ES2792150A1 - METHOD FOR PREDICTING AND/OR DIAGNOSING CANCER METASTASIS (Machine-translation by Google Translate, not legally binding) - Google Patents

Abstract

Method to predict and/or diagnose cancer metastasis. The invention relates to an in vitro method for diagnosing and/or predicting cancer metastasis in a subject suffering from cancer, or for predicting the overall survival of a subject suffering from cancer, which comprises determining levels of methylation, or the expression levels of the promoter of a gene that belongs to the protocadherin gene cluster in a sample from said subject. The invention also refers to an agent that inhibits the activity of a protein encoded by a gene belonging to the protocadherin gene cluster, for use in the treatment and/or prevention of cancer metastasis. (Machine-translation by Google Translate, not legally binding)

Description

DESCRIPTION

Method to predict and / or diagnose cancer metastasis

The invention relates to an in vitro method for diagnosing and / or predicting cancer metastasis in a subject suffering from said cancer, or for predicting the overall survival of a subject suffering from cancer, in addition to an agent that inhibits the activity of a protein encoded by a gene belonging to the protocadherin gene cluster (or group) for use in the treatment and / or prevention of cancer metastasis in a subject. Therefore, the present invention belongs to the field of cancer diagnosis and treatment.

STATE OF THE ART

Mitochondrial complex II deficiency, succinate dehydrogenase (SDH), is frequently associated with the development of tumors, especially pheochromocytomas and paragangliomas (PPGL). PPGLs are rare neuroendocrine tumors that originate in diffuse paraganglionic tissue and in the adrenal gland, respectively. Approximately 40% of these tumors are inherited and are associated with germline mutations in SDHB, SDHC, SDHA, SDHD, and SDHAF2 (together SDHx), in addition to RET, VHL, NF1, TMEM127, MAX, FH, KIF1B, and EGLN1 among others. One of the peculiarities of PPGLs is that they are generally slow-growing, indolent (low-risk) tumors. However, 10-30% of PPGLs metastasize, usually several years or even decades after the first diagnosis; And once metastasis occurs, the treatment options are quite limited. Currently, no evidence-based clinical or histopathological criteria have been established to distinguish malignant from benign tumors, and the occurrence of metastases is the only evidence of malignant PPGL. Another peculiarity is that the result of metastatic PPGLs (mePPGLs) is highly variable; some patients remain clinically stable for decades, while others experience rapidly progressive disease, and there are no reliable prognostic markers to identify patients at higher risk for aggressive disease.

Currently, the presence of germline inactivating mutations in the SDHB gene is by far the most molecular predictor of malignancy. important. Although mutations in other PPGL predisposing genes, such as FH, SDHC, SDHD, SDHA, and TMEM127 have been observed in patients with mePPGL, these mutations represent only <5% of cases, making the mutation in the germline of genes SDHB in the only reliable risk factor for metastasis. Germline mutations of the SDHB gene are found in more than 40% of patients with mePPGL (especially extra-adrenal tumors, that is, outside the adrenal medulla) and approximately 50% of patients with SDHB mutations develop metastases associated with short-term survival rates. Despite extensive research efforts, how SDHB-deficient tumor cells acquire the ability to colonize distant organs remains a central issue in the field and a challenge that must be overcome for better clinical management. This problem underscores the pressing need for novel and efficient molecular tests that enable improved prognosis and personalized therapies.

Loss of the functional SDH complex is believed to cause a pseudohypoxic state characterized by post-translational stabilization of hypoxia-inducible factors HIF-1a and HIF-2a, leading to increased expression of growth, angiogenic factors and mitogenic. However, no clear and definitive quantitative or qualitative distinction has been made between the hypoxia signaling pathways in benign PPGL (bPPGL) and mePPGL. Furthermore, it is not known whether the stabilization of HIF-a differs between SDHB-PPGL and tumors carrying mutations in other SDHx genes. There is also increasingly conclusive evidence of the critical involvement of epigenetically silenced genes in the initiation of SDHx-PPGL (Oishi T, et al. 2017. J Clin Transí Endocrino !. 7: 12-20; de Cubas AA, et al. 2015. Clin Cancer Res., 21: 3020-3030; Letouzé E, et al. 2013, Cancer Ce !!., 23: 739-752; Loriot C, et al. 2012, J Clin Endocrino! Metab., 97 : E954-E962). The study of DNA methylation profiles has revealed a hyper-methylating phenotype in SDHx-PPGL and has revealed that succinate acts as an oncometabolite, which inhibits 2-oxoglutarate (OG) -dependent dioxygenases, such as histone and DNA demethylases. Some of the epigenetic changes identified are associated with various characteristics of SDHx-PPGL. For example, the silencing of genes involved in the differentiation of neuroendocrine cells, such as PNMT, leads to the noradrenergic secretory phenotype of SDHx-PPGL, the hypermethylation of the KRT19 gene contributes to the activation of the epithelial to mesenchymal transition observed in SDHB-mePPGL, and it has been observed hypermethylation of the RDBP gene in mePPGL, although this change turned out to be independent of the genetic background of the tumors. However, the information available regarding the role of epigenetic traits in the metastatic development of cancer, particularly SDHB-PPGL, is still scarce.

Therefore, there is a need in the state of the art to find new biomarkers for the diagnosis and prognosis of cancer metastasis, in addition to a useful target for the treatment and prevention of cancer metastasis.

DESCRIPTION OF THE INVENTION

The inventors of the present invention have found that DNA methylation levels are significantly higher in metastatic cancer, specifically metastatic SDHB-PPGLs than in non-metastatic cancer. The change in DNA methylation levels includes long-term de novo methylation of the gene clusters of the protocadherins PCDHA, PCDHB, and PCDHG. The methylation of one of these genes, PCDHGC3, was further validated and found to be of clinical significance. High levels of PCDHGC3 promoter methylation were validated in primary metastatic SDHB-PPGLs, and it was observed that they were amplified in the corresponding metastases, being significantly correlated with a reduced expression of PCDHGC3. Interestingly, this epigenetic alteration could be detected in primary tumors that developed metastases several years later. PCDHGC3 downregulation is also shown to promote metastasis initiation abilities such as cell proliferation, migration and invasion.

The present invention provides the first evidence for a role of a PCDH gene in the pathogenesis of a tumor of neuroendocrine origin. Somatic and germline mutations in SDHB are seen in an increasing number of neoplasms, including gastrointestinal stromal tumors, pancreatic neuroendocrine tumors, ganglioneuromas, and renal cell carcinomas. Fundamentally, SDH deficiency in these tumors has important prognostic implications. The data shown here suggest that de novo methylation of the PCDHGC3 gene of protocadherins has a role in the metastatic phenotype of cancer, particularly SDHB-PPGLs, and therefore could be useful as a tool to identify patients with a higher risk of develop metastatic disease and as a prognostic marker in PPGL and other SDHB- related cancers . These results provide a novel target for molecular therapy and could have important clinical implications for designing clinical follow-up and treatment in SDHB- associated cancer .

Method of the invention

In one aspect, the present invention relates to an in vitro method for the diagnosis and / or prognosis of cancer metastasis in a subject suffering from cancer, or for predicting the clinical outcomes of a subject suffering from cancer, or for determining the response of a subject to a therapy, hereinafter "method of the invention", comprising

a) determine promoter methylation levels, or expression levels, of a gene belonging to the protocadherin gene cluster in a sample from said subject, and

b) comparing methylation levels, or expression levels, obtained in step a) with a reference value,

where

- if the methylation levels obtained in step (a) are higher than the methylation levels of the reference value, or

- the expression levels in step (a) are lower than the expression levels of the reference value, then

(i) the PPGL tumor is a metastatic tumor, or is prone to developing metastases,

(ii) the prognosis, clinical results, and / or the subject's response to therapy is negative.

As used herein, the term "diagnose" refers to identifying the nature of a medical condition, disease, or other problem by examining the symptoms, parameters, or biomarkers in a subject. In the context of the present invention, the parameter required for diagnosis is the methylation levels, or the expression levels, of a gene belonging to the protocadherin gene cluster in a subject sample.

As used herein, the term "prognosis" refers to the process of predicting the probability or expected development of a disease (in this case metastasis), including whether signs and symptoms will improve or worsen (and how fast) or will remain stable over time. The term "prediction" is used herein to refer to the probability that a patient will have particular clinical outcomes. As will be explained later, clinical results can be positive or negative. The predictive methods of the present invention can be used clinically to make treatment decisions by choosing the most appropriate treatment modalities for any particular patient. The predictive method of the present invention is a valuable tool in predicting whether a patient is likely to respond favorably to a treatment regimen.

In the context of the present invention, the term "the subject's prognosis is negative" means that the subject's tumor is a malignant tumor that will metastasize. In contrast, the expression "The subject's prognosis is positive" means that the tumor is a benign tumor that will not metastasize. As used herein, the terms "cancer" and "tumor" are considered equivalent.

In the present invention the term "clinical results" is understood as the expected course of a disease. It denotes the doctor's prediction of how a subject's disease will progress, and whether there is a possibility of recovery or recurrence.

The term "negative clinical results" or "poor prognosis" means a decrease in any measure of the patient's condition, including those measures that are commonly used in the art, such as the duration of the recurrence-free interval (ILR), the overall survival time (OS), disease-free survival (DFS), length of distant recurrence-free interval (ILRD), and the like. An increase in the probability of positive clinical results corresponds to a decrease in the probability of cancer metastasis.

Prediction of clinical outcomes can be performed using any measurement of the endpoints used in oncology and known to the medical specialist. Useful endpoint parameters to describe the course of a disease include:

• disease-free progression which, as used herein, describes the proportion of subjects in complete remission who have not had disease recurrence during the time period under study;

• an objective response, which, as used in the present invention, describes the proportion of people treated in whom a complete or partial response is observed;

• tumor control, which, as used in the present invention, refers to the proportion of people treated in whom a complete response, a partial response, a minor response or a stable disease> 6 months is observed.

• progression-free survival which, as used herein, is defined as the time from the start of treatment to the first measurement of cancer growth.

• six-month progression-free survival or a “SLP6” rate which, as used herein, refers to the percentage of people who are progression-free in the first six months after initiation of therapy

• “disease-free survival” (SLE) is understood as the length of time after treatment for a specific disease during which a subject survives without signs of the disease, and

• the median survival, which, as used herein, refers to the time when half of the subjects entered the study.

In a particular embodiment, the clinical results are measured as overall survival.

In the present invention, the term "overall survival" (also referred to as OS) refers to the length of time from either the date of diagnosis or the start of treatment for a disease, such as cancer, in which patients patients diagnosed with the disease are still alive. In a clinical trial, measuring overall survival is a way to see how well a new treatment works.

The calculation of the measures detailed above in practice may vary from study to study depending on whether the definition of events is censored or is not considered.

The term "determining the response of a subject to a therapy" refers to the evaluation of the results of a therapy in a patient with cancer in response to a therapy. The subject's response to therapy can be negative (subject does not respond to therapy) or positive (subject responds to therapy).

In the present invention, a subject is considered to have a "negative response to therapy" or "unresponsive to therapy" when, during and immediately after treatment, the reduction in tumor size is less than 25%, the tumor stabilizes or the tumor continues to grow unaffected by therapy, metastasizing and reaching other organs. Rather, a subject is considered to have a "positive response to therapy" or "responds to therapy" when the reduction in tumor size is greater than 25%, or the tumor is not detectable, or the tumor remains. stable and does not metastasize. A negative response from the subject to the therapy means that the administered therapy is not being effective. A large number of treatments are available to deal with cancer metastasis and any of them can be used in the context of the present invention.

In the context of the present invention, "metastasis" is understood as the spread of a tumor or cancer from the organ where it started to a different organ. It generally occurs through the blood or lymphatic system. When cancer cells spread and form a new tumor, the latter is called a secondary or metastatic tumor. The cancer cells that make up the secondary tumor are like those of the original tumor. If a lung cancer, for example, spreads (metastasizes) to the bone, the secondary tumor forms from malignant lung cancer cells. The disease in the bone is metastatic lung cancer and not bone cancer.

In a first step, the method of the invention comprises determining the promoter methylation levels of a gene belonging to the protocadherin gene cluster in a sample from a subject.

The term "methylation" is considered to mean the presence of a methyl group added by the action of a DNA methyltransferase enzyme to a cytosine base or bases in a region of the nucleic acid, eg genomic DNA. As described herein, there are various methods known to those of skill in the art to determine the level or degree of methylation of a nucleic acid.

Any method to detect DNA methylation can be used in the methods of the present invention. A number of methods are available for the detection of differentially methylated DNA at specific loci either in primary tissue samples or in patient samples such as blood, urine, feces, or saliva. For an analysis of the rate or degree of DNA methylation in a target gene, the DNA is typically treated with sodium bisulfite and the regions of interest are amplified using primers and PCR conditions that will amplify regardless of the DNA methylation status. Methylation of the general amplicon or individual CpG sites can then be assessed by sequencing, including pyrosequencing, restriction enzyme digestion (COBRA), or by melting curve analysis. Alternatively, ligation-based methods can be used for analysis of methylation at specific CpG sites. Detection of aberrantly methylated DNA released from tumors and in body fluids is being developed as a means of diagnosing cancer. In the case of hypermethylated sequences, it is necessary to use sensitive methods that allow selective amplification of the methylated DNA sequence from a normal cellular DNA background that is not methylated. Such methods based on bisulfite treated DNA, for example; They include selective methylation PCR (MSP), Heavymethyl PCR, Headloop PCR , and helper-dependent chain reaction.

Briefly, methods for detecting methylation include, but are not limited to, random shearing or random fragmentation of genomic DNA, cutting of DNA with a methylation-sensitive or methylation-dependent restriction enzyme, and then selectively identifying and / or analyzing cut or uncut DNA. Selective identification can include, for example, separating cut and uncut DNA (eg, by size) and quantifying a sequence of interest that was cut or, alternatively, was not cut. Alternatively, the method may encompass amplifying intact DNA after restriction enzyme, thereby amplifying only DNA that was not cleaved by restriction enzyme in the area amplified. In some embodiments, amplification can be performed using primers that are gene specific. Alternatively, adapters can be added to the ends of randomly fragmented DNA, the DNA can be digested with a methylation-dependent or methylation-sensitive restriction enzyme, intact DNA can be amplified using primers that hybridize to the DNA sequences. adapters. In this case, a second step can be performed to determine the presence, absence or quantity of a particular gene in a pool of amplified DNA. In some embodiments, the DNA is amplified using real-time quantitative PCR.

In some embodiments, the methods comprise quantifying the average methylation density in a target sequence within a population of genomic DNA. In some embodiments, the method comprises contacting genomic DNA with a methylation-dependent restriction enzyme or a methylation-sensitive restriction enzyme under conditions that allow at least some copies of the potential restriction enzyme cleavage sites in the locus remain uncleaved; quantify intact copies of the locus; and comparing the amount of the amplified product with a control value representing the amount of methylation of the control DNA, thereby qualifying the average methylation density at the locus compared to the methylation density of the control DNA.

The amount of methylation of a DNA locus can be determined by providing a sample of genomic DNA comprising the locus, cleaving the DNA with a restriction enzyme that is either methylation sensitive or methylation dependent, and then quantifying the amount of Intact DNA or by qualifying the amount of DNA cut at the DNA locus of interest. The amount of intact or cut DNA will depend on the initial amount of genomic DNA that the locus contains, the amount of methylation at the locus, and the number (i.e., fraction) of nucleotides at the locus that are methylated in the genomic DNA. . The amount of methylation at a DNA locus can be determined by comparing the amount of intact DNA or cut DNA with a control value representing the amount of intact DNA or cut DNA in a similarly treated DNA sample. The control value can represent a known or predicted number of methylated nucleotides. Alternatively, the control value can represent the amount of intact or cut DNA from the same locus in another cell (eg, normal, not diseased) or at a second locus.

