ES2810701T3 - Procedures for Therapeutic Administration of Messenger Ribonucleic Acid Medications - Google Patents

Abstract

A messenger RNA (mRNA) encoding a polypeptide of interest, wherein the mRNA comprises: (i) at least one miR-142-3p microRNA binding site; (ii) at least one miR-126 binding site; or (iii) at least one miR-142-3p microRNA binding site and at least one miR-126 binding site, optionally where the mRNA comprises one or more modified nucleobases, for use in a method to reduce or inhibit an anti-drug antibody response in a subject, the method comprises administering the mRNA to the subject such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject.

Description

DESCRIPTION

Procedures for Therapeutic Administration of Messenger Ribonucleic Acid Medications

Background of the invention

Biologics, such as recombinant antibodies, cytokines, and growth factors, have been shown to be effective in treating a wide variety of diseases, and a large number of such agents have been approved by the FDA for use in humans (for For a review, see Kinch, MS (2015) Drug Discov. Today 20: 393-398). The vast majority of FDA-approved biologics are protein-based agents. More recently, messenger RNA-based agents are being developed as a disruptive therapeutic embodiment. There are several reported examples of effective mRNA-based vaccines including both infectious disease vaccines and tumor vaccines (for respective reviews, see Marc MA, et al. (2015) Expert Opin Drug Deliv. Sep 12: 1-15 and Sahin , U., et al. (2014) Nature Reviews Drug Discovery 13: 759-780). More recently, the use of mRNA-based agents for therapeutic purposes is targeted, for example, using mRNA constructs that encode a therapeutic protein of interest.

Consequently, new strategies and procedures are needed for the use of mRNA-based agents in a subject, such as mRNA-based therapeutic agents, particularly procedures that offer advantageous properties with respect to the safety and / or therapeutic effectiveness of the mRNA-based agent. MRNA in the subject.

Summary of the Invention

The present invention is defined in the claims and provides a messenger RNA (mRNA) encoding a polypeptide of interest, wherein the mRNA comprises:

(i) at least one miR-142-3p microRNA binding site;

(ii) at least one miR-126 binding site; or

(iii) at least one miR-142-3p microRNA binding site and at least one miR-126 binding site, optionally where the mRNA comprises one or more modified nucleobases, for use in a method to reduce or inhibit a anti-drug antibody response in a subject, the method comprises administering the mRNA to the subject such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject.

Other aspects of the invention are also defined in the claims.

The description provides methods for use with mRNA-based agents for administration to a subject, where the methods provide advantageous features for the use of the mRNA-based agents in vivo. Now, it has been surprisingly discovered that administration to non-human primates of agents based on mRNA encoding a protein of interest can lead to the development of an unwanted immune response in animals, where antibodies against the protein encoded by the mRNA can be detected in the animal. This is an unexpected result, as the animal was not administered a therapeutic protein, but rather an mRNA construct, and local production of the protein of interest in the target tissues in vivo was not expected to lead to a response against the encoded protein product. The response observed in non-human primates has also been studied in other relevant animal model systems and is analogous to the art-recognized anti-drug antibody (ADA) response seen in both the fields of recombinant protein treatments and molecule treatments. little. A recognizable distinction in terminology is apparent to one of ordinary skill in the art in that a classical anti-drug antibody (ADA) response is generally understood as a response to systemic administration of, for example, a recombinant therapeutic protein, which can generate antibodies directly to said therapeutic protein. In the field of mRNA treatment, the antibody responses observed in the animal studies described in this invention do not correspond to the mRNA-based drug per se. Rather, antibody responses are to the drug-encoded protein product of mRNA. One of skill in the art may refer to a phenomenon as anti-protein antibody (APA), but due to pharmacologically analogous effects, instant application will use art-recognized terminology of anti-drug antibody (ADA).

Surprisingly, it has now also been discovered that the inclusion in the mRNA construct of at least one microRNA binding site (miR) for a miR expressed in conventional immune cells or any cell that expresses TLR7 and / or TLR8 and secretes chemokines and / or or pro-inflammatory cytokines (for example, in immune cells of peripheral lymphoid organs and / or splenocytes and / or endothelial cells) results in a dramatic inhibition of ADA responses in vivo. Accordingly, the disclosure provides methods for reducing or inhibiting anti-drug antibody responses in which a protein of interest is encoded by a messenger RNA (mRNA) comprising at least one microRNA binding site (miR) for a miR expressed in conventional immune cells or any cell that expresses TLR7 and / or TLR8 and secretes chemokines and / or pro-inflammatory cytokines (eg, in immune cells from peripheral lymphoid organs, such as spleen cells, eg, splenic myeloid cells, and / or endothelial cells ). In exemplary aspects, the disclosure provides methods for reducing or inhibiting anti-drug antibody responses in which a protein of interest is encoded by messenger RNA (mRNA), eg, modified messenger RNA (mmRNA) comprising one or more modified nucleobases. and the mRNA, eg, mmRNA, further comprises at least one microRNA binding site (miR) for a miR expressed in conventional immune cells or any cell that expresses TLR7 and / or TLR8 and secretes chemokines and / or pro-inflammatory cytokines (for for example, in immune cells of peripheral lymphoid organs, such as spleen cells, for example, splenic myeloid cells, and / or endothelial cells). In the methods of the disclosure, a subject is administered mRNA, eg, mmRNA, encoding the polypeptide of interest and comprising the binding site for the at least one miR expressed in immune cells such that a response of anti-drug antibody to the polypeptide of interest is reduced or inhibited in the subject. In exemplary embodiments, the miR binding site is for an abundantly or preferentially expressed miR in immune cells (eg, immune cells of peripheral lymphoid organs and / or splenocytes). In exemplary embodiments, the miR binding site is included in an untranslated region (UTR) of the mRNA, eg, mmRNA, that encodes the protein of interest ( eg, the 3 'UTR, the 5' UTR, or in both 3 'and 5' UTR). Accordingly, in the methods of the disclosure, an anti-drug antibody response is reduced or inhibited by post-transcriptional regulation of mRNA, with a possible component of translational repression, by the inclusion of at least one miR binding site, without the need to alter the amino acid sequence of the protein of interest.

In one embodiment, the at least one miR expressed in immune cells is a miR-142-3p microRNA binding site. In another embodiment, the at least one miR expressed in immune cells is a miR-126 microRNA binding site, such as a miR-126-3p binding site. Accordingly, the disclosure provides a method of reducing or inhibiting an anti-drug antibody response in a subject, which comprises administering to the subject a messenger RNA (mRNA), eg, a modified messenger RNA (mRNA) encoding a polypeptide of interest. , where the mRNA, for example mmRNA, comprises at least one miR-142-3p microRNA binding site and / or at least one miR-126 microRNA binding site, and where the mRNA, for example, mmRNA , comprises one or more nucleobases modified, such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject. In one embodiment, the miR-142-3p microRNA binding site comprises the sequence shown in SEQ ID NO: 3. In one embodiment, the miR-126 binding site is a miR-126- binding site. 3p. In one embodiment, the miR-126-3p microRNA binding site comprises the sequence shown in SEQ ID NO: 26.

In other embodiments, the mRNA, eg, mmRNA, comprises at least one microRNA binding site for a miR selected from the group consisting of miR-142, miR-146 miR-155, miR-126, miR-16 , miR-21, miR-223, miR-24 and miR-27. A miR referred to in this invention by a number can refer to either of the two mature microRNAs originating from opposite arms of the same pre-miRNA (eg, the 3p or 5p microRNA). All miRs referenced by a number in this invention are intended to include both the 3p and 5p arms / sequences.

In another example, the mRNA, eg, mmRNA, comprises at least two miR binding sites for microRNAs expressed in immune cells. In various embodiments, the mRNA, eg, mmRNA comprises 1-4, one, two, three, or four miR binding sites for microRNAs expressed in immune cells. These miR binding sites can be for microRNAs selected from the group consisting of miR-142 (including miR-142-3p and miR-142-5p), miR-146 (including miR-146-3p and miR-146 -5p), miR-155, miR-126 (including miR-126-3p and miR-126-5p), miR-16, miR-21, miR-223, miR-24, miR-27, and combinations thereof . In another embodiment, the mRNA, eg , the mmRNA comprises at least two miR binding sites, for microRNAs expressed in immune cells, where at least one of the miR binding sites is for miR-142-3p. In various embodiments, the mRNA, eg, mmRNA, comprises binding sites for miR-142-3p and miR-155, miR-142-3p and miR-146, or miR-142-3p and miR-126 (eg , miR- 126-3p). In another embodiment, the mRNA, for example, the mmRNA comprises at least two miR binding sites, for microRNAs expressed in immune cells, where at least one of the miR binding sites is for miR-126 (for example, miR -126-3p). In various embodiments, the mRNA, eg, mmRNA, comprises binding sites for miR-126 and miR-155, miR-126 and miR-146, or miR-126 and miR-142. In one embodiment, the mRNA, eg, mmRNA, comprises a miR-142-3p binding site and a miR-126 binding site.

In one embodiment, the mRNA, eg, mmRNA, comprises a 5 'UTR, a codon optimized open reading frame encoding the polypeptide of interest, a 3' UTR comprising the at least one microRNA binding site for a miR expressed in immune cells of and a 3 'tail region of linked nucleosides. In various embodiments, the 3 'UTR comprises 1-4, at least one, two, three, or four miR microRNA binding sites expressed in immune cells, preferably abundantly or preferentially expressed in immune cells (e.g., in immune cells peripheral lymphoid organs and / or splenocytes). In other embodiments, the 3 'UTR comprises at least one miR-142-3p microRNA binding site or at least two miR binding sites for miR expressed in immune cells, where one miR binding site is for miR- 142-3p. In another embodiment, the 3 'UTR comprises at least one miR-126 microRNA binding site or at least two miR binding sites for miRs expressed in immune cells, where one miR binding site is for miR-126. In one embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site (e.g., a miR-142-3p and / or a miR-126 binding site) is found within the 3 'UTR 1-100 nucleotides after the stop codon. In another embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site (e.g., a miR-142-3p and / or a miR-126 binding site) is found within the 3 'UTR 30-50 nucleotides after the stop codon. In another embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site (e.g., a miR-142-3p microRNA binding site and / or a miR-126 microRNA binding site) is located within the 3 'UTR at least 50 nucleotides after the stop codon.

In another embodiment, the mRNA, eg, the mmRNA, comprises a 5 'UTR and a 3' UTR that are heterologous to the open reading frame.

In another embodiment, the chemically modified mRNA, eg, mmRNA, is completely modified. In other embodiments, the chemically modified mRNA, eg, mmRNA, comprises one or more modified nucleobases further described in this invention.

In some embodiments, the mRNA comprises pseudouridine ( ^and ). In some embodiments, the mRNA comprises pseudouridine (y) and 5-methyl-cytidine (m5C). In some embodiments, the mRNA comprises 1-methyl-pseudouridine (m1 ^). In some embodiments, the mRNA comprises 1-methyl-pseudouridine (m1Y) and 5-methyl-cytidine (m5C). In some embodiments, the mRNA comprises 2-thiouridine (s2U). In some embodiments, the mRNA comprises 2-thiouridine and 5-methyl-cytidine (m5C). In some embodiments, the mRNA comprises 5-methoxyuridine (mo5U). In some embodiments, the mRNA comprises 5-methoxy-uridine (mo5U) and 5-methyl-cytidine (m5C). In some embodiments, the mRNA comprises 2'-O-methyl uridine. In some embodiments, the mRNA comprises 2'-O-methyl uridine and 5-methyl-cytidine (m5C). In some embodiments, the mRNA comprises N6-methyl-adenosine (m6A). In some embodiments, the mRNA comprises N6-methyl-pseudouridine (m6A) and 5-methyl-cytidine (m5C).

In any of the above aspects, the mRNA described in this invention comprises pseudouridine ( ^y ), N1-methylpseudouridine (m1Y), 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza -pseudouridine, 2-thio-1-methylpseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4 -methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine or 2'-O-methyl uridine, or combinations thereof. In some embodiments, an mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (eg, a combination of 2, 3, or 4 of the aforementioned modified nucleobases).

In some embodiments, the modified nucleobase is 1-methyl-pseudouridine (m1Y), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), pseudouridine (y), a-thio-guanosine, or a-thio- adenosine. In some embodiments, an mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (eg, a combination of 2, 3, or 4 of the aforementioned modified nucleobases).

In one embodiment, the mRNA, eg, mmRNA, is administered intravenously, encapsulated in a lipid nanoparticle. In one embodiment, the anti-inflammatory agent is a corticosteroid. In one embodiment, the lipid nanoparticle comprises a cationic and / or ionizable lipid. In one embodiment, the cationic and / or ionizable lipid is DLin-KC2-DMA or DLin-MC3-DMA.

In one embodiment, the polypeptide of interest is a therapeutic protein, a cytokine, a growth factor, an antibody, or a fusion protein. Other examples of polypeptides of interest are described in this invention.

In one embodiment, the mRNA, eg, mmRNA, is administered by infusion once a week. In another embodiment, the infusion is administered intravenously. In another embodiment, the mRNA, eg, mmRNA, is infused once a week for at least 4 weeks. In another embodiment, the mRNA, eg, mmRNA, is administered intratumorally. Suitable dosage regimens are further described in this invention.

In another embodiment, the disclosure provides a method of reducing or inhibiting the anti-drug antibody response after repeated administration of a polypeptide of interest to a subject, comprising administering to the subject intravenously a first dose of an mRNA, for example, Modified mRNA (mmRNA), encoding a polypeptide of interest encapsulated in an LNP, where the mRNA, for example mmRNA, comprises at least one miR-142-3p microRNA binding site and / or at least one binding site miR-126 microRNA, and where the mRNA, eg, mmRNA, comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of mRNA, eg, mmRNA, encapsulated in an LNP, such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject.

In another aspect, the disclosure provides a method of reducing or inhibiting an anti-drug antibody response after repeated administration of a polypeptide of interest to a subject, comprising

(i) administering to the subject intravenously a first dose of an mRNA, eg, modified mRNA (mRNA), encoding a polypeptide of interest encapsulated in an LNP, where the mRNA, eg, mRNA, comprises at least one site binding site for a miR expressed in immune cells (for example, a miR-142-3p microRNA binding site and / or a miR-126 microRNA binding site), and where the mRNA, for example, mmRNA, comprises one or more modified nucleobases;

(ii) detecting a level of anti-drug antibodies in a sample from a subject; Y

(iii) administering to the subject intravenously a second dose of mRNA , eg, mmRNA, encapsulated in an LNP when the level of anti-drug antibodies in the sample decreases, such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibits in the subject.

In another aspect, the disclosure provides a method of reducing or inhibiting drug-related toxicity in a subject, comprising administering to the subject a messenger RNA (mRNA), eg, modified messenger RNA (mmRNA), encoding a polypeptide of of interest, where the mRNA for example, mmRNA, comprises at least one microRNA binding site for a miR expressed in immune cells (for example, a miR-142-3p microRNA binding site and / or a binding site for miR-126 microRNA) and where the mRNA, eg, mmRNA comprises one or more modified nucleobases, such that drug-related toxicity to the polypeptide of interest is reduced or inhibited in the subject. In one embodiment, the drug-related toxicity for the polypeptide of interest is reduced blood counts (cytopenia) in the subject. In one embodiment, the drug-related toxicity for the polypeptide of interest is autoimmunity in the subject. In one embodiment, drug-related toxicity for the polypeptide of interest is complement-mediated effects in the subject. In one embodiment, the drug-related toxicity for the polypeptide of interest is reduced hematopoiesis in the subject. In other embodiments, the drug-related toxicity can be, for example, kidney or liver toxicity.

Furthermore, it has now been further discovered that the inclusion of at least one binding site for a microRNA (miR) expressed in conventional immune cells or in any cell that expresses TLR7 and / or TLR8 and secretes chemokines and / or pro-inflammatory cytokines (e.g. , in immune cells of peripheral lymphoid organs, such as spleen cells, for example, splenic myeloid cells, and / or endothelial cells), as a binding site of miR-126 and / or miR-142, in an mRNA reduces or it inhibits unwanted immune cell activation (eg, B cell activation, cytokine secretion) in a subject to whom the mRNA is administered. It has further been discovered that the inclusion of this at least one or more miR binding sites in an mRNA can reduce or inhibit the accelerated blood clearance (AUC) of a compound or composition comprising lipids where the mRNA is administered. Furthermore, the inclusion of this at least at miR binding sites in an mRNA can reduce or inhibit the proliferation and / or activation of plasmacytoid dendritic cells (pDC) and / or reduce or inhibit the production of IgM against the compound or composition. comprising lipids where the mRNA is administered by B cells, such as, for example, IgM against phospholipid components (e.g., phosphatidylcholine) of the compound or composition comprising lipids by B cells.

Accordingly, in one aspect, the disclosure provides methods for reducing or inhibiting unwanted immune cell activation in a subject administered an RNA, eg, mRNA, encoding a polypeptide of interest, the methods comprising administering to the subject an RNA, e.g. mRNA, for For example, a chemically modified messenger RNA (mmRNA), encoding a polypeptide of interest, comprising at least one binding site for a microRNA (miR) expressed in conventional immune cells or any cell that expresses TLR7 and / or TLR8 and secretes chemokines and / or pro-inflammatory cytokines (eg, in immune cells from peripheral lymphoid organs, such as spleen cells, eg, splenic myeloid cells, and / or endothelial cells), as a miR-126 microRNA binding site and / or of miR-142, such that unwanted immune cell activation is reduced or inhibited in the subject. In another aspect, the disclosure provides methods for reducing or inhibiting unwanted cytokine production in a subject administered an RNA, eg, mRNA, encoding a polypeptide of interest, the methods comprising administering RNA to the subject, for example, mRNA, for example, a chemically modified messenger RNA (mmRNA), encoding a polypeptide of interest, comprising at least one binding site for a microRNA (miR) expressed in conventional immune cells or any cell that expresses TLR7 and / or TLR8 and secretes chemokines and / or pro-inflammatory cytokines (eg, in immune cells of peripheral lymphoid organs, such as spleen cells, eg, splenic myeloid cells, and / or endothelial cells), as a microRNA binding site of miR-126 and / or miR-142, such that unwanted cytokine production is reduced or inhibited in the subject. The RNA may be an mRNA, such as a chemically modified mRNA (referred to in this invention as mmRNA) comprising one or more modified nucleobases. The mmRNA can be completely modified (that is, all nucleotides or nucleobases of a particular type are modified within the mmRNA), they can be partially modified (that is, a portion of nucleotides or nucleobases of a particular type are modified within the mRNA or they can be a chimeric mRNA containing stretches of modified and unmodified nucleobases.

In one embodiment, the reduction or inhibition of unwanted immune cell activation and / or cytokine production is determined in comparison to the administration of a control RNA, eg, mRNA, eg, mmRNA, lacking the at least one binding site for a microRNA (miR) expressed in immune cells, such as a miR-126 and / or a miR-142 microRNA binding site. In one embodiment, immune cell activation is decreased by at least 10%. In another embodiment, immune cell activation is decreased by at least 25%. In yet another embodiment, immune cell activation is decreased by at least 50%. In yet another embodiment, immune cell activation is decreased without a corresponding decrease in the expression of a polypeptide (eg, therapeutic protein) of interest encoded by the mRNA.

In one embodiment, the immune cell activation is lymphocyte activation. In one embodiment, lymphocyte activation is B cell activation. In one embodiment, B cell activation is determined by the frequency of CD19 + CD86 + CD69 + B cells. In another embodiment, B cell activation is determined by cytokine secretion, eg, in serum or from total spleen cells. In one embodiment, B cell activation is determined by secretion of interleukin-6 (IL-6), tumor necrosis factor a (TNF-a), or interferon-Y (IFN-y), for example, in serum or by total splenic cells. In one embodiment, B cell activation is determined by IL-6 secretion, eg, from serum or from total spleen cells. In one embodiment, the reduction or inhibition of cytokine production is determined by the reduction or inhibition of the production of interleukin-6 (IL-6), tumor necrosis factor a (TNF-a), or interferon-Y (IFN- ^and ). In yet another embodiment, the reduction or inhibition of cytokine production is determined by the reduction or inhibition of interleukin-6 (IL-6) production.

In another embodiment, the disclosure provides a method of reducing or inhibiting accelerated blood clearance in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), The method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the Chemically modified mRNA comprises one or more modified nucleobases, such that accelerated blood clearance is reduced or inhibited in the subject after repeated administration.

In some embodiments, the disclosure provides a method of reducing or inhibiting accelerated blood clearance in a subject administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), comprising administering to the subject intravenously a first dose of a chemically modified mRNA encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the modified mRNA chemically it comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of a chemically modified mRNA encapsulated in an LNP, such that accelerated blood clearance is reduced or inhibited in the subject.

In some embodiments, the disclosure provides a method of reducing or inhibiting the production of IgM molecules that recognize polyethylene glycol (PEG) in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding the polypeptide of interest. encapsulated in a lipid nanoparticle (LNP), the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that the production of IgM molecules that recognize PEG is reduced or inhibited in the subject after repeated administration.

In additional embodiments, the disclosure provides a method of reducing or inhibiting B1a cell activation in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP). ), the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and wherein the chemically modified mRNA comprises one or more modified nucleobases, such that activation of B1a cells is reduced or inhibited in the subject after repeated administration.

In some embodiments, the disclosure provides a method of reducing or inhibiting plasmacytoid dendritic cell activation in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle ( LNP), the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that plasmacytoid dendritic cell activation is reduced or inhibited in the subject after repeated administration.

In additional embodiments, LNP does not activate B cells and / or does not induce the production of IgM molecules capable of binding to LNP, such that accelerated blood clearance is reduced or inhibited in the subject following administration of one or more more subsequent doses. In some embodiments, the IgM molecules recognize polyethylene glycol (PEG).

In some embodiments, the reduction or inhibition of accelerated blood clearance is determined compared to the control administration of a chemically modified mRNA, which lacks the at least one microRNA binding site encapsulated in a lipid nanoparticle (LNP). In additional embodiments, accelerated blood clearance is reduced or inhibited without a corresponding reduction or inhibition in the expression of the polypeptide of interest encoded by the chemically modified mRNA.

In some embodiments, the interval between two consecutive doses is less than 2 weeks. In other embodiments, the interval between two consecutive doses is less than 1 week.

In one embodiment, the mRNA, eg, mmRNA, comprises a 5 'UTR, a codon optimized open reading frame encoding a polypeptide of interest, a 3' UTR comprising the at least one binding site for a microRNA ( miR) expressed in immune cells, such as a miR-126 (eg miR-126-3p) or miR-142 (eg miR-142-3p) a microRNA binding site, and a 3 'region of tail of linked nucleosides. In one embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one binding site for the microRNA expressed in immune cells (e.g., a miR-142 binding site -3p and / or a miR-126-3p binding site) is located within the 3 'UTR, 1 to 100 nucleotides after the stop codon. In another embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one binding site for the microRNA (miR) expressed in immune cells, such that a binding site miR-126 and / or miR-142 microRNA is located within the 3 'UTR, 30 to 50 nucleotides after the stop codon. In another embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one binding site for the microRNA (miR) expressed in immune cells, such that a binding site miR-126 and / or miR-142 microRNA is located within the 3 'UTR, at least 50 nucleotides after the stop codon. In another embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one binding site for the microRNA expressed in immune cells (e.g., a miR-142 binding site -3p and / or a miR-126-3p binding site) is located anywhere in the 3 ' UTR (for example, after the first 100 nucleotides after a stop codon). In another embodiment, the mRNA, eg, the mmRNA, comprises a 5 'UTR and a 3' UTR that are heterologous to the open reading frame.

In various embodiments, the mRNA, for example, the mmRNA comprises 1 to 4, one, two, three, or four miR binding sites for microRNAs expressed in immune cells, where at least one of the miR binding sites is a miR-126 binding site. In one embodiment, the mRNA, eg, the mmRNA comprises at least two microRNA binding sites, for microRNAs expressed in immune cells, where at least one of the microRNA binding sites is a miR-126 binding site. In one embodiment, the mRNA, eg, mmRNA, comprises miR-126 binding site and a second microRNA binding site for a miR selected from the group consisting of miR-142-3p, miR-142-5p , miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27. In another embodiment, the mRNA, eg, mmRNA, comprises a miR-126 binding site (eg, miR-126-3p) and a miR-142 binding site (eg, miR-142-3p). . In one embodiment, the mRNA, eg, the mmRNA comprises at least three microRNA binding sites, for microRNAs expressed in immune cells, where at least one of the microRNA binding sites is a miR-126 binding site. In one embodiment, the mRNA, eg, mmRNA, comprises a miR-126 binding site, a miR-142 binding site (eg, miR 142-3p), and a third microRNA binding site for a miR. selected from the group consisting of miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27. In another embodiment, the mRNA, eg, mmRNA, comprises a miR-126 binding site, a miR-142 binding site (eg, miR-142-3p), and a miR-155 binding site.

In another example, the mRNA, eg, mmRNA, comprises at least two microRNA binding sites for microRNAs expressed in immune cells. In another embodiment, the mRNA, eg, mmRNA, comprises a miR-126 binding site, a miR-142-3p binding site, a miR-142-5p binding site, and a miR binding site. -155. A miR referred to in this invention by a number can refer to either of the two mature microRNAs originating from opposite arms of the same pre-miRNA (eg, the 3p or 5p microRNA). All miRs referenced by a number in this invention are intended to include both the 3p and 5p arms / sequences.

In one embodiment, the miR-126-3p binding site comprises the sequence shown in SEQ ID NO: 26. In one embodiment, the miR-142-3p binding site comprises the sequence shown in SEQ ID NO: 3. In one embodiment, the miR-155 binding site comprises the sequence shown in SEQ ID NO: 35.

In some embodiments, the microRNA binding site binds to a microRNA expressed in myeloid cells. In other embodiments, the microRNA binding site binds to a microRNA expressed on plasmacytoid dendritic cells. In still other embodiments, the microRNA binding site binds to a microRNA expressed in macrophages.

In another embodiment, the mRNA, eg, mmRNA, is completely modified for a particular chemical modification. The types of suitable chemical modification are further described in this invention. In other embodiments, the mRNA, eg, mmRNA, comprises one or more modified nucleotides or nucleobases, as further described in this invention.

In some embodiments, the mRNA comprises pseudouridine ( ^and ). In some embodiments, the mRNA comprises pseudouridine (y) and 5-methyl-cytidine (m5C). In some embodiments, the mRNA comprises 1-methyl-pseudouridine (m1 ^). In some embodiments, the mRNA comprises 1-methyl-pseudouridine (m1Y) and 5-methyl-cytidine (m5C). In some embodiments, the mRNA comprises 2-thiouridine (s2U). In some embodiments, the mRNA comprises 2-thiouridine and 5-methyl-cytidine (m5C). In some embodiments, the mRNA comprises 5-methoxyuridine (mo5U). In some embodiments, the mRNA comprises 5-methoxy-uridine (mo5U) and 5-methyl-cytidine (m5C). In some embodiments, the mRNA comprises 2'-O-methyl uridine. In some embodiments, the mRNA comprises 2'-O-methyl uridine and 5-methyl-cytidine (m5C). In some embodiments, the mRNA comprises N6-methyl-adenosine (m6A). In some embodiments, the mRNA comprises N6-methyl-adenosine (m6A) and 5-methyl-cytidine (m5C).

In some embodiments, the modified nucleobase is pseudouridine ( ^y ), Nl-methylpseudouridine (m1Y), 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio -1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxypseudouridine, 4 -thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine or 2'-O-methyl uridine. In some embodiments, an mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (eg, a combination of 2, 3 or 4 of the aforementioned modified nucleobases).

In some embodiments, the modified nucleobase is 1-methyl-pseudouridine (m1Y), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), pseudouridine ( ^y ), a-thio-guanosine, or a-thio-adenosine. . In some embodiments, an mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (eg, a combination of 2, 3, or 4 of the aforementioned modified nucleobases).

In one embodiment, the mRNA, eg, mmRNA, is administered intravenously, encapsulated in a lipid nanoparticle. In one embodiment, the lipid nanoparticle is a liposome. In one embodiment, the lipid nanoparticle comprises a cationic and / or ionizable lipid. In one embodiment, the cationic and / or ionizable lipid is DLin-KC2-DMA or DLin-MC3-DMA.

In one embodiment, the mRNA, eg, mmRNA, encodes a polypeptide of interest. In various embodiments, the polypeptide of interest is a therapeutic protein, a cytokine, a growth factor, an antibody, or a fusion protein. Additional examples of polypeptides of interest are described in this invention.

In one embodiment, the mRNA, eg, mmRNA, is administered by infusion once a week. In another embodiment, the infusion is administered intravenously. In another embodiment, the mRNA, eg, mmRNA, is infused once a week for at least 4 weeks. In another embodiment, the mRNA, eg, mmRNA, is administered intratumorally. Suitable dosage regimens are further described in this invention.

In another embodiment, the disclosure provides a method of reducing or inhibiting unwanted immune cell activation (eg, B cell activation) and / or unwanted cytokine production in a subject administered messenger RNA. (MRNA) encoding a polypeptide of interest, the method comprising administering to the subject intravenously a first dose of mRNA, for example, modified mRNA (mRNA) encoding a polypeptide of interest encapsulated in an LNP, where the mRNA, for example , MmRNA, comprises at least one binding site for a microRNA (miR) expressed in immune cells, such as a miR-126 microRNA binding site and / or at least one miR-142 microRNA binding site,

and where the mRNA, eg, mmRNA, comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of the mRNA, eg, mmRNA, encapsulated in an LNP, such that the activation of unwanted immune cells and / or the production of unwanted cytokines is reduced or inhibited in the subject. .

In another aspect, the disclosure provides a method of reducing or inhibiting unwanted immune cell activation (eg, B cell activation) and / or unwanted cytokine production in the subject after repeated administration of an RNA. messenger (mRNA) encoding a polypeptide of interest to a subject, comprising

(i) administering to the subject intravenously a first dose of mRNA, for example, modified mRNA (mmRNA) encoding a polypeptide of interest, encapsulated in an LNP, where the mRNA, for example, mmRNA, comprises at least one site of binding for a microRNA (miR) expressed in immune cells, such as a miR-126 microRNA binding site and / or a miR-142 microRNA binding site,

and where the mRNA, eg, mmRNA, comprises one or more modified nucleobases;

(ii) detecting a level of immune cell activation in a sample from a subject; Y

(iii) administering to the subject intravenously a second dose of the mRNA, eg, mmRNA, encapsulated in an LNP when the level of immune cell activation in the sample is reduced, such that unwanted immune cell activation is reduces or inhibits in the subject.

In yet another aspect, the disclosure provides a modified messenger RNA (mmRNA) encoding a polypeptide of interest, where the mmRNA comprises at least two different microRNA binding sites (miR), where the microRNA is expressed in an immune cell of the hematopoietic lineage or a cell that expresses TLR7 and / or TLR8 and secretes chemokines and / or pro-inflammatory cytokines, and where the mmRNA comprises one or more modified nucleobases. In some aspects, the immune cell of the hematopoietic lineage is a lymphoid cell, such as a T cell, a B cell, or a NK cell. In some aspects, the immune cell of the hematopoietic lineage is a myeloid cell, such as monocytes, macrophages, neutrophils, basophils, eosinophils, erythrocytes, dendritic cells, megakaryocytes, or platelets. In some aspects, the immune cell of the hematopoietic lineage is a hematopoietic progenitor cell. In some aspects, the cell that expresses TLR7 and / or TLR8 and secretes chemokines and / or proinflammatory cytokine is an endothelial cell.

In some aspects of the disclosure, the mmRNA comprises at least two different microRNA binding sites, in which the microRNA is abundant in the same or different cell type of interest. In some aspects, microRNA is abundant in multiple cell types of interest.

In some aspects, the disclosure provides a mmRNA comprising at least a first microRNA binding site of a microRNA abundant in an immune cell of hematopoietic lineage and at least a second microRNA binding site of a microRNA abundant in endothelial cells, where the mRNA comprises one or more modified nucleobases.

In some aspects, the disclosure provides a mmRNA comprising at least a first microRNA binding site of a microRNA abundant in B cells and at least one second microRNA binding site of an endothelial cell abundant microRNA, wherein the mmRNA comprises a or more modified nucleobases. In some aspects, the disclosure provides an mmRNA comprising at least a first microRNA binding site of a microRNA abundant in plasmacytoid dendritic cells and at least a second microRNA binding site of an endothelial cell abundant microRNA, wherein the mmRNA comprises one or more modified nucleobases.

In some aspects of the disclosure, mmRNA comprises multiple copies (2, 3, 4 copies) of a first microRNA binding site and at least one copy of a second microRNA binding site. In some aspects, mmRNA comprises 2 copies of a first microRNA binding site and 1 copy of a second microRNA binding site.

In some aspects, the disclosure provides a mmRNA comprising a first and a second microRNA binding site of the same microRNA, such as, for example, microRNA binding sites of the 3p and 5p arms of the same microRNA.

Some aspects of the disclosure provide a modified messenger RNA (mmRNA) encoding a polypeptide of interest, where the mmRNA comprises at least two different microRNA binding sites (miR), where the microRNA is selected from the group consisting of miR -126, miR-142, miR-144, miR-146, miR-150, miR-155, miR-16, miR-21, miR-223, miR-24, miR-27 and miR-26a, and where the MRNA comprises one or more modified nucleobases. In some aspects, the microRNA is selected from the group consisting of miR126-3p, miR-142-3p, miR-142-5p, and miR-155. In some aspects, the at least one microRNA binding site is a miR-126 binding site, as set forth in SEQ ID NO: 26. In some aspects, the at least one microRNA binding site is a miR-142 binding site, as set forth in SEQ ID NO: 3.

In still other aspects, the disclosure provides a modified messenger RNA (mmRNA) encoding a polypeptide of interest, where the mmRNA comprises at least two different microRNA binding sites (miR), where a microRNA binding site is a microRNA binding site. binding of miR-126 and the second microRNA binding site is for a microRNA selected from the group consisting of miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR -155, miR-16, miR-21, miR-223, miR-24 and miR-27, and where the mRNA comprises one or more modified nucleobases.

In other aspects, the disclosure provides a modified messenger RNA (mmRNA) encoding a polypeptide of interest, where the mmRNA is a miR-126-3p binding site and a miR-142-3p binding site, and where the MRNA comprises one or more modified nucleobases. In some aspects, mmRNA comprises at the 5 'or 3' UTR 'a single miR-126-3p binding site as set forth in SEQ ID NO: 26 and a single miR-142-3p binding site as is set forth in SEQ ID NO: 3. In some aspects, mmRNA comprises at least one miR-142-3p binding site and at least one 142-5p binding site, as set forth in SEQ ID NO : 3 and SEQ ID NO: 51, respectively.

In still other aspects, the disclosure provides a modified messenger RNA (mmRNA) encoding a polypeptide of interest, where the mmRNA comprises at least three different microRNA binding sites, where at least one of the microRNA binding sites is a site. binding site of miR-126, and where the mmRNA comprises one or more modified nucleobases.

In some aspects, the disclosure provides a modified messenger RNA (mmRNA) encoding a polypeptide of interest, where the mmRNA comprises at least three different microRNA binding sites, where at least one of the microRNA binding sites is a miR-142 binding site, and where the mmRNA comprises one or more modified nucleobases.

