ES2725705T3 - New phytase, method to obtain it and use it - Google Patents

Abstract

An isolated nucleic acid molecule i) comprising the nucleotide sequence according to SEQ ID NO: 1 encoding a protein with phytase activity or ii) having a sequence identity of at least 86% with a nucleotide sequence according to SEQ ID NO: 1 encoding a protein with phytase activity, wherein the isolated nucleic acid molecule comprises codon optimization mutations with respect to a host cell organism, where the host cell organism is Pichia pastoris, and where the nucleic acid molecule differs of the corresponding wild nucleotide coding sequence according to SEQ ID NO: 8 in the presence of at least 50 codon optimization mutations.

Description

DESCRIPTION

New phytase, method to obtain it and use it

Field of the Invention

The invention generally relates to novel and improved nucleic acid sequences encoding a polypeptide or a protein having the enzymatic activity of a phytase and to methods for effectively expressing these enzymes in a host cell.

In a first aspect, the present invention relates to an isolated nucleic acid molecule i) comprising the nucleotide sequence according to SEQ ID NO: 1 encoding a protein with phytase activity or ii) having a sequence identity of at least 86% with a nucleotide sequence according to SEQ ID NO: 1 that encodes a protein with phytase activity.

The present invention also relates to an expression construct or a vector comprising the aforementioned isolated nucleic acid molecule. The present invention further relates to a method for producing a protein that has the enzymatic activity of a phytase, which comprises the steps of:

a) introducing into a host cell a vector comprising:

i) elements that regulate expression that are functional in the host cell; Y

ii) operatively connected thereto a nucleic acid molecule as defined herein;

b) culturing the host cells obtained in step a) under conditions suitable for protein expression, and optionally

c) recover the protein produced in stage b) from the cell culture.

The present disclosure describes proteins obtained by the method according to the invention and the use thereof for the manufacture of feed additives.

Background of the invention

The invention generally relates to new nucleic acid molecules encoding a polypeptide or a protein that has the enzymatic activity of a phytase and a method for effectively producing this protein with phytase activity in a host cell. A polypeptide or protein obtained by the method according to the present invention and the use thereof as an active ingredient in the manufacture of feed additives and / or for the release of phosphate from the organic material from the soil is disclosed herein.

Elemental or pure phosphorus (P) is quite rare in nature, which is usually found as part of molecules that include the phosphate group (PO43-) linked to a carbon-based organic group of animals and plant tissues.

However, phosphorus (P) is an important nutrient for plants and animals. P is an important macronutrient of plants, constituting about 0.2% of the dry weight of a plant. It is a component of key molecules such as nucleic acids, phospholipids and ATP and, therefore, plants cannot grow without a reliable supply of this nutrient. Inorganic phosphorus is the only source of phosphorus that can be absorbed and captured by plants. Due to the low availability of inorganic phosphorus in the soil, farmers are forced to make macronutrient P. available.

In addition, animals require phosphorus as a nutrient, which can generally be provided either in the form of inorganic phosphorus, for example, in a diet or by degradation of the various organic phosphorus ingredients that constitute the diet.

Phytic acid or phytate is the main form of phosphorus storage in plants such as cereals, legumes, oilseeds, with values ranging from 1 to 5% by weight. "Phytic acid", also called inositol hexaquisphosphate (IP6), or the salt of "phytate" itself, is a saturated cyclic acid. On the other hand, phytic acid typically chelates and thus renders certain important secondary minerals such as zinc and iron and, to a lesser extent, also macrominerals such as calcium and magnesium. Phytin refers specifically to the form of calcium or magnesium salt of phytic acid. Phytic acid catabolites are called inositol polyphosphates lower. Examples are penta- (IP5), tetra- (IP4) and inositol triphosphate (IP3). More than two thirds of the phosphorus contained in cereals and legumes are present in the form of phytate.

Phytate is not digestible for humans or non-ruminant animals (monogastric animals), so it is not an appropriate source of either inositol or phosphate, if eaten directly. In particular, the phosphorus and inositol present in the form of phytate cannot be made bioavailable for non-ruminant animals, because they lack the digestive enzyme phytase that is required to remove phosphate from the inositol in the phytate molecule. The phosphorus present in the form of phytate constitutes about 20 to 40% of the phosphorus of plant origin ingested by monogastric animals.

Since phytate cannot be adsorbed by non-ruminant animals, non-absorbed phytate usually passes through the gastrointestinal tract, raising the amount of phosphorus in feces. Excretion of excess phosphorus can lead to environmental and ecological problems, such as eutrophication. Phosphorus soil contamination poses a serious problem in agriculture, especially in areas of intensive agriculture with monogastric animals.

In addition, although some of the microorganisms of the intestinal flora of the small intestine are capable of hydrolyzing phytic acid, phosphorus is only absorbed in small amounts. On the other hand, an excess of phytate has the effect of an antinutritional factor since phytate is capable of chelating essential metal ions such as calcium, copper or zinc, which are necessary for animal nutrition, thereby decreasing its nutritional value.

To avoid the above disadvantages, animal feed was commonly enriched with inorganic phosphorus, which in turn increased the costs of livestock production. An additional approach that recently emerged to alleviate these disadvantages is the direct addition of phytase, which catalyzes the hydrolysis of phytate to release and make organic phosphorus accessible for animal feed.

The use of microbial phytase is currently approved for use in feed, with the purpose of increasing the availability of phosphorus from phytic acid. For example, 6-phytase produced by Aspergillus oryzae (DSM 14223) was authorized for broilers, laying hens, turkeys, fattening pigs and female pigs by Regulation (EC) No. 255/2005 of the European Commission . These phytases are extremely weak and unstable, expressing the maximum pH activity between 5.0 and 7.5, so that the activity is reduced and substantially limited due to the low pH values of the stomach (pH 2-3). It is also known that phytase enzymes are strongly inhibited by excess substrate (phytate) and product (inorganic phosphorus) and high temperatures (Power and Khon, 1993).

Synthetic phytases are phosphomonoesrases capable of hydrolyzing phytic acid in inorganic orthophosphate with low proportions of phosphoric esters, being the intermediate products of pentaphosphate to monophosphate, and free myoinositol (Nayini and Markakis, 1986; Lasztity and Lasztity, 1988; Harland and Morris, 1995 ). IUPAC- | U ^b (1976) has recognized 3-phytase (EC 3.1.3.8), isolated in animals and microorganisms (Reddy et al., 1982; Lasztity and Lasztity, 1988).

Exogenous phytases have been found in microorganisms such as fungi and yeasts (eg Saccharomyces cerevisae and Aspergillus sp) and bacteria (Bacillus subtilis, Pseudomonas). The phytase obtained from Aspergillus sp follows a certain order of hydrolyzing of the phytase molecule, that is, after releasing the phosphate group from position 3, it continues in the following order, 4, 5, 6 and 2 ( Venekamp et al., 1995). These enzymes show activity at different pH 2.5 and H5.5. The activity at pH 2.5 is about 40% less effective than at pH 5.5, which is important since phosphorus absorption occurs to a greater degree in the small intestine that has a pH 5.5. (Power and Khon, 1993).

The phytase produced by Aspergillus jicuumm is a purified glycoprotein, with an enzymatic activity that changes with temperature and pH. The optimal temperature of the enzyme is between 60 and 70 ° C. However, for 10 minutes at 68 ° C, a loss of activity was observed up to 60% (Nasi, 1990). The thermostable Aspergillus niger enzymes are resistant against the nodulization process and its activity is shown to be at least 5000 FTU / g. (Nasi, 1990).

WO 2011/141613 A2 / EP 2743 347 A2 describes a novel gene isolated from Serratia odorífera, which encodes a protein or polypeptide that has phytase activity, a method for obtaining the same in a yeast host cell as, such as Pichia pastoris, and the use of the enzyme as an active ingredient in the manufacture of feed additives. WO 201 1/141613 / EP 2743347 A2 reports on a phytase, which was not sensitive to the difference in pH between the stomach (pH 3.5) and the intestinal tract (pH 7.0) and that maintained its activity at over a wide pH range. It was reported that the phytase described in WO 2011/1416 had improved thermostability.

Yang et al. entitled "Enhancement of alkaline phytase production in Pichia pastoris: influence of gene dosage, sequence optimization and expression temperature." (Protein Expr Purif. August 2012; 84 (2): 247-54) discloses the properties of catalytic and thermal stability of alkaline phytase from lily pollen (LIALP).

