ES2683921B1 - Method for determining the prognosis in subjects diagnosed with pulmonary arterial hypertension - Google Patents

Description

D E S C R I P C I O N

METHOD FOR THE DETERMINATION OF THE FORECAST IN SUBJECTS

DATAGNOSTICATED WITH PULMONARY ARTERIAL HYPERTENSION

TECHNICAL SECTOR

The present invention is related to a method that allows prediction of the prognosis in subjects diagnosed with pulmonary arterial hypertension and, also, with a method to select a personalized therapy for the subjects affected by this disease, carriers of mutations in the BMPR2, ACVRL1 genes. and ENG, involved in the pathology.

BACKGROUND OF THE INVENTION

Pulmonary Arterial Hypertension is a rare disease and is defined as an abnormally high pressure in the pulmonary arteries with normal postcapillary pressure. This increase in pressure is due to the narrowing or tamponade suffered in the small arteries and pulmonary capillaries, creating an increase in resistance to the flow of blood that flows through them. The progressive increase in pulmonary vascular resistance (PVR) that is created can lead to failure of the right cardiac ventricle and even to premature death.

The mean normal pressure of the pulmonary artery is approximately 14 mmHg at rest. However, in patients with PAH, the mean arterial pressure in the pulmonary artery is equal to or greater than 25 mmHg at rest. It is known that an increase in resistance causes an increase in the tension of the right ventricle, having to exert more work in each beat so that the blood can be moved to the lungs. This eventually leads to right heart failure when ventricular hypertrophy gives way to dilatation and retrograde increase in systemic venous pressure. Although there are more and more therapeutic options against Pulmonary Arterial Hypertension, the prognosis continues to be bad.

Only 6% of patients with pulmonary hypertension refer family history according to the data of the National Institute of Health. This is possibly due to the fact that familial pulmonary hypertension is inherited as a dominant autosomal disease with incomplete penetrance. Therefore, a family history of Pulmonary Arterial Hypertension can go unnoticed in cases of idiopathic pulmonary arterial hypertension as a consequence of this incomplete penetrance or due to the appearance of de novo mutations .

There are several types of pulmonary hypertension that are classified into 5 groups: PAH which in turn can be idiopathic, hereditary (associated with the Type II receptor of bone morphogenetic proteins (BMPR2) with autosomal dominant transmission with incomplete penetrance and, to a lesser extent, Activin Kinase Type I (activin-like kinase-type I, ALK-1), Endoglin or unknown genes), or associated (exposure to drugs or other diseases), in relation to heart diseases left; associated with pulmonary diseases or chronic hypoxia; chronic thromboembolic pulmonary hypertension; multifactorial pulmonary hypertension. Hereditary PAH and idiopathic PAH present a similar clinical course, although the former has a younger age of onset and a somewhat more severe hemodynamic deterioration, although both present a similar survival.

To date, about five hundred mutations have been described that affect the genes involved in pulmonary arterial hypertension, using different molecular methodologies. In approximately 70% of patients with familial involvement, mutation has been detected in the BMPR2 gene, however, in patients with no family history of the pathology, the detection rate varies between the different works from 10% to 40%. For the ACVRL1 and ENG genes, the percentage of mutations found is lower.

Of all the changes detected in these genes, most of them are located in the coding region. These nucleotide changes can affect the amino acid sequence ( missense ), produce a stop codon ( nonsense) or be silent. These changes can produce variations in the structure or expression of the protein. Also, another part of the changes are located in the promoter region of these genes. These changes do not affect the sequence of amino acids directly but if the structure or expression of the protein and could modify binding sites to transcription factors of the gene, preventing their union.

To date, with respect to Pulmonary Arterial Hypertension, no functional studies have been done for the mutations found in the coding region of the genes and these changes may have a significant implication in the pathogenesis. These analyzes allow a genotype / phenotype correlation, opening a wide range of possibilities. These changes produce a more severe phenotype in carrier patients.

The evolution of these patients is highly variable and depends both on factors of the disease itself, as well as on the environment and the individual's own genetic burden. In this way, knowing these data, a personalized treatment can be administered to each patient.

Although the influence of certain markers on the evolution of patients affected with pulmonary arterial hypertension is known, there is no analysis algorithm that allows to give a specific weight to each genetic marker in the determination of the progression of the disease. In addition, since the genetic load presents an important implication in the pathology, there is no mechanism to evaluate the clinical and genetic conditions of a patient with respect to the treatment administered.

EXPLANATION OF THE INVENTION

The authors of the present invention have developed a method to determine the prognosis of a patient with pulmonary arterial hypertension. This method is based on the combination of particular genetic profiles associated with the development of PAH. These genetic profiles are determined from the results obtained from the mutational analysis of certain genes associated with the development of the disease and whose main objective is its use in the evaluation of the prognosis of patients with PAH and to select a personalized therapy for the affected subjects. for this disease.

1. First method of the invention:

In a first aspect, the present invention relates to an in vitro method for determining the prognosis in subjects diagnosed with Arterial Pulmonary Hypertension comprising the determination of the pathogenic mutations of the BMPR2 , ACVRL1 and ENG genes , wherein an increase of said mutations is indicative of a severe prognosis of Pulmonary Arterial Hypertension.