In still other aspects, the disclosure provides a modified messenger RNA (mmRNA) encoding a polypeptide of interest, wherein the mmRNA comprises at least one miR-126-3p binding site, at least one miR-142-3p, and a third microRNA binding site for a microRNA selected from the group consisting of miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24, and miR -27, and where the mRNA comprises one or more modified nucleobases. In some aspects, mmRNA comprises at least one miR-126-3p binding site, at least one miR-142-3p binding site, and at least one miR-155 binding site (e.g., a 155-5p junction as stated in the Sequence Listing). In some aspects, mmRNA comprises at least one miR-126-3p binding site, at least one miR-142-3p binding site, at least one miR-142-5p binding site, and at least one miR-142-5p binding site. binding of miR-155.

In any of the above and related aspects, the disclosure provides an mmRNA comprising a 5 'UTR, a codon optimized open reading frame encoding the polypeptide of interest, a 3' UTR and a 3 'tail region of linked nucleosides. , where the microRNA binding sites are located in the 5 'UTR, the 3' UTR, or both in the 5 'UTR and in the 3' UTR of the mmRNA. In some aspects, the microRNA binding sites are found in the 3 'UTR of the mmRNA. In some aspects, the microRNA binding sites are found in the 5 'UTR of the mmRNA. In some aspects, the microRNA binding sites are found in both the 5 'UTR and the 3' UTR of mmRNA. In some aspects, the at least one microRNA binding site is located in the 3 'UTR immediately adjacent to the stop codon of the coding region of the mmRNA. In some aspects, the at least one microRNA binding site is located at bases 70-80 of the 3 'UTR downstream of the stop codon of the coding region of mmRNA. In some aspects, the at least one microRNA binding site is located in the 5 'UTR immediately before the start codon of the coding region of the mmRNA. In some aspects, the at least one microRNA binding site is located at nucleotides 15-20 of the 5 'UTR before the start codon of the coding region of the mmRNA. In some aspects, the at least one microRNA binding site is located at nucleotides 70-80 of the 5 'UTR before the start codon of the coding region of the mmRNA.

In some aspects, the disclosure provides an mmRNA comprising multiple copies of the same or different microRNA binding sites positioned immediately adjacent to each other or with a spacer of less than 5, 5-10, 10-15 or 15-20 nucleotides, at the 5 'UTR, the 3' UTR, or both. In some aspects, mmRNA comprises multiple copies of the same microRNA binding site located in the 3 'UTR, where the first microRNA binding site is positioned immediately adjacent to the stop codon and both the second and third binding sites of microRNAs are placed 30-40 bases downstream of the first microRNA binding site. In some aspects, mmRNA comprises 2 copies of a first microRNA binding site and 1 copy of a second microRNA binding site located in the 3 'UTR, where the first copy of the first microRNA binding site is placed immediately adjacent. At the stop codon, the second microRNA binding site is placed 30-40 bases downstream of the first copy of the first microRNA binding site, and the second copy of the first microRNA binding site is placed 30-40 bases downstream downstream of the second microRNA binding site.

In any of the above or related aspects, the description provides a modified mRNA where the mmRNA is completely modified.

In any of the above or related aspects, the description provides an mmRNA comprising pseudouridine (y), pseudouridine (y) and 5-methyl-cytidine (m5C), 1-methyl-pseudouridine (m1 ^), 1-methyl-pseudouridine (m1 ^) and 5-methyl-cytidine (m5C), 2-thiouridine (s2U), 2-thiouridine and 5-methyl-cytidine (m5C), 5-methoxy-uridine (mo5U), 5-methoxy-uridine (mo5U ) and 5-methyl-cytidine (m5C), 2'-O-methyl uridine, 2'-O-methyl uridine and 5-methyl-cytidine (m5C), N6-methyladenosine (m6A) or N6-methyl-adenosine (m6A ) and 5-methyl-cytidine (m5C).

In any of the above aspects, the mRNA described in this invention comprises pseudouridine (y), N1-methylpseudouridine (m1Y), 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza -pseudouridine, 2-thio-1-methylpseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4 -methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine or 2'-O-methyl uridine, or combinations thereof.

In any of the above or related aspects, the description provides an mmRNA comprising 1-methyl-pseudouridine (m1Y), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), pseudouridine (y), a- thio-guanosine, or atio-adenosine, or combinations thereof.

In any of the above or related aspects, the description provides an mmRNA encoding a polypeptide of interest, where the polypeptide of interest is a therapeutic protein, a cytokine, a growth factor, an antibody or a fusion protein.

In any of the above or related aspects, the description provides a lipid nanoparticle comprising a modified mRNA as described in this invention. In some aspects, the lipid nanoparticle comprises a liposome. In some aspects, the lipid nanoparticle comprises a cationic and / or ionizable lipid. In some aspects, the cationic or ionizable lipid is DLin-KC2-DMA or DLin-MC3-DMA.

In any of the above or related aspects, the description provides a pharmaceutical composition comprising the mmRNA or lipid nanoparticle as described in this invention, and a pharmaceutically acceptable carrier, diluent or excipient.

In any of the above or related aspects, the disclosure provides an mmRNA, a lipid nanoparticle, or a pharmaceutical composition as described in this invention, for use in reducing or inhibiting an anti-drug antibody response or inhibiting toxicity related to the drug in a subject who needs it.

In any of the above or related aspects, the disclosure provides an mmRNA, a lipid nanoparticle, or a pharmaceutical composition, as described in this invention, for use in reducing or inhibiting unwanted immune cell activation or reducing or inhibition of unwanted cytokine production in a subject in need.

In any of the above or related aspects, the description provides an mmRNA, a lipid nanoparticle or a pharmaceutical composition as described in this invention for use in reducing or inhibiting accelerated blood clearance in a subject in need thereof.

In any of the above or related aspects, the description provides an mmRNA, a lipid nanoparticle or a pharmaceutical composition as described in this invention for use in reducing or inhibiting the production of IgM molecules that recognize polyethylene glycol (PEG). in a subject that needs it.

Details of various embodiments of the description are set forth in the description below. Other features, objects, and advantages of the description will be apparent from the description and drawings, and from the claims.

Brief description of the drawings

FIGURE 1 is a bar graph showing human erythropoietin protein (hEPO) levels in cynomologous macaques treated with mRNA encoding hEPO (but lacking any miR binding site) at indicated doses, or with the protein of recombinant hEPO as a positive control, six hours after infusion on the indicated days of treatment.

FIGURE 2 is a schematic diagram of mRNA constructs without and with one or more inserted miR site (s) at the 3 'UTR.

FIGURE 3 is a graph comparing anti-hEPO antibody levels in cynomologous macaques treated with PBS or 0.2 mg / kg of mmRNA encoding hEPO, lacking or containing a miR-142-3p binding site in the 3 'UTR of the construct. Animals positive for an anti-drug antibody (ADA) response are indicated.

FIGURES 4A-C are graphs showing protein expression levels (Figure 4A), B cell frequency (Figure 4B) and activated B cell frequency (Figure 4C) in mice treated with 0.05 mg / kg of mmRNA. encoding hEPO and lacking or containing a miR-142-3p binding site, a miR-126 binding site, or both miR-142-3p and miR-126 binding sites, in the 3 'UTR of the construct.

FIGURES 5A-B are graphs showing protein expression levels for mice treated with a single dose of 0.2 mg / kg (Figure 5A) or 1 mg / kg (Figure 5B) of mmRNA encoding hEPO and lacking or containing a miR-142-3p binding site, a miR-126 binding site, or both miR-142-3p and miR-126 binding sites, in the 3 'UTR of the construct.

FIGURES 6A-B are graphs showing protein expression levels for mice treated with two doses of 0.2 mg / kg (Figure 6A) or 1 mg / kg (Figure 6B) of mmRNA encoding hEPO and lacking or containing a miR-142-3p binding site, a miR-126 binding site, or both miR-142-3p and miR-126 binding sites, in the 3 'UTR of the construct.

FIGURE 7 are graphs showing the frequency of B cells from mice treated with a single dose. indicated (0.2 mg / kg or 1 mg / kg) of mmRNA encoding hEPO that lacks or contains a miR-142-3p binding site, a miR-126 binding site, or both miR-142-3p and miR-126, in the 3 'UTR of the construct.

FIGURE 8 are graphs showing the frequency of activated B cells from mice treated with a single indicated dose (0.2 mg / kg or 1 mg / kg) of mmRNA encoding hEPO and lacking or containing a binding site of miR-142-3p, a miR-126 binding site, or both miR-142-3p and miR-126 binding sites, in the 3 'UTR of the construct.

FIGURE 9 are graphs showing the frequency of B cells from mice treated with two doses of the indicated dosage (0.2 mg / kg or 1 mg / kg) of mmRNA encoding hEPO and lacking or containing a site of binding of miR-142-3p, a miR-126 binding site, or both miR-142-3p and miR-126 binding sites, at the 3 'UTR of the construct.

FIGURE 10 are graphs showing the frequency of activated B cells from mice treated with two doses of the indicated dosage (0.2 mg / kg or 1 mg / kg) of mmRNA encoding hEPO and lacking or containing a site binding site of miR-142-3p, a binding site of miR-126, or both binding sites of miR-142-3p and miR-126, in the 3 'UTR of the construct.

FIGURES 11A-B are graphs showing IL-6 levels in mice treated with a single dose of 0.2 mg / kg (Figure 11A) or 1 mg / kg (Figure 11B) of mmRNA encoding hEPO and lacking or containing a miR-142-3p binding site, a miR-126 binding site, or both miR-142-3p and miR-126 binding sites, in the 3 'UTR of the construct.

FIGURES 12A-B are graphs showing I L-6 levels in mice treated with two doses of 0.2 mg / kg (Figure 12A) or 1 mg / kg (Figure 12B) of mmRNA encoding hEPO and lacking or containing a miR-142-3p binding site, a miR-126 binding site, or both miR-142-3p and miR-126 binding sites, in the 3 'UTR of the construct.

FIGURES 13A-C are graphs showing I L-6 levels (Figure 13A), TNF-α levels (Figure 13B) and IFN-y levels (Figure 13C) in mice treated with two doses of 0. , 2 mg / kg mmRNA encoding hEPO lacking or containing a miR-142-3p binding site, a miR-126 binding site, or both miR-142-3p and miR-126 binding sites , in the 3 'UTR of the construct.

FIGURES 14A-C are graphs showing I L-6 levels (Figure 14A), TNF-α levels (Figure 14B), and I FN-y levels (Figure 14C) in mice treated with two doses of 1 mg / kg mmRNA encoding hEPO lacking or containing a miR-142-3p binding site, a miR-126 binding site, or both miR-142-3p and miR-126 binding sites, in the 3 'UTR of the construct.

FIGURES 15A-B are graphs showing Luciferase (Luc) expression levels, as measured by total body luminescence in mice treated for 1 week (Figure 15A) or two weeks (Figure 15B) with 0.2 mg / kg of mmRNA encoding hEPO that lacks or contains a miR-142-3p binding site, a miR-126 binding site, or both miR-142-3p and miR-126 binding sites, at the 3 'UTR of the construct.

FIGURE 16 are graphs showing the total frequency of B cells from mice treated with 0.2 mg / kg mmRNA encoding Luc lacking or containing a miR-142-3p binding site, a binding site for miR-126 or both miR-142-3p and miR-126 binding sites, in the 3 'UTR of the construct.

FIGURE 17 are graphs showing the frequency of activated B cells from mice treated with 0.2 mg / kg mmRNA encoding Luc lacking or containing a miR-142-3p binding site, a binding site of miR-126 or both miR-142-3p and miR-126 binding sites, in the 3 'UTR of the construct.

FIGURES 18A-C are graphs showing secreted I L-6 levels (Figure 18A), TNF-α levels (Figure 18B) and IFN-y levels (Figure 18C) in mice treated with 0, 2 mg / kg of mmRNA encoding Luc, lacking or containing a miR-142-3p binding site, a miR-126 binding site, or both miR-142-3p and miR-126 binding sites, in the 3 'UTR of the construct.

FIGURES 19A-B are graphs showing EPO expression levels in the serum of mice treated for 1 week (Figure 19A) or two weeks (Figure 19B) with 0.2 mg / kg of mRNA encoding EPO and lacking or contains a miR-142-3p binding site, a miR-142-5p binding site, a miR-155-5p binding site, or multiple copies or combinations thereof.

FIGURE 20 are graphs showing the total frequency of B cells in mice treated for 1 week with 0.2 mg / kg of mmRNA encoding EPO and lacking or containing a miR-142-3p binding site, a binding site of miR-142-5p, a miR-155-5p binding site, or multiple copies or combinations thereof.

FIGURE 21 are graphs showing the frequency of activated B cells in mice treated for 1 week with 0.2 mg / kg mmRNA encoding EPO and lacking or containing a miR-142-3p binding site, a binding site of miR-142-5p, a miR-155-5p binding site, or multiple copies or combinations thereof.

FIGURE 22 are graphs showing the total frequency of B cells in mice treated for two weeks with 0.2 mg / kg of mmRNA encoding EPO and lacking or containing a miR-142-3p binding site, a miR-142-5p binding site, a miR-155-5p binding site, or multiple copies or combinations thereof.

FIGURE 23 are graphs showing the frequency of activated B cells in mice treated for 2 weeks with 0.2 mg / kg mmRNA encoding EPO and lacking or containing a miR-142-3p binding site, a binding site of miR-142-5p, a miR-155-5p binding site, or multiple copies or combinations thereof.

FIGURES 24A-C are graphs showing secreted IL-6 levels (Figure 24A), TNF-α levels (Figure 24B) and IFN-y levels (Figure 24C) in mice treated for 2 weeks with de 0.2 mg / kg mmRNA encoding EPO lacking or containing a miR-142-3p binding site, a miR-142-5p binding site, a miR-155-5p binding site, or multiple copies or combinations thereof.

FIGURES 25A-B are graphs showing the percentage of CD27 + CD19 + B cells in splenic CD19 + B cells (Figure 25A) and the expression level of CD27 in CD27 + CD19 + B cells (Figure 25B) in mice treated with mmRNA encoding EPO and lacking or containing a miR-142 binding site, a miR-126 binding site, or miR-142 and miR-126 binding sites.

FIGURES 26A-B are graphs showing the total frequency of CD11c + cells in spleen cells (Figure 26A) and the percentage of activated dendritic cells (CD11c + CD70 + CD86 + cells) (Figure 26B) in mice treated with mmRNA encoding EPO and lacking or containing a miR-142 binding site, a miR-126 binding site, or miR-142 and miR-126 binding sites.

FIGURE 27 is a graph showing the level of naive B cell proliferation in the presence of plasmacytoid dendritic cells (pDC) isolated from mice treated with mmRNA encoding EPO and lacking or containing a miR-142 binding site, a binding of miR-126 or binding sites of miR-142 and miR-126. FIGURES 28A-C are graphs showing the level of serum anti-PEG IgM antibodies in mice treated with two doses (Figure 28A), three doses (Figure 28B) or four doses (Figure 28C) of mRNA encoding EPO and lacking or containing a miR-142 binding site, a miR-126 binding site, or miR-142 and miR-126 binding sites.

FIGURE 29 is a graph showing EPO expression levels in the serum of mice treated for 6 weeks with 0.2 mg / kg mmRNA encoding EPO and lacking or containing a miR-142-3p binding site , a miR-126 binding site, or both miR-142-3p and miR-126 binding sites, in the 3 'UTR of the construct. FIGURE 30 is a graph showing Luciferase (Luc) expression levels in serum of mice treated for 5 weeks with 0.2 mg / kg of mRNA encoding Luc and lacking or containing a miR-142 binding site -3p, a miR-126 binding site, or both miR-142-3p and miR-126 binding sites, in the 3 'UTR of the construct.

FIGURES 31A-D are graphs showing the level of eGFP expression in primary hepatocytes transfected with an equimolar mixture of Luc and eGFP mRNA constructs in LNP, where the mRNA constructs contained either no recognizable miR site (control), binding sites of miR-122 1X or 3X or a putative mRNA with a sequence similar to the sequences of eGFP and Luc (control), in doses of 7.5 ng (Fig. 31A), 15 ng (Fig. 31B), 50 ng (Fig. 31C) or 100 ng (Fig. 31D).

FIGURES 32A-D are graphs showing the percent phase confluence (as a measure of caspase-mediated toxicity) of primary hepatocytes transfected with caspase mRNA constructs that either do not contain recognizable miR sites (control), which contain 1X or 3X miR-122 binding sites or contain putative mRNA with a caspase-like sequence (control) without a start codon, at doses of 7.5 ng (Fig. 32A), 15 ng (Fig. 32B ), 50 ng (Fig. 32C) or 100 ng (Fig. 32D).

FIGURE 33 is a graph showing the level of hEPO expression in cynomologous monkeys administered mRNA constructs containing either no recognizable miR site (control or 1X or 3X miR-142-3p binding sites.

FIGURE 34 is a bar graph showing the level of eGFP expression in RAW264.7 cells transfected with mRNA constructs that do not contain recognizable miR sites (control), a 3 'miR-142-3p binding site UTR (1X or 3X), a miR-142-3p binding site in the 5 'UTR (inserted at P1, P2 or P3) or a miR-142-3p binding site in both the 3' UTR and in the 5 'UTR.

FIGURE 35 is a bar graph showing the level of hEPO expression in primary hepatocyte cells transfected with mRNA constructs that do not contain recognizable miR sites (control), a miR-122 binding site in the 3 'UTR ( 1X or 3X), a miR-122 binding site in the 5 'UTR (inserted at P1, P2 or P3) or a miR-122 binding site in both the 3' UTR and 5 'UTR.

Detailed description

A challenge associated with the clinical use of protein-based therapy is the development of an unwanted anti-drug antibody response (ADA), where the patient's immune system generates antibodies against the therapeutic agent (for reviews, see, for example, Subramanyam, M. (2006) J. Immunotoxicol. 3: 151-156; De Groot, AS and Scott, DW (2007) Trends Immunol. 28: 482-490; Nechansky, A. and Kircheis, R. (2010) Expert Opin.

Drug. Discov. 5: 1067-1079). The development of ADA responses has been reported for both recombinant antibody biologics and non-antibody biologics (see, for example, Brickelmaier, M. et al. (1999) J. Immunol. Methods 227: 121-135 ; Ruf, P. et al. (2010) Br. J. Clin. Pharmacol. 69: 617-625; Lundkvist, M. et al. (2013) Mult. Scler. 19: 757-764). The ADA response can interfere with or neutralize the effect of the therapeutic agent, affecting the pharmacokinetics and efficacy of the drug. Neutralizing antibodies (NABs) are generally of more concern than non-neutralizing binding antibodies (BABs), but both can have clinical consequences.

Additionally, allergic reactions, complement activation, and other adverse events are often associated with the development of ADA, affecting the safety of medications. Therefore, ADA is a significant factor in the ability to use biologics for long-term treatment.

The use of modified mRNA, eg mRNAs (mmRNA), as therapeutic agents offers an exciting alternative to protein-based therapy. The mRNA treatment offers several advantages over the protein-based treatment technique, including, for example, the fidelity of the characteristics of the encoded protein (because the protein is produced by the body's own translation apparatus), the pharmacokinetic profile sensitive and tunable (protein expression may be transient, which may be favorable for some therapeutic strategies to better control pharmacokinetics and dosage), an excellent safety profile (as revealed in several vaccine clinical trials), functionality in the cytoplasm without the need to travel to the nucleus, resulting in protein translation almost immediately after mRNA administration, eliminates any risk of genomic integration, as well as ease of manufacture, for example, mRNAs are easily produced by various generic in vitro procedures, for example, in vi transcription reactions tro, without the need for living organisms. Furthermore, the mRNA can be designed to have self-adjuvant properties, eg, in vaccine applications, or to evade immunogenic activation, eg, in therapeutic applications. However, it has now been discovered that the administration of mRNA encoding a protein of interest, particularly in cases where the administration of mRNA leads directly or indirectly to the expression of the encoded protein in immune cells, for example the spleen , can also lead to the development of an anti-drug antibody response to the protein encoded by the mRNA. However, it has surprisingly been shown that the incorporation of at least one microRNA (miRNA) binding site for a miR expressed in immune cells (for example, in immune cells of peripheral lymphoid organs and / or splenocytes) into mRNA (mRNA ) encoding the protein of interest may reduce the anti-drug antibody response to the protein of interest when the mRNA is administered to the subject.

Accordingly, the disclosure provides methods for reducing or inhibiting an anti-drug antibody (ADA) response to a protein of interest through post-transcriptional regulation, particularly in immune system tissue, such as the spleen. The disclosure also provides methods for reducing drug-related toxicity in a subject by incorporating at least one microRNA (miRNA) binding site for a miR expressed in immune cells into an mRNA ( eg, mmRNA) encoding a protein of interest. Preferred microRNA binding sites used in the methods of the disclosure are those that bind miRs expressed abundantly or preferentially in immune cells (eg, immune cells of peripheral lymphoid organs and / or splenocytes). A particularly preferred microRNA binding site is for miR-142-3p. Another particularly preferred microRNA binding site is for miR-126.

As described in Example 1, an in vivo study where cynomologous macaques were administered a mRNA construct encoding human erythropoietin (hEPO) led to the observations that hEPO levels decreased over time in the animals. In addition, reticulocytopenia and reduced hematopoiesis of the bone marrow were also observed. These results suggested the possibility that anti-drug antibodies were being generated in the animals, which was confirmed by an ELISA analysis of serum. Although it is in no way subject to theory, previous experience with the mRNA delivery system used in the study (used lipid nanoparticles, LNPs) showed that mRNA was distributed mainly to the liver but also to the spleen and therefore this Distribution could lead to increased immunity to the protein that is being encoded by the mRNA. Again, although not limited by theory or mechanism, it is possible that the expression of the encoded protein made in the spleen (administered based on the distribution of LNP to the spleen by direct delivery through the bloodstream or indirectly to through professional antigen-presenting cells) can lead to the production of T-cell-dependent antibodies by presenting appropriate epitopes ( i.e., of the protein of interest) to T cells.

To address this, as described in Example 2, additional mRNA constructs were designed that included at least one microRNA (miRNA) binding site for a miR expressed in immune cells ( e.g., at least one binding site for miR -142-3p). Administration of the miR-containing mRNA construct in vivo led to a significant reduction in the development of ADA responses in recipient animals.

Another challenge associated with the clinical use of protein-based therapy in the art is the development of unwanted immune cell activation (e.g., B-cell activation) against the therapeutic protein, leading to drug-mediated side effects. immune system. However, it has now been discovered that the administration of mRNA encoding a protein of interest, particularly in cases where the administration of mRNA, for example, leads directly or indirectly to the expression of the encoded protein in immune cells, for example For example, splenocytes, it can also lead to the development of unwanted immune cell activation (eg, B cell activation, including cytokine production). However, it has surprisingly been shown that the incorporation of at least one binding site for a microRNA (miRNA) that is expressed in peripheral lymphoid tissue and / or endothelial cells, in particular, at least one miR-126 and / or The miR-142 binding site to mRNA (mRNA) can reduce or inhibit the activation of unwanted immune cells when the mRNA is administered to the subject. Accordingly, the disclosure provides compositions and methods for reducing or inhibiting unwanted immune cell activation when using mRNA-based therapeutic agents via post-transcriptional regulation, in particular, in immune system tissue, such as peripheral lymphoid organs. or spleen.

The experiments described in Example 3 demonstrated that incorporation of a miR-126 or miR-142 binding site (eg, miR-142-3p), or the two sites in combination, into mRNA constructs that encode a protein of interest, led to a reduced frequency of activated B cells, as well as reduced levels of cytokine production (IL-6, TNF-α, IFN-y), in animals to which the constructs were administered, compared to animals treated with constructs lacking the miR binding site (s). The effect of the miR-126 binding site alone was more potent than the effect of the miR-142 binding site alone, with the strongest effects being observed with the two sites used in combination. The frequency of B cell activation and cytokine production are early indicators of an increased immune response in vivo, including antibody responses. Accordingly, these results indicate that the inclusion of a miR-126 binding site in an mRNA construct (alone or in combination with a miR-142-3p binding site) can lead to a reduction in the development of responses. of ADA to the protein encoded in the recipient animal.

Although by no means subject to theory, the inclusion of a miR-126 binding site in an mRNA construct may lead to the reduction or inhibition of immune cell activation by one or more possible mechanisms, depending on the pattern. expression of miR-126. It is known that microRNA-126 is highly and selectively expressed in plasmacytoid dendritic cells (pDC) and regulates the maturation, survival and effector functions of these cells (Agudo, J. et al. (2014) Nat. Immunol 15: 54-62; Cella, M. and Trinchieri, G. (2014) Nat. Immunol 15: 8-9). Plasmacytoid dendritic cells represent less than 0.1 % of peripheral blood mononuclear cells and 0.4-0.6% of total spleen cells can differentiate into dendritic cells upon activation, produce interferons, and serve as a link between innate and adaptive immunity, as well as playing a role in antigen presentation (for reviews of pDC, see, for example, Jegalian, AG et al. (2009) Adv. Anat. Pathol. 16: 392-404; Reizis, B. et al. (2011) Annu. Rev. Immunol. 29: 163-183; Tel, J. et al. (2012) Cancer Immunol. Immunotherap. 61: 1279-1288). Furthermore, pDCs are also involved in promoting B cell activation and differentiation and in stimulating cytokine production (see, for example, Douag, I. et al. (2009) J. Immunol. 182: 1991-2001; Ding, C. et al. (2009) J. Immunol. 183: 7140-7149; Gujer, C. et al. (2011) J. Leukoc. Biol. 89: 811-821. Consequently, the Reduced frequency of B-cell activation and reduced cytokine production observed by inclusion of a miR-126 binding site in an mRNA construct may result, for example, from inhibition of the antigen-presenting function of cells. pDC and / or inability of pDCs to elicit an effective response against foreign nucleic acids and / or inhibition of pDC maturation and survival, leading to reduced promotion of B cell activation and reduced cytokine production, the general result of these effects being a reduced ADA response in vivo against the protein encoded by the mRNA construct.

Furthermore, miR-126 is known to be expressed in endothelial cells (see, for example, Fish, JE et al. (2008) Dev. Cell. 15: 272-284; Wang, S. et al. (2008) Dev Cell. 15: 261-271). Consequently, the effect of including a miR-126 binding site in an mRNA construct may be related to the abundance of miR-126 in endothelial cells. Consequently, the inclusion of a miR-126 binding site in an mRNA construct can lead to reduced expression of the encoded protein in endothelial cells in vivo, resulting in reduced antigen presentation by endothelial cells, which leads to a concomitant reduction in the frequency of B cell activation and reduced cytokine production, resulting in reduced ADA responses against the encoded protein in vivo.

As demonstrated in Example 6, the inclusion of a miR-142 and / or miR-126 binding site in a construct of MRNA leads to a reduced total frequency of CD11c + dendritic cells, as well as a reduced frequency of activated dendritic cells (CD11c + CD70 + CD86 +) within the CD11c + spleen cell population. In contrast, the inclusion of a miR-142 and / or miR-126 binding site in mRNA constructs did not affect the frequency of CD27 + CD19 + B cells in splenic CD19 + B cells, nor did it affect the expression level of CD27 in the CD27 + CD19 + B cell population. Furthermore, naive B cell proliferation was reduced when incubated with pDC isolated from mice treated with the miR binding sites containing constructs, compared to treatment with an mRNA construct lacking miR binding sites. Therefore, these experimental data support the proposed mechanism that inhibition of B cell activation and inhibition of cytokine production in mice treated with modified mRNA constructs that include a miR or a combination thereof results from a decreased frequency and / or activation of pDC, thus leading to decreased B cell stimulation, probably as a result of decreased CD70-CD27 interactions or decreased dendritic cell cytokine secretion .

There is a separate challenge with the use of lipid-comprising compounds and compositions, such as lipid nanoparticles (LNP), to deliver therapeutic agents, eg, modified mRNA, where the agents are rapidly cleared from the blood after second and subsequent administrations. (ie Accelerated Blood Clearance (AUC)). The mechanism includes the recognition of compounds or compositions comprising lipids (for example, LNP) by B cells, in particular by B1a cells, through the recognition of CD36 and / or TLR of the lipid components, such as phosphatidylcholine. Activated B1a cells secrete IgM, in particular wild type IgM, which can contribute to AUC ( eg, through an acute phase response type mechanism. The phospholilidic component ( eg, DSPC) of a compound or composition comprising lipids (eg, LNP) can also activate platelets, eg, in circulation. Activated platelets can aggregate and bind to macrophages, which subsequently release inflammatory cytokines and migrate to the spleen. Sequestration of lipid-comprising compounds or compositions (eg, LNP) to the spleen occurs almost immediately after administration.

ABC has been found to be mediated, at least in part, by B cells, specifically B1a cells. These B cells are normally responsible for secreting natural IgM antibodies, which are polyreactive, meaning that they can bind to a variety of antigens, albeit with a relatively low affinity for each. Following the administration of a first dose of an agent, the B1a cells bind to the agent and become activated, thus secreting the natural IgM that binds to the agent, such as phosphatidylcholine. A second or subsequent dose of a lipid-comprising compound or composition is then targeted by circulating IgM and rapidly cleared. Conventional B cells, referred to as B2 cells or CD19 (+) B cells in this invention, are also involved in ABC. Specifically, conventional B cells can first mount an IgM response followed by an IgG response concomitant with a memory response. Conventional B cells react against the administered agent and polyethylene glycol (PEG) and contribute to the IgM (and eventually IgG) that mediates ABC. Previous solutions to this challenge have focused on suppressing the immune response in the LNP compositions administered to the subject. In particular, joint medication regimens ( eg, antihistamines, non-steroidal anti-inflammatory drugs (NSAIDs), steroids, corticosteroids, and the like) have been used to suppress the immune system. However, it has now been discovered that incorporation of at least one microRNA binding site for a microRNA expressed in immune cells (eg, miR-126, miR-142, miR-155, and combinations thereof) into a construct Modified mRNA can reduce or inhibit AUC when the lipid-comprising compound or composition, comprising the modified mRNA, is administered to a subject. Specifically, it has been discovered that the incorporation of at least one microRNA binding site into a modified mRNA can reduce or inhibit the proliferation and / or activation of plasmacytoid dendritic cells and / or reduce or inhibit the production of anti-PEG IgM. For example, as demonstrated in Example 7, the inclusion of at least one or more miR binding sites in the mRNA construct leads to decreased levels of serum anti-PEG IgM antibodies in mice administered a compound. or composition comprising lipids, comprising the mRNA constructs.

There are multiple possible mechanisms by which the inclusion of at least one microRNA binding site (s), as described in this invention, in a modified mRNA construct that is delivered by compounds or compositions comprising lipids leads to reduction or inhibition. of the ABC. In one embodiment, the mechanism of action of the miRNA binding site (s) is a microRNA "sponge", where the miRNA binding site (s) in the construct "absorb (s)" the microRNAs that bind to the binding site (s). This can lead to the deregulation of natural targets of the specific microRNA, since this microRNA is less available or not available for their regulation. This scenario mimics the effects of a microRNA inactivation / removal. In examples where proper regulation of microRNA natural targets is necessary for the cell's ability to act as an immune cell Effectively, this sponge-like effect of the microRNA renders the cell incapable of producing an immune response. It is also possible that dysregulation of an endogenous microRNA target disrupts cell homeostasis (eg, calcium signaling), leading to a stress response (eg, an unfolded protein response). Alternatively, it is possible that the inclusion of the microRNA binding in the mRNA suppresses the expression of this mRNA in the specific cell type that harbors the microRNA. It is also possible that the inclusion of the microRNA binding site leads to degradation of the mRNA before a TLR7-like sensor can recognize it. The latter two mechanisms are postulated to depend on RNA-induced silencing complex (RISC) mediated cleavage of an mRNA comprising one or more binding sites for a microRNA (miR) expressed in immune cells. It is also possible that these mechanisms act in concert, both leading to the observed miR-mediated effects described in this invention.

Regardless of the mechanisms involved, the impact resulting from the inclusion of at least one or more microRNA binding sites, as described in this invention, in an mRNA construct is that immune cells that recognize lipid-comprising compounds or compositions (eg, pDC, B cells ( eg, circulating B cells, macrophages) are not activated and therefore do not migrate to the spleen to activate B cells ( eg, spleen B cells). In addition, the production of Cytokines (eg IL-6) are reduced or inhibited, further preventing the activation of immune cells. Reduction or inhibition of B cell activation results in a reduction or inhibition of IgMs ( eg , by natural B1a), IgM and IgG cells.The production of these molecules is essential for ABC and therefore reducing or inhibiting their production reduces or inhibits ABC in general.

Accordingly, the disclosure provides methods for reducing or inhibiting ABC when using compounds comprising lipids or compositions comprising modified mRNA encoding a polypeptide of interest. Various aspects of the description are further described in the subsections below.

MRNA

The disclosure provides isolated RNAs, in particular mRNAs, eg, chemically modified mRNAs, encoding a polypeptide of interest and including at least one microRNA binding site (eg, miR-126 and / or miR binding sites. -142). In other embodiments, the disclosure provides RNAs, eg, chemically modified RNAs, that include at least one microRNA binding site (eg, miR-126 and / or miR-142 binding sites), but not necessarily encode a polypeptide of interest. The latter RNAs may also lack other typical mRNA features (such as the mRNA features described below), although they include the miR-126 and / or miR-142 binding site (s).

An RNA can be a naturally occurring or non-naturally occurring RNA, eg, mRNA. An mRNA may include one or more nucleobases, nucleosides, or modified nucleotides, as described below, in which case it may be referred to as "chemically modified mRNA", also referred to herein as "modified mRNA" or "mmRNA". As described in this invention, "nucleoside" is defined as a compound containing a sugar molecule (eg, a pentose or ribose) or a derivative thereof, in combination with an organic base (eg, a purine or pyrimidine) or a derivative thereof (which is also called "nucleobase" in this invention). As described in this invention, "nucleotide" is defined as a nucleoside that includes a phosphate group.

An mRNA can include a 5 'untranslated region (5' UTR), a 3 'untranslated region (3' UTR), and / or a coding region (eg, an open reading frame). An mRNA can include any suitable number of base pairs, including hundreds (eg 200, 300, 400, 500, 600, 700, 800 or 900) or thousands (eg 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000) base pairs. Any number (eg, all, some, or none) of nucleobases, nucleosides, or nucleotides can be an analog of a canonical, substituted, modified, or otherwise unnatural species. In certain embodiments, a particular type of nucleotide or nucleobase can be modified.

In one embodiment, the mRNA comprises a first flanking region located at the 5 'terminal of an open reading frame (coding region) and a second flanking region located at the 3' terminal of the open reading frame (coding region), wherein the first flanking region comprises a 5 '' untranslated region (5 'UTR) and the second flanking region comprises a 3' untranslated region (3 'UTR). In one embodiment, the 5 'UTR and 3' UTR of the mRNA are not derived from the same species. In one embodiment, the 5 'UTR and / or the 3' UTR of the mRNA are not derived from beta-globin. In one embodiment, the 5 'untranslated region is heterologous to the coding region of the mRNA. In another embodiment, the 3 'untranslated region is heterologous to the coding region of the mRNA. In even another In embodiment, the 5 'untranslated region and the 3' untranslated region are heterologous to the coding region of the mRNA. In yet another embodiment, the mRNA comprises at least two stop codons.

