fourth dimension, for example, describing the position of a tissue section in a tissue biopsy, or the position of a tissue biopsy in a subject's organ. Temporal address sequences could be added to nucleic acids from a tissue sample to indicate a point in time in a temporal developmental experiment, for example, investigating changes in gene expression in a cell in response to a physical or chemical stimulus , such as a drug treatment during a clinical trial.

It should be noted that, as used in this specification and the appended claims, the singular forms "a", "an", "the" and "the" include plural referents unless the content clearly indicates otherwise. . Thus, for example, reference to "a capture probe" includes a mixture of two or more capture probes and the like.

The term "approximately," particularly in reference to a given amount, is intended to encompass deviations of plus or minus five percent.

As used in this document, the terms "includes", "including", "inclusive", "contains", "containing" and any variations thereof, are intended to cover a non-exclusive inclusion, so that a process , method, product by process or composition of matter that includes or contains an element or list of elements does not include only those elements, but may include other elements that are not expressly listed or are inherent to said process, method, product by process or composition of matter.

As used herein, the terms "address," "tag," or "index," when used in reference to a nucleotide sequence, mean a unique nucleotide sequence that is distinguished from other indices, as well as from other nucleotide sequences within polynucleotides contained within a sample. A nucleotide "address," "tag," or "index" may be a random or specifically designed sequence of nucleotides. An "address", "tag" or "index" may be of any desired sequence length, as long as it is long enough to be a unique nucleotide sequence within a plurality of indices in a population and/or within a plurality of indices. polynucleotides being analyzed or interrogated. A nucleotide "address", "tag" or "index" of the description is useful, for example, for binding to a target polynucleotide for marking a particular species to identify all tagged members of the species within a population. Accordingly, an index is useful as a barcode in which different members of the same molecular species may contain the same index and in which different species within a population of different polynucleotides may have different indices.

As used herein, a "spatial address", "spatial marker" or "spatial index", when used in reference to a nucleotide sequence, means an address, marker or index that encodes spatial information related to the region or location of origin of an addressed, labeled, or indexed nucleic acid in a tissue sample.

As used herein, the term "substrate" is intended to mean a solid support. The term includes any material that can serve as a solid or semi-solid base for the creation of features, such as wells for the deposition of biopolymers, including nucleic acids, polypeptides, and/or other polymers. A substrate as provided herein is, for example, modified or may be modified to accommodate biopolymer attachment by a variety of methods well known to those of skill in the art. Examples of types of substrate materials include glass, modified glass, functionalized glass, inorganic glasses, microspheres, including inert and/or magnetic particles, plastics, polysaccharides, nylon, nitrocellulose, ceramics, resins, silica, silica-based materials, carbon, metals, an optical fiber or bundles of optical fibers, a variety of polymers other than those exemplified above, and multiwell microtiter plates. Specific types of plastic examples include acrylics, polystyrene, copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, and Teflon™. Specific types of silica-based materials examples include silicon and various forms of modified silicon.

Those skilled in the art will know or understand that the composition and geometry of a substrate, as provided herein, may vary depending on the intended use and user preferences. Therefore, although flat substrates, such as slides, chips, or wafers, are provided as an example in this document referring to microarrays for illustration, given the teachings and guidance provided herein, those skilled in the art will understand that a wide variety of other substrates exemplified herein or well known in the art may also be used. in the methods and/or compositions herein.

In some embodiments, the solid support comprises one or more surfaces of a flow cell. The term "flow cell", as used herein, refers to a chamber comprising a solid surface through which one or more fluid reactants can flow. Examples of flow cells and related fluidic systems and sensing platforms that can be readily used in the methods of the present disclosure are described, for example, in Bentley et al., Nature, 456:53-59 (2008), WO 04/018497; US 7,057,026; WO 91/06678; WO 07/123744; US 7,329,492; US 7,211,414; US 7,315,019; US 7,405,281, and US 2008/0108082.

In some embodiments, the solid support includes a patterned surface. A "patterned surface" refers to an arrangement of different regions in or on an exposed layer of a solid support. For example, one or more of the regions may be characteristic in which one or more amplification primers are present. The features may be separated by interstitial regions in which amplification primers are not present. In some embodiments, the pattern may have an x-y format of features that are in rows and columns. In some embodiments, the pattern may be a repeating arrangement of features and/or interstitial regions. In some embodiments, the pattern may be a random arrangement of features and/or interstitial regions. Examples of patterned surfaces that can be used in the methods and compositions set forth herein are described in US Serial No. 13/661,524 or US Patent Application No. publication 2012/0316086 A1.

As used herein, the term "interstitial region" refers to an area in a substrate or surface that separates other areas of the substrate or surface. For example, an interstitial region may separate one feature of an array from another feature of the array. The two regions that are spaced apart from each other may be discrete, not in contact with each other. In another example, an interstitial region may separate a first part of a feature from a second part of a feature. The separation provided by an interstitial region may be a partial or complete separation. The interstitial regions usually have a surface material that differs from the surface material of the surface features. For example, features of an array may have an amount or concentration of capture agents or primers that exceeds the amount or concentration present in the interstitial regions. In some embodiments, the capture agents or primers may not be present in the interstitial regions.

In some embodiments, the solid support includes an array of wells or depressions in one surface. This can be manufactured as is generally known in the art using a variety of techniques, including, but not limited to, photolithography, stamping techniques, casting techniques, and microengraving techniques. As those skilled in the art will appreciate, the technique used will depend on the composition and shape of the matrix substrate.

Features on a patterned surface can be wells in an array of wells (eg , microwells or nanowells) on glass, silicon, plastic, or other suitable solid supports with a covalently bonded gel pattern, such as poly(N-(5- azidoacetamidylpentyl)acrylamide-coacrylamide) (PAZAM). The process creates short gel beds used for sequencing that can be stable during sequencing runs with a high number of cycles. The covalent attachment of the polymer to the wells is useful in maintaining the gel in the structured features throughout the useful life of the structured substrate during a variety of uses. However, in many embodiments, the gel need not be covalently attached to the wells. For example, under some conditions, silane-free acrylamide (SFA, see, eg, US Patent Application Publication No. 2011/0059865 A1), which is not covalently attached to any part of the structured substrate, can be used. , like gel material.

In particular embodiments, a structured substrate can be made by patterning wells (eg, microwells or nanowells) on a solid support material, coating the patterned support with a gel material (eg, PAZAM, SFA, or modified variants). chemically thereof, such as the azidolized version of SFA (azido-SFA)) and polishing the gel-coated support, for example by chemical or mechanical polishing, thereby retaining the gel in the wells but removing or substantially inactivating the rest of the gel from the interstitial regions on the surface of the structured substrate between the wells. The primer nucleic acids can be bound to the gel material. A solution of target nucleic acids (eg, a fragmented human genome) can be contacted with the polished substrate such that individual target nucleic acids will seed individual wells via interactions with primers bound to the gel material; however, the target nucleic acids will not occupy the interstitial regions due to the absence or inactivity of the gel material. Amplification of target nucleic acids will be limited to the wells as the absence or inactivity of gel in the interstitial regions prevents outward migration of the growing nucleic acid colony. The process can be conveniently fabricated, is scalable and uses conventional micro- or nanofabrication methods.

A patterned substrate can include, for example, etched wells on a slide or chip. The pattern of the engravings and the geometry of the wells can take a variety of different shapes and sizes as long as such features are physically or functionally separable from each other. Particularly useful substrates having such structural features are patterned substrates that can select the size of the solid support particles, such as microspheres. An example of a patterned substrate having these characteristics is the etched substrate used in connection with BeadArray technology (Illumina, Inc., San Diego, CA). More examples are described in US Patent No. 6,770,441.

As used herein, the term "immobilized", when used in reference to a nucleic acid, is intended to mean directly or indirectly attached to a solid support by one or more covalent or non-covalent bonds. In certain embodiments, covalent attachment may be used, but all that is required is that the nucleic acids remain stationary or bound to a support under conditions in which the support is intended to be used, for example, in applications that require the amplification and /or nucleic acid sequencing. Oligonucleotides to be used as capture primers or amplification primers can be immobilized such that a 3' end is available for enzymatic extension and at least a portion of the sequence is capable of hybridizing to a complementary sequence. Immobilization may occur by hybridization to a surface-bound oligonucleotide, in which case the immobilized oligonucleotide or polynucleotide may be in the 3'-5' orientation. Alternatively, immobilization can occur by means other than base-pairing hybridization, such as the covalent attachment discussed above.

Certain embodiments may make use of solid supports composed of an inert substrate or matrix (eg, glass slides, polymer beads, etc.) that has been functionalized, for example, by applying a layer or coating of an intermediate material. comprising reactive groups that allow covalent attachment to biomolecules, such as polynucleotides. Examples of such supports include, but are not limited to polyacrylamide hydrogels supported on an inert substrate such as glass, particularly polyacrylamide hydrogels as described in WO 2005/065814 and US 2008/0280773. In such embodiments, the biomolecules (eg, polynucleotides) may be covalently attached directly to the intermediate material (eg, the hydrogel), but the intermediate material may itself be non-covalently attached to the substrate or matrix (eg, hydrogel). example, the glass substrate). The term "covalent attachment to a solid support" should therefore be construed as encompassing this type of arrangement.

Exemplary covalent bonds include, for example, those resulting from the use of click chemistry techniques. Examples of non-covalent bonds include, but are not limited to nonspecific interactions (eg, hydrogen bonds, ionic bonds, van der Waals interactions, etc.) or specific interactions (eg, affinity interactions, receptor-binding interactions). ligand, antibody-epitope interactions, avidin-biotin interactions, streptavidin-biotin interactions, lectin-carbohydrate interactions, etc.). Examples of linkages are noted in US Patent Nos. 6,737,236; 7,259,258; 7,375,234 and 7,427,678; and US Patent Publication No. 22011/0059865 A1.

As used herein, the term "array" refers to a population of sites that can be distinguished from each other based on relative location. Different molecules that are at different sites on an array can be distinguished from one another based on the locations of the sites on the array. An individual site on an array may include one or more molecules of a particular type. For example, a site may include a single target nucleic acid molecule having a particular sequence or a site may include multiple nucleic acid molecules having the same sequence (and/or a complementary sequence thereto). The sites of an array can be different features located on the same substrate. Examples of features include, without limitation, pits in a substrate, spheres (or other particles) in or on a substrate, projections from a substrate, ridges on a substrate, or channels in a substrate. The sites on an array can be separate substrates, each with a different molecule. Different molecules bound to separate substrates can be identified based on the locations of the substrates on a surface to which the substrates are associated or based on the locations of the substrates in a liquid or gel. Examples of arrays in which separate substrates are located on one surface include, without limitation, those that have spheres in the wells.

As used herein, the term "plurality" is intended to mean a population of two or more different members. Pluralities can range in size from small, medium, large, or very large. The size of a small plurality can vary, for example, from a few members to tens of members. Average size pluralities can range, for example, from tens of members to about 100 members or hundreds of members. Large pluralities can range, for example, from a few hundred members to about 1,000 members, thousands of members, and even tens of thousands of members. Very large pluralities can range, for example, from tens of thousands of members to around hundreds of thousands, a million, millions, tens of millions, and up to or more than hundreds of millions of members. Thus, a plurality can range in size from two to over a hundred million members, as well as all sizes, measured by number of members, between and greater than the examples in the above ranges. An example of a number of features within a microarray includes a plurality of about 500,000 or more discrete features within 1.28 cm2. Examples of pluralities of nucleic acids include, for example, populations of about 1x105, 5x105, and 1x106 or more different nucleic acid species. Accordingly, the definition of the term is intended to include all integer values greater than two. An upper limit of a plurality may be established, for example, by the theoretical diversity of nucleotide sequences in a nucleic acid sample.

As used herein, the term "nucleic acid" is intended to be consistent with its use in the art and includes naturally occurring nucleic acids or functional analogs thereof. Particularly useful functional analogs are capable of hybridizing to a nucleic acid in a sequence-specific manner or can be used as a template for replication of a particular nucleotide sequence. Naturally occurring nucleic acids generally have a backbone containing phosphodiester bonds. An analogous structure may have alternative backbone linkages, including any known in the art. Naturally occurring nucleic acids generally have a deoxyribose sugar (eg, found in deoxyribonucleic acid (DNA)) or a ribose sugar (eg, found in ribonucleic acid (RNA)). A nucleic acid may contain any of a variety of analogs of these sugar moieties that are known in the art. A nucleic acid can include native or non-native bases. In this regard, a native deoxyribonucleic acid may have one or more bases selected from the group consisting of adenine, thymine, cytosine, or guanine and a ribonucleic acid may have one or more bases selected from the group consisting of uracil, adenine, cytosine, or guanine. . Useful non-native bases that can be included in a nucleic acid are known in the art. The term "target", when used in reference to a nucleic acid, is intended as a semantic identifier for the nucleic acid in the context of a method or composition set forth herein and does not necessarily limit the structure or function of the nucleic acid beyond that. of what is explicitly stated otherwise. Particular forms of nucleic acids can include all types of nucleic acids found in an organism, as well as synthetic nucleic acids such as polynucleotides produced by chemical synthesis. Particular examples of nucleic acids that are applicable for analysis via incorporation into microarrays produced by methods such as those provided herein include genomic DNA (gDNA), expressed sequence tags (ESTs) , messenger RNA copied from DNA (cDNA), messenger RNA copied from a Rn (cRNA), mitochondrial DNA or genome, RNA, messenger RNA (mRNA), and/or other populations of RNAs. Fragments and/or portions of these exemplary nucleic acids are also included within the meaning of the term as used herein.

As used herein, the term "double-stranded", when used in reference to a nucleic acid molecule, means that substantially all of the nucleotides in the nucleic acid molecule are hydrogen bonded to a complementary nucleotide. A partially double-stranded nucleic acid may have at least 10%, 25%, 50%, 60%, 70%, 80%, 90%, or 95% of its nucleotides hydrogen-bonded to a complementary nucleotide.

As used herein, the term "single-stranded", when used in reference to a nucleic acid molecule, means that essentially none of the nucleotides in the nucleic acid molecule are hydrogen bonded to a complementary nucleotide.

As used herein, the term "capture primers" is intended to mean an oligonucleotide having a nucleotide sequence that is capable of specifically associating with a single-stranded polynucleotide sequence to be analyzed or subjected to nucleic acid interrogation under the conditions found in a primer annealing step, eg, of an amplification or sequencing reaction. The expression and terms "nucleic acid", "polynucleotide" and "oligonucleotide" are used interchangeably herein. The various terms and expressions are not intended to indicate any particular difference in size, sequence, or other property unless specifically stated otherwise. For clarity of description, the terms and expressions may be used to distinguish one nucleic acid species from another when describing a particular method or composition that includes multiple nucleic acid species.

As used herein, the term "gene-specific" or "target-specific" when used in reference to a capture probe or other nucleic acid is intended to mean a capture probe or other nucleic acid that includes a nucleotide sequence specific for a target nucleic acid, eg, a nucleic acid from a tissue sample, namely a nucleotide sequence capable of selectively associating with an identifying region of a target nucleic acid. Gene-specific capture probes may be a single oligonucleotide species or may include two or more species with different sequences. Thus, gene-specific capture probes may be two or more sequences, including 3, 4, 5, 6, 7, 8, 9, or 10 or more different sequences. Gene-specific capture probes may comprise a gene-specific capture primer sequence and a universal capture probe sequence. Other sequences, such as sequencing primer sequences and the like, can also be included in a gene-specific capture primer.

By comparison, the term "universal" when used in reference to a capture probe or other nucleic acid is intended to mean a capture probe or nucleic acid that has a common nucleotide sequence among a plurality of capture probes. A common sequence can be, for example, a complementary sequence with the same adapter sequence. Universal capture probes are applicable for interrogating a plurality of different polynucleotides without necessarily distinguishing between different species, while gene-specific capture primers are applicable for distinguishing between different species.

In various embodiments, capture elements (eg, capture primers or capture probes or other nucleic acid sequences) can be spaced apart to A) spatially resolve nucleic acids within single cell geometry, i.e., multiple sites capture per cell; B) spatially resolve nucleic acids to approximately the single cell level, ie, approximately 1 capture site per cell. In addition, the capturing elements may be spaced as in A or B above, and be: I) spaced to sampling nucleic acids from a sample at regular intervals, for example, spaced in a grid or pattern such that approximately every alternate cell or every 5th or 10th cell is sampled, or approximately every 5th or 10th group 2, 3, 4, 5, 6, 7, 8, 9, 10 or more cells are sampled; II) spaced to capture samples of substantially all available cells in one or more regions of a sample, or III) spaced to capture samples of substantially all available cells in the sample.

As used herein, the term "amplicon", when used in reference to a nucleic acid, means the product of copying the nucleic acid, wherein the product has a nucleotide sequence that is the same or complementary to at least a portion of the nucleotide sequence of the nucleic acid. An amplicon can be produced by any of a variety of amplification methods that use the nucleic acid, or an amplicon thereof, as a template, including, for example, polymerase extension, polymerase chain reaction (PCR), amplification of rolling circle (RCA), extension by coupling or chain reaction by coupling. An amplicon can be a nucleic acid molecule that has a single copy of a particular nucleotide sequence (eg, a PCR product) or multiple copies of the nucleotide sequence (eg, an RCA concatemeric product). A first amplicon of a target nucleic acid may be a complementary copy. Subsequent amplicons are copies that are created, after the generation of the first amplicon, from the target nucleic acid or the first amplicon. A subsequent amplicon may have a sequence that is substantially complementary to the target nucleic acid or substantially identical to the target nucleic acid.

The number of template copies or amplicons that can be produced can be modulated by appropriate modification of the amplification reaction including, for example, varying the number of amplification cycles executed, using polymerases of variable processivity in the amplification reaction, and/or or varying the length of time in which the amplification reaction is performed, as well as modifying other conditions known in the art that influence amplification yield. The number of copies of a nucleic acid template can be at least 1, 10, 100, 200, 500, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000 and 10,000 copies, and can be varied. depending on the particular application.

As used herein, the expression "each", when used in reference to a collection of items, is intended to identify an individual item in the collection, but does not necessarily refer to each item in the collection unless the context clearly indicates otherwise.

Arrays and methods of detection and spatial analysis (eg, mutational analysis or detection of single nucleotide variation (SNV)) of a nucleic acid in a tissue sample are provided herein. The arrays described herein may comprise a substrate on which a plurality of capture probes are immobilized such that each capture probe occupies a distinct position on the array. Some or all of the capture probes may comprise a unique positional marker (ie, a spatial address or indexing sequence). A spatial address can describe the position of the capture probe in the array. The position of the capture probe on the array can be correlated to a position in the tissue sample.

As used herein, the term "tissue sample" refers to a piece of tissue that has been obtained from a subject, fixed, sectioned, and mounted on a flat surface, eg, a microscope slide. The tissue sample may be a formalin-fixed paraffin-embedded (FFPE) tissue sample or a fresh tissue sample or a frozen tissue sample, etc. The methods described in this document can be performed before or after staining the tissue sample. For example, after hematoxylin and eosin staining, a tissue sample can be spatially analyzed according to the methods provided herein. One method may include analyzing the histology of the sample (for example, using hematoxylin and eosin staining) and then spatially analyzing the tissue.

As used herein, the term "formalin-fixed paraffin-embedded (FFPE) tissue section" refers to a piece of tissue, e.g., a biopsy that has been obtained from a subject, fixed in formaldehyde (e.g. , 3%-5% formaldehyde in phosphate buffered saline) or Bouin's solution, dipped in wax, cut into thin sections and then mounted on a flat surface, eg a microscope slide.

In some embodiments, nucleic acids from a tissue sample are transferred to and captured on a matrix. For example, a section of tissue is contacted with a matrix and the nucleic acid is captured on the matrix and marked with a spatial address. The spatially tagged DNA molecules are released from the array and analyzed, for example, by high-throughput next-generation sequencing (NGS), such as sequencing-by-synthesis. SBS). In some embodiments, a nucleic acid in a tissue section (eg, a formalin-fixed paraffin-embedded (FFPE) tissue section) is transferred to an array and captured on the array by hybridization with a capture probe. In some embodiments, a capture probe can be a universal capture probe that hybridizes, for example, to an adapter region in a nucleic acid sequencing library, or to the poly-A tail of an mRNA. In some embodiments, the capture probe can be a gene-specific capture probe that hybridizes, for example, to a specifically targeted mRNA or cDNA in a sample, such as a TruSeq™ Custom Amplicon (TSCA) oligonucleotide probe (Illumina , Inc). A capture probe can be a plurality of capture probes, eg, a plurality of the same or different capture probes.

In some embodiments, a nucleic acid in a tissue section (eg, an FFPE section) is transferred to an array and captured on the array by single-stranded coupling with a universal adapter oligonucleotide. For example, universal adapter oligonucleotides that include spatial directions can be immobilized on an array of beads. Single-stranded nucleic acid targets can be coupled to the adapters for capture. The nucleic acid may comprise cDNA or genomic DNA amplicons. Universal adapters can be used to capture gene-specific DNA cDNAs or amplicons. The orientation of the universal adapters on the array (eg, array of beads) can be controlled to capture the 3' and 5' regions of the target nucleic acids.

In some embodiments, a capture array (ie, an array of capture sites) can be integrated with an electrophoretic system.

capture site on the matrix. Electrophoretic transfer of nucleic acids can maintain spatial resolution over the tissue context by limiting the diffusion of nucleic acid molecules away from their location of origin during transfer and thus reducing loss of nucleic acids between capture sites.

In some embodiments, a combinatorial indexing (addressing) system is used to provide spatial information for analysis of nucleic acids in a tissue sample. The combinatorial indexing system may involve the use of two or more spatial address sequences (eg two, three, four, five or more spatial address sequences).

In some embodiments, two spatial address sequences are incorporated into a nucleic acid during the preparation of a sequencing library. A first spatial address can be used to define a certain position (i.e., a capture site) in the X dimension on a capture matrix and a second spatial address sequence can be used to define a position (i.e., a capture site) capture) in the Y dimension over the capture matrix. During library sequencing, the X and Y spatial address sequences can be determined and the sequence information can be analyzed to define the specific position on the capture array.

In some embodiments, three spatial address sequences are incorporated into a nucleic acid during the preparation of a sequencing library. A first spatial address can be used to define a certain position (i.e. a capture site) in the X dimension over a capture matrix, a second spatial address sequence can be used to define a position (i.e. a site capture) in the Y dimension over the capture matrix, and a third spatial address sequence can be used to define a position of a two-dimensional sample section (for example, the position of a slice of a tissue sample) in a sample (for example, a tissue biopsy) to provide positional spatial information in the third dimension (Z dimension) of a sample. During library sequencing, the X, Y, and Z spatial address sequences can be determined and the sequence information can be analyzed to define the specific position in the capture array.

In some embodiments, a temporary address sequence (T) is optionally incorporated into a nucleic acid during preparation of a sequencing library. In some embodiments, the temporal address sequence may be combined with two or three spatial address sequences. The temporal targeting sequence can be used, for example, in the context of a developmental experiment over time to determine time-dependent changes in gene expression in a tissue sample. Time-dependent changes in gene expression can appear in a tissue sample, for example, in response to a chemical, biological, or physical stimulus (eg, a toxin, drug, or heat). Nucleic acid samples obtained at different times from comparable tissue samples (eg, proximal sections of a tissue sample) can be pooled and mass sequenced. An optional first spatial address sequence can be used to define a certain position (i.e., a capture site) in the X dimension in a capture matrix, an optional second spatial address sequence can be used to define a position (i.e., a capture site) in the Y dimension in the capture matrix and an optional third spatial address sequence can be used to define a position of a two-dimensional sample section (for example, the position of a slice of a tissue sample) in a sample (eg, a tissue biopsy) to provide positional spatial information in the third dimension (Z dimension) of the sample. During library sequencing, the T, X, Y, and Z address sequences are determined and the sequence information is analyzed to define the specific X, Y (and optionally Z) position on the capture matrix for each time point ( T).

The X, Y, and optionally Z and/or T address sequences may be consecutive nucleic acid sequences or the address sequences may be separated by one or more nucleic acids (eg, 2 or more, 3 or more, 10 or more, 30 or more, 100 or more, 300 or more, or 1,000 or more). In some embodiments, the X, Y, and optionally Z and/or T address sequences may each individually and independently be combinatorial nucleic acid sequences.

In some embodiments, the length of the address sequences (eg, X, Y, Z, or T) may individually and independently be 100 or fewer nucleic acids, 90 or fewer nucleic acids, 80 or fewer nucleic acids, 70 or fewer nucleic acids. less, 60 nucleic acids or less, 50 nucleic acids or less, 40 nucleic acids or less, 30 nucleic acids or less, 20 nucleic acids or less, 15 nucleic acids or less, 10 nucleic acids or less, 8 nucleic acids or less, 6 nucleic acids or less, or 4 nucleic acids or less. The length of two or more address sequences in a nucleic acid may be the same or different. For example, if the length of the address sequence X is 10 nucleic acids, the length of address sequence Y may be, for example, 8 nucleic acids, 10 nucleic acids or 12 nucleic acids.

Address sequences, eg, spatial address sequences such as X or Y, may be partially or fully degenerate sequences.

In some embodiments, spatially targeted capture probes on an array can be delivered from the array to a tissue section for generation of a spatially targeted sequencing library. In some embodiments, a capture probe comprises a random primer sequence for in situ synthesis of spatially labeled cDNA from RNA in the tissue section. In some embodiments, a capture probe is a TruSeq™ Custom Amplicon (TSCA) oligonucleotide probe (Illumina, Inc.) for capturing and spatially labeling genomic DNA in the tissue section. Spatially labeled nucleic acid molecules (eg, cDNA or genomic DNA) are recovered from the tissue section and processed in one-tube reactions to generate a spatially labeled amplicon library.

In some embodiments, magnetic nanoparticles can be used to capture nucleic acid (eg, cDNA synthesized in situ) in a tissue sample for generation of a spatially targeted library.

In some embodiments, spatial detection and analysis of nucleic acid in a tissue sample can be performed with a droplet driver.

4.1 Matrix generation

In one aspect, capture arrays comprising spatially encoded capture probes are provided herein. The spatially encoded capture probes on the capture probes can be immobilized, for example, on a flat glass substrate or on a plurality of spheres.

Figure 1A illustrates a plan view of an exemplary embodiment of a capture array 100 for capturing a nucleic acid in a tissue sample. Capture matrix 100 comprises an array (eg, rows and columns) of capture sites 105 on solid support 110. In some embodiments, solid support 110 is a flat glass substrate. In some embodiments, solid support 110 is a sphere (eg, see Figure 1C). At least one capture probe 115 is immobilized to each of the capture sites 105 of the capture array 100, as shown in Figure 1B. That is, Figure 1B illustrates a side view of a capture site 105 of the capture array 100, wherein the single capture site 105 comprises at least one capture probe 115 for capturing a nucleic acid in a sample. of tissue. Figure 1B shows a capture probe 115 immobilized on the surface of solid support 110. In this embodiment, a single capture probe 115 is shown, but any number of capture probes 115 can be immobilized on solid support 110 at each site of capture. capture 105. The capture probe 115 may optionally comprise a cleavable sequence in a cleavable region 120, an SBS primer sequence in an SBS primer binding site 125, a spatial address sequence in a spatial address region 130 and a capture sequence in a capture region 135. A cleavable region 120 may be used to release the captured nucleic acid from the capture matrix 100 such that the spatial address region 130 is included in the released nucleic acid and the nucleic acid is "marked". The SBS primer region 125 can comprise an SBS primer sequence (eg, SBS12 or SBS3) that can be used in a sequencing-by-synthesis (SBS) process. Alternatively, the SBS 125 primer sequence or some portion thereof may be added later, for example, by ligation or by PCR synthesis. The SBS primer region 125 can also be used in an amplification reaction to generate a sequencing library as described in more detail with reference to Figure 12 and Figure 13. The spatial address region 130 corresponds to the position of capture probe 115 in capture array 100. Each capture probe 115 at a capture site 105 comprises a unique spatial address region 130. The position of capture probe 115 in capture array 100 can be correlated with a position in the tissue sample.

Capture region 135 may be, for example, a universal (general) capture region. In some embodiments, capture region 135 comprises a poly-T oligonucleotide that can be used to capture total mRNA in a tissue sample as described in more detail with reference to Figure 3. In some embodiments, capture region 135 is a universal capture region that can be used to capture cDNAs synthesized by in situ reverse transcription of RNA as described in more detail with reference to Figure 6. In some embodiments, capture region 135 is a universal capture region that is can be used to capture amplicons from genomic DNA as described in more detail with reference to Figure 9 and Figure 10.

In some embodiments, capture region 135 is a gene- or target-specific capture region that can be used to capture a specific nucleic acid in a tissue sample. Each capture probe 115 in capture array 100 may comprise one or more unique gene-specific capture regions 135. U.S. Patent Publication Publication No. 2015148239, filed September 22, 2014, Peter et al. describe cleavable PCR primers in which each probe includes multiple cleavable primers, and which can be used in this and other embodiments described herein. Different capture probes 115 in capture array 110 may have the same gene-specific capture region or may be different gene-specific capture regions. In some embodiments, the nucleic acid in the tissue sample is a Gene-specific mRNA as described in more detail with reference to Figure 4 . In some embodiments, the nucleic acid in the tissue sample is a gene-specific cDNA synthesized by in situ reverse transcription of RNA as described in more detail with Refer to Figure 7. In some embodiments (not shown), capture region 135 is a gene-specific region that can be used to capture amplicons from genomic DNA.

The probes can be contacted with tissue by placing the tissue directly on the surface comprising the probes; placing the tissue over a substance, such as a filter or a gel or a thin layer of buffer, separating the tissue from the probes so that target nucleic acids can diffuse from the tissue, through the substance, to the probes; placing the tissue on a substance such as a filter or a gel or a fine buffer layer that separates the tissue from the probes so that the probes can diffuse from the surface comprising the probes, through the substance to the targets; extracting the targets from the tissue onto an intermediate substrate (eg, a gel, filter, solid substrate, or combinations of the foregoing), which is then placed on the probe-bearing surface; and combinations of the above. In each case, the technique is selected to substantially maintain the information encoding the spatial orientation of the targets in the sample.