Therefore, in one aspect, the invention relates to an in vitro method to predict whether a subject diagnosed with Pulmonary Arterial Hypertension is going to present a smoother or more severe phenotype, and therefore a better or worse prognosis, which comprises:

i) determine the genomic profile of patients diagnosed with pulmonary arterial hypertension, sequencing the genes BMPR2, ACVRL1 and ENG, associated with the disease, and obtain the corresponding genic profile of a biological sample from a subject with pulmonary arterial hypertension;

ii) in vitro analysis of the genetic profile by luciferase assays and hybrid minigenes, in order to identify pathogenic mutations of the genetic variants identified in the genes BMPR2, ACVRL1 and ENG determined in step

⁽ 0 -

The term "subject", as used in the present description, refers to human beings, female or male, and of any race or age. Throughout the present description, the terms "subject" and "patient" are used interchangeably.

The term "milder phenotype" or "severe mbs phenotype", as used in the present invention, as well as the term "severe pronostic", refers to the evolution of the disease.Patients with a "more severe phenotype" or a severe disease "develops the symptoms of the disease earlier than patients with a" mild mbs phenotype. "Likewise, a patient with pulmonary arterial hypertension is considered to be a patient with a serious history of pulmonary arterial hypertension when it presents an early diagnosis age. , higher mbs values for the pulmonary arterial pressure, for the mean pulmonary arterial pressure and for the pulmonary vascular resistance, presents lower values for the cardiac index, it does not diminish at least one functional rate, after the diagnosis, with the administration of the treatment and does not respond correctly to the administered treatment.

The term "disease" as used in the present invention refers to the condition of a subject having been diagnosed with Pulmonary Arterial Hypertensib.

1.1. Determination of the genetic profile:

The step (i) of the first method of the invention consists of determining the genetic profile of the main genes related to the disease of a subject diagnosed with Pulmonary Arterial Hypertension and obtaining the corresponding genetic profile.

The term "genetic variant", as used in this description, includes mutations, polymorphisms and allelic variants.A genetic variant is found between individuals within populations and between populations within species.

In a particular embodiment, the genetic variants used in the present invention are human gonomic variants associated with the evolution of Pulmonary Arterial Hypertension present in one or more genes in a sample of a subject diagnosed with Pulmonary Arterial Hypertensing. Human genetic variants associated with the evolution of patients with pulmonary arterial hypertension that have been related to the fastest progression of the disease are found in the genes BMPR2, ACVRL1 and ENG,

The TGF-P family (transforming growth factor beta) belongs to a superfamily of growth factors that includes three isoforms for TGF-P (TGF-pi, TGF-P2, TGF-P3) and other varied factors, such as the morphogenic bone protein. (BMP), activins, inhibins and the antimulleriana hormone. They are involved in cellular processes such as hematopoiesis, cell proliferation, angiogenesis, differentiation, migration and cellular apoptosis, which is fundamental during embryogenesis and development.

The main genes related to the pathology belong to the TGF-p family, whose functions are detailed below:

- BMPR2 (Bone morphogenetic protein receptor type II gene): When there is a modification in the BMPR2 gene , the patient is predisposed to vasoconstriction and vascular remodeling. A mutation in the BMPR2 gene is considered the first event to trigger the Puimonar arterial hypertension; however, the mutations in this gene are not entirely penetrating and therefore require a second event, originated from the activation of genetic modifiers and / or environmental mediation, so that vascular remodeling can take place, with the consequent development of anatomopathological lesions typical in pathology.

- ACVRL1 (Activin-like kinase-type I): It belongs to the TGF-p superfamily group and shows an expression pattern highly restricted to endothelial celluias and highly vascularized tissues, such as the placenta and the lung. It is a homodimeric transmembrane protein of the ceiular surface and, at first, was called TSR-I.

- ENG (Endoglin): It presents a high level of expression in the proliferation of vascular endothelial cells where angiogenesis is active, during embryogenesis, in inflammatory processes, in vascular lesions and in tumor vessels. It has been identified as an accessory receptor for type III TGF-P {TpR-III) that only binds to ligands when associated with TpR-ll. It has been observed that endoglin is necessary for the signaling of TGF-p / ALK1. Furthermore, in the absence of endoglin, the endothelial cells do not grow and the signaling of ALK1 is suppressed while the ALK5 pathway is stimulated. In contrast, overexpression of endoglin downregulates the signaling of TGF-p / ALK5 by inhibiting the transcriptional activity of Smad3. The endoglin could so! serve as a regulator of the growth of CDs mediated by TGF-p by stimulating the signaling of TGF-p / ALKI and indirectly inhibiting TGF-P / ALK5, promoting the activation phase of angiogenesis.

In order to determine the genetic profile of the subjects, in the main genes related to Puimonar Arterial Hypertensing, by means of the method of the invention, in a first stage the nucleic acid of a biological sample of the subject to be analyzed is extracted.

The extraction of nucleic acid (DNA) from a biological sample from a subject can be carried out by conventional methods using commercially useful products to extract said DNA. Virtually any biological sample containing DNA can be used to make the practical implementation of the invention; by way of illustration, not limitative, said biological sample can be a sample of biopsy, tissues, cells or fluids, for example blood, saliva, plasma, serum, secretions, milk, etc. In a particular embodiment, said biological sample is blood. It is a preferred embodiment, said biological sample is a peripheral blood sample.

Once the DNA is obtained, those regions of said DNA containing the genetic variants to be identified are amplified. As previously mentioned, the thermal "genetic variant", as used in this description, includes polymorphisms (eg, SNPs), mutations and allelic variants.To amplify the regions of DNA containing the genetic variations to be identified, oligonucleotides specific primers that amplify the fragments of the genome that may contain said gonic variants, said specific oligonucleotides primers are described in detail below.

Thus, the DNA regions containing the genic variants to be identified (target DNA regions) are subjected to an amplification reaction to obtain the amplification products containing the genic variants to be identified. Although any technique or method allowing the amplification of all DNA sequences containing the genetic variants to be identified can be performed, in a particular embodiment, said sequences are amplified by a polymerase chain amplification (PCR) reaction.