The sequence of a non-limiting example of a suitable 5 'UTR for use in the mRNA constructs is shown in SEQ ID NO: 53. The sequence of a non-limiting example of a suitable 3' UTR for use in the constructs mRNA is shown in SEQ ID NO: 30. Other 5 'and 3' UTRs suitable for use in mRNA constructs are well known in the art.

For example, suitable 5 'UTRs include those of the p-globin gene (see, for example, Kariko et al. (2008) Mol. Therap. 16: 1833-40; US 8,278,063, Us 9,012,219) , the α-globin gene (see, for example, US 9,012,219), the human cytochrome b-245 polypeptide (CYBA) gene (see, for example, Ferizi et al. (2015) Lab. Chip .

23: 1456-1464), the hydroxysteroid dehydrogenase gene (17-p) (HSD17B4) (see, for example, Thess et al. (2015) Mol. Therap. 23: 1456-1464; WO 2015/024667), the TOP gene (see, for example, WO / 2015101414, WO2015 / 101415, WO2015 / 062738, WO2015 / 024667, WO2015 / 024667), the Large 32 (L32) ribosomal protein gene (see, for example, WO2015 / 101414 , WO2015 / 101415, WO2015 / 062738) and the ATP51 gene (see, for example, WO2015 / 024667), as well as the viral 5 'UTRs, including those from tobacco etching (TEV) (see, for example, Katalin and col. (2012) Mol. Therap. 20: 948-953; US 8,278,063, US 9,012,219), Venezuelan equine encephalitis virus (VEEV), (see, for example, Andries et al. (2015) J. Control Release 217: 337-344) and the immediate early CMV 1 (IE1) gene (see, for example, US20140206753, WO2014 / 089486, WO2013 / 185069, WO2014 / 144196, WO2014 / 152659, WO2014 / 152940, WO2014 / 152774, WO2014 / 153052). Synthetic 5 'UTRs have been described and are also suitable for use (see, for example, Mandal and Rossi (2013) Nat. Protocol 5: 68-82).

Additionally, for example, the 3 'UTRs include those of the p-globin gene (see, for example, Kariko et al. (2008) Mol. Therap. 16: 1833-40; US 8,278,063; US 9,012,219; WO2007 / 036366, US 2011/0065103, WO2011 / 015347, WO2012 / 072096, WO2013 / 143555, WO2014 / 071963), the a-globin gene (see, for example, US 9,012,219; WO2015 / 101414, WO2015 / 101415, WO2015024667 ), the human cytochrome a b-245 polypeptide (CYBA) gene (see, for example, Ferizi et al. (2015) Lab. Chip. 23: 1456-1464), the albumin gene (see, for example, Thess et al. (2015) Mol. Therap. 23: 1456-1464), the human growth gene (hGH) (see, for example, US20140206753, WO2013 / 185069, WO2014 / 089486, WO2014 / 144196, WO2014 // 152659 , WO2014152940, WO2014 / 152774, WO2014 / 153052), the ribosomal rps9 protein gene (see, for example, WO2015 / 101414), the FIG4 gene (see, for example, WO2015 / 101415), the human albumin7 gene ( see, for example, WO2015 / 101415, WO2015 / 101414, WO2015 / 06273, WO2015 / 024667, WO2105 / 062737), as well as viral 3 'UTRs, including those of the Venezuelan equine encephalitis virus (VEEV), (see, for example, Andries et al. (2015) J. Control Release 217: 337-344).

In some embodiments, an mRNA as described in this invention may include a 5 'end structure, a strand terminating nucleotide, a Kozak sequence (also known as a Kozak consensus sequence), a hairpin, a polyA and / or a sequence. polyadenylation signal. In other embodiments, the mRNA lacks a poly A sequence and / or a polyadenylation signal, but instead contains an alternative structure to stabilize the mRNA.

A 5 'end structure or end species is a compound that includes two nucleoside moieties linked by a linker and can be selected from a naturally occurring end, a non-natural end or an analogous end, or an anti-reverse end analog. (ARK). An end species can include one or more modified nucleosides and / or linker moieties. For example, a wild-type mRNA end may include a guanine nucleotide and a guanine nucleotide (G) methylated at position 7, linked by a triphosphate bond at their 5 'positions, for example, m7G (5') ppp (5 ') G, commonly written as m7GpppG. An end species can also be an anti-reverse end analog. A non-limiting list of possible endpoint species includes m7GpppG, m7Gpppm7G, m73'dGpppG, m ² 7 ° 3'GpppG, m ² 7 ° 3'GppppG, m ² 7 ° 2'GppppG, m7Gpppm7G, m73'dGpppG, m ² 7 ° 3'GpppG, m ² 7 ° 3'GppppG and m ² 7 ° 2'GppppG. In various embodiments, the mRNA may comprise a 5 'terminus selected from the group consisting of Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2'-fluoroguanosine, 7-deaza-guanosine, 8-oxo-guanosine , 2-amino-guanosine, LNA-guanosine and 2-azido-guanosine. In one embodiment, the 5 'terminal end is Cap1.

An mRNA may include, instead or in addition, a strand terminating nucleoside. For example, a chain terminating nucleoside can include those nucleosides deoxygenated at the 2 'and / or 3' positions of its sugar group. Such species may include 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythimine, and 2 ', 3'-dideoxynucleosides, such as 2', 3'-dideoxyadenosine, 2 ', 3'-dideoxyuridine, 2', 3'-dideoxycytosine, 2 ', 3'-dideoxyguanosine and 2', 3'-dideoxythymine. In some embodiments, the Incorporation of a strand-terminating nucleotide into an mRNA, for example at the 3 'end, can result in stabilization of the mRNA, as described, for example, in International Patent Publication No. WO 2013/103659.

An mRNA may, instead or in addition, include a hairpin, such as a histone hairpin. A hairpin can include 2, 3, 4, 5, 6, 7, 8, or more nucleotide base pairs. For example, a hairpin can include 4, 5, 6, 7, or 8 base pairs of nucleotides. A hairpin can be located in any region of an mRNA. For example, a hairpin can be located in, before or after an untranslated region (a 5 'untranslated region or a 3' untranslated region), a coding region, or a polyA sequence or tail. In some embodiments, a hairpin can affect one or more functions of an mRNA, such as translation initiation, translation efficiency, and / or transcriptional termination.

An mRNA may, instead or in addition, include a polyA sequence and / or polyadenylation signal. A polyA sequence can be composed wholly or primarily of adenine nucleotides or analogs or derivatives thereof. A polyA sequence can be a tail located adjacent to a 3 'untranslated region of an mRNA. In some embodiments, a polyA sequence can affect nuclear export, translation, and / or stability of an mRNA.

In some embodiments, an mRNA is a bicistronic mRNA comprising a first and a second coding region with an intermediate sequence comprising an internal ribosome entry site sequence (IRES) that allows the initiation of internal translation between the first and the second coding region, or with an intermediate sequence that codes for a self-cleaving peptide, such as a 2A peptide. IRES sequences and 2A peptides are typically used to enhance the expression of multiple proteins from the same vector. A variety of IRES sequences are known and available in the art and can be used, including, for example, the encephalomyocarditis virus IRES sequence.

In one embodiment, the polynucleotides of the present disclosure may include a sequence that encodes a self-cleaving peptide. The self-cleaving peptide can be, among others, a 2A peptide. A variety of 2A peptides are known that are available in the art and can be used, including, for example, foot and mouth disease virus (FMDV) peptide 2A, equine rhinitis virus A peptide 2A, Thesea virus 2A maps and the porcine teschovirus-1 peptide 2A. Various viruses use 2A peptides to generate two proteins from a ribosome skip transcript, such that a normal peptide bond is affected in the 2A peptide sequence, resulting in the production of two discontinuous proteins from of a translation event. As a non-limiting example, peptide 2A can have the protein sequence: GSGATNFSLLKQAGDVEENpGp (SEQ ID NO: 4), fragments or variants thereof. In one embodiment, peptide 2A cleaves between the last glycine and the last proline. As another non-limiting example, the polynucleotides of the present disclosure may include a polynucleotide sequence encoding peptide 2A having the protein sequence GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 4) fragments or variants thereof. An example of a polynucleotide sequence encoding peptide 2A is: GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAG AACCCTGGACCT (SEQ ID NO: 5). In an illustrative embodiment, a 2A peptide is encoded by the following sequence: 5'-TCCGGACTCAGATCCGGGGATCTCAAAATTGTCGCTCCTGTCAAACAAACTCTTA ACTTTGATTTACTCAAACTGGCTGGGATGTAGAAAGCAATCCAGGTCCACTC-3 '(SEQ). The polynucleotide sequence of peptide 2A can be modified or optimized at the codon by the methods described in this invention. and / or procedures known in the art.

In one embodiment, this sequence can be used to separate the coding regions of two or more polypeptides of interest. As a non-limiting example, the sequence encoding peptide 2A may lie between a first coding region A and a second coding region B (A-2Apep-B). The presence of peptide 2A results in the cleavage of a long protein into protein A, protein B, and peptide 2A. Protein A and protein B can be the same or different peptides or polypeptides of interest.

Modified mRNA

In some embodiments, an mRNA of the disclosure comprises one or more nucleobases, nucleosides, or modified nucleotides (referred to as "chemically modified mRNA", also referred to herein as "modified mRNA" or "mmRNA"). In some embodiments, the modified mRNAs may have useful properties, including improved stability, intracellular retention, improved translation, and / or the lack of substantial induction of the innate immune response of a cell into which the mRNA is introduced, by comparison. with an unmodified reference mRNA. Therefore, the use of modified mRNAs can improve the efficiency of protein production, intracellular retention of nucleic acids, as well as having reduced immunogenicity.

In some embodiments, an mRNA includes one or more (eg, 1, 2, 3, or 4) different nucleobases, nucleosides, or modified nucleotides. In some embodiments, an mRNA includes one or more (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more) nucleobases, nucleosides or modified nucleotides. In some embodiments, the modified mRNA may have reduced degradation in a cell into which the mmRNA is introduced, relative to a corresponding unmodified mRNA.

In one embodiment, the mRNA comprises at least one nucleoside (or nucleotide) modification. In another embodiment, the mRNA comprises at least one modification. compared to the chemical structure of a ribonucleoside A, G, U, or C. In yet another embodiment, the mRNA is an isolated polynucleotide comprising;

(a) a first region of linked nucleosides, said first region encoding a polypeptide of interest; (b) a first flanking region located 5 'to said first region comprising a 5' untranslated region (5 'UTR) and at least one 5' terminal end;

(c) a second flanking region located 3 'to said first region comprising a 3' (3 'UTR) untranslated region and a 3' tail sequence of linked nucleosides;

wherein said polynucleotide comprises at least one chemically modified nucleoside.

In some embodiments, the modified nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having a modified uracil include pseudouridine ( ^y ), pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio -uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (for example, 5-iodo-uridine or 5-bromo-uridine), 3-methyluridine (m3U), 5-methoxy-uridine (mo5U), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5 -carboxymethyl-uridine (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5-thixycarbonyl-uridine (mcm5-2-carboxycarbonyl) (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 5-methylaminomethyl-2-thiouridine (mnm5s2U), 5-methylaminomethyl-2-selene-uridine (mnm5se 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-ca rboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine (Tm5U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thi5s2U (Tm5souridine) -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine (m5U, that is, having the nucleobase deoxythymine), 1-methyl-pseudouridine (m1 ^, 5-methyl-2-thio-uridine (m5s2U), 1 -methyl-4-thio-pseudouridine (m1s4 ^), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m3 ^), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza -pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine , 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxypseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3- (3-amino-3-carboxypropyl) uridine ( acp3U), 1-methyl-3- (3-amino-3-carboxypropyl) pseudouridine (acp3 ^), 5- (isopentenylaminomethyl) uridine (im5U), 5 (isopentenylaminomethyl) -2-thio-uridine (i nm5s2U), a-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine (^ m), 2- thio-2'-O-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl- 2'-O-methyl-uridine (cmnm5Um), 3,2-O-dimethyluridine (m3Um), and 5- (isopentenylaminomethyl) -2'-O-methyl-uridine (im5Um), 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5- (2-carbomethoxyvinyl) uridine, and 5- [3- (1-E-propenylamino)] uridine.

In some embodiments, the modified nucleobase is a modified cytosine. Examples of nucleobases and nucleosides that have a modified cytosine include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methylcytidine (m3C), N4-acetyl-cytidine (ac4C), 5-formyl-cytidine (f5C) , N4-methyl-cytidine (m4C), 5-methyl-cytidine (m5C), 5-halocytidine (for example, 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo- cytidine, pyrrolopseudoisocytidine, 2-thio-cytidine (s2C), 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza -pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularin, 5-aza-zebularin, 5-methylzebularin, 5-aza-2-thio-zebularin, 2-thio-zebularin, 2-methoxy-cytidine, 2-methoxy -5-methyl-cytidine, 4-methoxypseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k ² C), α-thio-cytidine, 2'-O-methyl-cytidine (Cm), 5.2 ' -O-dimethyl-cytidine (m5Cm), N4-acetyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methylcytidine (f®Cm), N4, N4,2 '-O-trimethyl-cytidine (m4 ² Cm), 1-thio-cytidine, 2'-F-ara-cytidine, 2'-F-cytidine and 2'-OH-ara-cytidine.

In some embodiments, the modified nucleobase is a modified adenine. Examples of nucleobases and nucleosides having a modified adenine include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (eg, 2-amino-6-chloro-purine), 6- halo-purine (for example, 6-chloro-purine), 2-amino-6-methyl-purine, 8-azidoadenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2- amino-purine, 7-deaza-8-aza-2-amino-purine, 7deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A), 2 -methylthio-N6-methyl-adenosine (ms2m6A), N6-isopentenyl-adenosine (i6A), 2-methylthio-N6-isopentenyl-adenosine (ms2i6A), N6- (cis-hydroxyisopentenyl) adenosine (io6A), 2-methylthio- N6- (cishydroxyisopentenyl) adenosine (ms2io6A), N6-glycinylcarbamoyl-adenosine (g6A), N6-threonylcarbamoyl-adenosine (t6A), N6-methyl-N6-threonylcarbamoyl-adenosine (m6t6A), Namoyl-6-methyl-threnylcarb6-methyl-6A (ms2g6A), N6, N6-dimethyladenosine (m6 ² A), N6-hydroxynorvalylcarbamoyl-adenosine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine (ms2hn6A), N6-acetyl-adenosine, 7-methyl- adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine (Am), N6,2'-O-dimethyl-adenosine (m6Am), N6, N6, 2'-O-trimethyl-adenosine (m6 ² Am), 1,2-O-dimethyladenosine (m1Am), 2'-O-ribosyladenosine (phosphate) (Ar (p)), 2-amino-N6-methyl-purine , 1-thio-adenosine, 8-azidoadenosine, 2'-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine-ara-adenosine and N6- (19-aminopentaoxanonadecyl) -adenosine.

In some embodiments, the modified nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having a modified guanine include inosine (I), 1-methyl-inosine (m1I), wiosin (imG), methylwiosine (mimG), 4-demethyl-wiosin (imG-14), isowiosin (imG2 ), wibutosin (yW), peroxywibutosin (or ² yW), hydroxywibutosin (OhyW), insufficiently modified hydroxywibutosin (OhyW *), 7-deaza-guanosine, queuosine (Q), epoxyqueuosin (oQ), galactosyl-queuosin (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanosine (preQü), 7-aminomethyl-7-deaza-guanosine (preQ ¹ ), arcaeosine (G +), 7-deaza-8-aza-guanosine, 6 -thio-guanosine, 6-thio-7-deazaguanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine (m7G), 6-thio-7-methyl-guanosine, 7-methyl- inosine, 6-methoxy-guanosine, 1-methyl-guanosine (m1G), N2-methyl-guanosine (m2G), N2, N2-dimethyl-guanosine (m2 ² G), N2,7-dimethyl-guanosine (m27G), N2 , N2,7-dimethyl-guanosine (m227G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2, N2-dimethyl-6-thio-guanosine, a-thio- guanosine, 2'-O-methyl-guanosine (Gm), N2-methyl-2'-O-methyl-guanosine (m2Gm), N2, N2-dimethyl-2'-O-methyl-guanosine (m2 ² Gm), 1-methyl-2'-O-methylguanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m27Gm), 2'-O-methyl-inosine (Im), 1,2'-O -dimethyl-inosine (m1Im), 2'-O-ribosylguanosine (phosphate) (Gr (p)), 1-thio-guanosine, O6-methyl-guanosine, 2'-F-ara-guanosine and 2'-F- guanosine.

In some embodiments, a mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (eg, a combination of 2, 3, or 4 of the aforementioned modified nucleobases).

In some embodiments, the modified nucleobase is pseudouridine ( ^y ), Nl-methylpseudouridine (m1 ^), 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2- thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxypseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine or 2'-O-methyl uridine. In some embodiments, a mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (eg, a combination of 2, 3, or 4 of the aforementioned modified nucleobases).

In some embodiments, the modified nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having a modified cytosine include N4-acetyl-cytidine (ac4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (eg, 5-iodo-cytidine), 5-hydroxymethyl- cytidine (hm5C), 1-methyl-pseudoisocytidine, 2-thio-cytidine (s2C) and 2-thio-5-methyl-cytidine. In some embodiments, a mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (eg, a combination of 2, 3, or 4 of the aforementioned modified nucleobases).

In some embodiments, the modified nucleobase is a modified adenine. Exemplary nucleobases and nucleosides that have a modified adenine include 7-deaza-adenine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), and N6-methyl-adenosine (m6A). In some embodiments, a mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (eg, a combination of 2, 3, or 4 of the aforementioned modified nucleobases).

In some embodiments, the modified nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having a modified guanine include inosine (I), 1-methyl-inosine (m1I), wiosine (imG), methylwiosine (mimG), 7-deaza-guanosine, 7-cyano-7-deaza- guanosine (preQü), 7-aminomethyl-7-deaza-guanosine (preQ ¹ ), 7-methylguanosine (m7G), 1-methyl-guanosine (m1G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine . In some embodiments, a mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (eg, a combination of 2, 3, or 4 of the aforementioned modified nucleobases).

In some embodiments, the modified nucleobase is 1-methyl-pseudouridine (m1 ^), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), pseudouridine ( ^y ), a-thio-guanosine or a-thio-adenosine. In some embodiments, a mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (eg, a combination of 2, 3, or 4 of the aforementioned modified nucleobases).

In some embodiments, the mmRNA comprises pseudouridine ( ^y ). In some embodiments, the mmRNA comprises pseudouridine (y) and 5-methyl-cytidine (m5C). In some embodiments, the mmRNA comprises 1-methylpseudouridine (m1Y). In some embodiments, the mmRNA comprises 1-methyl-pseudouridine (m1Y) and 5-methyl-cytidine (m5C). In some embodiments, the mmRNA comprises 2-thiouridine (s2U). In some embodiments, the mmRNA comprises 2-thioudouridine and 5-methyl-cytidine (m5C). In some embodiments, the mmRNA comprises 5-methoxyuridine (mo5U). In some embodiments, the RNA, for example, comprises 5-methoxy-uridine (mo5U) and 5-methyl-cytidine (m5C). In some embodiments, the mmRNA comprises 2'-O-methyl uridine. In some embodiments, the mmRNA comprises 2'-O-methyl uridine and 5-methyl-cytidine (m5C). In some embodiments, the mmRNA comprises N6-methyladenosine (m6A). In some embodiments, the mmRNA comprises N6-methyl-adenosine (m6A) and 5-methyl-cytidine (m5C).

In certain embodiments, a mRNA of the disclosure is uniformly modified (ie, completely modified, throughout the entire sequence) for a particular modification. For example, a mmRNA can be uniformly modified with 1-methyl-pseudouridine (m1Y) or 5-methyl-cytidine (m5C), meaning that all uridine or cytosine residues in the mmRNA sequence are replaced with 1-methyl-pseudouridine. (m1Y) or with 5-methyl-cytidine (m5C), respectively. Similarly, the mRNAs of the disclosure can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above.

In some embodiments, an mRNA of the disclosure can be modified in a coding region (eg, an open reading frame that encodes a polypeptide). In other embodiments, an mRNA can be modified in other regions, in addition to a coding region. For example, in some embodiments, a 5 'UTR and / or a 3' UTR are provided, where one or both may independently contain one or more different nucleoside modifications. In such embodiments, nucleoside modifications can also be present in the coding region.

Examples of nucleoside modifications and combinations thereof that may be present in the mmRNAs of the present disclosure include, among others, those described in PCT Patent Application Publications: WO2012045075, WO2014081507, WO2014093924, WO2014164253 and WO2014159813.

The mRNAs of the disclosure may include a combination of modifications to the sugar, the nucleobase, and / or the inter-nucleoside linkage. These combinations can include one or more modifications described in this invention.

Examples of modified nucleosides and modified nucleoside combinations are provided below in Table 1 and Table 2. These modified nucleotide combinations can be used to form the mRNAs of the disclosure. In certain embodiments, the modified nucleosides may be partially or completely replaced by the natural nucleotides of the mRNAs of the disclosure. As a non-limiting example, the natural nucleotide uridine can be substituted with a modified nucleoside described in this invention. In another non-limiting example, the natural nucleoside uridine may be partially substituted (eg, about 0.1, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 , 70, 75, 80, 85, 90, 95 or 99.9% of the natural uridines) with at least one of the modified nucleosides described in this invention.

Table 1. Combinations of nucleoside modifications

Table 2. Modified nucleosides combinations thereof

5 % 5-methyl-CTP 75 % CTP / 5-methoxy-UTP

5% 5-methyl-CTP 75% CTP / 75% 5-methoxy-UTP 25% 1-methyl-pseudo-UTP 5% 5-methyl-CTP 75% CTP / 75% 5-methoxy-UTP 25% UTP

5% 5-phenyl-CTP 75% CTP / 25% 5-methoxy-UTP 75% UTP

5% 5-phenyl-CTP 75% CTP / 75% 5-methoxy-UTP 25% UTP

5% 5-trifluoromethyl-CTP 75% CTP / 25% 5-methoxy-UTP 75% UTP

5% 5-trifluoromethyl-CTP 75% CTP / 75% 5-methoxy-UTP 25% UTP

5% 5-trifluoromethyl-CTP 75% CTP / 1-methyl-pseudo-UTP

5% N4-Ac-CTP 75% CTP / 25% 5-methoxy-UTP 75% UTP

5% N4-Ac-CTP 75% CTP / 75% 5-methoxy-UTP 25% UTP

5% N4-Bz-CTP 75% CTP / 25% 5-methoxy-UTP 75% UTP

5% N4-Bz-CTP 75% CTP / 75% 5-methoxy-UTP 25% UTP

5% N4-methyl-CTP 75% CTP / 25% 5-methoxy-UTP 75% UTP

5% N4-methyl-CTP 75% CTP / 75% 5-methoxy-UTP 25% UTP

5% pseudo-iso-CTP 75% CTP / 25% 5-methoxy-UTP 75% UTP

5% pseudo-iso-CTP 75% CTP / 75% 5-methoxy-UTP 25% UTP

5% 5-bromo-CTP / 75% CTP / pseudo-UTP

5% 5-methoxy-UTP / 25% 5-methyl-CTP / ATP / GTP

5% 5-methoxy-UTP / 5-methyl-CTP / ATP / GTP

5% 5-methoxy-UTP / 75% 5-methyl-CTP / ATP / GTP

5% 5-methoxy-UTP / CTP / ATP / GTP

5% 5-methoxy-UTP / 50% 5-methyl-CTP / ATP / GTP

-amino-ATP

-thio-CTP

-thio-pseudouridine TP, ATP, GTP, CTP

-tio-pseudo-UTP

- tio- UTP

- methyl-CTP

- methyl-pseudo-UTP

- tio-UTP

0% 5-bromo-CTP 50% CTP / 1-methyl-pseudo-UTP

0% 5-hydroxymethyl-CTP 50% CTP / 1-methyl-pseudo-UTP

0% 5-methoxy-UTP / 5-methyl-CTP / ATP / GTP

0% 5-methyl-CTP 50% CTP / 25% 5-methoxy-UTP 75% 1-methyl-pseudo-UTP 0% 5-methyl-CTP 50% CTP / 25% 5-methoxy-UTP 75% UTP

0% 5-methyl-CTP 50% CTP / 50% 5-methoxy-UTP 50% 1-methyl-pseudo-UTP 0% 5-methyl-CTP 50% CTP / 50% 5-methoxy-UTP 50% UTP

0 % 5-methyl-CTP 50 % CTP / 5-methoxy-UTP

0% 5-methyl-CTP 50% CTP / 75% 5-methoxy-UTP 25% 1-methyl-pseudo-UTP 0% 5-methyl-CTP 50% CTP / 75% 5-methoxy-UTP 25% UTP

0% 5-trifluoromethyl-CTP 50% CTP / 1-methyl-pseudo-UTP

0% 5-bromo-CTP / 50% CTP / pseudo-UTP

0% 5-methoxy-UTP / 25% 5-methyl-CTP / ATP / GTP

0% 5-methoxy-UTP / 50% 5-methyl-CTP / ATP / GTP

0% 5-methoxy-UTP / 75% 5-methyl-CTP / ATP / GTP

0% 5-methoxy-UTP / CTP / ATP / GTP

-aminoallil-CTP

-aminoallil-CTP / 5-methoxy-UTP

-aminoallil-UTP

-bromine-CTP

-phenyl-CTP / 5-methoxy-UTP

-bromo-CTP / 1-methyl-pseudo-UTP

-bromo-CTP / pseudo-UTP

-bromocytidine TP, ATP, GTP, UTP

-bromine-UTP

-carboxy-CTP / 5-methoxy-UTP

-ethyl-CTP / 5-methoxy-UTP

-etinyl-CTP / 5-methoxy-UTP

-fluoro-CTP / 5-methoxy-UTP

-formyl-CTP / 5-methoxy-UTP

-hydroxy-methyl-CTP / 5-methoxy-UTP

-hydroxymethyl-CTP

-hydroxymethyl-CTP / 1-methyl-pseudo-UTP

-hydroxymethyl-CTP / 5-methoxy-UTP

-hydroxymethyl-cytidine TP, ATP, GTP, UTP

-iodo-CTP / 5-methoxy-UTP

-Me-CTP / 5-methoxy-UTP

-methoxycarbonyl methyl-UTP

-methoxy-CTP / 5-methoxy-UTP

-methoxy-uridine TP, ATP, GTP, UTP

-methoxy-UTP

-methoxy-UTP

-methoxy-UTP / N6-isopentenyl-ATP

-methoxy-UTP / 25% 5-methyl-CTP / ATP / GTP

-methoxy-UTP / 5-methyl-CTP / ATP / GTP

-methoxy-UTP / 75 % 5-methyl-CTP / ATP / GTP

-methoxy-UTP / CTP / ATP / GTP

-methyl-2-thio-UTP

-methylaminomethyl-UTP

-methyl-CTP / 5-methoxy-UTP

-methyl-CTP / 5-methoxy-UTP (end 0)

-methyl-CTP / 5-methoxy-UTP (no end)

-methyl-CTP / 25% 5-methoxy-UTP 75% 1-methyl-pseudo-UTP -methyl-CTP / 25% 5-methoxy-UTP 75% UTP

-methyl-CTP / 50% 5-methoxy-UTP 50% 1-methyl-pseudo-UTP -methyl-CTP / 50% 5-methoxy-UTP 50% UTP

-methyl-CTP / 5-methoxy-UTP / N6-Me-ATP

-methyl-CTP / 75% 5-methoxy-UTP 25% 1-methyl-pseudo-UTP -methyl-CTP / 75% 5-methoxy-UTP 25% UTP

-phenyl-CTP / 5-methoxy-UTP

-trifluoro-methyl-CTP / 5-methoxy-UTP

-trifluoromethyl-CTP

-trifluoromethyl-CTP / 5-methoxy-UTP

-trifluoromethyl-CTP / 1-methyl-pseudo-UTP

-trifluoromethyl-CTP / pseudo-UTP

-trifluoromethyl-UTP

-trifluoromethylcytidine TP, ATP, GTP, CTP

5% 5-aminoallyl-CTP 25% CTP / 25% 5-methoxy-UTP 75% UTP 5% 5-aminoally-CTP 25% CTP / 75% 5-methoxy-UTP 25% UTP 5% 5-bromo-CTP 25 % CTP / 25% 5-methoxy-UTP 75% UTP 5% 5-bromo-CTP 25% CTP / 75% 5-methoxy-UTP 25% UTP 5% 5-carboxy-CTP 25% CTP / 25% 5-methoxy -UTP 75% UTP 5% 5-carboxy-CTP 25% CTP / 75% 5-methoxy-UTP 25% UTP 5% 5-ethyl-CTP 25% CTP / 25% 5-methoxy-UTP 75% UTP

5% 5-ethyl-CTP 25% CTP / 75% 5-methoxy-UTP 25% UTP

5% 5-ethi nyl-CTP 25% CTP / 25% 5-methoxy-UTP 75% UTP 5% 5-ethi nyl-CTP 25% CTP / 75% 5-methoxy-UTP 25% UTP 5% 5-fluoro- CTP 25% CTP / 25% 5-methoxy-UTP 75% UTP 5% 5-fluoro-CTP 25% CTP / 75% 5-methoxy-UTP 25% UTP 5% 5-formyl-CTP 25% CTP / 25% 5 -methoxy-UTP 75% UTP 5% 5-formyl-CTP 25% CTP / 75% 5-methoxy-UTP 25% UTP

According to the description, the polynucleotides of the description can be synthesized such that they comprise the individual combinations or modifications of Table 1 or Table 2.

When a single modification is listed, the numbered nucleoside or nucleotide represents 100 percent of that modified A, U, G, or C nucleotide or nucleoside. When percentages are listed, they represent the percentage of that particular nucleobase A, U, G, or C triphosphate out of the total amount of A, U, G, or C triphosphate present. For example, the combination: 25% 5-aminoallyl-CTP 75% CTP / 25% 5-methoxy-UTP 75% UTP refers to a polynucleotide where 25% of the cytosine triphosphates are 5-aminoallyl-CTP, whereas 75% of the cytosines are CTP; while 25% of uracils are 5-methoxy UTP, while 75% of uracils are UTP. Where no modified UTP is listed, then a natural ATP, UTP, GTP and / or CTP is used at 100% of those nucleotide sites found in the polynucleotide. In this example, all GTP and ATP nucleotides are left unmodified.

The mRNAs of the present disclosure, or regions thereof, can be codon optimized. Codon optimization procedures are known in the art and can be useful for a variety of purposes: matching codon frequencies in host organisms to ensure proper folding, to alter GC content to increase mRNA stability or reduce secondary structures , to minimize tandem repeat codons or base runs that may impede gene expression or construction, to modify transcriptional and translational control regions, to insert or remove protein trafficking sequences, to remove or add modification sites post-translational in encoded proteins (e.g., glycosylation sites), to add, remove, or mix protein domains, to insert or remove restriction sites, to modify ribosome binding sites and mRNA degradation sites, to adjust translation rates in order to allow the various domains of the protein to fold appropriately, or to reduce or eliminate problematic secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art; non-exhaustive examples include the services of GeneArt (Life Technologies), DNA2.0 (Menlo Park, CA) and / or proprietary procedures. In one embodiment, the mRNA sequence is optimized using optimization algorithms, for example, to optimize expression in mammalian cells or improve mRNA stability.

In certain embodiments, the present disclosure includes polynucleotides that have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99% sequence identity to any of the sequences of polynucleotides described in this invention.

The mRNAs of the present disclosure can be produced by means available in the art, including, but not limited to, in vitro transcription (IVT) and synthetic procedures. Enzymatic (IVT), solid phase, liquid phase, combined synthetics, small region synthesis, and ligation procedures can be used. In one embodiment, the mRNAs are made using IVT enzymatic synthesis procedures. Procedures for making polynucleotides by IVT are known in the art and are described in International Application PCT / US2013 / 30062. Accordingly, the present disclosure also includes polynucleotides, eg, DNAs, constructs and vectors that can be used to transcribe an mRNA described in this invention in vitro.

Unnatural modified nucleobases can be introduced into polynucleotides, eg, mRNA, during or after synthesis. Modifications can be present at an internucleotide bond, purine or pyrimidine bases, or sugars. In particular embodiments, the modification can be introduced at the terminus of a polynucleotide chain or at any other place on the polynucleotide chain; with chemical synthesis or with a polymerase enzyme. Examples of modified nucleic acids and their synthesis are described in PCT application No. PCT / US2012 / 058519. The synthesis of modified polynucleotides is also described in Verma and Eckstein, Annual Review of Biochemistry, vol. 76, 99-134 (1998).

Enzymatic or chemical ligation procedures can be used to conjugate polynucleotides or their regions with different functional moieties, such as targeting or delivery agents, fluorescent labels, liquids, nanoparticles, etc. On polynucleotide and modified polynucleotide conjugates, there is a review in Goodchild, Bioconjugate Chemistry, vol. 1 (3), 165-187 (1990).

MicroRNA binding sites for miR expressed in immune cells

MicroRNAs (or miRNAs) have noncoding RNAs 19-25 nucleotides long (commonly 19-23 nucleotides long, more typically 22 nucleotides long) that bind to the 3 'UTR of nucleic acid molecules and regulate towards down gene expression after translation, either by reducing the stability of the nucleic acid molecule or by inhibiting translation. The mRNAs of the disclosure may comprise one or more microRNA target sequences or sites, microRNA binding sequences or sites, a sequence complementary to microRNA sequences, or a sequence complementary to a microRNA seed region or sequence. Said sequences can correspond to any known microRNA, such as those taught in US Publication US2005 / 0261218 and US Publication US2005 / 0059005. A microRNA sequence comprises a "seed" region or sequence, that is, a sequence in the region of positions 2-8 of the mature microRNA, the sequence of which has perfect Watson-Crick complementarity with the miRNA target sequence. The bases of the microRNA seed region or sequence have complete complementarity to the target sequence. MicroRNAs are enzymatically derived from regions of RNA transcripts that fold back on themselves to form short hairpin structures, often referred to as pre-miRNAs (precursormiRNAs). The pre-mipre-miRNA typically has a two nucleotide overhang at its 3 'end, and has 3' hydroxyl and 5 'phosphate groups. This precursor-mRNA is processed in the nucleus and subsequently transported to the cytoplasm, where DICER (an RNAse III enzyme) processes it to form a mature microRNA of approximately 22 nucleotides. The mature microRNA is then incorporated into a ribonuclear particle to form the RNA-induced silencing complex, RISC, which mediates gene silencing. The art-recognized nomenclature for mature miRNAs typically designates the arm of the pre-miRNA from which the mature miRNA is derived; "5p" means that the microRNA is from the main 5 arm of the pre-miRNA hairpin and "3p" means that the microRNA is from the 3 end of the pre-miRNA hairpin. A miR referred to in this invention by a number can refer to either of the two mature microRNAs originating from opposite arms of the same pre-miRNA (eg, the 3p or 5p microRNA). All miRs referred to in this invention are intended to include both 3p and 5p sequences / arms, unless particular specification is made by designating 3p and 5p.