Figure 1C illustrates a side view of one embodiment of a universal capture sphere 150 for capturing a nucleic acid in a tissue sample. In some embodiments, there is a universal capture bead 150 at each of the capture sites 105 of the capture array 100. For example, the universal capture beads 150 may be deposited in wells on a solid support 110 (eg, a solid support). glass substrate). Universal capture bead 150 comprises bead 155. A universal adapter oligonucleotide 160 is immobilized on the surface of bead 155. Universal adapter oligonucleotide 160 is essentially the same as capture probe 115 of Figure 1B except that the capture region 135, i.e., universal adapter oligonucleotide 160 comprises only the cleavable region 120, the SBS primer region 125, and the spatial address region 130. The SBS primer region 125 may comprise, for example, a SBS12 sequence or an SBS3 sequence. In this embodiment, a single universal adapter oligonucleotide 160 is shown, but any number of universal adapter oligonucleotides 160 can be immobilized on bead 155. Universal capture bead 150 can be used to capture a nucleic acid in a tissue sample by coupling single strand of a target nucleic acid (eg, cDNA or genomic DNA amplicons) to the universal adapter oligonucleotide 160 as described in more detail with reference to Figures 12 to 15.

A gene-specific capture array, such as an array of beads with a plurality of gene-specific capture probes on each bead, can be produced using a docking-based approach. For example, an array of spheres can be designed to have 1 million spatial directions on a sphere. The array can be designed to capture nucleic acid from 1000 genes. To capture the nucleic acid of 1,000 genes on a sphere designed to have 1 million spatial directions, one billion capture probes would be required (ie, 1,000 genes x 1 million spatial directions = 1 billion capture oligonucleotides). To avoid the synthesis of a billion capture probes, a set of oligonucleotides representing gene-specific capture regions (e.g., capture region 135) can be docked onto capture probes with spatial directions that comprise the cleavage region 120 , SBS primer region 125, and spatial address region 130 (eg, oligonucleotides representing 1,000 gene-specific capture regions 1 million spatial address regions = 1.1 million capture probes). In some embodiments, the set of gene-specific capture regions is coupled to the spatially directional capture probes using an enzymatic docking strategy. In some embodiments, the set of gene-specific capture regions is coupled to the spatially directional capture probes using a chemical docking strategy.

A coupling-based strategy can also be used to produce a plurality of spatial directions for an array of spheres. The current strategy for producing an array of spatially directional spheres requires the synthesis of each oligonucleotide independently for each distinct spatial direction (eg, 1 million spatial directions requires the synthesis of 1 million oligonucleotides). To avoid the synthesis of 1 million oligonucleotides, a combinatorial strategy can be used. For example, three distinct subsets of oligonucleotides with unique sequences (eg, subset A with 100 unique sequences, subset B with 100 unique sequences, and subset C with 100 unique sequences) are synthesized and used in a combinatorial coupling reaction, e.g. , 100 subset A x 100 subset B x 100 subset C = 1 million oligonucleotides with different spatial directions. The combinatorial strategy requires the synthesis of only 300 different oligonucleotides.

In some embodiments, a hybridization and extension strategy can be used to produce spatially targeted gene-specific capture probes. For example, a set "X" of 1,000 oligonucleotides with unique spatial addresses is synthesized. A second "Y" pool of 1000 oligonucleotides is synthesized that individually captures a unique gene and can be annealed to form "X" pool oligonucleotides. Each individual oligonucleotide of the "Y" pool oligonucleotides is annealed to "X" pool oligonucleotides and an extension reaction is performed. With this strategy, the synthesis of 2000 oligonucleotides is required to generate 1 million different capture probes (1000 unique spatial address sequences individually paired with 1000 different gene-specific capture sequences). Using general oligonucleotide synthesis, the production of 1,000 gene-specific capture probes, each with 1,000 different spatial directions, would require the synthesis of 1 million oligonucleotides (1,000 genes x 1,000 directions).

The beads comprising the probes can be contacted with tissue by placing the tissue directly on the surface comprising the beads; placing the tissue over a substance, such as a filter or a gel or a thin layer of buffer, separating the tissue from the beads so that target nucleic acids can diffuse from the tissue, through the substance to the probes; placing the tissue on a substance such as a filter or a gel or a thin layer of buffer that separates the tissue from the probes so that the probes can diffuse from the beads, through the substance to the targets; extracting the targets from the tissue onto an intermediate substrate (eg, a gel, filter, solid substrate, or combinations of the foregoing), which is then placed on the bead-bearing surface; depositing the spheres directly on the fabric; and combinations of the above. In each case, the technique is selected to substantially maintain the information encoding the spatial orientation of the targets in the sample.

4.2 Spatial detection and analysis of nucleic acid in a tissue sample

In another aspect, a method for the spatial detection and analysis of nucleic acids in a sample is provided herein.

Figure 2 illustrates a flow chart of one embodiment of a method 200 for spatial detection and analysis of a nucleic acid in a tissue sample. Method 200 may include, but is not limited to, some or all of the following steps.

In a step 210, a tissue sample is prepared for analysis. In some embodiments, the tissue sample is an FFPE tissue sample that is sectioned onto a slide. Other examples include fresh tissue, frozen tissue, etc.

In a step 215, in situ biochemistry is performed on the tissue section to facilitate subsequent manipulation of a nucleic acid in the sample. In some embodiments, an in situ reverse transcription reaction is used to synthesize cDNA from target mRNA in the tissue sample. In some embodiments, an in situ amplification reaction can be used to produce multiple genomic DNA amplicons from target genes in the tissue sample. In some embodiments, there is no in situ biochemistry step, and cDNA synthesis is performed after RNA capture or extraction from tissue.

In a step 220, the target nucleic acid in the tissue section is transferred to an array such that the position of a nucleic acid on the array can be correlated to a position in the tissue section. In some embodiments, the target nucleic acid comprises an mRNA. In some embodiments, the target nucleic acid comprises a cDNA synthesized in situ. In some embodiments, the nucleic acid comprises genomic DNA amplicons generated by in situ amplification. In some embodiments, the array is an array of capture sites, such as capture sites 105 of capture array 100 shown in Figure 1A and Figure 1B. In some embodiments, the array is an array of beads (eg, universal capture beads 150 of Figure 1C) that include a plurality of capture probes. Other examples of an array include an array of wells or pores or projections or a sequencing flow cell that includes a plurality of capture probes. The nucleic acid can be captured on the array, for example, by hybridizing the nucleic acid with the capture probes on the array. In some embodiments, the nucleic acid can be captured on the matrix by single-stranded coupling of the nucleic acid onto universal adapter oligonucleotides.

In this and other embodiments described herein, the probes can be contacted with the target nucleic acid by placing the tissue directly on the surface comprising the probes; placing the tissue on a substance such as a filter or a gel or a thin layer of buffer that separates the tissue from the probes so that the target nucleic acid can diffuse from the tissue, through the substance to the probes; placing the tissue on a substance, such as a filter or a gel or a thin layer of buffer that separates the tissue from the probes so that the probes can diffuse from the surface comprising the probes, through the substance to the acid target nucleic; extracting the target nucleic acid from the tissue onto an intermediate substrate (eg, a gel, filter, solid substrate, or combinations of the foregoing), which is then placed on the probe-bearing surface; and combinations of the above. In each case, the technique is selected to substantially maintain the information encoding the spatial orientation of the targets in the sample.

At step 225, a sequencing library is prepared. In some embodiments, the sequencing library is prepared for sequencing by synthesis. Library preparation can be achieved on the capture array substrate, or nucleic acids can be cleaved from the substrate and pooled so that library preparation can be achieved separately, for example, using a NeoPrep™ library preparation (Illumina, Inc., San Diego).

In a step 230, the library is sequenced. Sequencing can be accomplished using any sequencing technique. Examples of suitable sequencers include those available from, or being developed by, Illumina, Inc., F. Hoffmann-La Roche AG, Life Technologies, Inc., Beckman Coulter, Inc., Pacific Biosciences, Inc., Oxford Nanopore, Inc. and/or its affiliates.

In a step 235, the sequence data (eg, mutations and/or variant calls) is analyzed and the spatial information is decoded. The spatial information can be used to provide information about the location of the nucleic acid in the tissue section.

(a) Hybridization-based nucleic acid capture

In some embodiments, hybridization-based capture is used to capture target nucleic acids in a tissue sample onto capture probes in an array. The array can be, for example, an array of spheres or wells or pores or projections, a flat surface, or a sequencing flow cell that includes a plurality of capture probes. In one example, the tissue sample is contacted with capture probes that are affixed to the surface of the array. The tissue sample can be placed directly on the surface comprising the capture probes or the tissue sample can be placed on a substance such as a filter or a gel or a thin layer of buffer that separates the tissue sample from the capture probes. so that the target nucleic acid can diffuse from the tissue through the substance to the capture probes.

In another example, the tissue sample is contacted with the array and the capture probes on the array are released into the tissue sample for hybridization with the nucleic acids in the tissue sample. The tissue sample can be placed directly on the surface comprising the capture probes or the tissue sample can be placed on a substance such as a filter or a gel or a thin layer of buffer that separates the tissue sample from the capture probes. so that the released capture probes can diffuse from the matrix through the substance to the nucleic acid in the tissue sample. Capture probes can be attached to the matrix using a releasable group or a selectively cleavable moiety or linker. Capture probes can be released from the matrix using, for example, chemical cleavage, enzymatic cleavage, or photocleavage. In another example, capture probes can be printed onto the surface of the array and dried. Capture probes can be released from the matrix by rehydration. In yet another example, capture probes can be printed onto the array using a substance that dissolves in the presence of a certain treatment. Treatment is then applied to release the capture probes before the tissue sample is placed on the array.

In some embodiments, the nucleic acid is total mRNA. In some embodiments, the nucleic acid is gene-specific mRNA.

Figure 3 illustrates a side view of another embodiment of a capture site 105 of the capture array 100 of Figure 1A and shows one embodiment of a total mRNA capture process in a tissue sample on the array. In this embodiment, capture probe 115 comprises a poly-T capture region 310. A nucleic acid sample, such as a tissue sample, or substrate comprising nucleic acid targets derived from a tissue sample (not shown). ), which includes a plurality of 315 mRNA molecules, contacts the 105 capture site. The 315 mRNA molecule comprises a 320 poly-A tail. A 325 mutation may be present in the 315 mRNA molecule. mutation 325 can be, for example, a single nucleotide polymorphism ("single nucleotide polymorphism", SNP). The 315 mRNA molecule is captured onto the 115 capture probe by hybridizing the poly-A 320 tail to the poly-T 310 capture region. The poly-T 310 capture region can also act as a primer. reverse transcriptase for first-strand cDNA synthesis of the captured mRNA molecule 315 (indicated by a dashed arrow).

In this example, the tissue sample is brought into contact with a capture probe 115 which binds to the surface of the capture site 105. The mRNA molecule 315 is captured on the matrix by hybridization to the poly-capture sequence. T 310. In another example (not shown), the tissue sample is contacted with the matrix and the capture probe 115 is released from the capture site 105 into the tissue sample by cleavage of the optional cleavable sequence 120.

In some embodiments (not shown), capture region 310 is a random oligonucleotide ("randomer") capture region that can be used to capture a random set of RNA molecules. The random oligonucleotide capture region may, for example, comprise a random sequence with reduced complexity such that capture of ribosomal RNA in the tissue sample is substantially reduced.

Figure 4 illustrates a side view of some embodiments of a capture site 105 of the capture array 100 of Figure 1A and shows one embodiment of a process for capturing individually targeted (i.e., gene-specific) mRNA in a sample. of tissue on the matrix. In this embodiment, two capture probes 115 are shown, ie, capture probe 115a and 115b. Capture probe 115a comprises a gene-specific capture region 410a. Similarly, capture probe 115b comprises a different gene-specific capture region 410b. A nucleic acid sample, such as a tissue sample or substrate comprising nucleic acid targets derived from a tissue sample (not shown), comprising a plurality of different mRNA molecules 415, is contacted with the site capture 105. In this embodiment, a first mRNA molecule 415a is the transcript of a first gene and a second mRNA molecule 415b is the transcript of a second gene. The 415a mRNA molecule may include a 420a mutation. The 415b mRNA molecule may include a 420b mutation. Mutations 420 can be, for example, SNPs. The 415a mRNA molecule is captured onto the 115a capture probe by hybridization of complementary mRNA sequences to the 410a gene-specific capture region. Similarly, the 415b mRNA molecule is captured onto the 115b capture probe by hybridization of a complementary mRNA molecule to the 410b gene-specific capture region. The 410 gene-specific capture region can also act as a reverse transcriptase primer for the synthesis of first-strand cDNA from the captured 415 mRNA molecule.

In this example, the tissue sample is brought into contact with the 115 capture probes which are affixed to the surface of the 105 capture site. The 415 mRNA molecules are captured onto the array by hybridization with 410 gene-specific capture sequences. In another example (not shown), the tissue sample is contacted with the matrix and the capture probes 115 are released from the capture site 105 into the tissue sample by cleavage of the optional cleavable sequence 120.

In some embodiments, hybridization-based capture is used to capture cDNA generated by in situ reverse transcription of RNA in a tissue sample onto an array.

Figure 5 illustrates a flow diagram of one embodiment of a method 500 for generating cDNA by in situ reverse transcription of RNA into a tissue sample for capture onto an array (eg, capture array 100 of Figure 1A ). Method 500 comprises, but is not limited to some or all of the following steps.

At step 510, the gene-specific cDNA is synthesized from the target mRNA in a tissue sample by reverse transcription in situ. For example, an oligonucleotide sequence comprising a gene-specific first primer and a universal capture sequence can be used to prime first-strand cDNA synthesis.

In an optional step 515, the cDNA is amplified in the tissue sample by isothermal in situ amplification. For example, an oligonucleotide sequence comprising a second gene-specific primer and an SBS primer sequence, eg, SBS12, can be used for isothermal amplification.

In a step 520, the amplified cDNA is captured onto an array. The cDNA is captured on the array by hybridizing the cDNA to capture probes on the array. In some embodiments, the capture probes include a universal capture sequence and can be used to capture cDNA synthesized using a gene-specific primer comprising a complementary capture sequence as described in more detail with reference to Figure 6. In some embodiments, In embodiments, the capture probes include gene-specific capture sequences and can be used to capture cDNA synthesized using a set of gene-specific primers or random primers that include an SBS primer sequence as described in more detail with reference to figure 7.

Figure 6 illustrates one embodiment of the steps of a method 500 of Figure 5. In this embodiment, an in situ isothermal amplification step (ie, optional step 515) is used prior to transfer of DNA to an array. Specifically, a section of tissue (not shown) comprises a 610 target mRNA molecule. The 610 target mRNA molecule may include a 615 mutation. At step 510, the 610 target mRNA molecule is reverse transcribed in situ using a reverse transcription (RT) primer 620. The RT primer 620 comprises a first gene-specific primer region 625 and a universal capture region 630. The RT primer 620 may also include a unique molecular identifier region. molecular identifier”, UMI) (not shown). A cDNA molecule 635 synthesized using RT primer 620 comprises universal capture region 630. At step 515, cDNA molecule 635 is amplified by in situ isothermal amplification using an amplification primer 640. The amplification primer 640 comprises a second 645 gene-specific primer region and an SBS 650 sequencing primer region comprising, for example, an SBS12 sequence. A 655 DNA molecule generated using the 640 amplification primer comprises the 630 universal capture region and the 650 SBS sequencing primer. At step 520, the 655 DNA molecule is captured over the 105 capture site. For example, the tissue sample containing the 655 DNA molecule or a substrate comprising DNA 655 molecule derived from the tissue sample (not shown) contacts the capture site 105. In some embodiments, the capture probe 115 above capture site 105 comprises a capture region 660 that is complementary to universal capture region 630; the SBS 130 sequencing primer is SBS3. The 655 DNA molecule is captured on the 105 capture site by hybridization of the 630 universal capture region with the 660 capture region.

In this example, both capture region 660 and universal capture region 630 can also act as primers for an extension reaction. When the 660 capture region is used as a primer, the 615 mutation in the 655 DNA molecule is copied. When the 630 universal capture region is used as a primer, the 130 spatial address region and the SBS primer region are copied. 125. Both extension products can be used for downstream library generation.

In this example, the tissue sample is brought into contact with the capture probe 115 which is fixed on the surface of the capture site 105. The DNA molecule 655 is captured on the matrix by hybridizing the universal capture region 630 with the 660 capture region. In another example (not shown), the tissue sample is contacted with the matrix and the 115 capture probes are released from the 105 capture site into the tissue sample by sequence cleavage optional breakaway 120.

Figure 7 illustrates one embodiment of the steps of a method 500 of Figure 5. In this embodiment, a gene-specific capture probe is used to capture a specific cDNA and the optional isothermal amplification step 515 of Figure 5 is omitted. That is, a tissue section (not shown) comprises the 610 target mRNA molecule. The 610 target mRNA molecule may include the 615 mutation. At step 510, the 610 target mRNA molecule is reverse transcribed in situ using an RT 710 primer. The RT 710 primer comprises a 625 gene-specific primer region and an SBS 720 primer region, eg, SBS3. RT 710 primer can also include a UMI sequence (not shown). A cDNA molecule 725 synthesized using the RT primer 710 comprises the SBS primer region 720. At step 520, the cDNA molecule 725 is captured over the capture site 105. For example, the tissue sample containing the DNA molecule 725 or a substrate comprising DNA molecule 725 derived from the tissue sample (not shown) is brought into contact with the capture site 105. In this embodiment, the capture probe 115 on the capture site 105 comprises a gene-specific capture region 730 that is complementary to a sequence at the 3' end of the cDNA molecule 725; the primer region of SBS 125 is SBS12. The 725 cDNA molecule is captured on the 105 capture site by hybridization of the 730 capture region with complementary sequences at the 3' end of the 725 cDNA molecule.

In some embodiments, hybridization-based capture can be used to transfer amplicons generated by in situ amplification of genomic DNA in a tissue sample to an array. In some embodiments, genomic DNA amplicons are generated using a "TSCA-like" amplification strategy. In some embodiments, genomic DNA amplicons are generated using a DNA-lock strategy.

Figure 8 illustrates a flow chart of one embodiment of a DNA amplicon capture method 800 on an array (eg, capture array 100 of Figure 1A), in which DNA amplicons are generated by amplification. in situ of the target nucleic acid. In this embodiment, the amplification reaction is a TSCA-like amplification ("T ruSeq Custom Amplicon assembly", Illumina T ruSeq custom amplicon assembly). Method 800 comprises, but is not limited to some or all of the following steps.

In a step 810, a pair of gene-specific capture oligonucleotides flanking a region of interest are hybridized in situ with genomic DNA. For example, a first capture oligonucleotide that hybridizes 5' to a region of interest may comprise a gene-specific sequence and a universal capture sequence. A second capture oligonucleotide that hybridizes 3' to the region of interest may comprise a second gene-specific sequence and an SBS primer sequence (eg, SBS12).

In a step 815, an in situ docking/extension reaction is performed between the flanking capture oligonucleotides through the region of interest.

At step 820, the DNA flanked by capture oligonucleotides is amplified by isothermal in situ amplification to generate multiple copies of the region of interest, ie, multiple genomic amplicons. Isothermal amplification can be performed, for example, using primer sequences that are complementary to the universal capture sequence and the SBS primer sequence.

In a step 825, the genomic amplicons are transferred to an array and captured by hybridization to universal capture regions on the array.

Figure 9 illustrates one embodiment of the steps of a method 800 of Figure 8. Specifically, a tissue section (not shown) comprises a target genomic DNA molecule 910. The target DNA molecule 910 may include a mutation 915. At step 810, a first gene-specific capture oligonucleotide 920 and a second gene-specific capture oligonucleotide 925 flanking a region of interest are annealed in situ to DNA molecule 910. Capture oligonucleotide 920 comprises a region of gene specific 930 and a universal capture region 935. The capture oligonucleotide 920 may also comprise a UMI region (not shown). Capture oligonucleotide 925 comprises a second gene-specific region 940 and an SBS primer region 945 (eg, SBS12). At step 815, an in situ docking/extension reaction is performed between the flanking capture oligonucleotides 920 and 925 through the region of interest. A DNA molecule 950 that is formed in the extension/docking reaction comprises the universal capture region 935 and the SBS primer region 945. In step 820, the DNA molecule 950 is amplified by in situ isothermal amplification to generate multiple copies (multiple amplicons) of the target region of interest. Isothermal amplification can be performed, for example, using a 935a primer region that is complementary to the 935 universal capture region and a 945a primer region that is complementary to the 945 SBS primer region. 950 genomic amplicons are captured onto the capture site 105. For example, the tissue sample containing the 950 genomic amplicons or a substrate comprising 950 genomic amplicons derived from the tissue sample (not shown) is contacted with the 950 genomic amplicons. capture site 105. In this example, capture probe 115 on capture site 105 comprises a capture region 960 that is complementary to universal capture region 935; the SBS 130 primer region is SBS3. The 950 DNA amplicons are captured onto the 105 capture site by hybridization of the 935 universal capture region with the 960 capture region.

In this example, the tissue sample is brought into contact with the capture probe 115 which is affixed to the surface of the capture site 105. The 950 genomic amplicon is captured onto the array by hybridizing the 935 universal capture sequence with capture sequence 960. In another example (not shown), the tissue sample is contacted with the matrix and capture probes 115 are released from the capture site 105 into the tissue sample by cleavage of the sequence optional breakaway 120.

Figure 10 illustrates a flow diagram of embodiments of a DNA amplicon capture method 1000 in an array (eg, capture array 100 of Figure 1A), in which the DNA amplicons are generated by in situ amplification. of target nucleic acid. In some embodiment, the amplification reaction may be a DNA padlock amplification. Method 1000 may comprise, but is not limited to some or all of the following steps.

In a step 1010, a padlock capture probe is hybridized in situ with genomic DNA. For example, the padlock capture probe may comprise a first gene-specific sequence and an SBS primer sequence that are linked by a linker sequence to a universal capture sequence and a second gene-specific sequence. The first gene-specific sequence and the second gene-specific sequence flank a target region of interest in the genomic DNA.

At step 1015, an in situ docking/extension reaction is performed between the flanking gene-specific sequences in the lock capture probe through the target region to generate a circular molecule.

In a step 1020, the DNA flanked by the padlock capture probe is amplified by rolling circle in situ amplification to generate a concatamer of target amplicons. Rolling circle amplification can be performed, for example, using a primer sequence that is complementary to the SBS primer sequence in the padlock capture probe.

In a step 1025, the target amplicon concatamers are captured onto an array comprising a universal capture sequence.

Figure 11 illustrates the steps of a method 1000 of Figure 10. Specifically, a tissue section (not shown) comprises a target genomic DNA molecule 1110. The target DNA molecule 1110 may include a mutation 1115. In step 1010, a lock capture probe 1120 is hybridized in situ to the 1110 DNA molecule. The lock capture probe 1120 may comprise a first gene-specific region 1125 and an SBS primer region 1130 (eg, SBS12) which can bind via a linker region 1135 with a universal capture region 1140 and a second gene-specific region 1145. The lock capture probe 1120 may also include a unique molecular identifier (UMI) region (not shown). ), to facilitate the correction of sequencing errors. The first gene-specific region 1125 and the second gene-specific region 1145 flank a target region of interest on the DNA molecule 1110. In a step 1015, an in situ docking/extension reaction is performed between the first gene-specific region framework 1125 and the second gene-specific region 1145 across the target region of interest to form a circular 1150 molecule. In some embodiments, CircLigase™ (Epicenter, Illumina) can be used to ligate the circular 1150 molecule prior to amplification. At step 1020, the circular molecule 1150 is amplified by rolling circle in situ amplification to generate a concatamer 1155 comprising multiple copies of the circular molecule 1150. The rolling circle amplification is performed using a primer sequence (not shown) which is complementary to the SBS 1130 primer region on the 1150 circular molecule. At step 1025, the 1155 concatamer is captured onto the 105 capture site comprising the 120 cleavable region, the SBS 125 sequencing primer region (e.g. , SBS3), spatial address region 130, and capture region 135 (eg, a universal capture sequence). For example, tissue sample containing the 1155 concatamer or a substrate comprising 1155 concatamer derived from the tissue sample (not shown) is contacted with the 105 capture site. In some embodiments, the 115 capture probes above capture site 105 comprise a capture region 1160 that is complementary to universal capture region 1140; the SBS primer region comprises an SBS3 sequence. The 1155 concatamer is captured onto the 105 capture site by hybridizing the universal 1140 capture regions to capture 1160 regions.

In this example, the tissue sample is contacted with the 115 capture probe which binds to the surface of the 105 capture site. The 1155 concatamer is captured on the array by hybridizing to the 1140 universal capture sequences to capture the 1160 sequence. In another example (not shown), the tissue sample is contacted with the matrix and the 115 capture probes are released from the 105 capture site into the tissue sample by cleavage of the optional cleavable sequence 120.

(B) Docking-based nucleic acid capture

In some embodiments, docking-based capture is used to capture target nucleic acids on a tissue sample onto capture probes in an array. The array can be, for example, an array of spheres or wells or pores or projections, a flat surface, or a sequencing flow cell that includes a plurality of capture probes. In one example, the tissue sample is contacted with capture probes that are affixed to the surface of the array. The tissue sample may be placed directly on the surface comprising the capture probes, or the tissue sample may be placed on a substance, such as a filter or a gel or a thin layer of buffer, that separates the tissue sample from the probes. such that the target nucleic acid can diffuse from the tissue through the substance to the capture probes.

In another example, the tissue sample is contacted with the matrix and the capture probes on the matrix are released into the tissue sample for hybridization with the nucleic acids in the tissue sample. The tissue sample can be placed directly on the surface comprising the capture probes or the tissue sample can be placed on a substance such as a filter or a gel or a thin layer of buffer that separates the tissue sample from the capture probes. so that the released capture probes can diffuse from the array through the substance to nucleic acid in the tissue sample. Capture probes can be attached to the matrix using a releasable group or a selectively cleavable linker or moiety. Capture probes can be released from the matrix using, for example, chemical cleavage, enzymatic cleavage, or photocleavage. In another example, capture probes can be printed onto the surface of the array and dried. Capture probes can be released from the matrix by rehydration. In yet another example, capture probes can be printed onto the array using a substance that dissolves in the presence of a certain treatment. Treatment is then applied to release the capture probes before the tissue sample is placed on the array.

In one example, the nucleic acid is cDNA synthesized by in situ reverse transcription of RNA in a tissue sample. In another example, nucleic acids are DNA amplicons generated by in situ amplification of genomic DNA in a tissue sample.

Figure 12 illustrates a flow diagram of one embodiment of a method 1200 of capturing cDNA onto an array (for example, the capture array 100 of Figure 1A) by single-stranded ligation, in which the cDNA is generated by reverse transcription. in situ of target RNA molecules. Method 1200 comprises, but is not limited to some or all of the following steps.

At step 1210, the cDNA is synthesized in situ using gene-specific primers. For example, a gene-specific reverse transcription (RT) primer comprising a first gene-specific primer region and a unique molecular identifier (UMI) region can be used to prime first-strand cDNA synthesis. The cDNA can be modified at the 5' or 3' end to prevent self-coupling. In some embodiments, a modification to prevent self-coupling of the cDNA may be pre-incorporated into the UMI sequence prior to in situ cDNA synthesis. In some embodiments, a modification, such as the addition of an oligonucleotide "tail" region, may be added after cDNA synthesis to prevent self-coupling of the cDNA.

At step 1215, the cDNA is transferred to a bead array and captured by coupling the cDNA to universal adapter oligonucleotides on the bead array. Universal adapter oligonucleotides can include a cleavable region, an SBS primer sequence (eg, SBS3), and a spatial address as described with reference to Figure 1A and Figure 1C.

At step 1220, the cDNA is cleaved from the bead array.

At step 1225, the second-strand cDNA is synthesized using gene-specific primers. Gene-specific primers can include, for example, a gene-specific sequence and an SBS sequencing primer sequence (eg, SBS12).

In a step 1230, the cDNA is amplified using a pair of SBS primers to generate a sequencing library. For example, a first SBS primer may comprise sequences complementary to SBS12 and P7 sequences. A second SBS primer may comprise sequences complementary to SBS3 and P5 sequences. The resulting library amplicons may be flanked at the 5' end by P7 sequence and SBS primer sequences and by UMI, a spatial address, an SBS sequencing primer, and P5 sequences at the 3' end. The P7 and P5 sequences can be used to bind DNA amplicons to the surface of a flow cell for subsequent amplification and cluster sequencing.

At step 1235, the library is sequenced.

