ES2766862A1 - Plekhg5 as a pharmaceutical target for neurological disorders (Machine-translation by Google Translate, not legally binding) - Google Patents

Abstract

Plekhg5 as a pharmaceutical target for neurological disorders. The invention relates to the use of the Plekhg5 gene as a pharmacological target for the screening, testing, and/or validation of molecules, compounds, agents, and modulators useful in the treatment and/or prevention of neurological diseases, preferably neurodegenerative diseases. More preferably, the invention also refers to molecules, compounds, agents, and modulators capable of inhibiting the expression of the Plekhg5 gene, inducing a neuroprotective phenotype of microglial cells, which makes it possible to reduce or stop the neurodegeneration processes that occur in mammals, preferably in humans. (Machine-translation by Google Translate, not legally binding)

Description

DESCRIPTION

Plekhg5 as a pharmaceutical target for neurological disorders

The invention relates to the use of the Plekhg5 gene as a pharmaceutical target for the screening, testing, and / or validation of molecules, compounds, agents, and modulators useful in the treatment and / or prevention of neurological diseases, preferably neurodegenerative diseases. More preferably, the invention also relates to molecules, compounds, agents, and modulators capable of inhibiting the expression of the Plekhg5 gene , inducing a neuroprotective phenotype of microglial cells that makes it possible to reduce or stop neurodegeneration processes that take place in mammals, preferably humans.

STATE OF THE ART

Neuroinflammation is a fundamental process that contributes to the death of neurons in neurodegenerative diseases, for example in Parkinson's disease (PD), Alzheimer's disease (AD) and Multiple Sclerosis (MS). The underlying neuroinflammation in these neurodegenerative diseases is characterized by the activation of microglial cells (Gonzalez et al., 2014; Wolf et al., 2017). During this inflammatory process, microglial cells acquire the shape of an amboid cell and, among other mechanisms, decrease the release of neurotrophic factors, such as the brain-derived neurotrophic factor (BDNF ), and secrete cytotoxic substances. , which lead to neuronal death. In contrast, in a healthy brain, microglial cells are in branched morphology and support a variety of CNS functions by secreting neurotrophic factors. It is interesting to note that microglial cells are not permanent in one or another state of activity, but are instead able to switch between different phenotypes and states of activity. Therefore, understanding the molecular machinery that reverses the inflammatory activation of microglial cells is essential for protection against neurodegeneration.

In AD, it is known that microglial cells accumulate around beta-amyloid plaques, and mutations in various microglial genes can increase the risk of developing the disease. The inability of cells Microglial preservation of a constant production of beta-amyloids leads to the release of inflammatory factors that further compromise cellular functions, eventually transforming them into a disease-associated form that induces constant detrimental neuroinflammation. In PD, activated microglial cells are known to be abundant in substantia nigra, the brain structure that is damaged in disease. PET studies have shown widespread inflammatory microglial cells at an early stage in the course of the disease, and evidence suggests that the same type of "double-edged sword" situation seen in Alzheimer's disease - in which the Initially protective microglial cells escape regulation, leading to constant damaging neuroinflammation - also occurs in Parkinson's disease. In amyotrophic lateral sclerosis (ALS), inflammatory microglial cells have been found near injured neurons in the patients brain.

Therefore, the ability to easily identify activated microglial cells has sparked considerable interest in their value as indicators of pathology and hence their diagnostic potential. Furthermore, substantial interest surrounds the possible role of activated microglial cells in the pathogenesis of disease, and the question of whether the activity of activated microglial cells exacerbates pathology or aids in tissue repair and improves disease.

In this regard, it is known that primary microglial cells exposed to adipose tissue-derived mesenchymal stem cells (ASC) or their secreted factors (conditioned medium, MC), underwent a dramatic cellular shape shift towards morphology. extremely elongated in vitro (Neubrand et al., Glia. 2014; 62 (12): 1932-42), similar to the microglial cell phenotype observed in a healthy brain. MC-induced elongation was associated with upregulation of neurotrophic factors, such as BDNF, that is indicative of acquisition of a neuroprotective phenotype. In this way, MC-stimulated microglial cells represent an ideal tool to study the intracellular events necessary for the transition from inflammatory activated microglial cells to other non-inflammatory neuroprotective cells. In fact, the small Rho GTPases Rac1 and Cdc42, have been identified as important regulators of the actin cytoskeleton, and consequently play fundamental roles in this phenotypic transition (Neubrand et al., Glia. 2014; 62 (12): 1932-42) .

Trem2, a myeloid protein involved in mycelial cell survival and proliferation, regulates a necessary checkpoint for neurodegenerative diseases, and the Trem2 deletion prevents the accumulation of microglial cells around Ap plates and leads to additional neuritic damage (Jay TR , et al. J Exp Med. 2015; 212: 287-95; Krasemann S, et al. Immunity. 2017; 47: 566-81. e569). These findings suggest that neurodegenerative diseases may be protectively directed toward more effective phagocytosis and clearance of pathological protein aggregates in neurodegenerative disorders. However, global microglial cell depletion in mouse models with AD resulted in a protective effect on synaptic health, independent of p amyloid (Han J, et al. Mol Brain. 2017; 10: 25). These emphasize the immense complexity of functional roles of microglial cells in neurodegeneration, and support the existence of different pro-inflammatory functional states within neurodegenerative diseases.

Taking into account the information mentioned above, a comprehensive understanding of the key drug regulators, markers and targets of homeostatic, pro-inflammatory and anti-inflammatory microglial cell phenotypes in neurodegenerative diseases could provide new therapeutic targets for the treatment of a number of neurodegenerative conditions.

DESCRIPTION OF THE INVENTION

The present invention discloses the identification of the Plekhg5 gene and / or its encoded protein, or a fragment, or derivative, or variant thereof as a target of drugs useful for the treatment of neurodegenerative diseases.

The invention is based on the fact that the inventors have observed that the inhibition of the expression and / or activity of the plekhg5 gene , and / or its encoded protein, or a fragment, derivative, or variant thereof, induces a neuroprotective phenotype of microglial cells, making it possible to reduce or stop the neurodegeneration processes that take place in mammals, preferably humans.

More specifically, the results obtained demonstrate that exposure of primary microglial cell cultures to siRNA against the Plekhg5 gene , or a fragment, or derivative, or variant thereof induces a negative differential circularity value (Table 4) which implies that microglial cells transfected with the siRNA specific against the plekhg5 gene showed an increased branching pattern.

In summary, the results of the invention allow new therapeutic approaches to be developed for neurodegenerative diseases, through the use of pharmaceutical compositions that comprise active ingredients that inhibit the expression and / or activity of the Plekhg5 gene and / or its encoded protein.

Therefore, one aspect of the invention refers to the use of the Plekhg5 gene and / or the protein thus encoded, or a fragment, or derivative, or variant thereof, as a pharmacological target for screening useful molecules in the treatment and / or prevention of neurological diseases.

Plekhg5 (pleckstrin and RhoGEF homology domain containing G5) is also called Syx, Tech, DSMA4, CMTRIC, GEF720 and BC023181. In the context of the present invention, the Plekhg5 gene is characterized by at least one of the sequences identified by its Ensembl Gene Access Numbers or NCBI ID. Any expert in the Plekhg5 gene can be accessed by an expert in the field through public databases. For example, ENSEMBL (Ensembl version 89-May 2017) (EMBL-EBI / Wellcome Trust Sanger Institute) has the following numbers Acceson of human and mouse Plekhg5: ENSG00000171680 and ENSMUSG00000039713, respectively. In addition, the access numbers NCBI Gene ID for human and mouse Plekhg5 are 57,449 and 269,608, respectively. The Ensembl gene ID provided for the Plekhg5 gene can be used to determine the nucleotide sequence of the gene, in addition to the associated protein and transcript sequences, by entering Ensemble ID data into the Ensemble database (Ensembl version 89).