For the determination by PCR of the genomic variants of the method of the invention, the use of specific oligonucleotide pairs or primers capable of amplifying said target DNA regions containing the genetic variants to be identified as explained above is required. Virtually any pair of oligonucleotide primers that allows specific amplification of said target DNA regions, preferably, pairs of oligonucleotide primers that allow said amplification in e. number possible of amplification reactions. In this way, using the specific oligonucleotide pairs of primers and the appropriate conditions, all the target DNA regions necessary for the determination of the genetic profile can be amplified for said genetic variants to be analyzed with the minimum possible number of reactions. In a particular embodiment, said oligonucleotide primers are selected from the oligonucleotide primers identified in Table 1.

Table 1: Specific primers for the amplification of the exons of the BMPR2, ACVRL1 and ENG genes for the search of genetic variants.

In a preferred embodiment, exon 1A of the BMPR2 gene will be amplified by the oligonucleotide pair of sequence primers Seq ID No. 1 and Seq ID No. 2, exbn 1B will be amplified by the oligonucleotide pair of sequence primers Seq ID No. 3 and Seq. ID No. 4, exon 2 will be amplified by the pair of oligonucleotide primers of sequence Seq ID No. 5 and Seq ID No. 6 and so on with the other exons of all the genes used in this invention.

In a particular embodiment, for the determination of the genetic variants of each of the exons of the BMPR2, ACVRL1 and ENG genes , the PCR products can be obtained using different specific oligonucleotides primers.

Subsequently, the PCR products can be resolved on a 2% agarose gel and visualized with ultraviolet light, in order to be able to purify them using a different method. commercial.

Once the purification of the PCR product is carried out, the sequencing reaction is carried out by means of a commercial kit containing a mixture of the 4 90% dNTPs, a 10% mixture of dideoxyribonucleotides (ddATP, ddTTP, ddCTP and ddGTP), each labeled one with a different fluorophore, and the enzyme DNA polymerase.

Once the sequence of each exon has been completed, the purification of the product from the sequencing reaction will proceed. This purification will be necessary to eliminate the unincorporated labeled dNTPs and to obtain the maximum quality in the sequences. In a preferred embodiment, the purification reaction of the sequences is carried out with the aid of ethanol and salts.

Once the product of the sequencing reaction was purified, the purified sequences were migrated in a capillary sequencer over single strands, so it was necessary to denature the samples by subjecting them to 99 ° C for five minutes. To increase the denaturation of the samples, they are resuspended in 25 pL of maximum purity formamide. Once denatured they remain cold. During its electrophoretic migration from the coding to the anode, the fragments separated in the capillary according to their size, will go through the reading zone of the capillary, where the fluorochromes will be excited by a beam of UV light and therefore, they will to emit fluorescence at a certain wavelength. This emitted fluorescence will be captured and analyzed by a computer program. The system software contains information about the fluorochromes that are being used and provides the appropriate filters to collect the light intensities.

The reading and analysis of the sequences will be carried out with informatic programs, in the present invention the informatics program ClustalW2 (http://www.ch.embnet.org/software/ClustalW.html) that compares multiple alignments of different sequences is preferably used. and indicates the differences found between them. In this way, we can identify the genetic variants present in these fragments.

Once the genomic profile of a subject diagnosed with Pulmonary Arterial Hypertension is determined, the pathogenic character of the genetic variants will be determined. identified by in vitro studies .

1.2. Determination of the pathogenic character of the genetic variants:

The step (ii) of the first method of the invention consists of determining the pathogenic character of the genetic variants identified in the genes BMPR2 , ACVRL1 and ENG. In this way, the pathogenic mutations of the genetic variants can be differentiated by in vitro molecular characterization , which in turn will include Luciferase Assays and Hybrid Minigenes.

The term "pathogenic mutation", as used in the present description, only includes malignant mutations related to the appearance of diseases. A pathogenic mutation is found between individuals within populations and between populations within species.

Firstly, an analysis of the identified genetic variants is carried out to classify them as missense-type mutations (change-of-sense mutations), nonsense (missense mutations), sinbnimas or mutations of the 5'UTR region and, subsequently, the In vitro analysis to verify how mutations located in the 5'UTR region produce alterations in transcriptional activity and to be able to confirm which mutations affect the mechanism of splicing.

In a particular embodiment, for the study of the effect of gonic variants located in the 5'UTR region of the BMPR2 gene , ACVRL1 and ENG in the expression levels of the corresponding proteins, an in vitro study based on a gene system will be carried out. reporters that measures the luciferase activity. For the study of the effect on the RNA processing mechanism that the genetic variants identified in the exonic region of said genes could have, they were analyzed by the construction of Hybrid Minigenes.

1.2.1. Luciferase assays of the genetic variants identified in the 5'UTR region of the genes under study:

After the identification of variations in the 5'UTR region of the genes under study, amplification will be carried out by PCR of said region. In one embodiment preferred, the genomic DNA of the patients should be split and the specific oligonucleotides primers should contain the AAAAA tail, followed by the restriction target to be used, these targets allow the subsequent cloning of the fragment in the vector in the desired direction, and the sequence of 20 base pairs of the insert. The Nhel and Xhol restriction targets will be used.

Amplified the 5'UTR region of the genes, it will be cloned in the vector pGL3-Basic, since it lacks promoter and enhancer sequences of eukaryotic genes, which allows the maximum flexibility in the cloning of regulatory sequences. The pGL3-Promoter vector without cloning was used as a positive control, the pGL3-Basic vector without cloning as a negative control and the vector pRL-CMV as internal control.