Figures 13A and 13B illustrate the steps of a method 1200 of Figure 12. In some embodiments, cDNA synthesized in situ may be captured onto a bead array comprising universal capture bead 150 of Figure 1C. Specifically, a tissue section (not shown) may comprise a 1310 target RNA molecule. The 1310 target RNA molecule may include a 1315 mutation. 1320 gene. The 1320 RT primer may comprise a 1325 gene-specific region and a 1330 UMI region. A 1335 cDNA molecule synthesized using the 1320 RT primer comprises the 1330 UMI region. At step 1215, the 1335 cDNA molecule is captured onto universal capture sphere 150. For example, the tissue sample containing the 1335 cDNA molecule or a substrate comprising the 1335 cDNA molecule derived from the tissue sample (not shown) is contacted with the universal capture bead 150. The cDNA molecule 1335 is captured onto the universal capture bead 150 by coupling UMI 1330 to the spatial address region 130 in the universal adapter oligonucleotide 160. In step 1220, the 1335 cDNA is cleaved from the universal capture sphere 150. The 1335 cDNA molecule now comprises the SBS primer region 125 (for example, SBS3) and the 130 spatial address region. At step 1225, the second cDNA strand is synthesized using a 1340 gene-specific primer. The 1340 gene-specific primer comprises a 1345 gene-specific region and an SBS 1350 (eg, SBS12) primer region. A 1355 second-strand cDNA molecule synthesized using the 1340 gene-specific primer comprises the 1350 SBS sequencing primer region, the 1330 UMI region, the 130 spatial address region, and the 125 SBS primer region. 1230, the 1355 cDNA molecule is amplified using a first SBS 1360 primer and a second SBS 1365 primer. The SBS 1360 primer comprises a complementary region of SBS 1350a that is complementary to the SBS 1350 sequencing primer and a region P71370 primer. The SBS 1365 primer comprises a complementary region of SBS 125a that is complementary to the SBS 125 primer region and a P5 1375 primer region. library 1380 synthesized using SBS primers 1360 and 1365 is flanked at the 5' end by the P71370 primer region and the SBS 1350 primer region and at the 3' end by the UMI 1330 region, the spatial address region 130 , the SBS 125 sequencing primer region, and the P51375 primer region. At step 1235 (not shown), the library is sequenced.

In this example, the tissue sample is contacted with universal adapter oligonucleotide 160 which is affixed to the surface of universal capture bead 150. The cDNA molecule 1335 is captured onto the array by coupling of UMI 1330 to the spatial direction 130 in the universal adapter oligonucleotide 160. In another example molecule (not shown), the tissue sample is contacted with the matrix and the universal adapter oligonucleotides 160 are released from the matrix into the tissue sample by cleavage of the optional cleavable sequence 120.

In some embodiments, an anchor PCR step (not shown) may optionally be performed to enrich for target cDNA sequences prior to step 1225. For example, an anchor PCR amplification using gene-specific primers may be performed first. without the SBS 1350 primer sequence. In the anchoring PCR amplification step, a second amplification can be performed using the 1340 gene-specific primer comprising the 1345 gene-specific region and the SBS 1350 sequencing primer region .

Figure 14 illustrates a flowchart of embodiments of a DNA amplicon capture method 1400 on an array (eg, capture array 100 of Figure 1A), in which DNA amplicons can be generated by in -line amplification. situ of the target nucleic acid. Method 1400 may comprise, but is not limited to some or all of the following steps.

At step 1410, a pair of gene-specific capture probes flanking a region(s) of interest are hybridized in situ to genomic DNA. For example, a first capture oligonucleotide that hybridizes 5' to a region of interest may comprise a first gene-specific sequence and a universal sequence. A second capture oligonucleotide that hybridizes 3' to a region of interest may comprise a second gene-specific sequence, an IMU, and an SBS (eg, SBS3) primer sequence.

At step 1415, an in situ docking/extension reaction is performed between the flanking capture probes through the regions of interest.

In a step 1420, the DNA flanked by capture probes is amplified by isothermal in situ amplification to generate multiple copies of the regions of interest, ie, multiple amplicons. Isothermal amplification can be performed, for example, using primer sequences that are complementary to the universal sequence and the SBS primer sequence.

At step 1425, a 3' tail oligonucleotide can be added to the DNA amplicons to prevent self-coupling.

At step 1430, the DNA amplicons are transferred to a bead array (for example, universal capture bead array 150 shown in Figure 1C) and captured by coupling onto universal capture oligonucleotides on the bead array. spheres. For example, DNA amplicons can be denatured, transferred to the bead array, and coupled to universal capture oligonucleotides. Universal capture oligonucleotides can include a cleavable sequence, an SBS primer sequence (eg, SBS12), and a spatial targeting sequence as described with reference to Figure 1C. Both strands (ie, top strand and bottom strand) of the denatured amplicons can be coupled to the capture oligonucleotides on the bead array.

At step 1435, the DNA amplicons are excised from the bead array.

At step 1440, the DNA amplicons are amplified using an SBS primer pair to generate a sequencing library. For example, a first SBS primer may comprise sequences complementary to SBS12 and P7 sequences. A second SBS primer may comprise sequences complementary to SBS3 and P5 sequences. In some embodiments, only target sequences that are flanked by SBS12 and SBS3 sequences (ie, the top strand of the DNA amplicon) are amplified. The resulting library amplicons are flanked at the 5' end by SBS12 and P7 primer sequences and by UMI, spatial direction, SBS3 primer and P5 sequences at the 3' end.

At step 1445, the library is sequenced.

Figures 15A, 15B and 15C illustrate the steps of a method 1400 of Figure 14. Specifically, a tissue section (not shown) comprises a region of target DNA 1510. The target DNA molecule 1510 may include a 1515 mutation. At step 1410, a first gene-specific capture probe 1520 and a second gene-specific capture probe 1525 flanking a region of interest are hybridized in situ to the DNA molecule 1510. The gene-specific capture probe 1520 comprises a 1530 gene-specific region and a 1535 universal region. The 1525 gene-specific capture probe may comprise a second 1540 gene-specific region, a 1545 UMI region, and a 1550 SBS primer region (eg, SBS3). At step 1415, an in situ docking/extension reaction is performed between the flanking 1520 and 1525 gene-specific capture probes in the region of interest to generate a 1555 DNA molecule. The 1555 DNA molecule comprises the 1535 universal region, the 1545 UMI region, and the 1550 SBS primer region. At step 1420, the 1555 DNA is amplified (e.g. , isothermal in situ amplification) to generate multiple copies (ie, multiple amplicons) of the target region of interest. Amplification, eg, isothermal amplification, is performed using a 1535a primer region that is complementary to the 1535 universal region and a 1550a primer region that is complementary to the 1550 SBS primer region. adds a 3' tail oligonucleotide 1560 to DNA amplicons to prevent self-coupling. At step 1430, the 1555 DNA molecule is denatured and transferred to universal capture sphere 150. For example, tissue sample containing the 1555 DNA molecule or a substrate comprising the 1555 DNA molecule derived from the tissue sample (not shown) is brought into contact with universal capture sphere 150. Each strand (i.e., top strand "A" and bottom strand "B") of the 1555 DNA molecule is captured onto the universal capture bead 150 by coupling the 3' tail oligonucleotide 1560 to the spatial address region 130 in the universal adapter oligonucleotide 160. At step 1435, the 1555 DNA molecules are cleaved from the universal capture bead 150. form two different configurations of the 1555 DNA molecule: A) a 1565 DNA molecule comprising (in the 3' to 5' direction) the SBS primer region 125 (eg, SBS12), the spatial address region 130 , the 3' tail oligonucleotide 1560, the universal region 1535, the DNA molecule 1555, the UMI region 1545, and the primer region of SBS 1550 (eg, SBS3), and B) a DNA molecule 1570 comprising (in the 3' to 5' direction) the SBS primer region 125 (eg, SBS12), spatial address region 130, 3' tail oligonucleotide 1560, SBS primer region 1550 (eg, SBS3), UMI region 1545, DNA 1555 and the universal region 1535. At step 1440, the DNA molecules 1565 (A) and 1570 (B) are amplified using a first primer of SBS 1575 and a second primer of SBS 1580. The first primer of SBS 1575 comprises an SBS 125a primer sequence that is complementary to the SBS 125 primer sequence and a P71585 sequence. The SBS 1580 second primer comprises an SBS 1550a primer sequence that is complementary to the SBS 1550 primer sequence and a P5 sequence. A 1595 library amplicon amplified from the 1565 DNA molecule using SBS primers 1575 and 1580 is flanked at the 3' end by the P7 1585 region, the SBS 125 primer region (eg, SBS12), the spatial address region 130, the 3' tail oligonucleotide 1560, and the universal region 1535, and at the 5' end by the UMI region 1545, the SBS primer region 1550 (eg, SBS3), and the primer region P51590. Due to the configuration of the SBS sequences in the 1570 DNA molecule, the 1570 DNA molecule is not amplified.

In this example, the tissue sample is brought into contact with universal adapter oligonucleotide 160 which is affixed onto the surface of universal capture bead 150. The DNA molecule 1555 is captured onto universal capture bead 150 by coupling of the 3' tail oligonucleotide 1560 to the spatial direction 130. In another example (not shown), the tissue sample is contacted with the matrix and the universal adapter oligonucleotides 160 are released from the matrix into the tissue sample by cleavage of the optional cleavable sequence 120.

4.3 Transfer of nucleic acids to capture matrices

In some embodiments of the methods described herein, nucleic acid molecules can be transferred from a sample, such as a tissue section, to a capture matrix by passive diffusion.

In some embodiments, the transfer of nucleic acid molecules from a sample to a capture matrix can be facilitated, for example, by electrophoresis or centrifugation.

In some embodiments, nucleic acid molecules can be transferred directly from a sample, such as a tissue section, to a capture matrix. For example, a tissue section can be placed directly on a capture matrix.

In some embodiments, nucleic acid molecules can be indirectly transferred from a sample, such as a tissue section, to a capture matrix. For example, nucleic acids from a tissue section may first be transferred to one or more intermediate substrates, eg, any substrate that is not a capture matrix, such that the relative spatial orientation of the nucleic acids in the intermediate substrate reflect the relative spatial orientation in the tissue section. Nucleic acids can then be transferred from the intermediate substrate to the capture matrix such that the relative spatial orientation of the nucleic acids in the capture matrix reflects the relative spatial orientation of the nucleic acids in the tissue section. Indirect transfer can occur, for example, by passive diffusion or by facilitated transfer (eg, electrophoresis or centrifugation). The intermediate substrate can be, for example, a membrane, such as a nylon membrane, a gel, or a microwell plate. In some embodiments, nucleic acids from a tissue sample may be transferred first to a gel, then to one or more membranes, and then to the capture matrix. In some embodiments, the intermediate substrate can be configured to stabilize the separation of nucleic acids in different spatial regions of the tissue section. For example, nucleic acids in different spatial regions in the tissue section can be permanently separated from one another by placing different fragments of the tissue section (or of a gel or membrane comprising nucleic acids from the tissue section) in different wells of the microwell plate. such that the relative spatial orientation of the tissue section fragments in the microwell plate can be correlated with the relative spatial orientation of the tissue section fragments. Nucleic acids from the tissue fragments in the microwell plate can subsequently be transferred from the microwell plate to the capture matrix.

In some embodiments, intermediate substrates can be used to produce two or more copies of nucleic acids whose relative spatial orientation can be correlated to their relative spatial orientation in a tissue section. For example, nucleic acids can be transferred from a tissue section to various membranes, for example, by placing the tissue section on a membrane that forms the first layer of several layered membranes. Transfer from the tissue section to the two or more layered membranes may occur, for example, by passive diffusion or may be facilitated. The spatial orientation of the nucleic acids in each of the two or more layered membranes corresponds to the relative spatial orientation of the nucleic acids in the tissue section. Nucleic acids from the two or more layered membranes can subsequently be transferred to two or more capture matrices.

In some embodiments, the transfer of nucleic acid molecules from a sample to a capture matrix can be facilitated using magnetically responsive nanoparticles.

(a) Facilitated transfer of nucleic acids to capture matrices

In some embodiments, facilitated transfer of nucleic acid may result in higher yields of transfer of nucleic acid from the sample to the capture matrix, compared to transfer of nucleic acid by passive diffusion under comparable experimental conditions (e.g., temperature of transfer). transfer, transfer buffer and the like). In some embodiments, facilitated nucleic acid transfer may result in at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, or at least 100-fold higher yields compared to passive diffusion transfer of nucleic acids. Methods for analyzing nucleic acid transfer efficiency are well known in the art, for example, using radioisotope-labeled or fluorescently-labeled nucleic acids, or comparing yields or efficiencies of next-generation sequencing reactions.

In some embodiments, facilitated nucleic acid transfer may allow for reduced transfer times, compared to nucleic acid transfer by passive diffusion under otherwise comparable experimental conditions (e.g., reduced transfer times of more than 12 hours, more than 24 hours, more than 36 hours, or more than 48 hours, less than 6 hours, less than 4 hours, less than 2 hours, or less than 1 hour). In some embodiments, facilitated nucleic acid transfer may result in at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold reduction in transfer times, compared to nucleic acid transfer by passive diffusion. Methods for analyzing or comparing transfer times are well known in the art. For example, the transfer time may represent the time required to transfer a certain amount of nucleic acid from the sample to the capture matrix, as determined, for example, by the use of radioisotope-labeled or fluorescently-labeled nucleic acids, or comparing returns. or efficiencies of next-generation sequencing reactions.

In some embodiments, facilitated transfer of nucleic acids may allow transfer of nucleic acids from larger samples, eg, thicker tissue sections, to a capture matrix, compared to transfer of nucleic acids by passive diffusion under conditions. otherwise comparable experiments. In some embodiments, facilitated nucleic acid transfer may allow transfer of nucleic acids from tissue sections that are at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold thicker, compared to the thickness of samples typically applied when transferring nucleic acids by passive diffusion (eg, from about 10 gm to about 100gm thick). In some embodiments, the thickness of a tissue section may be less than about 5 gm.

In some embodiments, transfer of nucleic acid from a tissue sample may be facilitated with respect to certain capture sites in a capture matrix, while transfer of nucleic acid from a tissue sample may be via passive diffusion with respect to certain capture sites. to certain other capture sites in the capture matrix. In some embodiments, transfer of nucleic acid from a tissue sample to a capture matrix may be facilitated with respect to a selected subset of capture sites, e.g., a subset of at least 1%, at least 3%, al at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% of capture sites.

(B) Electrophoretic system for spatial detection and analysis of nucleic acids in a tissue sample

In some embodiments, a capture array (ie, an array of capture sites) can be integrated with an electrophoretic system to force nucleic acid molecules to move directly from a tissue section to capture probes. In some embodiments, the nucleic acid is RNA. In some embodiments, the nucleic acid is DNA (eg, cDNA or DNA amplicons).

Figure 16 illustrates a side view of a portion of an exemplary electrophoretic blot system 1600 that is configured for spatial detection and analysis of nucleic acid in a tissue sample. the system electrophoretic transfer 1600 comprises a capture matrix 1610. The capture matrix 1610 may be the capture matrix 100 of Figure 1A. Capture array 1610 comprises a solid support 1615. In some embodiments, solid support 1615 is a flat glass substrate. An array (eg, rows and columns) of capture sites 1620 is formed on solid support 1615. In some embodiments, a row of six capture sites 1620 (i.e., capture sites 1620a through 1620f) is shown, but Any number and configuration of capture sites 1620 may be used. A plurality of oligonucleotides (not shown) are immobilized at each of the capture sites 1620. Associated with each capture site 1620 is a lower electrode 1625 (eg, six lower electrodes). lower 1625a to 1625f). In this example, one lower electrode 1625 is shown for each capture site 1620, but any number of lower electrodes 1625 may be used per capture site 1620. For example, the capture array 1610 may include 2 lower electrodes 1625 per capture site. 1620 capture site, or 10 1625 bottom electrodes per 1620 capture site, or 100 1625 bottom electrodes per 1620 capture site, or any number of 1625 bottom electrodes per 1620 capture site. capture 1610. In one example, sample substrate 1630 is a flat glass substrate. The sample substrate 1630 includes an upper electrode arrangement 1635. In this example, the upper electrode arrangement 1635 corresponds to the lower electrode arrangement 1625 in the capture array 1610, that is, an upper electrode 1635 (for example , upper electrodes 1635a to 1635f) by lower electrode 1625 (eg, lower electrodes 1625a to 1625f). In another example (not shown), sample substrate 1630 includes a single top electrode 1635. A tissue sample 1640 is mounted on the surface of sample substrate 1630 facing capture sites 1620 of the capture array. 1610.

Capture sites 1620, lower electrodes 1625, and upper electrodes 1635 are configured for electrophoretic transfer and capture of nucleic acids from a tissue sample such that spatial orientation is maintained and diffusion of nucleic acids from the tissue sample is maintained. tissue sample and leakage of nucleic acids between capture sites 1620 is eliminated or substantially reduced. Each of the capture sites 1620 can be targeted (loaded) individually or all or selected groups of the capture sites. Capture 1620 can be run together as a single unit. A voltage source 1645 is connected across the lower electrodes 1625 and the upper electrodes 1635. In the presence of an electric field supplied by the voltage source 1645, a plurality of nucleic acids 1650 are transferred from the tissue sample 1640 to the 1620 capture sites. Nucleic acids 1650 are captured at the 1620 capture sites by hybridization to capture probes (not shown) that are immobilized to the 1620 capture sites.

4.4 Spatial Detection and Analysis of Nucleic Acids in a Tissue Sample Using Capture Probe Sets

In accordance with the methods described herein, spatial detection and analysis of nucleic acids in a tissue sample can be performed using sets of two or more capture probes (eg, 3 or more, 4 or more, 5 or more). more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more capture probes). Typically, at least a first capture probe in a set of capture probes is immobilized on a capture matrix. In some embodiments, a second capture probe may be immobilized on the same capture matrix as the first capture probe, eg, in close proximity to the first capture probe, eg, at the same capture site. In some embodiments, a second capture probe can be immobilized on a particle, such as a magnetic particle or magnetic nanoparticle. See, for example, section 5.6. In some embodiments, a second capture probe may be in solution, for example, to be used to perform in situ reactions with a nucleic acid in a tissue sample.

The capture probes in the capture probe sets can individually and independently have a variety of different regions, for example, a capture region (eg, a gene-specific or universal capture region), a primer-binding region (for example, an SBS primer region, such as an SBS3 or SBS12 region, or other universal region, such as a P5 or P7 region), a spatial targeting region (for example, a combinatorial or partial spatial targeting region ) or a cleavable region.

In some embodiments, only one capture probe in a set of capture probes comprises a capture region. In some embodiments, two or more capture probes in a capture probe set comprise a capture region.

In some embodiments, only one probe in a set of capture probes comprises a spatial address region, eg, such as a full spatial address region that describes the position of a capture site in a capture array. In some embodiments, two or more probes in a capture probe set may comprise a spatial address region, for example, two or more probes may each comprise a partial spatial address region (i.e., combinatorial address region), wherein each partial address region describes the position of a capture site in a capture matrix, eg, along the x-axis or the y-axis.

In some embodiments, a capture probe set may comprise at least one capture probe comprising a capture region and a spatial address region (eg, a full or partial spatial address region). In some embodiments, no capture probe in a set of capture probes comprises both a capture region and a spatial address region.

In another aspect, a capture array for the spatial detection and analysis of nucleic acids in a tissue sample is provided herein, comprising a capture site comprising a set of capture probes. In some embodiments, the capture probe set comprises at least two capture probes (ie, at least one pair of capture probes). In some embodiments, the capture probe set comprises three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more capture probes. In some embodiments, the capture matrix can be integrated into an electrophoretic transfer system described herein. See, for example, section 5.3.

Figure 17 illustrates a side view of a capture site 1700 on a capture array (for example, capture array 100 of Figure 1A), where the single capture site 1700 comprises two distinct sets of capture probes. immobilized. In some embodiments, an immobilized capture probe set comprises two capture probes (ie, a pair of capture probes). In some embodiments, an immobilized capture probe set comprises three or more capture probes. By way of example, Figure 17 shows capture site 1700a of a capture array. A first set of capture probes 1710 comprises an SBS primer region 1715 (eg, SBS3) and a spatial targeting region 1720. Each capture probe 1710 immobilized to capture site 1700a comprises the same unique spatial targeting region 1720 Capture probes 1710 immobilized to other capture sites 1700 (not shown), eg, capture sites 1700b to 1700f, each include their own unique spatial address region 1720 (eg, spatial address region 1720b to 1720f), that is, each capture site 1700 has a unique spatial address region. A second set of 1725 capture probes comprises a second SBS primer region 1730 (eg, SBS12) and a 1735 gene-specific capture region, eg, 1735a gene-specific capture region and 1735a gene-specific capture region. 1735b. In some embodiments, the second set of capture probes does not comprise a spatial address sequence. In this example, two capture probes with spatial addresses 1710 and capture probes 1725 are shown, but any number of capture probes with spatial addresses 1710 and capture probes 1725 may be immobilized at capture site 1700a. In some embodiments, the capture array illustrated in Figure 17 can be integrated into an electrophoretic transfer system 1600 of Figure 16.

Because at least two different sets of capture probes are used, for example, in the embodiment illustrated in Figure 17, the number of oligonucleotides needed to achieve gene-specific capture is substantially reduced. For example, in a conventional approach, for RNA from 100 different genes at 20,000 capture sites, 2 million capture oligonucleotides with different spatial directions would be needed. However, according to the methods described herein, to capture RNA from 100 different genes at 20,000 capture sites, only 20,000 spatially addressed oligonucleotides and 100 capture oligonucleotides are required.

In some embodiments, a capture array comprises a capture site (eg, 1700a) comprising a pair of capture probes immobilized on a surface (eg, 1710 and 1725a), wherein a first capture probe (eg, example, 1710) of the capture probe pair comprises a first primer binding region (eg, the primer binding region of SBS 1715; eg, SBS3) and a spatial address region (eg, the primer binding region). spatial address 1720), and wherein a second capture probe (eg, 1725a) of the capture probe pair comprises a second primer-binding region (eg, the primer-binding region of SBS 1730; eg , SBS12) and a capture region (eg, 1735a).

In some embodiments, the first capture probe does not comprise a gene-specific region.

In some embodiments, the second capture probe does not comprise a spatial address region.

In some embodiments, the capture site is a plurality of capture sites. In some embodiments, the plurality of capture sites is 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 30,000 or more, 100,000 or more. , 300,000 or more, 1,000,000 or more 3,000,000 or more, or 10,000,000 or 1,000. 000,000 or more capture sites.

In some embodiments, the capture matrix comprises a capture site density of 1 or more, 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more. more, 100,000 or more, 1,000,000 or more, capture sites per square centimeter (cm2).

In some embodiments, the capture probe pair at a capture site is a plurality of capture probe pairs. In some embodiments, the plurality of capture probes is 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 30,000 or more, 100,000 or more , 300,000 or more, 1,000,000 or more 3,000. 000 or more, or 10,000,000 or more, 100,000,000 or more, or 1,000,000,000 or more capture probes.

In some embodiments, the capture probe pair at a capture site of a capture array is a plurality of capture probe pairs. In some embodiments, each first capture probe in the plurality of pairs of capture probes within the same capture site comprises the same spatial address sequence. In some embodiments, each first capture probe in the plurality of pairs of capture probes at different capture sites comprises a different spatial address sequence.

In some embodiments, one or more capture sites in the capture array have the same number of first capture probes and second capture probes. In some embodiments, one or more capture sites have more first capture probes than second capture probes. For example, in some embodiments, one or more capture sites have at least 2 times, at least 3 times, at least 10 times, at least 30 times, at least 100 times, at least 300 times, at least 1,000 times, at least 3,000 times or at least 10,000 times more first capture probes than second capture probes. In some embodiments, one or more capture sites have more second capture probes than first capture probes. For example, in some embodiments, one or more capture sites have at least 2 times, at least 3 times, at least 10 times, at least 30 times, at least 100 times, at least 300 times, at least 1000 times, at least 3000 times or at least 10,000 times more second capture probes than first capture probes.

In some embodiments, the capture matrix is integrated into an electrophoresis system. In some embodiments, the electrophoresis system is an electrophoresis system as described in section 5.3 (see, eg, Figure 16). In some embodiments, each capture site can be independently electrically targeted in the electrophoresis system. In some embodiments, a capture site in the electrophoresis system is configured for the transfer and capture of nucleic acids from a tissue sample such that diffusion of nucleic acids from the tissue sample and loss of nucleic acids between Capture sites are substantially reduced relative to a passive nucleic acid transfer that occurs under otherwise identical conditions in the absence of the electrophoresis system, eg, by diffusion.

In some embodiments, the capture array surface is a flat surface, eg, a glass surface. See, for example, Figure 1B. In some embodiments, the capture array surface comprises one or more wells. In some embodiments, said one or more wells correspond to one or more capture sites. In some embodiments, the surface of the capture array is a surface of spheres, for example, as illustrated in Figure 1C.

In some embodiments, the capture region in the second capture probe is a gene-specific capture region. In some embodiments, the gene-specific capture region in the second capture probe comprises the sequence of a TruSeq™ Custom Amplicon (TSCA) oligonucleotide probe (Illumina, Inc.). For example, gene-specific capture regions in a plurality of second capture probes at a capture site may comprise a plurality of TSCA oligonucleotide probe sequences.

In some embodiments, the capture region in the second capture probe is a universal capture region. In some embodiments, the universal capture region in the second capture probe comprises a random primer sequence. For example, the capture regions in a plurality of second capture probes at a capture site may comprise random sequences. In some embodiments, the universal capture region in a second capture probe comprises a poly-T capture sequence. For example, some or all of the universal capture sequences in a plurality of second capture probes at a capture site may comprise a poly-T capture sequence.

In some embodiments, the capture regions in one or more second capture probes of a capture site may be essentially the same capture regions in two or more capture sites of the capture array. In some embodiments, at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40 %, at least 50%, at least at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% of the second probes of capture have the same capture regions in two or more capture sites of the capture matrix (for example, in at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% of the capture sites in a capture matrix).

In some embodiments, the capture regions in one or more second capture probes of a capture array may be at least 1%, at least 5%, at least 10%, at least 15%, essentially the same capture sequences. at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of the capture sites in a capture matrix. In some embodiments, the capture regions in one or more second capture probes of a capture array may be essentially the same capture sequences at essentially all capture sites in a capture array.

In some embodiments, the spatial address region comprises two or more partial spatial address regions (eg, a first, second, and optionally a third partial address region) that can be combinatorially combined (eg, X * AND Z). In some embodiments, the spatial address region comprises first and second partial address regions for identifying the position of a capture site on the capture matrix in the first (X) and second (Y) dimensions. In some embodiments, the spatial address region further comprises a third partial address region for identifying the location of a tissue slice (and a nucleic acid transferred from the tissue slice) in the tissue sample in the third dimension (Z ).

In some embodiments, the first or second capture probe in the capture array further comprises a time address region (T) to identify the relative sequence of times when a capture was obtained. sample in the course of a developmental time experiment (for example, a developmental time experiment to determine changes in gene expressions in a tissue over time in response to a chemical, biological, or physical stimulus) .

In some embodiments, two or more address regions (eg, spatial or temporal address regions) in a capture probe are consecutive. In some embodiments, two or more address regions are separated by one or more nucleic acids (eg, by 2 or more, 3 or more, 10 or more, 30 or more, 100 or more, 300 or more, or 1,000 or more). more nucleic acids).

Figure 18 illustrates a flow diagram of one embodiment of a method 1800 for transferring nucleic acids from a tissue sample to a capture array for generation of a spatially addressed sequencing library, wherein the capture array comprises sites including separate pairs of immobilized capture probes, for example, as shown in Figure 17. In this embodiment, the nucleic acid is RNA. In some embodiments of the method illustrated in Figure 18, the capture matrix is integrated into an electrophoretic transfer system, such as electrophoretic transfer system 1600 of Figure 16. Method 1800 comprises, but is not limited to some or all of the following stages.

Optionally, in a step 1810, a nucleic acid from a tissue sample may be electrophoretically transferred to a capture matrix. For example and now referring to Figure 16 and Figure 17, the sample substrate 1630 with the tissue sample 1640 thereon can be placed on top of the capture matrix 1610. In this example, the capture sites 1620 of The capture array 1610 include distinct pairs of immobilized capture probes, for example, as shown in Figure 17. An electric field is applied to the capture sites 1620. As the capture sites 1620 are activated, the acids Nuclei 1650 from tissue sample 1640 are transferred to capture array 1610 and hybridized to capture probes 1725 that are immobilized to capture sites 1620. In this embodiment, capture probes 1725 are gene-specific capture probes. designed to capture specific mRNAs.

In some embodiments, at step 1810, transfer of a nucleic acid from a sample, such as tissue sample 1640, may occur by passive diffusion. In some embodiments, at step 1810, transfer of a nucleic acid from a sample, such as tissue sample 1640, is facilitated by a method other than electrophoresis.

At step 1815, the first strand cDNA is synthesized. For example, the specific capture regions of 1735 genes can act as reverse transcriptase primers for the synthesis of first-strand cDNA from captured mRNA molecules.

At step 1820, the first strand cDNA is covalently linked to the second capture probe 1710 by single-stranded coupling of the cDNA to the spatial address region 1720.

At step 1825, the second-strand cDNA is synthesized using a primer that is complementary to the primer region of SBS 1715.

At step 1830, second-strand cDNA molecules are released from the capture site 1700 by denaturation.

At step 1835, the cDNA is amplified to generate a sequencing library.

Figures 19A, 19B, 19C and 19D graphically show the steps of the method 1800 of Figure 18. Specifically, in step 1810, a plurality of mRNA molecules 1910 are transferred (eg, electrophoretically) from a tissue section (not shown) to the capture site. 1700 and hybridize with the 1725 capture probes. In some embodiments, a first 1910a mRNA molecule is a transcript of a first gene and a second 1910b mRNA molecule is a transcript of a second gene. The 1910a mRNA molecule may include a 1915a mutation. The 1910b mRNA molecule may include a 1915b mutation. The 1910a mRNA molecule is captured onto the 1725a capture probe by hybridization of complementary mRNA sequences to the 1735a gene-specific capture region. Similarly, the 1910b mRNA molecule is captured onto the 1725b capture probe by hybridization of complementary mRNA sequences to the 1735b gene-specific capture region.

At step 1815, first-strand cDNA is synthesized using the 1735 gene-specific capture region as a primer. A 1920 cDNA molecule (ie, 1920a and 1920b cDNA molecules) includes the SBS 1730 primer region.

At step 1820, the cDNA molecule 1920 is covalently linked to the spatially addressed oligonucleotides 1710 by single-stranded coupling of the cDNA molecule 1920 to the spatially addressed region 1720.

At step 1825, the second-strand cDNA is synthesized using a 1715a primer region that is complementary to the SBS 1715 primer region.