In some embodiments, an mRNA of the disclosure may include one or more microRNA (miRNA) binding sites. As used in this invention, the term "microRNA (miRNA) binding site" refers to a sequence within a polynucleotide, eg, within a DNA or RNA transcript, that has sufficient complementarity to all or one region of a miRNA to interact, associate or bind to the miRNA. In exemplary embodiments, the miRNA binding sites are included in the mRNA, eg, in the 5 'UTR and / or the 3' UTR of an mRNA. A miR binding site sequence that has sufficient complementarity to miR refers to a degree of complementarity sufficient to facilitate miR-mediated regulation of mRNA, eg, miR-translated repression or degradation of mRNA. In exemplary aspects of the disclosure, a miR binding site sequence that has sufficient complementarity to miR refers to a degree of complementarity sufficient to facilitate miR-mediated degradation of mRNA, eg, RISC-mediated and guided by miR of mRNA. The miR binding site may have complementarity to, for example, a miR sequence 19-25 nucleotides in length, with a miR sequence of 19-23 nucleotides, more typically with a miR sequence of 22 nucleotides in length. A miR binding site can be complementary to only a portion of a miR, eg, a portion 1, 2, 3, or 4 nucleotides shorter than a natural miR. Full or complete complementarity (eg, fully or fully complementary, especially in a significant portion of a natural miR) is preferred when the desired regulation is mRNA degradation. In some embodiments, a miRNA binding site includes a sequence that has complementarity (eg, partial or complete complementarity) to a miRNA seed sequence. In particular embodiments, the miRNA binding site includes a sequence that has complete complementarity to a miRNA seed sequence. In some embodiments, a miRNA binding site includes a sequence that has complementarity (eg, partial or complete complementarity) to a miRNA sequence. In particular embodiments, the miRNA binding site includes a sequence that has complete complementarity to a miRNA sequence. In some embodiments, a miRNA binding site has complete complementarity to a miRNA sequence, but for 1, 2, or 3 nucleotide substitutions, terminal additions, and / or truncations.

One or more miR binding sequences can be incorporated into an mRNA of the disclosure for one or more of a variety of different purposes. For example, the incorporation of one or more miRNA binding sites into an mRNA of the disclosure can target the molecule for degradation or reduced translation, as long as the miRNA in question is available (eg, expressed in a target cell or tissue. ). In some embodiments, the incorporation of one or more miRNA binding sites into an mRNA of the disclosure may reduce the risk of nonspecific effects upon administration of nucleic acid molecules and / or allow tissue-specific regulation of the expression of a polypeptide encoded by the mRNA. In still other embodiments, the incorporation of one or more miRNA binding sites into an mRNA of the disclosure can modulate immune responses after in vivo nucleic acid administration. In additional embodiments, the incorporation of one or more miRNA binding sites into an mRNA of the disclosure can modulate the accelerated blood clearance (AUC) of lipid-comprising compounds and compositions described in this invention.

Representative miRNAs were selected based on the expression and abundance in immune cells of the hematopoietic lineage, such as B cells, T cells, macrophages, dendritic cells, and cells known to express TLR7 / TLR8 and / or to be capable of secreting cytokines, like endothelial cells and platelets. The miRNA pool therefore included miRs that may be responsible in part for the immunogenicity of these cells, and in such a way that a corresponding incorporation of the miR site into the mRNA could lead to destabilization of the mRNA and / or suppression of the translation of these mRNAs into the specific cell type. Representative non-limiting examples include miR-142, miR-144, miR-150, miR-155, and miR-223, which are specific for many of the hematopoietic cells; miR-142, miR150, miR-16 and miR-223, which are expressed in B cells; miR-223, miR-451, miR-26a, miR-16, which are expressed in hematopoietic progenitor cells; and miR-126, which is expressed on plasmacytoid dendritic cells, platelets, and endothelial cells. For a more detailed discussion on tissue miR expression, see, for example, Teruel-Montoya, R. et al. (2014) PLoS One 9: e102259; Landgraf, P. et al. (2007) Cell 129: 1401-1414; Bissels, U. et al. (2009) RNA 15: 2375-2384. As evidenced, the incorporation of any miR site into the 3 'UTR and / or the 5' UTR can mediate such effects in multiple cell types of interest (for example, miR-142 is abundant in both B cells and cells dendritic).

It is beneficial to target the same cell type with multiple miRs and incorporate binding sites to each of the 3p and 5p arms if both are abundant (for example, both miR-142-3p and miR142-5p are abundant in hematopoietic stem cells) . Accordingly, for example, in certain embodiments, an mRNA construct contains two or more (eg, two, three, four, or more) miR binding sites from: (i) the group consisting of miR-142, miR -144, miR-150, miR-155 and miR-223 (which are expressed in many hematopoietic cells); or (ii) the group consisting of miR-142, miR150, miR-16 and miR-223 (which are expressed in B cells); or the group consisting of miR-223, miR-451, miR-26a, miR-16 (which are expressed in hematopoietic progenitor cells).

It is also beneficial to combine multiple miRs so that multiple cell types of interest are selected at the same time (eg, miR-142 and miR-126 to target many cells of the hematopoietic lineage and endothelial cells). Accordingly, for example, in certain embodiments, an mRNA construct contains two or more (eg, two, three, four, or more) miR binding sites, where: (i) at least one of the miR cells is targets the hematopoietic lineage (e.g., miR-142, miR-144, miR-150, miR-155, or miR-223) and at least one of the miR targets dendritic cells, platelets, or plasmacytoid endothelial cells (e.g. example, miR-126); or (ii) at least one of the miRs targets B cells (e.g., miR-142, miR150, miR-16, or miR-223) and at least one of the miRs targets dendritic cells, platelets, or plasmacytoid endothelial cells (eg, miR -126); or (iii) at least one of the miRs targets hematopoietic progenitor cells (eg, miR-223, miR-451, miR-26a, or miR-16) and at least one of the miRs targets dendritic cells plasmacytoid, platelets or endothelial cells (eg, miR-126); or (iv) at least one of the miR target cells of the hematopoietic lineage (eg, miR-142, miR-144, miR-150, miR-155 or miR-223), at least one of the miR B cells (eg miR-142, miR150, miR-16 or miR-223) and at least one of the miR targets plasmacytoid dendritic cells, platelets or endothelial cells (eg miR-126); or any other possible combination of the above four classes of miR binding sites (i.e., those that target the hematopoietic lineage, those that target B cells, those that target progenitor hematopoietic cells, and / or the targeting plamacytoid dendritic cells / platelets / endothelial cells).

Accordingly, in one example, to modulate immune responses, an mRNA may comprise one or more miR binding sequences that bind to one or more miRs that are expressed in conventional immune cells or in any cell that expresses TLR7 and / or TLR8 and secretes chemokines and / or pro-inflammatory cytokines (eg, in immune cells of peripheral lymphoid organs and / or splenocytes and / or endothelial cells). It has now been discovered that incorporation into an mRNA of one or more miRs that are expressed in conventional immune cells or in any cell that expresses TLR7 and / or TLR8 and secretes pro-inflammatory chemokines and / or cytokines (for example, in immune cells of organs peripheral lymphoid cells and / or splenocytes and / or endothelial cells) reduces or inhibits immune cell activation (e.g., B cell activation, as measured by the frequency of activated B cells) and / or cytokine production ( for example, the production of IL-6, IFN- ^and and / or TNFa). Furthermore, it has been discovered that incorporation into an mRNA of one or more miRs that are expressed in conventional immune cells or any cell that expresses TLR7 and / or TLR8 and secretes chemokines and / or pro-inflammatory cytokines (eg, immune cells from lymphoid organs peripheral cells and / or splenocytes and / or endothelial cells) can reduce or inhibit an anti-drug antibody (ADA) response against a protein of interest encoded by the mRNA.

In another example, to modulate the accelerated blood clearance of an mRNA administered in a compound or composition comprising lipids, the mRNA may comprise one or more miR binding sequences that bind to one or more miRs that are expressed in conventional immune cells. or in any cell that expresses TLR7 and / or TLR8 and secretes chemokines and / or pro-inflammatory cytokines (eg, in immune cells of peripheral lymphoid organs and / or splenocytes and / or endothelial cells). It has now been discovered that incorporation into an mRNA of one or more miR binding sites reduces or inhibits the accelerated blood clearance (AUC) of the lipid-comprising compound or composition for use in mRNA delivery. Furthermore, it has now been discovered that incorporation of one or more miR binding sites into an mRNA reduces serum levels of anti-PEG anti-IgM (e.g., reduces or inhibits the acute production of IgM recognized by polyethylene glycol (PEG ) by B cells) and / or reduces or inhibits the proliferation and / or activation of plasmacytoid dendritic cells after administration of a lipid-comprising compound or composition, comprising the mRNA.

Such miR sequences can correspond to any microRNA expressed in immune cells, including, but not limited to, those taught in US Publication US2005 / 0261218 and US Publication US2005 / 0059005. Non-limiting examples of miRs expressed in immune cells include those expressed in spleen cells, myeloid cells, dendritic cells, plasmacytoid dendritic cells, B cells, T cells, and / or macrophages. For example, the binding sites of miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24 and miR-27 are expressed in myeloid cells, miR-155 is expressed in dendritic, B and T cells, miR-146 is upregulated in macrophages upon TLR stimulation and miR-126 is expressed in plasmacytoid dendritic cells. In certain embodiments, the miR (s) are abundantly or preferentially expressed in immune cells. For example, the binding sites of miR-142 (miR-142-3p and / or miR-142-5p), miR-126 (miR-126-3p and / or miR-126-5p), miR-146 ( miR-146-3p and / or miR-146-5p) and miR-155 (miR-155-3p and / or miR155-5p) are abundantly expressed in immune cells. These microRNA sequences are known in the art and therefore one of ordinary skill in the art can easily design binding sequences or target sequences to which these microRNAs will bind based on Watson-Crick complementarity.

Accordingly, in various examples, the mRNA comprises at least one microRNA binding site for a miR selected from the group consisting of miR-142, miR-146 miR-155, miR-126, miR-16, miR- 2l, miR-223, miR-24 and miR-27. In another example, the mRNA comprises at least two miR binding sites for microRNAs expressed in immune cells. In various embodiments, the mRNA comprises 1-4, one, two, three, or four miR binding sites for microRNAs expressed in immune cells. In another example, the mRNA comprises three miR binding sites. These miR binding sites can be for microRNAs selected from the group consisting of miR-142, miR-146, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24, miR-27 and combinations thereof. In one example, the mRNA comprises two or more (eg, two, three, four) copies of the same miR binding site expressed in immune cells, eg, two or more copies of a miR binding site selected from the group of miR consisting of miR-142, miR-146, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24, miR-27.

For example, in one embodiment, the mRNA comprises three copies of the same miR binding site. As described in Example 8, in certain embodiments, the use of three copies of the same miR binding site may show beneficial properties compared to the use of a single miR binding site. Non-limiting examples of sequences for 3 'UTR containing three miR binding sites are shown in SEQ ID NO: 38 (three miR-142-3p binding sites), SEQ ID NO: 40 (three miR-142-3p binding sites). binding of miR-142-5p) and SEQ ID NO: 54 (three binding sites of miR-122).

In another embodiment, the mRNA comprises two or more (eg, two, three, four) copies of at least two different miR binding sites expressed in immune cells. Non-limiting examples of 3 'UTR sequences containing two or more different miR binding sites are shown in SEQ ID NO: 33 (a miR-142-3p binding site and a miR-126 binding site -3p), SEQ ID NO: 47 (one miR-142-3p binding site and one miR-122-5p binding site), SEQ ID NO: 41 (two miR-142- 5p and one miR-142-3p binding site) and SEQ ID NO: 44 (two miR-155-5p binding sites and one miR-142-3p binding site).

In another embodiment, the mRNA comprises at least two miR binding sites for microRNAs expressed in immune cells, where at least one of the miR binding sites is for miR-142-3p. In various embodiments, the mRNA comprises binding sites for miR-142-3p and miR-155 (miR-155-3p or miR-155-5p), miR-142-3p, and miR-146 (miR-146-3 or miR-146-5p), or miR-142-3p and miR-126 (miR-126-3p or miR-126-5p).

In another embodiment, the mRNA comprises at least two miR binding sites for microRNAs expressed in immune cells, where at least one of the miR binding sites is for miR-126-3p. In various embodiments, the mRNA comprises binding sites for miR-126-3p and miR-155 (miR-155-3p or miR-155-5p), miR-126-3p, and miR-146 (miR-146-3p or miR-146-5p), or miR-126-3p and miR-142 (miR-142-3p or miR-142-5p).

In another example, the mRNA comprises at least two miR binding sites for microRNAs expressed in immune cells, where at least one of the miR binding sites is for miR-142-5p. In various embodiments, the mRNA comprises binding sites for miR-142-5p and miR-155 (miR-155-3p or miR-155-5p), miR-142-5p, and miR-146 (miR-146-3 or miR-146-5p), or miR-142-5p and miR-126 (miR-126-3p or miR-126-5p).

In yet another example, the mRNA comprises at least two miR binding sites for microRNAs expressed in immune cells, where at least one of the miR binding sites is for miR-155-5p. In various embodiments, the mRNA comprises binding sites for miR-155-5p and miR-142 (miR-142-3p or miR-142-5p), miR-155-5p, and miR-146 (miR-146-3 or miR-146-5p), or miR-155-5p and miR-126 (miR-126-3p or miR-126-5p).

In exemplary embodiments, the one or more miR binding sites are placed within the 3 'UTR, the 5' UTR, or both the 3 'and 5' UTR, such that the mRNA has the desired properties. The miR binding site can be placed within the 3 'UTR immediately after the stop codon of the coding region within the mRNA construct (or, if there are multiple copies of a stop codon, in the construct, immediately after stop codon) or the miR binding site (s) may be positioned downstream of the stop codon, in which case there are 3 'UTR bases between the stop codon and the miR binding site (s). For example, three non-limiting examples of possible insertion sites for a miR in a 3 'UTR are shown in SEQ ID NO: 48, 49 and 50, showing a sequence of 3' UTR with a miR-142 site. 3p inserted into one of three different possible insertion sites, respectively, within the 3 'UTR. In addition, one or more miR binding sites can be positioned within the 5 'UTR at one or more possible insertion sites. For example, the three non-limiting examples of possible insertion sites for a miR in a 5 'UTR are further described in Example 9 and shown in SEQ ID NO: 55, 56 and 57, showing a 5' sequence. UTR with a miR-142-3p site inserted into one of three different possible insertion sites, respectively, within the 5 'UTR. Additionally, SEQ ID NO: 58, 59 and 60 show a 5 'UTR sequence with a miR-122 site inserted. at one of three different possible insertion sites, respectively, within the 5 'UTR.

In one embodiment, a codon-optimized open reading frame encoding a polypeptide of interest comprises a stop codon and the at least one microRNA binding site is located within the 3 'UTR 1 to 100 nucleotides after the stop codon. stop. In one embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site for a miR expressed in immune cells lies within the 3 'UTR of 30 at 50 nucleotides after the stop codon. In another embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site for a miR expressed in immune cells lies within the 3 'UTR at least 50 nucleotides after the stop codon. In other embodiments, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 3 ' ^u T ^r immediately after the stop codon, or within the 3 'UTR 15 to 20 nucleotides after the stop codon or within the 3' UTR 70 to 80 nucleotides after the stop codon. In other embodiments, the 3 'UTR comprises more than one miR binding site (eg, 2 to 4 miR binding sites), where there may be a spacer region (eg, 10-100, 20-70 or 30-50 nucleotides in length) between each miR binding site. In another embodiment, the 3 'UTR comprises a spacer region between the end of the miR binding site (s) and the nucleotides of the poly A tail. For example, a spacer region of 10-100, 20-70, or 30- 50 nucleotides in length can be located between the end of the miR binding site (s) and the beginning of the poly A tail.

In one embodiment, a codon-optimized open reading frame encoding a polypeptide of interest comprises a start codon and the at least one microRNA binding site is located within the 5 'UTR from 1 to 100 nucleotides before (upstream ) of the start codon. In one embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a start codon and the at least one microRNA binding site for a miR expressed in immune cells lies within the 5 'UTR of 10 at 50 nucleotides before (upstream) the start codon. In another embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a start codon and the at least one microRNA binding site for a miR expressed in immune cells lies within the 5 'UTR at least 25 nucleotides before (upstream) the start codon. In other embodiments, the codon-optimized open reading frame encoding the polypeptide of interest comprises a start codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 5 'UTR immediately before of the start codon, or within the 5 'UTR 15 to 20 nucleotides before the start codon or within the 5' UTR 70 to 80 nucleotides before the start codon. In other embodiments, the 5 'UTR comprises more than one miR binding site (eg, 2 to 4 miR binding sites), where there may be a spacer region (eg, 10-100, 20-70 or 30-50 nucleotides in length) between each miR binding site.

In one embodiment, the 3 'UTR comprises more than one stop codon, where at least one miR binding site is positioned downstream of the stop codons. For example, a 3 'UTR can comprise 1, 2 or 3 stop codons. Non-limiting examples of triple stop codons that can be used include: UGAUAAUAG, UGAUAGUAA, UAAUGAUAG, UGAUAAUAA, UGAUAGUAG, UAAUGAUGA, UAAUAGUAG, UGAUGAUGA, UAAUAAUAA, and UAGUAGUAG. Within a 3 'UTR, for example, 1, 2, 3 or 4 miR binding sites, for example miR-142-3p binding sites, can be placed immediately adjacent to the stop codon (s) or at any nucleotide number downstream of the final stop codon. When the 3 'UTR comprises multiple miR binding sites, these binding sites can be placed directly next to each other in the construct (i.e. one after the other) or, alternatively, spacer nucleotides can be placed between each site. of Union.

In one embodiment, the 3 'UTR comprises three stop codons with a single miR-142-3p binding site located downstream of the third stop codon. Non-limiting examples of 3 'UTR sequences having three stop codons and a single miR-142-3p binding site located at different positions downstream of the final stop codon are shown in SEQ ID NO: 31 and 48 -fifty.

In one embodiment, the mmRNA comprises a 5 'UTR, a codon optimized open reading frame encoding the polypeptide of interest, a 3' UTR comprising the at least one microRNA binding site for a miR expressed in immune cells , and a 3 'tail region of linked nucleosides. In various embodiments, the 3 'UTR comprises 1 to 4, at least one, two, three or four microRNA binding sites for miRs expressed in immune cells, preferably abundantly or preferentially expressed in immune cells.

In one embodiment, the at least one miR expressed in immune cells is a microRNA binding site of miR142-3p. In one embodiment, the miR-142-3p microRNA binding site comprises the sequence shown in SEQ ID NO: 3. In one embodiment, the 3 'UTR of the mRNA comprising the miR microRNA binding site -142-3p comprises the sequence shown in SEQ ID NO: 2.

In one embodiment, the at least one miR expressed in immune cells is a miR-126 microRNA binding site. In one embodiment, the miR-126 binding site is a miR-126-3p binding site. In one embodiment, the miR-126-3p microRNA binding site comprises the sequence shown in SEQ ID NO: 26. In one embodiment, the 3 'UTR of the mmRNA comprising the miR microRNA binding site -126-3p comprises the sequence shown in SEQ ID NO: 27.

Exemplary non-limiting sequences for miR to which the microRNA binding sites of the disclosure can bind include the following: miR-142-3p (SEQ ID No: 8), miR-142-5p (SEQ ID NO: 9 ), miR-146-3p (SEQ ID NO: 10), miR-146-5p (SEQ ID NO: 11), miR-155-3p (SEQ ID NO: 12), miR-155-5p (SEQ ID NO : 13), miR-126-3p (SEQ ID NO: 14), miR-126-5p (SEQ ID NO: 15), miR-16-3p (SEQ ID NO: 16), miR-16-5p (SEQ ID NO: 17), miR-21-3p (SEQ ID NO: 18), miR-21-5p (SEQ ID NO: 19), miR-223-3p (SEQ ID NO: 20), miR-223-5p (SEQ ID NO: 21), miR-24-3p (SEQ ID NO: 22), miR-24-5p (SEQ ID NO: 23), miR-27-3p (SEQ ID NO: 24) and miR-27 -5p (SEQ ID NO: 25). Other suitable miR sequences expressed in immune cells (eg, abundantly or preferentially expressed in immune cells) are known and available in the art, eg, from the University of Manchester microRNA database, miRBase. Sites that bind to any of the miRs mentioned above can be designed based on Watson-Crick complementarity with the miR, typically 100% miR complementarity, and can be inserted into an mRNA construct of the description, such as is described in this invention.

In still other embodiments, the therapeutic window and / or differential expression (eg, tissue-specific expression) of a polypeptide of the disclosure can be altered by incorporating a miRNA binding site into an mRNA encoding the polypeptide. . Examples of tissues in which microRNA is known to regulate mRNA and thus protein expression include, but are not limited to, liver (eg miR-122), muscles (eg miR-133, miR-206 and miR-208), endothelial cells (for example, miR-17-92 and miR-126), myeloid cells (for example, miR-142-3p, miR-142-5p, miR-16, miR- 21, miR-223, miR-24 and miR-27), adipose tissue (for example, let-7 and miR-30c), heart (for example, miR-1d and miR-149), kidney (for example, miR -192, miR-194 and miR-204) and lung epithelial cells (for example, let-7, miR-133 and miR-126). Accordingly, in various embodiments, an mRNA may comprise one or more binding sites for any of the aforementioned miRs, alone or in combination, to thereby regulate tissue expression of an encoded protein of interest.

For example, an mRNA can include one or more miRNA binding sites that are bound by miRNA with higher expression in one type of tissue, compared to another. In another example, an mRNA may include one or more miRNA binding sites that bind by miRNAs with lower expression in a cancer cell, compared to a non-cancerous cell from the same tissue of origin. When present in a cancer cell expressing low levels of said miRNA, the polypeptide encoded by the mRNA will typically show increased expression. If the polypeptide can induce apoptosis, this can result in preferential cell death of cancer cells compared to normal cells.

For example, liver cancer cells (eg, hepatocellular carcinoma cells) typically express low levels of miR-122 compared to normal liver cells. Thus, an mRNA encoding a polypeptide that includes at least one miR-122 binding site (e.g., in the 3 'UTR of the mRNA) will typically express comparatively low levels of the polypeptide in normal liver cells and comparatively high levels of the polypeptide in liver cancer cells. If the polypeptide is capable of inducing apoptosis, this can cause preferential death of liver cancer cells (eg, hepatocellular carcinoma cells), compared to normal liver cells.

Accordingly, as a non-limiting example of incorporation of a miR binding site (s) into an mRNA to modulate tissue expression of an encoded protein of interest, the mRNAs of the disclosure may include at least one miR binding site. -122. For example, an mRNA of the disclosure may include a miR-122 binding site that includes a sequence with partial or complete complementarity to a miR-122 seed sequence. In some embodiments, a miR-122 seed sequence may correspond to nucleotides 2-7 of a miR-122. In some embodiments, a miR-122 seed sequence can be 5'-GGAGUG-3 '. In some embodiments, a miR-122 seed sequence may be nucleotides 2-8 of miR-122. In some embodiments, a miR-122 seed sequence can be 5'-GGAGUGU-3 '. In some embodiments, the miR-122 binding site includes a nucleotide sequence of 5'-UAUUUAGUGUGAUAAUGGCGUU-3 '(SEQ ID NO: 45) or 5'-CAAACACCAUUGUCACACUCCA-3 '(SEQ ID NO: 46) or a complement thereof. In some embodiments, the inclusion of at least one miR-122 binding site in an mRNA can dampen the expression of an mRNA-encoded polypeptide in a normal liver cell compared to other cell types that express low levels of miR- 122. In other embodiments, the inclusion of at least one miR-122 binding site in an mRNA may allow for increased expression of an mRNA-encoded polypeptide in a liver cancer cell (eg, a hepatocellular carcinoma cell. ) compared to a normal liver cell.

In yet another embodiment, the mRNA (eg, the 3 'UTR thereof) may comprise at least one miR binding site for a miR expressed in immune cells, to thereby reduce or inhibit immune activation (eg, activation of B cells, cytokine production, ADA responses) following in vivo nucleic acid administration, and may comprise at least one miR binding site to modulate tissue expression of an encoded protein of interest. For example, in one embodiment, the mRNA comprises a miR-122 binding site, thereby allowing increased expression of a polypeptide encoded by the mRNA in a liver cancer cell (eg, a hepatocellular carcinoma cell) in comparison to a normal liver cell, and also comprises one or more miR binding sites for a miR expressed in immune cells, for example, selected from the group consisting of miR-142, miR-146, miR-155, miR-126, miR-16, miR-21, miR -223, miR-24, miR-27.

In another embodiment, the mRNA (eg, the 3 'UTR thereof) may comprise at least one miR binding site to reduce or inhibit accelerated blood clearance, eg, by reducing or inhibiting IgM production, eg against PEG, via B cells and / or reducing or inhibiting proliferation and / or activation of pDC, and may comprise at least one miR binding site to modulate tissue expression of an encoded protein of interest. For example, in one embodiment, the mRNA comprises a miR-122 binding site, thereby allowing increased expression of a polypeptide encoded by the mRNA in a liver cancer cell (eg, a hepatocellular carcinoma cell) in compared to a normal liver cell, and also comprises one or more miR binding sites, for example selected from the group consisting of miR-142, miR-146, miR-155, miR-126, miR-16 , miR-21, miR -223, miR-24, miR-27.

In one embodiment, the mRNA construct comprises a miR-122 binding site and a miR-142-3p binding site. In other embodiments, the mRNA comprises a miR-122 binding site and a miR-142-5p binding site. In some embodiments, the mRNA construct comprises a miR-122 binding site and a miR-126-3p binding site. In another embodiment, the mRNA comprises a miR-122 binding site and a miR-155-5p binding site. In some embodiments, the mRNA construct comprises a miR-122 binding site and a miR-126-3p binding site. In another embodiment, the mRNA comprises a miR-122 binding site, a miR-142 binding site (miR-142-3p or 142-5p), and a miR-126 binding site (miR-126-3p or miR-126-5p). In another embodiment, the mRNA comprises a miR-122 binding site, a miR-142 binding site (miR-142-3p or 142-5p), and a miR-155 binding site (miR-155-3p or miR-155-5p). In another embodiment, the mRNA comprises a miR-122 binding site, a miR-126 binding site (miR-126-3p or 126-5p), and a miR-155 binding site (miR-155-3p or miR-155-5p). In yet another embodiment, the mRNA comprises a miR-122 binding site, a miR-142 binding site (miR-142-3p or miR-142-5p), a miR-126 binding site (miR- 126-3p or 126-5p) and a miR-155 binding site (miR-155-3p or miR-155-5p). In any of these embodiments, the miR-122 binding site can be a miR-122-5p binding site. A non-limiting example of a 3 'UTR sequence comprising both a miR-142-3p binding site and a miR-122-5p binding site is shown in SEQ ID NO: 47. The structure of 3 'UTR of SEQ ID NO: 47 includes three stop codons at its 5' end, immediately followed by a single miR-142-3p binding site, followed downstream by spacer nucleotides, and then a single binding of miR-122-5p. The distance between miR binding sites (eg, miR-142-3p and miR-122-5p) can vary considerably; Several different constructs with different locations of the two miR binding sites have been tested and all have been functional. In certain embodiments, a nucleotide spacer is placed between the two miR binding sites of a sufficient length to allow RISC to bind to each. In one embodiment, the two miR binding sites are positioned approximately 40 bases apart and the total length of the 3 'UTR is approximately 100-110 bases.

Proteins of Interest

The mRNAs of the disclosure can encode a protein of interest, typically a protein that has therapeutic properties for use in a subject. The protein of interest can be essentially any protein that can be encoded by the mRNA. In particular, a protein of interest may be one that stimulates the activation of immune cells (for example, the activation of B cells), such as eliciting a response of anti-drug antibodies (ADA) in a subject and, consequently, reducing or inhibiting immune cell activation (eg, reducing the ADA response) in the subject is desirable. In various embodiments, the protein of interest can be, for example, a therapeutic protein, a cytokine, a growth factor, an antibody, or a fusion protein. Non-limiting examples of therapeutic proteins include, for example, blood factors (such as Factor VIII and Factor VII), complement factors, the low-density lipoprotein receptor (LDLR), and MUT1. Non-limiting examples of cytokines include, for example, interleukins, interferons, chemokines, lymphokines, and the like. Non-limiting examples of growth factors include erythropoietin, EGF, PDGF, FGF, TGF, IGF, TNF, CSF, MCSF, GMCSF, and the like. Non-limiting examples of antibodies include, for example, adalimumab, infliximab, rituximab, ipilimumab, tocilizumab, canakinumab, itolizumab, tralokinumab. Non-limiting examples of fusion proteins include, for example, etanercept, abatacept, and belatacept.

In one embodiment, the protein of interest is human erythropoietin. In one embodiment, the mRNA encodes human erythropoietin and comprises a microRNA binding site that binds-142-3p, such as mRNA having the sequence shown in SEQ ID NO: 1. In another embodiment, the mRNA encodes human erythropoietin and comprises a microRNA binding site that binds to miR-126, such as mRNA having the sequence shown in SEQ ID NO: 28. In yet another embodiment, the mRNA encodes human erythropoietin and comprises a site binding site of microRNA that binds a miR-142-3p and a microRNA binding site that binds a miR-126 such as mRNA having the sequence shown in SEQ ID NO: 29. In another embodiment, the protein of Of interest is LDLR (for use in cholesterol inhibition). In another embodiment, the protein of interest is MUT1 (for use in the treatment of methylmalonic acidemia (MMA)). In still other embodiments, the protein of interest encoded by the mmRNA is a therapeutic antibody, including, but not limited to, the antibodies listed above.

Nanoparticles

The mRNAs of the disclosure can be formulated into nanoparticles or other delivery vehicles, for example, to protect them from degradation when administered to a subject. Illustrative nanoparticles are described in Panyam, J. & Labhasetwar, V. (2003) Adv. Drug Deliv. Rev. 55, 329-347 and Peer, D. et al. (2007) Nature Nanotech. 2, 751-760. In certain embodiments, an RNA, eg, mRNA, of the disclosure is encapsulated within a nanoparticle. In particular embodiments, a nanoparticle is a particle that has at least one dimension (for example, a diameter) less than or equal to 1000 nM, less than or equal to 500 nM, or less than or equal to 100 nM. In particular embodiments, a nanoparticle includes a lipid. Lipid nanoparticles include, but are not limited to, liposomes and micelles. Any of a number of lipids may be present, including cationic and / or ionizable, anionic, neutral lipids, amphipathic, PEGylated, and / or structural lipids. Such lipids can be used alone or in combination. In particular embodiments, a lipid nanoparticle comprises one or more RNAs, for example, mRNAs, described in this invention, for example, a mmRNA that encodes a polypeptide of interest and that comprises at least one microRNA binding site for a miR expressed in immune cells.

In some embodiments, the lipid nanoparticle formulations of the mRNAs described in this invention may include one or more cationic and / or ionizable lipids (eg, 1, 2, 3, 4, 5, 6, 7, or 8). Such cationic lipids include, but are not limited to, 3- (didodecylamino) -N1, N1,4-tridodecyl-1-piperazineethanamine (KL10), N1- [2- (didodecylamino) ethyl] -N1, N4, N4-tridodecyl-1, 4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraazaoctatriacontane (KL25), 1,2-dilinoleyloxy-N, N-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4 -dimethylaminomethyl- [1,3] -dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4- (dimethylamino) butanoate (DLin-MC3-DMA), 2,2 dilinoleyl-4- (2-dimethylaminoethyl) - [1,3] -dioxolane (DLin-KC2-DMA), 2 - ({8 - [(3p) -cholest-5-en-3-yloxy] octyl} oxy) -N, N-dimethyl-3 - [(9Z, 12Z) -octadeca-9,12-dien-1-yloxy] propan-1-amine (Octyl-cLinDMA), (2R) -2 - ({8- [ (3p) -cholest-5-en-3-yloxy] octyl} oxy) -N, N-dimethyl-3 - [(9Z, 12Z) -octadeca-9,12-dien-1-yloxy] propan-1- amine (Octyl-CLinDMA (2R)), (2S) -2 - ({8 - [(3p) -cholest-5-en-3-yloxy] octyl} oxy) -N, N-dimethyl-3 - [( 9Z, 12Z) -octadeca-9,12-dien-1-yloxy] propan-1-amine (Octyl-CLinDMA (2S)). N, N-dioleyl-N, N-dimethylammonium chloride ("dOdAC"); N- (2,3-dioleyloxy) propyl-N, N-N-triethylammonium chloride ("DoTmA"); N, N-distearyl-N, N-dimethylammonium bromide ("DDAB"); N- (2,3-dioleoyloxy) propyl) -N, N, N-trimethylammonium chloride ("DOTAP"); 1,2-Dioleyloxy-3-trimethylaminopropane chloride salt ("DOTAp.Cl"); 3-p- (N - (N ', N'-dimethylaminoethane) -carbamoyl) cholesterol ("DC-Chol"), N- (1- (2,3-dioleyloxy) propyl) -N-2- (sperminecarboxamido ) Ethyl) -N, N-dimethyltrifluoroammonium acetate ("DOSPA"), dioctadecylamidoglycyl carboxyspermine ("DOGS"), 1,2-dioleoyl-3-dimethylammonium propane ("DODAP"), N, N-dimethyl-2,3 -dioleyloxy) propylamine ("DODMA"), and N- (1,2-dimyristyloxypropyl-3-yl) -N, N-dimethyl-N-hydroxyethyl ammonium bromide ("DMRIE"). In addition, a number of commercial cationic lipid preparations can be used, such as, for example, LIPOFECTIN® (including DOTMA and DOPE, available from GIBCO / BRL); and LIPOFECTAMINE® (including DOSPA and DOPE, available from GIBCO / BRL). KL10, KL22 and KL25 are described, for example, in US Patent No. 8,691,750. In particular embodiments, the cationic or ionizable lipid is DLin-MC3-DMA or DLin-KC2-DMA.

Suitable anionic lipids for use in lipid nanoparticles of the disclosure include, but are not limited to, phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoyl phosphatidylethanolamine, N-succinyl phosphatidylethanolamine, N-glutatholphostarylphosphylloxy-linked modifiers, N-glutathiolethanolamine modifiers, and other lipidyl phosphate groups. neutral.

Neutral lipids suitable for use in the lipid nanoparticles of the disclosure include, but are not limited to, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, dihydrosphingomyelin, cephalin, and cerebrosides. Lipids having a variety of acyl chain groups of varying chain length and degree of saturation are available or can be isolated or synthesized by well known techniques. In addition, lipids having mixtures of saturated and unsaturated fatty acid chains can be used. In some embodiments, the neutral lipids used in the description are DOPE, DSPC, DPPC, POPC, or any related phosphatidylcholine. In some embodiments, the neutral lipid can be composed of sphingomyelin, dihydrosphingomilin, or phospholipids with other major groups, such as serine and inositol.

In some embodiments, the amphipathic lipids are included in nanoparticles of the disclosure. Examples of amphipathic lipids suitable for use in nanoparticles of the disclosure include, but are not limited to, sphingolipids, phospholipids, and aminolipids. In some embodiments, a phospholipid is selected from the group consisting of 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycerophosphocholine (DMPC), 1,2-dioleoyl -sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2- diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18: 0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycerol - 3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-Dipitanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2 -dilinolenoyl-sn-glycero-3-phosphoet anolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-snglycero-3-phospho-rac- (1-glycerol) salt sodium (DOPG) and sphingomyelin. Other compounds lacking phosphorus, such as sphingolipids, glycosphingolipid families, diacylglycerols, and p-acyloxyacids, are also found within the group of amphipathic lipids. Additionally, such amphipathic lipids can be easily mixed with other lipids, which include triglycerides and sterols.