The names of its proteins are as follows: NF ^k B activating protein, member 5 of the G family that contains a PH domain, guanine 720 nucleotide exchange factor, protein that contains a new PH domain, pleckstrin homology domain that contains a member 5 of the G family (with a RhoGef domain), synectin-binding guanine exchanger factor, RhoA-specific guanine exchanger factor SYX1, RhoA-specific guanine exchanger factor SYX2 and RhoA-synectin-binding factor RhoA . He Plekhg5 encodes a protein that belongs to the guanine exchange factor Rho (GEF) protein family, which activates GTPases by replacing GDP with GTP. This family member is a RhoA GEF that has a role in endothelial cell migration and tubular formation. It is required for angiogenesis and can function in the differentiation of neuronal cells. Mutations in the Plekhg5 gene have been associated with different forms of motor neuron disease such as type IV distal spinal muscular atrophy (DSMA-IV), intermediate Charcot-Marie-Tooth disease (CMT), and amyotrophic lateral sclerosis (ALS). The molecular cause is believed to lie in the neurospecific disruption of autophagy of synaptic vesicles, a process that is also regulated, in addition to other proteins, by Plekhg5. Indeed, Plekhg5- deficient mice develop late-onset motor neuron disease characterized by axon terminal degeneration, and cultured Plekhg5 - depleted motor neurons show defective autophagy. Plekhg5 overexpression leads to the activation of NF- ^k B, which is a well known transcription factor responsible for the expression of many proinflammatory molecules, also during the neuroinflammatory processes.

Plekhg5 is an Rnd3 / RhoE effector protein. In particular, Plekhg5 acts as a downstream of Rnd3 / RhoE and the interaction between both proteins inhibits Plekhg5 function . This correlates with the results shown in the present patent in reference to that Rnd3 / RhoE must be upregulated to acquire a neuroprotective phenotype, therefore, in this case the expression and / or activity of Plekhg5 would be strongly inhibited. On the other hand, the present invention discloses that the inhibition of Plekhg5 implies a neuroprotective phenotype, which of course would also lead to down-regulation of the expression and / or activity of Plekhg5 , and therefore is correlated with our findings with Rnd3 / RhoE. Therefore, Plekhg5 presents a new function as a potential regulator of a neuroprotective phenotype of microglial cells.

Table 1 shows, as an example, the Plekhg5 gene characterized by the access number of EnsembI Gene (ENSG), which can be accessed in the public database EnsEMBL (http://www.ensembl.org) (Ensembl version 89-May 2017) and by its Entrez Gene ID, which can be accessed in the NCBI public database (https://www.ncbi.nlm.nih.gov/), and includes the protein sequences of all the isoforms disclosed therein, in humans and mice.

In a preferred embodiment, the invention relates to the use of the human Plekhg5 gene with the accession number of EnsembI Gene ENSG00000171680 and NCBI Gene ID 57449, preferably the human Plekhg5 gene comprises the nucleotide sequence SEQ ID NO: 20, and includes the Protein sequences of all isoforms encoded by it, such as pharmaceutical targets for the screening, testing and / or validation of molecules, compounds, agents, and modulators useful in the treatment and / or prevention of neurological diseases.

The present invention also relates to Plekhg5 homologs, orthologs, paralogs , and fragments and variations thereof.

As used herein, the term "homologous" is known in the state of the art and refers to related sequences that share an ancestor or member of a common family and are determined based on the degree of sequence identity. The terms "homology", "homolog", "substantially similar" and "substantially corresponding" are used interchangeably herein. Homologs usually control, mediate, or influence the same or similar biochemical pathways, however particular homologs can give rise to different phenotypes. It is therefore understood, as will be appreciated by those skilled in the art, that the invention encompasses more than the examples of specific sequences. These terms describe the relationship between a gene found in one species or subspecies and the corresponding or equivalent gene in another species or subspecies. For the purpose of this invention, homologous sequences are compared.

The term "homologous" is sometimes used to apply it to the relationship between genes separated by the speciation event (see "ortholog") or to the relationship between genes separated by the gene duplication event (see "paralog").

The term "ortholog" refers to genes in different species that evolved from a common ancestral gene by speciation. Orthologists usually maintain the same function over the course of evolution. The identification of orthologs is of vital importance for a reliable prediction of gene function in recently sequenced genomes.

The term "paralog" refers to related genes by duplication within a genome. While orthologs generally maintain the same function over the course of evolution, paralogs can develop new functions, even if they are related to the original.

"Homologous sequences" or "homologs" or "orthologs" are thought, believed or known to be functionally related. A functional relationship may be indicated in any of a number of ways, including, but not limited to: ( a) degree of sequence identity and / or (b) the same or similar biological function Preferably, both (a) and (b) are indicated.The degree of sequence identity may vary, but in one embodiment, it is at least 50% (when using known standard sequence alignment programs), at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least 98.5%, or at least about 99%, or at least 99.5%, or at least 99.8%, or at least 99.9%. Homology can be determined using available software programs, such as those discussed in the current Protocols in Molecular Biology ("Current Protocols in Molecular Biology" FM Ausubel et al., Eds., 1987) Supplement 30, section 7.718, Table 7.71 Some alignment programs are MacVector (Oxford Molecular Ltd, Oxford, UK) and ALIGN Plus (Scientific and Educational Software, Pennsylvania.) Other non-limiting alignment programs include Sequencher (Gene Codes, Ann Arbor, Mich.), AlignX, and Vector NTI (Invitrogen, Carlsbad, Calif).

In the state of the art, the terms "identity" and "similarity" mean the degree of kinship of the polypeptide and polynucleotide sequences that are determined by matching a problem sequence (query sequence) and other sequences preferably of the same type (acid sequence nucleic or protein) with each other. Preferred software methods for calculating and determining "identity" and "similarity" include, but are not limited to, GCG BLAST (Basic Local Alignment Search Tool) (Altschul et al., J. Mol. Biol. 1990, 215: 403-410; Altschul et al., Nucleic Acids Res. 1997, 25: 3389-3402; Devereux et al., Nucleic Acids Res. 1984, 12: 387), BLASTN 2.0 (Gish W., http: // blast.wustl.edu, 1996-2002), FASTA (Pearson and Lipman, Proc. Natl. Acad. Sci. USA 1988, 85: 2444-2448), and GCG GelMerge that determines and aligns a pair of contigs with the overlap of increased length (Wilbur and Lipman, SIAM J. Appl. Math. 1984, 44: 557-567; Needleman and Wunsch, J. Mol. Biol. 1970, 48: 443-453).

The Plekhg5 gene of the invention, and / or the protein encoded therein, may have variants. Furthermore, the term "variant" includes any shorter or longer version of a gene transcript that preferably retains at least one biological activity or function of the Plekhg5 gene and / or the protein encoded by it, in the context of the present invention The term "variants" will also comprise a sequence having at least about 80% sequence identity, more preferably at least about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%. , 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of sequence identity over the full length of Ensembl Gene access numbers ENSG00000171680 NCBI ID or 57449, preferably the human Plekhg5 gene comprises the nucleotide sequence SEQ ID NO: 20. Variations will be included of sequences where one codon is replaced with another codon due to alternative base sequences, but the amino acid sequence translated by the DNA sequence remains unchanged. This phenomenon known in the state of the art is called redundancy of the set of codons that translate specific amino acids. These variants refer to limited variations in the amino acid sequence, which make it possible to maintain the functionality of the gene. This means that the sequence mentioned above and the sequence of the variant are similar as a whole and identical in many regions. These variations are generated by substitutions, deletions or additions. Such substitutions are, for example, but not limited to, with conserved amino acids. Conserved amino acids are amino acids that have side chains and similar properties in relation to, for example, hydrophobicity and aromaticity. These substitutions include, but are not limited to, substitutions between glutamic acid (Glu) and aspartic acid (Asp), between lysine (Lys) and arginine (Arg), between asparagine (Asn) and glutamine (Gln), between serine (Ser ) and threonine (Thr) and / or among the amino acids that comprise the group of alanine (Ala), leucine (Leu), valine (Val) and isoleucine (Ile). The variations can be artificially generated variations, for example, by mutagenesis or direct synthesis. Therefore, the scope of the present invention includes nucleotide sequences whose nucleotides are identical or homologous to the sequences described in the present invention.

The term "pharmacological target", as used in the present invention, refers to the Plekhg5 gene and / or the protein encoded by it, which is useful for studying the biochemical effect of molecules capable of binding to it. These molecules they can be, without limitation, compounds, modulators, or agents that are selected by screening methods, where the inhibition of the expression and / or the activity of the Plekhg5 gene and / or the protein encoded by it is analyzed.