At step 1830, second-strand cDNA molecules 1920 are released from the capture site 1700 by denaturation The 1920 cDNA molecules now include the SBS 1715 primer region, the 1720 spatial address region, and the SBS 1730 primer region.

At step 1835, the 1920 cDNA molecules are amplified to generate a sequencing library. In a first amplification reaction, the cDNA molecules are amplified using a first SBS 1925 primer. The SBS 1925 primer comprises a complementary region of SBS 1730a that is complementary to the SBS 1730a primer region and a P7 1930 region. The 1935 amplicons (i.e., 1935a and 1935b amplicons) are flanked at the 5' end by the P7 1930 region and the SBS 1730 primer region, and at the 3' end by the 1720 spatial address region and the 1720 primer region. SBS 1715 primer. The 1935 amplicons are amplified using a second SBS 1940 primer. The SBS 1940 primer comprises an SBS 1715a complementary region that is complementary to the SBS 1715 primer region and a P5 1945 region. The 1935 amplicons ( that is, amplicons 1935a and 1935b) are now flanked by the P71930 region and the SBS 1730 primer region and by the 1720 spatial address region, the SBS 1715 primer region, and the P5 1945 region.

In another aspect, a method for the spatial detection and analysis of nucleic acids in a tissue sample is provided herein, comprising providing a capture matrix described herein. In some embodiments, the capture array comprises a capture site comprising a set of capture probes. In some embodiments, the capture probe set comprises two capture probes (ie, a pair of capture probes). In some embodiments, the capture probe set comprises three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more capture probes. In some embodiments, the capture matrix can be integrated into an electrophoretic transfer system described herein. See, for example, section 5.3.

In some embodiments, the method comprises (a) providing a capture array, comprising a capture site comprising a pair of capture probes (eg, 1710 and 1725a) immobilized on a surface, wherein a first capture probe capture of the capture probe pair comprises a first primer binding region (eg, 1715) and a spatial address region (eg, 1720), and wherein a second capture probe of the capture probe pair comprises a second primer binding region (eg, 1730) and a capture region (eg, 1735a).

In some embodiments, the first capture probe does not comprise a capture region.

In some embodiments, the second capture probe does not comprise a spatial address region.

In some embodiments, the method further comprises one or more of the following steps: (b) contacting the capture matrix with a tissue sample such that the position of a capture site on the matrix can be correlated with a position on the tissue sample; (c) allowing nucleic acids from the tissue sample to hybridize to the capture region of the second capture probe; (d) extending the capture region of the second capture probe to form an immobilized complementary first strand of nucleic acid hybridized to the gene-specific sequence; (e) coupling the immobilized first complementary strand to the spatial targeting sequence of a first capture probe to immobilize the first complementary strand at both ends; (f) synthesizing a second complementary strand using a primer complementary to the first primer-binding sequence of the first capture probe; (f) releasing the complementary second strand from the surface of the capture matrix; (g) analyzing the sequence of the released second complementary strand, and (h) correlating the sequence of the released second complementary strand with the position of the nucleic acid in the tissue sample.

In some embodiments, allowing nucleic acids from the tissue sample to hybridize to the capture region of the second capture probe comprises electrophoretic transfer of the nucleic acids from the tissue sample to the capture matrix.

In some embodiments, allowing nucleic acids from the tissue sample to hybridize to the capture region of the second capture probe comprises passive diffusion of the nucleic acids from the tissue sample to the capture matrix.

In some embodiments, analyzing the released complementary strand sequence comprises next generation sequencing, eg, sequencing by synthesis.

In some embodiments, the nucleic acids in the tissue sample comprise messenger ribonucleic acid (mRNA).

In some embodiments, the first or second primer binding region comprises an SBS primer sequence. In some embodiments, the SBS primer sequence is an SBS3 or SBS12 sequence.

In some embodiments, the capture region of the second capture probe comprises a single nucleotide variation (SNV). In some embodiments, the method has an SNV detection sensitivity of at least 0.00025% SNV (1/400,000 cells). The sensitivity of spatial NGS for the detection of single nucleotide variations is described in more detail with reference to Table 3 below.

In some embodiments, the capture region in the second capture probe is a universal capture region. In some embodiments, the universal capture region in the second capture probe comprises a random primer sequence. In some embodiments, the capture regions in the plurality of second capture probes at a capture site comprise 10 or more, 100 or more, 1,000 or more, 10,000 or more, 100,000 or more, or 1,000,000 or more sequences. random capture. In some embodiments, the universal capture region in the second capture probe comprises a poly-T capture sequence.

In some embodiments, the capture region in the second capture probe is a gene-specific capture region. In some embodiments, the gene-specific capture region in the second capture probe comprises the sequence of a TSCA oligonucleotide probe. In some embodiments, the capture regions in the plurality of second capture probes at a capture site comprise 10 or more, 100 or more, 1,000 or more, 10,000 or more, 100,000 or more, or 1,000,000 or more sequences. TSCA catch.

In some embodiments, at least one capture probe in a set of capture probes is in solution, eg, to hybridize to a nucleic acid in the tissue sample. Figure 20 shows an example of an embodiment of a process 2000 for capturing a nucleic acid in a tissue sample for its subsequent anchoring on a matrix. In this embodiment, a capture probe 2010 comprises a nucleic acid capture region 2015 and a universal array capture region 2020. In one example, the nucleic acid capture region 2015 is a random primer sequence. In another example, the 2015 nucleic acid capture region is a gene-specific primer sequence. Universal matrix capture region 2020 is a universal sequence that is used to anchor a nucleic acid molecule on a capture matrix. The 2010 capture probe can be used in a solution-based hybridization reaction to capture a 2025 nucleic acid molecule in a tissue section. In one example, nucleic acid molecule 2025 is a genomic DNA molecule. The 2010 capture probe hybridizes to the 2025 nucleic acid molecule from a tissue sample and is extended to form a nucleic acid complementary to the 2025 nucleic acid molecule (indicated by the arrow) and incorporate the matrix capture region universal 2020 on the complementary strand. Universal matrix capture region 2020 is then used to anchor the copied nucleic acid molecule onto a capture matrix (not shown). In another example, nucleic acid molecule 2025 is an RNA molecule. The 2010 capture probe hybridizes to the 2025 nucleic acid molecule and is used as a primer in a reverse transcription reaction to synthesize first-strand cDNA (indicated by arrow) and incorporate the 2020 universal matrix capture region into the molecule. of cDNA. The 2020 universal matrix capture region is then used to anchor the cDNA molecule onto a capture matrix (not shown).

In some embodiments, the method comprises (a) providing a capture array, comprising a capture site comprising a first capture probe immobilized on a surface, wherein the capture probe comprises a cleavable region, a first capture region, primer binding and a spatial targeting region.

In some embodiments, the first capture probe does not comprise a capture region.

In some embodiments, the method further comprises one or more of the following steps: (b) contacting a tissue sample with a second capture probe, wherein the second capture probe comprises a second primer binding region and a capture region (eg, a specific gene or a universal capture region); (c) allowing nucleic acids from the tissue sample to hybridize to the capture region of the second capture probe; (d) extending the capture region of the second capture probe to form a complementary first strand of nucleic acid hybridized to the nucleic acid.

In some embodiments, the second capture probe does not comprise a spatial address region.

In some embodiments, the method further comprises one or more of the following steps: (e) optionally, hybridizing an oligonucleotide complementary to the capture probe spatial address region to form a double-stranded spatial address region; (f) contacting the capture matrix with the tissue sample comprising the complementary first strand of nucleic acid such that the position of a capture site on the matrix can be correlated with a position in the tissue sample; (g) allowing the complementary first strand of nucleic acid to transfer from the tissue sample to the capture matrix; (h) coupling the complementary first strand of the nucleic acid (which optionally hybridizes to the nucleic acid) to the first capture probe (eg, by blunt-end coupling, such as double-stranded blunt-end coupling) to form a nucleic acid spatially labeled double-stranded nucleic acid comprising a first and a second primer binding site and a cleavable domain; (g) releasing the double-stranded nucleic acid from the surface of the capture matrix; (h) analyzing the sequence of the released double-stranded nucleic acid, and (i) correlating the sequence of the released nucleic acid with the position of the nucleic acid in the tissue sample.

In some embodiments, allowing the complementary first strand of nucleic acid to transfer from the tissue sample to the capture matrix comprises electrophoretic transfer of the nucleic acids from the tissue sample to the capture matrix.

In some embodiments, allowing the complementary first strand of nucleic acid to transfer from the tissue sample to the capture matrix comprises passive diffusion of the nucleic acids from the tissue sample. tissue to the capture matrix.

In some embodiments, the released double-stranded nucleic acid comprises next generation sequencing, eg, sequencing by synthesis.

In some embodiments, the nucleic acids in the tissue sample comprise messenger ribonucleic acid (mRNA).

In some embodiments, the first or second primer binding region comprises an SBS primer sequence. In some embodiments, the SBS primer sequence is an SBS3 or SBS12 sequence.

4.5 Combinatorial indexing system

In another embodiment, a combinatorial indexing (addressing) system is used to provide spatial information for analysis of nucleic acids in a tissue sample. In this approach, two or more spatial address sequences are incorporated into a nucleic acid during the preparation of a sequencing library. A first spatial address is used to define a certain position (i.e., a capture site) in the X dimension on a capture matrix and a second spatial address sequence is used to define a position (i.e., a capture site). ) in the Y dimension over the capturing matrix. During library sequencing, the X and Y spatial address sequences are determined, and the sequence information is analyzed to define the specific position on the capture array.

In one example, the tissue sample is contacted with capture probes that are affixed to the surface of the array. The tissue sample can be placed directly on the surface comprising the capture probes or the tissue sample can be placed on a substance such as a filter or a gel or a thin layer of buffer that separates the tissue sample from the capture probes. so that the target nucleic acid can diffuse from the tissue through the substance to the capture probes.

Figures 21A and 21B show a grid array 2100 of a one-dimensional indexing scheme and a grid array 2105 of a two-dimensional indexing scheme, respectively, for spatial detection and analysis of nucleic acids in a tissue sample. Referring to Fig. 21A, to achieve the spatial address of 100 positions in a one-dimensional indexing scheme, 100 unique spatial addresses are required. Referring now to Fig. 21B, to achieve the spatial address of 100 positions in a two-dimensional indexing scheme, 10 unique spatial addresses are required for the X dimension and 10 unique spatial addresses are required for the Y dimension, i.e., the sequences The total unique spatial addresses required are 20. Combinatorial indexing substantially reduces the number of spatial addresses that are needed for the spatial detection and analysis of nucleic acids in a tissue sample.

In some embodiments, a capture site in an array comprises a first capture probe with a first spatial addressing sequence for the X dimension and a second capture probe with a second spatial addressing sequence for the Y dimension. In some embodiments, the first and second capture probes are oriented in opposite directions on the capture site so that the 5' and 3' ends of an RNA molecule are captured. During the following library preparation steps, the first and second spatial address sequences are incorporated into the library amplicons as described in more detail with reference to Figure 22 and Figures 23A and 23B.

In some embodiments, the first and second capture probes are oriented in the same direction on the capture site such that only the 3' end of an mRNA molecule is captured. During the following steps of library preparation, the first and second spatial address sequences are incorporated into the library amplicons as described in more detail with reference to Figure 24 and Figures 25A and 25B.

In some embodiments, two or more partial address regions (eg, a first and a second partial address region) may be incorporated into a single capture probe. The two or more partial address regions may form a consecutive region or be separated by one or more nucleic acids. For example, two or more partial address regions can be incorporated into a single first capture probe of a pair of capture probes, according to the capture arrays and methods illustrated, for example, in Figures 17-19 .

Figure 22 illustrates a flowchart of an exemplary method 2200 for using a combinatorial indexing system for the generation of a spatially addressed cDNA sequencing library. Method 2200 comprises, but is not limited to some or all of the following steps.

In a step 2210, a tissue sample comprising a plurality of mRNA molecules is contacted with a capture matrix. The capture array can be, for example, the capture array 100 of Figure 1A. For each gene-specific (i.e. specifically targeted) mRNA molecule, two capture probes are used, i.e. a first capture probe capture probe comprising sequences specific to the 3' end of the mRNA molecule and a second capture probe comprising sequences specific to the 5' end of the mRNA molecule. The mRNA molecules are captured on the array by hybridization of the mRNA to the gene-specific capture regions on the capture probes. An example of the capture probes on the array capture 100 is described in more detail with reference to FIG. 23A.

At step 2215, the first strand cDNA is synthesized. For example, gene-specific capture regions in the first capture probe are used as reverse transcriptase primers for first-strand cDNA synthesis from captured mRNA molecules. The cDNA molecule is then coupled to the 5' end of the second capture probe.

At step 2220, the cDNA molecule is released from the capture matrix. For example, the cDNA molecule is released from the capture matrix by a cleavage reaction.

At step 2225, the cDNA is amplified to generate a sequencing library.

Figures 23A and 23B illustrate the steps of the method 2200 of Figure 22. In this example, a single capture site 105 of the capture array 100 of Figure 1A is shown. Capture site 105 comprises a first probe of capture 2310a and a second capture probe 2310b. The 2310 capture probes include a 2315 cleavable domain, a 2320 SBS primer region, a 2325 spatial address region, a 2330 unique molecular identifier (UMI), and a 2335 capture region. For example, the 2310a capture probe comprises cleavable region 2315; the SBS 2320a primer region, comprising, for example, an SBS3 sequence; spatial address region 2325a, comprising a unique spatial address sequence for the X dimension; the UMI 2330a region, comprising a sequence unique to the 2310a capture probe; and a 2335a gene-specific capture region, which is specific for the 3' end of an mRNA molecule. Capture probe 2320a is immobilized to capture site 105 in the 5' to 3' orientation (ie, the 5' end of capture probe 2320a is bound to the surface of capture site 105). Similarly, the 2310b capture probe comprises the 2315 cleavable sequence; the SBS 2320b primer region, comprising an SBS12 sequence; spatial address region 2325b, comprising a spatial address region unique to the Y dimension; the UMI 2330b region, comprising a sequence unique to the 2310b capture probe; and a 2335b gene-specific capture region, which is specific for the 5' end of the mRNA molecule. Capture probe 2320b is immobilized to capture site 105 in the 3' to 5' orientation (ie, the 3' end of capture probe 2320a is bound to the surface of capture site 105).

At step 2210, a 2340 mRNA molecule is captured in a tissue sample on the 2310 capture probes. For example, the tissue sample containing the 2340 mRNA molecule or a substrate comprising the 2340 mRNA molecule derived from tissue sample (not shown) is contacted with 2310 capture probes. The 2340 mRNA molecule may include a 2345 mutation. The 2340 mRNA molecule is captured at the 105 capture site by 3'-end annealing of the 2340 mRNA molecule with the 2335a capture region, and by hybridizing the 5' end of the 2340 mRNA molecule with the 2335b capture region.

At step 2215, a 2350 cDNA molecule is synthesized using the 2335a capture region as a primer in a reverse transcription reaction. The 3' end of the 2350 cDNA molecule is then coupled to the 5' end of the 2335b capture region.

At step 2220, the 2350 cDNA molecule is released from the 105 capture site by cleavage of the 2315 cleavable region. The 2350 cDNA molecule comprises the primer region of SBS 2320a (i.e., SBS3), the spatial address region 2325a (i.e., unique spatial address for X dimension), UMI region 2330a, UMI 2330b region, spatial address region 2325b (i.e., unique spatial address for Y dimension), and SBS primer region 2320b (ie SBS12).

At step 2225, the 2350 cDNA molecule is amplified using an SBS 2355 primer and a second SBS 2360 primer. The SBS 2355 primer comprises a sequence of SBS 2320a' that is complementary to the SBS 2320a primer region and a P52365 region. The SBS 2360 primer comprises a region of SBS 2320b' that is complementary to the 2320b region of the SBS 2355 primer and a P72370 region. A 2375 library amplicon synthesized using SBS2355 and 2360 primers is flanked at the 5' end by the P52365 region, the SBS 2320a primer region (i.e., SBS3), the 2325a spatial address region (i.e., unique spatial address for the X dimension), the UMI region 2330a, and at the 3' end by the UMI region 2330b, the spatial address region 2325b (i.e., unique spatial address for the Y dimension), the primer region of SBS 2320b (ie SBS12) and the P72370 region.

Figure 24 illustrates a flow diagram of an example of an alternative method 2400 of using a combinatorial indexing system for the generation of a spatially addressed cDNA sequencing library. Method 2400 comprises, but is not limited to some or all of the following steps.

In a step 2410, a tissue sample comprising a plurality of mRNA molecules is contacted with a capture matrix. The capture matrix can be, for example, the capture matrix 100 of Figure 1A. Two capture probes are used for each gene-specific mRNA molecule, i.e. a first capture probe comprising sequences specific to the 3' end of the mRNA molecule and a second capture probe comprising sequences specific to the 3' end. 3' of a corresponding first-strand cDNA molecule. The mRNA molecules are captured on the array by hybridizing the 3' end of the mRNA to gene-specific regions on the first capture probe. An example of the capture probes on the array capture device 100 is described in more detail with reference to Fig. 25A.

At step 2415, the first strand cDNA is synthesized. For example, gene-specific capture regions on the first capture probe are used as reverse transcriptase primers for first-strand cDNA synthesis from captured mRNA molecules.

At step 2420, the first strand cDNA is captured on the second capture probe. The first strand cDNA is captured on the second capture probe by hybridizing the 3' end of the cDNA to a gene-specific region on the second capture probe.

At step 2425, the second-strand cDNA is synthesized. For example, gene-specific regions on second capture probes are used as primers for the synthesis of second-stranded DNA molecules.

At step 2430, the second strand cDNA molecules are released from the capture matrix. For example, cDNA molecules are released from the capture matrix by a cleavage reaction.

At step 2435, the cDNA molecules are amplified to generate a sequencing library.

Figures 25A, 25B, and 25C illustrate the steps of the method 2400 of Figure 24. In this example, a single capture site 105 of the capture array 100 of Figure 1A is shown. Capture site 105 is essentially the same as described above with reference to FIG. 23A, except that capture probes 2310 are oriented in the same direction at capture site 105, i.e., both capture probe 2310a and capture probe 2310b are immobilized to capture site 105 in the 5' to 3' direction (ie, the 5' end of capture probes 2310a and 2310b are bound to the surface of capture site 105). The 2335a capture region is specific for the 3' end of an mRNA molecule, and the 2335b capture region is specific for the 3' end of the corresponding first-strand cDNA molecule.

At step 2410, a 2510 mRNA molecule is captured in a tissue sample on capture probe 2310a. For example, the tissue sample containing the 2510 mRNA molecule or a substrate comprising the 2510 mRNA molecule derived from the tissue sample (not shown) is contacted with the 2310 capture probes. The mRNA molecule 2510 may include a 2515 mutation. The 2510 mRNA molecule is captured at the 105 capture site by hybridization of the 3' end of the 2510 mRNA molecule with the 2335a capture region.

At step 2415, first-strand cDNA is synthesized using the 2335a capture region as a primer in a reverse transcription reaction.

At step 2420, a 2520 first-strand cDNA molecule is captured on the 2310b capture probe by hybridizing the 3' end of the 2520 cDNA molecule to the 2335b capture region.

At step 2425, the second-strand cDNA is synthesized in an extension reaction using the 2335b capture region as a primer.

At step 2430, a 2525 cDNA molecule is released from the 105 capture site by cleavage of the 2315 cleavable region. The 2525 cDNA molecule comprises the primer region of SBS 2320a (i.e., SBS3), the targeting region spatial address region 2325a (i.e., spatial address unique to the X dimension), UMI region 2330a, UMI region 2330b, spatial address region 2325b (i.e., spatial address unique to the Y dimension), and SBS primer region 2320b (ie SBS12).

At step 2435, the 2525 cDNA molecule is amplified using an SBS 2530 primer and a second SBS 2535 primer. The SBS 2530 primer comprises an SBS 2320a' region that is complementary to the SBS 2320a primer region and a P52540 region. The SBS 2535 primer comprises an SBS 2320b' region that is complementary to the SBS 2320b primer region and a P7 2545 region. An amplicon from the 2550 library synthesized using the SBS 2530 and 2535 primers is flanked at the 5-end ' through the P5 region 2540, the SBS primer region 2320a (i.e., SBS3), the spatial address region 2325a (i.e., spatial address unique to the X dimension), the UMI region 2330a, and at the 3-end ' by the UMI 2330b region, the spatial address region 2325b (ie, spatial address unique to the Y dimension), the SBS primer region 2320b (ie, SBS12), and the P72545 region.

In some embodiments, a combinatorial indexing system may involve the use of two different arrays, i.e. a first array comprising spatial address sequences for the X dimension and a second array comprising spatial address sequences for the Y dimension. For example, a first array can be used to transport reverse transcription (RT) primers to a tissue sample for in situ synthesis of cDNA, and a second array is used to capture the cDNA for generation of a sequencing library with spatial directions.

Figure 26A illustrates a plan view of an exemplary array 2600 for transporting RT primers to a tissue sample for in situ cDNA synthesis. Array 2600 comprises an arrangement, eg, rows, of delivery sites 2605 on solid support 2610. In this example, 10 delivery sites 2605 (eg, sites 2605a through 2605j) are disposed on a solid support 2610. In one example, solid support 2610 is a glass coverslip. A plurality of RT primers 2615 (eg, imprinted) are deposited in a stripe along the length of each delivery site 2605. RT primers 2615 are deposited at each delivery site 2605 so that they can be easily released from the 2600 matrix on a tissue sample.

Figure 26B illustrates a side view of a portion of a delivery site 2605 of array 2600, wherein the portion of delivery site 2605 comprises at least one RT primer 2615 for cDNA synthesis from mRNA in an array. tissue sample. In this example, a single 2615 RT primer is shown, but any number of 2615 RT primers can be deposited on the 2610 solid support at each 2605 delivery site. The 2615 RT primer comprises a region of 2620 SBS primer (for example, SBS3), a 2625 spatial address region (i.e., unique spatial address for the X dimension), and a 2630 gene-specific primer region. The 2615 RT primer has a unique 2625 spatial address region for each site 2605, ie, delivery site 2605a has a unique spatial address region 2625a, delivery site 2605b has a unique spatial address region 2625b, and so on. The gene-specific primer region 2630 may be the same gene-specific region or may be different gene-specific sequences.

Figure 27A illustrates a plan view of an exemplary capture array 2700 for capturing cDNA synthesized in situ using the RT primers 2615 of Figure 26B. Capture array 2700 comprises an arrangement, eg, columns, of capture sites 2705 on solid support 2710. In this example, 10 capture sites 2705 (eg, capture sites 2705a through 2705j) are arranged on a solid support 2710. In one example, solid support 2710 is a flat glass surface. A plurality of capture probes 2715 are deposited in a stripe along the length of each capture site 2705.

Figure 27B illustrates a side view of a capture site portion 2705 of the capture array 2700, wherein the capture site portion 2705 comprises at least one capture probe 2715 for capture of cDNA synthesized in situ using RT primers 2615 of Figure 26B. In this example, a single 2715 capture probe is shown, but any number of 2715 capture probes can be immobilized on the 2710 solid support at each 2705 capture site. The 2715 capture probe comprises a cleavable region 2720, a region of 2725 SBS primer (for example, SBS12), a 2730 spatial address region, a 2735 unique molecular identifier (UMI) region, and a 2740 gene-specific capture region. The 2715 capture probe has a unique spatial address region 2730 for each capture site 2705, ie, capture site 2705a has unique spatial address region 2730a, capture site 2705b has unique spatial address region 2730b, and so on. Capture region 2740 is complementary to capture region 2630 of capture probe 2615 of Figure 26B.

Figure 28 illustrates a flow diagram of an example of a 2800 method for generating a spatially addressed sequencing library, in which a first template is used for in situ synthesis of first-strand cDNA, and a second template is used to capture the cDNA for subsequent library generation. Method 2800 comprises, but is not limited to the following steps.

In a step 2810, a tissue sample comprising a plurality of mRNA molecules is contacted with a first matrix. The array is, for example, array 2600 of Figure 26A comprising a plurality of RT 2615 primers. Rt 2615 primers are released from array 2600 onto the tissue sample.

At step 2815, the first strand cDNA is synthesized in situ . For example, the gene-specific primer sequences in the RT primers are used to prime first-strand cDNA from target mRNA molecules in the tissue sample. After first-strand cDNA synthesis, the 2600 matrix is removed from the surface of the tissue sample.

At step 2820, the first strand cDNA is captured onto a second array and the second strand cDNA is synthesized. For example, capture array 2700 of Figure 27A comprising a plurality of capture probes 2715 is contacted with the tissue sample. First-strand cDNA is captured onto the 2700 capture array by hybridizing the 3' end of the cDNA to gene-specific regions on the 2715 capture probes. Second-strand cDNA is synthesized using gene-specific regions on the capture probe. 2715 as primers in an extension reaction.

At step 2825, the second-stranded cDNA molecules are released from the capture matrix. For example, cDNA molecules are released from the capture matrix by a cleavage reaction.

At step 2830, the cDNA molecules are amplified to generate a sequencing library.

Figures 29A and 29B illustrate the steps of the method 2800 of Figure 28. In step 2810, a tissue sample (not shown) comprising an mRNA molecule 2910 is contacted with matrix 2600 (not shown). . For example, the tissue sample containing the 2910 mRNA molecule or a substrate comprising the 2910 mRNA molecule derived from the tissue sample (not shown) is contacted with the 2600 matrix. The 2910 mRNA molecule can include a 2915 mutation. The 2615 RT primers are released from the 2600 array onto the tissue sample and hybridize to the 2910 mRNA molecule via the 2630 gene-specific region.

At step 2815, a first-stranded cDNA molecule 2920 is synthesized in situ using the specific region of 2630 gene as a primer in a reverse transcription reaction.

At step 2820, the capture array 2700 of FIG. 27A comprising a plurality of capture probes 2715 is contacted with the tissue sample. The first-strand 2920 cDNA is captured at the 2705 capture site by hybridizing the 3' end of the first-strand 2920 cDNA with the gene-specific capture region 2740. The second-strand cDNA is synthesized in an extension reaction using the 2740 gene-specific capture region as primer.

At step 2825, a 2925 second-strand cDNA is released from the 2705 capture site by cleavage of the 2720 cleavable region. The 2925 cDNA molecule comprises the SBS primer region 2725 (SBS12), the 2730 spatial address region (ie, the unique spatial address for the Y dimension), the UMI 2735 region, the 2625 spatial address region (ie, the unique spatial address for the X dimension), and the SBS primer region 2620 (SBS3).

At step 2830, the 2925 cDNA molecule is amplified using an SBS 2930 primer and an SBS 2935 primer. The SBS 2930 primer comprises a region of SBS 2725a that is complementary to the SBS 2725 primer region and a region P5 2940. The SBS 2935 primer comprises a region of SBS 2620a that is complementary to the SBS 2620 primer region and a P7 2945 region. An amplicon from the 2950 library synthesized using the SBS 2930 and 2935 primers is flanked at the 5' end by the P5 2940 region, the SBS primer region 2725 (i.e., SBS3), the 2730 spatial address region (i.e., spatial address unique to the Y dimension), the UMI 2735 region, and at the 3' end by the 2625 spatial address region (ie, spatial address exclusive to the X dimension), the SBS 2620 primer region (ie, SBS3), and the P72945 region.

In this example, the tissue sample is contacted with the 2715 capture probes that bind to the surface of the 2705 capture sites. The 2920 first-strand cDNA is captured at the 2705 capture site by 3-end hybridization. ' of the 2920 first-strand cDNA with the 2740 gene-specific capture sequence. In another example (not shown), the tissue sample is contacted with the 2700 capture matrix and the 2715 capture probes are released from the 2705 capture sites into the tissue sample by cleavage of the 2720 cleavable sequence. Second-strand cDNA is synthesized in an extension reaction using the 2740 gene-specific capture sequence as a primer.

4.5 Spatial Detection and Analysis of Nucleic Acid in a Tissue Sample Using Releasable Capture Probes

In other embodiments, a spatially targeted array is used to deliver capture probes to a tissue section for generation of a spatially targeted sequencing library. In this approach, spatially directional capture probes are deposited on the surface of a substrate (eg, a glass coverslip) at distinct capture sites or "features." In one example, spatially directional capture probes are anchored on the substrate surface by formation of a cleavable bond. Spatially directional capture probes are released into a tissue section by reversible bond cleavage and are incorporated into nucleic acid in subsequent steps of biochemical processing. In some embodiments, spatially directional capture probes are deposited on the substrate suspended in a matrix, such as a BioGel matrix. Spatially directional capture probes suspended in the BioGel are released into a tissue section, for example, by applying a heat treatment or a chemical treatment. Immobilization of spatially directional capture probes onto a substrate surface using a cleavable bond or BioGel suspension avoids the need to capture nucleic acid (i.e., RNA, cDNA, or genomic DNA) from a tissue section onto a substrate surface. substrate for the generation of a library with spatial addresses.

In one example, a spatially directed capture probe comprises a random primer sequence that is used for the in situ synthesis of cDNA from total RNA in a tissue sample.

Figure 30 illustrates a flowchart of an exemplary method 3000 for generating a spatially targeted cDNA library using releasable capture probes. Method 3000 comprises, but is not limited to the following steps.

In a step 3010, a coverslip is printed with capture probes with spatial addresses to form an array of spatial features. In one example, spatially directional capture probes are printed on a 2 cm x 2 cm coverslip to form an array of spatial features that are 100 gm in diameter with a height of 35 gm. Spatially targeted capture probes include a random primer sequence for cDNA synthesis in a reverse transcription reaction, a spatially targeted sequence, and a biotinylated SBS primer sequence as described in more detail with reference to Figures 31A . and 31B. Spatially directional capture probes also include a modification at the 5' end of the molecule for reversible binding to the coverslip. In one example, the spatially directional capture probes include a 5' disulfide modification as described in more detail with reference to Figures 32A, 32B and 32C. In some embodiments, the spatially-addressable capture probes include a photocleavable linker. 5' as described in more detail with reference to Figures 33A, 33B and 33C.