In some embodiments, the lipid component of a nanoparticle of the disclosure may include one or more PEGylated lipids. A PEGylated lipid (also known as a PEG lipid or a PEG-modified lipid) is a polyethylene glycol-modified lipid. The lipid component can include one or more PEGylated lipids. A PEGylated lipid can be selected from the non-limiting group consisting of PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, and PEG-modified dialkylglycerols. For example, a PEGylated lipid can be a PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

A lipid nanoparticle of the disclosure can include one or more structural lipids. Examples of non-limiting structural lipids that may be present in the lipid nanoparticles of the disclosure include cholesterol, fecosterol, sitosterol, campesterol, stigmasterol, brassicasterol, ergosterol, tomatidine, tomatine, ursolic acid, or alpha-tocopherol).

In some embodiments, one or more mRNAs of the disclosure may be formulated into a lipid nanoparticle having a diameter of from about 1 to about 900 nm, for example, about 1 to about 100 nm, about 1 to about 200 nm, about 1 to about 300 nm, about 1 to about 400 nm, about 1 to about 500 nm, about 1 to about 600 nm, about 1 to about 700 nm, about 1 to 800 nm, about 1 to about 900 nm. In some embodiments, the nanoparticle may have a diameter of about 10 to about 300 nm, about 20 to about 200 nm, about 30 to about 100 nm, or about 40 to about 80 nm. In some embodiments, the nanoparticle may have a diameter of about 30 to about 300 nm, about 40 to about 200 nm, about 50 to about 150 nm, about 70 to about 110 nm, or about 80 to about 120 nm. In one embodiment, an mRNA may be formulated into a lipid nanoparticle with a diameter of about 10 to about 100 nm, including ranges in between such as, but not limited to, about 10 to about 20 nm, about 10 to about 30 nm, around 10 to around 40 nm, around 10 to around 50 nm, around 10 to around 60 nm, around 10 to around 70 nm, around 10 to around 80 nm, around 10 at around 90 nm, around 20 at around 30 nm, around 20 to around 40 nm, around 20 to around 50 nm, around 20 to around 60 nm, around 20 to around 70 nm, around 20 to around 80 nm , around 20 to around 90 nm, around 20 to around 100 nm, around 30 to around 40 nm, around 30 to around 50 nm, around 30 to around 60 nm, around 30 to around 70nm, around 30 to around 80nm, around 30 to around 90nm, around 30 to around 100nm, around 40 to around 50nm, around 40 to around 60nm, around 40 to around 70 nm, around 40 to around 80 nm, around 40 to around 90 nm, around 40 to around 100 nm, around 50 to around 60 nm, around 50 to around 70 nm, around 50 to around 80 nm, around 50 to around 90 nm, around 50 to around 100 nm, around 60 to around dor 70nm, around 60 to around 80nm, around 60 to around 90nm, around 60 to around 100nm, around 70 to around 80nm, around 70 to around 90nm, around 70 to around 100 nm, around 80 to around 90 nm, around 80 to around 100 nm and / or around 90 to around 100 nm. In one embodiment, an mRNA can be formulated into a lipid nanoparticle with a diameter of from about 30 to about 300 nm, about 40 to about 200 nm, about 50 to about 150 nm, about 70 to about 110 nm, or about 80 to about 120 nm, including intervals in between.

In some embodiments, a lipid nanoparticle may have a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm. , greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm or greater than 950 nm .

In some embodiments, the particle size of the lipid nanoparticle can be increased and / or decreased. The change in particle size can help to counteract a biological reaction such as, inter alia, inflammation, or it can increase the biological effect of the mRNA, administered to a patient or subject.

In certain embodiments, it is desirable to target a nanoparticle, eg, a lipid nanoparticle, of the disclosure using a target structure that is specific for a cell type and / or tissue type. In some embodiments, a nanoparticle can be targeted to a particular cell, tissue, and / or organ using a target structure. In particular embodiments, a nanoparticle comprises one or more of the mRNAs described in this invention and a target structure. Exemplary non-limiting target structures include ligands, cell surface receptors, glycoproteins, vitamins (eg, riboflavin), and antibodies (eg, full-length antibodies, antibody fragments (eg, Fv fragments, single-chain Fv fragments). (scFv), Fab 'fragments) or F (ab') 2 fragments), single domain antibodies, camelid antibodies and their fragments, human antibodies and their fragments, monoclonal antibodies and multispecific antibodies (eg bispecific antibodies)). In some embodiments, the target structure can be a polypeptide. The target structure can include the entire polypeptide (eg, a peptide or protein) or fragments thereof. A target structure is typically placed on the outer surface of the nanoparticle such that the target structure is available for interaction with the target, eg, a cell surface receptor. A variety of different targeting moieties and procedures are known and available in the art, including those described, for example, in Sapra et al., Prog. Lipid Res. 42 (5): 439-62, 2003 and Abra et al. ., J. Liposome Res. 12: 1-3, 2002.

In some embodiments, a lipid nanoparticle (eg, a liposome) can include a surface coating of hydrophilic polymer chains, such as polyethylene glycol (PEG) chains (see, eg, Allen et al., Biochimica et Biophysica Acta 1237: 99 -108, 1995; DeFrees et al., Journal of the American Chemistry Society 118: 6101-6104, 1996; Blume et al., Biochimica et Biophysica Acta 1149: 180-184, 1993; Klibanov et al., Journal of Liposome Research 2: 321-334, 1992; US Patent No. 5,013,556; Zalipsky, Bioconjugate Chemistry 4: 296-299, 1993; Zalipsky, FEBS Letters 353: 71-74, 1994; Zalipsky, in Stealth Liposomes Chapter 9 (Lasic and Martin, Ed.) CRC Press, Boca Raton Fla., 1995. In one strategy, a target structure for targeting the lipid nanoparticle is linked to the polar head group of lipids that make up the nanoparticle. In another strategy, the target structure is attached to the distal ends of the PEG chains that form the coating hydrophilic polymer to (see, for example, Klibanov et al., Journal of Liposome Research 2: 321-334, 1992; Kirpotin et al., FEBS Letters 388: 115-118, 1996).

Standard procedures can be used to couple the target framework (s). For example, phosphatidylethanolamine, which can be activated for binding of target structures, or derived lipophilic compounds, such as lipid-derived bleomycin, can be used. Antibody-directed liposomes can be constructed using, for example, liposomes incorporating protein A (see, for example, Renneisen et al., J. Bio. Chem., 265: 16337-16342, 1990 and Leonetti et al., Proc. Natl. Acad. Sci. (USA), 87: 2448-2451, 1990). Other examples of conjugation of antibodies are described in US Patent 6,027,726. Examples of target structures can also include other polypeptides that are specific for cellular components, including antigens associated with neoplasms or tumors. Polypeptides used as target structures can be attached to liposomes by covalent bonds (see, for example, Heath, Covalent Attachment of Proteins to Liposomes, 149 Methods in Enzymology 111-119 (Academic Press, Inc. 1987)). Other targeting methods include the biotin-avidin system.

In some embodiments, a lipid nanoparticle of the disclosure includes a target structure that directs the lipid nanoparticle to a cell that includes, but is not limited to, hepatocytes, colon cells, epithelial cells, hematopoietic cells, epithelial cells, endothelial cells, lung cells, bone cells. , stem cells, mesenchymal cells, neural cells, cardiac cells, adipocytes, vascular smooth muscle cells, cardiomyocytes, skeletal muscle cells, beta cells, pituitary cells, synovial lining cells, ovarian cells, testicular cells, fibroblasts, B cells, T cells, reticulocytes, leukocytes, granulocytes, and tumor cells (including primary tumor cells and metastatic tumor cells). In particular embodiments, the target structure directs the lipid nanoparticle to a hepatocyte. In other embodiments, the target structure directs the lipid nanoparticle to a colon cell. In some embodiments, the target structure directs the lipid nanoparticle to a liver cancer cell (eg, a hepatocellular carcinoma cell) or a colorectal cancer cell (eg, a primary tumor or metastasis).

Pharmaceutical compositions

The present description includes pharmaceutical compositions comprising an mRNA or a nanoparticle (eg, a lipid nanoparticle) described (a) in this invention, in combination with one or more pharmaceutically acceptable carriers, excipients or diluents. In particular embodiments, the mRNA is present in a nanoparticle, for example, a lipid nanoparticle. In particular embodiments, the mRNA or nanoparticle is present in a pharmaceutical composition. In various embodiments, the mRNA, present in the pharmaceutical composition, is encapsulated in a nanoparticle, eg, a lipid nanoparticle.

The pharmaceutical compositions can optionally include one or more additional active substances, for example, therapeutically and / or prophylactically active substances. The pharmaceutical compositions of the present disclosure can be sterile and / or pyrogen-free. General considerations of the formulation and / or manufacture of pharmaceutical agents can be found, for example, in Remington: The Science and Practice of Pharmacy, 21st edition, Lippincott Williams & Wilkins, 2005. In particular embodiments, a pharmaceutical composition comprises an mRNA and a lipid nanoparticle, or complexes thereof.

The formulations of the pharmaceutical compositions described in this invention can be prepared by any method known or further developed in the art of pharmacology. In general, such methods of preparation include the step of associating the active ingredient with an excipient and / or one or more accessory ingredients and then, if necessary and / or desirable, dividing, forming and / or packaging the product into a desired single dose or multiple dose set.

The relative amounts of the active ingredient, the pharmaceutically acceptable excipient and / or any additional ingredient in a pharmaceutical composition according to the invention will vary according to the identity, size and / or condition of the subject treated and further according to the route of administration of the composition. . By way of example, the composition may comprise between 0.1 and 100%, for example between 0.5 and 70%, between 1 and 30%, between 5 and 80% or at least 80% (w / w) of active ingredient. In some embodiments, the active agent is an mRNA encoding a protein of interest and at least one microRNA binding site for a miR expressed in immune cells, such as a miR-142-3p binding site.

The mRNAs of the disclosure can be formulated using one or more excipients to: (1) increase stability, (2) increase transfection of cells; (3) allow sustained or delayed release (eg, from a depot formulation of the mRNA); (4) alter biodistribution (eg, targeting mRNA to specific tissues or cell types); (5) increase the translation of a polypeptide encoded by mmRNA in vivo; and / or (6) altering the release profile of an mRNA-encoded polypeptide in vivo. In addition to traditional excipients, such as any solvents, dispersion media, diluents or other liquid vehicles, dispersion or suspension aids, surface-active agents, isotonic agents, thickening or emulsifying agents, preservatives, excipients may include, but are not limited to, lipidoids, liposomes, lipid nanoparticles (eg, liposomes and micelles), polymers, lipoplexes, capsid nanoparticles, peptides, proteins, carbohydrates, cells transfected with mRNA vaccines (eg, for transplantation into a subject), hyaluronidase, nanoparticle mimetics, and combinations thereof. Accordingly, the formulations of the description may include one or more excipients, each in an amount that, taken together, increases mRNA stability, increases cellular transfection by mRNA, increases expression of a polypeptide encoded by mRNA, and / or alters the release profile of a polypeptide encoded with MRNA. Furthermore, the mRNAs of the present disclosure can be formulated using self-assembled nucleic acid nanoparticles.

Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, MD, 2006). Except insofar as some conventional excipient medium is not compatible with a substance or its derivatives, such as in the production of an undesired biological effect or, otherwise, in the harmful interaction with any other component or components of the pharmaceutical composition, its use is intended to be within the scope of the present invention. Excipients may include, for example: release agents, antioxidants, binders, coatings, compression aids, disintegrants, colorants (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, glidants (flow enhancers), lubricants , preservatives, printing. inks, sorbents, suspending or dispersing agents, sweeteners and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, cross-linked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropylcellulose, hydroxypropylcellulose, hydroxypropylcellulose, hydroxypropylcellulose, , magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, povidone, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium carboxymethyl starch sodium, sorbitol, (corn) starch, stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

In some embodiments, the formulations described in this invention may include at least one pharmaceutically acceptable salt. Examples of pharmaceutically acceptable salts that may be included in a formulation of the disclosure include, but are not limited to, acid addition salts, alkaline earth metal salts, mineral or organic acid salts of basic residues such as amines; alkaline or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include salts of acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, fumarate, glucocero sulfate, fumarate, glucocerophosphate, , heptanoate, hexanoate, hydroxybromide, hydroxychloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate , pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium, quaternary ammonium, and amine cations, including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like.

In some embodiments, the formulations described in this invention may contain at least one type of polynucleotide. As a non-limiting example, the formulations may contain 1, 2, 3, 4, 5, or more than 5 mRNAs described in this invention.

Liquid dosage forms for parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and / or elixirs. In addition to active ingredients, liquid dosage forms may comprise inert diluents that are commonly used in the art, such as, for example, water or other solvents, solubilizing and emulsifying agents, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, Ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed oil, peanut, corn, germ, olive, castor and sesame), glycerol, tetrahydrofurfuryl alcohol , polyethylene glycols and sorbitan fatty acid esters and mixtures thereof. In addition to inert diluents, oral compositions can include adjuvants such as wetting, emulsifying, and / or suspending agents. In certain embodiments for parenteral administration, the compositions are mixed with solubilizing agents such as CREMOPHOR®, alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and / or combinations thereof.

It is possible to formulate injectable preparations, for example sterile aqueous injectable suspensions or oleaginous suspensions, according to the known art, using suitable dispersing agents, wetting agents and / or suspending agents. Sterile injectable preparations may be sterile injectable solutions, suspensions and / or emulsions in non-toxic parenterally acceptable diluents and / or solvents, for example, a solution in 1,3-butanediol. Among the acceptable solvents and vehicles that may be employed are water, Ringer's solution, USP, and isotonic sodium chloride solution. Sterile non-volatile oils are conventionally employed as a solvent or suspending medium. For this purpose, any tasteless non-volatile oil can be used, including synthetic mono- or diglycerides. Fatty acids such as oleic acid can also be used in the preparation of injections. Injectable formulations can be sterilized, for example, by filtration through a bacteria retention filter and / or by incorporation of sterilizing agents in the form of sterile solid compositions that can be dissolved or dispersed in sterile water or other sterile injectable medium prior to its use.

In some embodiments, pharmaceutical compositions that include at least one mRNA described in this invention are administered to mammals (eg, humans). Although the descriptions of the pharmaceutical compositions provided in this invention are directed primarily to pharmaceutical compositions that are suitable for administration to humans, the skilled person will understand that such compositions are generally suitable for administration to any other animal, for example, to a non-human mammal. Modification of pharmaceutical compositions suitable for administration to humans to render the compositions suitable for administration to various animals is well understood, and the normally trained veterinary pharmacist can design and / or effect such modification with experimentation simply. ordinary, if any. Subjects for whom administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and / or primates; mammals, including commercially relevant mammals, such as cattle, pigs, horses, sheep, cats, dogs, mice and / or rats; and / or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys. In particular embodiments, a subject is provided with two or more mRNAs described in this invention, for example, a first mRNA encoding a first polypeptide of interest and comprising at least one microRNA binding site for a miR expressed in immune cells and a second mRNA encoding a second polypeptide of interest and comprising at least one microRNA binding site for a miR expressed in immune cells. In particular embodiments, the first and second mmRNA are provided to the subject at the same time or at different times, eg, sequentially. In particular embodiments, the first and second mRNAs are provided to the subject in the same pharmaceutical composition or formulation, for example, to facilitate uptake of both mRNAs by the same cells.

Inhibition of immune cell activation and cytokine production

The methods of the disclosure allow to reduce or inhibit unwanted immune cell activation and / or unwanted cytokine production in a subject being treated with an mRNA-based therapeutic agent, such as unwanted immune cell activation and / or the production of cytokines that is stimulated by a polypeptide of interest (eg, a therapeutic agent) encoded by the mRNA-based therapeutic agent, by including at least one miR-126 (eg, miR-126-3p ) and / or a miR-142 binding site (eg, miR-142-3p) in the mRNA construct. In one embodiment, the immune cell activation is lymphocyte activation. In one embodiment, the immune cell activation is the B cell activation. In another embodiment, the immune cell activation is the T cell activation. In still other embodiments, the immune cell activation is the macrophage activation, the dendritic cell activation, NK cell activation, basophil activation or eosinophil activation.

In one embodiment, the reduction or inhibition of unwanted immune cell activation is determined compared to control administration of mmRNA, which lacks the at least one miR-126 or miR-142 microRNA binding site. In various embodiments, immune cell activation decreases by at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, at least about 60, 70, 80, 5 to 50, 10 to 50, 15 to 50, 20 to 50, 25 to 50, around 10 to 80, around 10 to 70, around 10 to 60, around 20-80, around 20-70, around 20-60, around 20-40, or between about 25-75%.

The level of immune cell activation can be assessed by essentially any method established in the art to assess immune cell activation, such as the frequency of a population of activated immune cells, typically assessed by detecting cells expressing activation markers. cell surface, or production levels of one or more cytokines indicative of immune cell activation. In one embodiment, immune cell activation is B cell activation, where the level of B cell activation is determined by measuring the frequency of activated B cells, such as the frequency of activated B cells among the population of splenic B cells. B cell surface markers indicative of B cell activation are well known in the art (see, for example, Maddalay, R. et al. (2010) FEBS Letters 584: 4883-4894). In one embodiment, B cell activation is determined by the frequency of CD19 + CD86 + CD69 + B cells. In another embodiment, immune cell activation is B cell activation, where the level of B cell activation is determined by cytokine secretion, such as interleukin-6 (IL-6) secretion, the tumor necrosis factor a (TNF-a) or interferon-Y (IFN-y), for example, in the serum of treated subjects. In one embodiment, B cell activation is determined by IL-6 secretion, for example, in the serum of treated subjects. In other embodiments, the unwanted cytokine production that is reduced or inhibited is the production of interleukin-6 (IL-6), tumor necrosis factor a (TNF-a), or interferon-Y (IFN-y), for example, in the serum of treated subjects. In another embodiment, the unwanted cytokine production that is reduced or inhibited is the production of interleukin-6 (IL-6).

In one embodiment, the activation of immune cells is the activation of plasmacytoid dendritic cells (pDC), where the level of activation of pDC is determined by measuring the frequency of activated pDC, such as the frequency of activated pDC among the population of pDC. splenic. Activation-indicative pDC surface markers are well known in the art (see, for example, Dzionek, A., et al., (2002) Hum Immunol. Vol.

63 (12): 1133-48). In one embodiment, the activation of pDC is determined by the frequency of the CD11c + CD70 + CD86 + cells.

In one embodiment, unwanted immune cell activation and / or unwanted cytokine production is decreased without a corresponding decrease in expression of a polypeptide of interest encoded by mmRNA. Accordingly, the methods of the disclosure make it possible to inhibit or reduce immune cell activation (eg, B cell activation, cytokine production) in a subject treated with an mRNA encoding a polypeptide of interest that is a therapeutic agent. without significantly affecting the expression level of the therapeutic agent in the subject.

A standard metric that can be used in the methods of the disclosure is the measure of the ratio of the level or amount of encoded polypeptide (protein) produced in a cell, tissue, or organism to the level or amount of one or more (or a panel) of cytokines whose expression is triggered in the cell, tissue or organism as a result of administration or contact with the chemically modified mRNA. Said ratios are referred to in this invention as the Protein: Cytokine Ratio or "PC" Ratio. The higher the PC ratio, the more effective the chemically modified mRNA (the polynucleotide encoding the measured protein) will be. The preferred PC ratios, per cytokine, of the present disclosure can be greater than 1, greater than 10, greater than 100, greater than 1000, greater than 10,000 or more. Modified mRNAs having higher CP ratios are preferred than a modified mRNA of a different or unmodified construct.

The proportion of PC can be further qualified by the percentage of modification present in the mRNA. For example, with normalization to 100% modified mRNA, protein production can be determined as a function of the cytokine (or risk) or the cytokine profile.

In one embodiment, the present disclosure provides a method of determining, through chemical analysis, cytokines or percent modification, the relative efficiency of any particular modified mRNA comprising at least one miR-126 binding site and / or a miR-142 binding site for the PC ratio of the modified mRNA including the miR-126 binding site and / or the miR-142 binding site for the PC ratio of the same construct without the binding site of miR-126 and / or the miR-142 binding site.

In one embodiment, the level of expression of a polypeptide of interest encoded by mmRNA in the serum of a mammal (eg, human) may be at least 50 pg / ml at least two hours after administration. In another embodiment, the level of expression of a polypeptide of interest encoded by mmRNA in the serum of a mammal (eg, human) may remain above 50 pg / nl for at least 72 hours after administration. In another embodiment, the level of expression of a polypeptide of interest encoded by mmRNA in the serum of a mammal (eg, human) may remain above 60 pg / nl for at least 72 hours after administration.

Inhibition of Bla cells / Inhibition of accelerated blood clearance

The spleen has previously been implicated in ABC, although the precise mechanisms responsible for ABC have not previously been understood. The spleen is made up of red pulp (rich in red blood cells), white pulp (rich in lymphocytes), and the marginal zone (located between the red and white pulp and outside the marginal sinus). Antigens that enter the spleen are retained in the marginal zone, where blood flow is reduced to allow interaction between antigens and immune effector cells (eg, B cells) (Harms et al., Infect. Immuno Vol. 64: 4220-4225, 1996). The role of the spleen in accelerated blood clearance is believed to be significant. Biodistribution data demonstrate that lipid-comprising compounds or compositions ( eg, LNP) they are absorbed by the spleen (data not shown). Histological evaluation shows LNP uptake in the marginal zone rapidly after dosing ( eg, IV dosing). Within the spleen, LNPs can interact with splenic B cells, contributing to several elements of the immune response to LNPs. For example, certain components of LNPs ( eg, PEG components) can interact with CD19 B cells in the spleen, resulting in attachment, internalization, membrane fusion, and / or activation of such cells. , resulting in the production of specific IgG and / or IgM molecules for the components of the LNPs, leading to accelerated blood clearance, for example, in a second or subsequent dosing with the LNPs.

Surprisingly, it has also been shown in this invention that some particular cells of the immune system, namely the pDCs, also contribute to the ABC phenomenon. It has been demonstrated in this invention that the inclusion of miR binding sites ( eg, miR-126 binding sites) can lead to the reduction of unwanted immune responses ( eg, ADA) against proteins encoded by the encapsulated mRNAs. in LNP, for example, the modified mRNAs. It has now also surprisingly been shown that the inclusion of miR binding sites, in particular miR-126 binding sites, can lead to the reduction of additional unwanted immune responses against LNPs that encapsulate mRNAs. MiR-126 ( eg, miR-126-3p) is highly expressed in pDCs and, in fact, is upregulated during pDC activation. PDCs synergistically increase B cell activation in response to nucleic acids and other forms of activation through cytokine secretion and plasma cell activation. In addition, "low miR-126-3p" pDCs ( eg, pDCs in which miR-126 has been inactivated or removed) are impaired in activation ( eg, unable to elicit an effective immune response to nucleic acids, secrete IFN-a / p, secrete IL-6, etc., have the inability to migrate to the spleen upon activation and the like). As demonstrated in this invention, the inclusion of miR-126 binding sites in mRNA results in low B cell activation and low serum IL-6 over several weeks of repeated dosing of LNP-encapsulated mRNA. Protein expression is maintained throughout similar dosing schedules. Surprisingly, anti-PEG IgM responses drop dramatically over weeks of repeat dosing. Accordingly, an unexpected benefit of the inclusion of miR-126 binding sites in mRNA, particularly in LNP-encapsulated mRNA, is the reduction of AUC.

In the spleen, for example, in the marginal zone of the spleen, some of these key immune cells may interact directly or indirectly, for example, as a result of the production of cytokines (eg, IL-6).

Without wishing to be bound by theory, this description provides evidence that miRs expressed in immune cells present in the marginal zone participate in accelerated blood clearance. When an mRNA of the disclosure includes one or more miR binding sites that bind to one or more miR expressed in immune cells, the miR of interest is down-regulated (eg, antagonized and / or degraded). Inclusion of at least one miR binding site that binds to at least one miR expressed in immune cells results in decreased production of IgM molecules capable of binding lipid components (e.g., PEG lipids), compared to the mRNA without the at least one miR binding site. Given the known role of IgM molecules in accelerated blood clearance, the ability of a miR binding site that binds to a miR expressed in immune cells to inhibit or reduce the production of IgM molecules indicates an important role. of miRs expressed in immune cells, specifically in the marginal zone of the spleen, in accelerated blood clearance.

The methods of the description make it possible to reduce or inhibit accelerated blood clearance in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more nucleobases modified, such that accelerated blood clearance is reduced or inhibited in the subject after repeated administration.

In other embodiments, accelerated blood clearance is reduced or inhibited in a subject administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), by administration to the subject intravenously. a first dose of a chemically modified mRNA encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more nucleobases modified; and administering to the subject intravenously a second dose of a chemically modified mRNA encapsulated in a LNP, such that accelerated blood clearance is reduced or inhibited in the subject.

In some embodiments, accelerated blood clearance is reduced or inhibited in a subject administered multiple doses of a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), by administration to the subject of a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that accelerated blood clearance is reduced or inhibited in the subject after administration of one or more subsequent doses.

In other embodiments, accelerated blood clearance is reduced or inhibited in a subject administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a nanoparticle.

lipid (LNP), by administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in cells immune, and where the chemically modified mRNA comprises one or more modified nucleobases, such that accelerated blood clearance is reduced or inhibited in the subject after administration of a subsequent dose of mRNA.

In additional embodiments, accelerated blood clearance is reduced or inhibited in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), by administration to the subject. a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune c, where the chemically modified mRNA comprises one or more modified nucleobases, and where the

LNP does not activate B cells and / or does not induce the production of IgM molecules capable of binding to LNP, such that accelerated blood clearance is reduced or inhibited in the subject after repeated administration.

In additional embodiments, accelerated blood clearance is reduced or inhibited in a subject administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a nanoparticle.

lipid (LNP), by intravenously administering to the subject a first dose of a chemically modified mRNA encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in c immune, and where the chemically modified mRNA comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of a chemically modified mRNA encapsulated in a

LNP, where LNP does not activate B cells and / or does not induce the production of IgM molecules capable of binding LNP, such that accelerated blood clearance is reduced or inhibited in the subject.

In other embodiments, accelerated blood clearance is reduced or inhibited in a subject administered multiple doses of a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), by administration to the subject. a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, where the chemically modified mRNA comprises one or more modified nucleobases, and where the

LNP does not activate B cells and / or does not induce the production of IgM molecules capable of binding to LNP, such that accelerated blood clearance is reduced or inhibited in the subject after administration of one or more subsequent doses.

In some embodiments, accelerated blood clearance is reduced or inhibited in a subject administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), by administering a modified mRNA to the subject. chemically encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, where the chemically modified mRNA comprises one or more modified nucleobases, and where LNP does not activate B cells and / or does not induce

the production of IgM molecules capable of binding to LNP, such that accelerated blood clearance is reduced or inhibited in the subject after administration of a subsequent dose of mRNA.

In some embodiments, the disclosure provides a method of reducing or inhibiting the production of IgM molecules that recognize polyethylene glycol (PEG) in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding the polypeptide of interest. encapsulated in a lipid nanoparticle

(LNP), by administering to the subject a chemically modified mRNA that encodes the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that the production of IgM molecules that recognize PEG is reduced or inhibited in the subject after repeated administration.

In some embodiments, the production of IgM molecules that recognize polyethylene glycol (PEG) is reduced or inhibited in a subject administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP). , by intravenously administering to the subject a first dose of a chemically modified mRNA encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of a chemically modified mRNA encapsulated in an LNP, such that the production of IgM molecules that recognize PEG is reduced or inhibited in the subject.

In some embodiments, the production of IgM molecules that recognize polyethylene glycol (PEG) is reduced or inhibited in a subject who has been administered multiple doses of a messenger RNA (mRNA) encoding the polypeptide of interest encapsulated in a lipid nanoparticle. (LNP), by administering to the subject a chemically modified mRNA that encodes the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that the production of IgM molecules that recognize PEG is reduced or inhibited in the subject after administration of one or more subsequent doses.

In other embodiments, the production of IgM molecules that recognize polyethylene glycol (PEG) is reduced or inhibited in a subject who has been administered a messenger RNA (mRNA) that encodes the polypeptide of interest encapsulated in a lipid nanoparticle (LNP). , by administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the Chemically modified mRNA comprises one or more modified nucleobases, such that the production of IgM molecules that recognize PEG is reduced or inhibited in the subject after administration of a subsequent dose of mRNA.

In additional embodiments, the disclosure provides a method of reducing or inhibiting B1a cell activation in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP). ), by administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that activation of B1a cells is reduced or inhibited in the subject after repeated administration.

In some embodiments, activation of B1a cells is reduced or inhibited in a subject administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), by administering to the subject of intravenously a first dose of a chemically modified mRNA encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more more modified nucleobases; and administering to the subject intravenously a second dose of a chemically modified mRNA encapsulated in an LNP, such that activation of B1a cells is reduced or inhibited in the subject.

In other embodiments, B1a cell activation is reduced or inhibited in a subject administered multiple doses of a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), by administration to the subject of a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the modified mRNA chemically it comprises one or more modified nucleobases, such that activation of B1a cells is reduced or inhibited in the subject after the administration of one or more subsequent doses.

In some embodiments, B1a cell activation is reduced or inhibited in a subject administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), by administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that B1a cell activation is reduced or inhibited in the subject after administration of a subsequent dose of mRNA.

In further embodiments, the disclosure provides a method of reducing or inhibiting plasmacytoid dendritic cell activation in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle ( LNP), by administering to the subject a chemically modified mRNA that encodes the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that plasmacytoid dendritic cell activation is reduced or inhibited in the subject after repeated administration.

In some embodiments, plasmacytoid dendritic cell activation is reduced or inhibited in a subject administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), by administration to the subject. intravenously a first dose of a chemically modified mRNA encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises a or more modified nucleobases; and administering to the subject intravenously a second dose of a chemically modified mRNA encapsulated in an LNP, such that the activation of plasmacytoid dendritic cells is reduced or inhibited in the subject.

In some embodiments, plasmacytoid dendritic cell activation is reduced or inhibited in a subject administered multiple doses of a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), by administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the mRNA Chemically modified comprises one or more modified nucleobases, such that the activation of plasmacytoid dendritic cells is reduced or inhibited in the subject after the administration of one or more subsequent doses.

In some embodiments, plasmacytoid dendritic cell activation is reduced or inhibited in a subject administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), by administration to the subject. of a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises a or more modified nucleobases, such that plasmacytoid dendritic cell activation is reduced or inhibited in the subject after administration of a subsequent dose of mRNA.

In additional embodiments, the mRNA encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP) does not activate B cells and / or does not include the production of IgM molecules capable of binding to LNP. In some embodiments, the mRNA encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP) does not activate B cells. In other embodiments, the mRNA encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP) does not include the production of IgM molecules capable of binding to LNP.

In some embodiments, the reduction or inhibition of accelerated blood clearance is determined compared to the control administration of a chemically modified mRNA, which lacks the at least one microRNA binding site encapsulated in a lipid nanoparticle (LNP). In other embodiments, accelerated blood clearance is reduced or inhibited without a corresponding reduction or inhibition in the expression of the polypeptide of interest encoded by the chemically modified mRNA.

In further embodiments, where the interval between two consecutive doses is less than 2 weeks. In some embodiments, the interval between two consecutive doses is less than 1 week.

In some embodiments, the IgM molecules recognize polyethylene glycol (PEG).

Procedures of the invention

In one aspect, the description relates to a method for reducing or inhibiting an anti-drug antibody response in a subject, comprising administering to the subject a modified messenger RNA (mmRNA) encoding a polypeptide of interest, wherein the mmRNA comprises at least one microRNA binding site for a miR expressed in immune cells (for example, miR-142-3p and / or miR-126-3p), and where the mmRNA comprises one or more modified nucleobases, such that it is reduced or inhibited an anti-drug antibody response to the polypeptide of interest in the subject. As described above, in various embodiments, the mmRNA may comprise, for example, two or more, 1-4, one, two, three, or four binding sites for one or more miRs expressed in immune cells. In certain embodiments, the mmRNA comprises at least two binding sites for at least two different miRs expressed in immune cells. For example, the mmRNA may comprise a first binding site for miR-142-3p and a second binding site for a different miR expressed in an immune cell, such as miR-155, miR-146 (miR-146-3p and / or miR-146-5p) or miR-126. Alternatively, the mmRNA may comprise a first binding site for miR-126 (e.g., miR-126-3p) and a second binding site for a different miR expressed in an immune cell, such as miR-142 (miR -142-3p and / or miR-142-5p), miR-155 or miR-146 (miR-146-3p and / or miR-146-5p). In one embodiment, the mmRNA comprises a first binding site for miR-142-3p and a second binding site for miR-126.

In related embodiments, the subject receives or is administered a nanoparticle (eg, a lipid nanoparticle) comprising the mmRNA. In further related embodiments, the subject receives or is administered a pharmaceutical composition of the disclosure. In particular embodiments, the pharmaceutical composition comprises a mmRNA encoding a polypeptide of interest and which comprises at least one miR binding site as described in this invention, or comprises a nanoparticle comprising the mmRNA. In particular embodiments, the mmRNA is present in a nanoparticle, for example, a lipid nanoparticle. In particular embodiments, the mmRNA or nanoparticle is present in a pharmaceutical composition.

In one embodiment, the mmRNA is administered intravenously, encapsulated in a lipid nanoparticle. In one embodiment, the mmRNA is administered by infusion once a week (eg, by intravenous infusion, such as through a pump). In one embodiment, the mmRNA is administered by infusion once a week for at least 4 weeks.

In another embodiment, the disclosure provides a method of reducing or inhibiting an anti-drug antibody response after repeated administration of a polypeptide of interest to a subject, comprising intravenously administering to the subject a first dose of a modified mRNA (mmRNA ) that encodes a polypeptide of interest encapsulated in an LNP, where the mmRNA comprises at least one binding site for a miR expressed in immune cells (for example, a miR-142-3p microRNA binding site and / or a miR-126 microRNA binding),

and where the mRNA comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of the mRNA encapsulated in an LNP, such that the anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject.

In another aspect, the disclosure provides a method of reducing or inhibiting an anti-drug antibody response after repeated administration of a polypeptide of interest to a subject, comprising

(i) administering to the subject intravenously a first dose of modified mRNA (mmRNA) encoding a polypeptide of interest, encapsulated in an LNP, where the mmRNA comprises at least one miR microRNA binding site expressed in immune cells (for example , a miR-142-3p microRNA binding site and / or a miR-126 microRNA binding site)

and where the mRNA comprises one or more modified nucleobases;

(ii) detecting a level of anti-drug antibodies in a sample from a subject; Y

(iii) administering to the subject intravenously a second dose of mmRNA encapsulated in an LNP when the level of anti-drug antibodies in the sample decreases, such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject.