Using at least one methylation-sensitive or methylation-dependent restriction enzyme under conditions that allow at least some copies of potential restriction enzyme cleavage sites at the locus to remain uncleaved, and subsequently quantifying the remaining intact copies and By comparing the amount to a control, the mean methylation density of a locus can be determined. A methylation-sensitive enzyme is one that cuts DNA if its recognition sequence is unmethylated, whereas a methylation-dependent enzyme cuts DNA if its recognition sequence is methylated. If the restriction enzyme comes into contact with copies of a DNA locus under conditions that allow at least some copies of the potential restriction enzyme cleavage sites at the locus to remain uncleaved, then the remainder of the intact DNA will be directly proportional to the methylation density, and thus can be compared to a control to determine the relative methylation density of the locus in the sample. Similarly, if a methylation-dependent enzyme is contacted with copies of the DNA locus under conditions that allow at least some copies of the potential restriction enzyme cleavage sites at the locus to remain uncleaved, then the The remainder of the intact DNA will be inversely proportional to the methylation density, and thus can be compared to a control to determine the relative methylation density of the locus in the sample.

Kits for the above methods can include, for example, one or more methylation-dependent restriction enzymes, methylation-sensitive restriction enzymes, amplification reagents, probes and / or primers (eg, by PCR).

Amplification methods (eg, quantitative PCR or quantitative linear amplification) can be used to quantify the amount of intact DNA within a locus flanked by amplification primers following restriction digestion. Quantitative amplification methods are widely known in the state of the art. Amplifications can be monitored in "real time".

Additional methods of detecting DNA methylation may involve genomic sequencing before and after bisulfite treatment of DNA. When sodium bisulfite is contacted with DNA, unmethylated cytosine is converted to uracil, while methylated cytosine is unchanged. In some In embodiments, restriction enzyme digestion of amplified PCR products from bisulfite converted DNA is used to detect DNA methylation.

A specific methylation PCR ("MSP") reaction can be used alone or in combination with other methods to detect DNA methylation. An MSP assay involves initial DNA modification by sodium bisulfite, converting all unmethylated cytosines, but not methylated ones, to uracil, and subsequent amplification with specific primers for methylated versus unmethylated DNA. Similarly, a MethyLight assay can be used alone or in combination with other methods to detect DNA methylation. Briefly, in the MethyLight process, genomic DNA is converted in a sodium bisulfite reaction (the bisulfite process converts unmethylated cytosine residues to uracil). Amplification of a DNA sequence of interest is then performed using PCR primers that hybridize to CpG dinucleotides. By using primers that hybridize only to sequences that are the result of bisulfite conversion of methylated DNA, (or alternatively to non-methylated sequences), amplification can indicate the methylation status of the sequences to which the primers hybridize. Furthermore, the amplification product can be detected with a probe that specifically binds to a sequence that is the result of bisulfite treatment of unmethylated DNA. If desired, both primers and probes can be used to detect methylation status. Therefore, kits for use with MethyLight may include sodium bisulfite in addition to detectable primers or probes that can be detected (including, but not limited to, Taqman or molecular beacon probes) that distinguish between methylated and unmethylated DNA that have been treated with bisulfite. Other components of the kits may include, for example, reagents necessary for DNA amplification, including but not limited to, PCR buffers, deoxynucleotides; and a thermostable polymerase.

A Ms-SNuPE reaction ( Methylation-sensitive Single Nucleotide Primer Extension) can be used alone or in combination with other methods to detect DNA methylation. The Ms-SNuPE technique is a quantitative method for assessing methylation differences at specific CpG sites based on bisulfite treatment of DNA treatment, followed by a single nucleotide primer extension. Briefly, genomic DNA is reacted with sodium bisulfite to converting unmethylated cytosine to uracil while leaving 5-methylcytosine unmodified. Amplification of the desired target sequence is then performed using specific PCR primers for bisulfite converted DNA, and the resulting product is isolated and used as a template for analysis of methylation at the CpG site (s) of interest.

Any of the techniques mentioned above can be used to determine promoter methylation levels of a gene belonging to the protocadherin gene cluster in a sample from the subject, as disclosed in the first step of the method of the invention.

Protocadherins (PCDH), which are predominantly expressed in the nervous system, constitute the largest family of the cadherin superfamily of cell adhesion molecules. In mammals, two types of PCDH genes have been defined: the unclustered PCDH genes, which are spread throughout the genome; and the clustered PCDH genes, which are organized into three closely linked gene clusters designated as a, p, and y. Therefore, as used herein, the term "protocadherin gene cluster (PCDH)" refers to a set of genes that are organized into three closely linked gene clusters, designated as a (PCDHA), p (PCDHB) and y (PCDHG). Elements of the PCDH gene family were also shown to mediate cell-cell adhesion in cell-based assays. In a particular embodiment, the PCDH gene cluster is the PCDHA gene cluster, PCDHB gene cluster, or the PCDHG gene cluster.

Examples of genes belonging to the PCDHA gene cluster include, but are not limited to, PCDHA @ [alpha protocadherin cluster, complex locus; HGNC ID: HGNC: 8662, chr. 5q31], PCDHACT [alpha protocadherin constant, HGNC ID: HGNC: 8678, chr. 5q31], PCDHAC1 [alpha C protocadherin subfamily, 1; HGNC ID: HGNC: 8676, chr. 5q31.3], PCDHAC2 [alpha C protocadherin subfamily, 2; HGNC ID: HGNC: 8677, chr. 5q31.3], PCDHA1 [protocadherin alpha 1; HGNC ID: HGNC: 8663, chr. 5q31.3], PCDHA2 [protocadherin alpha 2; HGNC ID: HGNC: 8668, chr. 5q31.3], PCDHA3 [protocadherin alpha 3; HGNC ID: HGNC: 8669, chr. 5q31.3], PCDHA4 [protocadherin alpha 4; HGNC ID: HGNC: 8670, chr. 5q31.3], PCDHA5 [protocadherin alpha 5; HGNC ID: HGNC: 8671, chr. 5q31.3], PCDHA6 [protocadherin alpha 6; HGNC ID: HGNC: 8672, chr. 5q31.3], PCDHA7 [protocadherin alpha 7; HGNC ID: HGNC: 8673, chr. 5q31.3], PCDHA8 [protocadherin alpha 8; HGNC ID: HGNC: 8674, chr. 5q31.3], PCDHA8 [protocadherin alpha 8; HGNC ID: HGNC: 8674, chr. 5q31.3], PCDHA9 [protocadherin alpha 9; HGNC ID: HGNC: 8675, chr. 5q31.3], PCDHA10 [protocadherin alpha 10; HGNC ID: HGNC: 8664, chr. 5q31.3], PCDHA11 [protocadherin alpha 11; HGNC ID: HGNC: 8665, chr. 5q31.3], PCDHA12 [protocadherin alpha 12; HGNC ID: HGNC: 8666, chr. 5q31.3], PCDHA13 [protocadherin alpha 13; HGNC ID: HGNC: 8667, chr. 5q31.3], or PCDHA14 [protocadherin alpha 14 pseudogene; HGNC ID: HGNC: 2163, chr. 5q31.3].

Examples of genes belonging to the PCDHB gene cluster include, but are not limited to, PCDHB @ [beta protocadherin cluster; HGNC ID: HGNC: 8679; chr. 5q31], PCDHB1 [protocadherin beta 1; HGNC ID: HGNC: 8680; chr.

5q31.3], PCDHB2 [protocadherin beta 2; HGNC ID: HGNC: 8687; chr. 5q31.3], PCDHB3 [protocadherin beta 3; HGNC ID: HGNC: 8688; chr. 5q31.3], PCDHB4 [protocadherin beta 4; HGNC ID: HGNC: 8689; chr. 5q31.3], PCDHB5 [protocadherin beta 5; HGNC ID: HGNC: 8690; chr. 5q31.3], PCDHB6 [protocadherin beta 6; HGNC ID: HGNC: 8691; chr. 5q31.3], PCDHB7 [protocadherin beta 7; HGNC ID: HGNC: 8692; chr. 5q31.3], PCDHB8 [protocadherin beta 8; HGNC ID: HGNC: 8693; chr. 5q31.3], PCDHB9 [protocadherin beta 9; HGNC ID: HGNC: 8694; chr. 5q31.3], PCDHB10 [protocadherin beta 10; HGNC ID: HGNC: 8681; chr. 5q31.3], PCDHB11 [protocadherin beta 11; HGNC ID: HGNC: 8682; chr. 5q31.3], PCDHB12 [protocadherin beta 12; HGNC ID: HGNC: 8683; chr. 5q31.3],

PCDHB13 [protocadherin beta 13; HGNC ID: HGNC: 8684; chr. 5q31.3], PCDHB14 [protocadherin beta 14; HGNC ID: HGNC: 8685; chr. 5q31.3], PCDHB15 [protocadherin beta 15; HGNC ID: HGNC: 8686; chr. 5q31.3], PCDHB16 [protocadherin beta 16; HGNC ID: HGNC: 14546; chr. 5q31.3], PCDHB17P [protocadherin beta 17 pseudogene; HGNC ID: HGNC: 14547; chr. 5q31.3], PCDHB18P [protocadherin beta 18 pseudogene; HGNC ID: HGNC: 14548; chr.

5q31.3] or PCDHB19P [protocadherin beta 19 pseudogene; HGNC ID: HGNC: 14549; chr. 5q31.3].

Examples of genes belonging to the PCDHG gene cluster include, but are not limited to, PCDHG @ [gamma protocadherin cluster; HGNC ID: HGNC: 8679; chr. 5q31], PCDHGA1 [gamma A protocadherin subfamily, 1; HGNC ID: HGNC: 8696; chr. 5q31.3], PCDHGA2 [gamma A protocadherin subfamily, 2; HGNC ID: HGNC: 8700; chr. 5q31.3], PCDHGA3 [protocadherin subfamily gamma A, 3; HGNC ID: HGNC: 8701; chr. 5q31.3], PCDHGA4 [gamma A protocadherin subfamily, 4; HGNC ID: HGNC: 8702; chr. 5q31.3], PCDHGA5 [gamma A protocadherin subfamily, 5; HGNC ID: HGNC: 8703; chr. 5q31.3], PCDHGA6 [subfamily of the protocadherins gamma A, 6; HGNC ID: HGNC: 8704; chr. 5q31.3], PCDHGA7 [subfamily of the protocadherins gamma A, 7; HGNC ID: HGNC: 8705; chr. 5q31.3], PCDHGA8 [gamma A protocadherin subfamily, 8; HGNC ID: HGNC: 8706; chr. 5q31.3], PCDHGA9 [subfamily of protocadherins gamma A, 9; HGNC ID: HGNC: 8707; chr. 5q31.3], PCDHGA10 [gamma A protocadherin subfamily, 10; HGNC ID: HGNC: 8697; chr. 5q31.3], PCDHGA11 [gamma A protocadherin subfamily, 11; HGNC ID: HGNC: 8698; chr. 5q31.3], PCDHGA12 [gamma A protocadherin subfamily, 12; HGNC ID: HGNC: 8699; chr. 5q31.3], PCDHGB1 [subfamily of the protocadherins gamma B, 1; HGNC ID: HGNC: 8708; chr. 5q31], PCDHGB2 [gamma B protocadherin subfamily, 2; HGNC ID: HGNC: 8709; chr. 5q31], PCDHGB3 [gamma B protocadherin subfamily, 3; HGNC ID: HGNC: 8710; chr. 5q31], PCDHGB4 [gamma B protocadherin subfamily, 4; HGNC ID: HGNC: 8711; chr. 5q31], PCDHGB5 [gamma B protocadherin subfamily, 5; HGNC ID: HGNC: 8712; chr. 5q31], PCDHGB6 [gamma B protocadherin subfamily, 6; HGNC ID: HGNC: 8713; chr. 5q31], PCDHGB7 [gamma B protocadherin subfamily, 7; HGNC ID: HGNC: 8714; chr.

5q31], PCDHGB8P [pseudogene of the subfamily of protocadherins gamma B, 8; HGNC ID: HGNC: 8715; chr. 5q31], PCDHGB9P [pseudogene of the subfamily of protocadherins gamma B, 9; HGNC ID: HGNC: 15688; chr. 5q31], PCDHGCT [gamma protocadherin constant; HGNC ID: HGNC: 8719; chr. 5q31], PCDHGC3 [gamma C protocadherin subfamily, 3; HGNC ID: HGNC: 8716; chr. 5q31.3], PCDHGC4 [gamma C protocadherin subfamily, 4; HGNC ID: HGNC: 8717; chr.

5q31.3] or PCDHGC5 [subfamily of protocadherins gamma C, 5; HGNC ID: HGNC: 8718; chr. 5q31.3],

In a particular embodiment, the gene belonging to the protocadherin gene cluster is a gene belonging to the PCDHG gene cluster which, in a more particular embodiment, the gene is the PCDHGC3 gene.

The PCDHGC3 gene (protocadherin gamma C subfamily, 3) is a member of the gamma protocadherin gene cluster, one of three related clusters linked in tandem on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a new mechanism may be involved in its regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies as disclosed above. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The 22 exon tandem alignments of a large variable region are followed by a constant region containing 3 exons shared by all genes in the cluster. Each exon of the variable region encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The exons of the constant region encode the common cytoplasmic region. Most likely these neuronal cadherin-like cell adhesion proteins play a critical role in the establishment and function of specific cell-cell connections in the brain. An alternative cleavage has been described for the genes of the gamma cluster. Other names for the PCDHGC3 genes are cadherin 2, protocadherin 2, and protocadherin 43 type. The symbols PCDH2, PC-43, PC43, and PCDH-GAMMA-C3 can also be used to refer to the PCDHGC3 gene. The PCDHGC3 gene is conserved in chimpanzee, cow, mouse, rat, and chicken.

In the context of the present invention, the promoter methylation levels of any of the genes mentioned above can be used in the method of the invention for the diagnosis and / or prognosis of cancer metastasis in a subject. However, in a particular embodiment, the methylation levels of the promoter of the PCDHGC3 gene are used. In another particular embodiment, the promoter of the PCDHGC3 gene comprises a nucleotide sequence that comprises a sequence identity of at least 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99% with the sequence SEQ ID NO: 1.

In the present invention, "identity" or "sequence identity" is understood to refer to the degree of similarity between two nucleotide or amino acid sequences obtained by aligning the two sequences. Depending on the number of common residues between the aligned sequences, a different degree of identity will be obtained, expressed as a percentage. The degree of identity between two amino acid sequences can be determined by conventional methods, for example, by standard sequence alignment algorithms known in the state of the art, such as, for example BLAST [Altschul SF et al. Basic local alignment search tool. J Mol Biol. 1990 Oct 5; 215 (3): 403-10], BLAST programs, eg BLASTN, BLASTX, and T BLASTX, BLASTP and TBLASTN, are from public domain on the website of the National Center for Biotechonology Information (NCBI). The person skilled in the art understands that mutations in the nucleotide sequence of genes that lead to conservative amino acid substitutions at positions not critical to the functionality of the protein are evolutionarily neutral mutations that do not affect its overall structure or functionality.

In a more particular embodiment, the promoter of the PCDHGC3 gene comprises a nucleotide sequence that comprises 100% sequence identity with the sequence SEQ ID NO: 1.