The term "modulator" as used in the present invention refers to a molecule capable of changing or modifying the level of expression and / or activity of a gene, or a transcription product of a gene, or a translation product. of a gene. A "modulator" refers to a molecule that has the ability to either enhance or inhibit, thus "modulate" a functional property of a protein, to "modulate" binding, antagonization, repression, blocking, neutralization or kidnapping, activation, agonization and upward regulation. The term "modulation" will also be used to refer to the ability to affect activity biological of a cell. Preferably, a "modulator" is capable of changing or modifying the biological activity of a transcription product or a translation product of a gene. Such modulation, for example, may be an increase or decrease in biological activity and / or pharmaceutical activity, a change in the binding characteristics, or any other change or alteration in the biological, functional or immunological properties of said gene translation product.

The terms "agent", "reagent", or "compound" refers to any substance, chemical, composition, or extract that has a positive or negative biological effect on a cell, tissue, body fluid, or within the context of any biological system, or any assay system examined May be target agonists, antagonists, partial agonists or inverse agonists Such agents, reagents, modulators or compounds may be natural or synthetic nucleic acids, peptides or protein complexes, or fusion proteins They can also be antibodies, organic or inorganic molecules or compositions, small molecules, such as interfering RNA, drugs or any combination of any of the above agents.They can be used for testing, diagnostic and therapeutic purposes.

In a more preferred embodiment, the molecule, compound, agent or modulator is an inhibitor or antagonist of the Plekhg5 gene and / or the protein encoded by it. As used in the invention, the term "compound / inhibitor or antagonist agent" refers to a molecule that when it binds or interacts with the Plekhg5 gene and / or with the protein encoded by it, or with functional fragments thereof , decreases or eliminates the expression and / or activity of this gene and / or the protein encoded by it, therefore, the inhibitor or antagonist induces the suppression or reduction of the transmission of biochemical signals through Plekhg5. Plekhg5 can be easily assayed by any method known in the art This definition also includes those compounds that prevent or decrease gene transcription or expression, mRNA maturation, mRNA translation, and post-translational modification. Most preferred embodiment, the inhibitory or antagonist compound / agent may be an antibody that recognizes the Plekhg5 protein , or a polynucleotide encoding an antisense sequence of nucleotides specific to the Plekhg5 sequence , for example using RNAi, antisense, ribozyme or aptamers. Inhibitory activity can be tested by measuring the level of Plekhg5 expression , the protein level or the RNA level.

As used herein, the term "antibody" is intended to refer broadly to any immunological binding agent such as IgG, IgM, IgA, IgD, and IgE, and humanized or chimeric antibody. In certain embodiments, IgG and / or IgM are preferred because they are the most common antibodies in the physiological situation and are most easily manufactured. The term "antibody" is used to refer to any antibody-like molecule that has an antigen-binding region, and includes antibody fragments such as Fab ', Fab, F (ab') 2, single domain antibodies ( DABs), Fv, scFv (single chain Fv), and the like. Techniques for preparing and using various antibody-based constructs and fragments are well known in the state of the art. Means for preparing and characterizing antibodies are also known in the state of the art (See, eg, Harlow and Lane, 1988).

A "humanized" antibody is an antibody in which the constant and variable framework region of one or more human immunoglobulins fuses with the binding region, eg, CDR, of an animal immunoglobulin. The "humanized" antibodies contemplated by the present invention are chimeric antibodies from mouse, rat, or other species, bearing human constant and / or variable region domains, biospecific antibodies, recombinant and genetically engineered antibodies, and fragments thereof. Such humanized antibodies are designed to maintain the binding specificity of the non-human antibody from which the binding regions are derived, but to avoid an immune reaction against the non-human antibody.

A "chimeric" antibody is an antibody molecule in which (a) the constant region, or part of it, is modified, replaced, or exchanged such that the antigen binding site (variable region) binds to a constant region of a different or modified class, effector function and / or species, or a totally different molecule that confers new properties on the chimeric antibody, for example, an enzyme, toxin, hormone, growth factor, drug, etc .; or (b) the variable region, or a part thereof, is modified, replaced or exchanged with a variable region having different or altered antigen specificity.

Inhibitors of the expression and / or activity of the Plekhg5 gene of the invention may also be nucleic acid molecules. The term "nucleic acid" includes, but is not limited to, RNAi, antisense, aptamer, interfering CRISPR (CRISPRi), and ribozoma molecules. In the present invention, a "nucleic acid molecule that specifically interferes with Plekhg5 expression "is a nucleic acid molecule that is capable of reducing or suppressing the expression of the Plekhg5 protein gene encoding , in a specific way.

The term "RNAi" or "interfering RNA" means any RNA that is capable of down-regulating the expression of the target protein. It encompasses small interference RNA (siRNA), double-stranded RNA (dsRNA), single-stranded RNA (mRNA), microRNA (miRNA), and short-hairpin RNA (shRNA) molecules. RNA interference designates a phenomenon whereby dsRNA specifically suppresses the expression of a target gene at the post-translational level. Under normal conditions, RNA interference is initiated by double-stranded RNA (dsRNA) molecules of several thousand base pairs in length. In vivo, the dsRNA introduced into a cell is cleaved into a mixture of short dsRNA molecules called siRNAs. SiRNAs are typically designed against a 50-100 nucleotide region after the 3 '( downstream) end of the translation initiator codon, while the 5'UTR (untranslated region) and 3'UTR are routinely avoided. The target siRNA sequence should be BLAST screened against the EST database to ensure that the only desired gene is targeted. Various products are available to assist in the preparation and use of siRNA. In a preferred embodiment, the siRNA molecule is an siRNA of at least about 15-50 nucleotides in length, preferably about 20-30 nucleotides in base, preferably about 20-25 nucleotides in length.

There are a large number of diverse examples of siRNA molecules that inhibit the expression and / or activity of the Plekhg5 gene . Table 2 shows, as an example, siRNA molecules targeting Plekhg5 mRNA. (SiRNA ID * corresponds to the identification number provided by ThermoFisher Scientific).

In a particular embodiment, the siRNA molecule comprises the sequences selected from the list consisting of: a sense sequence selected from the list consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 , SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11, more preferably the sense sequence is selected from the list consisting of: SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 ; and an antisense sequence that is selected from the list consisting of: SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12, more preferably the antisense sequence is selected from the list consisting of SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6. The RNAi can comprise RNA of natural origin, synthetic RNA, or recombinantly produced RNA, in addition to altered RNA that differs from naturally occurring RNA in the addition, deletion, substitution, and / or alteration of one or more nucleotides. Such alterations may include the addition of non-nucleotide material, such as at the end of the molecule or at one or more internal nucleotides of the RNAi, including modifications that make the RNAi resistant to nuclease digestion. RNAi can be administered freely (naked) or through the use of delivery systems that increase stability and / or targeting, for example, liposomes, or incorporated into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres. , or protein vectors, or in combination with peptides. They can also be administered in the form of their precursor or coding DNA. In a particular embodiment, the RNAi are encapsulated inside vesicles, preferably inside liposomes.

Antisense nucleic acid can also be used to down-regulate the expression and / or activity of the Plekhg5 gene . The antisense nucleic acid can be complementary to all or part of a sense nucleic acid encoding a Plekhg5 protein eg, complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence, and is believed to be interferes with the translation of the target mRNA. In a preferred embodiment, the antisense nucleic acid is a complementary RNA molecule to a target mRNA that encodes Plekhg5 polypeptides .

An antisense nucleic acid can be, for example, approximately 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. In particular, antisense RNA molecules are usually 18-50 nucleotides in length.

An antisense nucleic acid for use in the method of the invention can be constructed using chemical synthesis and enzymatic ligation reactions, using procedures known in the state of the art. In particular, antisense RNA, produced by in vitro transcription from linear (eg, PCR products) or circular templates (eg, viral or non-viral vectors), or produced by in vivo transcription from vectors can be chemically synthesized. viral or non-viral.

The antisense nucleic acid can be modified to have increased stability, nuclease resistance, target specificity, and improved pharmacological properties. For example, the antisense nucleic acid may include modified nucleotides designed to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, eg, phosphorothioate derivatives and acridine substituted nucleotides.

Ribozyme molecules can also be used to decrease levels of functional Plekhg5 . Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-chain nucleic acid, such as mRNA, for which they have a complementary region. Thus, ribosomes can be used to catalytically cleave mRNA transcripts to thereby inhibit translation of the protein encoded by the mRNA. Ribozyme molecules specific for functional Plekhg5 can be designed, produced, and administered by methods commonly known in the state of the art (see for example, Fanning and Symonds, 2006, where the therapeutic use of head ribozymes of hammer and short hairpin RNA).