However, the modest level of expression of this wild protein Phytase of Serratia still represents an obstacle with regard to large-scale protein production. There is still a strong need to identify the factors and conditions that lead to an improved and effective expression of the phytase protein in a host cell. The state of the art still lacks means and methods capable of effectively producing more protein with phytase activity by volume and over time. Hence, there is still a strong need to improve production conditions on an industrial scale in order to provide an economical and reliable method. Summary of the invention

The above objective is solved by the methods and means according to the present invention that are described and claimed herein. The present invention addresses these needs and provides a novel nucleic acid molecule isolated from Serratia odorífera that encodes a protein or polypeptide with phytase activity. The present invention further provides methods for effectively expressing and subsequently purifying the isolated genes according to the invention in a host cell.

In a first aspect, the present invention relates to an isolated nucleic acid molecule

i) comprising the nucleotide sequence according to SEQ ID NO: 1 encoding a protein with phytase activity or ii) having a sequence identity of at least 86% with a nucleotide sequence according to SEQ ID NO: 1 encoding a protein with phytase activity,

wherein the isolated nucleic acid molecule comprises codon optimization mutations with respect to a host cell organism, where the host cell organism is Pichia pastoris, and where the nucleic acid molecule differs from the corresponding wild nucleotide coding sequence according to SEQ ID NO: 8 in the presence of at least 50 codon optimization mutations.

In a further preferred embodiment, the isolated nucleic acid molecule has a sequence identity of at least 90% with a nucleotide sequence according to SEQ ID NO: 1 that encodes a protein with phytase activity. In yet another preferred embodiment, the nucleic acid molecule does not comprise a nucleotide sequence encoding an N-terminal signaling peptide.

According to the present invention, the host cell organism is Pichias Pastoris.

The present invention relates to a nucleic acid molecule that differs from the corresponding wild nucleotide coding sequence in the presence of at least 50 codon optimization mutations.

In a further preferred embodiment, at least 50% of the codons of the corresponding wild nucleic acid sequence are modified in the codons most favored by the host cell organism.

In a preferred embodiment, all codons of the isolated nucleic acid molecule are modified in the codons most favored by the host cell organism.

In further preferred embodiments, the isolated nucleic acid molecule according to this encodes the amino acid sequence of the phytase activity protein according to SEQ ID NO: 3.

In a second aspect, the present invention relates to an expression construct comprising the said isolated nucleic acid molecule operatively connected to elements that regulate the expression of the nucleic acid sequence in a host cell, wherein the host cell organism is Pichia pastoris.

In a preferred embodiment, said expression construct the elements that regulate the expression comprise a functional promoter in a host cell and optionally a termination sequence.

According to the present invention, said host cell is a fungal cell and the fungal cell is Pichia Pastoris. In a third aspect, the invention relates to a vector comprising said nucleic acid molecule or the expression construct.

In a fourth aspect, the present invention relates to a method for producing a protein that has the enzymatic activity of a phytase comprising the steps of:

a) introducing into a host cell a vector comprising:

i) elements that regulate expression that are functional in the host cell; Y

ii) operatively connected thereto a nucleic acid molecule encoding a protein with phytase activity as defined herein;

b) culturing the host cells obtained in step a) under conditions suitable for protein expression, and optionally

c) recover the protein produced in stage b) from the cell culture, where the host cell organism is Pichia pastoris.

In a further embodiment, the elements that regulate the expression comprise a functional promoter in the host cell and optionally a termination sequence.

According to the present invention, the host cell is a yeast cell, and wherein the yeast cell is Pichia Pastoris.

In further preferred embodiments of the present, protein expression is carried out using a methanolic expression system.

In still other preferred embodiments, the protein recovered in step c) has a phytase activity of at least 1000 units / l.

In a further preferred embodiment, said recovery step comprises i) separating the secreted protein from the medium and / or i) separating the protein from the host cell.

The present invention relates to a protein obtained by the method according to the invention.

The use of the protein produced by the method described herein for the manufacture of feed additives is also disclosed herein.

Feed additives comprising the protein described herein or comprising the protein produced by the method described herein are also disclosed herein.

Brief description of the drawings

The following drawings are illustrative of the embodiments of the invention and are not intended to limit the scope of the invention as encompassed by the claims.

Figure 1: Determination of the molecular weight of AppAs-r phytase protein by denaturing acrylamide gel (SDS-PAGE): Culture medium without induction with methanol (Lane 1); Phytase expression AppAs-r in culture medium with methanol (Lane 2); Optimal AppAs-r phytase expression in methanol culture medium (Lane 3); PM marker (Lane 4)

Figure 2: Determination of the enzymatic activity (%) of optimal AppAs-r phytase protein dependent on temperature (° C) and temperature resistance

Figure 3: Determination of the enzymatic activity of optimal AppAs-r phytase protein depending on the pH Figure 4: Effect of pepsin (filled rhombus) and trypsin (filled square) proteases on the optimal AppAs-r enzymatic activity .

Figure 5: Maintaining the optimal AppAs-r phytase activity over time

Figure 6A: Nucleotide sequence of the original odoriferous Serratia phytase sequence (SEQ ID NO: 2) wild and the odoriferous Serratia nucleotide sequence without the nucleotide sequence encoding the N-terminal signaling peptide sequence (SEQ ID NO: 8 ). The nucleotide sequence encoding the N-terminal signaling peptide sequence (SEQ ID NO: 4) is highlighted in gray. Figure 6B: Nucleotide sequence of optimized / improved odoriferous Serratia phytase ( optimal / optimal AppAs-r phytase ) (SEQ ID NO: 1)

Figure 6C: protein sequence of amino acid phytase Åppås-r optimal Serratia odoriferous (SEQ ID NO: 3) Figure 6D: Comparison of amino acid sequences between the translated 6A (upper sequence) sequence and translated sequence of Fig 6B (lower sequence).

Figure 6E: Nucleotide comparison of the gene sequence of Fig 6A (upper sequence) and the gene sequence of Fig 6B (lower sequence).

Figure 7: Expression profiles of wild phytase and an improved phytase (optimal phytase)

Figure 8 Graph showing the production of phytase (units / l) over time (h) of wild phytase compared to improved phytase (optimal phytase)

Detailed description of the achievements

The invention generally relates to new and improved nucleic acid sequences encoding a polypeptide or a protein having the enzymatic activity of a phytase and to methods for effectively expressing these enzymes in a host cell.

Although the present invention will be described with respect to particular embodiments, this description should not be considered in a limiting sense.

Before describing in detail exemplary embodiments of the present invention, important definitions are given to understand the present invention.

As used herein and in the appended claims, the singular forms of "a" and "one" also include the respective plurals unless the context clearly dictates otherwise.

In the context of the present invention, the terms "around" and "approximately" indicate a range of precision that one skilled in the art will understand to still ensure the technical effect of the characteristic in question. Typically, the term indicates a deviation from the indicated numerical value of ± 20%, preferably ± 15%, more preferably ± 10% and even more preferably ± 5%.

It will be understood that the term "comprising" is not limiting. For the purposes of the present invention, the term "consisting of" is considered to be a preferred embodiment of the term "comprising." If it is subsequently defined herein that a group comprises at least a certain number of embodiments, it is understood that this also encompasses a group that preferably consists only of these embodiments.

On the other hand, the terms "first", "second", "third" or "(a)", "(b)", "(c)", "(d)" etc. and the like in the description and claims are used to distinguish between similar elements and not necessarily to describe a sequential or chronological order. It is to be understood that the terms thus used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operating in sequences other than those described or illustrated herein.

In case the terms "first", "second", "third" or "(a)", "(b)", "(c)", "(d)" "i", "ii" etc. refer to stages of a method or use or test, there is no consistency of time or time intervals between the stages, that is, the stages can be carried out simultaneously or there may be time intervals of seconds, minutes, hours, days , weeks, months or even years between these stages, unless otherwise indicated in the application as indicated herein before or after.

It is to be understood that this invention is not limited to methodology, protocols, reagents, etc. particulars described herein, as these may vary. It will also be understood that the terminology used herein is intended to describe only particular embodiments, and is not intended to limit the scope of the present invention that will only be limited by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meanings that are commonly understood by a person skilled in the art.

The above objective is solved by the methods and means according to the present invention that are described and claimed herein. The present invention addresses these needs and provides means and methods for obtaining an isolated Serratia odoriferous gene encoding a protein or polypeptide with phytase activity. The present invention further provides methods for effectively expressing and subsequently purifying the isolated genes according to the invention in a host cell.