SEQ ID NO: 1 Ggactctgtgtgccgctgtcggccaatgaagacgctggagatcgggcccctgcccgtcccctttctgcgccccgggatg aca aaacaaaaactaaacaacca 1 2 3 acatccAGAAAGCCATGTCG4GACT aacaaatcaaca GCG CG 5 6 7 CCCAAGCG8CTAACCCGCTGAAAGTTTCTCAGCGAAATCT CAGGGACGATCTGGACCCCGCTGAGAGGAACTGCTTTTGAGTGAGATGGTCCC CCCAGCG AGAGGCCTGGAGGAGCGGACTGGTAAGCACCGGGAGGGTAGTGGGAGTTTTGC TTCTGCTTGGTGCCTTGAACAAGGCTTCCACGGTCATTCACTATGAGATCCCGGA GGAAAGAGAG

SEQ ID NO: 1 comprises the region of genomic DNA analyzed for methylation of the PCDHGC3 promoter (in bold). In lowercase letters the 5 'untranslated region of the PCDHGC3 gene is shown, and in capital letters the sequence of the beginning of the first exon. The transcription initiation codon (ATG) is underlined. Methylated CpG sites are shown with double underlining and identified with a superscript number corresponding to the following positions on chromosome 5 of the human genome (GRCh38: CM000667.2 by Ensembl): 1. chr5: 140,855,546; 2. chr5: 140,855,549; 3. chr5: 140,855,561; 4. chr5: 140,855,581; 5. chr5: 140,855,587; 6. chr5: 140,855,590; 7. chr5: 140,855,597; and 8. chr5: 140,855,605.

In a particular embodiment, step a) of the method of the invention comprises determining the methylation status of at least one, two, three, four, five, six, seven or eight of the CpG sites of the sequence SEQ ID NO: 1 .

Alternatively to promoter methylation levels, step a) of the method of the invention encompasses determining the expression levels of a gene belonging to the protocadherin gene cluster for diagnosing and / or predicting (predicting) cancer metastasis, and / or predicting clinical outcomes of a subject suffering from cancer, and / or determining a subject's response to therapy.

The term "expression" includes any step involved in the production of a polypeptide including, but not limited to, transcription, posttranscriptional modification, translation, post-translational modification, and secretion. Therefore, as the person skilled in the art understands, the expression levels of genes can be measured by determining the mRNA expression levels of said genes or by determining the levels of proteins encoded by said genes.

The expression level is determined by measuring the expression level of a gene of interest for a given patient population, determining the mean expression level of said gene for the population, and comparing the expression level of the same gene for a single patient with the mean expression level for the determined patient population. For example, if the expression level of a gene of interest for the individual patient is determined to be above the mean expression level of the patient population, said patient is determined to have high expression of the gene of interest. Alternatively, if the expression level of a gene of interest for the individual patient is determined to be below the average expression level of the patient population, said patient is determined to have low expression of the gene of interest. In some embodiments, the individual patient has cancer metastasis, and the patient population has cancer but no metastasis (ie, a benign tumor).

As understood by the person skilled in the art, the levels of gene expression can be quantified by measuring the levels of the messenger RNA (mRNA) of said gene or of the protein encoded by said gene.

For this purpose, the biological sample can be treated to physically or mechanically disrupt the tissue or cell structure, releasing the intracellular components in an organic solution to prepare nucleic acids. Nucleic acids are extracted by commercially available methods known to those skilled in the art.

Therefore, the expression levels of a gene that belongs to the protocadherin gene cluster can be quantified from the RNA obtained as a result of the transcription of said gene (mRNA) or, alternatively, from DNA. complementary (cDNA) of said gene. Therefore, in a particular embodiment of the invention, the quantification of the expression levels of a gene that belongs to the protocadherin gene cluster comprises the quantification of the messenger RNA of said gene or a fragment of said mRNA, complementary DNA of the gene or a fragment of said cDNA or mixtures thereof.

Practically any method within the scope of the invention can be used to detect and quantify the levels of mRNA encoded by the gene belonging to the protocadherin gene cluster or the corresponding cDNA thereof. By way of non-limiting illustration, the levels of mRNA encoded by said gene can be quantified using conventional methods, for example, methods comprising amplification of mRNA and the quantification of said product of amplification of the mRNA, such as electrophoresis and staining, or alternatively, by Southern blot assay and using appropriate probes, Northern blot assay and using specific probes of the mRNA of the gene of interest (gene that belongs to the protocadherin gene cluster) or of the corresponding cDNA thereof, mapping with S1 nuclease, RT-PCR assay, hybridization, microarrays, etc., preferably by real-time quantitative PCR using a suitable marker. Similarly, the levels of cDNA corresponding to said mRNA encoded by said gene can also be quantified by using conventional techniques; in this case, the method of the invention includes a step to synthesize the corresponding cDNA by reverse transcription (RT) of the corresponding mRNA followed by amplification and quantification of said cDNA amplification product.

In a particular embodiment, the expression levels of the gene belonging to the protocadherin gene cluster are quantified by quantitative polymerase chain reaction (PCR) or a DNA or RNA matrix.

In a particular embodiment, the gene that belongs to the protocadherin gene cluster is the PCDHGC3 gene. The PCDHGC3 gene has been explained previously in the previous paragraphs. The nucleotide sequence of the PCDHGC3 gene can be seen in the gene: PCDHGC3 ENSG00000240184, version of Ensembl ENSG00000240184.7, whose transcription gives rise to 3 transcripts, each one encoding a different protein isoform. Table 1 below shows the nucleotide sequence of the transcript and the corresponding proteins.

Table 1

Therefore, in a particular embodiment, the PCDHGC3 gene comprises a nucleotide sequence that comprises a sequence identity of at least 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% with the sequence SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6. Therefore, allelic variants of SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 are encompassed within the context of the present invention. However, in a particular embodiment, the PCDHGC3 gene comprises a nucleotide sequence that comprises a sequence identity of 100% with the sequence SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6.

Furthermore, the level of expression of the gene belonging to the protocadherin gene cluster can also be quantified by quantifying the levels or quantity of the protein encoded by said gene, or any functionally equivalent variant of said protein.

In the context of the present invention, "functionally equivalent variant of the protein" is understood as (i) variants of the protein encoded by a gene belonging to the protocadherin gene cluster in which one or more of the amino acid residues are substituted by a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue), wherein said substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) variants comprising an insertion or a deletion of one or more amino acids and that have the same function as the protein encoded by a gene that belongs to the protocadherin gene cluster, that is, to mediate cell-cell adhesion in cell-based assays. Variants of the protein can be identified using methods based on the ability of the protein encoded by the gene belonging to the protocadherin gene cluster to mediate cell-cell adhesion and cell survival in cell-based assays. To determine cell-cell adhesion, the expression constructs encoding the PCDH genes are transfected into K562 cells (human leukemia cell line, ATCC CCL243) and, after 24 hours in culture, aggregation of the transfected cells is allowed. (pooled) for 1-2 hours on a rocker (rocking shaker) inside the incubator. The cells are then fixed in 4% paraformaldehyde, washed, and rinsed with 50% glycerol for microscope imaging and quantification of cell aggregates.

The level of proteins can be quantified by any conventional method that allows the detection and quantification of said protein in a sample from a subject. By way of non-limiting illustration, said protein levels can be qualified, for example, using antibodies with a specific binding capacity to the protein (or a fragment of the same that contains an antigenic determinant) and the subsequent quantification of the complexes formed. . The antibodies used in these assays may or may not be labeled. Illustrative examples of labels that may be used include radioactive isotopes, enzymes, fluorophores, chemiluminescence reagents, enzyme substrates or cofactors, enzyme inhibitors, particles, dyes, etc. There is a wide range of known assays that can be used in the present invention using unlabeled antibodies (primary antibody) and labeled antibodies (secondary antibody); These techniques include Westem-blot or Western blotting , ELISA (enzyme-linked immunosorbent assay), RIA (radioimmunoassay), competitive EIA (competitive enzyme immunoassay), DAS-ELISA (double antibody sandwich ELISA), immunocytochemical and immunohistochemical techniques, based on the use of protein microarrays or biochips that include specific antibodies or assays based on colloidal precipitation in formats such as test strips. Other ways to detect and quantify proteins include affinity chromatography techniques, ligand binding assays, etc. When using an immunological method, any antibody or reagent that is known to specifically bind to the protein with high affinity can be used to detect the amount of the protein. itself. Examples of antibodies include, but are not limited to, polyclonal sera, hybridoma supernatants or monoclonal antibodies, antibody fragments, Fv, Fab, Fab 'and F (ab') 2, scFv, humanized diabodies, tribodies, tetrabodies, nanobodies , alphabodies, stapled peptides, cyclopeptides, and antibodies.

In a particular embodiment, protein levels are qualified by Western blot assay, immunohistochemistry, ELISA or protein matrix.

In another particular embodiment, protein levels are quantified from exosomes or circulating DNA. Exosomes are 40-100 nm membrane vesicles secreted by most cell types in vivo and in vitro. Exosomes form in a particular population of endosomes, called multivesicular bodies (MVB) by internal budding into the lumen of the compartment. Upon fusion of the MVB with the plasma membrane, these internal vesicles secrete. Exosomes can be isolated from various cell lines or body fluids by various methods well known in the art; Various commercial kits are available for the isolation of exosomes such as ExoQuick ™ or ExoTest ™.

As explained in previous paragraphs, in a particular embodiment of the method of the invention, the gene that belongs to the protocadherin gene cluster is a gene that belongs to the PCDHG gene cluster that, in a more particular embodiment, the gene is the PCDHGC3 gene. Therefore, in another particular embodiment, the protein encoded by the gene that belongs to the protocadherin gene cluster is the protein encoded by the PCDHGC3 gene, that is, the PCDHGC3 protein.

As explained above, there are three isoforms of PCDHGC3 proteins that comprise the sequences SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 7. Therefore, in a particular embodiment, the level of expression of PCDHGC3 genes can be quantified by quantifying the levels of any of the PCDHGC3 protein isoforms.

As is well known to those of skill in the art, altering the primary structure of a protein by conservative substitution may not significantly alter the activity of that protein because the amino acid side chain that is introduced into the sequence may be able to form bonds and contacts similar to the side chain of the amino acid that has been replaced. Non-conservative substitutions are possible as long as they do not disrupt or interfere with the function of the isoforms of the PCDHGC3 protein. Thus, in the context of the present invention, it also encompasses functionally equivalent variants of the isoforms of the PCDHGC3 protein. The term "functionally equivalent variant" has been explained above. An assay to determine whether a given protein is a functionally equivalent variant of the PCDHGC3 protein can be identified using methods based on the ability of the PCDHGC3 protein to mediate cell-cell adhesion in cell-based assays. A given protein is considered a variant of the PCDHGC3 protein if that protein shows a sequence identity of at least 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99% with the SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7. The term "sequence identity" has been previously defined. Such mutants, variants or derivatives are considered to be "functional" if they maintain the same or similar properties and / or activity as the PCDHGC3 protein. A variant of the PCDHGC3 protein of the invention is considered functional when the activity level is at least 60%, preferably at least 70%, more preferably at least 80%, even more preferably 90%, 95%, 96%, 97% , 98%, 99% or 100% of that of the PCDHGC3 protein. Such properties and activities can be determined by the skilled person in routine practice and examples of such methods are provided in the present specification and have been mentioned above.

Once the methylation levels, or expression levels, of the promoter of a gene belonging to the protocadherin gene cluster in a subject sample have been determined (step a), the method of the invention comprises comparing the levels methylation levels, or the expression levels, obtained in step a) with a reference value.

Determination of promoter methylation levels, or expression levels, of a gene belonging to the protocadherin gene cluster must be correlated with the values of a reference value. Depending on the type of tumor to be analyzed, the exact nature of the reference value may to vary. Thus, the reference value can be the average of promoter methylation levels (or expression levels) obtained in a set of subjects having a non-metastatic tumor. Similarly, the reference value can be the mean value of the methylation levels, or the expression levels, of the promoter of a gene in a set of samples from cancer subjects who have not metastasized.

In general, routine reference samples will be obtained from subjects who are clinically well documented and in whom the absence of metastases is well characterized. Various considerations should be taken into account when determining the reference value. Among such considerations are the age, weight, sex, general physical condition of the patient, and the like. For example, equal amounts from a group of at least 2, at least 10, at least 100 preferably more than 1000 subjects, preferably classified according to the above considerations, for example, according to various age categories, are taken as the reference group. The set of samples from which the reference level is obtained will preferably be made up of subjects suffering from the same type of cancer as the patient under study. Similarly, the reference value within a group of patients can be established by using a receiving operating curve (ROC) and measuring the area under the curve for all sensitivity and specificity pairs to determine what par provides the best values and to which reference value it corresponds.

Once the reference value is established, the methylation values, or the expression values, obtained in step (a) of the method of the invention, can be compared with this reference value, and therefore can be assigned a level of "low" (decrease) or "high" (increase) of the levels of methylation or levels of expression of the promoter of the gene that belongs to the protocadherin gene cluster.

By "high level" it is meant that the mean value of the methylated CpG dinucleotides in the subject analyzed is higher than the reference value, that is, either the proportion of the methylated DNA molecules in a particular CpG site is greater or there are a greater number of separate methylated CpG sites in the subject. It is to be understood that the terms "increased" and "increased" are used interchangeably with the term "higher." The present invention is not limited by a precise amount of methylated residues that are considered indicative of the diagnosis of metastasis in a subject, since some variation occurs between patient samples. The present invention is also not limited by the positioning of the methylated residue.

In a particular embodiment, an increase in expression above the reference value of at least 1.1-times, 1.5-times, 2-times, 5-times, 10-times, 20-times, 30-times , 40-times, 50-times, 60-times, 70-times, 80-times, 90-times, 100-times or even more compared to the reference value is considered a “higher” expression (increase). In a particular embodiment, a decrease in expression below the reference value of at least 0.9-times, 0.75-times, 0.2-times, 0.1-times, 0.05-times, 0.025 -times, 0.02-times, 0.01-times, 0.005-times or even less compared to the reference value is considered a “lower” (reduced) expression.

In view of these results, the following conclusions are reached:

- if the methylation levels obtained in step (a) are higher than the methylation levels of the reference value, or

- the expression levels obtained in step (a) are lower than the expression levels of the reference value, then

(i) the PPGL tumor is a metastatic tumor or is prone to develop metastases,

(ii) the prognosis, clinical results, and / or the subject's response to therapy is negative.

The method of the present invention can be carried out on a suitable biological sample. As used herein, a "biological sample" refers to any sample of biological material obtained from an animal such as, but not limited to, cellular material, biofluids (eg, blood), feces, biopsy specimens of tissues, surgical specimens or fluid that has been introduced into the body of an animal and subsequently withdrawn. The biological sample that is tested according to the method of the present invention may be directly tested or may require some form of pre-assay treatment. For example, a biopsy or surgical specimen may require pre-assay homogenization or may require sectioning for an in situ assay to determine the qualitative expression levels of individual genes.

To the extent that the DNA region of interest is present in the biological sample, the biological sample can be directly tested or all or part of the nucleic acid present in the biological sample can be isolated prior to testing. In another example, the sample can be partially purified or otherwise enriched prior to analysis.

In a particular embodiment, the sample is selected from the group consisting of blood, urine, feces and tissue from a biopsy. In a more particular embodiment, the sample is a tumor sample.

In the present invention "tumor sample" is understood as the sample (eg, tumor tissue, circulating tumor cell, circulating tumor DNA) that originates from the primary cancerous tumor. Said sample can be obtained by conventional methods, for example biopsy, using methods well known to those skilled in the related medical arts. Methods for obtaining a biopsy sample include dividing a tumor into large pieces, or microdissection, or other methods of cell separation known in the art. Tumor cells can be further obtained by cytology through aspiration with a small gauge needle. To simplify specimen storage and handling, specimens can be formalin-fixed and paraffin-impregnated, or frozen first and then soaked in a tissue-freezing medium such as an OCT ( Optima! Cutting) compound . Temperature ”), by immersion in a highly cryogenic medium that allows rapid freezing.

The method of the invention refers to an in vitro method for the diagnosis and / or prognosis of cancer metastasis in a subject suffering from cancer, or to predict the clinical outcomes of a subject suffering from cancer, or to determine the response of a subject to therapy.