A "deregulation" will mean an up-regulation or down-regulation of gene expression and / or an increase or decrease in the stability of gene products. A gene product comprises either an RNA or a protein and is the result of the expression of a gene. The amount of a gene product can be used to measure how active a gene is and how stable its gene products are. In a preferred embodiment, the term deregulation refers to down-regulation of the expression and / or activity of the Plekhg5 gene and furthermore it also refers to down-regulation of the expression and / or activity of the protein encoded by the Plekhg5 gene . . The term "gene" as used in the present specification and in the claims encompasses both coding regions (exons) and non-coding regions (eg, non-coding regulatory elements such as promoters or enhancers, introns, leader sequences and trailer).

In a preferred embodiment, it is also possible to use ZFNs, TALENs and CRISPRs technologies as methods for genomic editing, preferably for inhibition of the Plekhg5 gene . Thus, an agent capable of inducingly altering the Plekhg5 expression or activity may comprise: a nuclease capable of modifying the endogenous Plekhg5 gene, such as to down-regulate or abolish Plekhg5 expression , or a heterologous repressor protein capable of repressing transcription of the endogenous Plekhg5 gene, such as the protein heterologous repressor. The agent can comprise more than one nuclease. In certain embodiments, the agent comprises more than one TALE protein or zinc finger, whereby a TALE or zinc finger targets Plekhg5. In other embodiments, the agent comprises more than two nucleases, capable of targeting multiple genes. In certain embodiments, a CRISPR-Cas system is used and multiple guide RNAs are used to target the CRISPR enzyme to multiple gene targets.

Neurological diseases or disorders according to the present invention preferably refer to neurodegenerative diseases, more preferably Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis, amyotrophic lateral sclerosis, Pick's disease, frontotemporal dementia, nuclear paralysis progressive, corticobasal degeneration, cerebrovascular dementia, multisystemic atrophy, dementia with argyrophilic granules and other tauopathies, and mild cognitive impairment. In a preferred embodiment, neurodegenerative disease is selected from the list consisting of: preferably Alzheimer's disease, Parkinson's disease, and Huntington's disease.

Another aspect of the invention relates to an in vitro method for screening and identifying molecules, compounds, agents, and modulators useful in inhibiting Plekhg5 expression and / or activity , wherein the method comprises:

a) contacting a compound, agent and / or modulator with the Plekhg5 gene and / or the protein encoded by it,

b) analyze the interaction between the molecule, compound, agent and modulator and the Plekhg5 gene and / or the protein encoded by it, and

c) selecting the molecule, compound, agent and / or modulator of step (a) capable of inhibiting the expression and / or activity of the Plekhg5 gene and / or the protein encoded by it.

Another aspect of the invention relates to an in vitro method for screening and identifying molecules, compounds, agents and modulators useful in treatment and / or prevention of neurological diseases, where the method comprises:

a) contacting a compound, agent and / or modulator with the Plekhg5 gene and / or the protein encoded by it,

b) analyze the interaction between the molecule, compound, agent and modulator and the Plekhg5 gene and / or the protein encoded by it, and

c) selecting the molecule, compound, agent and / or modulator of step (a) that has the capacity to inhibit the expression and / or activity of the Plekhg5 gene and / or the protein encoded by it.

In general, the screening methods mentioned above, in addition to the potential drug molecules (eg, agents, modulators, antagonists, agonists) identified therefrom, have applicability in relation to the treatment and / or prevention of neurological diseases. , preferably in the neurological diseases mentioned herein.

The term "activity" as used herein should be understood as a measure of the ability of a substance, such as a transcription product or a translation product, to produce a biological effect or a measure to determine the level of biologically active molecules. The term "activity" also refers to biological activity and / or pharmacological activity that refers to the binding, antagonization, repression, blocking, neutralization or hijacking of a transporter or transporter subunit and which refers to the activation and regulation by increase of a transporter or transporter subunit.

The terms "level" and / or "activity" as used herein refer to levels of gene expression or gene activity. Gene expression can be defined as the use of information contained in a gene by transcription and translation that leads to the production of a gene product.

In another embodiment, the present invention provides molecules, compounds, agents, and modulators, in accordance with the present invention, obtainable by the screening method disclosed herein.

In another aspect, the present invention provides molecules, compounds, agents, and modulators, in accordance with the present invention, wherein the molecule, compound, agent, or modulator, has potential activity in the treatment and / or prevention of neurological diseases. .

In a preferred embodiment, the molecule, compound, agent, or modulator according to the present invention is preferably an antagonist or inhibitor of the expression and / or activity of the Plekhg5 gene and / or the protein encoded by it.

In a more preferred embodiment, the molecule, compound, agent or modulator according to the present invention, preferably an antagonist or inhibitor of the levels of expression and / or activity of the Plekhg5 gene and / or the protein encoded by it, is selected of at least one of the list consisting of:

a) an antibody,

b) an aptamer,

c) a ribozyme

d) an antisense sequence

e) an interference RNA (RNAi), and

f) an interference CRISPR (CRISPRi).

The molecule, compound, agent or modulator mentioned above in a) -f) prevent, inhibit or decrease the expression and / or activity of Plekhg5 (gene and / or protein), and therefore eliminate its biological function. These molecules, compounds, agents or modulators mentioned above can be developed by an expert in the field of genetic engineering based on the existing knowledge in the state of the art in relation to transgenesis and the inhibition of gene expression.

In a preferred embodiment, the molecule, compound, agent, or modulator according to the present invention is preferably an iRNA that is selected from the list consisting of: siRNA, dsRNA, mRNA, miRNA, and shRNA molecules.

In a more preferred embodiment, the siRNA is a siRNA. In a still more preferred embodiment, the siRNA molecule comprises the sequences selected from the list consisting of: a sense sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11, more preferably the sense sequence is selected from the list consisting of: SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5; and an antisense sequence that is selected from the list consisting of: SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12, more preferably the antisense sequence is selected from the list consisting of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6.

Another particular aspect of the invention refers to the in vitro use of a molecule, compound, agent or modulator of the invention, preferably an antagonist or inhibitor compound, characterized in that it is a nucleic acid or polynucleotide that prevents or diminishes expression and / or or activity of the Plekhg5 gene and / or the protein encoded by it.

Another aspect of the invention relates to a pharmaceutical composition or drug comprising a therapeutically effective amount of the molecule, compound, agent or modulator according to the present invention, and at least one or more useful and pharmaceutically acceptable adjuvants and / or vehicles. for the treatment and / or prevention of neurological diseases.

The pharmaceutically acceptable adjuvants and carriers that can be used in such compositions are the adjuvants and carriers known to those skilled in the art and commonly used in the production of therapeutic compositions. The term "pharmaceutically acceptable vehicle" is a substance used in the composition to dilute any of the components included therein to a certain volume or weight. The pharmaceutically acceptable vehicle is an inert substance or of action identical to any of the elements included in The composition of the present invention The function of the vehicle is to facilitate the incorporation of other elements, to allow a better dosage and administration or to provide consistency and shape to the composition Additionally, the pharmaceutical composition of the invention may comprise one or more adjuvants and / or or excipients The term "excipient" refers to a substance that assists in the absorption of the elements of the composition of the invention, stabilizes said elements, activates or assists in the preparation of the composition in the sense of providing consistency or providing it with flavors that make it more pleasant. Therefore, the excipients could have the function of keeping the ingredients linked together, such as for example in the case of starches, sugars or cellulose, the function of sweetening, the function of coloring, the function of protecting the composition, such such as isolating it from air and / or humidity, the function of filling a tablet, capsule or any other form of presentation, a disintegrating function to facilitate the dissolution of the components and their absorption in the intestine, without excluding other types of excipients not mentioned in this paragraph.

In the sense used in the description, the expression "therapeutically effective amount" refers to the amount of the molecule, compound, agent or modulator according to the present invention, calculated to produce the required effect and, in general, will be determined, among other factors, due to the inherent properties of the compounds, including age, condition of the patient, severity of the alteration or disorder, and the route and frequency of administration.

In a particular embodiment, said therapeutic composition is prepared in solid form or in aqueous suspension, in a pharmaceutically acceptable diluent. The therapeutic composition provided by the present invention can be administered through any appropriate route of administration, whereby said composition will be formulated in the pharmaceutical form suitable for the selected route of administration. In a particular embodiment, the administration of the therapeutic composition provided by the invention is carried out parenterally, orally, intraperitoneally, subcutaneously, intracranially, etc. A review of the different pharmaceutical forms of drug administration and the excipients required to obtain them can be found, for example, in the "Galénica Pharmacy Treaty", C. Faulii Trillo, 1993, Luzán 5, S.A. Ediciones, Madrid.