As used herein, the term "gene" refers to a defined region that is located within a genome and that may comprise regulatory nucleic acid sequences responsible for the control of expression, that is, transcription and translation of the coding portion. A gene can also comprise other untranslated sequences and 5 'and 3' termination sequences. Additional elements that may be present are, for example, introns.

An "isolated nucleic acid molecule" encoding the protein with phytase activity according to the present invention refers to a nucleic acid molecule that is identified and separated from at least one contaminating nucleic acid molecule with which it is normally associated in the natural source of the nucleic acid encoding polypeptide. A nucleic acid molecule encoding isolated polypeptide is different from that in the form or location in which it is found in nature.

Therefore, isolated nucleic acid molecules are distinguishable from another nucleic acid molecule that encodes specific polypeptide since it exists in natural cells. However, a nucleic acid molecule encoding isolated polypeptide includes nucleic acid molecules encoding polypeptide contained in cells that normally express the polypeptide where, for example, the nucleic acid molecule is in a different chromosomal position than that of natural cells.

As used herein, the term "mutation" means any change in a polypeptide or nucleic acid molecule in relation to a polypeptide or wild nucleic acid molecule from which the 'mutant' is derived and, for example, it may comprise changes of individual or multiple amino acids or nucleotides, or changes of both nucleotides and amino acids, including point mutations, null mutations, frame change mutations, and may comprise deletions or insertions or substitutions of one or more nucleic acids or amino acids, which may comprise nucleotides or amino acids or analogs thereof present or not present in nature.

A "nucleic acid" or a "nucleic acid molecule", as used herein, generally refers to deoxyribonucleotides or ribonucleotides and polymers thereof in mono-, double-stranded or triple form. The term may encompass nucleic acids containing known analogs of natural nucleotides that have similar binding properties to the reference nucleic acid. A particular nucleic acid sequence may also implicitly encompass conservatively modified variants thereof (eg degenerate codon substitutions) and complementary sequences. The terms "nucleic acid", "nucleic acid sequence" or "polynucleotide" can also be used interchangeably with gene, cDNA and mRNA encoded by a gene.

The terms "nucleic acid or acids of the invention" or "nucleic acid molecule or molecules" used herein designate a nucleotide sequence that can be used by itself or in the compositions or methods described herein. . The terms refer to the entire coding sequence of a protein or polypeptide from Serratia odorífera with phytase activity according to SEQ ID NO: 2 mentioned herein. On the other hand, the terms also designate nucleic acids encoding functional protein fragments, vectors comprising the coding sequences or functional fragments of the above proteins as well as derivatives of the nucleic acids mentioned herein, which have modifications, i.e. deletions. , additions, investments, etc. of one or more, p. ex. 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 2, or 1 nucleotide or nucleotides, which nevertheless encode polypeptides that have substantially the phytase activity that is describes for the odoriferous Serratia phytase according to SEQ ID NO: 2.

Functional derivatives of the nucleic acids of the invention encode phytase polypeptides having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more phytase activity when they are compared with the wild polypeptide.

On the other hand, as indicated above, the terms "nucleic acid or acids of the invention" or "nucleic acid molecule or molecules" further designate vectors comprising the nucleic acids described herein. These vectors may contain regulatory sequences that allow effective transcription and translation of the nucleic acids described herein.

The terms "polypeptide", "peptide" and "protein" may also include polymers that include modifications such as, but not limited to, glycosylation, lipid binding, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ribosylation of ADP.

The term "isolated polypeptide," as used herein, describes the various polypeptides disclosed herein, means a polypeptide that has been identified and separated and / or recovered from a component of its natural environment. However, normally, the isolated polypeptide will be prepared by at least one purification step.

In a first aspect, the present invention relates to an isolated nucleic acid molecule

i) comprising the nucleotide sequence according to SEQ NO: 1 encoding a protein with phytase activity or

ii) having a sequence identity of at least 86% with a nucleotide sequence according to SEQ ID NO: 1 that encodes a protein with phytase activity.

An isolated, synthetic or recombinant nucleic acid molecule comprising (a) a nucleic acid (polynucleotide) encoding at least one polypeptide having phytase activity is disclosed herein, wherein the nucleic acid comprises a sequence having at least around 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82% , 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99 % or more sequence identity or full sequence identity (100%) with the nucleic acid sequence (polynucleotide) of SEQ ID NO: 1. In a further preferred embodiment, the isolated nucleic acid molecule has a sequence identity of at least 90% with a nucleotide sequence encoding a phytase according to SEQ ID NO: 1.

SEQ ID NO: 1 refers to a nucleotide sequence of the nucleic acid molecule that encodes a protein or polypeptide from Serratia odorífera with phytase activity. The nucleotide sequence of this enhanced or optimized phytase nucleotide sequence is referred to herein as "optimal AppAs-r" or "optimal phytase" (SEQ ID NO: 1) and is represented in Figure 6B:

SEQ ID NO: 1

gagcctagatacgttttggaaaaggtggttgaggtctctcgacacggcgttagaccaccaacctca gaactaactggacacggttatgcagccgcaacacttaaaggaagatacgaagccgattattataga ggtaacagacaggctatgcaagcgggaaccggaagggagtggccacaatggctgactcgtgacgga cgtcagggcctattggcaaacggttgtccatctgctggggctgtttacgtctgggctagtcctcta caaagaacaagggccaccgcacaggctttgatggacggtgcatttcccggatgcggggtcgccatt catgctgcagccactgaacaagatcccttgtttcaagcagataagatgggtcttgttccactcgat gccgaaagggctagaactgcaataaggcaggcaatgggtggctcagccgagcaagtgaagacacgt tttagtgctgacattaggcgtctgcaagctgctgtttgtttgcctcaacaggcttgtcctgccttt gaacaaccttgggaaattactcaagagcatgacggtagattcagcatcaatggtctaggaacattg tccaatatggctgaatctattagacttgcctactctgaaaaccagccaacggctcaagtcgcattt ggacacggtgtcaacgcatccgccgtcgctcctttgttaccactgctaaccgccagatatgacttt accaatgafcgtgccctatatcgctcaaagaggtggctccgttctgttaaaccaaattgctttggct cttgccgcagataggacttctgccggggcgccacctgctgctcgttggttgttatttgtcgctcat gacaccaatatcgcttatttaagaactctgcttggtttttcttggcaacagggactttacccaaga ggtaatattccccctgctggaagtttggttttcgaaagatggcgtgatagacaaacaggtc yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy

An aspect of the present invention is to identify and provide suitable mutations in the wild gene sequence of odoriferous Serratia in order to enhance and improve protein expression in a host cell. The wild-type unmodified or unmodified nucleotide sequence has been described in WO 2011/141613 A2 (which is incorporated by reference) and is referred to herein as SEQ ID NO: 2 (see Figure 6A):

SEQ ID NO: 2

atgttgctattgcaaaaggactggtcgcgtctgttatttgc.cgtcacgctgggtatgatttccagc gtagcccaggctgagccgcgctacgtattggaaaaggtggttgaggtcagccgccacggcgtacgc ccgccgacctcaggcaaccggcaggcgal_gcaggcgggaaccggccgagagtggccacaatggctg acgcgcgacggcgaactcactggccacggttatgccgccgccacgctgaaaggacgctatgaagcc gactattatcgccgtcagggcctattggccaacggctgtccgagcgcgggggcggtgtatgtctgg gccagtccgctacagcgcacgcgagccaccgcacaggcgttgatggacggcgcatttcccggctgc ggggtcgccattcatgcggccgccaccgaacaggaccccctgtttcaggcagataaaatgggccbg gtgccgctcgatgccgaacgggctcgcacggcaataaggeaggcaatgggcggcagcgccgagcag gtgaaaacgegctttagcgctgacattcggcgtctgcaagcggcggtctgcctgccgcaacaggct tgcccggcctttgaacaaccgtgggaaatcactcaggagcacgacggccgcttcagcatcaacggt ctggggacgttgtccaacatggcggaaagcattcgcctggcctacagcgaaaaccagccgacggcg caggtcgcctttggccacggtgtcaacgcatcggccgtcgcgccgttgctgcccctgctcaccgcc cgctatgactttaccaatgacgtgccctatatcgcgcaacgcggtggctcggtgctgttaaaccaa atcgcgctggcgctggccgccgatcgaacctctgccggggcgccaccggcggcgcgctggttgctg tttgtcgcgcatgacaccaatatcgcttatctgcgcaccctgcttggctttagctggcaa cagggg acgggccagcgcttcctgcgtctgtacttccaggcgcaatcgctggatcaaatccgccagttgtca ctttacccacgcggcaatattcccccggctggcagtctggtattcgaacgctggcgcgatcggcaa ccgctgagcacgctgtcgccaccgttaaaaaccgagttcagccgtcctggctgccggcagttgtca ctgggcgtactctgtccctggactgagtcgatgcaacggatgcgcgcggctatcgacccgacggcg ctgcctacggtgcagtaccggccataa

The nucleotide sequence of odoriferous Serratia phytase optimized according to SEQ ID NO: 1 differs from the wild nucleotide sequence according to SEQ ID NO: 2 in the presence of 211 mutations or specific modifications in the nucleotide sequence.