Amplified the insert of the 5'UTR region, it will proceed to the digestion of the insert and the vector to produce the cohesive ends necessary for its binding with the vector. The digestion reaction will take place in a thermal cycler and according to the restriction enzymes used.

Once the digestions are finished, they are checked on a 2% agarose gel with ethidium bromide at a concentration of 10 pg / mL, loading the entire volume of the digestion. A band for the digested insert and two bands for the digested vector should be observed in the gel: a band of 4798 base pairs corresponding to the digested linear vector and a band of 20 base pairs corresponding to the fragment located between the points of Cutting of both enzymes. After digesting, the total DNA of the samples should be quantified by means of a spectrophotometer to proceed to vector-insertion binding, using the T4 DNA Ligase enzyme, and its subsequent transformation using competent E. coli JM109 cells and commercial LB culture medium. liquid with 50 pg / mL of Ampicillin.

Confirmed the transformation of the desired insert, using the primers oligonucleotides primers RVprimer3 {TGGAAGACGCCAAAAACATAAAG; Seq ID No 85) and GLprimer2 (GGGACAGCCTATTTTGCTAG; Seq ID No. 86), the fragment was sequenced, using a commercial kit, to verify that the sequence is correct and to know if, in each case, the sequence has been cloned. wild or that carrier of the mutation to study. For this purpose, a small scale plasmid DNA extraction will be carried out to verify the existence of the plasmid of interest, using a commercial kit. With this wild and mutated piasmidic DNA, COS-1 cells were transfected to perform the luciferase assay using a commercial kit and following the manufacturer's instructions.

After 24 hours of transfection, the cells were lysed and the supernatant was collected to measure the activity of Photinus luciferase and the activity of Renilla luciferase, which is used to normalize the values obtained and correct differences due to the efficiency of the Transfection Because both types of luciferase have a different evolutionary origin it is possible to measure their activities simultaneously and discriminate their activity. To do this, use the commercial kit Dual Luciferase Assay kit (Promega).

The final values will be measured by a luminometer and the real value of luciferase will be obtained by dividing the value obtained from the Photinus luciferase reaction by the value of the Renilla luciferase reaction. The test must be carried out in triplicate, in two different tests. This test will allow to verify that variations produce an alteration of the transcriptional activity of the genes under study.

In a particular embodiment, variants that produce variations greater than 10% will be classified as pathogenic.

1.2.2. Hybrid minigenes of the genetic variants identified in the exonic region of the genes under study:

After the identification of the generic variants of the missense, nonsense and sinonimas type, the in vitro analysis of said variants was analyzed to analyze which of them affect the mechanism of splicing by hybridized minigenes.

The study of the effect of mutations that presumably affect the RNA processing mechanism will be carried out through the construction of hybrid minigenes. These consist of the insertion of the fragment to be studied (comprising both the exon of interns and its flanking intronic regions) between two exons previously cloned in an expression vector of mammalian cells. Once the hybridized minigenes are obtained, they will be transfected into cells eukaryotes and the effect caused by the mutations studied in this processing will be evaluated.

As for the luciferase assays of the gene variants identified in the 5'UTR region of the genes under study, genomic DNA from the patients will be used and the specific oligonucleotides primers will be designed in the same way. To carry out the analysis of the mutations, the vector p.SPL3 Expression vector that can be used for the constitutive or transient expression in mammalian cells will be used. In the polylinker region of vector p.SPL3, between the restriction sites Xhol and Nhel, the insert of interest was cloned. This region is located between exons SD6 and SA2 of the vector.

The digestion of the insert and the vector, the binding of the construction, transformation, the extraction of plasmid DNA and the sequencing of the test were carried out, using the specific oligonucleotides primers CATGCTCCTTGGGATGTTGAT (direct, Seq ID No. 87) and ACTGTGCGTTACAATTTCTGG (reverse Seq. ID No 88). Once obtained the wild and mutated constructions, these will be transfected in COS-7 cells using a commercial kit. After 48 hours after cellular transfection, RNA extraction of the transfected cells was carried out using a commercial kit.

After RNA extraction, the synthesis of the complementary DNA strands was carried out using RNA, using a concentration of 1000 ng of RNA, to obtain the same concentration of DNA complementary to all mutants and wild-type constructions. After obtaining the cDNA a PCR was performed, with the specific primers oligonucleotides TCTGAGTCACCTGGACAACC (direct, Seq ID No. 89) and ATCTCAGTGGTATTTGTGAGC (reversed, Seq ID No. 90), and Phusion High-Fidelity DNA Polymerase was used.

The PCR product will be analyzed on a 1.5% agarose gel and ethidium bromide, tai and as described above. Each of the obtained bands must be purified separately with a commercial DNA purification kit. Finally, the purified PCR product was sequenced and analyzed.

In a particular embodiment, those variants that affect the mechanism of splicing they will be classified as splicing mutations and pathogenic mutations.

1.2.3. Analysis of the phenotype of patients:

After the genetic characterization of the patients and the molecular characterization of the genetic variants identified by in vitro analysis , it will be known which patients present a severe prognosis and which present a milder phenotype, in function of being carriers of pathogenic mutations.

Those patients carrying one or more pathogenic mutations in the same gene or in different genes of those analyzed and included in this invention, will be classified as patients presenting a worse prognosis, where an increase of said mutations is indicative of a severe prognosis of Pulmonary Arterial Hypertension.