The therapeutic compositions of the invention can be administered in combination with other drugs used in the treatment of neurological diseases, with a view to acting in a complementary or reinforcing manner.

Another aspect of the invention refers to the molecule, compound, agent, modulator or pharmaceutical composition of the invention for use as a medicine.

The term "medicine", as used in the present description, refers to any substance or combination of substances with properties for the treatment or prevention of diseases in organisms, preferably humans, or that can be used in or administered to said organisms, preferably human beings, with the purpose of restoring, correcting or modifying the physiological functions exerting a pharmacological, immunological or metabolic action. The drug of the invention can be used both alone and in combination with other drugs or compositions to improve cognitive performance and / or promote cognitive development through combination therapy, and can be administered simultaneously or at different time intervals.

Another aspect of the invention relates to the molecule, compound, agent, modulator, or pharmaceutical composition of the invention, for use in the treatment and / or prevention of neurological diseases, preferably a neurodegenerative disease, and more preferably neurodegenerative diseases. mentioned in the present invention.

The term "treatment", as used in the present invention, refers to combating the effects caused as a consequence of the disease or pathological condition of interest in a subject (preferably a mammal, and more preferably a human) including:

(i) inhibiting the disease or pathological condition, that is, stopping its development;

(ii) alleviate the disease or pathological condition, that is, cause the regression of the disease or pathological condition or its symptoms;

(iii) stabilize the disease or pathological condition.

The term "prevention", as used in the present invention, consists in avoiding the appearance of the disease, that is, avoiding the disease or pathological condition in a subject (preferably a mammal and, more preferably, a human), in particularly, when said subject has a predisposition to the pathological condition but has not yet been diagnosed.

In another aspect, the present invention relates to a method of treating and / or preventing neurological diseases, which comprises administering in a therapeutically or prophylactically effective amount a molecule, compound, agent, modulator or pharmaceutical composition of the invention, to a subject. in need of such treatment.

As used herein, the term "subject" indicates a mammal, such as a rodent, feline, canine, and a primate. Preferably a subject of agreement with the invention he is a human. Preferably, a subject according to the invention is a subject affected by or susceptible to suffering from a neurological disease, preferably a neurodegenerative disease, and more preferably a neurodegenerative disease selected from the list consisting of: Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis, amyotrophic lateral sclerosis, Pick's disease, frontotemporal dementia, progressive nuclear paralysis, corticobasal degeneration, cerebrovascular dementia, multisystemic atrophy, argyrophilic granule dementia, and mild cognitive impairment, preferably Alzheimer's disease, Parkinson's disease, and disease Huntington's.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as that commonly understood by a person skilled in the art to which this invention belongs. Methods and materials similar or equivalent to those described in the present patent may be used in the practice of the present invention. Throughout the description and claims, the term "comprises" and its variations are not intended to exclude other technical characteristics, additives, components or steps. Objects, advantages and additional characteristics of the invention will become apparent to those skilled in the art when examining the description, or may be learned by practice of the invention The following examples and drawings are provided by way of illustration and are not intended to be limiting of the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Transfection of Rac1 siRNA efficiently downregulated the Rac1 protein and mRNA in microglial cells . (A) Primary microglial cells (140,000 cells / well, 12-well plates ) were transfected with 50 pmol Rac1 from Rac1 siRNA from Silencer Select (" Select ' Rac1) or random sequence or" scrambled "siRNA ( "Select' scrambled ) (used as a control) and 1.5 pl of Lipofectamine 3000. The expression of the Rac 1 protein was determined by Western Blot analysis 96h later. (B) and (C) Primary microglial cells were transfected as in step (A) during the indicated time periods and down regulation of Rac1 was evaluated by RT-qPCR (B) and by Western Blot analysis (C) . Data are the mean ± SEM (standard error of the mean) of three independent experiments, * p <0.05 vs. Random sequence siRNA.

FIG. 2. Rac1 siRNA efficiently inhibited MC-induced branching. (A) Mouse primary microglial cells were transfected with Rac1 siRNA or random sequence siRNA (used as a control) for 4 days, then incubated in normal medium or in MC for 4h and stained with the surface marker of isolectin B4 microglial cells (fluorescence). The morphology of the microglial cells was evaluated under a fluorescence microscope. Scale bars, 20 pm. (B) A high magnification image of the cells in (A) is shown and the typical black and white threshold images of cells generated by the Fiji / ImageJ image analysis program are shown as an example. The contours of each cell were drawn to measure the perimeter and the area, which are the necessary parameters to calculate the circularity values (they correspond to numbers close to each contour). It should be noted that the cells that touch the edges of the image were automatically excluded from the measurement. Scale bars, 20 pm.

(C) Microglial cells were transfected with three Rac1-targeting siRNA oligonucleotides (s72646, s72647 or s72648, provided by ThermoFisher Scientific) or a pool thereof (3x Rac1 siRNA: s72646, s72647 and s72648, ThermoFisher Scientific) and then incubated with MC. Isoglin B4 stained microglial cells were visualized under a microscope and the shape of the cell was quantified using the circularity value. Untransfected cells (no tr) or cells transfected with random sequence siRNA were used as reference controls. Data are the mean ± SEM of three independent experiments. * p <0.05, ** p <0.01 vs. Random sequence siRNA.

FIG. 3. Validation of decreased protein expression ( Knock-down) by Western Blot of positive candidates . Primary mouse microglial cells were transfected with three individual siRNAs against the indicated target genes (See Table 5). After three ( B and E ) or four days ( A , C , D , F , G , H ) the cells were harvested and Western Blot analysis was performed with the indicated antibodies. Representative Western Blot analyzes of each protein are shown. The expression of the indicated proteins was normalized to the expression of GAPDH. Data are the mean ± SEM of at least three independent experiments. * p <0.05, ** p <0.01, *** p <0.001 vs. Random sequence siRNA.

FIG 4. Down-regulation of Creb1, RhoE and p38p reduced BDNF expression in microglial cells . Primary microglial cells were transfected with two individual siRNA oligonucleotides against the indicated target genes (See Table 6). Untransfected cells (no tr) or cells transfected with random sequence siRNA were used as controls. After four days, BDNF gene expression was determined by RT-qPCR and normalized to GAPDH expression. The data is expressed as the expression of BDNF relative to that observed in cells transfected with siRNA of random sequence. Data are the mean ± SEM of at least three independent experiments. * P <0.05, ** p <0.01, *** p <0.001 vs. Random sequence siRNA.

FIG 5. Down-regulation of RhoE, Tiaml and kBa increased microglial cell migration. Microglial cells were transfected with two individual siRNA oligonucleotides against the indicated target genes (See Table 6) for 3 days and then treated with MC. Random sequence siRNA was used as a control. Cell migration was determined in a 24h scratch test. ( A ) Representative images of the width of the wound at 1h and at 24h are shown. ( B ) The width of the wound at 24h was determined as the percentage of the width of the original wound at 1h, and then it was expressed in relation to the width of the wound of the cells transfected with siRNA of random sequence (normalized to 1, 0) in each experiment. Data are the mean ± SEM of at least three independent experiments. * p <0.05, ** p <0.01, *** p <0.001 vs. Random sequence siRNA.

FIG. 6. Images of microglial cells transfected with Plekhg5, Rhoq, Arhgef6 (See Table 4) or random sequence siRNA (used as a control) for 4 days, then incubated in MC for 4h and stained with the cell surface marker. microglial isolectin B4. The morphology of the microglial cells was evaluated under a fluorescence microscope. Scale bars, 40 pm.

EXAMPLES

Materials and methods

Animals and ethical statement.

Female C57Bl / 6 mice (7-8 weeks old) were purchased from Charles River. They were used to obtain newborns from P0 to P2 to isolate primary microglial cells and to obtain adipose tissue to isolate ASC. Mice were housed in a temperature / humidity controlled environment (22 ± 1 ° C, 60-70% relative humidity) in individual cages (10 mice per cage, with wood chip material for beds and nests), with one cycle 12 hours light / dark (lights on at 7:00 am) and fed rodent food (Global Diet 2018, Would) and running water ad libitum. The experimental protocols of this study conform to EU Directive 2010/63 and followed the ethical guidelines for research with animal experiments approved by the Animal Experimentation Ethics Committee of the Higher Council for Scientific Research. Animal studies are described in compliance with ARRIVE guidelines (Kilkenny C, et al. Br J Pharmacol. 2010; 160 (7): 1577-9).