The odoriferous serratia phytase nucleotide sequence optimized according to SEQ ID NO: 1 does not comprise the nucleotide sequence encoding an N-terminal peptide signaling sequence of the wild sequence according to SEQ ID NO: 4. The signaling peptide sequence in the sequence of wild phytase indicated above according to SEQ ID NO: 2 is highlighted in gray.

The wild coding sequence without the signaling peptide sequence is referred to herein as SEQ ID NO: 8.

A sequence comparison of the sequence of SEQ ID NO: 1 with SEQ ID NO: 2 is shown in Figure 6 E. Each mismatch in sequence alignment corresponds to a mutated or modified position, where the nucleotide with respect to the sequence Original was exchanged for another nucleotide.

Referring to the sequence alignment according to Fig. 6E, the nucleotide sequence of odoriferous Serratia phytase optimized according to SEQ ID NO: 1 differs from the wild nucleotide sequence according to SEQ ID NO: 8 in 211 mutations or point modifications in the nucleotide sequence.

The expression of the nucleotide sequence according to SEQ ID NO: 1 results in the polypeptide sequence of the odoriferous Serratia phytase shown in Figure 6C (SEQ ID NO: 3). SEQ ID NO: 3 corresponds to the polypeptide sequence of the mature phytase protein. As seen in the sequence alignment of Figure 6C, the translated polypeptide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 share 100% identity, i.e. none of the 211 mutations described in SEQ ID NO: 1 gave as a result an exchange of one of the encoded amino acids.

Preferably, the term "modification" or "mutation" within the meaning of the present invention refers to alterations in the position of the nucleotides of the wild sequence, which do not result in the exchange of the encoded amino acid but the change of the codon of a given amino acid, thus the exchange of nucleotides of codonic adjustment or codonic optimization.

As will be appreciated, codon optimization is generally based on the use of codons in a specific host organism, in which a given nucleic acid sequence is expressed, that is, translated into the corresponding protein. The codonic optimization of the nucleic acid encoding the odoriferous Serratia phytase protein described herein takes into account the relative coding frequencies, the optimized GC content and the mRNA instabilities.

Generally, "percent identity" (in%) refers to a quantitative measure of the similarity between two sequences (DNA, amino acid or other). Closely related species are expected to have a higher identity percentage for a given sequence than more distant related species, and thus the percentage of Identity to a degree reflects relationship. The percent identity is calculated by multiplying the number of matches in the pair by 100 and dividing by the length of the aligned region, including the gaps. The identity score only counts perfect matches, and does not consider the degree of amino acid similarity with each other. For the calculation, only internal gaps in length are included, not gaps in the ends of the sequence.

Percentage of Identity = (Concordances x 100) / Length of the aligned region (with gaps)

The "percentage (%) of nucleic acid sequence identity" with respect to the nucleic acid sequence according to SEQ ID NO: 1 encoding a protein with phytase activity identified herein is defined as the percentage of nucleotides in a possible sequence that are identical to the nucleotides of the nucleic acid sequence according to SEQ ID NO: 1, after aligning the sequences and entering gaps, if necessary, to reach the maximum percentage of sequence identity. Alignment for the purpose of determining the percentage of nucleic acid sequence identity can be achieved in various ways that are within the skill of the art by using publicly available software such as BLAST, BLAST-2, ALIGN or Megalign software (ADNSTAR) .

For example, the percentage of nucleic acid sequence identity can be determined using the NCBI-BLAST2 sequence comparison program (Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997). The sequence comparison program NCBI-BLAST2 can be downloaded from http://www.ncbi.nlm.nih.gov or otherwise obtained from the National Institute of Health, Bethesda, MD. NCBI-BLAST2 uses several search parameters, where all those parameters Search values are set to default values including, for example, unmasked = yes, string = all, expected presences = 10, minimum low complexity length = 15/5, multi-step value e = 0.01, multi-step constant = 25, fall for alignment with final gaps = 25 and score matrix = BLOSUM62.

When the length of the given nucleic acid sequence, ie the optimal AppAs-r sequence (SEQ ID NO: 1), is not equal to the length of a comparison nucleic acid sequence, the percent identity is calculated as follows :

1. Optimal AppAs-r (SEQ ID NO: 1) is shorter than the comparison DNA:

AppAs-r optimal NNNNNNNNNNNNNN (length = 14 nt)

Comparison DNA NNNNNNXXXXXXXXXX (length = 16 nt)

(The lengths of the sequences are exemplary)

% nucleic acid sequence identity = (the number of identically matching nucleotides between the two nucleic acid sequences as determined, e.g., by NCBI-BLAST2) x 100 divided by (the total number of nucleotides in the sequence of optimal AppAs-r nucleic acid) = 6 x 100 divided by 14 = 42.9%

2. Optimal AppAs-r (SEQ ID NO: 1) is longer than the comparison DNA:

AppAs-r optimal NNNNNNNNNNNNNN (length = 12 nt)

NNNNNNXXXYY comparison DNA (length = 9 nt)

(The lengths of the sequences are exemplary)

% nucleic acid sequence identity = (the number of identically matching nucleotides between the two nucleic acid sequences as determined, e.g., by NCBI-BLAST2) x 100 divided by (the total number of nucleotides in the sequence of optimal AppAs-r nucleic acid) = 4 x 100 divided by 24 = 33.3%

Hence, the length of the reference sequence (optimal AppAs-r nucleic acid sequence) determines the length of the aligned region. It will be appreciated that this principle is also applicable for the comparison of polypeptide sequences.

The terms "protein with phytase activity" or "phytase" used herein refer to meso-inositol phosphohydrolase hexaphosphate, which catalyze the dissociation of phosphate groups from phytic acid (IP6) or phytate. The result of this enzymatic reaction is a free phosphate group and a phosphateinositol ester (IP5-IP1). Generally, phytases can be classified into two groups: microbial or fungal phytases (EC 3.1.3.8) or 3-phytase, which begin to hydrolyze the phosphorus group located in the C1 or C3 inositol ring or plant phytases (EC 3.1.3.26) or 6-phytase, which begin to hydrolyze, preferably, the phosphate group located in the C6 of the inositol ring.

Accordingly, "phytase activity", as used herein, refers to an enzymatic hydrolyzing reaction of phosphate groups from phytic acid (IP6) or phytate. In one embodiment, the phytase enzyme activity is the phytase activity described for the odoriferous Serratia protein according to SEQ ID NO: 2.

The present invention also contemplates measuring phytase activity. By way of example, phytase activity can be measured with the assays described in WO 2011/141613 A2 or described herein in Example 3, in which the specific activity was evaluated by measuring the concentration of Phosphate or free phosphorus that was released by the enzyme phytase using the acid molybdate-vanadate method.

This method is based on the APHA Standard Method 4500-P C. In acids, orthophosphate ions react with ammonium molybdate and ammonium vanadate to form yellow ammonium phosphoric vanadomolibdate, which can be analyzed photometrically at 415 nm. The intensity of the yellow color is proportional to the phosphate concentration. However, the present invention also provides for other methods or assays for measuring or determining and phytase activity that are within the skill of the person skilled in the art. An alternative method is the molybdenum blue method. In an acidic medium, ortho phosphates bind with ammonium molybdate to form molybdenic phosphoric acid. With the help of a reducing agent, this forms a blue phosphorus molybdenum compound. The photometric measurement of the dye intensity can be performed at 880 nm.

In a specific aspect, the invention provides a nucleic acid sequence that lacks the N-terminal signaling sequence and / or the initiating methionine and is encoded by a nucleotide sequence encoding an amino acid sequence as described hereinabove.

The signaling peptide sequence of the wild Serratia odoriferous gene is defined by the nucleotide sequence according to SEQ ID NO: 4 and by the amino acid sequence according to SEQ ID NO: 5.