In a step 3015, the coverslip is placed on top of a semi-permeabilized FFPE tissue section mounted on a glass slide, such that the surface of the coverslip with the spatially directed capture probes thereon is in contact with the tissue section. .

In a step 3020, spatially addressed capture probes immobilized on the coverslip are released from the surface of the coverslip into the cellular space of the tissue section. In one example, spatially directional capture probes that include a 5' disulfide modification are released by flowing a solution of dithiothreitol (DTT) through the semi-permeabilized tissue section. In some embodiments, spatially directional capture probes that include a 5' photocleavable linker are released using ultraviolet light irradiation.

At step 3025, a first strand cDNA is synthesized in situ using a reverse transcription reaction. For example, a reverse transcription master mix solution is flowed between the coverslip and glass slide onto the semi-permeabilized tissue section. The coverslip acts as a barrier to prevent evaporation during the reaction. Due to the internal biotin label in the spatially directional capture probes used in the reverse transcription reaction, the first strand cDNA is biotinylated.

At step 3030, the RNA:cDNA hybrids dissociate and the cellular matrix breaks down. In one example, RNA:cDNA duplexes dissociate and the cell matrix is disrupted using NaOH solution. In some embodiments, the RNA:cDNA duplexes are dissociated and the cellular matrix is disrupted using a heat treatment protocol.

At step 3035, the semi-permeabilized tissue sample with RNA and cDNA on it is removed from the surface of the glass slide and collected in a collection tube. In one example, the tissue sample semi-permeated with RNA and first-strand cDNA is scraped off the glass slide into an Eppendorf tube. In some embodiments, the semi-permeated tissue sample with RNA and first-strand cDNA is removed from the glass slide by placing the slide in a 50 mL centrifuge tube and centrifuging to collect the material in a receptacle at the bottom of the tube.

In a step 3040, the biotinylated first-strand cDNA is purified using two rounds of a streptavidin bead-based purification protocol. The purified first-strand cDNA is collected in a PCR tube for subsequent processing steps. The cDNA molecule comprises an SBS primer sequence (eg, SBS12), a spatial targeting sequence, and the random primer sequence.

At step 3045, the first-strand cDNA is amplified in a multiplex reaction using a mixture of forward and reverse primer pairs flanking, eg, one or more target SNVs. For example, a forward primer comprises a gene-specific sequence that targets an SNV of interest, an SBS (eg, SBS3) primer sequence, and P5 sequences. The gene-specific sequence is designed to be approximately 50 bp upstream of a target SNV. A reverse primer comprises sequences complementary to SBS12 and P7 sequences.

At step 3050, the library amplicons are sequenced. For example, read 1 (eg, from about 50 bp to about 75 bp) of an SBS reaction provides sequence information for the target SNV and read 2 (about 25 bp) provides sequence information for spatial direction.

Figures 31A and 31B illustrate schematic diagrams of a spatially directed capture probe 3100 comprising a 5' disulfide modification and a spatially directed capture probe 3150 comprising a 5' photoscleavable linker, respectively. Referring to Figure 31A, spatially targeted capture probe 3100 comprises a random primer region 3110, a spatially targeted region 3115, and an SBS primer region 3120 (eg, SBS12). Random primer region 3110 can comprise, for example, a 6 bp sequence that can be used to prime cDNA synthesis from the entire transcriptome of a cell in a reverse transcription reaction. Spatial address region 3115 comprises a unique sequence for each spatial feature in an array. The SBS 3120 primer region comprises an internal 3125 biotin tag. The 3125 internal biotin tag is used to purify the cDNA in subsequent processing steps. The 3100 spatially directional capture probe also comprises a 5' disulfide modification 3130. The 3130 disulfide modification is used to reversibly anchor the 3100 spatially directional capture probe onto the surface of a glass substrate (e.g., glass coverslips). glass) as described in more detail with reference to Figures 32A, 32B and 32C.

Referring to Figure 31B, the spatially targeted capture probe 3150 is substantially the same as the spatially targeted capture probe 3100, except that the 5' end of the spatially targeted capture probe 3150 is modified with a linker. 3155 photocleavable amino linker. The 3155 photocleavable amino linker is used to reversibly anchor the 3150 spatially directional capture probe onto the surface of a glass substrate (eg, glass coverslips) as described in more detail with reference to Figures 33A, 33B and 33C.

Figures 32A, 32B and 32C illustrate an example of a reversible capture probe docking process with spatial direction 3100 of Figure 31A on the surface of a glass coverslip.

In a first step and referring now to Figure 32A, a glass coverslip 3210 functionalized with a plurality of thiol (SH) 3215 groups is provided. Thiol functionalized coverslips are commercially available.

In a next step and referring now to Figure 32B, spatially addressed capture probes 3100 are deposited (eg printed) onto the surface of glass coverslip 3210.

In a next step and referring now to Figure 32C, the spatially directional capture probes 3100 are anchored onto the surface of the glass coverslip 3210 by disulfide bond formation in a thiol-disulfide exchange reaction between the groups. 3215 thiol and 3130 disulfide modifications on the 3100 spatially addressed capture probes. The 3100 spatially addressed capture probes can subsequently be released from the 3210 glass coverslip by cleavage of the disulfide bond using a reducing agent. In one example, dithiothreitol (DTT) is used to cleave the disulfide bond and release the capture probes with spatial addresses 3100.

Figures 33A, 33B and 33C illustrate an example of a reversible docking process of capture probes with spatial directions 3150 of Figure 31B on the surface of a glass coverslip.

In a first step and referring now to Figure 33A, a 3310 glass coverslip functionalized with a plurality of 3315 aldehyde groups is provided. Aldehyde functionalized glass substrates are commercially available.

In a next step and referring now to Figure 33B, spatially directional capture probes 3150 are deposited onto the surface of glass coverslip 3310.

In a next step and referring now to Figure 33C, the spatially directional capture probes 3150 are anchored onto the surface of the glass coverslip 3310 by formation of a covalent bond between the aldehyde groups 3315 and the photocleavable amino linkers 3155. into the 3150 spatially targeted capture probes. The 3150 spatially targeted capture probes can subsequently be released from the 3310 glass coverslip by cleavage of the covalent bond using ultraviolet light irradiation (eg, 350 nm for about 5 minutes).

Figures 34A and 34B graphically show the steps of the method 3000 of Figure 30. In step 3010, a coverslip 3410 is printed with spatially directional capture probes (not shown) to form an array of spatial features 3415. In a For example, spatially directional capture probes are printed on a 2 cm x 2 cm coverslip to form an array of 3415 spatial features that are 100 gm in diameter with a height of 35 gm. Spatially targeted capture probes are, for example, the 3100 spatially targeted capture probe of Figure 31 which are used to capture the entire transcriptome of a cell.

At step 3015, coverslip 3410 is placed on top of a semi-permeabilized tissue section 3420 that is mounted on a glass slide 3425. Tissue section 3420 comprises a plurality of cells 3430. Each cell contains one or more RNA molecules 3435 One or more 3435 RNA molecules may include a 3440 single nucleotide variation (SNV).

At step 3020, spatially directional capture probes (indicated by arrows) immobilized on coverslip 3410 are released from the coverslip surface into the cell space.

At step 3025, first-strand cDNA is synthesized in situ in a reverse transcription reaction using random primer sequences 3110 on the spatially directed capture probe 3100. For example, a reverse transcription master mix solution is flowed (not shown) between the 3410 coverslip and the 3425 glass slide to the 3420 semi-permeabilized tissue section.

At step 3030, the RNA:cDNA hybrids dissociate and the cellular matrix in the 3420 tissue sample breaks to release a 3445 cDNA molecule. In one example, the RNA:cDNA duplexes dissociate and the cellular matrix breaks using a NaOH solution. In some embodiments, the RNA:cDNA duplexes are dissociated and the cellular matrix is disrupted using a heat treatment protocol.

At step 3035, the 3420 semi-permeabilized tissue sample with the 3430 cells, 3435 RNA molecules, and 3445 cDNA molecules thereon are extracted from the surface of the 3425 glass slide and collected in a 3450 collection tube. In one example, the 3420 semi-permeabilized tissue sample with the 3430 cells, 3435 RNA molecules, and 3445 cDNA molecules is scraped off the 3425 glass slide into an Eppendorf tube. In some embodiments, the 3420 semi-permeabilized tissue sample with the 3430 cells, 3435 RNA molecules, and 3445 cDNA molecules on it is removed from the 3425 glass slide by placing the 3425 glass slide in a 50 mL centrifuge tube and centrifuging to collect the material in a receptacle at the bottom of the 50 ml tube.

In step 3040, the 3445 biotinylated cDNA molecules are purified using two rounds of a streptavidin bead-based purification protocol.

In step 3045, the 3445 cDNA molecules are amplified in a multiplex reaction using a mixture of forward and reverse primer pairs that flank the target SNVs. For example, a 3455 forward primer comprises a 3460 gene-specific region that targets an SNV (eg, SNV 3440) of interest, a 3465 SBS (eg, SBS3) primer region, and a 3470 P5 region. The specific region of the 3460 gene is designed to be approximately 50 bp upstream of a target SNV. A 3475 reverse primer comprises a complementary region of SBS12 3120a and a P7 3480 region. the 3110 random primer region, the 3115 spatial address region, the 3120 SBS primer region, and the P73480 region.

At step 3050, the library amplicons are sequenced. For example, read 1 (eg, from about 50 bp to about 75 bp) of an SBS reaction provides sequence information for the target SNV and read 2 (about 25 bp) provides sequence information for spatial direction.

In some embodiments, a spatially targeted capture probe comprises sequences for in situ targeted capture and amplification of genomic DNA in a tissue sample. In one example, capture and amplification of target genomic DNA regions is performed using a TSCA-like strategy (TruSeq Custom Amplicon, Illumina). In the TSCA-like approach, a pair of capture probes flanking a target region of interest (eg, an SNV) is used to capture genomic DNA. Figure 35 illustrates a schematic diagram of an exemplary pair of capture probes 3500 for capturing a region of genomic DNA of interest. The 3500 capture probe pair comprises a first capture probe 3510 that hybridizes 5' to a region of interest and a second capture probe 3515 that hybridizes 3' to the region of interest. The first capture probe 3510 comprises an SBS primer region 3520a (eg, SBS12), a spatial address region 3525, and a gene-specific region 3530a. The second capture probe 3515 comprises an SBS 3520b primer region (eg, SBS3) and a 3530b gene-specific region.

Figure 36 illustrates a flowchart of an exemplary method 3600 for generating a spatially addressed genomic amplicon library using releasable capture probes. In this example, the capture and amplification of target genomic DNA regions is performed using a TSCA-like strategy (TruSeq Custom Amplicon, Illumina). Method 3600 comprises, but is not limited to the following steps.

At step 3610, a coverslip with spatially directional capture probes is placed on top of a semi-permeabilized FFPE tissue section mounted on a glass slide. In one example, spatially directional capture probes are suspended in a BioGel matrix that is deposited on the surface of the coverslip. Spatially addressed capture probes are a pair of probes that include DNA sequences that flank a region of interest (eg, an SNV) in genomic DNA. The capture probes also include sequences for subsequent PCR amplification (for example, SBS3 and SBS12 sequences) as described above with reference to Figure 35. One (or both) of the capture probes may also include a capture marker. internal biotin for subsequent purification of the target DNA region. Capture probes are released from the BioGel matrix onto the tissue section using, for example, a heat treatment protocol.

In a step 3615, the capture probes are hybridized to genomic DNA and an in situ docking/extension reaction is performed between the flanking capture probes through the target region of interest.

In step 3620, the extension/coupling products are purified. For example, the tissue sample with extension/docking products on it is removed from the surface of the glass slide and collected in a collection tube. The extension/coupling products are then purified using one or more rounds of a purification protocol, such as a streptavidin bead-based purification protocol.

At step 3625, the extension/docking products are amplified by PCR to add sequencing primers and indices.

At step 3630, the amplicons in the library are sequenced.

Figure 37 illustrates the steps of the method 3600 of Figure 36. In step 3610, a coverslip 3710 with spatially directed capture probes in a BioGel matrix is placed on top of a semi-permeabilized FFPE tissue section 3715 mounted on a glass slide. 3720. The 3715 tissue section comprises a 3725 cell. The 3725 cell comprises a region of 3730 target genomic DNA. The 3730 genomic DNA may include a 3735 SNV. The 3510 first capture probe and 3515 second capture probe are released into tissue section 3715 using a heat treatment protocol.

At step 3615, the first capture probe 3510 and the second capture probe 3515 are hybridized to the genomic DNA and an in situ docking/extension reaction is performed between the flanking capture probes through the target region of interest to generate a 3740 extension/coupling product.

In step 3620, the 3740 extension/docking product is purified. For example, the tissue sample with the 3740 extension/docking product is removed from the surface of the glass slide and collected in a 3745 collection tube. Extension/coupling product 3740 is then purified using one or more rounds of a purification protocol, such as a streptavidin bead-based purification protocol.

In step 3625, the 3740 extension/docking product is amplified by PCR using a 3750 forward primer and a 3755 reverse primer to add sequencing adapters. The 3750 forward primer comprises an SBS 3520b' region that is complementary to the SBS 3520b primer region and a P53760 region. The 3755 reverse primer comprises an SBS 3520a' region that is complementary to 3520a and a P73765 region.

4.6 Particle-Based Nucleic Acid Capture

In some embodiments, nucleic acids in tissue samples may first be captured by probes immobilized on particles, such as nanoparticles, and then transferred to a capture matrix described herein. Particle-based nucleic acid transfer can increase the efficiency, eg, yield or kinetics, of nucleic acid transfer from the tissue sample to the capture matrix.

Nucleic acids can be transferred from a tissue sample to a capture matrix by transferring particles comprising the nucleic acids from the tissue sample to the capture matrix. Particle transfer can be facilitated, for example, by using magnetically responsive particles, such as magnetically responsive nanoparticles, and applying a magnetic field to the tissue sample and capture matrix to facilitate transfer of the magnetically responsive nanoparticles from the tissue sample to the capture matrix. In some embodiments, the transfer of particles from the tissue sample to the capture matrix may be facilitated, for example, by using a molecular interaction, such as a ligand-binding interaction (eg, a streptavidin-biotin interaction). For example, particle transfer can be facilitated, for example, by the use of streptavidin-coated particles, such as streptavidin-coated nanoparticles, and a biotin-coated capture matrix. Alternatively, any protein-protein, protein-small molecule, or nucleic acid-nucleic acid interaction, or any specific chemical reaction (eg, "click chemistry") may be used to facilitate rapid or complete transfer of particles comprising a nucleic acid from the tissue sample to the capture matrix.

A variety of probes can be immobilized on the particles to capture nucleic acids from the tissue sample and combined with a variety of probes on a capture matrix described herein. In some embodiments, the probes on the particles consist essentially of capture regions to capture nucleic acids from the tissue sample (plus, for example, additional elements to immobilize the probes to the particle). In some embodiments, the probes on the particles may comprise a capture region and a spatial address region (eg, a partial or combinatorial spatial address region, or a full spatial address region). The probe-coated particles described herein can be used in combination with, for example, capture arrays comprising capture sites having probes comprising essentially a cleavable region, or a cleavable region and a spatial targeting region (eg , a partial or combinatorial spatial address region, or a full spatial address region), or a cleavable region, a spatial address region, and a capture region (eg, a region for capturing nucleic acids on particles), or any other combination of regions.

In some embodiments, magnetically responsive nanoparticles are used to capture nucleic acid (eg, cDNA synthesized in situ) in a tissue sample for generation of a spatially targeted library.

In some embodiments, the magnetically responsive nanoparticles may comprise immobilized probes that essentially comprise a capture region (eg, a gene-specific or universal capture region). In some embodiments, the probes may further comprise an SBS primer region (eg, an SBS3 or SBS12 region) or other universal regions, such as P5 or P7 regions. In some embodiments, the nanoparticles are used in combination with a capture array comprising capture probes comprising a cleavable region, a spatial targeting region, and a capture region (eg, a gene-specific capture region). In some embodiments, the probes on the capture array further comprise an SBS primer region (eg, an SBS 3 or SBS12 region) or other universal regions, such as P5 or P7 regions.

Figure 38 illustrates a flow diagram of an exemplary method 3800 for generating a spatially addressed sequencing library using particles, such as magnetically responsive nanoparticles, to capture a nucleic acid from a tissue sample.

At step 3810, cDNA is synthesized from the target mRNA in a tissue sample by reverse transcription in situ. In some embodiments, the cDNA is a gene-specific (ie, targeted) cDNA. In some embodiments, the cDNA is a random cDNA or a cDNA that represents the mRNA in bulk. For example, in some embodiments, a gene-specific RT primer attached to the surface of a particle, such as a magnetically responsive nanoparticle, can be used to prime first-strand cDNA synthesis in a reverse transcription reaction.

At step 3815, the first-stranded cDNA bound to the surface of, for example, a nanoparticle magnetically sensitive is captured over a matrix. The array is, for example, a glass substrate that is imprinted with spatially directional capture probes to form an array of capture sites. Spatially targeted capture probes may comprise, for example, a cleavable polylinker sequence, a spatially targeted sequence, and a gene-specific capture sequence that is complementary to a sequence in the first-strand cDNA. Spatially directional capture probes can be attached to the glass substrate via the cleavable polylinker sequence. The spatial address sequence is typically a unique sequence for each spatial feature in the array. Each spatial feature may include a plurality of spatially targeted capture probes with different gene-specific capture sequences. A magnet can be placed near the matrix. The reaction can be heated to an incubation temperature of approximately 95°C for approximately 1 minute to denature the RNA:cDNA hybrids. In the vicinity of the magnet, first-strand cDNA bound to the surface of a magnetically responsive nanoparticle can anchor on the surface of the array. First-strand cDNA molecules can be captured on the array by hybridization (eg, at about 60°C for about 10 minutes) with the gene-specific capture sequences in the spatially targeted capture probes.

At step 3820, the second-strand cDNA can be synthesized. For example, the magnet is removed from the vicinity of the array and first-strand cDNA molecules that are not hybridized to gene-specific capture sequences in the spatially targeted capture probes can be removed by washing. The second strand cDNA is synthesized in an extension reaction using the second gene-specific capture sequence as a primer.

At step 3825, the double-stranded cDNA can be released from the capture matrix by cleavage of the cleavable polylinker sequence.

At step 3830, the double-stranded cDNA can optionally be end-repaired and ligated to sequencing adapters to generate a sequencing library. In embodiments where the RT primer and the capture primer on the capture matrix comprise regions of the SBS primer, end repair

Figure 39 illustrates the steps of an exemplary method 3800 of Figure 38. That is, a tissue section (not shown) comprises a 3910 target RNA molecule. The 3910 target RNA molecule may include a 3915 mutation. In step 3810, the cDNA is synthesized in situ using a 3920 gene-specific RT primer in a reverse transcription reaction. The 3920 RT primer is bound to the surface of a 3925 magnetically responsive nanoparticle. A 3930 cDNA molecule synthesized using the 3920 RT primer binds to the 3925 magnetically responsive nanoparticle.

At step 3815, the 3930 cDNA molecules are captured onto an array comprising a plurality of 3935 capture sites. In this example, a single 3935 capture site is shown. The 3935 capture site comprises a targeting capture probe. 3940 spatial targeting capture probe comprises a 3945 cleavable polylinker region, a 3950 spatial targeting region, and a 3955 gene-specific capture region that is complementary to a sequence in the first-strand cDNA. The 3940 spatially directed capture probe binds to the 3935 capture site via the 3945 cleavable polylinker region. A 3960 magnet is placed near the 3935 capture site. The reaction is heated to an incubation temperature of approximately 95° C for approximately 1 minute to denature the RNA:cDNA hybrids. In the vicinity of the 3960 magnet, the 3930 first-strand cDNA molecules bound to the surface of the 3925 magnetically responsive nanoparticle anchor onto the 3935 surface capture site. The 3930 first-strand cDNA molecules are captured onto the 3935 capture site by hybridization (eg, at about 60°C for about 10 minutes) with the 3955 gene-specific capture region on the 3940 spatially directed capture probe. .

At step 3820, the second-strand cDNA is synthesized. For example, the 3960 magnet is removed from the vicinity of the 3935 capture site and 3930 first-strand cDNA molecules that do not hybridize to the 3955 gene-specific capture sequence in the 3940 spatially directed capture probe are removed by washed. Second-strand cDNA is synthesized in an extension reaction using the 3955 gene-specific capture region as a primer.

At step 3825, a 3965 double-stranded cDNA molecule now comprising the 3950 spatial address region is released from the 3935 capture site by cleavage of the 3945 cleavable polylinker region.

At step 3830 (not shown in FIG. 39), the 3965 double-stranded cDNA molecule is optionally end-repaired and coupled to sequencing adapters to generate a spatially addressed sequencing library.

In some embodiments, the RT primer and the capture primer on the capture matrix may optionally and independently comprise additional regions, such as SBS primer regions (eg, SBS3 or SBS12 regions) or universal regions (eg, P5 regions). or P7) that can, for example, be incorporated into the 3965 double-stranded cDNA molecule.

In another aspect, a method for the spatial detection and analysis of nucleic acids in a tissue sample is provided herein, comprising providing a magnetically responsive nanoparticle (eg, 3925) comprising an immobilized capture probe comprising a capture region (eg, 3920).

In some embodiments, the capture region is a gene-specific capture region (comprising, eg, a TSCA sequence). In some embodiments, the capture region is a universal capture region (comprising, eg, a poly-T sequence or a random nucleic acid sequence).

In some embodiments, the immobilized capture probe does not include a spatial address region.

In some embodiments, the method further comprises contacting the magnetically responsive nanoparticle with a tissue sample such that the position of the magnetically responsive nanoparticle on the tissue sample can be correlated with the position of a nucleic acid in the tissue sample. , and allowing the acidic nucleic acid to hybridize to the capture region of the immobilized capture probe.

In some embodiments, the method further comprises extending the capture region of the immobilized capture probe to form an immobilized complementary first strand of nucleic acid hybridized to the capture region (eg, 3930).

In some embodiments, the method further comprises contacting the tissue sample with a capture matrix such that the position of a capture site on the capture matrix can be correlated to a position on the tissue sample, wherein the capture array comprises a capture site (eg 3935) comprising a capture probe immobilized on a surface (eg 3940), wherein the capture probe comprises a cleavable region (eg 3945), a spatial address region (eg, 3950) and a gene-specific region (eg, 3955).

In some embodiments, the method further comprises applying a magnetic field to the capture matrix and tissue sample to transfer the magnetically responsive nanoparticle with the immobilized first complementary strand to the capture matrix, and allowing the immobilized first complementary strand to hybridize. with the capture region of the capture probe on the capture matrix.

In some embodiments, the method further comprises extending the capture region of the capture probe onto the capture matrix to form an immobilized complementary second strand of nucleic acid (eg, the newly synthesized strand of 3965).

In some embodiments, the method further comprises cleaving the capture probe on the capture matrix at the cleavable domain to release a complementary spatially labeled second strand from the surface of the capture matrix.

In some embodiments, the method further comprises analyzing the sequence of the released spatially tagged complementary second strand.

In some embodiments, the method further comprises correlating the sequence of the released spatially tagged complementary second strand with the position of the nucleic acid in the tissue sample.

In some embodiments, particle-associated probes (eg, nanoparticles) may be hybridized to a nucleic acid from a tissue sample prior to immobilizing the probe to the nanoparticle, and then the probe-nucleic acid hybrid may be immobilized to the nanoparticle. In some embodiments, a probe hybridized to a nucleic acid from the tissue sample can be extended to form a nucleic acid complementary to the nucleic acid from the tissue sample, and then the complementary nucleic acid can be immobilized on the nanoparticle. In some embodiments, the probes may comprise a linker element for attaching a probe-nucleic acid hybrid or complementary nucleic acid to the nanoparticle.

Figures 40A and 40B illustrate an example of a process 4000 of using a capture probe to form complementary nucleic acid in a tissue sample and subsequently immobilize the complementary nucleic acid to a nanoparticle.

In a first step and referring now to Figure 40A, a capture probe 4010 hybridizes to a nucleic acid 4015 from a tissue sample. Capture probe 4010 includes capture region 4015 and linker 4020. In one example, capture region 4015 comprises a random primer sequence. In another example, the 4015 capture region comprises a gene-specific primer sequence. Connector element 4020 is an element for attaching a nucleic acid-probe hybrid or complementary nucleic acid to a nanoparticle. In one example, nucleic acid molecule 4025 is a genomic DNA molecule. In another example, nucleic acid molecule 4025 is an RNA molecule. Capture probe 4010 hybridizes to nucleic acid molecule 4025 from a tissue sample and is extended to form a complementary nucleic acid molecule 4025a.

In a next step and referring now to Figure 40B, complementary nucleic acid 4025a is immobilized to nanoparticle 4030 via linker element 4020 on capture probe 4010. In one example, nanoparticle 4030 is a magnetically responsive nanoparticle. .

In another aspect, a method for the spatial detection and analysis of nucleic acids in a tissue sample is provided herein, comprising providing a primer comprising a capture region and a linker element (eg, a biotin moiety). , a thiol group, or other chemical linker).

In some embodiments, the capture region is a gene-specific capture region (comprising, eg, a TSCA sequence). In some embodiments, the capture region is a universal capture region (comprising, eg, a poly-T sequence or a random nucleic acid sequence).

In some embodiments, the method further comprises contacting a tissue sample with the primer and allowing the primer to anneal to a nucleic acid from the tissue sample.

In some embodiments, the method further comprises extending the primer to form an immobilized complementary first strand of nucleic acid hybridized to the primer.

In some embodiments, the method further comprises contacting the tissue sample with a magnetically responsive nanoparticle (eg, a streptavidin-coated magnetically responsive nanoparticle), such that the position of the magnetically responsive nanoparticle on the tissue sample can be correlated. with the position of the extended primer in the tissue sample, and immobilizing the extended primer comprising the immobilized first strand of nucleic acid to the magnetically responsive nanoparticle on the connector element.

In some embodiments, the method further comprises contacting the tissue sample with a capture matrix such that the position of a capture site on the capture matrix can be correlated to a position in the tissue sample, where the capture array comprises a capture site comprising a capture probe immobilized on a surface, wherein the capture probe comprises a cleavable region, a spatial targeting region and a gene-specific region.

In some embodiments, the method further comprises applying a magnetic field to the capture matrix and tissue sample to transfer the magnetically responsive nanoparticle with the immobilized first complementary strand to the capture matrix and allow the immobilized first complementary strand to hybridize with the gene-specific region of the capture probe on the capture matrix.

In some embodiments, the method further comprises extending the gene-specific region of the capture probe onto the capture matrix to form an immobilized complementary second strand of nucleic acid.

In some embodiments, the method further comprises cleaving the capture probe on the capture matrix to release a second complementary spatially labeled strand from the surface of the capture matrix.

In some embodiments, the method further comprises analyzing the sequence of the released spatially tagged complementary second strand.

In some embodiments, the method further comprises correlating the sequence of the released spatially tagged complementary second strand with the position of the nucleic acid in the tissue sample.

In some embodiments, a particle (eg, a magnetically responsive nanoparticle) may comprise an immobilized probe comprising a capture region (eg, a gene-specific or universal capture region) and a first partial targeting region. In some embodiments, the particle-associated probe may further comprise an SBS primer region (eg, an SBS3 or SBS12 region) or other universal region, such as a P5 or P7 region. In some embodiments, the particles can be used in combination with a capture array comprising a capture probe comprising a cleavable region, a second spatial address region, and a capture region (eg, a gene-specific capture region). ). In some embodiments, the probe on the capture array may further comprise an SBS primer region (eg, an SBS 3 or SBS12 region) or another universal region, such as a P5 or P7 region.

Figures 41A and 41B illustrate schematic diagrams of an example of a particle-associated capture probe comprising a first partial spatial address region and a second array capture probe comprising a second partial address region, respectively, for Spatial detection and analysis of nucleic acids in a tissue sample. Referring now to Figure 41A, a particle-associated capture probe 4110 comprises a capture region 4115 (eg, a universal or gene-specific capture region) and a first partial targeting region 4120 immobilized on a particle 4125. In one example, particle 4125 is a magnetically responsive nanoparticle. The 4110 capture probe hybridizes to a 4130 nucleic acid molecule from a tissue section and is extended (indicated by the arrow) to form a complementary nucleic acid to the 4130 nucleic acid molecule. The complementary nucleic acid comprises the first partial address region 4120 and particle 4125. The first partial address region 4120 identifies the position of a capture site along a first dimension of a capture matrix. In some embodiments, a magnetic field is used

particle 4125 to an array comprising an array capture probe.

Referring now to Figure 41B, an array capture probe 4135 comprises a capture region 4140 (eg, a gene-specific capture region), a second partial targeting region 4145 and SBS 4150 region, and a 4155 cleavable region. The 4135 array capture probe can be immobilized on the surface of a capture array ( not shown) via cleavable region 4155. The array capture probe 4135 on a capture array (not shown) can be contacted with a tissue sample comprising nucleic acid molecules labeled with the first region of partial address 4120 of FIG. 41A such that the position of the array capture probe 4135 can be correlated to a position in the tissue sample. Second partial address region 4145 identifies the position of a capture site along a second dimension of a capture matrix.

In another aspect, a method for the spatial detection and analysis of nucleic acids in a tissue sample is provided herein, comprising providing a magnetically responsive nanoparticle comprising an immobilized capture probe comprising a capture region and a first partial spatial direction region.

In some embodiments, the capture region is a gene-specific capture region (comprising, eg, a TSCA sequence). In some embodiments, the capture region is a universal capture region (comprising, eg, a poly-T sequence or a random nucleic acid sequence).