As used herein, the term "cancer" refers to those diseases in which abnormal cells divide uncontrollably and can invade nearby tissues. Cancer cells can also spread to other parts of the body through the blood and lymphatic systems (metastasis). There are several main types of cancer. Carcinoma is a cancer that begins in the skin or in the tissues that line or cover the internal organs. Sarcoma is a Cancer that begins in bone, cartilage, fatty tissue, muscle, blood vessels, or other connective or supporting tissues. Leukemia is a cancer that begins in hematopoietic tissue, such as the bone marrow, and causes large numbers of abnormal blood cells to be produced and into the blood. Lymphoma and multiple myeloma are cancers that begin in cells of the immune system. Central nervous system cancers are cancers that begin in the tissues of the brain or spinal cord. The cancer can be a solid tumor or a non-solid tumor, including metastasis.

Non-limiting examples of a tumor or cancer include a lung tumor or cancer, such as a small cell or non-small cell lung cancer, or an adenocarcinoma, squamous cell carcinoma, or a large cell carcinoma. Particular non-limiting examples of a tumor or cancer include a carcinoma, sarcoma, lymphoma, leukemia, adenoma, adenocarcinoma, melanoma, glioma, glioblastoma, meningioma, neuroblastoma, retinoblastoma, astrocytoma, oligodendrocytoma, mesothelioma, neoplasia, tumor, cancer or reticuloendothelial malignancy. lymphatic or hematopoietic. Additional non-limiting examples in particular of tumor or cancer is a neoplasm, tumor or cancer of the lung, thyroid, head or neck, nasopharynx, throat, nose or nasal sinuses, brain, spinal, breast, adrenal gland, pituitary gland, thyroid , lymph, gastrointestinal (mouth, esophagus, stomach, duodenum, ileus, jejunum (small intestine), colon, rectum), genito-urinary tract (uterus, ovaries, cervix, endometrial, bladder, testicles, penis, prostate) , kidney, pancreas, liver, bones, bone marrow, lymph, blood, muscle, or skin. Still other particular non-limiting examples of a tumor or cancer include breast cancer, prostate cancer, pancreatic cancer, gastric cancer, pleural mesothelioma, colon cancer, rectal cancer, cancer of the large intestine, cancer of the small intestine, cancer. esophageal cancer, duodenal cancer, tongue cancer, pharyngeal cancer, salivary gland cancer, brain tumor, schwannoma, liver cancer, kidney cancer, bile duct cancer, endometrial cancer, cervical cancer, body cancer cancer of the uterus, ovarian cancer, bladder cancer, urethral cancer, skin cancer, angioma, malignant lymphoma, malignant melanoma, thyroid cancer, parathyroid cancer, nasal cancer, paranasal cancer, cancer of the auditory organ, carcinoma of the mouth, laryngeal cancer, parotid cancer, submandibular cancer, bone tumor, angiofibroma, retinal sarcoma, penile cancer, testicular tumor, pediatric solid cancer, Kaposi's sarcoma, maxillary sinus tumor, Fibrous histiocytoma, leiomyosarcoma, rhabdomyosarcoma, lymphoma, multiple myeloma, or leukemia.

However, in a particular embodiment of the method of the invention, the cancer is a pheochromocytoma and paraganglioma tumor (PPGL), colon cancer, or kidney cancer, preferably, the kidney cancer is a clear cell renal cell carcinoma (CCRCC ).

Pheochromocytomas and paragangliomas (PPGL) are catecholamine-producing tumors that arise respectively from adrenal medullary cells or paraganglial chromaffins. More than 30% of PPGLs are inherited due to mutations in more than 11 tumor susceptibility genes identified to date. PPGLs in patients with SDHB mutations are characterized by norepinephrine and / or dopamine production, without significant epinephrine production.

Therefore, in a particular embodiment, the PPGL tumor is associated with mutations in the SDHx gene. In another particular embodiment, the SDHx gene is selected from the list consisting of the SDHB gene, SDHC gene, SDHA gene, SDHD gene and SDHAF2 gene.

The SDHB gene provides instructions for making one of four subunits of the enzyme succinate dehydrogenase (SDH). The SDH enzyme plays a vital role in mitochondria, which are structures inside cells that convert energy from food into a form that cells can use. Within the mitochondria, the SDH enzyme links two important pathways in energy conversion: the citric acid cycle (or Krebs cycle) and oxidative phosphorylation. As part of the citric acid cycle, the SDH enzyme converts a compound called succinate into another compound called fumarate. Negatively charged particles called electrons are released during this reaction. The SDHB protein provides a binding site for electrons as they are transferred to the oxidative phosphorylation pathway. In oxidative phosphorylation, electrons help create an electrical charge that provides energy for the production of adenosine triphosphate (ATP), the main source of energy for cells.

The SDHC gene provides instructions for making one of four subunits of the SDH enzyme. The SDHC protein helps anchor the SDH enzyme in the mitochondrial membrane.

The SDHA gene provides instructions for making one of four subunits of the SDH enzyme. The SDH enzyme plays a vital role in the mitochondria. The SDHA protein is the active subunit of the enzyme that performs the conversion of succinate, and also helps transfer electrons to the oxidative phosphorylation pathway. In oxidative phosphorylation, electrons help create an electrical charge that provides energy for the production of adenosine triphosphate (ATP), the cell's main source of energy.

The SDHAF2 gene provides instructions for making a protein that interacts with the SDH enzyme. The SDHAF2 protein helps a molecule called FAD bind to the SDH enzyme. FAD is called a cofactor because it helps the enzyme carry out its function.

As used herein "subject" or "patient" refers to all animals classified as mammals and includes, but is not limited to, domestic and farm animals, human primates, eg, humans, non-primates. humans, cows, horses, pigs, sheep, goats, dogs, cats or rodents. Preferably, the subject is a human male or female of any age or race.

Therapeutic method of the invention

The inventors have further observed that by inhibiting the activity of a protein encoded by a gene belonging to the protocadherin gene cluster, cancer and, more particularly, cancer metastasis can be treated and / or prevented.

Therefore, in another aspect, the present invention refers to an agent that inhibits the activity of a protein encoded by a gene that belongs to the protocadherin gene cluster, (hereinafter "inhibitor agent of the invention") for use in treating and / or preventing cancer metastasis in a subject suffering from said cancer.

As used herein, the term "inhibitory agent" refers to any molecule or compound capable of completely or partially inhibiting the activity of a protein, both by preventing the expression product of the gene that encodes the protein (ie , interrupting gene transcription and / or blocking the translation of the mRNA that comes from gene expression) and directly binding to and inhibiting the protein encoded by said gene. In the present invention, the protein is encoded by a gene belonging to the protocadherin gene cluster.

The expression "gene belonging to the protocadherin gene cluster" has been previously explained in the present description. In a particular embodiment, the gene that belongs to the protocadherin gene cluster is selected from the list consisting of the PCDHA gene cluster, PCDHB gene cluster and PCDHG gene cluster. In a particular embodiment, the gene that belongs to the protocadherin gene cluster is a gene that belongs to the PCDHG gene cluster in which, in a more particular embodiment, the gene is the PCDHGC3 gene. All of these terms and particular embodiments thereof have been disclosed / defined for the method of the invention, and are applicable to the present inventive aspect. The nucleotide / amino acid sequences of the PCDHGC3 gene, the transcripts derived from said gene, and the different isoforms of the proteins that come from the translation of the transcripts are shown in Table 1 above.

By way of non-limiting illustration, inhibitory agents suitable for use in the present invention include chemical compounds, antisense oligonucleotides, interfering RNA (siRNA), catalytic RNAs or specific ribozymes, and inhibitory antibodies.

Antisense oligonucleotides

A further aspect of the invention refers to the use of "antisense" nucleic acids to inhibit expression, for example, to inhibit the transcription and / or translation of a nucleic acid encoding the protein, the activity of which is to be inhibited. . Antisense nucleic acids can bind to the potential drug target by conventional base complementarity or, for example, in the case of binding double-stranded DNA by specific interaction in the large groove of the double helix. These methods generally refer to a range of techniques generally used in the art and include any method that is based on specific binding to oligonucleotide sequences.

An antisense oligonucleotide can be delivered, for example, as an expression plasmid which, when transcribed in a cell, produces RNA complementary to at least a single part of the cellular mRNA encoding the protein. Alternatively, the antisense oligonucleotide is an ex vivo generated oligonucleotide probe that, when introduced into the cell, causes inhibition of gene expression by hybridizing to the mRNA and / or gene sequences of a nucleic acid. Diana. Said oligonucleotide probes are preferably modified oligonucleotides that are resistant to endogenous nucleases, eg exonucleases and / or endonucleases and are therefore stable in vivo. Examples of nucleic acid molecules for use as antisense oligonucleotides are phosphoramidate, phosphothionate, and methylphosphonate DNA analogs.

With respect to antisense oligonucleotide, oligodeoxyribonucleotide regions derived from the translation start site, eg, between -10 and 10 of the target gene, are preferred. Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to the mRNA encoding the target polypeptide. The antisense oligonucleotide will bind to the transcribed mRNA and translation will be prevented.

Oligonucleotides that are complementary to the 5 'end of the mRNA, for example the 5' untranslated sequence up to and including the AUG start codon must function most efficiently to inhibit translation. However, sequences complementary to the 3 'untranslated sequences of mRNA have also been shown to be efficient at inhibiting translation of mRNA. Therefore, complementary oligonucleotides could be used in the 5 'or 3' untranslated, noncoding regions of a gene in an antisense approach to inhibit the translation of said mRNA. Oligonucleotides complementary to the 5 'untranslated region of the mRNA must include the complement of the AUG start codon. Oligonucleotides complementary to the coding region of mRNA are less efficient translation inhibitors but could also be used according to the invention. If they are designed to hybridize to the 5 'region, the 3' region, or the coding region of the mRNA, the antisense nucleic acids must have at least six nucleotides long and preferably less than about 100 and more preferably less than about 50, 25, 17-10 nucleotides long.

The antisense oligonucleotide can be single-stranded or double-stranded DNA or RNA or chimeric mixtures or derivatives or modified versions thereof. The oligonucleotide can be modified at the base group, the sugar group or the phosphate backbone, for example, to improve the stability of the molecule, its hybridization ability, etc. The oligonucleotide may include other linked groups, such as peptides (for example, to target receptors on host cells), agents to facilitate transport across the cell membrane or blood-brain barrier, and intercalating agents. For this purpose, the oligonucleotide can be conjugated to another molecule, for example, a peptide, a carrier agent, a hybridization-triggered cleavage agent, etc.

Antisense oligonucleotides can comprise at least one modified base group. The antisense oligonucleotide can also comprise at least one modified sugar group selected from the group that includes, but is not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose. The antisense oligonucleotide may also contain a neutral peptide-like backbone. Such molecules are known as peptide nucleic acid (ANP) oligomers. In yet another embodiment, the antisense oligonucleotide comprises at least one modified phosphate backbone. In yet another embodiment, the antisense oligonucleotide is an alpha-anomeric oligonucleotide.

While antisense oligonucleotides complementary to the coding region of the mRNA target sequence can be used, those complementary to the non-translated transcribed region can also be used.

In some cases, it may be difficult to achieve sufficient intracellular antisense concentrations to suppress translation of endogenous mRNA. Therefore, a preferred approach uses a recombinant DNA construct in which the antisense oligonucleotide is placed under the control of a strong pol III or pol II promoter.

Alternatively, expression of the target gene can be reduced by targeting complementary deoxyribonucleotide sequences to the regulatory region of the gene (i.e., the promoter and / or enhancers) to form triple helix structures that prevent transcription of the gene into target cells in the body. In certain embodiments, the antisense oligonucleotides are antisense morpholinos.

SiRNA

Small interfering RNAs or siRNAs are agents that are capable of inhibiting the expression of a target gene through RNA interference. An siRNA can be chemically synthesized, it can be obtained by in vitro transcription, or it can be synthesized in vivo in the target cell. Typically siRNAs consist of double stranded RNAs between 15 and 40 nucleotides in length and which may contain a 3 'and / or 5' overhang of 1 to 6 nucleotides. The length of the overhang is independent of the total length of the siRNA molecule. SiRNAs act by degrading or silencing the target messenger after transcription.

The siRNAs of the invention are substantially homologous to the mRNA of the gene belonging to the protocadherin gene cluster, or to the sequence of genes encoding the protein. By "substantially homologous" is meant that they have a sequence that is sufficiently complementary to or similar to the target mRNA, such that the siRNA is capable of degrading the latter through RNA interference. Suitable siRNAs to cause such interference include siRNAs made up of RNA, as well as siRNAs that contain different chemical modifications such as: (i) siRNAs in which the bonds between nucleotides are different from those that occur in nature, such as phosphorothionate bonds ; (ii) Conjugates of the RNA strand with a functional reagent, such as a fluorophore; (iii) Modifications of the ends of RNA chains, in particular of the 3 'end by modification with different hydroxyl functional groups in the 2' position; (iv) Nucleotides with modified sugars such as 2'-O-alkylated residues such as 2'-Omethylribose or 2'-0-fluorosibose; or (v) Nucleotides with modified bases such as halogenated bases (for example 5-bromouracil and 5-iodouracil), alkylated bases (for example 7-methylguanosine).

SiRNAs can be used in the form of double-stranded RNA with the characteristics mentioned above. Alternatively, it is possible to use vectors containing the sense and antisense strand sequence of siRNA under the control of suitable promoters for its expression in the cell of interest.

SiRNA can be generated intracellularly from so-called shRNA (short hairpin RNA) characterized in that the antiparallel chains that make up siRNA are connected by a loop region or a hairpin region. ShRNAs can be encoded by plasmids or viruses, in particular retroviruses, and are under the control of a promoter.

The siRNA and shRNA of the invention can be obtained using a number of techniques known to the person skilled in the art. The region of the nucleotide sequence taken as the basis for designing the siRNA is not limiting and may contain a region of the coding sequence (between the start codon and the stop codon) or it may alternatively contain sequences of the 5 'or 3' untranslated region, preferably between 25 and 50 nucleotides in length and at any position in the position downstream of the start codon.

DNA enzymes

On the other hand, the invention also contemplates the use of DNA enzymes to inhibit the expression of the gene that belongs to the protocadherin gene cluster. DNA enzymes incorporate some of the mechanism characteristics of both antisense and ribozyme technologies. DNA enzymes are designed in such a way that they recognize a particular target nucleic acid sequence similar to the antisense oligonucleotide, however, like ribozyme, they are catalytic and specifically cleave the target nucleic acid.

Ribozymes

Ribozyme molecules designed to catalytically cleave the transcription products of a target mRNA can also be used to prevent translation of the mRNA encoding the protein, the activity of which is to be inhibited. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves a specific hybridization of the sequence of a ribozyme molecule with a complementary target RNA, followed by an endonucleolytic cleavage event. The composition of the ribozyme molecules preferably includes one or more sequences complementary to the target mRNA and the well-known sequence responsible for cleavage of the mRNA or a functionally equivalent sequence. Examples of ribozymes to be used in the present invention include hammerhead ribozymes and RNA endoribonuclease (hereinafter "Cech-type ribozymes").

Inhibitory antibodies

In the context of the present invention, by "inhibitory antibody" is meant any antibody capable of specifically binding to the protein encoded by a gene that belongs to the protocadherin gene cluster, and that inhibits one or more of the functions of said protein. . Antibodies can be prepared using any of the methods that are known to those skilled in the art, some of which have been mentioned above. Therefore, polyclonal antibodies are prepared by immunizing an animal with the protein to be inhibited. In the context of the present invention, suitable antibodies include intact antibodies comprising an antigen-binding variable region and a constant region, "Fab", "F (ab ') 2" and "Fab"', Fv, scFv fragments, diabodies and bispecific antibodies.