SEQ ID NO: 4:

SEQ ID NO: 5: MLLLQKDWSRLLFAVTLGMISSVAQA

The inventors of the present invention observed that expression of the full-length odoriferous Serratia wild phytase gene as shown in Fig. 6A (SEQ ID NO: 2) that includes the 26 AA signaling peptide leads to an unstable protein that after the expression disappeared quickly. Therefore, the inventors of the present invention observed that omission of the 26 AA signaling peptide resulted in enhanced expression (see Example 1).

In a specific embodiment, the invention describes the AppAs-r sequence optimized for expression in a suitable host cell expression system. The optimized sequence takes into account the codon bias of the host cell organism. In one embodiment, the most preferred or most frequent codons are used for each amino acid of the nucleic acid sequence given that encodes the protein with phytase activity described herein. Alternatively, it may be sufficient to provide a partially optimized sequence, that is, where a part of the codons of the nucleic acid sequence is adapted to the most favored codon. In some embodiments, it is sufficient to optimize the codons of some specific amino acids in the AppAs-r sequence.

Preferred embodiments of the present invention refer to a nucleotide sequence, in which at least 5%, 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50% of the codons of the sequence of wild AppAs-r nucleic acid are modified in the codons most favored by the host cell organism. In additional preferred embodiments, at least 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58% or 59% of the codons of the nucleic acid sequence are modified in up to the most favored codons by the host cell organism. In additional preferred embodiments, at least 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68% or 69% of the codons of the wild nucleic acid sequence are modified in the most favored codons by the host cell organism. In additional preferred embodiments, at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% of the codons of the wild nucleic acid sequence are modified in the most favored codons by the host cell organism. In additional preferred embodiments, at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88% or 89% of the codons of the nucleic acid sequence are modified in the codons most favored by the host cell organism. In additional preferred embodiments, at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the codons of the wild nucleic acid sequence are modified in the codons most favored by the host cell organism.

In preferred embodiments, the isolated nucleic acid molecule nucleic acid molecule differs from the corresponding wild nucleotide coding sequence according to SEQ ID NO: 8 in the presence of codon optimization mutations.

"Codon optimization mutations" according to the present invention refers to synonymous mutations in the coding sequence that do not result in a change in the amino acid sequence. The use of the new phytase nucleotide sequences comprising codon optimization mutations according to the present invention has the surprising technical advantage over prior art phytase sequences that an expression improvement in a given host cell organism is possible without negatively affecting to the activity of phytase by changing the amino acid sequence, thus, the structure or function of the resulting phytase protein is preserved.

Additional preferred embodiments of the present disclosure refer to a nucleotide sequence, in which at least 5%, 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50% of the nucleotide coding sequence of wild phytase according to SEQ ID NO: 8 are modified in the codons most favored by the host cell organism. In further preferred embodiments, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58% or 59% of the codons of the wild phytase nucleotide coding sequence according to SEQ ID NO: 8 are modified in the codons most favored by the host cell organism. In further preferred embodiments, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68% or 69% of the codons of the wild phytase nucleotide coding sequence according to SEQ ID NO: 8 are modified in the codons most favored by the host cell organism. In additional preferred embodiments, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% of the codons of the wild phytase nucleotide coding sequence according to SEQ ID NO: 8 are modified in the codons most favored by the host cell organism. In additional preferred embodiments, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88% or 89% of the codons of the wild phytase nucleotide coding sequence according to SEQ ID NO: 8 are modified in the codons most favored by the host cell organism. In further preferred embodiments, at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the codons of the wild phytase nucleotide coding sequence according to SEQ ID NO: 8 they are modified in the codons most favored by the host cell organism.

In some embodiments, the isolated nucleic acid sequence comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 codon optimization mutations with respect to the host cell organism.

In other additional embodiments of the present invention; The isolated nucleic acid sequence comprises at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 codon optimization mutations with respect to the host cell organism.

In further preferred embodiments of the present invention, the isolated nucleic acid sequence comprises at least 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or 210 codon optimization mutations with respect to the host cell organism.

In the most preferred embodiments, all codons in the isolated nucleic acid sequence are codonically optimized with respect to the host cell organism.

In some embodiments, 99, 98, 97, 96, 95, 94, 93, 92, 91 and 90% of all amino acid positions use the most preferred codon of the host cell.

According to the present invention, the nucleic acid sequence has been optimized taking into account the use bias of codons in the methylotrophic yeast Pichia pastoris. In specific embodiments, such as those described further in Example 5 below, the original codons were analyzed one by one and changed to the most preferred codon for each amino acid in P. pastoris. The bias of codon use in P. pastoris was previously described in Bai et al. (Bai J., Swartz DJ, Protasevich II, Brouillette CG, Harrell PM, Hidebrandt E., Gasser B., Mattanovich D., Ward A., Chang G. and Urbatsch IL (2011) A gene optimization strategy that enhances production of fully functional P-glycoprotein in Pichia pastoris PLosOne 6: 1-15), Sinclair et al. (Sinclair G. and Choy FYM (2002) Synonymous codon usage bias and the expression of human glucocerebrosidase in the methylotrophic yeast Pichia pastoris. Protein Expression and Purification 26: 96-105) and Huang et al. (Huang H, Yang P, Luo H, Tang H, Shao N, et al. (2008) High-level expression of a truncated 1,3-1,4-beta-D-glucanase from Fibrobacter succinogenes in Pichia pastoris by optimization of codons and fermentation. Appl Microbiol Biotechnol. 78: 95-103.). The term "expression construct" or "expression cassette" may be used interchangeably herein and refers to a nucleic acid sequence capable of directing the expression of a particular nucleotide sequence in an appropriate host cell, which comprises a connected promoter. operatively to the nucleotide sequence of interest that is operatively connected to termination signals. Typically, it comprises sequences required for the proper translation of the nucleotide sequence. The coding region usually encodes a protein of interest. The expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components. The expression cassette can also be one that is present in nature but has been obtained in a recombinant form useful for heterologous expression. However, typically, the expression cassette is heterologous with respect to the host, that is, the particular DNA sequence of the expression cassette does not naturally occur in the host cell and must have been introduced into the host cell or a parent of the host. host cell through a transformation episode. The expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or an inducible promoter that initiates transcription only when the host cell is exposed to a particular external stimulus. In one embodiment, the expression vector includes an indicator gene operatively linked for expression with the nucleotide sequence encoding the polypeptide with phytase activity.

"Heterologous", as used herein, means "of a different natural origin" or represents an unnatural state. For example, if a host cell is transformed with a nucleic acid sequence derived from another organism, particularly another species, that nucleic acid sequence is heterologous with respect to that host cell and also with respect to descendants of the host cell they carry. that nucleic acid sequence. Similarly, heterologous refers to a nucleotide sequence derived from and inserted into the same type of natural original cell, but which is present in an unnatural state, e.g. ex. a different number of copies, or under the control of different regulatory elements.

"Regulatory elements" generally refer to sequences involved in conferring the expression of a nucleotide sequence. The regulatory elements commonly comprise a promoter operatively connected to the nucleotide sequence of interest and termination signals. Typically, they also encompass sequences required for proper translation of the nucleotide sequence. "Regulatory elements" suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. It is known that eukaryotic cells use promoters, polyadenylation signals and enhancers.

The term "operatively connected", as used herein, means that a nucleic acid sequence is located in a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader sequence is operatively linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operatively connected to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operatively connected to a coding sequence if it is positioned so as to facilitate translation. Generally, "operatively connected" means that the DNA sequences that are connected are contiguous, and, in the case of a secretory leader sequence, contiguous and in reading phase. Enhancers are not necessarily contiguous. The connection is made by ligation at convenient restriction sites. If these sites do not exist, synthetic oligonucleotide adapters or connectors are used according to common practice.

"Vectors are expression" or "expression plasmids" suitable for the expression of the optimized phytase gene according to the present invention in the various expression systems are completely within the skill of the art. Expression vectors suitable for expression in the Pichias lifter, by way of example, include, but are not limited to, the pPIC series of vectors. These vectors use the AOX1 promoter that is inducible with methanol. Expression plasmids may contain elements for the insertion of foreign DNA into the yeast genome and a signaling sequence for expressed protein secretion.