In some embodiments, the first partial spatial address region identifies the position of a capture site along a first dimension of a capture matrix.

In some embodiments, the method further comprises contacting the magnetically responsive nanoparticle with a tissue sample such that the position of the magnetically responsive nanoparticle on the tissue sample can be correlated with the position of a nucleic acid in the tissue sample. , and allowing the acidic nucleic acid to hybridize to the capture region of the immobilized capture probe.

In some embodiments, the method further comprises extending the capture region of the immobilized capture probe to form a first immobilized complementary strand of nucleic acid hybridized to the capture region, wherein the first immobilized complementary strand comprises the first targeting region. partial.

In some embodiments, the method further comprises contacting the tissue sample with a capture matrix such that the position of a capture site on the capture matrix can be correlated to a position in the tissue sample, where the capture array comprises a capture site comprising a capture probe immobilized on a surface, wherein the capture probe comprises a cleavable region, a second partial targeting region and a gene-specific region.

In some embodiments, the second partial spatial address region identifies the position of a capture site along a second dimension of a capture matrix.

In some embodiments, the method further comprises applying a magnetic field to the capture matrix and tissue sample to transfer the magnetically responsive nanoparticle with the immobilized first complementary strand to the capture site of a capture matrix and allow the first complementary strand to immobilized hybridizes to the capture region of the capture probe at the capture site of the capture array.

In some embodiments, the method further comprises extending the capture region of the capture probe over the capture site to form an immobilized second complementary strand of nucleic acid, wherein the second complementary strand of nucleic acid comprises the first and second regions. partial spatial address.

In some embodiment, the combination of the first and second partial spatial address regions defines the position of the capture site on the capture matrix.

In some embodiments, the method further comprises cleaving the capture probe on the capture matrix at the cleavable domain to release a complementary spatially labeled second strand from the surface of the capture matrix.

In some embodiments, the method further comprises analyzing the sequence of the released spatially tagged complementary second strand.

In some embodiments, the method further comprises correlating the sequence of the released spatially tagged complementary second strand with the position of the nucleic acid in the tissue sample.

In another aspect, a method for the spatial detection and analysis of nucleic acids in a tissue sample is provided herein, comprising providing a magnetically responsive nanoparticle comprising an immobilized capture probe comprising a capture region.

In some embodiments, the immobilized capture probe does not comprise a spatial address region.

In some embodiments, the capture region is a gene-specific capture region (comprising, eg, a TSCA sequence). In some embodiments, the capture region is a universal capture region (comprising, eg, a poly-T sequence or a random nucleic acid sequence).

In some embodiments, the method further comprises contacting the magnetically responsive nanoparticle with a tissue sample such that the position of the magnetically responsive nanoparticle on the tissue sample can be correlated with the position of a nucleic acid in the tissue sample. , and allowing the acidic nucleic acid to hybridize to the capture region of the immobilized capture probe.

In some embodiments, the method further comprises extending the capture region of the immobilized capture probe to form an immobilized complementary first strand of nucleic acid hybridized to the capture region.

In some embodiments, the immobilized first complementary strand does not comprise a spatial address region.

In some embodiments, the method further comprises contacting the tissue sample with a capture matrix such that the position of a capture site on the capture matrix can be correlated to a position in the tissue sample, where the capture matrix comprises a capture site comprising a probe immobilized on a surface, wherein the probe comprises a spatial address region.

In some embodiments, the probe does not comprise a capture region.

In some embodiments, the method further comprises applying a magnetic field to the capture matrix and tissue sample to transfer the magnetically responsive nanoparticle with the immobilized first complementary strand to the capture site of a capture matrix, and coupling the first complementary strand. immobilized to the spatial direction region of the probe on the capture matrix to immobilize the complementary first strand at both ends on the capture matrix and on the magnetically responsive nanoparticle.

Figures 42A and 42B illustrate schematic diagrams of an example of a particle-associated capture probe and a second array capture probe comprising a spatial address region, respectively, for the spatial detection and analysis of nucleic acids in an array. tissue sample. Referring now to Figure 42A, a particle-associated capture probe 4210 comprises a capture region 4215 (eg, a universal or gene-specific capture region) immobilized on a magnetically responsive nanoparticle 4220. The capture probe 4210 hybridizes to a 4225 nucleic acid molecule from a tissue section and is extended (indicated by the arrow) to form a complementary nucleic acid to the 4225 nucleic acid molecule. The complementary nucleic acid comprises the 4220 magnetically responsive nanoparticle. In some embodiments, a magnetic field is used to transfer the complementary nucleic acid molecule comprising the magnetically responsive nanoparticle 4220 onto an array comprising an array capture probe.

Referring now to Figure 42B, an array capture probe 4230 comprises a spatial address region 4235 and a cleavable region 4240. The array capture probe 4230 can be immobilized on the surface of a capture array (not shown). ) through the 4240 cleavable region. The 4230 array capture probe on one surface of the capture array (not shown) can be contacted with a tissue sample comprising the nanoparticle-tagged complementary nucleic acid molecules. magnetically responsive 4220 of FIG. 42A so that the position of the array capture probe 4230 can be correlated with a position in the tissue sample. Complementary nucleic acids comprising magnetically responsive nanoparticle 4220 can be captured onto capture probe 4230 by coupling to spatial address region 4235. Spatial address region 4240 identifies the position of a capture site on the array.

In some embodiments, the first complementary strand comprises a spatially addressable region when immobilized at both ends on the capture matrix and on the magnetically responsive nanoparticle.

In some embodiments, the capture probe immobilized on the magnetically responsive nanoparticle and the spatial targeting region each optionally further comprise a primer binding region (e.g., an SBS primer binding region, such as an SBS3 region or SBS12). In some embodiments, the method further comprises synthesizing a second complementary strand using a pair of primers complementary to the primer binding regions on the first complementary strand, wherein the second complementary strand comprises the spatial address region, and releasing the second complementary strand from the surface of the capture matrix. In some embodiments, the method further comprises analyzing the sequence of the released second complementary strand and correlating the sequence of the released second complementary strand with the position of the nucleic acid in the tissue sample.

In some embodiments, the capture probe immobilized on the magnetically responsive nanoparticle and the spatial address region each optionally further comprise a cleavable region (eg, the same cleavable region or different cleavable regions). In some embodiments, the method further comprises releasing the immobilized first complementary strand by cleaving cleavable regions on the immobilized first complementary strand. In some embodiments, the method further comprises analyzing the sequence of the released complementary first strand and correlating the sequence of the released second complementary strand with the position of the nucleic acid in the tissue sample.

In some embodiments, a particle (eg, a magnetically responsive nanoparticle) may comprise an immobilized probe comprising a capture region (eg, a universal or gene-specific capture region), a first primer-binding region (eg, an SBS primer region, such as an SBS3 or SBS 12 region ) and a spatial direction region. In some embodiments, the particle-associated probe may further comprise another universal region, such as a P5 or P7 region. In some embodiments, the particles can be used in combination with a capture array comprising a capture probe essentially comprising a second primer-binding region (eg, an SBS primer region, such as an SBS 3 or SBS12 region). ) and, optionally, another universal region, such as a P5 or P7 region.

Figures 43A and 43B illustrate schematic diagrams of an example of a particle-associated capture probe and a second array capture probe, respectively, for spatial detection and nucleic acid analysis of a tissue sample. Referring now to Figure 43A, a particle-associated capture probe 4310 comprises a capture region 4315 (eg, a universal or gene-specific capture region), a spatial address region 4320, and a first binding site. to the 4325 primer (eg, an SBS primer region of SBS3) immobilized on a magnetically responsive 4330 nanoparticle. The 4310 capture probe can be brought into contact with a tissue sample (not shown), such that the position of the 4310 capture probe on the tissue sample can be correlated with the position of a 4335 nucleic acid molecule. in the tissue sample. The 4310 capture probe hybridizes to the 4335 nucleic acid molecule from the tissue section and is extended (indicated by the arrow) to form a nucleic acid complementary to the 4335 nucleic acid molecule. sample) comprises the 4320 spatial address region, the 4325 first primer binding site, and the 4330 magnetically responsive nanoparticle. In some embodiments, a magnetic field generated by a magnet (not shown) is used to facilitate transfer of the molecule. of complementary nucleic acid comprising the magnetically responsive nanoparticle 4330 to an array comprising an array capture probe.

Referring now to Figure 43B, an array capture probe 4340 comprises a second primer binding site 4325a (eg, an SBS SBS12 primer region) that is different from the first primer binding site 4325 of Figure 43A. The 4340 array capture probe can be immobilized on the surface of a capture array (not shown). Array capture probe 4340 on a capture array surface (not shown) can be contacted with a tissue sample comprising complementary nucleic acid molecules labeled with magnetically responsive nanoparticle 4330 of Figure 43A. Complementary nucleic acid comprising the magnetically responsive nanoparticle 4330 can be captured on the capture probe 4340 by coupling to the second primer binding site 4325a.

In another aspect, a method for the spatial detection and analysis of nucleic acids in a tissue sample is provided herein, comprising providing a magnetically responsive nanoparticle comprising an immobilized capture probe comprising a capture region, a first primer binding region and a spatial address region.

In some embodiments, the capture region is a gene-specific capture region (comprising, eg, a TSCA sequence). In some embodiments, the capture region is a universal capture region (comprising, eg, a poly-T sequence or a random nucleic acid sequence).

In some embodiments, the method further comprises contacting the magnetically responsive nanoparticle with a tissue sample such that the position of the magnetically responsive nanoparticle on the tissue sample can be correlated with the position of a nucleic acid in the tissue sample. , and allowing the acidic nucleic acid to hybridize to the capture region of the immobilized capture probe.

In some embodiments, the method further comprises extending the capture region of the immobilized capture probe to form an immobilized complementary first strand of nucleic acid hybridized to the capture region, wherein the immobilized complementary first strand comprises the spatial address region .

In some embodiments, the method further comprises contacting the tissue sample with a capture matrix such that the position of a capture site on the capture matrix can be correlated to a position in the tissue sample, where the capture array comprises a capture site comprising a capture probe immobilized on a surface, wherein the capture probe essentially comprises a second primer-binding region (e.g., an SBS primer region, such as an SBS3 region or SBS12).

In some embodiments, the method further comprises applying a magnetic field to the capture matrix and tissue sample to transfer the magnetically responsive nanoparticle with the immobilized first complementary strand to the capture site of a capture matrix and couple the immobilized first complementary strand. to the capture probe. at the capture site of the capture matrix to immobilize the complementary first strand at both ends.

In some embodiments, the method further comprises synthesizing a second complementary strand using a primer complementary to the first primer-binding sequence of the first capture probe and releasing the second complementary strand from the surface of the capture matrix.

In some embodiments, the method further comprises analyzing the sequence of the released second complementary strand and correlating the sequence of the released second complementary strand with the position of the nucleic acid. in the tissue sample.

Figure 44 illustrates a perspective view of a magnetism-based transfer system 4400 that is configured for spatial detection and analysis of nucleic acid in a tissue sample. Magnetism-based transfer system 4400 includes capture array 4410. Capture array 4410 includes solid support 4415. In one example, solid support 4415 is a flat glass substrate. Printed on the surface of solid support 4415 are a plurality of discrete capture sites ("spatial features") 4420, which are regions containing spatially directional oligonucleotides. An example of a single capture site 4420 is described in more detail with reference to FIG. 45. Superimposed on capture array 4410 is sample substrate 4425. In one example, sample substrate 4425 is a glass slide. A tissue sample 4430 is mounted on the surface of sample substrate 4425 facing capture sites 4420 on capture matrix 4410. In one example, tissue section 4430 is an FFPE tissue section. Nucleic acid (not shown) in the 4430 tissue sample is labeled with a magnetically sensitive nanoparticle. Positioned below and near the capture die 4410 is a magnet 4435. The magnet 4435 may be a permanent magnet or an electromagnet. In one example, magnet 4435 is a moving magnet. Specifically, magnet 4435 can be moved near or far from capture array 4410. A magnetic field generated by magnet 4435 is used to attract the nanoparticle-labeled nucleic acid molecules (not shown) from tissue section 4430 to capture sites 4420 on capture matrix 4410. The magnetic field generated by magnet 4435 is configured such that transfer of nucleic acids from the tissue sample and loss of nucleic acids between capture sites 4420 are eliminated or are substantially reduced.

In another embodiment (not shown), the 4420 capture sites are microwells on the 4415 solid support. Printed on the bottom surface of each microwell are spatially directional oligonucleotides. In the presence of a magnetic field, the microwells act to trap the nanoparticle-labeled nucleic acid and eliminate or substantially reduce aggregation of the magnetically responsive nanoparticles.

Figure 45 illustrates a side view of a capture site 4420 on capture array 4410, where the single capture site 4420 includes a plurality of capture probes. In one example, a plurality of capture probes 4510 include an SBS primer sequence 4515 (eg, SBS3) and a spatial address sequence 4520. In another example (not shown), capture 4510 includes a P7 sequence, an SBS primer sequence (eg, SBS12) and a spatial address sequence as described in more detail with reference to Figure 49A. Each 4510 capture probe immobilized to a single 4420 capture site includes the same unique 4520 spatial address sequence (eg, 4520a spatial address sequence). For example, in Figure 45, both capture probe 4510a and capture probe 4510b have the same unique spatial address sequence 4520a. Other capture sites 4420 (not shown) each include their own unique spatial address sequence 4520 (eg, spatial address sequences 4520b, 4520c, 4520d, 4520e, etc.). Accordingly, 4510 capture probes immobilized to other 4420 capture sites each include their own unique 4520 spatial targeting sequence. The SBS 4515 primer sequence is used in subsequent processing steps for library preparation.

Figure 46 illustrates a flow diagram of an example of a 4600 method for transferring cDNA from a tissue sample to a capture matrix for generation of a spatially addressed sequencing library using the 4100 magnetism-based transfer system of Figure 44 and Figure 45. Method 4600 includes, but is not limited to the following steps.

At step 4610, first-strand cDNA is synthesized in situ from RNA in a tissue sample in a reverse transcription (RT) reaction. For example, an RT primer attached to the surface of a magnetically responsive nanoparticle is used to prime first-strand cDNA from mRNA in the 4430 tissue sample mounted on the 4425 sample substrate. In one example, the RT primer includes a gene-specific primer sequence and an SBS (eg, SBS3) primer sequence. In another example, the RT primer includes random primer sequences and an SBS primer sequence (eg, SBS3). Because the RT primer is bound to the surface of a magnetically responsive nanoparticle, the first strand cDNA is labeled with the magnetically responsive nanoparticle.

At step 4615, the first strand cDNA is transferred to a spatially directional capture matrix using a magnetic field. For example, sample substrate 4425 with tissue sample 4430 thereon is placed on top of capture array 4410. Magnet 4435 is placed in close proximity to capture array 4410. The magnetic field generated by magnet 4435 is used to attract the nanoparticle-labeled first-strand cDNA from the 4430 tissue section onto the 4420 capture sites on the 4410 capture matrix. Consequently, the first-strand cDNA is immobilized on the 4420 capture sites by the magnet 4435.

In a 4620 step, the first-strand cDNA is covalently linked to the 4510 capture probes by single-stranded coupling of the 3' end of the cDNA to the 4520 spatial address sequence.

In a step 4625, magnet 4435 moves away from capture array 4410 such that capture array 4410 is no longer within the magnetic field of magnet 4435. As the magnetic field in capture array 4410 decreases, the 5' end of the first-stranded cDNA molecule is released from the 4420 capture site. The cDNA of first strand is now anchored at the 4420 capture site via the 4510 capture probe.

At step 4630, second-strand cDNA is synthesized using a primer that is complementary to the SBS 4515 primer sequence on the 4510 capture probes.

At step 4635, second-strand cDNA is released from the 4420 capture site. In one example, second-strand cDNA is released from the 4420 capture site using a thermal denaturation protocol. In another example, second-strand cDNA is released using a chemical (eg, NaOH) denaturation protocol.

At step 4640, the second-strand cDNA is amplified to generate a sequencing library.

Figures 47A, 47B, and 47C graphically show the steps of the 4600 method of Figure 46. Specifically, a tissue section (not shown) includes a 4710 RNA molecule. The 4710 RNA molecule may include a 4715 mutation. step 4610, first-strand cDNA synthesized in situ is obtained using an RT 4720 primer. The RT 4720 primer includes a random 4725 primer sequence and an SBS 4730 (eg, SBS3) primer sequence. The 4720 RT primer is bound to the surface of a 4735 magnetically responsive nanoparticle. A 4740 first-strand cDNA molecule synthesized using the 4720 RT primer includes the sequence of the 4730 SBS primer and the 4735 magnetically responsive nanoparticle.

At step 4615, the 4740 first-strand cDNA molecules are transferred from the tissue section (not shown) to the 4420 capture site. The 4435 magnet is placed in close proximity to the 4410 capture array. The magnetic field generated by the 4435 magnet is used to attract nanoparticle-labeled 4740 first-strand cDNA molecules from the tissue section (not shown) to the 4420 capture site. Consequently, the 4740 first-strand cDNA molecules are immobilized at the sites catch 4420 by magnet 4435.

At step 4620, the 4740 first-strand cDNA molecules are covalently linked to the 4510 capture probes by single-stranded coupling of the 4740 cDNA molecules to the 4520 spatial address sequences.

At step 4625, magnet 4435 moves away from capture array 4410 such that capture array 4410 is no longer within the magnetic field of magnet 4435. As the magnetic field in capture array 4410 decreases, the The 5' end of the 4740 first-strand cDNA molecules is released from the 4420 capture site. The 4740 first-strand cDNA molecules are now anchored at the 4420 capture site via the 4510 capture probe.

At step 4630, a 4745 second-strand cDNA molecule is synthesized using a 4515a primer that is complementary to the SBS 4515 primer sequence on the 4510 capture probes.

At step 4635, the 4745 second-strand cDNA molecule is released from the 4420 capture site. The 4745 second-strand cDNA molecule includes the SBS primer sequence 4730 (for example, SBS3), the 4715 mutation, the sequence spatial address 4520 and the SBS primer sequence 4515 (eg, SBS12).

In step 4640, the 4745 second-strand cDNA molecule is amplified using an SBS 4750 first primer and a 4755 second primer to generate a sequencing library. The SBS 4750 first primer includes an SBS 4730a complementary sequence that is complementary to the SBS 4730 primer sequence and a P54760 sequence. The SBS 4755 second primer includes a complementary sequence of SBS 4515a that is complementary to the SBS 4515 primer sequence and a P74765 sequence. A 4770 library amplicon synthesized using the SBS 4750 and 4755 primers includes the sequence P54760, the SBS 4730 primer sequence (eg, SBS3), the 4715 mutation, the 4520 spatial address sequence, the SBS 4515 (eg SBS12) and the sequence P74765.

In another embodiment, RNA in a tissue sample (eg, an FFPE tissue sample) is labeled in situ with magnetically sensitive nanoparticles and subsequently transferred to a capture matrix for generation of a spatially targeted cDNA library.

Figure 48 illustrates a flow diagram of an example of a 4800 method of transferring RNA from a tissue sample to a capture array for generation of a spatially addressed sequencing library using the 4400 magnetism-based transfer system. of Figure 44. Method 4800 includes, but is not limited to the following steps.

At step 4810, RNA from a tissue sample is labeled with magnetically sensitive nanoparticles. For example, an SBS oligonucleotide primer attached to the surface of a magnetically responsive nanoparticle couples to RNA in a tissue sample. The 3' end of the RNA molecules is then modified (ie blocked) to prevent unwanted coupling in a later processing step.

In a step 4815, the labeled RNA is transferred to the 4420 capture site using a magnetic field as described above for cDNA in step 4615 of method 4600 of Figure 46.

At step 4820, first-strand cDNA is synthesized from the transferred RNA in an RT reaction. For example, an RT primer is used that includes a gene-specific primer sequence and an oligonucleotide of ligation to prime the first-strand cDNA. In another example, an RT primer including random primer sequences and a coupling oligonucleotide is used to prime the first-strand cDNA.

At step 4825, the first strand cDNA is covalently linked to the capture probes on the 4420 capture site by single-stranded coupling. Capture probes are described in more detail with reference to Figure 49A.

In a step 4830, the RNA template used to generate the cDNA is released from the capture site 4420. For example, the magnet 4435 is moved away from the capture matrix 4410. Thus, the magnetic field at the capture site is decreased. capture 4420 and the magnetically responsive nanoparticle is released from the 4420 surface capture sites. RNA:cDNA duplexes are dissociated using a heat treatment protocol. The first strand cDNA anchors at the 4420 capture site through coupling to the capture probes.

At step 4835, the second-strand cDNA is synthesized in an extension reaction. For example, a primer that includes a sequence that is complementary to the SBS primer sequence in the cDNA and a P5 sequence is used to prime second-strand cDNA synthesis.

At step 4840, the cDNA library molecules are released from the 4420 capture site by denaturation.

Figures 49A, 49B, and 49C graphically show the steps of the 4800 method of Figure 48. Specifically, a tissue section (not shown) includes a 4910 RNA molecule. The 4910 RNA molecule may include a 4915 mutation. step 4810, a 4920 SBS primer oligonucleotide attached to the surface of a 4925 magnetically responsive nanoparticle is coupled in situ to the 4910 RNA molecule. The 3' end of the 4910 RNA molecule is then modified (i.e., blocked) to avoid unwanted coupling in a later processing stage.

At step 4815, the 4910 RNA molecule with the 4925 magnetic response nanoparticle on it is transferred from the tissue section (not shown) to the 4420 capture site using a magnetic field as described above for cDNA in the step 4615 of method 4600 of Figure 46. In this example, capture site 4420 includes a capture probe 4935. Capture probe 4935 includes a sequence P7 4940, an SBS primer sequence 4945 (eg, SBS12) and a 4950 spatial address sequence.

At step 4820, cDNA is synthesized from the 4910 RNA molecule in an RT reaction. For example, a 4955 RT primer that includes a 4960 gene-specific primer sequence and a 4965 coupling oligonucleotide is used to prime the first-strand cDNA.

At step 4825, a 4970 cDNA molecule that includes the SBS 4920 primer sequence (eg, SBS3) and the 4965 docking oligonucleotide is covalently linked to the 4935 capture probe by single-stranded coupling of the 4965 docking oligonucleotide to the 4965 docking oligonucleotide. spatial address sequence 4950.

At step 4830, RNA molecule 4910 is released from capture site 4420. For example, magnet 4435 moves away from capture site 4420. Thus, the magnetic field at capture site 4420 is lowered and RNA molecule 4420 is released. the 4925 magnetically responsive nanoparticle bound to the 4910 RNA molecule from the 4420 surface capture site. The RNA:cDNA duplex (i.e., 4910 RNA molecule:4970 cDNA molecule duplex) is then dissociated using a protocol heat treatment. The 4970 cDNA molecule is now anchored at the 4420 capture site by the 4935 capture probe.

At step 4835, the 4970 cDNA molecule is copied in an extension reaction. For example, a 4975 primer that includes a 4920a sequence that is complementary to the SBS 4920 primer sequence (eg, SBS3) and a P54980 sequence is used to prime second-strand cDNA synthesis. The 4970 cDNA molecule now includes the P74940 sequence, the 4945 SBS primer sequence (for example, SBS12), the 4950 spatial targeting sequence, the 4965 coupling oligonucleotide, the 4915 mutation, the 4920 SBS primer sequence ( eg, SBS3) and the sequence P54980.

At step 4840, a 4970 cDNA molecule is released from the 4420 capture site by denaturation (eg, thermal or chemical denaturation). The 4970 cDNA molecule is now ready for sequencing.

4.7 DNA-based spatial tissue profiles

The techniques described provide methods of detection and spatial analysis (eg, mutational analysis or detection of single nucleotide variation (SNV)) of genomic DNA in a tissue sample. In one example, the fabric sample is an FFPE fabric sample. Spatial detection and analysis of DNA in a tissue sample (for example, an FFPE sample) has several advantages over spatial detection and analysis of RNA in a tissue sample: (1) DNA is more stable than RNA; (2) DNA fragments in an FFPE tissue sample are longer (eg, 300-400 bp) compared to RNA fragments in an FFPE tissue sample (eg, 100-200 bp); (3) RNA molecules expressed at a relatively low level may be undetectable; and (4) changes in tumor suppressor genes are detected in DNA while not detected in RNA.

A disadvantage of using DNA for spatial tissue profiling is that for most genes there may be only 2 copies of a gene per cell. The methods described herein include an initial in situ whole genome pre-amplification step which is used to increase the number of copies of the gene before further steps in the biochemical process are performed.

Figure 50 illustrates a flow chart of an exemplary method 5000 for profiling genomic DNA in a tissue sample. In one example, method 5000 is used to profile SNVs of interest in genomic DNA. Method 5000 includes, but is not limited to the following steps.

At step 5010, a glass substrate is printed with spatially directed PCR primers to form an array of spatial features. In one example, spatially targeted PCR primers are printed onto a 2 cm x 2 cm coverslip to form an array of spatial features that is 100 gm in diameter with a height of 35 gm. In another example, spatially directed PCR primers are printed in microwells made on the surface of a glass slide. Spatially directed PCR primers are printed onto a coverslip or glass slide using, for example, commercially available printing technologies. Spatial targeting PCR primers include a random primer sequence, a spatial targeting sequence, an SBS primer sequence, and a biotin tag as described in more detail with reference to Figure 51. Targeted PCR primers Spatial can also include a modification at the 5' end of the molecule for reversible binding to the coverslip. In one example, spatially targeted PCR primers can include a 5' disulfide modification as described for the spatially targeted capture probe 3100 of process 3200 of Figures 32A, 32B and 32C. In another example, spatially targeted PCR primers can include a 5' photoscleavable linker as described for the spatially targeted capture probe 3100 of process 3300 of Figures 33A, 33B, and 33C.

At step 5015, a PCR master mix solution is dispensed onto the surface of a semi-permeabilized FFPE tissue section mounted on a glass slide. The PCR master mix solution includes, for example, dNTPs, DNA polymerase, MgCl ² and reaction buffers.

In a step 5020, the glass substrate with the spatially directional PCR primers thereon is placed on top of the semi-permeabilized FFPE tissue section, such that the surface of the glass substrate with the spatially directional PCR primers on it itself is in contact with the section of tissue. Spatially directed PCR primers are released from the surface of the glass substrate into the cellular space of the tissue section.

In step 5025, the genomic DNA is amplified by isothermal in situ amplification. In one example, the amplification reaction is a recombinase polymerase amplification (RPA) reaction. Table 1 below shows other examples of isothermal DNA amplification methods that can be used to amplify genomic DNA. In another example, a conventional PCR-based whole genome amplification reaction is used to amplify genomic DNA. In one example, the conventional PCR-based method is an enhanced primer extension pre-amplification PCR (iPEP PCR). In another example, the conventional PCR-based method is degenerate oligonucleotide-primed PCR (DOP-PCR; eg, Rubicon Picoplex kit).

Table 1. Summary of isothermal nucleic acid amplification methods.

Volume

Method* ^Time

_cation ^of Target _{Amplification} Detection Reaction Limit

MDA 10-16 h E. coli genomic DNA -

gen mecA gen de Staphylo

menos de 10 copiaswithin

mecA gene Staphylo gene

less than 10 copies

RPA

1 h 9 nL ^{DNA ge}

_and ^no

_to ^m

_the ^icon

_I ^d

_you ^and

_cylinder ^yes

_to ^{taphylococcus aur} _resistant ^eus 300 copies/mL

* LAMP = loop-mediated isothermal amplification; HDA = helicase-dependent amplification; MDA = multiple displacement amplification; RCA = rolling circle amplification; RPA = recombinase polymerase amplification

In a step 5030, the semi-permeabilized tissue sample with the amplified genomic DNA thereon is removed from the surface of the glass slide and collected in a collection tube. In one example, the semi-permeabilized tissue sample with the amplified genomic DNA thereon is scraped off the glass slide into an Eppendorf tube. Due to the biotin label in the PCR primer used in the amplification reaction, the amplified DNA is biotinylated. The amplified biotinylated DNA is purified using a streptavidin bead-based purification protocol.

In step 5035, residual single-stranded PCR primers are removed by digestion using a 3' to 5' exonuclease.

At step 5040, the DNA is amplified in a multiplex PCR reaction targeting the SNVs of interest. For example, a forward primer includes a gene-specific sequence that targets an SNV of interest, an SBS primer sequence (eg, SBS3), and a P5 sequence. A reverse primer includes sequences complementary to SBS12 and a P7 sequence. In another example, a TSCA-like strategy is used to target DNA regions of interest.

At step 5045, the PCR product is sequenced.

Figure 51 illustrates a diagram of a 5100 spatially addressed PCR primer for pre-amplification and spatial indexing of whole genomic DNA. The 5100 spatial address PCR primer includes a 5110 random primer sequence, a 5115 spatial address sequence, and a 5120 SBS primer sequence (eg, SBS12). Random primer sequence 5110 is a 9 bp sequence that is used to amplify genomic DNA in a whole genome pre-amplification reaction. The spatial address sequence 5115 is a unique sequence for each capture site (spatial feature) on an array. The SBS 5120 primer sequence includes the 5125 biotin tag. The 5125 biotin tag is used to purify the amplified DNA in subsequent processing steps.

Figures 52A and 52B graphically show the steps of the method 5000 of Figure 50. In step 5010, a glass substrate 5210 is printed with spatially directed PCR primers (not shown) to form an array of spatial features 5215. In this example, the 5210 glass substrate is a 2 cm x 2 cm coverslip with spatial features 100 gm in diameter. Spatially targeted PCR primers are, for example, the 5100 spatially targeted PCR primer in Figure 51.

At step 5015, a 5220 semi-permeated tissue section mounted on a 5225 glass slide is coated with a 5230 PCR master mix solution. The 5220 semi-permeated tissue sample includes a 5235 cell. The 5235 cell includes a genomic DNA molecule 5240. The 5240 genomic DNA molecule may include a 5245 single nucleotide variation (SNV).