The present aspect refers to an agent that inhibits the activity of a protein encoded by a gene that belongs to the protocadherin gene cluster, for its use in the treatment and / or prevention of cancer metastasis in a subject suffering from said cancer. In a particular embodiment, the gene that belongs to the protocadherin gene cluster is the PCDHGC3 gene that encodes the PCDHGC3 protein. Examples of agents that inhibit PCDHGC3 protein activity include, but are not limited to, Thermo Fisher Scientific's PCDHGC3 siRNA, such as siRNA ID numbers 175327, 175328, 175329, 280722, 280723, 280724, 85222, 85317, 85411, HSS181790, HSS181791, HSS181792, MSS234896, MSS234897, MSS234898, RSS300654, RSS300655, RSS340440, S138392, S138393, S138394, S200447, S96674, S96675; S96676 and anti-PCDHGC3 antibodies such as, HPA008755, HPA010580 and HPA077289 antibodies from Atlas Antibodies or Sigma-Aldrich; Polyclonal and monoclonal anti-PCDHGC3 antibodies from Thermo Fisher Scientific.

The inhibitory agents of the present invention are used for the treatment and / or prevention of cancer metastasis in a subject suffering from said cancer.

As used herein, the term "treatment" or "treat" is one approach to obtaining beneficial or desired results, including clinical results. For the purpose of this invention, beneficial or desired clinical outcomes include, but are not limited to, one or more of the following: alleviating one or more symptoms that are the result of the disease, decreasing the extent of the disease, stabilizing the disease (e.g. prevent or delay disease worsening), prevent or delay the spread (e.g. metastasis) of the disease, prevent or delay disease recurrence, delay or slow disease progression, improve condition of the disease, provide a remission (partial or total) of the disease, decrease the dose of one or more medications required to treat the disease, delay the progression of the disease, increase the quality of life, and / or prolong survival. In the context of the present invention, the inhibitory agent of the invention inhibits or reduces the relapse, growth, progression, worsening or metastasis of the tumor or cancer; results in the partial or complete destruction of the mass, volume, cell size or number of neoplastic, tumorous, cancer or malignant cells, stimulating, inducing or increasing necrosis, lysis or apoptosis of neoplastic, tumorous, cancerous or malignant, reducing the cell mass, size, volume of the neoplasm, tumor, cancer or malignancy, inhibiting or preventing the progression or an increase in the volume, mass, size or numbers of cells of the neoplasm, tumor, cancer or malignancy, or prolonging life; results in the reduction or lessening of the severity, duration or frequency of an adverse symptom or complication associated with or caused by the neoplasm, tumor, cancer or malignancy; or the method results in the reduction or decrease of pain, discomfort, nausea, weakness or lethargy, or results in increased energy, appetite, improved mobility or psychological well-being.

As used herein, the term "preventing" (or "preventing" or "preventing") refers to the ability of the agent to inhibit the activity of a protein encoded by a gene that belongs to the cluster of genes of the protocadherins, to minimize or prevent the progression of a disease, condition or disorder in a subject. In the present invention, the disease, condition or disorder is cancer. The term "cancer" as well as "metastasis" have been previously defined in the present description.

In a particular embodiment, the cancer is a pheochromocytoma and paraganglioma tumor (PPGL), colon cancer, or kidney cancer, preferably, the kidney cancer is a clear cell type renal cell carcinoma (CCRCC). In a more particular embodiment, the PPGL tumor is associated with mutations in the SDHx gene. In an even more particular embodiment, the SDHx gene is selected from the list consisting of the SDHB gene, SDHC gene, SDHA gene, SDHD gene and SDHAF2 gene. All these terms have been defined previously in the previous paragraphs.

Administration of the inhibitory agent of the invention to the subject comprises administration of a therapeutically effective amount of the inhibitory agent. The term "therapeutically effective amount" means the amount of inhibitory agent that will elicit the biological or medical response of a tissue, system, animal, or human, which is sought by the researcher, veterinarian, physician, or other clinician. In the context of the present invention, the biological or medical response to be elicited is the treatment and / or prevention of cancer and cancer metastasis, that is, inhibiting the migration of cancer cells and / or inhibiting the proliferation of cancer cells. .

The inhibitory agent of the present invention can be used in combination with one or more drugs in the treatment, prevention, control, improvement or reduction of the risk of cancer, where the combination of the drugs with each other is safer or more effective than any of the drugs alone. Examples of drugs that can be used in combination with the inhibitory agent of the invention for the treatment, prevention, control, amelioration or reduction of cancer include, but are not limited to, cisplatin or carboplatin, gemcitabine, paclitaxel, docetaxel, etoposide, and vinorelbine.

The weight ratio of the inhibitory agent of the present invention to the other active ingredient (s) may vary and will depend on the effective dose of each ingredient. Generally, an effective dose of each will be used. Thus, for example, when the inhibitory agent of the present invention is combined with another agent, the weight ratio of the inhibitory agent to the other agent will generally be in a range from about 1000: 1 to about 1: 1000, or from about 200: 1 to about 1: 200.

The inhibitory agent of the present invention can be administered by oral, parenteral routes of administration (for example, intramuscular, intraperitoneal, intravenous, ICV, intracisternal injection or infusion, subcutaneous injection, or implant), by inhalation spray, nasal, vaginal route. rectal, sublingual, oral or topical and can be formulated, alone or in conjunction, into suitable dosage unit formulations containing conventional non-toxic pharmaceutically suitable carriers, adjuvants and vehicles appropriate for each route of administration. In addition to the treatment of warm-blooded animals, the inhibitory agent of the invention is effective for use in humans.

The inhibitory agent of the present invention can be incorporated into pharmaceutical compositions for administration to the subject. Therefore, in a particular embodiment, the inhibitor of the invention is comprised within a pharmaceutical composition. The inhibitory agent of the present invention may be conveniently presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All the methods include the step of associating the active principle with the support that constitutes one or more secondary ingredients. In general, pharmaceutical compositions are prepared by uniformly and intimately associating the active ingredient with a liquid support or a finely divided solid support or both, and then, if necessary, shaping the product into the desired formulation. In the pharmaceutical composition the active compound is included in an amount sufficient to produce the desired effect on the disease process or condition. As used herein, the term "composition" is intended to encompass a product that comprises the specified ingredients in the specified amounts, as well as any product that is the result, directly or indirectly, of the combination of the specific ingredients in the specific amounts.

The pharmaceutical compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, lozenges, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, solutions, hard or soft capsules , or syrups or elixirs. Compositions intended for oral use may be prepared according to any method known in the art for the preparation of pharmaceutical compositions and such compositions may contain one or more agents. selected from the group consisting of sweetening agents, flavoring agents, coloring agents, and preserving agents to provide pharmaceutically attractive and palatable preparations. Tablets contain the active ingredient in a mixture with pharmaceutically acceptable non-toxic excipients that are suitable for the preparation of tablets. These excipients can be, for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating agents and disintegrating agents, for example, cornstarch, or alginic acid; binding agents, for example starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc. The tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and therefore provide a sustained action for a longer period of time. For example, a time delay material such as glyceryl monostearate or glyceryl distearate can be employed. Oral tablets can also be formulated for immediate release, such as fast melt tablets or wafers, fast dissolve tablets or fast dissolve films.

Formulations for oral use can also be presented as hard gelatin capsules, where the active ingredient is mixed with an inert solid diluent, for example calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules where the active ingredient It is mixed with water or an oily medium, for example peanut oil, liquid paraffin, or olive oil.

Aqueous suspensions contain the active materials in a mixture with excipients suitable for the preparation of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and acacia; dispersing or wetting agents can be a phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long-chain aliphatic alcohols, for example heptadecaethylenexyketanol. , or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as a polyoxyethylene sorbitol monooleate, or condensation products of ethylene with partial esters derived from fatty acids and hexitol anhydrides, for example polyoxyethylene sorbitan monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyoxyethylene sorbitan monooleate. Aqueous suspensions may also contain one or more preservatives, for example ethyl or n-propyl phhydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.

Oily suspensions can be formulated by suspending the active ingredient in a vegetable oil, for example peanut oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oil suspensions can contain a thickening agent, for example beeswax, solid paraffin or cetyl alcohol. Sweetening agents such as those listed above, and flavoring agents may be added to provide a palatable oral preparation. These compositions can be preserved by the addition of an antioxidant such as ascorbic acid.

Dispersible powders and granules, suitable for the preparation of an aqueous suspension by adding water, provide the active ingredient in a mixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present.

The pharmaceutical compositions of the invention can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil, for example olive oil or peanut oil, or a mineral oil, for example liquid paraffin or mixtures of these. Suitable emulsifying agents may be gums of natural origin, for example gum arabic or gum tragacanth, phosphatides of natural origin, for example soybeans, lecithin, and esters or partial esters derived from fatty acids and anhydrides of hexitol, for example monooleate of sorbitan, and condensation products of said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. Emulsions can also contain sweetening and flavoring agents.

The pharmaceutical compositions may also be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated according to the known art using the appropriate dispersing or wetting agents and suspending agents mentioned above. The sterile injectable preparation can also be a sterile injectable solution or suspension in a parenterally acceptable non-toxic diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. Furthermore, sterile fixed oils are conventionally employed as the solvent or suspending medium. For this purpose, any soft fixed oil can be employed, including synthetic mono- or diglycerides. Furthermore, fatty acids such as oleic acid have use in the preparation of injectables.

The inhibitory agent of the present invention can also be administered in the form of suppositories for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable non-irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature, and therefore melts in the rectum to release the drug. Such materials are cocoa butter and polyethylene glycols.

For topical use, creams, ointments, gels, solutions or suspensions and the like containing the compounds of the present invention are employed. Similarly, transdermal patches can also be used for topical administration.

In the treatment, prevention, control, amelioration or reduction of the risk of cancer and / or cancer metastasis, an appropriate dosage level of the inhibitory agent of the invention will generally be from about 0.01 to 500 mg per Kg of body weight of the patient. per day that can be administered in single or multiple doses. A suitable dosage level may be from about 0.01 to 250 mg / kg per day, about 0.05 to 100 mg / kg per day, or about 0.1 to 50 mg / kg per day. Within this range the dosage can be from 0.05 to 0.5, 0.5 to 5 or 5 to 50 mg / kg per day. For oral administration, the compositions can be provided in the form of tablets containing from 1.0 to 1000 milligrams of the active ingredient, in particular 1.0, 5.0, 10.0, 15.0, 20.0, 25 , 0, 50.0, 75.0, 100.0, 150.0, 200.0, 250.0, 300.0, 400.0, 500.0, 600.0, 750.0, 800.0 , 900.0, and 1,000.0 milligrams of the inhibiting agent for the symptomatic adjustment of the dosage to the patient to be treated. The compounds can be administered on a regimen of 1 to 4 times per day, or they can be administered once or twice per day.

It will be understood, however, that the specific dose level and specific dosing frequency for any particular patient may vary and will depend on a variety of factors including the activity of the specific compound employed, metabolic stability, and length of action. of said compound, the age, body weight, general health, sex, diet, mode and time of administration, excretion rate, drug combination, severity of the particular condition, and the host undergoing therapy.

Invention kit and its uses

To practice the method of the invention or the therapeutic use of the invention, reagents are needed to determine the levels of methylation or levels of expression of the target gene. These agents can be provided in a kit, said kit being used for the diagnosis and / or prognosis of cancer metastasis in a subject suffering from cancer, or to predict the clinical outcomes of a subject suffering from cancer, or to predict the clinical results of a subject suffering from cancer, or to determine the response of a subject having cancer to therapy. Likewise, kits comprising the inhibitory agents of the invention for treating cancer, in particular cancer metastasis, are also contemplated in the present invention.

In another aspect, the invention relates to a kit for the diagnosis and / or prognosis of cancer metastasis in a subject suffering from cancer, or to predict the clinical results of a subject suffering from cancer, or to determine the response to therapy of a subject having cancer, where the kit comprises: a) means for quantifying the methylation levels, or the expression levels, of the promoter of a gene that belongs to the protocadherin gene cluster in a sample of said subject; and b) means for comparing the methylation levels, or expression levels, quantified in said sample with a reference value.

Among the means or reagents to quantify the methylation levels, or the expression levels, of the promoter of a gene that belongs to the cluster of genes of the Protocadherins include, but are not limited to, probes and primers specific for a gene belonging to the protocadherin gene cluster, and antibodies that specifically bind to the protein encoded by the gene belonging to the protocadherin gene cluster.

In a particular embodiment, the gene that belongs to the protocadherin gene cluster is the PCDHGC3 gene. Thus, reagents for quantifying promoter methylation levels, or expression levels, are probes and primers specific to the PCDHGC3 gene. The nucleotide sequence of the PCDHGC3 gene has been disclosed in the method of the invention. Similarly, in another particular embodiment, the protein encoded by the gene that belongs to the protocadherin gene cluster is the PCDHGC3 protein. Therefore, the reagents for quantifying promoter methylation levels, or expression levels, are antibodies that specifically bind to the PCDHGC3 protein. Examples of antibodies specific for the PCDHGC3 protein have been previously disclosed.

Additionally, the present invention also encompasses kits comprising the inhibitory agents of the invention for use in the treatment and / or prevention of cancer metastasis in a subject suffering from said cancer. Examples of inhibitors of the activity of the protein that is encoded by a gene belonging to the protocadherin gene cluster have been disclosed in previous paragraphs. In a particular embodiment, the inhibitory agents of the invention are specific to the PCDHGC3 gene or the PCDHGC3 protein. Examples of these inhibitory agents are disclosed earlier in the present description.

All the particular embodiments of the method of the invention and the inhibiting agent of the invention are applicable to the kits of the invention and their uses.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials similar or equivalent to those described herein may be used in the practice of the present invention. Throughout the description and claims the term "comprise" and its variations are not intended to exclude other technical characteristics, additives, components, or steps. Additional objects, advantages, and features of the invention will become apparent. to those skilled in the art upon examination of the description, or may be learned by practice of the invention. The following examples and drawings are provided by way of illustration and are not intended to be limiting of the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. SDHB-PPGL tissue DNA methylation fingerprints show differences between SDHB-bPPGL and SDHB-mePPG. (A) Unsupervised hierarchical clustering and heatmap including CpG dinucleotides with differential DNA methylation between SDHB-bPPGL and SDHB-mePPGL. Average methylation values are shown from 0 (blue) to 1 (yellow). (B) Distribution of hyper- and hypomethylated CpG sites in relation to the state of CpG islands (upper panel) and different genomic regions (lower panel) compared to the background of the matrix.

Figure 2. Long-range methylation of the PCDHA and PCDHG clusters in SDHB-mePPGL. (A) Schematic representation of the genomic region containing the PCDHA, PCDHB and PCDHG clusters. The PCDHGC3 gene is highlighted by a red square. The data in the graph shows a representative example of the beta values of the indicated probes located in the genomic regions indicated as A and B in SDHB-mePPGL and SDHB-bPPGL included in the set of discoveries of the PPGLs. (B) mRNA levels of the PCDHA, PCDHB and PCDHG genes expressed in normal paraganglia (n = 3 independent human carotid bodies), non-mutant bPPGL in SDHx (n = 9), SDHD-bPPGL (n = 5), and SDHB -bPPGL (n = 2). Data are derived from a described Affymetrix microarray data set (Merlo et al. 2012, J Clin Endocr Metab 97 (11): E2194-200). (C) PCDHGC3 promoter methylation data as determined by bisulfite DNA modification, DNA amplification, and pyrosequencing at 4 SDHB-mePPGL and 2 SDHB-bPPGL included in the series of discoveries. * p = 0.04.