Isolation and cell cultures.

Newborn C57Bl / 6 mouse microglial cells were prepared from P0 to P2, as previously described (Neubrand VE, et al. 2014. Glia, 62 (12): 1932 1942). Briefly, the olfactory bulb, cerebellum, hindbrain, and meninges were discarded from the dissected brains and then homogenized in microglial cell culture medium consisting of DMEM (Invitrogen), supplemented with 10% fetal bovine serum (FBS, Gibco), 10% horse serum and 1% penicillin / streptomycin (Gibco), using a Pasteur pipette and a 23 G syringe. Brain homogenates were centrifuged and the resulting cells were plated in poly-D-coated flasks. lysine and incubated in a culture medium for 10-12 days at 37 ° C and 5% CO2. Microglial cells were harvested on a shaker for 2 hr at 200 rpm and plated on poly-D-lysine coated coverslips at a density of 12,000 cells / cm2 or 6-well cell culture plates in microglial cell culture medium at a density of 37,000 cells / cm2. After 24 h, the microglial cell culture medium was replaced with fresh microglial cell culture medium.

Adipose-derived mesenchymal stem cells (ASCs) were isolated from the adipose tissue of adult C57Bl / 6 mice as previously described (Anderson, P., et al. 2013. Gut, 62 (8): 1131-1141). These cells showed a fibroblast-like morphology and a differentiating capacity for the adipocytic and osteocytic lineages, and expressed the phenotype MHC-II-CD14-CD18-CD31-CD34-CD45-CD80-CD117-CD144-CD13 + CD44 + CD29 + CD54 + CD73 + CD90 + CD105 + CD106 + CD166 +. Conditioned medium (MC) was collected from adipose tissue-derived mesenchymal stem cells from passage 2 to passage 6 of ASC cultures, which were plated at a cell density of 15,000 cells / cm2, cultured for 2 days before collecting their supernatant and then stored at -20 ° C. Before use, the MC was rapidly thawed and passed through a 0.2 ^ m filter.

SiRNA transfection.

A custom siRNA library against 160 target genes (with 3 individual siRNAs against each gene or a pool of these three siRNAs) was requested from ThermoFisher Scientific (See Tables 3 and 4 ). The specific siRNAs used in the examples of the present invention are disclosed by their identification number provided by the manufacturer (ThermoFisher Scientific). Primary microglial cells were placed for 48h as previously described. The culture medium was then replaced and the cells grown on coverslips in 48-well plates were transfected with 12.5 pmol of siRNA and 0.375 [mu] l of Lipofectamine 3000 (ThermoFisher Scientific) according to the manufacturer's instructions. Reagents for cultures in 24, 12, or 6-well plates were proportionally scaled up. Four days after the siRNA transfection, the cells were treated with MC for 4h and fixed to determine their cell shape. Alternatively, after four days the cells were harvested for analysis by Western Blot or RT-qPCR. Untransfected cells or cells that were transfected with a random sequence siRNA were used as reference in all studies.

Determination of the shape and circularity of cells.

Plated microglial cells on coverslips were fixed for 4 min in ice-cold methanol, and stained with Isolectin B4, labeled with AlexaFluor 568 (Invitrogen) for 30 min at room temperature and washed three times with PBS.

Images were acquired with 10x objectives under an Olympus IX 81 fluorescence microscope. Circularity or shape factor is an indicator of the shape of a cell. It is provided in values between 0 and 1. The value 1 would be a circle; values closer to 0 indicate a more branched cell shape. Differential circularity as a numerical indicator of cell shape is used to classify the target genes in the present invention (see Tables 1, 2 and 3) (Neubrand VE, et al.

2014. Glia, 62 (12): 1932-1942; Wilms, H., et al. 1997. Cell Tissue Res, 287 (3): 447 458.). To determine circularity or form factor, photos of three fields of view were taken by siRNA and analyzed by Fiji / ImageJ macro to determine the circularity of each individual cell. Briefly, each image was processed by the median filter within a radius of 8 pixels, then a black and white threshold image was generated, cell contours were drawn, and circularity within the shape descriptions was determined as 4n * area / (perimeter) 2. Cells that touched the limits of the image were excluded from the quantification procedure. In total, siRNA screening was performed three times so that the effect of each target gene on circularity was calculated from three independent experiments. Subsequently, the circularity values were normalized within each experiment and compared with microglial cells transfected with siRNA of random sequence. The difference in the “fold change” (relative change) between the circularity value for each gene and the random sequence siRNA was called differential circularity, since it indicates the difference between the random sequence siRNA and the gene siRNA, and it is provided as a logarithm (log2).

Wound test.

Microglial cell migration was determined using a wound assay. Cells at 18,000 cells / cm2 were plated and transfected as described above. The culture medium was replaced 3 days after MC transfection and the coverslip was streaked with a yellow pipet tip. Light background images were taken 1h and 24h after the "wound" ( scratch). The width of the wound was analyzed with a Fiji wound closure tool / ImageJ macro (MRI_Wound_Healing_Tool.ijm). The wound width at 24h was expressed as a percentage of the original wound width at 1h. For normalization, the wound width of random sequence siRNA transfected cells was set to 1.0 in each experiment and the wound width of siRNA transfected cells was set to values proportional to 1.0.

Western blot analysis.

Microglial cells were transfected as described above and then harvested with a cold lysis buffer consisting of 10mM Tris-HCl pH 8.0, 150mM NaCl, 1% Nonidet-P40, 1mM EDTA, 10mM NaF, 1 mM Na ³ VC ^{> 4} and a cocktail of commercially available protease inhibitors (Sigma, containing 104mM AEBSF, 80pM Aprotinin, 4mM Bestatin, 1.4mM E-64, 2mM Leupeptin, 1.5mM Pepstatin A). After centrifugation for 15 min at 14,000 rpm, the protein concentration of the supernatants was determined by Bradford assay (Bio-Rad) and samples were prepared for SDS-PAGE with a Laemmli SDS sample buffer. After semi-dry blotting or western blotting in a humid chamber for Tiam1, PVDF membranes were blocked with 5% milk in TBS Tween (0.1%) and incubated O / N (overnight) at 4 ° C with primary antibodies, rabbit anti-Ahrgef4, (Antibodies-Online), rabbit anti-kBa (Cell Signaling), mouse anti-Rac1 (BD Transduction laboratories), rabbit anti-GAPDH (Sigma), anti- Mouse Tiam1 and Mouse anti-Map3k2 (both from Santa Cruz) diluted in 2% BSA / TBS-Tween (0.1%), or incubated 1h at RT (room temperature) with primary anti-Mouse Creb1 antibodies , rabbit anti-RhoE, rabbit anti-GM-CSFR, rabbit anti-Mapk11 (all from Antibodies-Online) diluted in the blocking solution. Horseradish peroxidase-conjugated secondary antibodies (DakoCytomation) and ECL (GE Biotech) were used for detection. When necessary, the antibodies from the membranes were eliminated with an elimination buffer (100 mM p-mercaptoethanol, 2% SDS, 62.5 mM Tris pH 6.8) for 30 min at 55 ° C.

RNA extraction and RT-qPCR.

Total RNA was extracted using Tripure (Roche) from microglial cells placed in 6-well plates. After DNase I treatment (Sigma), the RNA (1 pg / sample) was reverse transcribed using a Revert Aid first-strand cDNA synthesis kit (Fermentas) and random hexamer primers. CDNA was analyzed by qPCR in triplicates on a Cfx96 cycler (Bio-Rad) with the SensiFASTTM SYBR® No-ROX kit (Bioline) and 2.5 pmol of the following primers: direct from mouse Rac1 (SEQ ID NO: 13 ; CCCAATACTCCTATCATCCTCG); inverse of mouse Rac1 (SEQ ID NO: 14; CAGCAGGCATTTTCTCTTCC); direct from mouse BDNF (SEQ ID NO: 15; CCCTCCCCCTTTT AACT G AA); mouse BDNF reverse (SEQ ID NO: 16; GCCTTCATGCAACCGAAGTA) with a primer efficiency of 100.7% and GAPDH forward and reverse primers) of the RevertAid first cDNA strand synthesis kit (Fermentas), with an efficiency of 86.3% primer.