Given the ability of the methods of the disclosure to reduce or inhibit the expression of the protein of interest encoded by the mmRNA in the spleen of the subject to which the mmRNA is administered, the disclosure further provides methods to reduce the toxicity of treatments based on MRNA. Consequently, in another Aspect, the disclosure provides a method of reducing or inhibiting drug-related toxicity in a subject, comprising administering to the subject a modified messenger RNA (mmRNA) encoding a polypeptide of interest, wherein the mmRNA comprises at least one binding site. for a miR expressed in immune cells (e.g., a miR-142-3p and / or miR-126 microRNA microRNA binding site) and where the mmRNA comprises one or more modified nucleobases, such that it is reduced or inhibited drug-related toxicity to the polypeptide of interest in the subject. In one embodiment, the drug-related toxicity for the polypeptide of interest is reduced blood counts (cytopenia) in the subject. In one embodiment, the drug-related toxicity for the polypeptide of interest is autoimmunity in the subject. In one embodiment, drug-related toxicity for the polypeptide of interest is complement-mediated effects in the subject. In one embodiment, the drug-related toxicity for the polypeptide of interest is reduced hematopoiesis in the subject. In other embodiments, the drug-related toxicity can be, for example, kidney or liver toxicity.

In another aspect, the disclosure relates to a method of reducing or inhibiting the activation of unwanted immune cells in a subject administered an RNA, for example, a messenger RNA (mRNA), which comprises administering to the subject a RNA, eg, an mRNA (eg, chemically modified mRNA or mmRNA), where the mRNA, eg, chemically modified RNA or mmRNA, comprises at least one miR-126 and / or miR microRNA binding site -142, and where the mRNA, eg, chemically modified mRNA or mmRNA, comprises one or more modified nucleobases, such that activation of unwanted immune cells is reduced or inhibited in the subject. In another aspect, the disclosure relates to a method of reducing or inhibiting the production of unwanted cytokines in a subject administered an RNA, eg, a messenger RNA (mRNA), the method comprising administering an RNA to the subject , for example, an mRNA (eg, chemically modified mRNA or mmRNA), where the mRNA, eg, chemically modified mRNA or mmRNA, comprises at least one miR-126 and / or miR-microRNA binding site 142, and where the mRNA, eg, chemically modified mmRNA, comprises one or more modified nucleobases, such that unwanted cytokine production is reduced or inhibited in the subject.

As described above, in various embodiments, the chemically modified mRNA (referred to as mmRNA) may comprise, for example, two or more, 1 to 4, one, two, three, or four binding sites for one or more miR expressed in immune cells. In certain embodiments, the mmRNA comprises at least two binding sites for at least two different miRs expressed in immune cells. For example, mmRNA may comprise a first binding site for miR-126 and a second binding site for a different miR expressed in an immune cell, such as miR-142 (miR-142-3p and / or miR-142- 5p), miR-155 or miR-146 (miR-146-3p and / or miR-146-5p). Alternatively, the mmRNA may comprise a first binding site for miR-142 (miR-142-3p and / or miR-142-5p) and a second binding site for a different miR expressed in an immune cell, such as miR-126, miR-155 or miR-146 (miR-146-3p and / or miR-146-5p). In one embodiment, the mmRNA comprises a first binding site for miR-142-3p and a second binding site for miR-126.

In certain embodiments, the mRNA encodes a polypeptide of interest (eg, a therapeutic agent), where activation of unwanted immune cells occurs in response to the polypeptide of interest.

In related embodiments, the subject receives or is administered a nanoparticle (eg, a lipid nanoparticle) comprising the mRNA, eg, mmRNA. In further related embodiments, the subject receives or is administered a pharmaceutical composition of the disclosure. In particular embodiments, the pharmaceutical composition comprises a mmRNA encoding a polypeptide of interest and which comprises at least one miR binding site as described in this invention, or comprises a nanoparticle comprising the mmRNA. In particular embodiments, the mmRNA is present in a nanoparticle, for example, a lipid nanoparticle. In particular embodiments, the mmRNA or nanoparticle is present in a pharmaceutical composition.

In one embodiment, the mRNA, eg, mmRNA, is administered intravenously, encapsulated in a lipid nanoparticle. In one embodiment, the mRNA, eg, mmRNA, is administered by infusion once a week (eg, by intravenous infusion, such as through a pump). In one embodiment, the mRNA, eg, mmRNA, is infused once a week for at least 4 weeks.

In another embodiment, the disclosure provides a method of reducing or inhibiting unwanted immune cell activation (eg, B cell activation) and / or unwanted cytokine production in a subject administered messenger RNA. (MRNA) encoding a polypeptide of interest, the method comprising administering to the subject intravenously a first dose of mRNA, for example, modified mRNA (mRNA) encoding a polypeptide of interest encapsulated in an LNP, where the mRNA, for example , MRNA, comprises at least one binding site for one expressed in immune cells, such as a miR-126 binding site and / or at least one miR-142 microRNA binding site,

and where the mRNA, eg, mmRNA, comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of the mRNA, eg, mmRNA, encapsulated in an LNP, such that the activation of unwanted immune cells and / or the production of unwanted cytokines is reduced or inhibited in the subject. .

In certain embodiments, the mRNA encodes a polypeptide of interest (eg, a therapeutic agent), where the activation of unwanted immune cells and / or the production of unwanted cytokines occurs in response to the polypeptide of interest.

In another aspect, the disclosure provides a method of reducing or inhibiting unwanted immune cell activation (eg, lymphocyte activation, B cell activation) or production of unwanted cytokines in a subject following repeated administration of a messenger RNA (mRNA) to the subject, the procedure comprising:

(i) administering to the subject intravenously a first dose of an mRNA, eg, chemically modified mRNA (mRNA) encapsulated in an LNP, where the mRNA, eg, mRNA, comprising at least one miR microRNA binding site -126 and / or miR-142, and where the mRNA, eg, mmRNA, comprises one or more modified nucleobases;

(ii) detecting a level of immune cell activation in a sample from a subject; Y

(iii) administering to the subject intravenously a second dose of the mRNA, eg, mRNA, chemically modified encapsulated in an LNP when the level of immune cell activation in the sample is reduced, such that an activation of immune cells unwanted or unwanted cytokine production is reduced or inhibited in the subject.

In certain embodiments, the mRNA, eg, mmRNA, encodes a polypeptide of interest (eg, a therapeutic agent), where the activation of unwanted immune cells or the production of unwanted cytokines occurs in response to the polypeptide of interest.

ADA trials

ADA assays (bioassays) can be used to test for binding neutralizing (NAB) and non-neutralizing (BAB) antibodies. NAB assays can include both cell-based assays, eg, cell proliferation assays, biomarker assays, gene expression assays, gene reporting assays, antibody-dependent cell-mediated cytotoxicity (ADCC) assays, cytotoxicity assays complement-dependent (CDC) and the like, as well as non-cell-based assays, e.g. competitive ligand-binding assays (CLBA), surface plasmon resonance (SPR), enzyme-linked immunosorbent assay (ELISA), electrochemiluminescence (ECL), e.g., chemiluminescence electroimmunoassay (ECLIA), dissociation-enhanced fluorescent lanthanide immunoassay (DELFIA®), Gyros® anti-drug antibody immunoassay (ADA), fluorescent enzyme immunoassay (FEIA), platelet-induced ristocetin aggregation RIPA) and the like.

In exemplary aspects, the therapeutic regimen may include performing one or more ADA assays prior to or during a therapeutic regimen. In exemplary embodiments, the ADA assay is a NAB assay. In such cases, the bioassay must be related to the mechanism of action of the product, otherwise the assay will not be informative on the effect of NAB on clinical pharmacology. In preferred embodiments, cell-based NABs are presented in the therapeutic regimen of the disclosure. If neutralizing cell-based assays are not feasible or available, competitive ligand binding assays or alternatives might be suitable. However, when these are used, the assays are preferably shown to reflect the neutralization potential / capacity in an adequate manner.

In addition to directly measuring the ADA response, the level of immune cell activation can also be assessed as a measure of a developing antibody response. The level of immune cell activation can be assessed by essentially any method established in the art to assess immune cell activation, such as the frequency of a population of activated immune cells, typically assessed by detecting cells expressing activation markers. cell surface, or production levels of one or more cytokines indicative of immune cell activation. In one embodiment, the immune cell activation is B cell activation, where the level of B cell activation is Determined by measuring the frequency of activated B cells, such as the frequency of activated B cells among the spleen B cell population. B cell surface markers indicative of B cell activation are well known in the art (see, for example, Maddalay, R. et al. (2010) FEBS Letters 584: 4883-4894). In one embodiment, B cell activation is determined by the frequency of CD19 + CD86 + CD69 + B cells. In another embodiment, immune cell activation is B cell activation, where the level of B cell activation is determined by cytokine secretion, such as interleukin-6 (IL-6) secretion, the tumor necrosis factor a (TNF-a) or interferon-Y (IFN-y), for example, in the serum of treated subjects. In one embodiment, B cell activation is determined by IL-6 secretion, for example, in the serum of treated subjects. In other embodiments, the unwanted cytokine production that is reduced or inhibited is the production of interleukin-6 (IL-6), tumor necrosis factor a (TNF-a), or interferon-y (IFN-y), for example, in the serum of treated subjects. In another embodiment, the unwanted cytokine production that is reduced or inhibited is the production of interleukin-6 (IL-6).

Administration of pharmaceutical compositions

A pharmaceutical composition including one or more RNA, eg, mRNA, of the disclosure can be administered to a subject by any suitable route. In some embodiments, the compositions of the disclosure are administered by one or more of a variety of routes, including parenteral injection (eg, subcutaneous, intracutaneous, intravenous, intraperitoneal, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal injection, intralesional or intracranial, as well as any suitable infusion technique), oral, trans or intradermal, interdermal, rectal, intravaginal, topical (for example, powders, ointments, creams, gels, lotions, and / or drops), mucous, nasal , buccal, enteral, vitreous, intratumoral, sublingual, intranasal; by intratracheal instillation, bronchial instillation, and / or inhalation; as an oral spray and / or powder, nasal spray, and / or aerosol, and / or through a portal vein catheter. In some embodiments, a composition can be administered intravenously, intramuscularly, intradermally, intraarterially, intratumorally, subcutaneously, or by inhalation. However, the present disclosure encompasses the delivery of compositions of the disclosure by any suitable route, taking into account possible advancements in the science of drug delivery. In general, the most suitable route of administration will depend on a variety of factors including the nature of the pharmaceutical composition that includes one or more mRNAs (for example, its stability in various bodily environments, such as the bloodstream and gastrointestinal tract), and the condition of the patient (eg, whether the patient can tolerate particular routes of administration). In one embodiment, the composition is administered parenterally. In another embodiment, the composition is administered intravenously. In another embodiment, the composition is administered intratumorally.

In certain embodiments, the compositions of the disclosure can be administered at dosage levels sufficient to deliver from about 0.0001 to about 10 mg / kg, from about 0.001 to about 10 mg / kg, from about 0.005 to about 10 mg / kg, from about 0.01 to about 10 mg / kg, from about 0.1 to about 10 mg / kg, from about 1 to about 10 mg / kg, from about 2 to about 10 mg / kg, from about 5 to about 10 mg / kg, from about 0.0001 to about 5 mg / kg, from about 0.001 to about 5 mg / kg, from about 0.005 to about 5 mg / kg, from about 0.01 to about 5 mg / kg, from about 0.1 to about 10 mg / kg, from about 1 to about 5 mg / kg, from about 2 to about 5 mg / kg, from about 0.0001 to about 1 mg / kg, from about 0.001 to about 1 mg / kg, from about 0.005 to about 1 mg / kg, from about 0.01 to about 1 mg / kg, or about te 0.1 to about 1 mg / kg in a given dose, where a dose of 1 mg / kg provides 1 mg of mRNA or nanoparticle per 1 kg of subject body weight. In particular embodiments, a dose of from about 0.005 mg / kg to about 5 mg / kg of mRNA or nanoparticle of the disclosure can be administered. In particular embodiments, a dose of from about 0.002 mg / kg to about 2 mg / kg of mRNA or nanoparticle of the disclosure can be administered. In particular embodiments, a dose of about 0.02 mg / kg to about 0.2 mg / kg of mRNA or nanoparticle of the disclosure can be administered.

A dose can be administered one or more times a day, in the same amount or in a different amount, to obtain a desired level of mRNA, expression and / or effect (eg, a therapeutic effect). The desired dose can be administered three times a day, twice a day, once a day, every other day, every three days, once a week, every two weeks, every three weeks, or every four weeks. In certain embodiments, it is possible to administer the desired dose in multiple administrations (eg, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations). In some embodiments, a single dose may be administered, for example, before or after a surgical procedure or in the event of an acute disease, disorder, or condition.

The specific dose level that is therapeutically or prophylactically effective or imaging suitable for any particular patient will depend on a variety of factors including the disorder being treated and the severity thereof; the activity of the specific compound that has been employed; the specific composition used; the age, body weight, general health, sex, and diet of the patient; the time of administration, the route of administration and the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidentally with the specific compound employed and similar factors known in the field of medicine.

In some embodiments, a pharmaceutical composition of the disclosure can be administered in combination with another agent, eg, another therapeutic agent, a prophylactic agent, and / or a diagnostic agent. By "in combination with", it is not intended to imply that the agents must be administered at the same time and / or that they must be formulated for co-administration, although these methods of administration are within the scope of the present disclosure. For example, it is possible to administer in combination one or more compositions that include one or more different mRNAs. The compositions can be administered concurrently with, before or after, one or more other desired medical or therapeutic procedures. In general, each agent will be administered at a specific dose and / or schedule for that agent. In some embodiments, the present disclosure encompasses the provision of compositions of the disclosure, or the imaging, diagnostic, or prophylactic compositions thereof in combination with agents that enhance their bioavailability, reduce and / or modify their metabolism, inhibit their excretion, and / or modify their distribution within the body.

Exemplary therapeutic agents that can be administered in combination with the compositions of the disclosure include, but are not limited to, cytotoxic, chemotherapeutic, and other therapeutic agents. Cytotoxic agents include, for example, taxol ,, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoside, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxy anthrazin dione, mitoxantrone, mitomycin dione, mitoxantrone, mitomycin dione, mitoxantrone 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, rachelmycin, and analogs thereof. Radioactive ions can also be used as therapeutic agents and can include, for example, radioactive iodine, strontium, phosphorus, palladium, cesium, iridium, cobalt, yttrium, samarium, and praseodymium. Other therapeutic agents may include, for example, antimetabolites (eg, methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, and 5-fluorouracil and decarbazine), alkylating agents (eg, mechlorethamine, thiotepa, chlorambucil, rachelmycin, melphalan, carmustine). , lomustine, cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cisdichlorodiamine platinum (II) (DDP) and cisplatin), anthracyclines (eg, daunorubicin and doxorubicin), antibiotics (eg, dactinramycin), and bleomycin, mitomycin, and antimicrobial agent antimitotic agents (eg, vincristine, vinblastine, taxol, and maytansinoids).

The particular combination of therapies (therapeutic products or procedures) to be employed in a combination regimen will take into account the compatibility of the desired therapeutics and / or procedures and the desired therapeutic effect that is intended to be achieved. It will also be appreciated that the therapies employed may achieve a desired effect for the same disorder (eg, a compound of the invention may be administered simultaneously with another anti-inflammatory agent), or may achieve different effects (eg, control of any adverse effects. ).

Other realizations

This description refers to the following embodiments:

In some aspects, the description refers to methods for reducing or inhibiting an anti-drug antibody response in a subject, comprising administering to the subject a modified messenger RNA (mmRNA) encoding a polypeptide of interest, wherein the mmRNA comprises at least one miR-142-3p microRNA binding site, and where the mmRNA comprises one or more modified nucleobases, such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject.

In other aspects, the disclosure relates to methods for reducing or inhibiting the anti-drug antibody response after repeated administration of a polypeptide of interest to a subject, comprising administering to the subject intravenously a first dose of a modified mRNA (mRNA ) encoding a polypeptide of interest encapsulated in a LNP, where the mmRNA comprises at least one miR-142-3p microRNA binding site, and where the mmRNA comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of mmRNA encapsulated in an LNP, such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject.

In still other aspects, the disclosure relates to methods for reducing or inhibiting an anti-drug antibody response after repeated administration of a polypeptide of interest to a subject, comprising

(i) administering to the subject intravenously a first dose of a modified mRNA (mmRNA) encoding a polypeptide of interest encapsulated in an LNP, where the mmRNA comprises at least one miR-142-3p microRNA binding site

and where the mRNA comprises one or more modified nucleobases;

(ii) detecting a level of anti-drug antibodies in a sample from a subject; Y

(iii) administering to the subject intravenously a second dose of mmRNA encapsulated in an LNP when the level of anti-drug antibodies in the sample decreases, such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject.

In some aspects, the description refers to methods for reducing or inhibiting drug-related toxicity in a subject, comprising administering to the subject a modified messenger RNA (mmRNA) encoding a polypeptide of interest, wherein the mmRNA comprises at least a miR-142-3p microRNA binding site, and wherein the mmRNA comprises one or more modified nucleobases, such that drug-related toxicity to the polypeptide of interest in the subject is reduced or inhibited.

In other aspects, the description relates to methods for reducing or inhibiting drug-related toxicity in a subject, comprising administering to the subject a modified messenger RNA (mmRNA) encoding a polypeptide of interest, wherein the mmRNA comprises at least a miR-126 microRNA binding site, and wherein the mmRNA comprises one or more modified nucleobases, such that drug-related toxicity to the polypeptide of interest in the subject is reduced or inhibited.

In some embodiments of the above aspects, the drug-related toxicity for the polypeptide of interest is reduced blood counts (cytopenia) in the subject. In other embodiments of the above aspects, the drug-related toxicity for the polypeptide of interest is autoimmunity in the subject. In further embodiments of the above aspects, drug-related toxicity for the polypeptide of interest is complement-mediated effects in the subject. In some embodiments of the above aspects, the drug-related toxicity for the polypeptide of interest is reduced hematopoiesis in the subject. In other embodiments of the above aspects, the drug-related toxicity is kidney or liver toxicity.

In some aspects, the description refers to methods for reducing or inhibiting an anti-drug antibody response in a subject, comprising administering to the subject a modified messenger RNA (mmRNA) encoding a polypeptide of interest, wherein the mmRNA comprises at least one miR-126 microRNA binding site, and wherein the mmRNA comprises one or more nucleobases modified, such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject.

In other aspects, the disclosure relates to methods for reducing or inhibiting the anti-drug antibody response after repeated administration of a polypeptide of interest to a subject, comprising administering to the subject intravenously a first dose of a modified mRNA (mRNA ) that encodes a polypeptide of interest encapsulated in an LNP, where the mmRNA comprises at least one miR-126 microRNA binding site, and where the mmRNA comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of mmRNA encapsulated in an LNP, such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject.

In still other aspects, the disclosure relates to methods for reducing or inhibiting an anti-drug antibody response after repeated administration of a polypeptide of interest to a subject, comprising

(i) administering to the subject intravenously a first dose of a modified mRNA (mmRNA) encoding a polypeptide of interest encapsulated in an LNP, where the mmRNA comprises at least one miR-126 microRNA binding site

and where the mRNA comprises one or more modified nucleobases;

(ii) detecting a level of anti-drug antibodies in a sample from a subject; Y

(iii) administering to the subject intravenously a second dose of mmRNA encapsulated in an LNP when the level of anti-drug antibodies in the sample decreases, such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject.

In some aspects, the disclosure relates to methods of reducing or inhibiting immune cell activation in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding a polypeptide of interest, the method comprising administering to the subject a chemically modified mRNA encoding the polypeptide of interest, wherein the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that immune cell activation is reduced or inhibited in the subject after repeated administration.

In some embodiments of the above aspects, the reduction or inhibition of unwanted immune cell activation is determined compared to the control administration of a chemically modified mRNA, which lacks the at least one microRNA binding site. In other embodiments of the above aspects, the reduction or inhibition of unwanted immune cell activation is the reduction or inhibition of lymphocyte activation.

In some embodiments of the above aspects, the reduction or inhibition of lymphocyte activation is the reduction or inhibition of B cell activation. In other embodiments of the above aspects, the reduction or inhibition of B cell activation is determined by the frequency of CD19 + CD86 + CD69 + B cells. In some embodiments of the above aspects, the reduction or inhibition of unwanted immune cell activation causes the reduction or inhibition of cytokine production. In some embodiments of the above aspects, immune cell activation is decreased by at least 10%. In further embodiments of the above aspects, immune cell activation is decreased by at least 25%. In some embodiments of the above aspects, immune cell activation is decreased by at least 50%. In some embodiments of the above aspects, accelerated blood clearance is reduced or inhibited without a corresponding reduction or inhibition in the expression of the polypeptide of interest encoded by the chemically modified mRNA.

In some aspects, the disclosure relates to methods of reducing or inhibiting immune cell activation in a subject to which a messenger RNA (mRNA) encoding a polypeptide of interest has been administered, which comprises administering the subject intravenously. a first dose of a chemically modified mRNA encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more nucleobases modified; and administering to the subject intravenously a second dose of a chemically modified mRNA encapsulated in an LNP, such that unwanted immune cell activation is reduced or inhibited in the subject.

In other aspects, the description relates to methods of reducing or inhibiting unwanted immune cell activation in a subject after repeated administration of a messenger RNA (mRNA) encoding a polypeptide of interest to the subject, comprising

(i) administering to the subject intravenously a first dose of a chemically modified mRNA encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells,

and where the chemically modified mRNA comprises one or more modified nucleobases;

(ii) detecting a level of immune cell activation in a sample from a subject; Y

(iii) administering to the subject intravenously a second dose of the chemically modified mRNA encapsulated in an LNP when the level of immune cell activation in the sample is reduced, such that an unwanted immune cell activation is reduced or inhibited in the subject.

In some embodiments of the above aspects, the reduction or inhibition of unwanted immune cell activation is the reduction or inhibition of B cell activation. In some embodiments of the above aspects, the reduction or inhibition of immune cell activation unwanted causes the reduction or inhibition of cytokine production.

In some aspects, the description refers to methods for reducing or inhibiting cytokine production in a subject to whom a messenger RNA (mRNA) encoding a polypeptide of interest has been administered, the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle, where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the modified mRNA chemically it comprises one or more modified nucleobases, such that the production of unwanted cytokines is reduced or inhibited in the subject.

In some embodiments of the above aspects, the reduction or inhibition of unwanted cytokine production is determined in comparison to the administration of chemically modified mRNA lacking the at least one microRNA binding site for the microRNA expressed in immune cells. In other embodiments of the above aspects, the reduced or inhibited production of cytokines is the reduced or inhibited production of interleukin-6 (IL-6), tumor necrosis factor □ (TNF- ^), or interferon- ^ (IFN-n) . In some embodiments of the above aspects, the reduced or inhibited production of cytokines is the reduced or inhibited production of interleukin-6 (IL-6).

In some embodiments of the above aspects, cytokine activation is decreased by at least 10%. In some embodiments of the above aspects, cytokine production is decreased by at least 25%. In some embodiments of the above aspects, cytokine production is decreased by at least 50%. In some embodiments of the above aspects, cytokine production is reduced or inhibited without a corresponding reduction in expression of the polypeptide of interest encoded by the chemically modified mRNA.

In still other aspects, the disclosure relates to methods of reducing or inhibiting accelerated blood clearance in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP ), the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and wherein the chemically modified mRNA comprises one or more modified nucleobases, such that accelerated blood clearance is reduced or inhibited in the subject after repeated administration.

In some aspects, the description refers to methods of reducing or inhibiting accelerated blood clearance in a subject to whom a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP) has been administered, which comprises administering to the subject intravenously a first dose of a chemically modified mRNA encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the mRNA chemically modified comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of a chemically modified mRNA encapsulated in an LNP, such that accelerated blood clearance is reduced or inhibited in the subject.

In other aspects, the description relates to methods for reducing or inhibiting accelerated blood clearance in a subject who has been administered multiple doses of a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP). , the method comprising administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that accelerated blood clearance is reduced or inhibited in the subject after administration of one or more subsequent doses.

In still further aspects, the description relates to methods for reducing or inhibiting accelerated blood clearance in a subject to whom a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP) has been administered, the method comprising administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and wherein the chemically modified mRNA comprises one or more modified nucleobases, such that accelerated blood clearance is reduced or inhibited in the subject after administration of a subsequent dose of mRNA.

In some aspects, the description refers to methods for reducing or inhibiting accelerated blood clearance in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP). , the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, where the Chemically modified mRNA comprises one or more modified nucleobases, and where LNP does not activate B cells and / or does not induce the production of IgM molecules capable of binding to LNP, such that accelerated blood clearance is reduced or inhibited in the subject after repeated administration.

In other aspects, the description refers to methods for reducing or inhibiting accelerated blood clearance in a subject to whom a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP) has been administered, which comprises administering to the subject intravenously a first dose of a chemically modified mRNA encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the mRNA chemically modified comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of a chemically modified mRNA encapsulated in an LNP, where the LNP does not activate the B cells and / or does not induce the production of IgM molecules capable of binding the LNP, such that the Accelerated blood clearance is reduced or inhibited in the subject.

In still other aspects, the description relates to methods of reducing or inhibiting accelerated blood clearance in a subject who has been administered multiple doses of a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle ( LNP), the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, where the chemically modified mRNA comprises one or more modified nucleobases, and where LNP does not activate B cells and / or does not induce the production of IgM molecules capable of binding to LNP, such that accelerated blood clearance is reduced or inhibited in the subject after administration of one or more subsequent doses.

In some aspects, the description refers to methods for reducing or inhibiting accelerated blood clearance in a subject to whom a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP) has been administered, the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, where the chemically modified mRNA comprises one or more modified nucleobases, and where LNP does not activate B cells and / or does not induce the production of IgM molecules capable of binding to LNP, such that accelerated blood clearance is reduced or inhibited in the subject after administration of a subsequent dose of mRNA.

In other aspects, the description relates to methods for reducing or inhibiting the production of IgM molecules that recognize polyethylene glycol (PEG) in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that the production of IgM molecules that recognize PEG is reduced or inhibited in the subject after repeated administration.

In some aspects, the description refers to methods of reducing or inhibiting the production of IgM molecules that recognize polyethylene glycol (PEG) in a subject who has been administered a messenger RNA (mRNA) that encodes a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), which comprises intravenously administering to the subject a first dose of a chemically modified mRNA encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of a chemically modified mRNA encapsulated in an LNP, such that the production of IgM molecules that recognize PEG is reduced or inhibited in the subject.

In other aspects, the disclosure relates to methods for reducing or inhibiting the production of IgM molecules that recognize polyethylene glycol (PEG) in a subject who has been administered multiple doses of a messenger RNA (mRNA) encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the mRNA Chemically modified comprises one or more modified nucleobases, such that the production of IgM molecules that recognize PEG is reduced or inhibited in the subject after administration of one or more subsequent doses.

In some aspects, the description refers to methods for reducing or inhibiting the production of IgM molecules that recognize polyethylene glycol (PEG) in a subject who has been administered a messenger RNA (mRNA) that encodes the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for an expressed microRNA in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that the production of IgM molecules that recognize PEG is reduced or inhibited in the subject after administration of a subsequent dose of mRNA.

In still further aspects, the description refers to a method for reducing or inhibiting the activation of B1a cells in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle. (LNP), the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells , and where the chemically modified mRNA comprises one or more modified nucleobases, such that activation of B1a cells is reduced or inhibited in the subject after repeated administration.

In some aspects, the description refers to methods for reducing or inhibiting the activation of B1a cells in a subject to whom a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP) has been administered, which comprises administering to the subject intravenously a first dose of a chemically modified mRNA encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of a chemically modified mRNA encapsulated in an LNP, such that activation of B1a cells is reduced or inhibited in the subject.

In other aspects, the description refers to methods of reducing or inhibiting B1a cell activation in a subject who has been administered multiple doses of a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle ( LNP), the method comprising administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in cells immune, and where the chemically modified mRNA comprises one or more modified nucleobases, such that activation of B1a cells is reduced or inhibited in the subject after administration of one or more subsequent doses.

In some aspects, the description refers to methods for reducing or inhibiting the activation of B1a cells in a subject to whom a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP) has been administered, the method comprising administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and wherein the chemically modified mRNA comprises one or more modified nucleobases, such that activation of B1a cells is reduced or inhibited in the subject after administration of a subsequent dose of mRNA.

In other aspects, the description refers to methods for reducing or inhibiting the activation of plasmacytoid dendritic cells in a subject who has been repeatedly administered a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle. (LNP), the method comprises administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells , and where the chemically modified mRNA comprises one or more modified nucleobases, such that plasmacytoid dendritic cell activation is reduced or inhibited in the subject after repeated administration.

In still other aspects, the description relates to methods of reducing or inhibiting the activation of plasmacytoid dendritic cells in a subject administered a messenger RNA (mRNA) that encodes a polypeptide of interest encapsulated in a lipid nanoparticle (LNP), which comprises intravenously administering to the subject a first dose of a chemically modified mRNA encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one site binding of microRNAs for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases; and administering to the subject intravenously a second dose of a chemically modified mRNA encapsulated in an LNP, such that the activation of plasmacytoid dendritic cells is reduced or inhibited in the subject.

In some aspects, the description refers to methods for reducing or inhibiting the activation of plasmacytoid dendritic cells in a subject who has been administered multiple doses of a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle. (LNP), the method comprising administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that the activation of plasmacytoid dendritic cells is reduced or inhibited in the subject after administration of one or more subsequent doses.

In other aspects, the description refers to methods for reducing or inhibiting the activation of plasmacytoid dendritic cells in a subject to whom a messenger RNA (mRNA) encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP) has been administered. , the method comprising administering to the subject a chemically modified mRNA encoding the polypeptide of interest encapsulated in a lipid nanoparticle (LNP), where the chemically modified mRNA comprises at least one microRNA binding site for a microRNA expressed in immune cells, and where the chemically modified mRNA comprises one or more modified nucleobases, such that the activation of plasmacytoid dendritic cells is reduced or inhibited in the subject after administration of a subsequent dose of mRNA.

In some embodiments of the above aspects, the mRNA encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP) does not activate B cells and / or does not include the production of IgM molecules capable of binding to LNP. In some embodiments of the foregoing aspects, the mRNA encoding a polypeptide of interest encapsulated in a lipid nanoparticle (LNP) does not activate B cells. In some embodiments of the foregoing aspects, the mRNA encoding a polypeptide of interest encapsulated in a nanoparticle Lipid (LNP) does not include the production of IgM molecules capable of binding to LNP.

In some embodiments of the above aspects, the reduction or inhibition of accelerated blood clearance is determined compared to the control administration of a chemically modified mRNA, which lacks the at least one microRNA binding site encapsulated in a lipid nanoparticle (LNP ). In some embodiments of the above aspects, accelerated blood clearance is reduced or inhibited without a corresponding reduction or inhibition in the expression of the polypeptide of interest encoded by the chemically modified mRNA. In some embodiments of the above aspects, the interval between two consecutive doses is less than 2 weeks. In some embodiments of the above aspects, the interval between two consecutive doses is less than 1 week.

In some embodiments of the above aspects, the IgM molecules recognize polyethylene glycol (PEG).

In any of the above aspects, the mRNA described in this invention is administered intravenously encapsulated in a lipid nanoparticle. In any of the above aspects, the mRNA described in this invention is administered by a weekly infusion.

In any of the above aspects, the mmRNA described in this invention comprises a 5 'UTR, a codon optimized open reading frame encoding the polypeptide of interest, a 3' UTR comprising the at least one microRNA binding site of miR-142-3p and a linked nucleoside 3 'tail region. In some embodiments, the mRNA described in this invention comprises a 5 'UTR and a 3' UTR that are heterologous to the coding structure. In some embodiments, the mRNA described in this invention is completely modified. In some embodiments, the mRNA described in this invention is completely modified for a particular chemical modification.

In any of the above aspects, the mRNA described in this invention comprises pseudouridine (y), pseudouridine ( ^y ) and 5-methyl-cytidine (m5C), 1-methyl-pseudouridine (m1 ^), 1-methyl-pseudouridine (m1 ^) and 5-methyl-cytidine (m5C), 2-thiouridine (s2U), 2-thiouridine and 5-methyl-cytidine (m5C), 5-methoxy-uridine (mo5U), 5-methoxy-uridine (mo5U) and 5-methyl-cytidine (m5C), 2'-O-methyl uridine, 2'-O-methyl uridine and 5-methyl-cytidine (m5C), N6-methyl-adenosine (m6A) or N6-methyl-adenosine (m6A) and 5-methyl-cytidine (m5C).

In any of the above aspects, the mRNA described in this invention comprises pseudouridine (y), N1-methylpseudouridine (m1 ^), 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1- deaza-pseudouridine, 2-thio-1-methylpseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine or 2'-O-methyl uridine, or combinations thereof.

In some embodiments, the mRNA described in this invention comprises 1-methyl-pseudouridine (m1 ^), 5-methoxyuridine (mo5U), 5-methyl-cytidine (m5C), pseudouridine (y), a-thio-guanosine, or a- thio-adenosine, or combinations thereof.

In any of the above aspects, the polypeptide of interest is a therapeutic protein, a cytokine, a growth factor, an antibody, or a fusion protein.

In any of the above aspects, the lipid nanoparticle is a liposome. In some embodiments, the lipid nanoparticle comprises a cationic and / or ionizable lipid. In some embodiments, the ionizable or cationic lipid is DLin-KC2-DMA or DLin-MC3-DMA.

In any of the above aspects, the mmRNA comprises at least two microRNA binding sites, where at least one of the microRNA binding sites is a miR-142-3p microRNA binding site. In any of the above aspects, the mmRNA comprises miR-142-3p binding site and a second microRNA binding site for a miR selected from the group consisting of miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27.

In any of the above aspects, the chemically modified mRNA comprises a 5 'UTR, a codon optimized open reading frame encoding the polypeptide of interest, a 3' UTR comprising the at least one microRNA binding site of and a 3 'tail region of linked nucleosides.

In any of the above aspects, the codon-optimized open reading frame that encodes the polypeptide of interest comprises a stop codon and where the at least one microRNA binding site is located within the 3 'UTR of 1 to 100 nucleotides after the stop codon. In some embodiments, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and where the at least one microRNA binding site is located within the 3 'UTR at least 50 nucleotides after the stop codon. stop.

In any of the above aspects, the chemically modified mRNA comprises a 5 'UTR, a codon optimized open reading frame encoding the polypeptide of interest, a 3' UTR comprising the at least one microRNA binding site for a microRNA expressed in immune cells from and a 3 'tail region of linked nucleosides.

In any of the foregoing aspects, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and where the at least one miR-142-3p microRNA binding site is located within the 3 ' UTR of 30 to 50 nucleotides after the stop codon. In some embodiments, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and where the at least one miR-142-3p microRNA binding site is located within the 3 'UTR at least 50 nucleotides after the stop codon.

In any of the above aspects, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and where the at least one miR-126 microRNA binding site is located within the 3 'UTR of 30 to 50 nucleotides after the stop codon. In some embodiments, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and where the at least one miR-126 microRNA binding site is located within the 3 'UTR at least 50 nucleotides after the stop codon.

In any of the above aspects, the mmRNA described in this invention comprises a 5 'UTR, a codon optimized open reading frame encoding the polypeptide of interest, a 3' UTR comprising the at least one microRNA binding site of miR-126 and a linked nucleoside 3 'tail region.