The optimized phytase protein according to the present invention can be expressed in any suitable host cell protein expression system. Commonly used protein expression systems include those derived from bacteria, yeast, baculovirus / insect and mammalian cells, and filamentous fungi such as the commercially important Myceliophthora thermophile fungus . Suitable bacterial systems include, but are not limited to, Escherichia coli, Corynebacterium or Pseudomonas fluorescens. Eukaryotic expression systems include yeast systems such as Saccharomyces cerevisiae, Pichia Pastoris or Kluyveromyces lactis. The present invention also contemplates the use of other fungal expression systems such as filamentous fungi such as Aspergillus, Trichoderma and Myceliophthora thermophila, C1, recently described for the production of various industrial enzymes. Additional eukaryotic expression systems include a baculovirus infected cell, for example, infected insect cells such as Sf9, Sf21, High Five strains or mammalian cells such as HeLa and HEK 293, which also allows the expression of glycosylated proteins that do not can be expressed using yeast or prokaryotic cells (such as E. coli). It is a very useful system for the expression of proteins with high quality. Additional suitable eukaryotic expression systems also include the expression of non-lytic insect cells as an alternative to the lithic baculoviral expression system, the Leishmania tarentolae (non-pathogenic strain) protozoan expression system, as well as plant systems (eg tobacco ) and mammalian systems such as Bos primigenius (bovine), Mus musculus (mouse), Chinese hamster ovary, human embryonic kidney cells and hamster breeding kidney.

In a further preferred embodiment, the fungal cell is Pichia Pastoris (see Cregg JM, Cereghino JL, Shi J, Higgins DR (September 2000). "Recombinant protein expression in Pichia pastoris". Mol. Biotechnol. 16 (1): 23 52). Pichia pastoris strains suitable for protein expression as described herein include GS 115, X33 or KH71H (Invitrogen, 1600 Faraday Avenue, Carlsbad, California, 92008, U.S.A.). In a preferred embodiment, the strain of Pichia pastoris is KH71H.

For the expression of the new phytase nucleotide nucleic acid molecule of the present invention, the gene is cloned into a suitable expression vector comprising said nucleic acid molecule or the expression construct as described herein in the examples.

The present invention relates to a method for producing a protein that has the enzymatic activity of a phytase comprising the steps of:

a) introducing into an host cell the expression vector comprising:

i) elements that regulate expression that are functional in the host cell; Y

ii) operatively connected thereto a nucleic acid molecule as defined herein;

b) culturing the host cells obtained in step a) under conditions suitable for protein expression, and optionally

c) recover the protein produced in stage b) from the cell culture.

The introduction stage of the expression vector is commonly known as "transformation," which is defined as the genetic alteration of a cell resulting from the direct uptake and incorporation of exogenous genetic material (exogenous DNA) from its surroundings and taken through the membrane or cell membranes. Methods for transforming a given host cell with the expression vector or expression construct as well as the optimal conditions generally depend on the host cell and are within the skill of the art. According to this, the expert is fully aware of the specific conditions for inducing expression in the host cell and culturing the host cell in an appropriate medium.

The terms "recover" and "purify" may be used interchangeably herein and refer to the separation of the expressed polypeptide culture to obtain a pure or substantially pure amount of the polypeptide, that is, separated from other proteins and / or lipids and / or nucleic acids and / or components of the host cell in the culture. Within the meaning of the present invention, said recovery step comprises i) separating the secreted protein from the medium and / or i) separating the protein from the host cell.

The optimized phytase protein of the present invention is expressed in the yeast Pichia pastoris. The production of recombinant protein in Pichia pastoris yeast has several advantages over other eukaryotic and prokaryotic expression systems, namely: rapid growth rate, high cell density fermentation, productivity in an almost protein-free medium; elimination of contamination by endotoxins and bacteriophages, various post-translational modifications that include folding, glycosylation, methylation, acylation, proteolytic adjustment and orientation to subcellular compartments of the polypeptide; and easy purification of the growth medium.

Most P. pastoris expression systems are based on the methanol-induced alcohol oxidase (AOX1) promoter (see Romans, MA, Scorer, CA, & Clare, JJ (1992). Yeast, 8, 423-488 .) By inducing by methanol, the total soluble protein fraction that is composed of alcohol oxidase can typically amount to up to 30%. Commonly used P. pastoris expression vectors comprise the following elements: (1) 5'-AOX1 (the alcohol oxidase promoter upstream of the gene of interest); (2) GIS (a secretion signaling sequence); (3) MCS (a multiple cloning site); (4) TT (a transcription termination site); (5) HIS4 (a marker for selection by hydroxyhistidinase); (6) Ampr (for selection with ampicillin); and (7) ColB1 (an element of replication for plasmid propagation in E. coli) (see Li, PZ, Gao, X.-G., Arellano, RO, & Renugopalakrishnan, V. (2001). Protein Expression and Purification , 22, 369-380.)

Additional commercially available vector systems for the expression P. pastoris include the pPICZa A, B and C vectors (Pichia Expression Kit K1710-01 or EasySelect ™ Pichia Expression Kit No. K1740-01 purchased from Invitrogen), which are based on the selection of the recombinant protein with Zeocin®.

In a further aspect the present disclosure relates to protein obtained by the method according to the invention. The methodology described herein results in the production of an odoriferous Serratia phytase protein codonically optimized according to the polypeptide sequence of SEQ ID NO: 2. The gene product expressed from the designed and optimized Serratia odoriferous gene corresponds to the mature protein that it lacks the first 26 amino acids, that is after the cleavage of the signaling peptide in the cell, which has a weight Molecular of about 45 to 46 kD as can be seen in the SDS gel in Fig. 1, which shows that at the same expression conditions and at the same sample load, the optimal expression level of the AppAs-r gene is substantially higher than that of the AppAs-r gene.

As evidenced by Example 5 and Figures 7 and 8, it was surprisingly found that the use of the codonically optimized sequence SEQ ID NO: 1 resulted in an improved expression compared to the expression of the corresponding wild phytase sequence according to SEQ ID NO: 2 or SEQ ID NO: 8. In this context, Example 5 demonstrates that the expression of the corresponding wild phytase sequence does not exceed 143 units / l (U / l) while the optimal phytase can be expressed up to amount of up to 29973 units / l. Example 5 demonstrates that mutations made in the optimal sequence, which takes into account the use of codons in the respective Pichia Pastoris yeast host cell , contributed substantially to an increased and effective protein expression, in which the amount of the expressed protein and the speed of expression. Hence, the expression of the optimized odoriferous Serratia phytase sequence resulted in a substantially improved protein expression.

In specific preferred embodiments, expression of the isolated nucleic acid sequence is carried out in an P. pastoris expression system as described herein.

In other additional embodiments of the present invention, protein expression is carried out using a methanolic expression system as described exemplary herein in Example 1 or 5 and phytase activity was measured in U / l using the method. of molybdate-vanadate in acidic medium (ISO 300024: 2009 (E)) as described in Example 3.

In preferred embodiments, the method according to the invention results in an improved expression, wherein the protein has a phytase activity of at least 250, 500, 750 or at least 1000 U / l as determined by the methods described herein.

In preferred embodiments, the method according to the invention results in an improved expression, where the protein has a phytase activity of at least 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000 , 7500, 8000, 8500, 9000, 9500 or at least 10,000 U / l as determined by the methods described herein. In other further preferred embodiments, the method according to the invention results in an improved expression, wherein the protein has a phytase activity of at least 11,000, 12,000, 13,000, 14,000, 15,000, 16,000, 17,000, 18,000, 19,000 or at least 20,000 U / l as determined with the methods described herein.

On the other hand, the optimized odoriferous Serratia phytase sequence was analyzed with respect to the temperature-dependent phytase activity, pH, the presence of proteases and the maintenance of active phytase over time in Example 3. Surprisingly, the results of Example 3 showed that the codonically optimized odoriferous Serratia phytase protein obtained by the method according to the present invention resulted in a specifically stable protein with enhanced phytase activity.

The use of the protein produced by the method described herein for the manufacture of feed additives is disclosed herein.

The optimized phytase protein expressed by the methods described herein has the following characteristics:

a) Molecular weight of about 45 to 47 kDa, preferably about 46 kDa;

b) pH optimum between 2.0 and 9, preferably between 2.5 and 8, even more preferably between 3.0 and 7, and most preferably 3.3 and 5.8.

c) the enzymatic activity is between 40 and 55 ° C, preferably at 50 ° C;

d) high specific activity at more than 500 U / mg, preferably more than 600, 700, 800, 900 or 1000 U / mg, more preferably at about 1120 / - 150 U / mg

e) high protease resistance, preferably pepsin and trypsin resistance

f) isoelectric point at 9.3.