After 42 cycles, Ct values were determined. To normalize the samples, ACt was calculated between the gene of interest and the GAPDH Ct values as the reference gene. The difference of x-fold in the expression between the different treatments was determined by subtraction of the ACt values and was called AACt. Finally, the total change was calculated as 2 "AAct and the relative amount was deduced compared to cells transfected with random sequence siRNA.

Statistic analysis.

All data are expressed as the mean ± SEM. Statistical analysis was performed with a two-way ANOVA assay followed by a Student's t-test. We assume significance at a value of p <0.05. For statistical analysis of siRNA screening, the cellHTS2 version 2.38.0 software package was applied (Boutros et al., Genome Biol.

2006; 7 (7): R66) of R version 3.3.2 to calculate and normalize all the circularity values within each experiment, as is the case in normalization by experiments.

Finally, these normalized values were compared for each gene with the random sequence siRNA used as a negative control sample using the limma software in its version 3.30.11 (Smyth, GK 2004. Stat Appl Genet Mol Biol, 3, Article3). The results achieved are presented as a “fold change” in circularity, given as a logarithmic value (log2). The threshold value between significant and non-significant genes was determined using an adjusted P value: the Fold Discovery Rate (FDR). We apply the standardized FDR, as described in (Benjamini, YH, Y. 1995. J Royal Statistical Society, Series B 57 (1): 289-300).

Results

Rac1 siRNA efficiently inhibited branching induced by MC

First, experimental conditions were established to evaluate the siRNA knock-down efficiency in primary mouse microglial cells. Since a dominant negative mutant of Rac1 small RhoGTPase inhibited MC-induced conversion to elongated neuroprotective cells (Neubrand, VE, et al. 2014. Glia, 62 (12): 1932-1942) and the same phenotype was expected for knock-down your siRNA. Therefore, the inventors used Rac1 as the test protein.

Expression of Rac1 protein and mRNA was down-regulated efficiently (66.1 ± 9.0% protein and 59.7 ± 5.1% mRNA at 72h) after transfection with Rac1 siRNA from Silencer Select compared to random sequence siRNA ( FIG. 1 ).

Thus, it was confirmed that MC-induced cell elongation was inhibited in Rac1 siRNA transfected microglial cells ( FIG 2A ). The high magnification image of the cells shown in Fig. 2A and the typical black and white threshold images generated by the Fiji / ImageJ image analysis program are shown as an example in FIG. 2B. The contours of each cell were drawn to measure the perimeter and area of the cell, which are the parameters necessary to calculate the circularity values (they correspond to numbers close to each contour). It should be noted that cells that touch the edges of the image were automatically excluded from the measurement ( FIG. 2B ). Furthermore, quantification shows that MC-treated microglial cells that were previously transfected with three individual siRNAs targeting Rac1 or a pool thereof have a higher value for circularity, corresponding to a more rounded cell shape, compared with control MC-treated microglial cells that were not transfected or transfected with random sequence siRNA ( FIG. 2C ). Therefore, these results show that Rac1 siRNA could be used as a specific positive control in this siRNA screening.

SiRNA screening in MC-treated microglial cells identifies various potential targets to regulate microglial cell activation

The effect on elongation of MC-induced microglial cells from a library made to measure of Silencer-Select siRNA against 160 mouse proteins including 103 cytoskeleton proteins and 57 regulators of microglial cell activation / inflammatory pathways were evaluated . 23 small RhoGTPases were selected (Bustelo, XR, et al. 2007. Bioessays, 29 (4): 356-370) and 80 of their activators, guanine nucleotide exchange factors Rho RhoGEFs (Rossman, KL, et al. 2005 Nat Rev Mol Cell Biol, 6 (2): 167-180), because they are involved in regulating the architecture of the cytoskeleton and changes in cell morphology are intrinsically related to the cytoskeleton. In addition, the main regulators of inflammatory pathways were also selected, including various members of the mitogen-activated protein kinases (MAPK), phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K), and the nuclear factor kappa B subunit 1 (NF ^k B) signaling pathways, because these are likely Proteins interfere with the MC-induced anti-inflammatory phenotype of microglial cells and therefore have a higher probability of influencing the inflammatory state of microglial cells.

Table 3 and Table 4 show the list of all genes that were targeted by an initial screening using an siRNA library and also show the effect of gene inhibition on their differential circularity. All siRNAs were provided by Thermofisher Scientifc (Massachusetts, USA). Briefly, primary microglial cells were transfected with a pool of siRNA oligonucleotides against each gene (see Tables 3 and 4 ) and assayed for their effect on branching of MC-induced microglial cells. The result was expressed as differential circularity.

SiRNAs that caused positive differential circularity values were selected and classified by their fold discovery rate (FDR), which represents an adjusted p-value. Statistically significant genes were shaded gray. Genes that were bounded by the Parkinson's Disease UK Gene Ontology Project (Foulger, RE, et al. 2016. Neuroinformatics, 14 (3): 297-304 and http://www.geneontology.org/external -project / parkinson% E2% 80% 99s-uk-geneontology-project) are marked in the EP gene column. Genes that were detailed in the University of Luxembourg EP mapping tool (http://minerva.uni.lu/MapViewer/) are marked in the EP mapping column (Fujita, KA, et al. 2014. Molecular Neurobiology, 49 (1): 88-102). Genes that overlap with differential transcriptome expression data from substantia nigra postmortem tissue (Glaab, E., et al. 2015. Neurobiology of Disease, 74: 1-13) published in the mapping tool from the EP of the University of Luxembourg (http://minerva.uni.lu/MapViewer/) are marked in the last column. Positive candidates who were selected for validation are represented in bold.

Table 3. List of siRNA targets that result in positive differential circularity. All siRNAs were provided by ThermoFisher Scientific and identified by their ID.

Table 4. List of siRNA targets that result in negative differential circularity. All siRNAs were provided by ThermoFisher Scientific and identified by their ID.

A positive differential circularity ( Table 3 ) implies that the cells were more rounded than the random sequence siRNA transfected cells and negative differential circularity values ( Table 4 ) imply that the microglial cells transfected with this gene showed an increased branching pattern. .

Because the inventors were interested in genes that inhibited the neuroprotective branching phenotype of microglial cells, statistically significant positive candidates (genes marked in bold in Table 3 ) were compared with the publicly available databases of pathways and expression. of genes associated with Parkinson's disease. Additionally, they are also Compares with the substance nigra post mortem tissue transcriptome differential expression data between healthy and Parkinson's disease patients.

Overlapping genes between the siRNA screening selected in the present invention and those databases in addition to the seven candidates with the highest differential circularities were subjected to a literature search to collect information about their potential physiological role in cells. microglial. In this sense, the following genes with positive circularity (corresponding to overlapping genes between siRNA screening and the databases mentioned above, in addition to the seven candidates with the highest differential circularities), were subjected to a search in the literature. : Arhgef4, Rnd3, Tiaml, Mapk11, Csf2ra, Map3k2, Map2k3, Cdc42, Crebl, Arhgef9, Rac1, Mapk9, Map2k7, Akt1, Mapk12, Nfkbia, Rnd2, Chuk, Dock6, Arhgef2, Arhgef2, Arhgef, P , Rhoc and Ect2. Furthermore, the following genes with negative circularity (corresponding to overlapping genes between siRNA screening and the databases mentioned above) were subjected to a literature search: Mapk1, Akt2, Mapk10, Plekhg5, Dock1, Arhgef16, Crebbp , Rnd1, Mapkapk2, Gsk3b, Pik3r2, Map2k4, Rhoq, Dock3, Csf1, Pik3r1 and Arhgef6. From there, the candidates Asef ( Arhgef4), Tiam1, GM-CSFR ( Csf2rA), IdBa ( Nfkbia), RhoE ( Rnd3), p38fí ( Mapk11), Creb1, MEK3 ( Map2k3), Map3k2 and JNK2 ( Mapk9) were selected and then validated in the next step.

Because siRNA screening in mammalian cells could be influenced by nonspecific effects, the inventors confirmed the selected positive candidates mentioned above by individual transfection of the three single siRNAs from the original pool. To exclude these nonspecific effects, at least two siRNA oligonucleotides directed against the same gene should exhibit the same phenotypic effect on MC-treated microglial cells (tested for changes in circularity values) and efficiency to decrease gene expression. of its gene target (tested by Western Blot).