At step 5020, the glass substrate 5210 is placed on top of the tissue section 5220 and the PCR master mix solution 5230 such that the surface glass substrate 5210 with the spatially directed PCR primers 5100 on it (not shown) is in contact with tissue section 5220. PCR primers 5100 (not shown) are released from the surface of glass substrate 5210 into the cellular space of tissue section 5220.

In step 5025, genomic DNA is amplified by isothermal in situ amplification using 5100 PCR primers.

At step 5030, tissue section 5220 with amplified DNA 5260 thereon is removed from the surface of glass slide 5225 and collected in collection tube 5255. In one example, collection tube 5255 is an Eppendorf tube. . Due to the 5125 biotin label on the 5100 PCR primer, the 5260 amplified DNA is biotinylated.

At step 5035 (not shown in Figure 52), the amplified DNA 5260 is purified using a streptavidin bead-based purification protocol.

At step 5040 (not shown in Figure 52), residual single-stranded PCR primers 5100 are removed by digestion using a 3' to 5' exonuclease.

In step 5045, the 5260 DNA molecules are amplified in a target-specific multiplex PCR reaction. For example, a 5265 forward primer includes a 5270 gene-specific sequence that targets SNV 5240, an SBS 5275 (eg, SBS3) primer sequence, and a P55280 sequence. A 5285 reverse primer includes a sequence complementary to SBS12 5120a and a P7 5290 sequence. A 5295 library amplicon synthesized using the 5265 forward primer and the 5285 reverse primer includes the P55285 sequence, the SBS 5275 primer sequence, the SNV 5240 , the 5115 spatial address sequence, the 5120 SBS primer sequence, and the P75290 sequence.

4.8 Spatial compartmentalization

To limit the diffusion of spatially directed oligonucleotides (and other components or reaction products) over a tissue section and maintain spatial resolution, compartmentalization of biochemical reactions in "microwell reactors" or "microreactors" can be used. Spatial information can be combined with any of the biochemical techniques described herein for the characterization of transcriptomes and/or genomic variation in tissues while preserving spatial information related to the origin of target nucleic acids in the tissue.

Figure 53 illustrates a perspective view of an example of a 5300 microwell reactor overlay. The 5300 microwell reactor overlay includes a 5310 glass slide. Mounted on top of the 5310 glass slide is a 5315 tissue section. For example, fabric section 5315 is an FFPE fabric section. A reaction fluid 5320 is dispensed onto the glass slide 5310 such that the tissue section 5315 is covered by the reaction fluid 5320. In one example, the reaction fluid 5320 is a PCR master mix solution used in a amplification reaction. In another example, reaction fluid 5320 is a reverse transcription mixing solution. A microwell substrate 5325 is placed on the reaction fluid 5320 and tissue section 5315 on the glass slide 5320. The microwell substrate 5325 includes a plurality of microwells 5330. Printed on the bottom surface of each microwell 5330 are a plurality of spatially directed oligonucleotides (not shown). The 5330 microwells act as compartmentalized reaction chambers for performing a biochemical reaction (eg, PCR amplification). The 5330 microwells are described in more detail with reference to Figure 54.

Figure 54 illustrates a perspective view of a single microwell 5330 of the microwell reactor overlay 5300 of Figure 53. In this example, microwell 5330 has a diameter of approximately 200 gm and a height of approximately 100 µm. The volume of the 5350 microwell is approximately 3 nL. Printed on the bottom surface of the 5350 microwell are a plurality of 5410 spatially addressed oligonucleotides. The 5410 spatially addressed oligonucleotides include a spatially addressing sequence unique to each 5330 microwell.

Figures 55A and 55B illustrate an example of a process 5500 for manufacturing the microwell substrate 5325 of the microwell reactor overlay 5300 of Figure 53. Only a portion of the microwell substrate 5325 is shown in this example.

In a first step and referring now to Figure 55A, the microwell substrate 5325 includes a glass substrate 5510. In one example, the glass substrate 5510 is a hydrophilic glass substrate that is approximately 1 mm thick. A 5515 polyimide layer is disposed on the surface of the 5510 glass substrate. In one example, the 5515 polyimide layer is a black Kapton layer that is about 100 gm thick. A 5520 hydrophobic layer is disposed on the surface of the 5515 polyimide layer. In one example, the 5520 hydrophobic layer is formed by silanizing the 5515 polyimide layer.

In a next step and referring now to Figure 55B, a plurality of 5525 microwells are formed in the 5515 polyimide layer. In this example, two 5525 microwells are shown, but any number and arrangement of 5525 microwells may be used. In one example, the 5525 microwells are formed in the 5515 polyimide layer using precise ultraviolet laser ablation to remove portions of the 5515 polyimide layer and the 5520 hydrophobic layer. In this example, the 5525 microwells are approximately 200 gm in diameter. Table 2 below shows other examples of suitable dimensions for the 5525 microwells. The 5525 microwells are hydrophilic regions that act as reaction chambers for conducting biochemical reactions. Due to the presence of the hydrophobic layer 5520 in the interstitial regions between the microwells 5525, lateral diffusion of reaction components or products is eliminated or substantially reduced. The relatively small volume of the 5525 microwell provides a small reaction volume and higher efficiency reactions. The compartmentalization (confinement) of spatially directional oligonucleotides within the 5525 microwells also avoids the need for process steps that may be required to release the imprinted oligonucleotides from the surface of a glass substrate.

Figure 56 illustrates a side view of an example of a microwell structure 5600 for the capture and spatial compartmentalization of nucleic acids from a tissue sample. Microwell assembly 5600 includes a substrate 5610. In one example, substrate 5610 is a glass slide. Substrate 5610 includes an array of microwells 5615. In one example, microwells 5615 are formed in substrate 5610 using an etching process, such as by precise ultraviolet laser ablation. The 5615 microwells are hydrophilic regions, while the interstitial regions between the 5615 microwells are hydrophobic regions. The 5615 microwells act as reaction chambers to perform biochemical reactions (eg, reverse transcription of RNA to cDNA, amplification of genomic DNA). Because the interstitial regions between microwells 5615 are hydrophobic, lateral diffusion of reaction components or products out of microwells 5615 is eliminated or substantially reduced. In one example, microwells 5615 have a diameter of approximately 1 mm and a height of approximately 100 gm. The space between the 5615 microwells is approximately 1 mm.

An amount of 5620 gel material is deposited in each microwell 5615. The amount of 5620 gel material deposited in each 5615 microwell is selected such that, as the 5620 gel material subsequently hydrates, the 5620 gel material swells to fill and protrude from microwells 5615 without contacting adjacent microwells 5615. In one example, gel material 5620 is a hydrogel material, such as poly(N-(5-azidoacetamidylpentyl)acrylamide-coacrylamide) (PAZAM) which is functionalized with covalently linked spatially directional capture oligonucleotides (not shown). Spatial addressable capture oligonucleotides (not shown) include a spatial address sequence that is unique to each 5615 microwell. Spatial addressable capture oligonucleotides also include a capture sequence for capturing nucleic acids (eg, RNA). or genomic DNA) from a section of tissue. The capture sequence may be, for example, a gene-specific capture sequence or a universal capture sequence. Gel material 5620 can be deposited in each microwell 5615 by printing (eg, contact printing or piezoelectric printing).

Figure 57 illustrates a flow diagram of an example of a 5700 method for capturing nucleic acids from a tissue section using the 5600 microwell structure of Figure 56 for sequencing library preparation. Method 5700 includes, but is not limited to the following steps.

In a step 5710, an amount of gel material 5620 is deposited in each microwell 5615 of the microwell array 5600, such that each microwell 5615 includes gel material 5620 having a unique spatial address sequence thereon. In some embodiments, the microwell structure 5600 having the gel material 5620 deposited thereon may be stored for a period of time prior to use.

In a step 5715, at the time of use, the microwell structure 5600 is immersed in a biochemical reaction solution to hydrate the gel material 5620. In some embodiments, the biochemical reaction solution includes reverse transcriptase and reaction components to synthesize cDNA from target RNA in a tissue sample. In some embodiments, the biochemical reaction solution includes DNA polymerase and reaction components for producing multiple genomic DNA amplicons from target genes in a tissue sample. The 5600 microwell structure is immersed in the biochemical reaction solution for a period of time sufficient for the 5620 gel material to hydrate. As the 5620 gel material hydrates, the 5620 gel material swells to fill and protrude. of the 5615 microwells. The 5600 microwell assembly is then removed from the biochemical reaction solution. Because the interstitial region between the 5615 microwells is hydrophobic, no biochemical reaction solution remains between the 5615 microwells. Spatially directional capture oligonucleotides covalently bound to the 5620 gel material are located in each 5615 microwell.

In a step 5720, a tissue section is placed on top of the microwell structure 5600 such that the tissue section is in contact with the hydrated gel material 5620 having spatially directional capture oligonucleotides thereon. In one example, the fabric section is a semi-permeable FFPE fabric section. When the tissue section comes into contact with the hydrated gel material 5620 that has spatially directed capture oligonucleotides on it, the biochemical reaction is initiated. Because the interstitial regions between the 5615 microwells are hydrophobic, reaction components and products localize in each 5615 microwell.

In a step 5725, the reaction products (eg, cDNA or DNA) are removed from the 5620 gel material. The reaction products can be purified from PAZAM using bead purification methods. At step 5730, a sequencing library is prepared.

Figure 58A illustrates a side view of an exemplary 5800 pin system for excision of tissue and preparation of a spatially directional nucleic acid library. The 5800 pin system includes a 5810 pin structure and a 5815 microwell block. The 5810 pin structure includes a 5820 substrate. In one example, the 5820 substrate is a glass substrate. Protruding from the substrate 5820 is an array of pins 5825. In one example, the pins 5825 are formed of a glass material. In one example, pins 5825 have a diameter of about 100 gm and a height of about 10 gm to about 20 gm. The spacing between the 5825 pins is approximately 100gm. At the end of each pin 5825 is an excision surface 5830. The excision surface 5830 may have any shape that facilitates removal of a tissue sample from a tissue section. Examples of different cleavage surfaces are described in more detail with reference to Fig. 58B. The 5825 pins may be coated with a substance (not shown) to facilitate tissue adherence to the 5825 pins. In one example, the 5825 pins may be coated with polylysine. In another example, pins 5825 are coated with an adhesive material. In yet another example, 5825 pins are coated with PAZAM. The 5820 substrate also includes 5835 alignment holes. In this example, two 5835 alignment holes are shown, but any number of 5835 alignment holes can be used. The 5835 alignment holes are used to align the 5810 pin structure with the 5815 microwell block.

The 5815 microwell block includes a 5840 substrate. The 5840 substrate includes an array of 5845 microwells. The 5845 microwells are arranged to align with the 5825 pins on the 5810 pin structure. The 5845 microwells are loaded with an amount of a mixture of 5850 biochemical reaction. In various embodiments, the 5850 biochemical reaction mixture includes spatially targeted capture oligonucleotides for targeting and labeling nucleic acids in a tissue sample. The spatially targeted capture oligonucleotides (not shown) in the 5850 biochemical reaction mix include a spatial targeting sequence that is unique to each 5845 microwell. In some embodiments, the 5850 biochemical reaction mix includes spatially targeted capture oligonucleotides , reverse transcriptase, and reaction components to synthesize cDNA from target RNA in a tissue sample. In some embodiments, the 5850 biochemical reaction mix includes capture oligonucleotides, DNA polymerase, and spatially directed reaction components to produce multiple genomic DNA amplicons from target genes in a tissue sample. In some embodiments, the 5850 biochemical reaction mixture is a solution of approximately 1 ul by volume. In some embodiments, the 5850 biochemical reaction mixture is a dehydrated reaction mixture or part thereof that is rehydrated before using the 5815 microwell block. The 5845 microwells with the 5850 biochemical reaction mixture are covered with a 5855 pierceable film. , just like a sheet. The 5815 microwell block also includes 5860 alignment pins. In this example, two 5860 alignment pins are shown, but any number of 5860 alignment pins can be used. The 5815 microwell block aligns with the 5810 pin structure by adjusting the alignment pins 5860 of the microwell block 5815 into the alignment holes 5835 of the pin frame 5810.

Figure 58B illustrates examples of different cleavage surfaces 5830 for pins 5825 on pin structure 5810 of Figure 58A. In one example, cleavage surface 5830a is concave in shape. In another example, cleavage surface 5830b is "v" shaped. In yet another example, cleavage surface 5830c has a relatively shallow jagged edge shape. In yet another example, cleavage surface 5830d has a relatively deep jagged edge shape.

Figure 59 illustrates a flow diagram of an example of a 5900 method for capturing nucleic acids from a tissue section using the 5800 pin system of Figure 58A for preparation of a sequencing library. In this example, the 5810 pin structure is used as a "touch" pin structure to contact a tissue section mounted on a solid substrate and extract tissue samples for subsequent transfer to the 5815 microwell block for capture. of nucleic acids. The 5900 method includes, but is not limited to the following steps.

At step 5910, tissue samples are collected from a tissue section using pin structure 5810. For example, a tissue section on a glass slide is contacted with pins 5825 such that the tissue sample is adheres to excision surfaces 5830. As the pin structure 5810 is removed from the surface of the tissue section, adherent tissue samples are removed from the tissue section. In one example, the fabric section is a semi-permeable FFPE fabric section.

In a step 5915, the pin structure 5810 having tissue samples on it is moved to the microwell block 5815. For example, the pin structure 5810 aligns and engages the microwell block 5815. In doing so, the 5855 pierceable film and 5825 pins that have the tissue samples on them are immersed in the 5850 biochemical reaction mix within the 5845 microwells.

In a step 5920, in an incubation period, the biochemical reaction is performed.

In a step 5925, the pin structure 5810 is removed from the microwell block 5815 and the biochemical reaction mixture having reaction products (eg, cDNA or genomic DNA amplicons) is collected from the microwells 5845.

At step 5930, a sequencing library is prepared.

Figure 60 illustrates side views of the pin system 5800 of Figure 58A and graphically shows steps 5910 and 5915 of the method 5900 of Figure 59. Specifically, at step 5910, a section of tissue 6010 (for example, a section of FFPE tissue) on top of a 6015 glass slide is brought into contact with the 5815 pin structure of the 5800 pin system. The tissue in contact with the 5830 excision surfaces adheres to the 5825 pins. 5815 is removed from the surface of the tissue section 6010, the adherent tissue samples 6020 are removed from the tissue section.

At step 5915, the pin structure 5810 having tissue samples 6020 on it is moved to the microwell block 5815. For example, the pin structure 5810 aligns and engages the microwell block 5815. In doing so, it breaks pierceable film 5855 and pins 5825 having tissue samples 6020 thereon are immersed in biochemical reaction mixture 5850 within microwells 5845.

Figure 61 illustrates a flow chart of another example of a 6100 method for capturing nucleic acids from a tissue section using the 5800 pin system of Figure 58A for preparation of a sequencing library. In this example, the 5810 pin structure is used as a "push" pin structure to contact a tissue section mounted on a pierceable substrate and push tissue samples directly into the 5845 microwells for injection. nucleic acid capture. Method 6100 includes, but is not limited to, the following steps.

In a step 6110, a tissue section mounted on a pierceable substrate is placed on the microwell block 5815, namely, on top of the pierceable film 5855 of the microwell block 5815. In one example, the tissue section is a tissue section Semi-permeabilized FFPE.

In a step 6115, the pin structure 5810 is translated into the microwell block 5815. For example, the pin structure 5810 aligns and engages the microwell block 5815. In doing so, both the pierceable substrate having the tissue section on it as the 5855 pierceable film are torn and the 5825 pins having tissue samples on them are immersed in the 5850 biochemical reaction mixture within the 5845 microwells.

In a step 6120, in an incubation period, the biochemical reaction is performed.

In a step 6125, the 5810 pin structure is removed from the 5815 microwell block and the biochemical reaction mixture with the reaction products (eg, cDNA or genomic DNA amplicons) therein is collected from the 5845 microwells.

At step 6130, a sequencing library is prepared.

Figure 62 illustrates side views of the pin system 5800 of Figure 58A and graphically shows steps 6110 and 6115 of the method 6100 of Figure 61. Specifically, at step 6110, a section of tissue 6210 (for example, a section of FFPE fabric) mounted on a pierceable substrate 6215 is placed on top of the 5815 microwell block. At step 6115, the 5810 pin structure is moved to the 5815 microwell block. 5815 microwell block. In doing so, the 6215 pierceable substrate that has a 6210 tissue section on it and the 5855 pierceable film are both broken and the 5825 pins that have the 6225 tissue samples on them are immersed in the reaction mixture 5850 biochemistry within the 5845 microwells.

Figure 63 illustrates a perspective view of a 6300 capillary "microreactor" system for capturing nucleic acids from a tissue section for the preparation of a spatially addressed nucleic acid library. The 6300 capillary microreactor system includes a plurality of 6310 capillary tubes. In one embodiment, the 6310 capillary tubes may be used individually to collect and process a sample or may be arrayed and used as a unit. In this example, 4 6310 capillary tubes are shown, but any number of 6310 capillary tubes can be used. The 6310 capillary tubes have a 6315 sample contact end and a 6320 non-contact end. The sample contact end 6315 of each capillary tube 6310 includes a small protrusion 6325. In one example, the capillary tubes 6310 are approximately 100 gm in diameter. Dried on the inner surface of each 6310 capillary tube is a number of spatially directed capture oligonucleotides (not shown) for targeting and labeling nucleic acids from a tissue section. Spatially addressed capture oligonucleotides (not shown) include a spatially addressed sequence that is unique to each 6310 capillary. Spatially addressed capture oligonucleotides also include a capture sequence for capturing nucleic acids (eg, RNA or genomic DNA) from a section of tissue. The capture sequence may be, for example, a gene-specific capture sequence or a universal capture sequence.

At the time of use, the 6310 capillary tubes are filled with a 6330 biochemical reaction solution. In one example, the 6310 capillary tubes are filled with the 6330 biochemical reaction solution by "wicking" or capillary action. In some embodiments, the 6330 biochemical reaction solution includes reverse transcriptase and reaction components for synthesizing cDNA from target RNA in a tissue sample. In some embodiments, the 6330 biochemical reaction solution includes DNA polymerase and reaction components for producing genomic DNA amplicons from target genes in a tissue sample.

The 6310 capillary tubes are "stamped" and pressed onto a 6335 fabric section mounted on a 6340 substrate. In one example, the 6335 fabric section is a semi-permeabilized FFPE fabric section. As the 6310 capillary tubes are pressed onto the 6335 tissue section, a tissue sample is pressed into the 6310 capillary tube through the 6325 protrusion. In some embodiments, an inert substrate (not shown) is placed between the 6310 capillary tube. 6335 tissue section and 6340 substrate. The inert substrate is used to seal the 6315 sample contact ends of the 6310 capillary tubes.

Figure 64 illustrates a flow chart of an exemplary method 6400 of capturing nucleic acids from a tissue section using the capillary microreactor system 6300 of Figure 63 for preparation of a sequencing library. Method 6400 includes, but is not limited to the following steps.

In a step 6410, at the time of use, the biochemical reaction solution 6330 is loaded by capillary action into capillary tubes 6310.

In a step 6415, capillary tubes 6310 having biochemical reaction solution 6330 therein are printed and pressed onto tissue section 6335 mounted on substrate 6340 to collect tissue samples.

In a step 6420, the capillary tubes 6310 are withdrawn from the substrate 6340 and sealed at the end contacting the sample 6315 to prevent evaporation. In some embodiments, the capillary tubes 6310 are removed from the substrate 6340 and the sample contact ends 6315 are stamped onto an inert substrate to seal against evaporation. In some embodiments, an inert substrate is placed between the 6335 tissue section and the 6340 substrate. As the 6310 capillary tubes are pressed over and through the 6335 tissue section, the 6315 sample contact ends are pressed. into the inert substrate and seal against evaporation.

In a step 6425, the non-contacting ends 6320 of the capillary tubes 6310 are sealed against evaporation. In some embodiments, the non-contact ends 6320 are stamped onto an inert substrate to seal against evaporation.

In a step 6430, in an incubation period, the biochemical reaction is performed.

In a step 6435, the biochemical reaction solution with the reaction products (eg, cDNA or genomic DNA amplicons) is collected from the capillary tubes 6310 and pooled.

At step 6440, a sequencing library is prepared.

4.9 Serial Sectioning DNA/RNA Workflow

A set of spatially directed random oligonucleotide primers can be used in a serial DNA/RNA workflow for spatial detection and analysis of DNA and RNA in a tissue sample. For example, a spatially directed random primer oligonucleotide may include a random primer sequence, a spatially directed sequence, an SBS primer sequence, and a biotin tag as described above for the 5100 spatially directed PCR primer of the Figure 51. A set of spatially directed random oligonucleotide primers is used in an in situ whole genomic Dn amplification reaction to amplify and spatially index the DNA in a serial section of the tissue sample. The amplified and spatially indexed DNA is then used to generate a sequencing library. The same set of spatially directed random oligonucleotide primers is used in an in situ RT reaction to synthesize and spatially index cDNA from RNA in a second serial section of the tissue sample. The spatially indexed cDNA is then used to generate a second sequencing library. The combined DNA/RNA workflow provides higher data output from a single tissue sample.

4.10 Droplet Actuator Configured for Spatial Sensing and Nucleic Acid Analysis

Figure 65 illustrates a side view of a portion of the 6500 droplet actuator that is configured for spatial detection and analysis of nucleic acids in a tissue sample. Droplet actuator 6500 includes a lower substrate 6510 that is separated from an upper substrate 6515 by a droplet actuation gap 6520. Droplet actuations are performed in a droplet actuation gap 6520 on a droplet actuation surface. . The lower substrate 6510 includes an array of droplet actuation electrodes 6525 (eg, electrowetting electrodes). Droplet actuations are carried out above droplet actuation electrodes 6525 on a droplet actuation surface. The upper substrate 6515 includes a reference electrode 6530. The upper substrate 6515 also includes a recessed area 6535 that is of sufficient size and shape to accommodate a 6540 pore sheet. The 6540 pore sheet is described in more detail with reference to Figure 66. Associated with recessed area 6535 is an electrophoresis electrode 6545. The lower substrate 6510 includes a corresponding electrophoresis electrode 6550. Electrophoresis electrodes 6545 and 6550 are connected to a voltage source 6555. The pore sheet 6540, Electrophoresis electrodes 6545 and 6550 are configured for electrophoretic transfer and capture of nucleic acids in a tissue sample in a manner that maintains spatial orientation. Also, the pore sheet 6540 is installed in the recessed area 6535 so that there is a certain amount of space 6536 between the top of the pore sheet 6540 and the electrophoresis electrode 6545.

A hydrophobic layer 6560 is disposed on the upper substrate surface 6515 facing the droplet performance space 6520. Similarly, another hydrophobic layer 6565 is disposed on the lower substrate surface 5610 facing the droplet performance space. 6520.

Figure 66 illustrates a side view of the pore sheet 6540 of the droplet actuator 6500 of Figure 65. The pore sheet 6540 includes a substrate 6610 having a top surface 6615 and a bottom surface 6620. The substrate 6610 includes a matrix of pores 6625. The pores 6625 are through holes (e.g., micropores) in the substrate 6610 that extend through the substrate 6610 from the top surface 6615 to the bottom surface 6620. Each pore 6625 is filled with a gel or solution. or a reaction matrix including a plurality of capture probes with unique spatial addresses (not shown). Each spatial direction corresponds to the position of the capture probes on the sheet of pores 6540. The position of each pore 6625 can be correlated to a position in a tissue sample. Lower surface 6620 of substrate 6610 may include a hydrophobic layer (not shown) to facilitate transport of a droplet into pore sheet 6540 and away from pore sheet 6540.

Figures 67A and 67B illustrate side views of the droplet actuator 6500 of Figure 65 and show a process 6700 of isolating a nucleic acid in a tissue sample for detection and spatial analysis. The 6700 process is an example of a nucleic acid isolation protocol in which nucleic acids from a tissue sample are electrophoretically transferred to a micropore array containing capture probes with unique spatial addresses, labeled with the targeting sequence spatially exclusive and transferred to a droplet for further processing. on the droplet actuator. The 6700 process includes, but is not limited to the following steps.

In one step and referring now to Fig. 67A, a tissue sample 6710 mounted on a sample substrate 6715 is placed in recessed area 6535; specifically, in space 6536 above pore sheet 6540. In one example, fabric sample 6710 is a section of FFPE fabric. In one example, the 6710 tissue sample is placed directly on the surface of the 6540 pore sheet. In another example, the 6710 tissue sample is placed on top of a substance (not shown) such as a gel or a thin layer of tampon separating the 6710 tissue sample from the 6540 pore sheet to facilitate the electrophoretic transfer of nucleic acids from the 6710 tissue sample to the 6540 pore sheet. concrete droplets 6525 aligned with pore sheet 6540. A voltage is applied from voltage source 6555 to electrophoresis electrodes 6545 and 6550, creating an electric field. In the presence of the electric field, a plurality of 6725 nucleic acids are transferred from the tissue sample 6710 into the pores 6625 of the pore sheet 6540. The 6725 nucleic acid in each pore 6625 of the pore sheet 6540 is labeled with a spatial address sequence (not shown) corresponding to the position of each pore 6625 on the sheet of pores 6540.

In another step and referring now to FIG. 67B, after a period of time sufficient for the 6725 nucleic acids to be captured on spatially directional capture probes contained in each 6625 pore, the 6725 nucleic acids are electrophoretically transferred into of the 6720 droplet. The 6720 droplet with 6725 labeled nucleic acids within it is transported using droplet actuations out of the 6540 pore sheet for downstream processing steps in the 6500 droplet actuator. For example, the 6500 droplet actuator may include a reaction zone (not shown) for performing the processing steps in a sequencing library preparation protocol (e.g., reverse transcription of RNA to cDNA, exonuclease I digestion, PCR amplification, and library preparation Nextera). Droplet actuator 6500 may also include a sequencing zone (not shown) for performing a DNA sequencing protocol (eg, an SBS protocol). The sequencing zone may be, for example, a sequencing flow cell.

4.11 Spatial tissue profiles based on DNA tagmentation

"Tagmentation" as used herein is a transposase-mediated cleavage and labeling process. Tagmentation often involves the modification of DNA by a transposome complex comprising a transposase enzyme complexed with adapters comprising a terminal transposon sequence. Tagmentation results in the simultaneous fragmentation of the DNA and coupling of the adapters to the 5' ends of both strands of DNA duplex fragments.

This description is based, in part, on the realization that tagmentation can be used effectively to search for the spatial directions of nucleic acids from a tissue sample on a capture matrix.

Figure 68 illustrates a flow diagram of an example of a 6800 method of profiling genomic DNA in a tissue sample using DNA tagmentation. In this example, the 6800 method is used to profile the SNVs of interest in genomic DNA. Method 6800 may comprise, but is not limited to some or all of the following steps.

In step 6810, a glass substrate is printed with spatially targeted oligonucleotides to form an array of spatial features. In some embodiments, spatially targeted oligonucleotides can be printed onto a 2 cm x 2 cm coverslip to form an array of spatial features that are 100 µm in diameter with a height of 35 µm. In some embodiments, spatially directional oligonucleotides can be print in microwells formed on the surface of a glass slide. Spatially addressed oligonucleotides can be printed onto a coverslip or glass slide using, for example, commercially available printing technologies. Spatially targeted oligonucleotides may comprise a linker sequence, an SBS primer sequence, a spatial targeting sequence, and a 19 bp Mosaic End (ME) sequence as described in more detail with reference to Figure 69A. In some embodiments, the ME sequence is a Tn5 transposase recognition sequence. In some embodiments, the ME sequence is a Mu transposase recognition sequence. Spatially targeted oligonucleotides may further comprise a modification at the 5' end of the molecule for reversible attachment to the coverslip. In some embodiments, the spatially directed oligonucleotides may comprise a 5' disulfide modification as described for the spatially directed capture probe 3100 of process 3200 of Figures 32A, 32B, and 32C. In some embodiments, the spatially targeted PCR primers may include a 5' photoscleavable linker as described for the spatially targeted capture probe 3100 of process 3300 of Figures 33A, 33B, and 33C.

At step 6815, a reverse complement oligonucleotide sequence anneals to the EM sequence to form a region of double-stranded DNA.

At step 6820, a transposase enzyme solution is added onto the surface of the spatially directed oligonucleotide array to form a transposome homodimer in each region of the double-stranded DNA. In some embodiments, the transposase enzyme solution comprises Tn5. In some embodiments, the transposase enzyme solution comprises Mu.

In a step 6825, a tissue section is placed on the array such that the substrate surface of the array with the spatially directed oligonucleotides and transposome homodimers thereon is in contact with the tissue section. In one example, the fabric section is an FFPE fabric section.

At step 6830, the double-stranded DNA is tagmented with a transposome complex. Methods, compositions, and kits for treating nucleic acids, and in particular methods and compositions for fragmenting and labeling DNA using transposon compositions, are described in detail, for example, in US2010/0120098 and US2011/0287435.

At step 6835, the tagged DNA is amplified using a gene-specific primer and a universal primer that includes a region complementary to the SBS primer sequence to generate a library of tagged genomic DNA.

At step 6840, the tagmented genomic DNA library is sequenced.

Figures 69A, 69B, and 69C illustrate the steps of the 6800 method of Figure 68. At step 6810 (see Figure 69A), a 6910 array surface is printed with spatially addressed 6915 oligonucleotides for spatial indexing and DNA tagmentation. full genome. In this example, a single 6915 spatial address oligonucleotide is shown, but any number of 6915 oligonucleotides can be immobilized on the surface of the 6010 array. The 6015 spatial address oligonucleotide includes a 6920 linker region, an SBS primer region 6925 spatial address region, a 6930 spatial address region, and a 6935 ME region. The 6930 spatial address region comprises a unique sequence for each capture site (spatial feature) on an array. The 19 bp ME sequence of the ME 6935 region or transposon end is described in detail, for example, in US2010/0120098 and US2011/0287435. Methods, compositions, and kits for treating nucleic acids, and in particular methods and compositions for fragmenting and labeling DNA using transposon compositions, are described in detail, for example, in US2010/0120098 and US2011/0287435.