Figure 3. High-level methylation of the PCDHGC3 promoter in SDHB-mePPGL. (A) Schematic representation of the structure of the PCDHGC3 gene and the genomic region containing the CpG sites selected for validation studies. (B E) Graphic representation of the methylation percentages detected in our validation series (BC) or TCGA series (DE), which includes the indicated PPGLs, which were classified according to the confirmed diagnosis of metastases (mePPGL) or non-metastatic (bPPGL) (B, D) or according to the presence (mut SDHB) or absence (wt SDHB) of germline mutations in bPPGL and mePPGL (C, E). (FROM). Methylation data from similar primary and metastatic tissues are plotted in panel F. As shown, 2 and 3 metastatic tissues from different anatomical sites were analyzed for patient 1 and 4, respectively. Data from two primary PPGLs were available for patient 5 of the TCGA series. (G) PCDHGC3 mRNA levels determined by RT-qPCR in 4 SDHB-mePPGL and 3 SDHB-bPPGL. (H) Graphic representation of the levels of DNA methylation and mRNA for PCDHGC3 in each of the samples analyzed in panel G. (I) Relative levels of PCDHGC3 mRNA in methylated or unmethylated tumors included in the database by TCGA. * p <0.05, ** p <0.01, **** p <0.0001.

Figure 4. Clinical significance of PCDHGC methylation . (A) Receptor operating characteristic curve (ROC curve) showing the methylation capacity of PCDHGC3 (19%) in distinguishing metastatic from non-metastatic SDHB-PPGL. The area under the curve is 89.7%. (B) Graphic representation of the methylation percentages detected in our validation series including bPPGL and mePPGL with mutations in SDHB. Negative (NPV) and positive (PPV) values were calculated for methylation levels at 19%. (C, D) Kaplan-Meier survival curves for patients with SDHB-PPGL [our validation series (C); our validation series TCGA (D) series] stratified by their levels of PCDHGC3 methylation .

Figure 5. Absence of methylation of the PCDHGC3 promoter in cells with reduced levels of SDHB proteins and increased levels of either HIF-1a or HIF-2a. (A, D) Western blot analysis of SDHB expression in 786-O (+) and 786-0 (-) (A) or RCC4 (+) (D) Selected cells after transfection with carrier lentiCRISPR plasmids of PCDHGC3 (KO) single guide RNA (sgRNA) or an empty vector (C). RCC4 (+) transfected cells were incubated under (Nx, 21% 02) or hypoxic (Hx, 1% 02) conditions for 12 hours before further analysis. (B, E) SDHB mRNA levels in control cells (C) and in PCDHGC3 knockout cells (KO): 786-0 (panel B) and RCC4 (panel E). (C, F) PCDHGC3 methylation levels in control cells (C) and PCDHGC3 knockout cells (KO): 786-0 (panel C) and RCC4 (panel F). **** p <0.0001.

Figure 6. Decreased levels of PCDHGC3 induce proliferation, migration to cell invasion. Cells 786-0 (+) and RCC4 (+) were stably transfected with shRNA from PCDHGC3 (hcPCDHGC3) or the shRNA control vector (Ctrl). (A, C) PCDHGC3 mRNA levels in Ctrl and hcPCDHGC3 cells. (B, D) Cell proliferation after PCDHGC3 silencing was determined by counting cells over time in cells incubated under normoxic or hypoxic conditions (1% 02). Data are represented as the mean ± of two experiments performed in triplicate. (E) Cell cycle analysis of cells indicated as evaluated by flow cytometry. (F) Colony formation tests. One thousand cells per plate were seeded in triplicate for each condition, and subjected to crystal violet staining on day 14. Representative images of cells with crystal violet staining are shown. The relative number of colonies (n = 3) is plotted. (G, H) Wound healing assays are performed on the indicated cells. (G) The forward migration rate of cell monolayers was analyzed by time-lapse video microscopy (recording during time intervals); at least 10 different fields were chosen randomly across the length of the wound. Values are the mean of the mean ± of two independent experiments. (H) Representative images captured with a 10x objective at the time the wound is made (0 hours) or 3 hours after the wound is made (3 hours). (I, J) 786 (+) (I) and RCC4 (+) (J) Control cells (Ctrl) and hcPCDHGC3 cells cultured as tumor spheroids were allowed to migrate for 20 hours, and time-lapse images were recorded. with a time resolution of 30 minutes. The transverse spheroid area of 10 tumor spheres in each experimental condition was measured at the indicated time points (J). Representative images of time-lapse movies are shown at the time points indicated in panels I and J. * p <0.05; ** p <0.01; *** p <0.001.

Figure 7. Kaplan-Meier estimates of overall survival among CCRCC patients. Patients are classified according to the level of expression of PCDHGC3: high expression,> 11.8; low expression, <11.8.

Figure 8. Kaplan-Meier estimates of overall survival among colon cancer patients. (A) Patients are classified according to the level of PCDHGC3 methylation: high methylation,>55%; low methylation, <55 (A) or according to level of PCDHGC3 transcript levels: high expression,>8.98; low expression, <8.98 (B).

EXAMPLES

Example 1

I. MATERIALS AND METHODS

Tumor specimens

Blood samples were obtained from patients with PPGL who were diagnosed and treated between 2005 and 2016 (Hospital Universitario Central de Asturias, Complejo Universitario de Navarra, Hospital Provincial de Castellón, Hospital General Virgen de la Luz, Hospital Gregorio Marañón, the Bellvitge Hospital, the Valencia University Clinical Hospital, the Virgen del Rocío Hospital and the Macarena Hospital in Spain) and in 1975 and 2011 (Mayo Clinic, Rochester, Minnesota). Paraganglia (carotid bodies and adrenal gland) were obtained from 6 independent autopsies. Genomic DNA was obtained from tissues either frozen or embedded in paraffin. Frozen materials were obtained from the tumor core, contained more than 60% tumor cells, and were immediately frozen at the time of surgical resection and stored at -80 ° C in RNAlater (registered trademark of Ambión) until processing. Written informed consent was obtained from the patients and the study was approved by the Ethics Committee of our institution. A PPGL was considered malignant when the patient had metastases at sites distant from the primary tumor lacking chromaffin cells.

Mutation analysis

Genomic DNA was isolated using a GlAmp DNA mini kit (Giagen, Inc., Chatsworth, CA) and subsequently treated with RNase A (1 unit / ml) at 37 ° C for 5 minutes from blood DNA. Mutation analysis was performed by direct sequencing as described above. VHL and SDHx genes were analyzed for the presence of large deletions in blood DNA using the multiple ligand dependent probe amplification method (MLPA), following the manufacturer's recommendations (SALSA MLPA P016 and P226, respectively, MRC Holland , Netherlands). No mutation analysis could be performed at the somatic level due to the limited amount of DNA. However, expect the rate of SDHx mutations in tumor DNA to be minimal as suggested by previously published work. Furthermore, SDHB immunohistochemistry in some tumors lacking SDHx mutations was positive, thus suggesting the absence of somatic SDHx mutations.

Whole genome methylation analysis

Tumor DNA was extracted with phenol-chloroform-isoamyl alcohol and converted bisulfite prior to full genome analysis of methylation with the Infinium Human Methylation450 BeadChip matrix (Illumina®, San Diego, CA, USA) at the "National Center for Genotyping ”Spanish CEGEN-ISCIII. The raw data files were imported and pre-processed using the R / Bioconductor minfi package (version 1.14.0). The crude methylation signals were normalized using the quantile subset within the normalization matrix (SWAN) method. A methylation measure was defined as faulty if it had a detection p-value above 0.01. Probes with more than 2 defective measurements were removed from the data set. Methylation was described as the beta value, which was in the range of 0 (no methylation) and 1 (complete methylation).

Annotation, Gene Ontology Analysis (GO), and Histone Enrichment Analysis

The probe sets were converted to gene sets using the annotation information from the Bioconductor package TxDb.Hsapiens.UCSC.hg19.knownGene (version 3.1.2). A probe was assigned to a gene if the probe was contained within the area of all genomic regions represented by the different transcripts belonging to that gene or within a region 2 kb upstream from the corresponding transcription start site. After probe-to-gene conversion, the gene sets of interest were analyzed using the HOMER software tool v4.9, 2-20-2017. The complete set of genes in HumanMethylation450 was used as the background. This software was also used for GO analysis and path analysis, using different databases, such as, the Gene Ontology (GO) Biological Process database, the ontologies of the Molecular Signatures Database (MSigDB) (Subramanian A, et al. 2005. Proc Natl Acad Sci US A., 102: 15545-15550), and the Kyoto Encyclopedia of Genes and Genomes (KEGG) and the Reactome metabolic pathway analysis database. To further capture the relationship between the terms, we used the Metascape software (http://metascape.org) (Tripathi S, et al. 2015, Cell Host M'crobe.18: 723-735); I know selected the enriched set of terms and represented as a network graph, where terms with similarity> 0.3 are connected by edges. We select the terms with the best p-values, with the restriction that there are no more than 15 terms and no more than 250 terms in total.

To analyze the enrichment of histone marks in the subset of probes, the information contained in the UCSC Genome Browser Broad Histone track of the ENCyclopedia Of DNA Elements (ENCODE) project was used. Fisher's exact test was used to determine whether there was significant enrichment of histone marks in the subset of interest. P-values were adjusted for multiple comparisons using the Benjamini-Hochberg method to control for the false discovery rate (FDR). A significance level of 0.05 was used to determine if the given combination of histone tag and cell line exhibited a significant change in ratio. The logarithm to base 2 of the odds ratios (OR) was used as a measure of effect size.

DNA methylation analysis

The level of methylation of the selected CpGs was validated by bisulfite modification of DNA, DNA amplification and pyrosequencing (PyroMarkQ24 Advanced System®). The primers used for PCR amplification (5'-GGGATGAGGTAGAGATTGAATAG-3 '[SEQ ID NO: 8]; 5'-CCTCCAAACCTCTAAAACCATCTCA-3' [SEQ ID NO: 9]) and sequencing (5'-GAGGTAGAGATTGAATAGT-3 ' [SEQ ID NO: 10]) were designed with the PyroMark assay designer tool. This approach facilitated an analysis of the methylation levels of 8 CpG sites within a fragment by 182-bp bisulfite PCR. The statistical significance of the differences between groups of tumors was evaluated using a t test with a threshold of significance of 0.05.

Generation of Knockout Cell Lines Using the Clustered and Regularly Interspaced Short Palindromic Repeats (CRISPR) -Cas9 technique

Two single guide RNAs or sgRNAs were designed for the lentiCRISPR v2 vector following the guidelines of human GeCKOv2: 5'-caccgTCGCCCTCTCCTTGAGGCGC-3 '[SEQ ID NO: 11] - 5'-aaacGCGCCTCAAGGAGAGGGCGAc-3' [SEQ ID NO: 12] Y 5'caccgGGCCGGCAACCGGCGCCTCA-3 '[SEQ ID NO: 13] - 5'-aaacTGAGGCGCCGGTTGCCGGCCc-3' [SEQ ID NO: 14], Next, 150 ng of the lentiCRISPR plasmid was cut with Esp3l (Thermo Scientific oligos) and ligated hybridized (0.5 pM) and T4 DNA ligase (NEB) in the same reaction, which consisted of 10 cycles of 5 minutes at 37 ° C followed by 10 minutes at 16 ° C. The two plasmids harboring sgRNA sequences or empty vectors (as controls) were transfected into 293T cells in the presence of lentivirus helper plasmids (VSV-G and PAX), and the supernatants were collected after 24 hours and 48 hours after transfection. and they mixed. Viruses were used to infect cells in culture flasks at 80% confluence, with 4 pg / ml of polybrene. Clones were selected with 4 pg / ml puromycin and 500 pg / ml G418 for two weeks.

HcRNA-induced gene silencing

Non-target PCDHGC3 shRNA or shRNA constructs cloned into the GIPZ lentiviral vector were obtained from Dharmacon. For viral infection of 786-0 or RCC4 cells, the usual medium was replaced with a culture medium containing 5 pg / ml polybrene. Cells were then exposed to lentivirus for 48 hours, washed, and cultured in selection media containing 4 pg / ml puromycin for 10 days.

Western transfer

The cells were homogenized in a lysis buffer containing 50 mM Hepes-KOH, pH 7.3, 250 mM NaCl, 5 mM EDTA, 0.2% Nonidet P-40, 5 mM dithiothreitol, and inhibitors of the protease (0.5 mM phenylmethylsulfonyl fluoride, 1 mM Na3V04, 1 pg / ml aprotinin, 10 pg / ml pepstatin, 10 pg / ml leupeptin) for 10 minutes at 4 ° C. After centrifugation at 8,000 xg for 5 minutes, supernatants were recovered, and protein concentrations were determined with Bradford's protein assay reagent. The Usados (20 pg) were loaded and resolved by 6% SDS polyacrylamide gel electrophoresis followed by transfer to an Immun-Blot polyvinylidene difluoride membrane (Bio-Rad). The membranes were hybridized with anti-SDHB (Sigma) at a 1: 1000 ratio or anti-p-actin antibodies (Sigma) at a 1: 10000 ratio and developed with secondary antibodies (IRDye 800CW anti-rabbit IgG and IRDye 800CW anti-mouse IgG IgG, LI-COR Biosciences) fluorescently labeled. Membrane images were recorded with the Odyssey infrared imaging system (Li-Cor Biotechnology).

Cell cycle analysis

Cells cultured to 70% confluence were harvested and fixed in 70% ethanol, followed by RNase A treatment and propidium iodide (Pl) staining. Flow cytometric analysis was performed to quantify the distribution of cells in the G1, S, and G2-M phases of the cell cycle.

MRNA quantification

Total RNA was isolated with the mirVana ™ miRNA Isolation Kit (Ambion) according to the manufacturer's instructions. A TaqMan assay (Applied Biosystems) was used to analyze the expression of PCDHGC3. Each sample was analyzed for peptidylprolyl isomerase A (PPIA) mRNA to normalize the input amounts of RNA and perform relative quantitation. All reactions were performed in triplicate, and mRNA expression was normalized against endogenous controls using the comparative delta-delta CT method.

Clonogenic survival assay

To study the potential for self-renewal, cells were seeded at a very low density of 1 * 103 cells per 100x17 mm per plate and cultured for 10 days. The cells were then fixed with ice cold methanol on ice for 10 minutes and stained with 0.5% crystal violet before the clones were manually counted.

Cell invasion assays and time-lapse video recording

For the generation of tumor spheres, cells were cultured in a spheroid formation medium (growth culture medium supplemented with 0.2% methylcellulose) in a non-adhesive convex environment for 12 hours at 37 ° C and 5% C02 . The tumor spheres were mixed with a collagen matrix (2.5 mg / ml) and incubated for 30 minutes at 37 ° C before microscopic analysis. Time-lapse microscope imaging was performed on a Zeiss AxioObserver Z1 microscope (Cari Zeiss, Germany) with a Plan-Apochromat 40X / 1.3 oil immersion lens objective (NA = 1.3, working distance = 0.21 mm) or Plan-Apochromat 63X / 1.4 (NA = 1.4, working distance = 0.19 mm), a camera (AxioCam MRm; Cari Zeiss), and an Apotome accessory (ApoTome 2; Cari Zeiss) . Mosaic images were taken using AxioVision software (Cari Zeiss) for a 20 hour period with a 30 minute time resolution. The spheroid cross-sectional area of 10 tumor spheres in each experimental condition was measured at each time point to calculate the invasion rate.

Wound healing tests

Cells were grown for confluence on a 2-well silicone insert (Ibidi) with a defined cell-free gap. After cell docking, the inserts were removed, and any floating cells were removed with extensive washing with Dulbecco's Modified Eagle's Medium (DMEM). The linear movements of the cells were monitored using a Zeiss AxioObserver Z1 microscope with a 20 * objective magnification. Images were captured at 15 minute intervals for 12 hours of five different fields in each well. Three fields were chosen randomly across the length of the wound to measure the rate of cell migration in the wound area.

Statistic analysis

All statistical analyzes were performed using SPSS version 19 statistical software (SPSS, Inc., Chicago, IL) as previously described or R 3.5.2 software. p <0.05 was defined as statistically significant. To evaluate the association between PCDHGC3 methylation levels and the presence of metastasis in patients with SDHB mutations, a univariate logistic regression model was used to calculate the odds ratio (OR) and a 95% confidence interval.