In yet another aspect, the present invention relates to feed additives comprising the protein described herein or comprising the protein produced by the method described herein. The additive is It can properly prepare on solid or liquid basis. The additives may further comprise other enzyme preparations commonly used for solid or liquid additive preparations, or commonly used in feed preparation. Feed additives may comprise an effective amount of phytase sufficient for the assimilation and enzymatic release of free phosphorus from phytate.

Examples

Example 1: Expression in Pichia pastoris

1. Construction of the expression vector.

The following oligonucleotides were used to isolate the mature protein coding area:

SerrF: GCGCGC GAATTC GAGCCGCGCTACGTATTGG (SEQ ID NO: 6)

SerrR: GCGCG CAAGCTT GTCTAGACGTGGCCGGTACTGCACCG (SEQ ID NO: 7)

The mature protein coding area was amplified using the SerrF and SerrR oligonucleotides. The amplification product was visualized on an agarose gel, the band of the expected size was cut and the DNA was extracted from the gel using the NucleoSpin Extract II Kit (Macherey-Nagel).

The purified DNA was inserted into the pPICZa A vector (Invitrogen, San Diego, Calif.) Through the EcoRI and Xbal restriction sites generated by the oligonucleotides. The EcoRI restriction site in SerrF and the Xbal restriction site in SerrR is highlighted in bold. The construct with the purified DNA inserted was transformed into DH5a cells, which were subsequently seeded in LB medium containing 25 pg / ml Zeocin. Positive colonies were collected and the vectors obtained were sequenced. The positive clone with the correct sequence was grown in large quantities in order to obtain DNA for the transformation of yeasts.

2. Yeast transformation and protein expression

The strain of Pichia pastoris KH71H (Invitrogen) was grown on YPD medium and prepared for transformation. 10 pg of pPICZa A AppAs-r plasmid was linearized by Pmel restriction enzyme and introduced into yeast cells by lithium / polyethylene shock.

The transformed yeast cells were seeded on YPDZ medium containing 100 pg / ml Zeocin, which allowed the selection of colonies that have integrated the Shble gene (product that confers resistance to Zeocin) in the host chromosomal DNA. Only the transformants, which had the Shble gene integrated, were able to grow on the YPDZ medium. After two days, the transformants were inoculated and cultured on minimal medium containing glycerol (BMGY) for 24 hours and then the yeasts were collected by centrifugation (2,500 g, 3 min) and resuspended in a medium with 0, methanol. 5% (BMMY) for the induction of phytase gene expression.

3. Quantification of the phytase activity of the transformants

A total of 61 transformants were analyzed and quantified with respect to phytase activity using the molybdate-vanadate method in acid medium (ISO 300024: 2009 (E)).

1,160 pl of substrate solution (5 mM sodium phytate in 250 mM sodium acetate buffer, pH 5.5) was added to 40 pl of diluted enzyme solution. The reaction was carried out at 37 ° C for 30 minutes. Subsequently, 800 pl of stop solution (14% nitric acid; 3.3% ammonium heptamolybdate tetrahydrate, 0.078% vanadate) was added to the solution to end the reaction. As a control, stop solution was added to the diluted enzyme solution for inactivation, which was then added to the substrate solution. After 10 minutes, the intensity of the yellow color was quantified at 415 nm and the activity of the enzyme solution and the respective control solution were quantified. A unit of phytase is defined as the amount of enzyme that releases 1 pmol of phosphorus per minute. Two days after induction with methanol, 6 of 61 transformants produced between 10 and 55 U / ml in culture medium. The gene obtained is a new gene that encodes a polypeptide with phytase activity. The polypeptide with phytase activity was called AppAs-r.

Example 2: Purification of AppAs-r polypeptide expressed in Pichia pastoris

In order to purify the phytase produced in Pichia pastoris , transformants with an activity of 55 U / ml were grown and induced under optimal conditions. Four days after induction with methanol, phytase activity was measured using the same method as in the previous examples resulting in a supernatant activity of 163 U / l. The supernatant was obtained by centrifugation at 14,100 g for 5 minutes. The precipitated cells were discarded.

The supernatant was reached through centrifugation with VIVASPIN 20 (50,000 MWCO (Sartorius Studium)). The concentrated solution was subsequently dialyzed in a sodium acetate buffer (0.25 M, pH 5.5). Finally, phytase was purified using gel filtration (Sephacryl S-200) with the same buffer that was used for dialysis.

Example 3: Characterization of the optimal AppAs-r expressed in Pichia pastoris

1. Determination of molecular weight

The optimal AppAs-r phytase molecular weight was characterized using denaturing acrylamide gel (SDS-PAGE). Figure 1 shows the result of the SDS-PAGE:

1) the first lane corresponds to the control (culture medium without induction with methanol),

2) the second lane corresponds to the expression in AppAs-r phytase methanol culture medium,

3) the third lane corresponds to the expression in culture medium with optimal AppAs-r phytase methanol and

4) the fourth lane corresponds to the molecular weight marker.

The same sample volume was loaded on lanes 1, 2 and 3.

As can be seen from Figure 1, the optimal AppAs-r molecular weight is about 46 KDa, which corresponds to the estimated molecular weight of the polypeptide sequence derived from the cloned DNA sequence. It can also be observed from SDS-gel that at the same expression conditions and at the same sample load the expression level of the optimal AppAs-r gene is substantially higher than that of the AppAs-r gene. 2. Determination of the optimal enzymatic activity of AppAs-r depending on the temperature

As can be seen in Figure 2, the enzymatic activity changes with temperature. The optimum temperature was determined at pH 5.5, which is the pH that was required by ISO 300024: 2009 (E). The activity was tested within the temperature range between 35 ° C and 85 ° C. The maximum activity was measured at 50 ° C. As shown in Figure 2, after 10 minutes at 60 ° C, the enzyme still retains 40% of its activity.

3. Determination of the optimal enzymatic activity of AppAs-r depending on the pH.

The effect of pH on phytase activity was tested using the following buffers: glycine-HCI for pH 1.5-3.5; sodium acetate for pH 3.5-6.0; Tris-HCI for pH 6.0-8.5; glycine-NaOH for pH 8.5-10.0. All buffers contained 0.05% IGPAL.

As can be seen in Figure 3, the enzymatic activity changes with the pH. The maximum activity was observed at pH 5.0. A 70% activity is still maintained at pH 4.0, while more than 80% activity is maintained at pH 5.5.

4. Effect of proteases on enzymatic activity

In order to determine the protease resistance, purified optimal AppAs-r (1.6 mg / ml) was incubated with 5 mg / ml pepsin or 50 mg / ml trypsin at 37 ° C. After incubation at different incubation times (5; 10; 15; 30 and 60 minutes) the remaining phytase activity was quantified in the sample. As can be seen in Figure 4, one hour after incubation with pepsin, AppAs-r phytase retained more than 70% (73%) of its initial activity and more than 90% (95%) of its initial activity one hour. after incubation with trypsin. This indicates that the phytase tested is very resistant to protease activity, which can be very beneficial for use in feed.

5. Maintenance of phytase activity over time

To determine the activity of the AppAs-r phytase over time, the specific activity per minute was determined at different time points after the substrate was added. How can it be derived from Figure 5, AppAs-r differs from most phytases in that it increases its specific activity over time. AppAs-r is still at least 8 hours after the substrate is added, and doubles its initial specific activity after 4 1/2 hours of activity (Figure 5). This increased and sustained activity over time has not been described for any other. This is a very important element because the digestion of animals usually takes more than 30 minutes so that the enzyme is required to remain active as much as possible. Increased activity sustained over time may also be important with respect to liquid feeds. Thus, this allows the release of most of the phosphorus present in the form of phytate in the feed by using a smaller amount of it.

6. Determination of the specific activity

In order to determine the specific activity, the concentration of AppAs-r phytase was measured using the Lowry method and the specific activity was evaluated by molybdate-vanadate in acid at 37 ° C and pH 4.75. The specific activity resulting from purified AppAs-r was 1,123 ± 112 U / mg.

Example 4: Phosphate release of organic material from soil

Due to the prolonged activity of phytase it was important to determine its ability to release inorganic phosphorus from organic material in the soil. The result of this test was considered useful for the preparation of a fertilizer additive. For this test, 5 soil samples were collected. 2.5 g of each sample were weighed and resuspended in an acetate buffer, and a final concentration of 0.25 g of sample / ml was calculated and adjusted. The samples were incubated for 20 minutes under stirring at room temperature. After a 1/10 dilution of the samples with acetate buffer, the equivalent of 1 U of AppAs-r / 100 g of soil was added to 1.2 ml of each sample and incubated for 24 hours at 25 ° C . The results show that the phosphorus release was 53.6 ± 27.8 mg of phosphorus / 100 g of soil, thus free soil phosphate was increased by 23.4 ± 18.1%.