As it has been demonstrated, it is known that patients with pathogenic mutations have an earlier age of onset of disease, altered mean values of pulmonary and systolic blood pressure, a higher value of pulmonary vascular resistance and lower value for the cardiac index than patients without pathogenic mutations in the analyzed genes.

2. Second method of the invention:

The first method of the invention described above is useful for knowing the prognosis of a subject diagnosed with Pulmonary Arterial Hypertension. According to the prognosis of the disease, the doctor could design a personalized therapy for said subject.

Therefore, in a second aspect, the present invention relates to a method for selecting a subject diagnosed with pulmonary arterial hypertension for personalized therapy, hereinafter the second method of the invention, which comprises determining whether said subject presents a severe prognosis of the patient. according to the method according to the first method of the invention, wherein said subject is selected for said therapy if it is classified as a patient at risk of developing Pulmonary Arterial Hypertensing with severe prognosis.

3. Third method of the invention:

Likewise, in a third aspect, the present invention relates to a method for selecting a personalized therapy for a subject diagnosed with Pulmonary Arterial Hypertension in need of treatment, hereinafter referred to as the third method of the invention, which comprises determining whether said subject presents a prognosis. serious according to the method according to the first method of the invention, wherein a personalized therapy for said subject is related if this is selected for said therapy if it is classified as a patient with risk of developing more severe pulmonary hypertension.

The term "therapy" or "personalized therapy" or "treatment" or "personalized treatment", as used in the present description, refers to a therapeutic treatment wherein the objective is to prevent the progression of the disease or reduce the Prognostic rate Beneficial or desirable clinical outcomes include, without limitation, a mean arterial pressure in the inferior pulmonary artery of 25 mmHg at rest and no alterations in pulmonary systolic blood pressure, pulmonary vascular resistance or cardiac index.

In a particular embodiment, the therapy is a vasodilator therapy. The therapy is decided according to the recommendations of the different European international guidelines such as: ERH (European Society of Hypertension), ERS (European Respiratory Society) or ESC (European Society of Cardiology). Vasodilator therapy includes, without limitation, all drugs marketed to date, such as sildenafil, bosentan, ambrisentan, etc. Patients with pathogenic mutations in the main genes associated with the pathology included in this invention do not respond correctly to treatment since they are treated with inhibitors of the phosphodiesterase-5 pathway, an example without limitation is Silderafil, and mutations Pathogenics affect the TGF- pathway (3) For this same reason, carriers with pathogenic mutations should be treated with a combination of drugs that affect different routes, including treatments that act on the endothelin route, the channels of calcium and on the TGF- (5.

4. Kits of the invention:

The present invention also contemplates the preparation of kits for the implementation of the methods according to the present invention.

Therefore, in a fourth aspect, the present invention relates to a kit, hereinafter, kit of the invention, which comprises the reagents necessary for genotyping the genes included in this invention associated with the Pulmonary Arterial Hypertension and the reagents necessary to be able to analyze Functionally, the identified genetic variants, using luciferase assays and hybrid minigenes, to classify them according to their pathogenicity.

Suitable kits include various reagents for use in accordance with the present invention in suitable containers and packaging materials, including tubes, vials, and cellophane and blow-molding packs.

Suitable materials for inclusion in an exemplary kit according to the present invention comprise one or more of the following: oligonucleotides specific primers for amplifying and sequencing the genes included in this invention (described in connection with the first method of the invention); reagents capable of amplifying a specific sequence of genomic DNA; reagents necessary for physically separated products derived from the various aces (for example agarose and a buffer to be used in electrophoresis); reagents necessary to be able to sequence the exons of the genes to be analyzed; reagents necessary to be able to clone the fragments of interest in the vectors included in the present invention (including the vectors pGL3-Basic, pGL3-Promoter, pRL-CMV and pSLP3, and including the specific oligonucleotides primers to be able to analyze and check the donation); necessary reagents to make the synthesis of RNA to complementary DNA.

5. Uses of the invention:

In a fifth aspect, the present invention relates to a use of a kit of the invention, hereinafter first use of the kit of the invention, to predict without a subject diagnosed with Pulmonary Arterial Hypertension is classified as a patient with serious pronbstico.

In a sixth aspect, the present invention relates to a use of a kit of the invention, hereinafter referred to as the second kit of the invention, for selecting a subject diagnosed with Pulmonary Arterial Hypertension for a personalized therapy comprising determining whether said subject is classified as patient with severe prognosis.

Likewise, in a seventh aspect, the present invention relates to a use of a kit of the invention, hereinafter third use of the kit of the invention, to select a personalized therapy for a subject diagnosed with Pulmonary Arterial Hypertension in need of treatment, which comprises determining whether said subject is classified as a patient with good prognosis or with a worse prognosis.

PREFERRED EMBODIMENT OF THE INVENTION

In this section we will show an example of material and methods and the results of the analysis of the complete BMPR2 gene. This analysis is the same for the ACVRL1 and ENG genes .

1. Patients:

In this study, a total of 60 patients suffering from Pulmonary Arterial Hypertension of group 1 of Nize 2013 (Nice, France) were included. The patients were diagnosed by experienced pneumologists based on their clinical history, as well as depending on the result of various hemodynamic tests. The diagnosis of PAH was based on a right catheterization with a mean pulmonary arterial pressure (mPAP) of £ 25 mmHg and an interlock pressure of less than 15 mmHg without specific treatment. In all cases, the usual management protocol was followed according to the recommendations of the European Respiratory Society / European Society of Cardiology (European Respiratory Society / European Society Cardiology; ERS / ESC).