II. RESULTS

Hypermethylation profile of SDHB-mePPGLs

DNA methylation status of> 450,000 CpG sites was compared in 18 tissues with PPGL and 4 normal paraganglionics, using Infinium Illumina Methylation Matrices. Table 2 shows the detailed clinicopathologic and genetic characteristics included in this series of findings. As shown, 12 PPGLs presented benign clinical behavior after a mean follow-up period of 101 ± 18 months and 6 PPGLs presented synchronous metastases. Four of all 6 mePPGL carried SDHB mutations and the other two tumors lacked

any known mutation.

A B C D E F G

14 PCC Yes NONE 136 0

35 H&N Yes SDHB c725G> A NA NA 27 H&N Yes NONE 144 84 55 H&N No SDHB c.725G> A 142 142 55 H&N No NONE NA NA 25 H&N No SDHD c.33C> A 120 120 66 H&N No NONE 108 108 42 H&N No NONE 109 109 39 H&N No SDHD c.383lnsT 105 105 44 A_PGL Yes SDHB c725G> A 29 0 29 A_PGL No SDHB of exon 1 96 96 29 H&N No NONE 84 84 44 H&N No SDHD c.191 192delTC 90 90 c. 544 550delGGGCTC

45 H&N No SDHB T 89 89 39 H&N No SDHD c.191_del192delTC 95 95 45 H&N No NONE 80 80 48 H&N Yes SDHB of exon 1 9 0 48 H&N Yes SDHB c.166_170delCCTCA 32 10

Table 2. Clinical and genetic data of patients with PPGL included in the trial of

methylation matrices. H&D: Head and neck; A_PGL: Abdominal paraganglioma;

CSF: pheochromocytoma; Columns: A: Age at diagnosis (years); B: Location

of the tumor; C: Metastatic disease; D: Mutated gene; E: Mutation; F: Tracking

(months); G: months without metastasis.

Significant differences in methylation between PPGL and normal controls

involved only 25 differentially methylated CpGs (21 hypermethylated and 4

hypomethylated) located in the promoter regions of 19 genes (Table 3).

control_pgl.hyper.450k control_pgl.hypo.450k cg21625301 cg00159780

cg26435961 cg07521889

cg09088580 cg15244360

cg01927162 cg24888989

cg16755833

cg08847919

cg04833853

cg10402321

cg18053228

cg17091056

cg03461781

cg20848921

cg00488747

cg02099148

cg07931190

cg01736389

cg00663986

cg10062109

cg10638573

cg10256045

cg01497527

Table 3. Probes with differential methylation in PPGL versus paraganglia

normal.

No significant differences were found between normal controls and SDHx-

PPGL in this series or between SDHx-PPGL and PPGL lacking SDHx mutations.

However, the data revealed that the methylation profile was significantly

different in the SDHB-PPGL group when comparing metastatic tumors

(n = 4) with non-metastatic (n = 3): SDHB-mePPGL had 1960 CpG sites (se

attributed to 1,119 genes) with mean methylation values more than two times more

higher than those of SDHB-bPPGL (p <0.01) (Figure 1A). I only know

observed 16 hypomethylated CpG sites in the SDHB-mePPGL compared to the

SDHB-bPPGL. The hypermethylated CpG sites were highly enriched in

islands CpG (CGI) (compared to “CGI-shore” (shore of islands), “CGI shelves” (ledges of

islands) and non-CGI) and were located mostly within the promoter regions of the

gene (Figure 1B).

Analysis of the set of hypermethylated genes identified in the SDHB-mePPGL

using GO and path analysis revealed a significant enrichment of terms

GO related to neuronal differentiation, synoptic transmission and adhesion

mobile. Statistically significant overlaps were observed with genes that

possess the trimethylated H3K27 mark on their promoters and gene targets of the complex PRC2 / EED-EZH2 transcriptional repressor. At the chromosome level, a surprising observation was the identification of a long region in the locus of chromosome 5q31 (approximately 800 Kb) that had a high density of hypermethylated CpG sites and encompassed in the PCDHA, PCDHB and PCDHG gene clusters. This observation prompted the inventors to investigate whether any of these PCDH genes could be candidate genes to be involved in the metastatic behavior of SDHB-PPGL.

First, the expression levels of individual PCDH genes in normal paraganglia and PPGL were explored. For this purpose, we consulted Affymetrix microarray data sets (Merlo, A. et al. 2012. J Clin Endocrinol Metab, 97: E2194-200) and observed that the mRNA levels of all PCDH genes were similar in bPPGL and normal paraganglia. Furthermore, of the individual PCDH detectable by multiple probe sets, PCDHGC3 showed the most robust expression (Figure 2). Experimental validation of the methylation matrix data was obtained by bisulfite sequencing of the PCDHGC3 promoter in 4 SDHB-mePPGL and 2 SDHB-bPPGL. As shown in Figure 2, the data confirmed the results obtained from the methylation matrices, showing that the PCDHGC3 promoter is unmethylated in SDHB-bPPGL and undergoes de novo methylation in SDHB-mePPGL. Therefore, the PCDHGC3 gene was selected for further studies.

High-level methylation of PCDHGC3 promoter in primary SDHB-mePPGL and its metastases.

The methylation status of PCDHGC3 was explored by bisulfite sequencing in a PPGL validation run (Table 4).

A B C D E F G H

47, F H&N No SDHB c.88_314 + 247del No 36 36 17, M H&N No SDHB c.644delC No 48 48 46, M H&N No SDHB ^{c.166 170delCCTC}

_{A No 60 60} 32, M H&N No SDHB c.269G> A No 120 120 39, F H&N No SDHB of exon 3 No 84 84 41, F H&N No SDHB c.761C> T No 96 96 54, F H&N No SDHB c.79C> T No 72 72 44, M H&N No SDHB ^{c.166 170delCCTC}

_{A No 78 78} Ab No SDHB of exon 1 No 60 60 Ab No SDHB c.688C> T No UN UN Ab No SDHB of exon 1 No 60 60 Ab No SDHB c.558-3 C> G No 180 180 A_PGL No SDHB of exon 2 No 30 30 Ad No SDHB of exon 6-8 No 37 37 H&N No SDHB c.649C> T No 22 22 Ab No SDHB of exon 1 No 36 36 Ad No Without SDHx No 12 12 H&N No Without SDHx UN UN UN H&N No Without SDHx UN UN UN H&N No Without SDHx UN UN UN Ad No Without SDHx No 13 13 H&N No SDHB c.136C> T No 78 78 Ad No NF1 UN No 185 185 Ad No Without SDHx * & No 62 62 Ad No Without SDHx * & No 58 58 Ad No Without SDHx * No 12 12 Ab Yes SDHB c725G> A Yes 29 0 Ab Yes SDHB c.558-3 C> G No 120 0 Ab Yes SDHB c.637dupA No 36 9 H&N Yes SDHB ^{c.166 170 of the CCTC}

_{A Yes 33} 10 Ab Yes SDHB of exon 1 Yes 9 0 VC Yes SDHB c.423 + 1G> A No 60 0 Ab Yes SDHB of exon 1 No 36 UN Ab Yes SDHB of exon 6-8 Yes 96 0 Ab Yes SDHB of exon 1 No 36 UN Ab Yes SDHB ^{c.166 170delCCTC} UN _{A No 36}

TC Yes SDHB c.688C> T No 36 0 Ab Yes SDHB c.637dupA No 18 0 Ab Yes SDHB c.637dupA No 22 0 Ab Yes SDHB c.1 -? _ 72+? Del No 36 0 Ab Yes SDHB c.637dupA No 24 0 Ab Yes SDHB of exon 1 No 36 0 Ad Yes SDHB UN No 144 84 Ab Yes SDHB of exon 1 Yes 36 0 Ab Yes SDHB - No 72 2 Ab Yes SDHB - No 60 0 se Yes SDHB - Yes 132 0 Ab Yes SDHB - No 108 0 Ab Yes SDHB - Yes 120 36 Ab Yes SDHB - No 60 0 Ab Yes SDHB - No 192 4 31, F Ab Yes SDHB - Yes 120 36 53, F Ab Yes SDHB No 96 0 69, M Ab Yes Without SDHx # No 99 29 54, F Ad Yes Without SDHx No 108 0 20, M TC Yes Without SDHx &# No 36 UN 39, M H&N Yes Without SDHx * & Yes 144 84 29, F Ab Yes Without SDHx Yes 84 18 14, F Ad Yes Without SDHx * No 136 0 53, M Ad Yes Without SDHx Yes 32 10 60, M Ad Yes Without SDHx No 48 12 75, M Ad Yes Without SDHx Yes 60 36 78, M Ad Yes Without SDHx Yes 2 2 4, F Ad Yes Without SDHx No 96 12 15, F Ad Yes NF1 UN No 95 94 36, M Ad Yes NF1 UN Yes 12 0

Table 4. Summary of the patient group used for the validation of PCDHGC3 methylation . Gender: M: Male, F: Female, A: Unknown; Tumor location: H&N: Head and neck, Ab: Abdominal, Ad: Adrenal; A_PGL: abdominal PGL; TC: Thoracic, VC: Vesical, CS: Sacral; Columns: A: Age at diagnosis, Gender; B: Location of the tumor; C: Metastatic disease; D: Mutated gene; E: Mutation; F: Exitus; G: Follow-up (months); H: months without metastasis.

The genomic region selected for validation is shown in Figure 3A. Methylation was not observed in two non-tumor human adrenal glands or in two adrenal neuroendocrine carcinomas, unrelated tumors appearing in the same organ. In contrast, de novo methylation of PCDHGC3 was detected in PPGL that was significantly higher in mePPGL compared to bPPGL (Figure 3B) (p <0.0001). Methylation was not associated with clinical variables such as age, sex, or tumor location. However, when considering the presence or absence of germline mutations, it was observed that de novo methylation was restricted to tumors with SDHB mutations, except for 2 mePPGL without SDHB mutations that showed methylation levels of 22% and 50% . Importantly, the level of methylation was significantly higher in SDHB-mePPGL (mean = 37.24%; de = 3.93%, n = 27) than in SDHB-bPPGL (mean = 9.59%; de = 2.18%, n = 19) (Figure 3C) (p <0.0001). A univariate logistic regression analysis revealed that PCDHGC3 promoter methylation was significantly associated with metastasis in patients with SDHB mutations (odds ratio = 1.105; 95% Cl = 1.033 to 1.18).

Importantly, in SDHB-mePPGL with high levels of methylation, the diagnosis of primary tumors and metastatic disease was synchronous in all cases except seven who had a metastasis-free time that ranged from 1 to 19 years. The absence of metastasis in patients with SDHB-bPPGL was confirmed with imaging tests and clinical examinations during a follow-up period of 5.6 ± 3.8 years.

Among bPPGL and mePPGL lacking SDHB mutations, 0 of 7 and 2 of 13 (15%) PPGL, respectively, showed methylation levels above 20%, with methylation values of 22% and 50% in the 2 cases. by mePPGL. The follow-up period for the bPPGL was 5.5 ± 3.9 years.

Next, an in silico validation was performed using publicly available methylation data, which was obtained using the Infinium Human Methylation450 BeadChip matrix, for the PPGL samples published in The Cancer Genome Atlas (TCGA). ) (Fishbeing, L. et al.

2017, Cancer Cell, 31: 181-193). From this group of 181 PPGLs, 166 primary PPGLs with a confirmed diagnosis of bPPGL or mePPGL were selected. The mean of the methylation levels was calculated, which was detected with 5 consecutive probes that hybridized within the promoter of PCDHGC3 (see Figure 3A), for each one of the tumor samples included in the series. Analysis of these data showed that PCDHGC3 methylation levels were significantly higher in mePPGL than in bPPGL (p <0.0001) (Figure 3D). Tumors with high levels of PCDHGC3 methylation did not carry somatic PCDHGC3 mutations or genomic deletions at the 5q31 PCDHGC3 chromosomal locus where PCDHGC3 is located. Although the number of SDHB-mePPGL in this series was quite limited (n = 5), an analysis was performed segregating PPGL according to the presence or absence of germline SDHB mutations. As shown in Figure 3E, de novo methylation of PCDHGC3 was mostly limited to SDHB-PPGL. Methylation levels were higher in SDHB-mePPGL (median = 43; mean = 40.55%; de = 14.35%, n = 5) than in SDHB-bPPGL (median = 14.18%; mean = 20.1%; de = 18.12%, n = 10; p = 0.024). Selecting the median value of SDHB-bPPGL methylation as a cut-off value, we observe that de novo methylation of PCDHGC3 was more frequent in patients with SDHB-mePPGL than in patients with SDHB-bPPGL (100% versus 50% of cases, respectively). Although the described follow-up period of the patients with SDHB-bPPGL in the TCGA series was quite short [1.66 ± 0.76 years (non-methylated cases) and 2.28 ± 2.14 years (methylated cases)], absence of metastasis was confirmed during this period of time. As in our series, two of the patients with SDHB-mePPGL developed metastases 4 and 18.81 years, respectively, after diagnosis of the primary tumor. Among bPPGL and mePPGL lacking SDHB mutations, only 2 of 144 (1.3%) and 6 (16.6%) PPGL, respectively, showed de novo methylation of PCDHGC3.

PCDHGC3 methylation levels were also analyzed in paired primary and metastatic tissues from 4 patients with SDHB-mePPGL who were included in our validation series. In this analysis, the results of 1 patient with SDHB-mePPGL primary and metastatic tissue that was described in the TCGA series were also included. A comparison of the PCDHGC3 promoter methylation levels between the primary tumor and the metastasis revealed that the mean level of methylation was significantly higher in metastasis (mean = 67.5%, de = 2.09%, n = 8 ) than in the corresponding primary PPGL (mean = 38.48%, de = 4.18%, n = 6) (p <0.0001) (Figure 3F).

Epigenetic silencing of PCDHGC3 in SDHB-mePPGL

Taken together, the data suggest that epigenetic alteration in the PCDHGC3 gene could be involved in the pathophysiology of SDHB-mePPGL. Thus, the inventors sought to determine whether the methylation of the PCDHGC3 promoter is associated with a decrease in the expression of the PCDHGC3 gene. A quantitative analysis of PCDHGC3 mRNA levels was performed in a reduced subset of SDHB-PPGL (4 mePPGL and 3 bPPGL) from which a high quality RNA was available. PCDHGC3 mRNA levels were significantly lower (mean = 0.04, de = 0.02) in SDHB-mePPGL than in SDHB-bPPGL (mean = 0.147, de = 0.02) (p = 0.023) ( Figure 3G). Furthermore, methylation levels and PCDHGC3 mRNA levels were inversely correlated (Pearson's correlation coefficient = -0.84, p = 0.0173), suggesting that methylation is functionally linked to gene silencing (Figure 2H ). Analysis of the TCGA database also revealed that PCDHGC3 mRNA levels were significantly lower in SDHB-mePPGL compared to SDHBbPPGL (Figure 31). An inverse correlation was also observed between PCDHGC3 mRNA and methylation levels in this series of patients (Pearson's correlation coefficient = -0.314, p <0.001).

Clinical significance of PCDHGC3 methylation in patients with SDHB-PPGL To evaluate whether PCDHGC3 methylation was presented as a useful predictive tool on having / developing metastatic disease in patients with SDHB mutations, we performed an analysis of the operating characteristic curve of the receptor (ROC). The area under the curve (AUC), using a methylation level cutoff of 19%, was 0.897 (95% Cl = 0.795-0.999). The negative (NPV) and positive (PPV) predictive values were 88.9% and 86.5%, respectively (Figure 4B). The ROC curve analysis using the data from our validation series plus the TCGA series produced an AUC of 0.871 (95% Cl = 0.774-0.968), and the NPV and PPV were, respectively, 85.2% and 83 , 8%.