In any of the above aspects, the mmRNA comprises at least two microRNA binding sites. In some embodiments, the mmRNA comprises at least two microRNA binding sites, where at least one of the microRNA binding sites is a miR-126 microRNA binding site. In some embodiments, the mmRNA comprises a miR-126 binding site and a second microRNA binding site for a miR selected from the group consisting of miR-142-3p, miR-142-5p, miR-146- 3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the chemically modified mRNA comprises a miR-126 binding site and a miR-142 binding site. In some embodiments, the mmRNA construct comprises a miR-126 binding site and a miR-142-3p binding site.

In any of the above aspects, the microRNA binding site is a miR-142-3p binding site. In some embodiments, the miR-142-3p binding site comprises the sequence shown in SEQ ID NO: 3. In any of the above aspects, the microRNA binding site is a miR microRNA binding site. -126. In some embodiments, the miR-126 binding site comprises the sequence shown in SEQ ID NO: 26.

In any of the above aspects, the microRNA binding site is a miR-155 microRNA binding site. In some embodiments, the miR-155 binding site comprises the sequence shown in SEQ ID NO: 35.

In any of the above aspects, the microRNA binding site binds to microRNA expressed in myeloid cells. In any of the above aspects, the microRNA binding site binds to a microRNA expressed in plasmacytoid dendritic cells. In any of the above aspects, the microRNA binding site binds to a microRNA expressed in macrophages.

Definitions

Accelerated blood clearance ( AUC): As used in this invention, "accelerated blood clearance" or "AUC" refers to a phenomenon where certain exogenously administered agents are rapidly cleared from the blood in second and subsequent administrations.

Administration: As used in this invention, "administration" refers to a method of administering a composition to a subject or patient. An administration method can be selected to direct administration (eg, to specifically administer) to a specific region or system of a body. For example, an administration can be parenteral (eg, subcutaneous, intracutaneous, intravenous, intraperitoneal, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, or intracranial injection, as well as any suitable infusion technique), oral, trans, or intradermal, interdermal, rectal, intravaginal, topical (eg, powders, ointments, creams, gels, lotions, and / or drops), mucosal, nasal, buccal, enteral, vitreous, intratumoral, sublingual, intranasal; by intratracheal instillation, bronchial instillation, and / or inhalation; as an oral spray and / or powder, nasal spray, and / or aerosol, and / or through a portal vein catheter.

Anti-drug antibody: As used in this invention, the term "anti-drug antibody", or "ADA", refers to antibodies generated in a subject against a therapeutic protein present in the subject. A classical anti-drug antibody (ADA) response is understood in the art as a result of the systemic administration of a recombinant therapeutic protein to the subject. Furthermore, as used in this invention with respect to mRNA treatment, an ADA response is intended to encompass the antibody responses observed in the animal studies described in this invention, in which antibodies that bind to the protein were generated. therapy encoded by the therapeutic mRNA (ie, antibodies raised against the protein encoded by the drug mRNA). Such antibody responses to the mRNA drug-encoded therapeutic protein are also called anti-protein antibody (APA) responses, the terminology of which can be used interchangeably in this invention with ADA responses.

Apoptosis: As used in this invention, "apoptosis" refers to a form of cell death in which a programmed sequence of events leads to the death of a cell. The hallmarks of apoptosis include morphological changes, cell contraction, caspase activation, nuclear and cytoplasmic condensation, and alterations in plasma membrane topology. In terms of biochemistry, apoptotic cells are characterized by a higher concentration of intracellular calcium, fragmentation of chromosomal DNA, and expression of new cell surface components. In particular embodiments, a cell undergoing apoptosis can undergo mitochondrial outer membrane permeabilization (MOMP).

About, Around: As used in this invention, the term "about" or "around", as applied to one or more values of interest, refers to a value that is similar to an indicated reference value. In certain embodiments, the term "about" or "about" refers to a range of values within 25, 20, 19, 18, 17, 16, 15, 14, 13 , 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 % or less in any direction (greater or less) of the value of indicated reference, unless otherwise stated, or otherwise evident from the context (unless that number exceeds 100% of a possible value).

Binding antibody ( BAB): As used in this invention, a "binding antibody" or "BAB" refers to an antibody that is capable of binding, ie interacting with, a target antigen, such as a therapeutic protein. The term "binding antibody" is intended to encompass neutralizing antibodies (that is, antibodies that bind to the target antigen and inhibit the functional activity of the antigen) and non-neutralizing antibodies (that is, antibodies that bind to the target antigen but do not inhibit the antigen functional activity).

Cancer: As used in this invention, "cancer" is a condition that involves abnormal and / or unregulated cell growth. The term cancer encompasses both benign and malignant cancers. Examples of non-limiting cancers include adrenal cortical cancer, advanced cancer, anal cancer, aplastic anemia, bile cancer, bladder cancer, bone cancer, bone metastasis, brain tumors, brain cancer, breast cancer, childhood cancer, cancer of origin unknown primary, Castleman disease, cervical cancer, colorectal cancer, endometrial cancer, esophageal cancer, Ewing family of tumors, eye cancer, gallbladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, gestational trophoblastic disease , Hodgkin's disease, Kaposi's sarcoma, renal cell carcinoma, laryngeal and hypopharyngeal cancer, acute lymphocytic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloid leukemia, liver cancer (eg, hepatocellular carcinoma), non-small cell lung cancer, small cell lung cancer, carcinoid tumor of lung, skin lymphoma, malignant mesothelioma, multiple myeloma, myelodysplasia syndrome, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cavity and oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer , penile cancer, pituitary tumors, prostate cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, adult soft tissue sarcoma, basal and squamous cell skin cancer, melanoma, small bowel cancer, stomach cancer, testicular cancer, cancer throat, thymus cancer, thyroid cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom's macroglobulinemia, Wilms tumor, and secondary cancers caused by cancer treatment. In particular embodiments, the cancer is liver cancer (eg, hepatocellular carcinoma) or colorectal cancer. In other embodiments, the cancer is a blood-based cancer or a hematopoietic cancer.

Conjugate: As used in this invention, the term "conjugate", when used with respect to two or more moieties, means that the moieties are physically associated or connected to each other, either directly or through one or more additional moieties that they serve as a binding agent, to form a structure that is stable enough that the moieties remain physically associated under the conditions in which the structure is used, eg, physiological conditions. In some embodiments, two or more moieties can be conjugated by direct covalent chemical bonding. In other embodiments, two or more moieties can be conjugated by ionic bonding or hydrogen bonding.

Contact: As used in this description, the term "contact" means to establish a physical connection between two or more entities. For example, contacting a cell with an mRNA or lipid nanoparticle composition means that the cell and the mRNA or lipid nanoparticle are made to share a physical connection. Procedures for contacting cells with external entities both in vivo and in vitro, as well as ex vivo are well known in the biological arts. In exemplary embodiments of the disclosure, the step of contacting a mammalian cell with a composition (eg, an isolated mRNA, nanoparticle, or pharmaceutical composition of the disclosure) is performed in vivo. For example, contact of a lipid nanoparticle composition and a cell (eg, a mammalian cell) that can be disposed within an organism (eg, a mammal) can be effected by any suitable route of administration (eg, administration parenteral to the body, including intravenous, intramuscular, intradermal and subcutaneous administration). For a cell present in vitro, a composition (for example, a lipid nanoparticle or isolated mRNA) and a cell can be brought into contact, for example, by adding the composition to the culture medium of the cell, which may involve or result in a transfection. Furthermore, by means of a nanoparticle composition it is possible to make contact with more than one cell.

Drug-related toxicity: As used in this invention, the term "drug-related toxicity drug ", or simply" toxicity ", refers to the undesirable effects in vivo that may result from the expression in a subject of a therapeutic protein encoded by an mRNA, for example, as a result of a stimulated immune response against the encoded therapeutic protein, such as the generation of antibodies that bind to (and potentially neutralize) the encoded therapeutic protein. Therefore, the term "drug-related toxicity" is intended to encompass adverse effects in vivo resulting from an unwanted immune response against the encoded therapeutic protein. , including, but not limited to, hematological ( eg, hematoxicity), kidney, autoimmune, liver, and the like.

Encapsulate: As used in this invention, the term "encapsulate" means to wrap, enclose or surround. In some embodiments, a compound, polynucleotide (eg, mRNA), or other composition, can be fully encapsulated, partially encapsulated, or substantially encapsulated. For example, in some embodiments, an mRNA of the disclosure can be encapsulated in a lipid nanoparticle, eg, a liposome.

Effective amount: As used in this invention, the term "effective amount" of an agent is the amount sufficient to achieve beneficial or desired results, eg, clinical results, and as such an "effective amount" depends on the context where applies. For example, in the context of administering an agent that treats cancer, an effective amount of an agent is, for example, an amount sufficient to accomplish the treatment, as defined in this invention, of cancer, as compared to the response obtained without agent administration. In some embodiments, a therapeutically effective amount is an amount of an agent to be administered (eg, a nucleic acid, a therapeutic agent, a diagnostic agent, or a prophylactic agent) that is sufficient, when administered to a subject suffering from or is susceptible to an infection, disease, disorder and / or condition, to treat, ameliorate the symptoms of, diagnose, prevent and / or delay the onset of the infection, disease, disorder and / or condition.

Expression: As used in this invention, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (eg , by transcription); (2) processing of an RNA transcript (eg, by cutting, editing, 5 'end formation and / or 3' end processing); (3) translation of an RNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein.

Identity: As used in this invention, the term "identity" refers to the general bond between polymeric molecules, eg, between nucleic acid molecules (eg, DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percent identity of two polynucleotide acid sequences can be performed, for example, by aligning the two sequences for optimal comparison (for example, spaces can be inserted into one or both of a first and a second nucleic acid sequence for optimal alignment, and non-identical sequences can be ignored for comparison purposes). In certain embodiments, the extent of an aligned sequence for comparison purposes is at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95 or substantially 100 % of the span of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as in the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of spaces and the length of each space, which needs to be introduced for optimal alignment of the two sequences. Sequence comparison and determination of percent identity between two sequences can be obtained using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using procedures such as those described in Computational Molecular Biology, Lesk, AM, Ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, Ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG, Ed., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., Ed., M Stockton Press, New York, 1991. For example, it is possible to determine the percent identity between two nucleotide sequences using the Meyers and Miller algorithm ( CABIOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0) through the use of a PAM120 weight residue table, a space length penalty of 12 and a space penalty of 4. The percent identity between two nucleotide sequences can alternatively be determined using the GAP program in the GCG software package, using a NWSgapdna.CMP matrix. Commonly employed procedures for determining percent identity between sequences include, but are not limited to, those described in Carillo, H., and Lipman, D., SIAM J Applied Math., 48: 1073 (1988). Techniques for determining identity are encoded in available computer programs to the public. Examples of computer software to determine homology between two sequences include, but are not limited to, the GCG program package, Devereux et al, Nucleic Acids Research, 12 (1): 387,1984, BLASTP, BLASTN, and FASTA, Altschul, SF et al., J. Molec. Biol., 215, 403, 1990.

Fragment: A "fragment", as used in this invention, refers to a portion. For example, protein fragments can include polypeptides obtained by digesting full-length proteins isolated from cultured cells or obtained by recombinant DNA techniques.

Hematotoxicity: As used in this invention, the term "hematotoxicity" refers to toxicological events (eg, those resulting from drug-related toxicity) that occur in the hematopoietic system, including, but not limited to, cytopenias (e.g. example, reticulocytopenia, thrombocytopenia, neutropenia), decreased hematopoiesis, and anemia. Although not intended to be limited by mechanism, hematotoxicity in a subject may result from the development of an immune response against a therapeutic protein encoded by an mRNA administered to the subject, for example, as a result of the generation of antibodies against the therapeutic protein. , and therefore hematotoxicity may be a subset of drug-related toxicities.

Heterologous: As used in this invention, "heterologous" indicates that a sequence (eg, an amino acid sequence or the polynucleotide that encodes an amino acid sequence) is not normally present in a given polypeptide or polynucleotide. For example, an amino acid sequence that corresponds to a domain or motif of one protein can be heterologous to a second protein.

Hydrophobic Amino Acid: As used in this invention, a "hydrophobic amino acid" is an amino acid that has an uncharged nonpolar side chain. Examples of naturally occurring hydrophobic amino acids are Alanine (Ala), Valine (Val), Leucine (Leu), Isoleucine (Ile), Proline (Pro), Phenylalanine (Phe), Methionine (Met), and Tryptophan (Trp).

Isolated: As used in this invention, the term "isolated" refers to a substance or entity that has been separated from at least some of the components with which it was associated (either naturally or under experimental conditions). Isolated substances can have varying levels of purity in reference to the substances from which they have been associated. Isolated substances and / or entities can be separated from at least around 10, around 20, around 30, around 40, around 50, around 60, around 70, around 80, around 90 % or more of other components to which they were initially associated. In some embodiments, the isolated agents are more than around 80, around 85, around 90, around 91, around 92, around 93, around 94, around 95, around 96, around 97, about 98, about 99% or more of about 99% pure. As used in this invention, a substance is "pure" if it is substantially free of other components. Liposome: As used in this invention, by "liposome" is meant a structure that includes a lipid-containing membrane that encloses an aqueous interior Liposomes may have one or more lipid membranes Liposomes include single layer liposomes (also known in the art as unilamellar liposomes) and multilayer liposomes (also known in the art as multilamellar liposomes).

Metastasis: As used in this invention, the term "metastasis" means the procedure by which cancer spreads from the site where it first arose as a primary tumor to distant sites in the body. A secondary tumor that arose as a result of this procedure may be called a "metastasis." MRNA: As used in this invention, an "mRNA" refers to a messenger ribonucleic acid. An mRNA may or may not be naturally occurring. For example, an mRNA can include naturally occurring and / or modified components, such as one or more nucleobases, nucleosides, nucleotides, or linkers. An mRNA can include a cap structure, a chain terminating nucleoside, a hairpin, a polyA sequence, and / or a polyadenylation signal. An mRNA can have a nucleotide sequence that encodes a polypeptide. Translation of an mRNA, for example, in vivo translation of an mRNA within a mammalian cell, can produce a polypeptide. Traditionally, the building blocks of an mRNA molecule include at least a coding region, a 5 'untranslated region (5' UTR), a 3 'UTR, a 5' end, and a polyA sequence.

MicroRNA ( miRNA): As used in this invention, a "microRNA (miRNA)" is a small non-coding RNA molecule that can function in the post-transcriptional regulation of gene expression (eg, by RNA silencing, as per cleavage of mRNA, destabilization of mRNA by shortening its polyA tail, and / or interfering with the efficiency of translation of mRNA into a polypeptide by a ribosome). A mature miRNA is typically about 22-23 nucleotides long.

MicroRNA ( miRNA) binding site (miR); As used in this invention, a "microRNA (miRNA) (miR) binding site" refers to a miRNA target site (miR) or a miRNA recognition site (miR), or any nucleotide sequence to where a miRNA (miR) binds or associates. In some embodiments, a miRNA binding site (miR) represents a nucleotide location or region of a polynucleotide (eg, mRNA) to which at least the "seed" region of a miRNA (miR) binds. It is to be understood that "binding" may follow traditional Watson-Crick hybridization rules or may reflect any stable association of the miRNA with the target sequence at or adjacent to the microRNA site. When referring to a miRNA binding site (miR), it should be understood that a miRNA sequence (miR) has complementarity (eg, partial, substantial, or complete (or full) complementarity) with the miRNA that binds to the site. binding of miRNA. A miRNA binding site (miR) can be partially complementary to a miRNA (miR), for example, to an endogenous miRNA (miR), as is the case when the miRNA (miR) can exert translational control and / or control stability of the transcription of its corresponding mRNA. Alternatively, a miRNA (miR) binding site can be fully complementary (complete complementarity) to a miRNA (miR), for example an endogenous miRNA (miR), as is the case when the miRNA (miR) can exercise translational control and / or stability control of the transcription of its corresponding mRNA. In preferred aspects of the description, a miRNA binding site (miR) is fully complementary to a miRNA (miR), for example an endogenous miRNA (miR), and can cause cleavage of the mRNA comprising said miRNA (miR ) in cells and / or tissues in vivo, where the corresponding miR is expressed, eg endogenously expressed.

MiRNA seed; As used in this invention, a "seed" region of a miRNA refers to a sequence in the region of positions 2-8 of a mature miRNA, which typically has perfect Watson-Crick complementarity with the binding site. of miRNA. A miRNA seed can include positions 2-8 or 2-7 of a mature miRNA. In some embodiments, a miRNA seed may comprise 7 nucleotides (eg, nucleotides 2-8 of a mature miRNA), where the seed complementary site in the corresponding miRNA binding site is flanked by an adenine (A) opposite miRNA position 1. In some embodiments, a miRNA seed may comprise 6 nucleotides (eg, nucleotides 2-7 of a mature miRNA), where the seed complementary site at the corresponding miRNA binding site is flanked by an adenine (A) opposite miRNA position 1. When referring to a miRNA binding site, it should be understood that a miRNA seed sequence has complementarity (eg, partial, substantial, or complete (or total) complementarity) with the miRNA seed sequence that binds to the site. binding of miRNA.

Modified; As used in this invention, "modified" refers to a changed state or structure of a molecule of the disclosure. Molecules can be modified in many ways, including chemically, structurally, and functionally. In one embodiment, the mRNA molecules of the present disclosure are modified by the introduction of unnatural nucleosides. and / or nucleotides, for example, as regards the natural ribonucleotides A, U, G and C. Non-canonical nucleotides, such as end structures, are not considered "modified", although they differ from the chemical structure of ribonucleotides A, C, G, U.

Nanoparticle; As used in this invention, "nanoparticle" refers to a particle that has any structural characteristics on a scale of less than about 1000 nm that shows new properties compared to a bulk sample of the same material. Nanoparticles routinely have any structural characteristics on a scale of less than about 500 nm, less than about 200 nm, or about 100 nm. Also routinely, nanoparticles have any structural characteristics on a scale of about 50 to about 500 nm, about 50 to about 200 nm, or about 70 to about 120 nm. In exemplary embodiments, a nanoparticle is a particle that has one or more dimensions on the order of about 1 to 1000 nm. In other exemplary embodiments, a nanoparticle is a particle that has one or more dimensions on the order of about 10 to 500 nm. In other exemplary embodiments, a nanoparticle is a particle that has one or more dimensions on the order of about 50 to 200 nm. A spherical nanoparticle would have a diameter, for example, between about 50-100 or 70-120 nanometers. A nanoparticle most often behaves as a whole in terms of its transport and properties. It is observed that the novel properties that differentiate the nanoparticles from the corresponding bulk material generally develop at a scale of size less than 1000 nm, or at a size of about 100 nm, but the nanoparticles can be larger, for example, for particles which are oblong, tubular, and the like. Although the size of most molecules would fit the scheme above, individual molecules are generally not referred to as nanoparticles.

Neutralizing Antibody ( NAB); As used in this invention, a "neutralizing antibody" or "NAB" refers to any antibody that is capable of binding to (ie, interacting with) a target antigen, (such as a therapeutic protein) and inhibit at least one functional activity of the antigen. Binding of a neutralizing antibody to its target antigen can cause a partial inhibition of at least one functional activity of the antigen or a complete inhibition of at least one functional activity of the antigen. In certain cases, the binding of a neutralizing antibody to its target antigen can cause partial or complete inhibition of all functional activities of the target antigen.

Nucleic acid: As used in this invention, the term "nucleic acid" is used in its broadest sense and includes any compound and / or substance that includes a nucleotide polymer. These polymers are often referred to as polynucleotides. Examples of nucleic acids or polynucleotides of the invention include, but are not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), DNA-RNA hybrids, iRNA inducing agents, iRNA agents, siRNA, shRNA, miRNA, RNA antisense, ribozymes, catalytic DNA, RNA that induces triplex formation, threonucleic acids (ATN), glycol nucleic acids (AGN), peptide nucleic acids (PNA), blocked nucleic acids (LNA, including LNA with a pD-ribo configuration, a-LNA with an aL-ribo configuration (a diastereomer of LNA), 2'-amino-LNA with a 2'-amino functionalization and 2'-amino-a-LNA with a 2'-amino functionalization) or hybrids of the themselves.

Patient: As used in this invention, "patient" refers to a subject who may seek or need treatment, who requires treatment, is receiving treatment, will receive treatment, or a subject who is under the care of a trained professional for a disease. or particular condition. In particular embodiments, a patient is a human patient.

Pharmaceutically acceptable: The phrase "pharmaceutically acceptable" is used in this invention to refer to compounds, materials, compositions and / or dosage forms which, according to sound medical judgment, are suitable for use in contact with human and animal tissues without cause excessive toxicity, irritation, allergic response or other problems or complications, with a reasonable corresponding benefit / risk ratio.

Pharmaceutically acceptable excipient: The phrase "pharmaceutically acceptable excipient", as used in this invention, refers to any ingredient other than the compounds described in this invention (eg, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially non-toxic and non-inflammatory in a patient. Excipients may include, for example: non-stick, antioxidants, binders, coatings, compression aids, disintegrants, colorants (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavorings, fragrances, glidants (enhancers of flow), lubricants, preservatives, printing. inks, sorbents, suspending or dispersing agents, sweeteners and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, cross-linked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropylcellulose, hydroxypropylcellulose, hydroxypropylcellulose, hydroxypropylcellulose, , magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, povidone, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium carboxymethyl starch sodium, sorbitol, (corn) starch, stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

Pharmaceutically acceptable salts: As used in this invention, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds in which the parent compound is modified by converting an existing acidic or basic moiety to its salt form (eg, reacting the free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkaline or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include salts of acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, fumarate, glucocero sulfate, fumarate, glucocerophosphate, , heptanoate, hexanoate, hydroxybromide, hydroxychloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate , pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium, quaternary ammonium, and amine cations, including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from inorganic acids or non-toxic organic. The pharmaceutically acceptable salts of the present disclosure can be synthesized from the main compound containing an acidic or basic moiety by conventional chemical procedures. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; Generally, non-aqueous media, such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile, are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, PH Stahl and CG Wermuth (ed.), Wiley-VCH, 2008 and Berge et al., Journal of Pharmaceutical Science, 66, 1-19 (1977).

Polypeptide: As used in this invention, the term "polypeptide" or "polypeptide of interest" refers to a polymer of amino acid residues typically linked by peptide bonds that can occur naturally (eg, in isolation or purified) or synthetically.

Subject: As used in this invention, the term "subject" refers to any organism to which a composition according to the description can be administered, for example, for experimental, diagnostic, prophylactic, cosmetic and / or therapeutic purposes. Typical subjects include animals (eg, mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants. In some embodiments, the subject can be a patient.

Substantially: As used in this invention, the term "substantially" refers to the qualitative condition of showing a total or almost total measure or degree of a characteristic or property of interest. One of ordinary skill in the biological field will understand that biological and chemical phenomena are rarely, if ever, completed and / or completed or achieved or avoided an absolute result. The term "substantially" is used in this invention, therefore, to capture the possible lack of completeness inherent in many biological and chemical phenomena.

Sufferer: An individual "suffering" from a disease, disorder and / or condition has been diagnosed and / or exhibits one or more symptoms of a disease, disorder and / or condition.

Target structure: As used in this invention, a "target structure" is a compound or agent that can target a nanoparticle to a cell, tissue, and / or type of organ.

Therapeutic agent: The term "therapeutic agent" refers to any agent that, after being administered to a subject, has a therapeutic, diagnostic and / or prophylactic effect, and / or produces a desired pharmacological and / or biological effect.

Transfection: As used in this invention, the term "transfection" refers to procedures for introducing a species (eg, a polynucleotide, such as an mRNA) into a cell.

Treat: As used in this invention, the term "treat" refers to alleviating, ameliorating, inhibiting, preventing, delaying the onset of, reducing the severity, and / or reducing the incidence of one or more symptoms or characteristics of a disease. , disorder and / or condition, in whole or in part. For example, "treating" cancer can refer to inhibiting the survival, growth, and / or spread of a tumor. Treatment can be administered to a subject who shows no signs of a disease, disorder, and / or condition, and / or to a subject who shows only initial symptoms of the disease, disorder, and / or condition, in order to decrease the risk of developing pathologies associated with the disease, disorder and / or condition.

Prevent: As used in this invention, the term "prevent" refers to the partial or total inhibition of the appearance of one or more symptoms or characteristics of an infection, disease, disorder and / or condition.

Tumor: As used in this invention, a "tumor" is an abnormal growth of tissue, either benign or malignant.

Unmodified: As used in this invention, "unmodified" refers to any substance, compound, or molecule before it was changed in any way. Unmodified can, but not always, refer to the wild type or the native form of a biomolecule. Molecules can undergo a number of modifications whereby each modified molecule can serve as the "unmodified" starting molecule for further modification.

Equivalents and scope

Those skilled in the art will recognize or be able to determine, using nothing more than routine experiments, many equivalents of specific embodiments according to the description provided in this invention. It is not intended to limit the scope of the present invention to the above description, but rather is set forth in the appended claims.

In the claims, items such as "a", "an" and "the" may mean one or more unless otherwise indicated or otherwise apparent from the context. Claims or descriptions that include "or" between one or more members of a group are considered fulfilled if one, more than one, or all members of the group are present, employed, or otherwise relevant to a product or process. given, unless otherwise stated or otherwise evident from the context. The invention includes embodiments where exactly one member of the group is present, employed or otherwise relevant to a given product or process. The invention includes embodiments where more than one or all of the group members are present, employed, or otherwise relevant to a given product or process.

It should also be noted that the term "comprising" is intended to be comprehensive and allows, but does not require, the inclusion of additional elements or steps. In this invention, when the term "comprising" is used, therefore, the term "consisting of" is also encompassed and described.

When ranges are provided, endpoints are included. In addition, it should be understood that, unless otherwise indicated, or otherwise apparent through the context and understanding of one of ordinary skill in the art, values that are expressed as ranges may take any specific value or sub-range within the ranges established in the different embodiments of the invention, up to one-tenth of the unit from the lower end of the range, unless the context clearly indicates otherwise.

In the case of contradictory statements from a cited source and the present application, the statement of the present application shall prevail.

Examples

The invention will be better understood by referring to the following examples. However, they should not be construed as limiting the scope of the description. It is understood that the examples and embodiments described in this invention are for illustrative purposes only and that various modifications or changes will be suggested to those skilled in the art in light thereof.

Example 1: Encoded mRNA Encoding hEPO Elicits an Anti-Drug Antibody (ADA) Response in Non-Human Primates

In this example, modified mRNA (mmRNA) encoding human erythropoietin (hEPO), but lacking miR binding sites, was administered to cynomologous macaques in a four-week study to examine hEPO expression in animals.

The mmRNA encoding hEPO was formulated into MC3 lipid nanoparticles (LNP), including 50% MC3, 10% DSPC, 38.5% cholesterol, 1.5% PEG-DMG, and N: P -5.5 . (Values are based on mole%). The mRNA construct contained a 5 'end structure of the 1 end (7mG (5') ppp (5 ') NlmpNp), was completely modified with 5-methylcytosine and 1-methylpseudouridine, and comprised a 140 nucleotide poly A tail. The mRNA construct lacked the presence of inserted miR binding sites. The nucleotide sequence of this construct encoding hEPO without any inserted miR binding site is shown in SEQ ID NO: 7 (not showing the polyA tail).

The study included seven groups of animals. The negative control group was treated with PBS. Three treatment groups were treated with one of three different doses of mmRNA LNP encoding hEPO, at 0.02 mg / kg / dose, 0.1 mg / kg / dose, or 0.2 mg / kg / dose. The low dose was selected to achieve at least 2 times the therapeutically effective exposure for human EPO, while the high dose was selected to achieve at least 10 times the hEPO exposure levels over the therapeutically effective dose. The positive control group was treated with recombinant hEPO protein at a dose of 6000 U / kg. Two other control groups were treated with LNP containing an irrelevant mmRNA (non-transcriptional form of mRNA) or with LNP alone. The dosing schedule was once a week for four consecutive weeks (for a total of 5 doses) by intravenous infusion. The infusions were for 60 minutes (IV) through pumps. The four-week dosing period was followed by a four-week recovery evaluation period (control and dose high only).

The hEPO expression levels in the macaques were measured by ELISA six hours after the infusion on each of the treatment days (days 1, 8, 15, 22 and 29). The results are shown in Figure 1. The results demonstrate that the macaques treated with the low dose of mmRNA (0.02 mg / kg / dose) showed a therapeutically effective level of hEPO that remained approximately at the same level during the study of four weeks. In contrast, in macaques treated with medium and high doses of mmRNA (0.1 mg / kg / dose and 0.2 mg / kg / dose), EPO levels decreased from days 8 and 15 of the study and they remained low for the duration of the study. Reticulocyte counts revealed persistent reticulocytopenia in animals treated with medium and high doses of mmRNA (0.1 mg / kg / dose and 0.2 mg / kg / dose). Furthermore, histological analysis revealed decreased hematopoiesis in the bone marrow of animals treated with medium or high doses of mmRNA. Reticulocytopenia and decreased hematopoiesis in animals treated with the highest doses of mmRNA suggested that an anti-drug antibody response (ADA) may have developed over time in the animals.

To determine if an ADA response against human EPO was present, ELISAs were performed on the serum of the animals to detect the presence of cynomologous macaque anti-human EPO antibodies. Blood was collected by femoral venipuncture and serum was collected at room temperature and allowed to clot for at least 30 minutes, followed by centrifugation for 10 minutes in a refrigerated centrifuge (4 ° C) at 2700 rpm. Standard ELISA procedures were used for the detection of anti-human IgG EPO in serum. All samples were analyzed in duplicate.

A series of negative control results was used to establish a threshold level, above which a "positive" result in the assay would constitute. Representative quantitative ELISA results for the negative control samples, which were thus used to establish a threshold level, are shown below in Table 3:

T l R l r l n li i ni r EP nih m n

The ELISA results for the seven different animal groups used in the study are shown below in Table 4:

Table 4: Antibody or EPO response of cynomolous macaques

The results show that all cynomologist monkeys treated with the highest dose of hEPO-encoding mmRNA (0.2 mg / kg / dose), and 50% of cynomologist monkeys treated with the medium level dose (0.1 mg / kg / dose) showed an ADA response against human EPO. This was an unexpected finding and led the inventors to design and test additional mmRNA constructs to try to reduce the response of ADA to the encoded protein in non-human primates. The results of those studies are described in Example 2.

Example 2: Incorporation of a miR-142-3p binding site into mmRNA inhibits an ADA response to the encoded protein

In this example, a human mmRNA construct was prepared encoding EPO, which incorporated a miR-142-3p binding site in the 3 'UTR of the construct. The mRNA construct comprised a 5 'end of the 1 end (7mG (5') ppp (5 ') NlmpNp), was completely modified with 5-methylcytosine and 1-methylpseudouridine, and comprised a poly A tail of approximately 140 nucleotides. A schematic diagram of the construct is shown in Figure 2. The nucleotide sequence of this human EPO encoding mmRNA is shown in SEQ ID NO: 1 (without the poly A tail). The nucleotide sequence of the 3 'UTR comprising the miR-142-3p binding site is shown in SEQ ID NO: 2. The nucleotide sequence of the miR-142-3p binding site is shown in SEQ ID NO: 3. In addition to the addition of the miR-142-3p binding site, the mRNA construct and the LNP preparation were the same as in Example 1.

The cynomologous macaque monkeys were treated with the construct comprising mmRNA encoding hEPO with the miR-142-3p binding site in the LNP at a dose of 0.2 mg / kg / day. This dose had previously been shown to elicit an ADA response against hEPO using a construct lacking the miR-142-3p binding site (see Example 1). A four-week study was conducted, where animals were treated on days 1, 8, 15, 22, and 29 as described in Example 1. Intravenous infusions (60 minutes) were administered via a temporary indwelling catheter in the brachial vein. or saphenous.

To examine whether an ADA response against hEPO was elicited in the animals, ELISAs were performed on the serum of the animals, as described in Example 1, in order to detect the presence of anti-human EPO antibodies from cynomologous macaques.

The results for the four animals (1301, 1302, 1303 and 1304), at each of the five time points for treatment at a dose of 0.2 / mg / kg, are shown below in Table 5. The Sample status as "negative" or "positive" was determined relative to a threshold value established based on the results for negative control samples, as described in Example 1.

Table 5: Antibody or EPO response of cynomolous macaques

The results showed that only one of the four treated monkeys (1303) showed an ADA response against hEPO. Consequently, when the miR-142-3p binding site was incorporated into the mRNA construct encoding hEPO, only 25% of the animals treated with the high dose (0.2 mg / kg) of the construct showed a ADA against the encoded protein (Table 5), while treatment with the same dose using a construct lacking the miR-142.p3 binding site resulted in 100% of the animals showing ADA against the encoded protein ( Table 4).

Figure 3 shows a comparison of ELISA results for monkeys treated with 0.2 mg / kg of the mRNA construct lacking the miR-142-3p binding site and ELISA results for monkeys treated with 0, 2 mg / kg of the mRNA construct containing the miR-142-3p binding site, showing anti-hEPO antibody levels in animals over time. Animals showing an anti-drug antibody (ADA) response are indicated. The results clearly demonstrate that significantly more ADA responses were observed in animals treated with the construct lacking the miR binding site, compared to the construct containing the miR binding site.

In a follow-up study in cynomologous macaque monkeys, results were observed very similar to the pilot study described above. Administration of a mRNA construct that encodes hEPO and lacks the miR-142-p3 binding site resulted in 100% of the animals showing ADA against the encoded protein, while incorporation of a miR binding site -142-3p in the construct resulted in that only 50% of the Animals will show an ADA against the encoded protein. Incorporation of three miR-142-3p binding sites into the construct did not lead to enhanced effects, demonstrating that a single miR-142-3p binding site was sufficient for the reduction of ADA against the encoded protein.

Consequently, these results demonstrate that incorporation of a miR-142-3p binding site into the mmRNA construct is effective in reducing or eliminating an ADA response against the encoded protein.

Example 3: Incorporation of a miR-126 or miR-142 binding site into mmRNA inhibits B cell activation and cytokine expression

In this example, human mmRNA constructs encoding EPO were prepared and incorporated a miR-142-3p binding site or a miR-126-3p binding site, or both a miR-142-3p and a binding site. of miR-126-3p, in the 3 'UTR of the construct. The mmRNA constructs were administered to mice to examine the effects of incorporating miR binding sites on various immune parameters in mice.

The mmRNA constructs contained a 5 'end structure of the 1 end (7mG (5') ppp (5 ') NlmpNp), was completely modified with 5-methylcytosine and 1-methylpseudouridine, and comprised a 140 nucleotide poly A tail. The control mmRNA construct lacked the presence of inserted miR binding sites. The nucleotide sequence of this control construct which encodes hEPO and has no inserted miR binding site is shown in SEQ ID NO: 7 (without showing the poly A tail). The nucleotide sequence of the construct encoding hEPO with the inserted miR-142-3p binding site is shown in SEQ ID NO: 1 (not showing the poly A tail). The nucleotide sequence of the construct encoding hEPO with the inserted miR-126-3p site is shown in SEQ ID NO: 28 (not showing the poly A tail). The nucleotide sequence of the construct encoding hEPO with the inserted miR 142-3p and miR-126-3p sites is shown in SEQ ID NO: 29 (without showing the poly A tail). A schematic diagram of exemplary mmRNA constructs is shown in Figure 2. The mmRNA constructs encoding hEPO were formulated in MC3 lipid nanoparticles (LNP), including 50% MC3, 10% DSPC, 38.5% cholesterol, and 1.5% PEG-DMG, N: P ~ 5.5. (Values are based on mole%).