Clinical data were collected as Functional Class (CF), 6-minute walk test (TM6M), Pulmonary Function and laboratory studies. The collected hemodynamic studies are the Pulmonary Arterial Blood Pressure (PAPm), Pulmonary Systolic Blood Pressure (PAPs), Interlocking Pressure (PE), Cardiac Index (1C), Pulmonary Vascular Resistance (PVR) and vasoreactivity test. The patients were stable at the time of catheterization.

2. DNA extraction:

The biological sample used to carry out the genetic studies was genomic DNA extracted from 9 mL of peripheral blood, from each of the patients studied, collected on anticoagulant EDTA (ethylenediaminotetraacbic acid). Said extraction was carried out by means of the FlexiGene DNA Kit kit (Qiagen, Hilden, Germany), following the manufacturer's instructions.

3. Mutational analysis of the gene BMPR2 :

For the determination of the mutational spectrum of the BMPR2 gene, by means of polymerase chain reaction, the oligonucleotide primers described by Deng et al. (Am J Hum Genet 2000; 67: 737-44). For this, the following amplification protocol was followed, with the final volume of 25 pL:

- 5 minutes at 95 ° C.

- 35 cycles of: 30 seconds at 95 ° C, 30 seconds at X ° C and 30 seconds at 72 ° C. - 7 minutes at 72 ° C

The temperature of X depends on the pair of specific oligonucleotide primers used. In this case, the temperature described by Deng et al. for the BMPR2 gene .

To verify the correct amplification of the PCR product, it was resolved on 2% agarose gels with ethidium bromide at a concentration of 10 pg / mL. Each sample of amplified DNA was mixed with 5 pL of a loading solution containing bromophenol blue, prior to being loaded into the gel. Electrophoresis was performed in e! Sub-Cell® GT equipment (Bio-Rad, Hercules, CA, USA), in TAE electrode buffer. Once the electrophoresis was complete, the DNA was visualized using a transilluminator (GelDoc EQ, Bio-Rad, Hercules, CA, USA) and a digital image of the gel was obtained using the QuantityOne 4.6.1 program.

After checking the correct amplification of the PCR product, it was purified using the commercial Nucleic Acid and Protein Purification kit, NucleoSpin Extract II (Macherey-Nagel, Dtiren, Germany), following the manufacturer's instructions.

After purification of the PCR product, the sequencing reaction was carried out using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Carlsbad, CA, USA), following the manufacturer's instructions. The so-called sequencing reaction takes place in the thermal cycler according to the following protocol:

- 3 minutes at 94 ° C.

- 35 cycles of: 10 seconds at 96 ° C, 6 seconds at 50 ° C and 4 minutes at 60 ° C.

The product of the sequencing reaction was purified to eliminate the unincorporated labeled ddNTPs and to obtain the highest quality in the sequences. For this, 55 pL of cold ethanol, 19 pL of 22 mM MgCl and 10 pL of sterile H20 were added to each sample. This mixture was mixed, incubated at -20 ° C for 20 minutes, centrifuged at 14,000 rpms for 15 minutes, the supernatant removed and 84 pL of 70% ethanol added. The mixture was centrifuged again at 14,000 rpms for 15 minutes, the supernatant was removed and the samples were stored. The sequences were read in the ABI PRISM 3130 Genetic Analyzer capillary sequencer (Applied Biosystems, Carlsbad, CA, USA).

4. Analysis of the sequences:

The sequences of the subjects were aligned with the reference sequence [ENST00000374580] of the Ensembl for the BMPR2 gene .

After the mutational analysis of the genes, genetic variants have been identified in 92% of the identified patients. Among these variants, variants of the missense, nonsense, synonyms and variants in the 5'UTR region of the genes have been identified.

5. Luciferase assays:

The dual reporter system Dual-Luciferase Reporter Assay System (Promega, USA) was chosen to establish the activity of the 5'UTR region of the genes under study. The 5'UTR region of the BMPR2 gene was amplified using the oligonucleotides specific primers GGAAGCACCGAAGCGAAAC (direct) and CCCTGGGCCAGCCAAGAAT (reverse) and the high fidelity Phusion polymerase (Finnzymes, Espoo, Finland). The resulting fragments were digested with the Nhel / XhoI restriction enzymes and cloned into the pGL3-Basic vector at the Nhel / XhoI restriction sites, using the T4 DNA Ligase enzyme (Invitrogen Corporation, Carlsbad, CA) to generate a the 5'UTR wild type and mutated region.

To ligate the vector and the inserts, previously digested, a concentration of 50 ng of digested vector was used and to know the optimal concentrations of the insert the following formula was followed, using two dilutions (1/3 and 1/5), being : ng (nanograms), Kb (kilobases), pL (microliters).

ng vector x Kb insert 3

^{-------------------------------------------------} Insert g

X ^" n

- ---------- = \ iL insert

Kb digested vector 1 _{[ insert ]}

ng vector x Kb insert 5 ng insert

^{pf. KB insert} vector digested 1 [insert]

After the vector-insert linkage, the transformation of the cloned construct (insert vector) was carried out using competent E. coli JM109 cells and commercial liquid LB culture medium with 50 pg / mL Ampicillin. To transform, 5 pL of the construct was added to 50 pL of competent cells, agitated gently and incubated on ice for 10 minutes. After this time, a thermal shock was applied at 42 ° C for 40-50 seconds, so that the cells opened their pores and the construction could enter them. Next, the cells were incubated on ice for 4 minutes so that the cells would close their pores and the construction could not exit. Each vial was added with competent cells and 500 pL of Super Optimar Outbreak medium with catabolite repression (SOC Medium) and seeded in Petri dishes with LB medium and 50 pg / mL Ampicillin and incubated for 24 hours in the dark. .