To assess the prognostic significance of PCDHGC3 methylation, we examined its association with survival in patients with SDHB-PPGL using the Kaplan-Meier survival analysis. All patients died due to PPGL. The cut-off value to define mePPGL with high or low PCDHGC3 methylation was 28%, which is the median level of methylation observed in SDHB-PPGL. The PCDHGC3 high methylation group showed significantly lower overall survival than the PCDHGC3 low methylation group [Hazard Ratio (HR): 3.8 (95% Confidence Interval (Cl): 1.23- 13.66); p = 0.026 Mantel Cox test] (Figure 4C). Similar results were obtained when SDHB-PPGL from the TCGA group were added to our series [HR: 4.16 (95% Cl 1.33-11.92); p = 0.012 Mantel Cox test] (Figure 4D).

SDHB and H IF-a are not required for the methylation of the promomer of PCDHGC3 The finding that the epigenetic modification of PCDHGC3 was mostly limited to SDHB-PPGL suggests that this trait is related in its mechanism to deficiency of SDHB and the metastatic phenotype of SDHB-PPGL. In fact, the predominant model of CpG site methylation in SDHx-deficient tumors holds that the accumulation of succinate in SDHx-PPGL tumors not only induces the accumulation of HIF-a protein, but also inhibits 2-dependent oxidative demethylation. OG, which in turn produces hypermethylation of DNA. Therefore, it was tested whether the decrease in SDHB levels and / or the accumulation of the HIF-a protein are sufficient to trigger the methylation of the PCDHGC3 promoter. Silencing of SDHB was performed using the CRISPR-Cas9 method in two related 786-0 renal cancer cell lines, lacking (-) or containing (+) the VHL gene. In the absence of VHL, 786-0 cells accumulate the HIF-2a protein, but not HIF-1a, under normoxic conditions. In contrast, HIF-2a degrades under normoxic conditions in 786-0 cells expressing VHL. SDHB knockout was verified by quantification of SDHB protein and mRNA levels (Figure 5A and B). As shown in Figure 4C, de novo methylation of the PCDHGC3 promoter did not occur in 786-0 (+) or 786-O (-) cells with decreased levels of SDHB proteins. The same approach was used in RCC4 (+) kidney cancer cells expressing exogenously transfected VHL. Figure 5D-F shows the absence of de novo methylation of the PCDHGC3 promoter in RCC4 (+) cells with reduced values of the SDHB protein. Absence of methylation was also observed after exposure of RCC4 (+) cells with silenced SDHB to hypoxic conditions (1% 02, 12 hours) that induce the accumulation of HIF-1a. These data suggest that reduced levels of the SDHB protein are not sufficient to induce PCDHGC3 methylation and that HIF-a activity is not a requirement for PCDHGC3 methylation in SDHB-deficient cells.

A decrease in PCDHGC3 gene expression increases cell proliferation, migration and invasion

To unravel the putative relevance of PCDHGC3 epigenetic events, we sought to analyze the functional significance of PCDHGC3 loss in cancer cell phenotypes using 786-0 (+) and RCC4 (+) cell lines in which PCDHGC3 gene expression it was partially eliminated by lentiviral transfection of shRNA (PCDHGC3-shRNA cells). PCDHGC3 mRNA levels decreased to approximately 20% and 40% in PCDHGC3-shRNA-786-O (+) and -RCC4 (+) cells, respectively, compared to those cells transfected with control shRNA (Figure 6A and C). To investigate the possible role of PCDHGC3 in cell proliferation, a cell count was performed in PCDHGC3-shRNA cells and in the corresponding control cells. As shown in Figure 6B and D, inhibition of PCDHGC3 expression significantly increased cell growth rates in both cell lines (8.5-fold and 3.2-fold increases on the 8th day of culture in 786-0 (+) cells and RCC4 (+), respectively). Consequently, the number of PCDHGC3-shRNA-786-O cells in the S phase of the cell cycle increased by 21% compared to that of control cells (Figure 6E). Cell proliferation was also promoted in control cells incubated under hypoxic conditions (1% 02) and this effect was further increased following treatment with PCDHGC3-shRNA (approximately 2-fold increases in both cell lines compared to proliferation in hypoxic control cells). The repression of PCDHGC3 also led to a significant (1.6-fold) increase in clonogenic growth of cells, suggesting that PCDHGC3 activity is involved in tumorigenicity (Figure 6F).

Wound healing assays showed that the reduced expression of PCDHGC3 increased the migratory potential of 786-0 (+) cells by approximately 35% compared to that of control cells (Figure 6G and H). We also analyzed whether the silencing of PCDHGC3 affected the invasive potential of the cells. For this purpose, we use cell spheroids completely embedded within collagen matrices and perform live cell imaging of cell aggregates over a period of 20 hours with a time resolution of 30 minutes. This analysis revealed that the migration and invasion of tumor cells into the collagen matrix took place in a coordinated way, maintaining cell-to-cell contacts and generating spheroids with progressively larger and irregular perimeters. A comparison of variations in area over time in control cells and in shRNA-PCDHGC3-786-0 (+) or -RCC4 (+) cells revealed that shRNA-PCDHGC3 cells invaded the extracellular matrix faster than expected. than did the control cells (Figure 6I and J).

III. CONCLUSION

Identifying PPGL patients with inherited mutated SDHB who are prone to developing metastatic disease is a significant challenge in the clinical setting. Here, evidence is provided for epigenetic alterations in SDHB-mePPGL that differ from those in SDHB-bPPGL. More specifically, the inventors observed that epigenetic silencing of the PCDHGC3 gene is putatively involved in the metastatic behavior of SDHB-PPGL.

The data shown here, with the largest number of SDHB-PPGLs studied epigenetically so far, provide a novel epigenetic signature that is present in SDHB-mePPGLs. Approximately 70% of the hypermethylated genes that are identified here in SDHB-mePPGL had not been previously described, suggesting that these genes could be specifically related to the metastatic process, in addition to the presence of germline SDHB mutations. . Analysis of the functional enrichment of said epigenetic signature reveals that most of the affected genes are involved in neuronal differentiation and were also methylated in cancer stem cells. This is a relevant finding that supports the hypothesis that stem cells are involved in the development of this type of cancer. The data shown here also highlights a significant enrichment of genes located at the 5q31 chromosomal locus encompassing the PCDHA, PCDHB, and PCDHG gene clusters.

The PCDH genes constitute the most diverse group within the cadherin superfamily and include 60 proteins encoded by the tandem multigenic clusters PCDHA, PCDHB, and PCDHG; These genes are involved in the regulation of neurodevelopment and are coupled in homophilic / heterophilic trans-interactions as multimers. Here, the first evidence is provided that PCDHs may play a role in the tumorigenesis of neuroendocrine tumors, specifically PPGLs. Methylation and silencing of one of the PCDH genes, PCDHGC3, is shown in specific subsets of PPGL. According to the TCGA-PPGL data and the validation series, the PCDHGC3 promoter was unmethylated in most PPGL lacking SDHx mutations but underwent de novo methylation in approximately 30% of SDHB-bPPGL and almost all SDHB-mePPGL. Interestingly, methylation levels were low in SDHB-bPPGL, moderate in SDHB-mePPGL, and high in metastatic tissues derived from SDHB-mePPGL. These data suggest that this epigenetic trait is progressively amplified during the transformation of tumor cells from benign to invasive and metastatic states, as suggested for other oncogenes and tumor suppressor genes.

Importantly, evidence is provided here that PCDHGC3 could function as a metastasis suppressor gene in PPGLs. In vitro data showed that reduced expression of PCDHGC3 genes in two cell lines Different carcinogens resulted in increased cell proliferation, cell migration, and mass cell invasion.

The data presented herein reveals that epigenetic silencing of PCDHGC3 is associated with a deficiency of SDHB. Reduced levels of the SDHB protein, which are induced by CRISPR / Cas9-mediated gene silencing in two different cancer cell lines, were not sufficient to trigger de novo methylation of the PCDHGC3 promoter. Considering the role attributed to SDH deficiency as an inducer of HIF-a transcription factor, it was also tested whether accumulation of HIF-1a or HIF-2a in SDHB-deficient cells could be the missing link for methylation. by PCDHGC3. The data revealed that none of these HIF-a subunits appear to play a role in the induction of this epigenetic event.

The data presented herein lead the inventors to propose that epigenetically silenced PCDHGC3 mediated signals may provide tumor cells with metastatic capacity. Epigenetic alterations of PCDHGC3 during tumor initiation may not automatically lead to full metastatic potential. Instead, the metastatic potential likely evolves through quantitative amplification, ultimately providing the cell with metastatic capacity. Interestingly, the inventors observed PCDHGC3 methylation in primary tumors that developed metastases several years after surgical removal of the tumor. Therefore, PCDHGC3 methylation functions as a metastasis prediction tool in patients with SDHB mutations.

To the best of the inventors' understanding, this study provides the first evidence of a role for a PCDH gene in the pathogenesis of a tumor of neuroendocrine origin. Somatic and germline mutations in SDHB are seen in an increasing number of neoplasms, including gastrointestinal stromal tumors, pancreatic neuroendocrine tumors, ganglioneuromas, and renal cell carcinomas. Importantly, SDH deficiency in these tumors has important prognostic implications. The data shown here suggest that de novo methylation of the PCDHGC3 protocadherin gene may play a role in the metastatic phenotype of SDHB-PPGL, and therefore could be useful as a tool to identify patients at high risk of developing metastatic disease and as a prognostic marker in PPGL and other SDHB-related cancers. These findings provide a new target for molecular therapy and could have important clinical implications for designing clinical follow-up and treatment in SDHB-related cancer.

Example 2. Prognosis of PCDHGC3 in other types of cancer than PPGL: colon cancer and kidney cancer.

I - MATERIALS AND METHODS

PCDHGC3 gene expression and DNA methylation levels were analyzed in clear cell kidney carcinoma and colon cancer using publicly available data from the Cancer Genome Atlas (TOGA) (Fishbeing, L. et al. 2017, Cancer Cell, 31: 181-193). The TOGA clear cell kidney carcinoma and TOGA colon cancer data sets contained 537 and 462 primary tumors, respectively. Both methylation and transcript levels were available for colon cancer, whereas only transcript data for kidney cancer were available. Molecular and clinical data were downloaded from the UCSC Xena Browser. The mean of the methylation levels was calculated, which was detected with 5 consecutive probes that hybridized within the PCDHGC3 promoter (see Figure 3A), for each of the tumor samples included in the series.

For the analysis of the clinical significance of PCDHGC3 methylation, the median value of the levels of PCDHGC3 transcripts was used as the cut-off value to establish a dichotomy of tumors as high-expression elements (above the median ) and elements of low expression (below the median). OS analysis revealed that a reduced PCDHGC3 expression in clear cell renal cancer was significantly associated with a low OS (HR: 1.49; 95% CI: 0.9-2.64; Mantel Cox test, p = 0.005). Figure 7 shows the Kaplan Meier survival curve. After adjusting for tumor size, lymphatic metastases, or distant metastases, PCDHGC3 methylation was an independent prognostic factor for overall survival (p = 0.003).

The levels of PCDHGC3 transcripts were inversely correlated with the levels of PCDHGC3 methylation in colon cancer (r = -0.47: p <0.0001). For analysis of the clinical significance of PCDHGC3 methylation, tumors were classified as tumors with high levels of methylation (above the P75 percentile value) or with low levels of methylation (below the P75 percentile). The PCDHGC3 high methylation group showed significantly lower overall survival than the PCDHGC3 low methylation group (HR: 1.5; 95% CI: 0.9-2.64; Mantel Cox test, p = 0.014). Figure 8A shows the Kaplan Meier survival curve. After adjusting for lymphatic or distant metastases and disease stage, PCDHGC3 methylation was an independent prognostic factor for overall survival (p = 0.014).

For analysis of the clinical significance of PCDHGC3 gene expression, tumors were classified as tumors with low expression levels (above the P25 percentile value) or high expression levels (below the P25 percentile value). The group with low expression of PCDHGC3 showed a lower overall survival than that shown by the group with high expression of PCDHGC3 (HR: 2.11; 95% CI: 1.13-3.04; Mantel Cox test, p = 0.014). Figure 8B shows the Kaplan Meier survival curve. After adjusting for lymphatic or distant metastases and disease stage, PCDHGC3 methylation was an independent prognostic factor for overall survival (p = 0.048).

Claims (20)

1. An in vitro method for the diagnosis and / or prognosis of cancer metastasis in a subject suffering from cancer, or for predicting the clinical outcomes of a subject suffering from cancer, or for determining the response of a subject to a therapy, that understands a) determine promoter methylation levels, or expression levels, of a gene belonging to the protocadherin gene cluster in a sample from said subject, and b) comparing methylation levels, or expression levels, obtained in step a) with a reference value, where - if the methylation levels obtained in step (a) are higher than the methylation levels of the reference value, or - the expression levels obtained in step (a) are lower than the expression levels of the reference value, then (i) the PPGL tumor is a metastatic tumor, or is prone to developing metastases, (ii) the prognosis, clinical results, and / or the subject's response to therapy is negative. Method according to claim 1, wherein the cancer is a pheochromocytoma and paraganglioma tumor (PPGL), colon cancer, or kidney cancer, preferably, the kidney cancer is clear cell renal carcinoma (CCRCC). Method according to claim 1 or 2, wherein the protocadherin gene cluster is selected from the list consisting of the PCDHA gene cluster, the PCDHB gene cluster and the PCDHG gene cluster. 4. Method according to any of claims 1 to 3, wherein the gene that belongs to the protocadherin gene cluster is the PCDHGC3 gene. Method according to claim 4, wherein the PCDHGC3 gene comprises a nucleotide sequence with a sequence identity of at least 70% with the nucleotide sequence SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7. 6. Method according to claim 4, wherein the promoter of the PCDHGC3 gene comprises a nucleotide sequence with a sequence identity of at least 70% with the nucleotide sequence SEQ ID NO: 1. 7. Method according to claim 6, wherein step a) comprises determining the methylation status of at least one, two, three, four, five, six, seven or eight of the CpG sites of the sequence SEQ ID NO: 1 . 8. Method according to any of claims 1 to 7, wherein the PPGL tumor is associated with mutations of the SDHx gene. A method according to claim 8, wherein the SDHx gene is selected from the list consisting of the SDHB gene, SDHC gene, SDHA gene, SDHD gene and SDHAF2 gene. A method according to any one of claims 1 to 9, wherein the sample is selected from the group consisting of blood, urine, feces and tissue from a biopsy. 11. Method according to any of claims 1 to 10, wherein the subject is a mammal, preferably a primate, more preferably a human. 12. An agent that inhibits the activity of a protein encoded by a gene belonging to the protocadherin gene cluster, for use in the treatment and / or prevention of cancer metastasis in a subject suffering from said cancer. An inhibitory agent for use according to claim 12, wherein the gene belonging to the protocadherin gene cluster is selected from the list consisting of the PCDHA gene cluster, PCDHB gene cluster and PCDHG gene cluster. An inhibitory agent for use according to claim 12 or 13, wherein the gene belonging to the protocadherin gene cluster is the PCDHGC3 gene. An inhibitory agent for use according to claim 14, wherein the PCDHGC3 gene comprises a nucleotide sequence with a sequence identity of at least 70% to the nucleotide sequence SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7. 16. An inhibitory agent for use according to claim 14 or 15, wherein the protein encoded by the PCDHGC3 gene is the PCDHGC3 protein. 17. An inhibitory agent for use according to claim 16, wherein the PCDHGC3 protein comprises an amino acid sequence with a sequence identity of at least 70% to the sequence SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8. 18. An inhibitory agent for use according to claim 12 to 17, wherein the cancer is a pheochromocytoma and paraganglioma (PPGL) tumor, colon cancer, or kidney cancer, preferably, the kidney cancer is clear cell renal cell carcinoma (CCRCC). 19. An inhibitory agent for use according to claim 18, wherein the PPGL tumor is associated with mutations in the SDHx gene. 20. An inhibitory agent for use according to claim 19, wherein the SDHx gene is selected from the list consisting of the SDHB gene, SDHC gene, SDHA gene, SDHD gene and SDHAF2 gene.