Example 5: Comparative expression of the wild phytase gene and a modified phytase gene (optimal phytase)

The inventors of the present invention observed that expression of the full-length odoriferous Serratia wild-type phytase gene as shown in Fig. 6A (SEQ ID NO: 2) that includes the 26 AA signaling peptide leads to a unstable protein that quickly disappeared after expression. Therefore, the inventors of the present invention observed that omission of the 26 AA signaling peptide (SEQ ID NO: 8) resulted in enhanced expression (see Example 1).

Starting from this observation, the pPICZa vector containing the nucleotide sequence encoding the wild odoriferous Serratia phytase described in Example 1 was further evaluated as to how the nucleotide sequence can be further modified for improved expression of the phytase protein in the host cell.

In order to obtain an improved AppAs-r sequence, the original codons were analyzed one by one and changed to the most preferred codon for each amino acid in P. pastoris. The bias of codon usage in P. pastoris was previously described in Bai et al. (Bai J., Swartz DJ, Protasevich II, Brouillette CG, Harrell PM, Hidebrandt E., Gasser B., Mattanovich D., Ward A., Chang G. and Urbatsch IL (2011) A gene optimization strategy that enhances production of fully functional P-glycoprotein in Pichia pastoris PLosOne 6: 1-15), Sinclair et al. (Sinclair G. and Choy FYM (2002) Synonymous codon usage bias and the expression of human glucocerebrosidase in the methylotrophic yeast Pichia pastoris. Protein Expression and Purification 26: 96-105) and Huang et al. (Huang H, Yang P, Luo H, Tang H, Shao N, et al. (2008) High-level expression of a truncated 1,3-1,4-beta-D-glucanase from Fibrobacter succinogenes in Pichia pastoris by optimization of codons and fermentation Appl Microbiol Biotechnol.

78: 95-103.).

In SEQ ID NO: 1, the most frequent codon use in P. pastoris was analyzed, identified and applied . In SEQ ID NO: 1, the 211 codons of the wild coding sequence have been optimized without the sequence encoding the N-terminal signaling peptide sequence (SEQ ID NO: 8). The evaluation that the frequency of codon use described in the literature was preserved to some extent in some P. pastoris genes that encode proteins with catalytic activity such as phosphatases and kinases.

The modified phytase polynucleotide comprising the optimized codon shown by SEQ ID NO: 1 was obtained by gene synthesis. The modified phytase polynucleotide was purchased by GenScript Company (Spain) and was inserted into the pPICZa A vector (Invitrogen, San Diego, Calif.) Through the restriction sites of EcoRI and Xbal.

The resulting plasmid containing the AppAs-rOp gene was linearized by digestion with the restriction enzyme Pmel and transformed into the yeast cells by lithium / polyethylene shock as in Example 1.

The gene product expressed from the designed and optimized Serratia odoriferous gene corresponds to the mature protein that lacks the first 26 amino acids, that is, after cleavage of the signaling peptide in the cell, which has a molecular weight of about 45 to 46 kD as can be seen in the SDS gel in Fig. 1.

Starting from the pPICZa vector containing the nucleotide sequence encoding the wild odoriferous Serratia phytase described in Example 1, the inventors of the present invention evaluated and tested point mutations in this nucleotide sequence that could lead to improved expression of the phytase protein in the host cell. It was observed that the 211 point mutations presented in Figure 6B (SEQ ID NO: 1) compared to the wild phytase sequence (SEQ ID NO: 2) contributed to an effective and stable expression in the yeast Pichia pastoris. Fig. 6C shows a sequence alignment of the optimal phytase sequence (SEQ ID NO: 1) and the wild phytase sequence (SEQ ID NO: 2). The mismatches indicate the point mutations made in the original gene sequence. Point mutations take the codons preferably used in the yeast of host cells Pichia pastoris. As can be seen from Fig. 6D, which shows an alignment of the mature protein translated from SEQ ID NO: 1 and SEQ ID NO: 2, the 211 mutations are synonymous, i.e. none of the mutations led to an amino acid different in the phytase polypeptide.

In order to determine if the mutations made in SEQ ID NO: 1 have an effect on yeast protein expression, the modified nucleotide sequence was expressed under the same conditions as in Example 1. In order to determine the expression profiles, Samples were taken at time points 0, 19, 31, 43, 55, 67, 79 and 91 hours after methanol expression. Phytase activity was measured using the molybdate-vanadate method in acidic medium (ISO 300024: 2009 (E)) as described in Example 3. AppAs-r of Example 3 was used as a comparative example.

The results are summarized in Table 1. The data in this comparative example are logarithmically expressed in the graph according to Figure 7, which shows the activity expressed in units / l versus time (h).

In Figure 7, the expression profile of the wild AppsAS-r phytase (comparative example) is shown in blue (filled rhombus) and the expression profile of the optimal sequence is shown in red (filled squares). As can be seen from the graph, the expression of the wild phytase gene is not optimal. The first measurable products appear after 40 hours of induction. After 91 hours, the saturation curve shows a maximum activity of 143 U / l. Surprisingly, the expression of the modified phytase gene sequence (optimal sequence) shows a phytase gene product immediately measurable in the first hours of protein expression, which reaches saturation after about 20 to 30 hours of induction of expression. gene. After 90 hours, phytase production was greater than 200 times. This increase in production was unexpected.

Example 5 thus demonstrates that mutations made in the optimal sequence, which takes into account the use of codons in the respective Pichia Pastoris yeast host cell , did indeed contribute to an increased and effective protein expression.

Table 1: Wild phytase expression profile compared to optimal phytase

Claims (13)

1. An isolated nucleic acid molecule i) comprising the nucleotide sequence according to SEQ ID NO: 1 encoding a protein with phytase activity or ii) having a sequence identity of at least 86% with a nucleotide sequence according to SEQ ID NO: 1 encoding a protein with phytase activity, wherein the isolated nucleic acid molecule comprises codon optimization mutations with respect to a host cell organism, where the host cell organism is Pichia pastoris , and wherein the nucleic acid molecule differs from the corresponding wild nucleotide coding sequence according to SEQ ID NO: 8 in the presence of at least 50 codon optimization mutations. 2. The isolated nucleic acid molecule according to claim 1, wherein the nucleic acid molecule does not comprise a nucleotide sequence encoding an N-terminal signaling peptide. 3. The isolated nucleic acid molecule according to any of the preceding claims, wherein at least 50% of the codons of the corresponding wild nucleic acid sequence are modified in the codons most favored by the host cell organism. 4. The isolated nucleic acid molecule according to any of the preceding claims, wherein all the codons of the isolated nucleic acid molecule are modified in the codons most favored by the host cell organism. 5. The isolated nucleic acid molecule according to any of the preceding claims, which encodes the amino acid sequence of the phytase activity protein according to SEQ ID NO: 3. 6. An expression construct comprising the nucleic acid sequence according to any one of claims 1 to 5 operatively connected to elements that regulate the expression of the nucleic acid sequence in a host cell, wherein the host cell organism is Pichia pastoris. 7. The expression construct according to claim 6, wherein the elements that regulate the expression comprise a functional promoter in the host cell and optionally a termination sequence. 8. A vector comprising the nucleic acid molecule according to claim 1 to 5 or the expression construct according to any of claims 6 to 7. 9. A method of producing a protein that has the enzymatic activity of a phytase comprising the steps of: a) introducing into a host cell a vector comprising: i) elements that regulate expression that are functional in the host cell; Y ii) operatively connected thereto a nucleic acid molecule as defined in any one of claims 1 to 5; b) culturing the host cells obtained in step a) under conditions suitable for protein expression, and optionally c) recover the protein produced in stage b) from the cell culture, where the host cell organism is Pichia pastoris. 10. The method according to claim 9, wherein the elements that regulate the expression comprise a functional promoter in the host cell and optionally a termination sequence. 11. The method according to claim 9 or 10, wherein the expression of the protein is carried out using a methanolic expression system. 12. The method according to any of claims 9 to 11, wherein the protein recovered in step c) has a phytase activity of at least 1000 units / l. 13. The method according to any of claims 9 to 12, wherein the recovery step comprises a) separating the secreted protein from the medium and / or b) separating the protein from the host cell.