In an initial study, groups of 30 mice each were assigned to the following treatment groups: (i) hEpo construct without any miR binding site; (ii) hEpo construct with a miR-142-3p binding site; (iii) hEpo construct with a miR-126-3p binding site; and (iv) hEpo construct with miR-142-3p and miR-126-3p binding sites. The mRNAs were administered intravenously to C57B1 / 6 mice at a dose of 0.05mg / kg. The dosing regimen was Days 1, 8, 15, 22, 29, and 36. For each treatment group, 5 mice were dosed per group on each dose day, for a total of 6 doses. The 25 additional mice in each group were divided into 5 subsets, such that 5 mice were dosed once on each of dose days 8, 15, 22, 29, and 36, for a total of one dose per mouse. .

After treatment, mice were examined for: (i) protein expression from the mRNA construct by measuring hEpo (in ng / ml), (ii) B cell frequency by measuring% CD19 + spleen cells , and (iii) the frequency of activated B cells by measuring the% of activated CD19 + cells in CD19 + spleen cells. The results for these three readings are shown in Figures 4A, B, and C, respectively. The results of this initial study demonstrated that there was no noticeable difference in protein expression when including miR-142-3p or miR-126 binding sites, alone or in combination, but there was a small but statistically significant decrease in B cell activation, observed by inclusion of the miR-126-3p binding site, alone or in combination with the miR-142-3p binding site in mmRNA constructs.

To further study this initial observation, a second set of experiments was performed to test the mRNA constructs at a higher dose (to provide the highest sensitivity) and with a larger number of mice per group (to increase statistical confidence). . The dosing regimen was on Days 1 and 8. Twelve mice per group were dosed intravenously on Day 1 with 0.2 mg / kg or 1 mg / kg of one of the four different mmRNA constructs described above (hEpo; hEpo miR-142-3p; hEPO miR-126-3p; or hEpo miR-142-3p / miR-126-3p), formulated in the LNP MC3. Six hours after dosing on Day 1, serum was collected for analysis of protein level expression by Epo ELISA. In addition, six hours after dosing on Day 1, spleens were collected from six of the mice for B cell analysis. The remaining six mice per group were redosed on Day 8, which was followed by serum collection and spleen collection 6 hours after dosing for further analysis.

Results for protein expression are shown in Figures 5A-B (for a dose, either 0.2 mg / kg in Figure 5A or 1 mg / kg in Figure 5B) and Figures 6A- B (for two doses, at 0.2 mg / kg for Figure 6A or 1 mg / kg for Figure 6B). The results demonstrated that the level of expression of the protein of interest encoded by the mRNA construct is not significantly affected by the inclusion of miR binding sites (miR-142-3p, miR-126-3p or both) in the construct. Protein expression was further monitored during week 6 of the study. Expression was reduced at week 4 and, by week 5, expression was reduced almost to baseline (data not shown). At week 6, almost all mice in the control group lacked expression, while the inclusion of the miR binding site (s) in the mRNA construct (miR-142-3p, miR-126-3p, or both) maintained significant levels of expression (Figure 29).

Results for B cell frequency and activated B cell frequency for single dose treatment are shown in Figures 7 and 8, respectively. Results for B cell frequency and activated B cell frequency for the two dose treatment are shown in Figures 9 and 10, respectively. These results showed that the overall frequency of B cells was not significantly affected by the inclusion of miRs in mmRNA constructs, but that B cell activation was slightly decreased in the presence of the miR-142-3p binding site. and was significantly reduced by the presence of the miR-126-3p binding site (alone or in combination with the miR-142-3p binding site). The frequency of B cells and the frequency of activated B cells were measured weekly until week 6 of the study and similar results were observed throughout the course of the study, with frequencies of total B cells not significantly affected by the inclusion of miR binding sites, but with activated B cell frequencies inhibited by the presence of the miR-142-3p or miR-126-3p binding site alone, or both miR binding sites in combination .

Results for IL-6 expression for mice treated with one dose are shown in Figures 11A-B (0.2 mg / kg for Figure 11A and 1 mg / kg for Figure 11B) and, for mice treated with two doses are shown in Figures 12A-B (0.2 mg / kg for Figure 12A and 1 mg / kg for Figure 12B). These results demonstrate that IL-6 expression is decreased in the presence of the miR-142-3p binding site and is further reduced by the presence of the miR-126-3p binding site (alone or in combination with the miR-126-3p binding site). binding of miR-142-3p).

Cytokine expression was further examined by measuring levels of TNF-α and IFN-y, as well as levels of IL-6. The results for these three cytokines for mice treated with two doses at 0.2 mg / kg are shown in Figures 13A (IL-6), 13B (TNF-a) and 13C (IFN-y) and, for the treated mice with two doses at 1 mg / kg, they are shown in Figures 14A (IL-6), 14B (TNF-a) and 14C (IFN-y). These results demonstrate that the expression of all three cytokines (IL-6, TNF-a and IFN-y) is decreased in the presence of the miR-142-3p binding site and is further reduced by the presence of the binding site of miR-126-3p (alone or in combination with the miR-142-3p binding site).

Cytokine expression was additionally monitored weekly until week 6 of the study, which demonstrated that the levels of all three cytokines in the serum, IL-6, IFN- ^y and TNF-α, were significantly inhibited by the presence of the miR-142-3p binding site or the miR-126-3p binding site alone, or both miR binding sites in combination, in the mRNA construct.

Accordingly, the studies described above demonstrate that incorporation into an mRNA construct of a miR-126-3p binding site, a miR-142-3p binding site, or both miR binding sites in combination, gives as results in a reduced frequency of B cell activation and a reduced secretion of a panel of different immunostimulatory cytokines (IL-6, TNF-α, IFN- ^y ) in vivo in animals treated with the mRNA construct, while having minimal impact. in the expression of a protein of interest encoded by the mRNA construct in the treated animal.

Example 4: Additional studies incorporating miR-126 and / or miR-142 binding sites in mmRNA constructs

In this example, mmRNA constructs were prepared that encoded luciferase and incorporated a miR-142-3p binding site or a miR-126-3p binding site, or both a miR-142-3p and a miR-142-3p binding site. miR-126-3p, in the 3 'UTR of the construct. The mmRNA constructs were administered to mice to examine the effects of incorporating miR binding sites on various immune parameters in mice. The mmRNA constructs contained a 5 'end structure of the 1 end (7mG (5') ppp (5 ') NlmpNp), was completely modified with 5-methylcytosine and 1-methylpseudouridine, and comprised a 100 nucleotide poly A tail. The control mmRNA construct lacked the presence of known miR binding sites. The mRNA constructs that encode luciferase (Luc) were formulated in MC3 lipid nanoparticles (LNP), including 50% MC3, 10% DSPC, 38.5% cholesterol and 1.5 PEG-d Mg. %, N: P ~ 5.5. (Values are based on mole%).

In an initial study, groups of 24 mice each were assigned to the following treatment groups: (i) Luciferase construct (Luc) without any miR binding site (the sequence of which is shown in SEQ ID NO: 30); (ii) Luc construct with a miR-142-3p binding site (the sequence of which is shown in SEQ ID NO: 31); (i¡¡) Luc construct with a binding site of miR-126-3p (the sequence of which is shown in SEQ ID NO: 32); and (iv) Luc construct with miR-142-3p and miR-126-3p binding sites (the sequence of which is shown in SEQ ID NO: 33). The mmRNAs were administered intravenously to C57B1 / 6 mice at a dose of 0.2 mg / kg. In each group, 15 mice were selected to dose on days 1, 8, 15, 22, 29, and 36, 3 mice were administered only once on Day 22, and 3 mice were administered only once on Day 36. Of the 15 mice Selected for repeat dosing, 5 were sacrificed for spleen harvesting 6 hours after the dose on Day 1, 6 hours after the dose on Day 22 and 6 hours after the dose on Day 36.

After treatment, mice were examined for: (i) luciferase expression of the mRNA construct by measuring total body luminescence; (ii) total B cell frequency by measuring% CD19 + spleen cells; (iii) the frequency of activated B cells by measuring the% activated CD19 + cells in splenic CD19 + cells; and (iv) the production of cytokines (IL-6, IFN-y, TNF-a).

Results for luciferase expression are shown in Figures 15A and 15B. Figure 15A shows the results after 1 week (1 dose) and Figure 15B shows the results after 2 weeks (or 2 doses). Luc levels were much more variable than the hEPO levels analyzed in Example 1. However, the results demonstrated that the expression level of the protein of interest (Luc) encoded by the mmRNA construct is not significantly affected by the inclusion of miR binding sites (miR-142-3p, miR-126-3p or both) in the construct. Protein expression was further monitored during week 6 of the study. Luciferase expression showed modest or no change during the 6 weeks. Figure 30 shows the expression at week 5.

Results for B cell frequency and activated B cell frequency for the two-dose treatment are shown in Figures 16 and 17, respectively. Results shown are from week 1 (1 dose). These results showed that the overall and total frequency of B cells was not significantly affected by the inclusion of miR binding sites in mmRNA constructs, but that the frequency of activated B cells was slightly decreased in the presence of the site of binding of miR-142-3p and was significantly reduced by the presence of the miR-126-3p binding site (alone or in combination with the miR-142-3p binding site). The reduced frequency of activated B cells was not due to reduced numbers of CD19 + cells since (i) we measured the percentage of activated B cells within the total population of B cells, and (ii) the frequencies of B cells did not fluctuate between the groups. The frequency of B cells and the frequency of activated B cells were measured weekly until week 6 of the study and similar results were observed throughout the course of the study, with frequencies of total B cells not significantly affected by the inclusion of miR binding sites, but with activated B cell frequencies inhibited by the presence of the miR-142-3p or miR-126-3p binding site alone, or both miR binding sites in combination .

Cytokine expression was examined by measuring the levels of IL-6, IFN-y and TNF-α in serum. The results for these three cytokines for mice treated with 0.2 mg / kg mmRNA are shown in Figures 18A (IL-6), 18B (IFN- ^y ) and 18C (TNF-a). Results shown are for the week. two; Similar results were seen at week 1 and week 3. Again, more variability in cytokine expression was observed in Luc-treated animals compared to hEPO-treated animals described in Example 1. However, these results demonstrate that the expression of at least some cytokines (most markedly with IFN- ^y and TNF-a) is decreased in the presence of the miR-142-3p binding site and / or the miR-126-3p binding site, alone or in combination. Cytokine expression was further monitored until week 6 of the study, which demonstrated that the levels of all three cytokines in the serum, IL-6, IFN- ^y and TNF-α, were significantly inhibited by the presence of the site of binding of miR-142-3p or the miR-126-3p binding site alone, or both miR binding sites in combination, in the mRNA construct.

Accordingly, the studies described above demonstrate that incorporation into an mRNA construct of a miR-126-3p binding site, a miR-142-3p binding site, or both miR binding sites in combination, gives as result in a reduced frequency of B cell activation and a reduced secretion of a panel of different immunostimulating cytokines (TNF-a, IFN- ^y ) in vivo in animals treated with the mRNA construct, while having minimal impact on the expression of a protein of interest encoded by the mRNA construct in the treated animal.

Example 5: Additional studies incorporating miR-142 and / or miR-155 binding sites in mmRNA constructs

In this example, mmRNA constructs were prepared that encode EPO and incorporate a miR-142-3p binding site, a miR-142-5p binding site, a miR-155-5p binding site, or combinations of the same, and / or multiple copies thereof, within the 3 'UTR of the construct. The sequence of miR-155-5p on which the insertion of the binding site was designed is as follows: uuaaugcuaauugugauaggggu (SEQ ID NO: 34). The miR-155-5p binding site inserted in the 3 'UTR has the following sequence: ACCCCTATCACAATTAGCATTAA (SEQ ID NO: 35).

The mmRNA constructs were administered to mice to examine the effects of incorporating miR binding sites on various immune parameters in mice. The mmRNA constructs contained a 5 'end structure of the 1 end (7mG (5') ppp (5 ') NlmpNp), was completely modified with 5-methylcytosine and 1-methylpseudouridine, and comprised a 100 nucleotide poly A tail. The control mmRNA construct lacked the presence of inserted miR binding sites. The mRNA constructs encoding EPO were formulated in MC3 lipid nanoparticles (LNP), including 50% MC3, 10% DSPC, 38.5 % cholesterol and 1.5% PEG-DMG, N: P ~ 5, 5. (Values are based on mole%).

In this study, mice were assigned to one of the following treatment groups: (i) EPO construct without any miR binding site (the sequence of which is shown in SEQ ID NO: 36); (ii) EPO construct with a miR-142-3p binding site (the sequence of which is shown in SEQ ID NO: 37); (iii) EPO construct with three miR-142-3p binding sites (EPO_3X-miR-142-3p) (the sequence of which is shown in SEQ ID NO: 38); (iv) EPO construct with a miR-142-5p binding site (the sequence of which is shown in SEQ ID NO: 39); (v) EPO construct with three miR-142-5p binding sites (EPO_3X-miR-142-5p) (the sequence of which is shown in SEQ ID NO: 40); (vi) EPO construct with two miR-142-5p binding sites and one miR-142-3p binding site (EPO_2X-miR-142-5p_1X-miR-142-3p) (whose sequence is shown in SEQ ID NO: 41); (vii) E ^p O construct with a miR-155-5p binding site (the sequence of which is shown in SEQ ID NO: 42); (viii) EPO construct with three miR-155-5p binding sites (EpO_3X-miR-155) (the sequence of which is shown in SEQ ID NO: 43); (ix) EPO construct with two miR-155-5p binding sites and one miR-142-3p binding site (EPO_2X-miR-155-5p_1X-miR-142-3p) (whose sequence is shown in SEQ ID NO: 44); and (x) LNP with non-transcriptional control sequence ("empty"). The mmRNAs were administered intravenously to C57B1 / 6 mice at a dose of 0.2 mg / kg. The dosing regimen was Days 1 and 8.

After treatment, mice were examined for: (i) protein expression of the mRNA construct by measuring levels of encoded EPO (in ng / ml); (ii) total B cell frequency by measuring% CD19 + spleen cells; (iii) the frequency of activated B cells by measuring the% activated CD19 + cells in splenic CD19 + cells; and (iv) the production of cytokines (IL-6, IFN-y, TNF-a).

The results for the expression of the EPO protein are shown in Figures 19A-B, with Figure 19A showing the results at week 1 and Figure 19B showing the results for week 2. The results demonstrated that the expression level of the protein of interest (EPO) encoded by the mRNA construct is not significantly affected by the inclusion of miR binding sites (miR-142-3p, miR-142-5p, miR-155-5p or multiple copies and / or combinations thereof) in the construct.

The results for B cell frequency and activated B cell frequency are shown in Figures 20 and 21, respectively, for week 1, and in Figures 22 and 23, respectively, for week 2. These results showed that the total frequency of B cells was not significantly affected by the inclusion of miRs in the EPO mmRNA constructs, but the frequency of activated B cells is decreased in the presence of the miR-142-3p binding site, the miR-142-5p binding site, miR-155-5p binding site, or multiple copies thereof and / or combinations thereof.

Cytokine expression was examined by measuring the levels of IL-6, TNF-α and TNF-Y in serum. The results for these three cytokines for mice treated with 0.2 mg / kg mmRNA are shown in Figures 24A (IL-6), 24B (TNF-a) and 24C (IFN-y). Results shown are for week 2. Variability in cytokine expression was observed in EPO-treated animals. However, these results demonstrate that the expression of at least some cytokines is decreased in the presence of the miR-142-3p binding site, the miR-142-5p binding site, the miR-155-5p binding site, or multiple copies thereof and / or combinations thereof.

Accordingly, the studies described above demonstrate that incorporation into an mRNA construct of a miR-142-3p binding site, a miR-142-5p binding site, a miR-155-5p binding site, or multiple copies thereof and / or combinations thereof, results in a reduced frequency of activation of B cells and a reduced secretion of a panel of different immunostimulatory cytokines in vivo in animals treated with the mRNA construct, while having minimal impact on the expression of a protein of interest encoded by the mRNA construct in the treated animal.

Example 6: Effect of miR Binding Sites on Particular Immune Cell Populations

In this example, studies were conducted to examine the effect of the inclusion in mRNA constructs of a miR binding site expressed in immune cells (miR-142, miR-126, or both miR-142 and miR-126) on the frequency and the activation of particular populations of immune cells. Balb / c mice were treated with EPO-encoding mRNA constructs as described above in Example 3, which constructs either lacked miR binding sites or contained a miR-142-3p binding site, a miR-126-3p binding or both a miR-142-3p binding site and a miR-126-3p binding site. Mice were treated intravenously on days 1, 8 and 15 with 0.2 mg / kg of the mRNA construct formulated in MC3 lipid nanoparticles. A first set of experiments examined whether miRs had any effect on the frequency of CD27 + B cells or the level of CD27 expression in these cells. The results are shown in Figures 25A-B. Figure 25A shows the frequency of CD27 + CD19 + B cells in splenic CD19 + B cells, demonstrating that the CD27 + B cell population was not affected by the inclusion of miR binding sites in mRNA constructs. Figure 25B shows the level of CD27 expression in the CD27 + B cell population and also shows that this expression was not affected by the inclusion of the miR binding site (s) in the mRNA constructs. Consequently, this first set of experiments demonstrated that the effect of miR binding sites in inhibiting B cell activation and / or inhibiting cytokine production was not the result of the binding sites of miR miR will affect either the frequency of CD27 + CD19 + B cells or the level of CD27 expression in these cells.

A second set of experiments examined whether miRs had any effect on the frequency of CD11c + cells, as a marker for dendritic cells, and / or the frequency of activated dendritic cells (CD11c + CD70 + CD86 + cells). The results are shown in Figures 26A-B. Figure 26A shows the percentage of CD11c + cells in spleen cells of mice, demonstrating that the total frequency of CD11c + cells was inhibited by the inclusion of the miR-142-3p binding site, the miR- binding site. 126-3p, or both binding sites, in mRNA constructs. Figure 26B shows the frequency of activated dendritic cells (cells (CD11c + CD70 + CD86 +) within the CD11c + splenic cell population, also shows that the frequency of activated dendritic cells was inhibited by the inclusion of miR binding sites in mRNA constructs. Consequently, this second set of experiments demonstrated that the inclusion of miR binding sites inhibited both the total frequency of dendritic cells and the frequency of activated dendritic cells, implicating this cell population in the mechanism of how inclusion of the miR binding site (s) leads to inhibition of B cell activation and inhibition of cytokine production. While not intended to be limited by mechanism, these results suggest that In mice, decreased levels of activated CD70 + dendritic cells lead to decreased interaction with CD27 + B cells, which leading to decreased B cell activation and decreased cytokine production.

To further investigate this, a third set of experiments was performed in which the ability of mouse plasmacytoid dendritic cells (pDC) to stimulate naive B cell proliferation was examined. For these experiments, 2x105 naive CFSE-tagged B cells were incubated with 4x104 pDC purified from the spleen of mice injected with either hEPO mRNA, hEPO mRNA miR142, hEPO mRNA miR126, or hEPO mRNA miR126 + 142 in the presence of anti IgM at 10 µg / ml. After 5 days of culture, cells were harvested and analyzed by flow cytometry for CFSE expression. The proliferation levels of naïve B cells incubated with the pDCs are shown in the graph of Figure 27. The results demonstrate that naïve B cells proliferate less in the presence of pDC from mice treated with the mRNA constructs that include the site of binding of miR-142, the miR-126 binding site, or both binding sites. These experiments further support the mechanism that in mice treated with miR-containing constructs, decreased levels of activated pDC leads to less B-cell stimulation, leading to inhibition of B-cell activation. and inhibition of cytokine production.

Example 7: Effect of miR binding sites on IgM

In this example, studies were conducted to examine the effect of inclusion in mRNA constructs of a miR binding site expressed in immune cells (miR-142, miR-126 or both miR-142 and miR-126) on the levels of IgM that binds to PEG (anti-PEG IgM). Since PEG is a component of the LNP in which the mRNA construct is encapsulated, the presence of anti-PEG IgM in the serum of mice contributes to the accelerated blood clearance (AUC) of the LNP / mRNA composition.

Mice were treated with the Luciferase-encoding mRNA constructs as described in Example 2. Serum was collected from the mice after the second, third, and fourth doses of treatment and serum anti-PEG IgM levels were measured. (in ng / ml). The results are shown in Figures 28A-C. Figure 28A shows the anti-PEG IgM levels after the second dose, Figure 28B shows the anti-PEG IgM levels after the third dose and Figure 28C shows the anti-PEG IgM levels after the fourth dose . The results demonstrate that the inclusion of miR binding sites significantly decreased the level of anti-PEG IgM in the mice. This effect was already observed after treatment with the second dose and the effect continued during treatment with the fourth dose. This reduction in anti-PEG IgM in mice treated with the mRNA constructs containing the miR binding site indicates that AUC, which is mediated at least in part by anti-PEG IgM, is expected to be reduced in these mice.

Example 8: Effect of only one miR binding site against multiple miR binding sites

In this example, studies were conducted to examine the effect of inclusion in mRNA constructs of a single miR binding site (1X) versus multiple miR binding sites (e.g., 3X, which has 3 binding sites of miR).

A first series of studies was conducted to examine miR-122, which is known to regulate mRNA expression in liver cells. To determine the effect of the inclusion of one against three miR-122 binding sites on the expression of a protein encoded by an mRNA construct, primary hepatocytes were co-transfected using Lipofectamine 2000 with a luciferase mRNA construct (Luc) and an enhanced green fluorescent protein (eGFP) mRNA construct, where the 3 'UTR of each construct (i) lacked any miR-122 binding site (control); (ii) contained a miR-122 binding site; or (iii) contained three miR-122 binding sites. Another control included transfection with Luc-like and eGFP-like RNA sequences without ATG in the putative coding sequence. The mRNA sequences of these four eGFP constructs are shown in SEQ ID NO: 61-64, respectively. The mRNA sequences of these four Luc constructs are shown in SEQ ID NO: 65-68, respectively. The sequence of the 3 'UTR containing three miR-122 binding sites is shown in SEQ ID NO: 54.

Cells were transfected with either 7, 5, 15, 50, or 100 ng of mRNA. The total green integrated intensity was measured over time for 24 hours. The results are shown in Figures 31A-D, which demonstrate that at lower mRNA doses (7.5 and 15 ng, in Figures 31A and 31B, respectively), the miR-1221X constructs and miR-1223X constructs led to a significant reduction in eGFP expression in primary hepatocytes, while at the highest doses of mRNA (50 and 100 ng, in Figures 31C and 31D, respectively), the miR-1223X constructs showed greater inhibition. of eGFP expression than the 1X miR-122 constructs, and at higher doses the 3X miR-122 constructs were able to maintain this loss of protein expression over time. Luciferase luminescence was also examined in primary hepatocytes and similar results were observed: that 3X miR-122 constructs led to a greater decrease in protein expression, particularly at higher doses of mRNA.

In a second series of experiments to examine the effect of inclusion of one versus three miR-122 binding sites on the expression of a protein encoded by an mRNA construct, primary hepatocytes were transfected using Lipofectamine 2000 with an mRNA construct that encodes a caspase and has, in its 3 'UTR, either (i) no miR-122 binding site (control); (ii) a miR-122 binding site; or (iii) three miR-122 binding sites. Another control included transfection with Caspase-like RNA sequences without ATG in the putative coding sequence. The mRNA sequences of these four caspase constructs are shown in SEQ ID NO: 69-72, respectively. Caspase-mediated toxicity was measured over time for 24 hours. The results are shown in Figures 32A-D, which demonstrate that at the lowest mRNA dose (7.5 ng, in Figure 32A), both the 1X miR-122 and the 3X miR-122 constructs inhibited the mediated toxicity. by caspase, the miR-1223X construct having a much stronger effect in inhibiting toxicity. Furthermore, at the highest doses of mRNA (15 ng, 50 ng, and 100 ng, in Figs. 32B, 32C, and 32D, respectively), only the miR-1223X construct was able to inhibit caspase-mediated toxicity. Studies were also conducted to transfect primary hepatocytes with the caspase mRNA construct into an MC3 lipid nanoparticle and similar results were observed: relief of caspase-mediated toxicity was significantly stronger with the miR-1223X construct than with the miR- construct. 1221X.

To confirm these results of the in vitro in vivo study, Balb / c mice were co-administered Luc mRNA and eGFP constructs (0.5 mg / kg), in MC3 nanoparticles, containing zero, one or three sites of binding of miR-122. The fluorescence of eGFP in the liver was examined, the results of which showed that the inclusion of one miR-122 binding site led to a modest decrease in the expression of eGFP in the liver, while the inclusion of three miR-binding sites -122 led to a significant decrease in eGFP expression in the liver. Similar results were seen for luciferase expression, with a 1X site reducing luciferase expression and 3X sites leading to a greater reduction in protein expression.

In a third series of experiments, cynomologous monkeys were administered hEPO mRNA constructs (0.2 mg / kg), in MC3 nanoparticles, containing zero, one, or three miR-142-3p binding sites at the 3 'UTR. The expression levels of hEPO (in ng / ml) in the monkeys were measured by ELISA, the results of which are shown in Figure 33. The results show that the inclusion of 3X binding sites of miR-142-3p in the construct of hEPO led to significantly lower expression of hEPO compared to constructs with zero or one miR-142-3p binding site.

In general, the studies described above demonstrate the benefit of including at least one miR binding site in mRNA constructs and the enhanced effect of including three miR binding sites in the construct.

Example 9: Effect of miR binding sites in the 5 'untranslated region (5' UTR)

In this example, studies were conducted to examine the effect of inclusion in mRNA constructs of a miR binding site at one of three different insertion sites within the 5 'UTR of the mRNA construct. The sequence of the 5 'UTR used is shown below: GGGAAATAAGAG ^ AGAAAAGAAGAGTA ^ AGAAGAAATATA ^ AGAGCCACC (SEQ ID NO: 53), with the three possible insertion sites (P1, P2, P3) indicated by a caret (□ ). The sequences of the 5 'UTR that have a miR-142-3p binding site inserted at P1, P2, or P3 are shown in SEQ ID NO: 55-57, respectively. The 5 'UTR sequences that have a miR-122 binding site inserted at P1, P2, or P3 are shown in SEQ ID NO: 58-60, respectively.

In a first series of experiments, enhanced green fluorescent protein (eGFP) mRNA constructs were transfected into RAW264.7 murine macrophage cells using Lipofectamine 2000, where the constructs contained 1x or 3x miR-142-3p binding sites in the 3 'UTR, or contained a miR-142-3p binding site inserted at P1, P2 or P3 of the 5' UTR, or contained a miR-142-3p binding site inserted at P1, P2 or P3 of the 5 'UTR in combination with a single miR-142-3p binding site in the 3' UTR. The eGFP fluorescence was measured at 48 hours after transfection. The results are shown in Figure 34. The results demonstrate that all the constructs tested, even those with the miR-142-3p binding site inserted at P1, P2 or P3, alone or in combination with a binding site of miR-142-3p in the 3 'UTR, led to the significant reduction of protein expression in cells.

Similar constructs were made using hEPO as the encoded protein and similar experiments were performed with transfected RAW264.7 cells. The results with the hEPO constructs were very similar to those with the eGFP constructs, with all the constructs tested, even those with the miR binding site inserted at P1, P2 or P3, alone or in combination with a site of miR binding at the 3 'UTR, led to significant reduction of protein expression in cells. However, with the hEPO constructs, the degree of inhibition by the 5 'UTR constructs P1, P2, and P3 was slightly lower (60, 73, and 93%, respectively) compared to the degree of inhibition with the constructs of eGFP (89, 96 and 98%, respectively).

In a second series of experiments, the hEPO mRNA constructs were made similar to those described above, except that the constructs contained 1x or 3x miR-122 binding sites in the 3 'UTR, or contained a miR-122 binding site. -122 inserted either at P1, P2, or P3 of the 5 'UTR, or contained a miR-122 binding site inserted at P1, P2, or P3 of the 5' UTR combined with a single miR binding site -122 in the 3 'UTR. The mRNA constructs were transfected into primary hepatocytes using Lipofectamine 2000. The expression of hEPO (in ng / mL) was measured by ELISA, the results of which are shown in Figure 35. The results demonstrate that all the tested constructs, even those with the miR-122 binding site inserted in P1, P2 or P3 alone or in combination with a miR-122 binding site in the 3 'UTR led to significantly reduced protein expression in cells.

Claims (14)

1. A messenger RNA (mRNA) encoding a polypeptide of interest, where the mRNA comprises: (i) at least one miR-142-3p microRNA binding site; (ii) at least one miR-126 binding site; or (iii) at least one miR-142-3p microRNA binding site and at least one miR-126 binding site, optionally where the mRNA comprises one or more modified nucleobases, for use in a method to reduce or inhibit a anti-drug antibody response in a subject, the method comprises administering the mRNA to the subject such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject. 2. A modified messenger RNA (mRNA) encoding a polypeptide of interest, wherein the mRNA comprises: (i) at least one miR-142-3p microRNA binding site; (ii) at least one miR-126 binding site; or (iii) at least one miR-142-3p microRNA binding site and at least one miR-126 binding site, and wherein the mRNA comprises one or more modified nucleobases, for use in a reduction or inhibition procedure of drug-related toxicity in a subject, the method comprising administering the mRNA to the subject, such that drug-related toxicity to the polypeptide of interest is reduced or inhibited in the subject. 3. The mRNA for the use of any of the preceding claims, wherein the mRNA is administered intravenously encapsulated in a lipid nanoparticle, optionally by weekly infusion. 4. A modified mRNA encoding a polypeptide of interest encapsulated in an LNP (lipid nanoparticle), where the mRNA comprises: (i) at least one miR-142-3p microRNA binding site; (ii) at least one miR-126 binding site; or (iii) at least one miR-142-3p microRNA binding site and at least one miR-126 binding site and wherein the mRNA comprises one or more modified nucleobases; for use in a method of reducing or inhibiting an anti-drug antibody response after repeated administration of the polypeptide of interest to a subject, the method comprising administer to the subject intravenously a first dose of the encapsulated mRNA and administering to the subject intravenously a second dose of the mRNA encapsulated in an LNP, such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject. 5. A modified mRNA encoding a polypeptide of interest encapsulated in an LNP, where the mRNA comprises: (i) at least one miR-142-3p microRNA binding site; (ii) at least one miR-126 binding site; or (iii) at least one miR-142-3p microRNA binding site and at least one miR-126 binding site, and wherein the mRNA comprises one or more modified nucleobases, for use in a method of reducing or inhibiting an anti-drug antibody response after repeated administration of the polypeptide of interest to a subject, the method comprising (i) administering the subject intravenously a first dose of the encapsulated mRNA LNP, (ii) detecting a level of anti-drug antibodies in a sample from a subject; Y (iii) administering to the subject intravenously a second dose of mRNA encapsulated in an LNP when the level of anti-drug antibodies in the sample decreases, such that an anti-drug antibody response to the polypeptide of interest is reduced or inhibited in the subject. The mRNA for the use of any of the preceding claims, wherein the mRNA comprises a 5 'UTR, a codon optimized open reading frame encoding the polypeptide of interest, a 3' UTR comprising (i) the at least one miR-142-3p microRNA binding site; (ii) the at least one miR-126 binding site; or (iii) the at least one miR-142-3p microRNA binding site and at least one miR-126 binding site, and a linked nucleoside 3 'tail region, and / or where the mRNA comprises a 5 'UTR and a 3' UTR that are heterologous to the coding region, and / or where the mRNA is completely modified. 7. The mRNA for the use of any of the preceding claims, wherein the mRNA comprises pseudouridine (y), pseudouridine (y) and 5-methyl-cytidine (m5C), 1-methyl-pseudouridine (m1 ^), 1-methyl -pseudouridine (m1 ^) and 5-methyl-cytidine (m5C), 2-thiouridine (s2U), 2-thiouridine and 5-methyl-cytidine (m5C), 5-methoxy-uridine (mo5U), 5-methoxy-uridine (mo5U) and 5-methyl-cytidine (m5C), 2'-O-methyl uridine, 2'-O-methyl uridine and 5-methyl-cytidine (m5C), N6-methyladenosine (m6A) or N6-methyl-adenosine (m6A) and 5-methyl-cytidine (m5C). 8. The mRNA for the use of any of the preceding claims, wherein the mRNA comprises pseudouridine (y), Nl-methylpseudouridine (m1 ^), 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1- methyl-1-deazapseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thiopseudouridine, 4-methoxy-2-thio- pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thiopseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine or 2'-O-methyl uridine, or combinations thereof. 9. The mRNA for the use of any of the preceding claims wherein the mRNA comprises 1-methylpseudouridine (mlY), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), pseudouridine (y), a-thio -guanosine or α-thioadenosine, or combinations thereof. The mRNA for the use of any of the preceding claims, wherein the polypeptide of interest is a therapeutic protein, a cytokine, a growth factor, an antibody or a fusion protein, and / or, The mRNA is in a nanoparticle lipid and / or where the lipid nanoparticle comprises a cationic and / or ionizable lipid, optionally where the cationic and / or ionizable lipid is DLin-KC2-DMA or DLin-MC3-DMA. 11. The mRNA for the use of any of the preceding claims, wherein (a) the mRNA comprises at least one miR-142-3p microRNA binding site comprising the sequence shown in SEQ ID NO: 3 or (b) the mRNA comprises at least two microRNA binding sites, where at least one of the microRNA binding sites is a miR-142-3p microRNA binding site, optionally where the mRNA comprises a miR binding site -142-3p and a second microRNA binding site for a miR selected from the group consisting of miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR -16, miR-21, miR-223, miR-24 and miR-27 or (c) the mRNA comprises at least one miR-126 microRNA binding site comprising the sequence shown in S ^and Q ID NO: 26 or (d) the mRNA comprises at least two microRNA binding sites, where at least one of the microRNA binding sites is a miR-126 microRNA binding site, optionally where the mRNA comprises a miR-126 binding site and a second microRNA binding site for a miR selected from the group consisting of miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-16 , miR-21, miR-223, miR-24 and miR-27 or (e) the mRNA construct comprises a miR-126 binding site and a miR-142-3p binding site. 12. The mRNA for the use of any of claims 1-7, wherein the mRNA construct comprises three miR-142-3p binding sites or three miR-126 binding sites. 13. The mRNA for the use of any of claims 1-7, wherein the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon and where the (i) at least one miR-142-3p microRNA binding site; (ii) at least one miR-126 binding site; or (iii) at least one miR-142-3p microRNA binding site and at least one miR-126 binding site are found within the 3 'UTR (a) 30-50 nucleotides after the stop codon or ( b) at least 50 nucleotides after the stop codon. 14. The mRNA for the use according to any of claims 1-7, wherein the (i) at least one miR-142-3p microRNA binding site; (ii) at least one miR-126 binding site; or (iii) at least one miR-142-3p microRNA binding site and at least one miR-126 binding site is located within a 5 'UTR of the mRNA construct.