The 6920 linker region in this example comprises a cleavable sequence that can be used to release the captured nucleic acid from the surface of the 6910 array such that the 6930 spatial address region is included in the released nucleic acid and the nucleic acid is "tagmented". The SBS 6925 primer region comprises an SBS primer sequence (eg, SBS12 or SBS3) that can be used in a sequencing-by-synthesis (SBS) process. The SBS 6925 primer region can also be used in an amplification reaction to generate a sequencing library as described in more detail with reference to Figure 12 and Figure 13.

At step 6815 (see Figure 69A), an ME 6940 reverse complement sequence hybridizes to the ME 6935 region.

At step 6820 (see Figure 69B), a transposase enzyme solution (not shown) is added onto the surface of the 6910 array to form a 6945 transposome homodimer in each region of double-stranded DNA. In some embodiments, the transposome ends comprise Mu transposome ends and the transposase is Mu transposase. In some embodiments, the transposome ends comprise Tn5 transposome ends and the transposase is Tn5 transposase.

At step 6825 (see Figure 69B), a 6950 tissue section is placed on top of the 6910 matrix surface such that the 6915 spatially directional oligonucleotides and the 6945 transposome homodimers thereon are in contact with the tissue section. 6950 fabric. In some embodiments, the 6950 fabric section is an FFPE fabric section. The 6950 tissue section includes a 6955 cell. The 6955 cell includes a DNA molecule genomic 6960. The genomic 6960 DNA molecule may include a single nucleotide variation (SNV) 6965.

At step 6830 (see Figure 69C), the 6960 genomic DNA is tagmented. For example, the 6960 genomic DNA is tagmented such that SNV 6965 is "A" upstream of a tagmentation event or "B" downstream of a tagmentation event. a tagmentation event.

At step 6835 (see Figure 69C), the labeled 6960 genomic DNA is amplified. For example, if SNV 6965 is "A" upstream of a tagmentation event, 6960 genomic DNA is amplified using a 6970 gene-specific primer and a 6975 universal primer that includes a region complementary to the SBS 6925 primer region. If SNV 6965 is "B" downstream of a tagmentation event, 6960 genomic DNA is amplified using a 6980 gene-specific primer and the 6975 universal primer.

At step 6840 (not shown in Figures 69A, 69B and 69C), the PCR product is sequenced.

In another aspect, a capture array for the spatial detection and analysis of nucleic acids in a tissue sample is provided herein, comprising a capture site comprising a capture probe (eg, 6915) comprising a spatial address region (eg, 6930) and a transposon end (TE) region (eg, 6935). In some embodiments, the capture probe further comprises a cleavable region (eg, 6920) and an SBS primer binding region (eg, 6925). In some embodiments, the transposon end region is annealed to a reverse complementary oligonucleotide (eg, 6940) to form a double-stranded transposon end region. In some embodiments, the TE region comprises an ME sequence.

In some embodiments, the capture matrix further comprises a transposase to form a transposome (eg, 6945).

In some embodiments, the transposome ends comprise Mu transposome ends and the transposase is Mu transposase. In some embodiments, the transposome ends comprise Tn5 transposome ends and the transposase is Tn5 transposase.

In another aspect, a method for the spatial detection and analysis of nucleic acids in a tissue sample is provided herein, comprising providing a capture matrix described herein. In some embodiments, the capture array comprises a capture site comprising a capture probe (eg 6915) comprising a spatial address region (eg 6930) and a transposon end (TE) region (eg ). example, 6935). In some embodiments, the capture probe further comprises a cleavable region (eg, 6920) and an SBS primer binding region (eg, 6925).

In some embodiments, the method further comprises contacting the capture matrix with an oligonucleotide that is a reverse complement of the TE region (eg, 6940) to form a double-stranded transposon end region.

In some embodiments, the method further comprises contacting the capture matrix with a transposase to form a transposome (eg, 6945). In some embodiments, the transposome ends comprise Mu transposome ends and the transposase is Mu transposase. In some embodiments, the transposome ends comprise Tn5 transposome ends and the transposase is T n5 transposase.

In some embodiments, the method further comprises contacting the capture matrix with a tissue sample such that the position of a capture site on the matrix can be correlated to a position in the tissue sample; and allowing a tagmentation reaction to occur between the genomic DNA of the tissue sample and the transposome at the capture site. In some embodiments, the genomic DNA comprises an SNV.

In some embodiments, the method further comprises analyzing the sequence of the tagged DNA. In some embodiments, sequencing the tagged DNA comprises performing a sequencing reaction using a combination of a gene-specific primer and a universal primer. In some embodiments, analyzing the sequence of the tagmented DNA comprises detecting SNV.

In some embodiments, the method further comprises correlating the sequence of the tagged DNA with the position of the genomic DNA in the tissue sample. In some embodiments, mapping the sequence of the tagged DNA comprises mapping the SNV to a position in the tissue sample.

4.12 Sequencing methods

The methods described herein can be used in conjunction with a variety of nucleic acid sequencing techniques. Particularly applicable techniques are those in which nucleic acids are bound at fixed locations in an array such that their relative positions do not change and in which the array is repeatedly imaged. Particularly applicable are embodiments where images are obtained in different color channels, eg, matching different markers used to distinguish one type of nucleotide base from another. In some embodiments, the process for determining the nucleotide sequence of an acid target nucleic can be an automated process. Preferred embodiments include sequencing by synthesis ("SBS") techniques.

"Sequencing-by-synthesis ("SBS") techniques" generally involve enzymatic extension of a nascent nucleic acid strand by iterative addition of nucleotides against a template strand. In traditional SBS methods, a single nucleotide monomer can be provided to a target nucleotide in the presence of a polymerase at each delivery. However, in the methods described herein, more than one type of nucleotide monomer can be provided to a target nucleic acid in the presence of a polymerase in one delivery.

SBS can use nucleotide monomers that have a terminator moiety or those that lack terminator moieties. Methods using nucleotide monomers lacking terminators include, for example, pyrosequencing and sequencing using Y-phosphate-labeled nucleotides, as discussed in more detail below. In methods using nucleotide monomers lacking terminators, the number of nucleotides added in each cycle is generally variable and depends on the template sequence and the mode of nucleotide supply. For SBS techniques that use nucleotide monomers that have a terminator moiety, the terminator may be effectively irreversible under the sequencing conditions used, as is the case with traditional Sanger sequencing using dideoxynucleotides, or the terminator may be reversible, as is the case with the sequencing methods developed by Solexa (now Illumina, Inc.).

SBS techniques can use nucleotide monomers that have a tag moiety or those that lack a tag moiety. Therefore, incorporation events can be detected based on a characteristic of the label, such as the fluorescence of the label; a characteristic of the nucleotide monomer, such as molecular weight or charge; a byproduct of nucleotide incorporation, such as the release of pyrophosphate; or the like. In embodiments where two or more different nucleotides are present in a sequencing reagent, the different nucleotides may be distinguishable from each other or, alternatively, the two or more different labels may be indistinguishable depending on the detection techniques that are used. For example, different nucleotides present in a sequencing reagent may have different labels and may be distinguished using appropriate optics as exemplified by sequencing methods developed by Solexa (now Illumina, Inc.).

Preferred embodiments include pyrosequencing techniques. Pyrosequencing detects the release of inorganic pyrophosphate (PPi) as particular nucleotides are incorporated into the nascent strand (Ronaghi, M., Karamohamed, S., Pettersson, B., Uhlen, M., and Nyren, P. (1996) , "Real-time DNA sequencing using detection of pyrophosphate release", Analytical Biochemistry, 242 (1), 84-89; Ronaghi, M. (2001), "Pyrosequencing Sheds Light on DNA Sequencing", Genome Res., 11 (1 ), 3-11, Ronaghi, M., Uhlen, M. and Nyren, P. (1998), "A sequencing method based on real-time pyrophosphate", Science, 281 (5375), 363, US Patent 6,210,891, US Patent 6,258,568 and US Patent 6,274,320 In pyrosequencing, released PPi can be detected by converting it immediately to adenosine triphosphate (ATP ) by ATP sulfurylase, and the level of ATP generated is detected by photons produced by luciferase.Nucleic acids to be sequenced can be bound to features on an array and images can be formed. tions of the matrix to capture the chemiluminescent signals that are produced due to the incorporation of nucleotides in the characteristics of the matrix. An image can be obtained after the array is treated with a particular nucleotide type (eg, A, T, C, or G). The images obtained after the addition of each type of nucleotide will differ with respect to the array features that are detected. These differences in the image reflect the different sequence content of the features in the array. However, the relative locations of each feature will remain unchanged in the images. Images may be stored, processed, and analyzed using the methods set forth in this document. For example, images obtained after treatment of the array with each different nucleotide type can be manipulated in the same manner as exemplified herein for images obtained from different detection channels for reversible terminator-based sequencing methods.

In another exemplary type of SBS, cycle sequencing is achieved by the stepwise addition of reversible terminator nucleotides containing, for example, a photobleachable or cleavable dye marker as described, for example, in International Patent Publication No. No. WO 04/018497 and US Patent 7,057,026. This strategy is being commercialized by Solexa (now Illumina Inc.), and is also described in the international patent publication. No. WO 91/06678 and International Patent Publication No. WO 07/123,744. Fluorescently labeled terminators are available in which the termination can be reversed and the cleaved fluorescent label facilitates efficient CRT sequencing. Polymerases can also be co-modified to efficiently perform incorporation and extension from these modified nucleotides.

Preferably, in reversible terminator-based sequencing embodiments, the labels do not substantially inhibit extension under SBS reaction conditions. However, detection labels can be removed, for example, by cleavage or degradation. Images can be captured upon incorporation of markers into nucleic acid features in an array. In particular embodiments, each cycle involves the simultaneous delivery of four different types of nucleotides to the array, and each type of nucleotide has a spectrally distinct label. Four images can then be obtained, each using a detection channel that is selective for one of four different markers. Alternatively, different types of nucleotides can be added sequentially and an image of the array can be obtained between each addition step. In such embodiments, each image will display nucleic acid features that have incorporated nucleotides of a particular type. Different features will be present or absent in the different images due to the different sequence content of each feature. However, the relative position of the features will remain unchanged in the images. Images obtained from such reversible termination-SBS methods can be stored, processed and analyzed as set forth herein. After the imaging step, labels can be removed and reversible terminator residues can be removed for subsequent cycles of nucleotide addition and detection. Removing labels after they have been detected in a particular cycle and before a subsequent cycle can provide the advantage of reducing background signal and crosstalk between cycles. Examples of useful markers and removal methods are set forth below.

In particular embodiments, some or all of the nucleotide monomers may include reversible terminators. In such embodiments, reversible terminators/cleavable fluorines can include fluorine attached to the ribose moiety through a 3' ester bond (Metzker, Genome Res., 15: 1767-1776 (2005)). Other strategies have separated the chemistry of the cleavage terminator from the fluorescent label (Ruparel et al., Proc. Natl. Acad. Sci. USA, 102: 5932-5937 (2005). Ruparel et al. described the development of reversible terminators that used a small 3' allyl group to block extension, but could be easily unblocked by short treatment with a palladium catalyst.The fluorophore was attached to the base via a photocleavable linker that could be easily cleaved by a 30 second exposure to long wavelength UV light. Therefore, disulfide reduction or photocleavage can be used as a cleavable linker. Another strategy for reversible termination is the use of natural termination that occurs after placement of a bulky dye on a dNTP The presence of a charged bulky dye on the dNTP can act as an effective terminator through steric and/or electrostatic hindrance. The presence of an incorporation event prevents further incorporation unless the dye is removed. Cleavage of the dye removes the fluorine and effectively reverses the termination. Examples of modified nucleotides are also described in US Patent 7,427,673, and US Patent 7,057,026.

Other examples of SBS methods and systems that can be used with the methods and systems described herein are described in US Patent Publication No. 2007/0166705, US Patent Publication No. 2007/0166705. 2006/0188901, US Patent 7,057,026, US Patent Publication No. 2006/0240439, US Patent Publication No. 2006/0281109, International Patent Publication No. WO 05/065814, US Patent Publication No. 2005/0100900, International Patent Publication No. WO 06/064199, International Patent Publication No. WO 07/010,251, United States Patent Publication No. US Patent Publication No. 2012/0270305 and US Patent Publication No. 2013/0260372.

Some embodiments may use detection of four different nucleotides using fewer than four different labels. For example, SBS can be performed using methods and systems described in US Patent Publication No. 2013/0079232. As a first example, a pair of nucleotide types can be detected at the same wavelength, but distinguished based on the difference in intensity of one member of the pair compared to the other, or based on a change in one member of the pair. pair (for example, by chemical modification, photochemical modification, or physical modification) that causes the apparent signal to appear or disappear compared to the signal detected for the other member of the pair. As a second example, three of the four different nucleotide types may be detected under particular conditions when a fourth nucleotide type lacks a label that is detectable under those conditions, or is minimally detected under those conditions (e.g., minimal detection due to to background fluorescence, etc.). The incorporation of the first three types of nucleotides into a nucleic acid can be determined based on the presence of their respective signals, and the incorporation of the fourth type of nucleotides into the nucleic acid can be determined based on the absence or minimal detection of any signal. As a third example, one type of nucleotide may include one or more labels that are detected in two different channels, while other types of nucleotide are detected in no more than one of the channels. The three exemplary configurations mentioned above are not considered mutually exclusive and may be used in various combinations. An exemplary embodiment combining all three examples is a fluorescence-based SBS method that uses a first type of nucleotide that is detected in a first channel (eg, dATP that has a label that is detected in the first channel when excited). with a first excitation wavelength), a second type of nucleotide that is detected in a second channel (for example, dCTP having a label that is detected in the second channel when excited by a second excitation wavelength) , a third type of nucleotide that is detected in both the first and second channels (for example, dTTP having at least one label that is detected in both channels when excited by the first and/or second excitation wavelengths ) and a fourth type of nucleotide that lacks a label that is not detected in any of the channels, or is minimally detected (for example, dGTP without a label).

Additionally, as described in US Patent Publication No. 2013/0079232, sequencing data can be obtained using a single channel. In so-called one-dye sequencing strategies, the first type of nucleotide is labeled, but the label is removed after the first image is generated, and the second type of nucleotide is labeled only after a first image is generated. The third type of nucleotide retains its label in both the first and second images, and the fourth type of nucleotide remains unlabeled in both images.

Some embodiments may use sequencing by docking techniques. Such techniques use DNA ligase to incorporate oligonucleotides and identify the incorporation of such oligonucleotides. Oligonucleotides typically have different labels that correlate to the identity of a particular nucleotide in a sequence to which the oligonucleotides hybridize. As with other SBS methods, images can be obtained after treating an array of nucleic acid features with labeled sequencing reagents. Each image will show features of nucleic acids that have incorporated markers of a particular type. Different features will be present or absent in the different images due to the different sequence content of each feature, but the relative position of the features will remain unchanged in the images. Images obtained from docking-based sequencing methods can be stored, processed, and analyzed as set forth herein. Examples of SBS methods and systems that can be used with the methods and systems described herein are described in US Patent 6,969,488, US Patent 6,172,218, and US Patent US 6,306,597.

Some embodiments may use nanopore sequencing (Deamer, DW and Akeson, M., "Nanopores and nucleic acids: prospects for ultrarapid sequencing", Trends Biotechnol., 18, 147-151 (2000); Deamer, D. and D. Branton, "Characterization of Nucleic Acids by Nanopore Analysis", Acc. Chem. Res., 35: 817-825 (2002 )); Li, J., M. Gershow, D. Stein, E. Brandin, and J. A. Golovchenko, "DNA molecules and configurations in a solid-state nanopore microscope," Nat. Mater., 2: 611-615 (2003)). In such embodiments, the target nucleic acid passes through a nanopore. The nanopore can be a synthetic pore or a biological membrane protein, such as α-hemolysin. As the target nucleic acid passes through the nanopore, each base pair can be identified by measuring fluctuations in the electrical conductance of the pore (US Patent 7,001,792; Soni, GV and Meller, A., " Progress toward ultrafast DNA sequencing using solid-state nanopores", Clin. Chem., 53, 1996-2001 (2007); Healy, K., "Nanopore-based singlemolecule DNA analysis", Nanomed., 2, 459-481 (2007 Cockroft, SL, Chu, J., Amorin, M., and Ghadiri, MR, "A singlemolecule nanopore device detects DNA polymerase activity with single-nucleotide resolution", J. Am. Chem. Soc., 130, 818-820 (2008)).The data obtained from nanopore sequencing can be stored, processed and analyzed as set forth in this document.In particular, the data can be treated as an image according to the example of optical image processing and other images that is set out in this document.

Some embodiments may use methods that involve real-time monitoring of DNA polymerase activity. Nucleotide incorporations can be detected via fluorescence resonance energy transfer (FRET) interactions between a fluorophore-bearing polymerase and Y-phosphate-labeled nucleotides as described, for example, in US Patent 7,329,492 and US Patent 7,211,414 or nucleotide incorporations can be detected with zero-mode waveguides as described, for example, in US Pat. 7,315,019, and using fluorescent nucleotide analogs and modified polymerases as described, for example, in US Patent 7,405,281 and US Patent Publication No. 2008/0108082. Illumination can be restricted to a zeptoliter-scale volume around a surface-bound polymerase so that incorporation of fluorescently labeled nucleotides can be observed with a low background (Levene, MJ et al., "Zero-mode waveguides for singlemolecule analysis at high concentrations", Science, 299, 682-686 (2003); Lundquist, PM et al., "Parallel confocal detection of single molecules in real time", Opt. Lett., 33, 1026-1028 (2008 Korlach, J. et al., "Selective aluminum passivation for targeted immobilization of single DNA polymerase molecules in zero-mode waveguide nanostructures", Proc. Natl. Acad. Sci. USA, 105, 1176-1181 (2008)). Images obtained from such methods may be stored, processed, and analyzed as set forth in this document.

Some embodiments of SBS include the detection of a proton released upon incorporation of a nucleotide into an extension product. For example, sequencing based on the detection of released protons may use an electrical detector and associated techniques that are commercially available from Ion Torrent (Guilford, CT, a subsidiary of Life Technologies) or sequencing methods and systems described in the publication US Patent No. 2009/0026082; US Patent Publication No. 2009/0127589; US Patent Publication No. 2010/0137143; or US Patent Publication No. 2010/0282617. The methods set forth herein for amplifying target nucleic acids using kinetic exclusion can be readily applied to substrates used to detect protons. More specifically, the methods set forth herein can be used to produce clonal populations of amplicons that are used to detect protons.

The above SBS methods can advantageously be carried out in multiplex formats such that multiple different target nucleic acids are handled simultaneously. In particular embodiments, different target nucleic acids may be treated in a common reaction vessel or on a particular substrate surface. This allows convenient delivery of sequencing reagents, removal of unreacted reagents, and detection of incorporation events in a multiplex manner. In embodiments using surface-bound target nucleic acids, the target nucleic acids may be in an array format. In an array format, target nucleic acids can typically be bound to a surface in a spatially distinguishable manner. Target nucleic acids can be attached by direct covalent attachment, attachment to a bead or other particle, or attachment to a polymerase or other surface-bound molecule. The array may include a single copy of a target nucleic acid at each site (also called a feature) or multiple copies may be present having the same sequence at each site or feature. Multiple copies can be produced by amplification methods, such as bridge amplification or emulsion PCR as described in more detail below.

The methods set forth herein may use arrays having features in any of a variety of densities including, for example, at least about 10 features/cm2, 100 features/cm2, 500 features/cm2, 1,000 features/cm2, 5,000 features /cm2, 10,000 features/cm2, 50,000 features/cm2, 100,000 features/cm2, 1,000,000 features/cm2, 5,000,000 features/cm2, or greater.

An advantage of the methods disclosed herein is that they provide rapid and efficient detection of a plurality of target nucleic acids in parallel. Accordingly, the present disclosure provides integrated systems capable of preparing and detecting nucleic acids using techniques known in the art, such as those exemplified above. Thus, an integrated system of the present disclosure may include fluidic components capable of delivering amplification reagents and/or sequencing reagents to one or more immobilized DNA fragments, the system comprising components such as pumps, valves, reservoirs, fluidic conduits, and Similar. A flow cell can be configured and/or used in an integrated system for the detection of target nucleic acids. Examples of flow cells are described, for example, in US Patent Publication No. 2010/0111768 A1 and US Patent Application No. 13/273,666. As exemplified for flow cells, one or more of the fluidic components of an integrated system may be used for an amplification method and a detection method. Taking an embodiment of nucleic acid sequencing as an example, one or more of the fluidic components of an integrated system may be used for an amplification method set forth herein and for administration of sequencing reagents in a sequencing method as exemplified. previously. Alternatively, an integrated system may include separate fluidic systems for carrying out amplification methods and for carrying out detection methods. Examples of integrated sequencing systems that are capable of creating amplified nucleic acids as well as determining the sequence of nucleic acids include, without limitation, the MiSeq™ platform (Illumina, Inc., San Diego, CA) and the devices described in US Patent Application No. 13/273,666, which is incorporated herein by reference. For example, the MiSeq™ platform can be implemented with 5' capture probes CAACGATCGTCGAAATTCGC[target primer] 3' and 5' [target primerjAGATCGGAAGAGCGTCGTGTA 3', where [target primer] is a sequence that is complementary to a target nucleic acid.

4.13 Concluding remarks

The foregoing detailed description of embodiments refers to the accompanying drawings, which illustrate specific embodiments of the present description. Other embodiments having different structures and operation do not depart from the scope of the present description. This specification is divided into sections for the convenience of the reader only. Headings should not be construed as limiting the scope of the description provided in this document. Definitions are intended to be part of the description provided in this document. Furthermore, the foregoing description is for illustrative purposes only and not for purposes of limitation.

5. Examples

5.1 Sensitivity of spatial NGS for the detection of single nucleotide variations

This example demonstrates that the sensitivity of SNV detection can be substantially increased using spatially addressed sequencing compared to bulk sequencing.

The sensitivity of SNV detection using bulk sequencing or spatially addressed sequencing data was assessed using simulated data sets. The calculations used to derive a massive sequencing data set were based on the following assumptions: (1) a typical FFPE section is 1.5 cm x 1.5 cm, which is approximately 225,000,000 pm2; (2) a typical cell is 20 x 20 pm, which has an area of approximately 400 pm2; (3) the number of cells in a typical FFPE section is about 563,000 (ie, 225,000,000 pm2 FFPE block x 400 pm2 cell = about 563K cells per section); and (4) the compaction density of cells in an FFPE section is about 70%, so the number of cells in a typical FFPE section is about 400,000. Table 3 below shows simulated data for the sensitivity of SNV detection in massive sequencing. To identify rare populations of clonally mutated cells by massive sequencing, the variant frequency (percent SNV) must be above the sequencing error rate, which is approximately 1%. For example, 1 variant cell ("localized mutated cells") in an FFPE section has a variant frequency (percent SNV) of 0.00025 (i.e. (1 cell r 400,000 cells in the FFPE section) x 100) = 0.00025% SNV), which is well below the sequencing error rate and therefore not detectable in bulk sequencing data. At least approximately 4,000 cells are required to detect an SNV in massive sequencing data, eg, 4,096 cells (400,000 cells in the FFPE section) x 100) = 1.024, which is above the sequencing error rate.

It was found that the sensitivity of SNV detection can be increased substantially using spatially addressed sequencing as exemplified using a simulated data set based on a 1.5 cm x 1.5 cm tissue section overlaid on a matrix of . 2cm x 2cm. Figure 70 illustrates a plan view of a spatial direction overlay 7000. The spatial direction overlay 7000 comprises a substrate 7005. In one example, the substrate 7005 is a flat glass substrate such as a coverslip having a size of 2 cm x 2 cm. Imprinted on the surface of the 7005 substrate are a plurality of discrete features (not shown) which are oligonucleotide-containing regions with spatial addresses. An example of a single spatial feature is described in more detail with reference to Figure 71. Superimposed on substrate 7005 is a section of fabric 7010. In one example, section of fabric 7005 is a 1.5 FFPE fabric section. cm x 1.5 cm in size.

Figure 71 illustrates a plan view of a single spatial feature 7100 on substrate 7005 of Figure 70. In this example, spatial feature 7100 is a 100 pm x 100 pm square (area = 10,000 pm 2 ). Spatial feature 7100 is of sufficient size to encompass a plurality of cells 7105 contained in a tissue sample. The 7105 cells can be normal cells (eg, 7105a) or variant (mutated) cells (eg, 7105b). In one example, the 7105 cells are 20 pm x 20 pm in size (area = 400 pm2) and the cell packing density in the tissue section is approximately 70%. Based on these parameters, the number of 7105 cells that are included in the 7100 spatial feature is approximately 18 (ie, (10,000 pm2 -f 400 pm2) * 0.7) = approximately 18).

Table 4 below shows simulated data for SNV detection sensitivity in sequencing data with spatial addresses based on the 7000 spatial address overlap of Figure 70 and Figure 71. For example, 1 variant cell ("cells mutated localized) in a single spatial feature 3000 has a variant frequency (% SNV) of approximately 6 (i.e., (1 cell -f 18 cells per spatial feature) * 100 = 6% SNV), which is above of 1% sequencing error rate and is therefore detectable in spatially addressed sequencing data.In comparison, about 4000 cells or more are required for detection of SNV in massive sequencing data.

The number ( x ) of 7100 spatial features on the 7005 substrate needed to achieve the desired level of detection sensitivity can be calculated as follows: (XY length of array) = (spatial feature edge xx) (( x - 1) x spatial feature spacing)), where the array length is 20,000 gm, the spatial feature border is 100 gm, and the spatial feature spacing is, for example, 50 gm ; then x = 133 spatial features for the X dimension and 133 spatial features for the Y dimension. The total number of features on the 7005 substrate (2 cm x 2 cm) is 133 x 133 = approx. 17,689.

Claims (15)

1 A capture array for the spatial detection and analysis of nucleic acids in a tissue sample, comprising a plurality of capture sites, wherein each capture site comprises a pair of probes immobilized on a surface, wherein a first probe of the pair of probes comprises a first primer binding region sequence and a unique spatial address region sequence and does not comprise a capture region sequence, and wherein a second probe of the pair of probes comprises a second primer binding region sequence and the capture region sequence and does not comprise the spatial address region sequence, wherein the capture region sequence comprises a poly-T capture sequence and the sequence poly-T capture cell is configured to hybridize to a target nucleic acid comprising a poly-A tail; or the capture region sequence comprises a gene-specific capture sequence and the gene-specific capture sequence is configured to hybridize to a target nucleic acid comprising a gene-specific sequence; or the capture region sequence comprises a random primer capture sequence and the random primer capture sequence is configured to hybridize to a target nucleic acid comprising a sequence complementary to the random primer capture sequence. 2. - The capture array of claim 1, wherein the pair of probes at a capture site is a plurality of pairs of probes. 3. - The capture matrix of claim 2, wherein one or more capture sites of the capture matrix have the same number of first probes and second probes, optionally in which one or more capture sites of the capture array have more first probes than second probes, and optionally wherein one or more capture sites of the capture array have more second probes than first probes. 4. - The capture matrix of claim 1, wherein the capture matrix is integrated into an electrophoresis system. 5. - The capture matrix of claim 4, wherein the capture site in the electrophoresis system is configured for the transfer and capture of nucleic acids from a tissue sample, such that the diffusion of nucleic acids from the tissue sample and leakage of nucleic acids between capture sites are substantially reduced relative to a passive transfer of nucleic acids that occurs under otherwise identical conditions by passive diffusion. 6. - A method for the spatial detection and analysis of nucleic acids in a tissue sample, comprising (a) providing the capture matrix of any one of claims 1-5, (b) contacting the plurality of capture sites with a tissue sample such that the position of each capture site on the array can be correlated to a position in the tissue sample. 7. - The method of claim 6, further comprising (c) allowing the nucleic acids of the tissue sample to hybridize with the respective poly-T capture sequence, the gene-specific capture sequence or with the sequence capturing random primer of the second probe from the plurality of capture sites to form hybridized second probes; (d) extending the capture region sequence of the hybridized second probes to form immobilized complementary first strands of the target nucleic acid; (e) coupling the immobilized first complementary strands to the spatial address region sequence of the first probes at each capture site to immobilize the first complementary strands at both ends; (f) synthesizing complementary second strands using a primer complementary to the first primer binding region sequence of the first probes; (g) releasing the complementary second strands from the surface of the capture matrix; (h) analyzing the sequence of the released complementary second strands, and (i) correlating the sequence of the released complementary second strands with the position of the nucleic acid in the tissue sample. 8. - The method of claim 7, wherein allowing the nucleic acids of the tissue sample to hybridize with the sequence of the poly-T capture region, the gene-specific capture sequence or with the sequence of capture of the random primer of the second probe comprises an electrophoretic transfer of the nucleic acids from the tissue sample to the capture matrix. 9. - The method of claim 6, wherein the first or second primer binding region sequence comprises an SBS primer sequence, which can be used in a sequencing by sequencing (SBS) process. 10. - The method of claim 9, wherein the SBS primer sequence is an SBS3 or SBS12 sequence. 11. - The method of claim 6, wherein the first primer binding region sequence and the second primer binding region sequence are different. 12. - The method of claim 6, wherein the capture region of the second probe comprises a single nucleotide variation (SNV). 13. - The method of claim 12, wherein the method has an SNV detection sensitivity of less than about 0.0001% in a typical FFPE section comprising up to 1 million fixed cells. 14. - The method of claim 6, wherein the capture region sequence in the second probe is a gene-specific capture sequence. 15. - The method of claim 14, wherein the gene-specific capture sequence in the second probe comprises the sequence of an amplicon-specific probe.