After 24 hours of incubation, it was checked whether the bacterial colonies had grown and were grown in a preculture of 3 mL of liquid LB medium at 37 ° C, in constant agitation, for 18 hours. After growing the colonies overnight in the liquid culture, they were amplified directly by PCR to verify the size of the insert and that the donation of the same in the vector occurred correctly. The specific oligonucleotide primers used were RVprimer3 (TGGAAGACGCCAAAAACATAAAG; Sec ID No 85) and GLprimer2 (GGGACAGCCTATTTTGCTAG; Sec ID No 86) (Promega, Madison, Wisconsin, USA), following the standard conditions of PCR amplification. The PCR result was checked on a 2% agarose gel with ethidium bromide at a concentration of 10 pg / mL. The specific oligonucleotide primers employed hybridize with e! vector, so that, if the insert has not been cloned, a band of 153 base pairs will be observed in the gel and if it has been correctly cloned, a band of between 500 and 1000 base pairs will be observed, depending on the size of the Amplified insert. The uncloned pGL3-Basic vector was used as a negative control and the pGL3-Promoter vector without cloning as a positive control.

For the luciferase assay, COS-1 cells were used. The cell line was cultured in DMEM medium (Gibco, Grand Island, USA), supplemented with 10% fetal bovine serum (FBS, Gibco, Grand Island, USA), 1% L-glutamine (Lonza , Basel, Switzerland) and 1% penicillin / streptomycin (Lonza, Basel, Switzerland), in a humidified atmosphere at 37 ° C with 5% CO2. The cells were cultured in 6-well plates and COS-1 cells were transfected, with a confluence of 80-90%, using 2 pg of the pGL3-Basic construct (with the 5'UTR region of the BMPR2 gene , wild-type and mutant) and positive and negative controls per well. The COS-1 cells were also transfected with 20 ng of pRL-CMV vector (Renilla control plasmid). Transfection was performed using Fugene FID (Promega, Madison, Wisconsin, USA), in a 2: 5 ratio of pg DNA and Fugene HD pi, respectively, and following the manufacturer's instructions.

The cells were harvested at 36 hours after transfection. Luciferase assays were performed with the Dual-Luciferase Reporter Assay System (Promega, USA) on an EnVision 2104 luminometer (PerkinElmer, Waltham, Massachusetts, USA). The cells were lysed with 500 pi of lysis buffer (buffer PLB) at room temperature for 30 minutes. For the luciferase assay, aliquots of 20 pi of lysate were added in a 96-well plate to measure Lucibrnaga luciferase (100 pL) and renilla luciferase (100 pi). The values of luciferase were divided by the values of renilla to normalize the fluctuations in the cells and obtain the efficiency. The test was carried out in triplicate, in two different trials. This test allowed us to verify which variations produce an alteration of the transcriptional activity of the genes under study.

Statistically significant differences were observed in the transcriptional activity in 4 of the 5 gnlic variants when compared to the wild type, by luciferase assays. Three of the genetic variants (c.1-347C> T, c.1-301 G> A and c.1-92C> A) showed a decreased transcriptional activity ranging between 70-77% (p <0.0001) in comparison with the wild type levels. Surprisingly, the genetic variant c.1-279C> A produced the greatest decrease in transcriptional activity: 93% (p <0.0001). The genetic variant c.1-186A> G led to a decrease of approximately 2% without statistical significance (p = 0.495).

After this analysis, we have been able to classify the gbnicas variants c.1-347C> T, c.1-301G> A. c.1-279C> A and c.1-92C> A as pathogenic mutations, and are present in 7 of the 60 patients analyzed.

6. Hybrid minigenes:

To construct the hybrid minigenes, fragments were generated containing the exon in which the genetic variant to be analyzed was located and 200 base pairs of the flanking intronic regions, in order to ensure that they contain the consensus sequences involved in the splicing. The fragments were amplified by PCR using genomic DNA from the patients, using the high fidelity Phusion polymerase (Finnzymes, Espoo, Finland). The fragments were cloned into the pSPL3 vector (Invitrogen Corporation, Carlsbad, CA) at the Xhol / Nhel restriction sites (New England Biolabs, Ipswich, Massachusetts, USA) using the T4 DNA ligase enzyme (Invitrogen Corporation, Carlsbad, CA) to generate wild type and mutated constructions.

The linkage and transformation was carried out in the same way described in the Luciferase assays section (5) However, competent cells E. coli DH5a were used for the bacterial transformation. The donation was confirmed by PCR using the specific primers oligonucleotides CATGCTCCTTGGGATGTTGAT (direct, Seq ID No. 87) and ACTGTGCGTTACAATTTCTGG (reverse Seq ID No. 88) and by automatic sequencing.

For the luciferase assay, COS-7 cells were used. The cell line was cultured in DMEM medium (Gibco, Grand Island, USA), supplemented with 10% fetal bovine serum (FBS, Gibco, Grand Island, USA), L-glutamine 1% (Lonza , Basel, Switzerland) and 1% penicillin / streptomycin (Lonza, Basel, Switzerland), in a humidified atmosphere at 37 ° C with 5% CO2. The cells were cultured in 6-well plates and the COS-7 cells were transfected, with a confluence of 80-90%, using 2 pg of the construction pSPL3 (with the exon of the BMPR2 gene , wild-type and mutated). The transfection was performed using Lipofectamine 2000 (Invitrogen Corporation, Carlsbad, CA, USA) in a 1: 3 ratio of pg of plasmid DNA and pi of Lipofectamine, respectively, and following the manufacturer's instructions.