As shown in Table 5 , not all positive candidates from the previous siRNA screening were verified in this validation assay. None of the three siRNAs (s77059, s77060 and s77061) against MEK3, nor the two siRNAs against JNK2 (s77122 and s77123) were able to individually change the circularity values in microglial cells treated with MC ( Table 5 ), and therefore the genes MEK3 and JNK2 were marked as false positives. Furthermore, the protein levels of all genes tested, except Arhgef4, were down-regulated significantly by at least two single siRNAs ( FIG.

3 ). Since none of the individual siRNAs targeting Arhgef4 were able to down-regulate the Arhgef4 protein, this candidate had to be considered a false positive.

Table 5. Validation of siRNA targets that result in positive differential circularity. Microglial cells were transfected with three single siRNA oligonucleotides ( # 1, # 2, and # 3) per gene and assayed for their effect on MC-induced microglial cell branching. The change in cell morphology was expressed as differential circularity. The results were classified by their FDR and the statistically significant genes are marked in bold. ( All siRNAs are provided by ThermoFisher Scientific and are identified by their siRNA ID).

Furthermore, FIG. 6 shows that MC-treated microglial cells that were previously transfected with Plekhg5 siRNA have higher branching compared to control MC-treated microglial cells that were transfected with random sequence siRNA.

Selected candidates differentially regulate BDNF production and migration in microglial cells

To pinpoint the functional consequences of branching degradation, the inventors ran secondary screens with the seven validated candidates (Tiam1, GM-CSFR, kBa, RhoE, p38p, Creb1, and Map3k2) by investigating their effects on two processes that are related to activation of microglial cells or with mechanisms through which microglial cells exercise their neuroprotective functions, specifically the capacity for cell migration and the production of neurotrophic factors. Because MC induced BDNF production in primary microglial cells (Neubrand, VE, et al. 2014. Glia, 62 (12): 1932-1942.), The inventors transfected primary microglial cells with two individual siRNAs of the seven Positive candidates mentioned above (See Table 6 ) that efficiently down-regulated their target protein ( FIG. 3 ), and measured BDNF mRNA expression four days later.

Table 6. Down-regulation of the target genes by two individual siRNAs for each of the genes shown.

SiRNAs against Creb1, RhoE and p38p were able to down-regulate the expression of BDNF mRNA at baseline by microglial cells ( FIG 4 ), suggesting that they could achieve their neuroprotective function through the production of BDNF. However, siRNAs against Tiam1, GM-CSFR, kBa and Map3k2 were unable to regulate BDNF expression (data not shown).

The amoeboid form of the cell in microglial cells is known to be associated with cell migration. Therefore, the inventors used a wound assay to test the effect of the seven validated candidates on microglial cell migration (Creb1, GM-CSF2RA, RhoE, p38p, Map3k2, Tiam1, and kBa.). Briefly, the inventors transfected primary microglial cells with two individual siRNAs from the above-mentioned positive candidates (See Table above), and three days later, MC was added and the coverslip "wound" was performed. The results showed that the cells siRNA transfected microglials against RhoE, Tiaml or kBa siRNA closed their wound before the random sequence siRNA ( FIG.

5 ), indicating that these three genes are negative regulators of microglial cell migration. In contrast, siRNAs against GM-CSFR, p38p, Crebl and Map3k2 did not affect their migratory capacity (data not shown). Downregulation of RhoE, Tiam1, or kBa by transfection of siRNA did not affect MTT reduction in microglial cell cultures (data not shown), suggesting that its effects on the wound assay are not due to action on viability / proliferation. Table 7 summarizes the results of both secondary screens. Briefly, microglial cells were transfected with validated siRNA oligonucleotides against their indicated target protein and assayed for their effect on BDNF expression and microglial cell migration as described in FIG. 4 and FIG. 5 .

Table 7. Summary of secondary screening.

Claims (21)

1. Use of the Plekhg5 gene and / or the protein encoded by it as a pharmacological target for the screening, testing and / or validation of molecules, compounds, agents and modulators useful in the treatment and / or prevention of neurological diseases. 2. Use according to claim 1 wherein the Plekhg5 gene and / or the protein encoded by it belongs to mammals. 3. Use according to any of claims 1 to 2 wherein the Plekhg5 gene and / or the protein encoded by it belongs to humans. 4. Use according to any of claims 1 to 3 wherein the Plekhg5 gene comprises the nucleotide sequence SEQ ID NO: 20. 5. Use according to any of claims 1 to 4 wherein the neurological disease is a neurodegenerative disease. 6. Use according to claim 5 wherein neurodegenerative disease is selected from the list consisting of: Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis, amyotrophic lateral sclerosis, Pick's disease, frontotemporal dementia, progressive nuclear paralysis , corticobasal degeneration, cerebrovascular dementia, multisystemic atrophy, argyrophilic granule dementia, and mild cognitive impairment, preferably Alzheimer's disease, Parkinson's disease, and Huntington's disease. 7. In vitro method of screening, testing or validating molecules, compounds, agents and modulators useful for the treatment and / or prevention of neurological diseases, comprising: a) Contacting a molecule, compound, agent, and / or modulator with the Plekhg5 gene and / or with the protein encoded by it according to any of claims 1 to 4, b) Analyze the interaction between the compound, agent, and / or modulator and the Plekhg5 gene and / or the protein encoded by it, and c) Select the compound, agent, and / or modulator of step (a) with the ability to bind the Plekhg5 gene and / or the protein encoded by it to decrease or inhibit its expression and / or activity. 8. In vitro method according to claim 7 wherein the neurological disease is a neurodegenerative disease. 9. In vitro method according to claim 8 wherein the neurodegenerative disease is selected from the list consisting of: Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis, amyotrophic lateral sclerosis, Pick's disease, frontotemporal dementia, paralysis progressive nuclear, corticobasal degeneration, cerebrovascular dementia, multi-system atrophy, argyrophilic granule dementia, and mild cognitive impairment, preferably Alzheimer's disease, Parkinson's disease, and Huntington's disease. 10. Molecules, compounds, agents, and modulators obtainable by the in vitro method according to any of claims 7 to 9. 11. Molecules, compounds, agents, and modulators of the levels of expression and / or activity of the Plekhg5 gene and / or the protein encoded by it, where the molecule, compound, agent, and modulator, have a potential activity in the treatment and / or prevention of neurological diseases. 12. Molecule, compound, agent, and modulator according to any of claims 10 to 11 characterized in that it is an antagonist or inhibitor. 13. Molecule, compound, agent, and modulator according to any of claims 10 to 12 wherein the antagonist or inhibitor is selected from at least one of the list consisting of: a) an antibody, b) an aptamer, c) a ribozyme, d) an antisense sequence, e) an RNAi, and f) a CRISPRi 14. Molecule, compound, agent, and modulator according to claim 13 wherein the antagonist or inhibitor is an RNAi. 15. Molecule, compound, agent, and modulator according to any of claims 13 to 14 wherein the RNAi is selected from the list consisting of: siRNA, dsRNA, dsRNA, miRNA, shRNA molecules, or any combination thereof. 16. Molecule, compound, agent, and modulator according to any of claims 13 to 15 wherein the RNAi is selected from the list consisting of: a sense sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO : 5, SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11; and an antisense sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 or SEQ ID NO: 12. 17. Pharmaceutical composition comprising a therapeutically effective amount of a molecule, compound, agent or modulator according to any of claims 10 to 16, and at least one or more pharmaceutically acceptable adjuvants and / or vehicles. 18. Molecule, compound, agent, and modulator according to any of claims 10 to 16, and pharmaceutical composition according to claim 17, for use as a medicament. 19. Molecule, compound, agent, and modulator according to any of claims 10 to 16, and pharmaceutical composition, according to claim 17, for use in the treatment and / or prevention of neurological diseases. 20. Molecule, compound, agent, and modulator according to claims 10 to 16, and pharmaceutical composition, according to claim 17, wherein the neurological diseases is a neurodegenerative disease. 21. Molecule, compound, agent, and modulator according to any of claims 10 to 16, and pharmaceutical composition, according to claim 17, where neurodegenerative disease is selected from the list consisting of: Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis, amyotrophic lateral sclerosis, Pick's disease, frontotemporal dementia, progressive nuclear paralysis, corticobasal degeneration, dementia Cerebrovascular disease, multisystem atrophy, argyrophilic granule dementia, and mild cognitive impairment, preferably Alzheimer's disease, Parkinson's disease, and Huntington's disease.