The COS-7 cells were incubated for 36 hours after the transfection and all the experiments were performed in duplicate. RNA extraction was carried out with the Nucleospin RNA II kit (Macherey-Nagel, Dtiren, Germany) according to the manufacturer's protocol. RT-PCR was carried out with the geneAmp Gold RNA PCR Kit Core Kit (Applied Biosystems, California, USA) and the resulting complementary DNA was amplified with the high fidelity Phusion polymerase (Finnzymes, Espoo, Finland) with the oligonucleotide primers Specific TCTGAGTCACCTGGACAACC (direct; Sec ID No. 89) and ATCTCAGTGGTATTTGTGAGC (reverse; Sec ID No. 90), which hybridize with exons SD6 and SA2 in the vector pSPL3, using 2pL of complementary DNA and the conditions of the amplification were: 30 seconds at 98 ° C, 35 cycles of 10 seconds at 98 ° C, 30 seconds at 58 ° C and 30 seconds at 72 ° C, finally 7 minutes at 72 ° C. PCR products were separated by 2% agarose gel electrophoresis to analyze changes in the transcription pattern, and sequenced with the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems, California, USA) to identify splicing changes .

In order to verify that genetic variants of the missense, nonsense or symntimal type affect the splicing mechanism, hybrid variants of 25 variants were made and 9 variants were identified that affect the processing of messenger RNA. Three of the variants that affect splicing are generic variants of the same type (c.633A> G, c.835G> T and c.981T> C), 3 genetic variants of the missense type (c.251G> T, c.412C > G and c.1400A> G) and 3 generic variants of nonsense type (c.156_157delTC, c.654T> A and c.893G> A).

The genetic variant c.633A> G prevents recognition of the main acceptor site. Direct sequencing of the complementary DNA confirmed the creation of a new 3 'alternative site, which produces a deletion of 12 base pairs in the 5' region of exbn 6 of the gene. The genetic variant c.835G> T produces the complete elimination of exon 6, generating a smaller amino acid protein. Finally, the genetic variant c.981T> C produces the complete elimination of exbn 8 and, therefore, a truncated protein of 985 amino acids.

3 of the generic variants of the missense type produce alterations in splicing. The c.251G> T genetic variant produces the complete elimination of exon 3, generating a change in the reading pattern and producing a premature stop codon in exon 4. The gbnica variant c.412C> G produces an atypical 5 'site resulting in a shorter protein of two amino acids since the mutation eliminates the main donor site and would generate a new donor splice site. Finally, the genetic variant c.1400A> G eliminates the main donor site, creating a new splice donor site and therefore, the new mutated protein would have only 494 amino acids.

Regarding the three nonsense genic variants, which generate shorter mbs proteins due to the premature stop codons (c.156_157delTC, c.654T> A and c.893G> A), of 54, 218 and 298 amino acids in length respectively, they affect the mechanism of splicing.

7 Statistic analysis:

The values are expressed as average standard deviation. The differences between the groups were examined to determine the statistical significance by means of the Student's t-test (luciferase assays). To compare the clinical and hemodynamic variables between the genotypes, the Chi-square test was used {the variables were classified according to the best cut-off point using ROC curves). These Correlations were analyzed using the Spearman test. Probability values less than 0.05 were considered statistically significant. Statistical analyzes were performed with SPSS for Windows (v19.0).

After the statistical and in vitro analysis of the identified genetic variants, a total of 19 pathogenic mutations were classified in 22 of the 60 patients analyzed. A genotype-phenotype comparison of the clinical and hemodynamic characteristics of the patients carrying pathogenic mutations with the non-carriers of pathogenic mutations was performed (Table 4). After this analysis, it was observed that the patients with pathogenic mutations present a systolic pulmonary arterial pressure, a mean pulmonary arterial pressure and a pulmonary vascular resistance statistically higher than the patients without mutations (p = 0.039, p = 0.029 and p = 0.015, respectively). The group of patients with pathogenic mutations also presented a statistically significant lower result for the 6-minute running test (p = 0.041). Patients with pathogenic mutations have a significantly lower diagnosis age than patients without pathogenic mutations (p = 0.030) and also have a lower cardiac index (p = 0.002). Finally, patients with pathogenic mutations do not respond well to treatment, in comparison with patients without pathogenic mutations (p = 0.010), being the treatment administered in non-responders Sildenafil (phosphodiesterase-5 inhibitor).

Therefore, these results indicate that patients with pathogenic mutations, tested by in vitro analysis , present a more severe phenotype than patients without pathogenic mutations. For this reason, these patients would be classified as "patients with worse prognosis".

Table 2: Genotype / phenotype correlation of patients with pathogenic mutations with patients without pathogenic mutations.

8. Applications:

In a first aspect, the present invention presents a clinical applicability, since it would help the physicians to predict the evolution of the disease according to its genomic stock, after an in vitro functional analysis of the BMPR2, ACVRL1 and ENG genes .

In a second aspect, the present invention relates to a method for selecting a personalized therapy for a subject diagnosed with pulmonary arterial hypertension in need of treatment, wherein a personalized therapy is selected for said subject, depending on the serialization routes affected. .

In a fourth aspect, the invention relates to a kit comprising the reagents necessary to genotype the genes involved in the development of the disease, where these genes are associated with the evolution of the disease.

Finally, the pharmacological market could be considered since, depending on the gen- erative characterization of the patients, they could adjust a more effective treatment that acts on the affected targets.

Claims (9)

1. In vitro method to determine the prognosis in subjects diagnosed with Pulmonary Arterial Hypertension characterized by the determination of the pathogenic mutations of the BMPR2, ACVRL1 and ENG genes, where an increase of said mutations is indicative of a severe prognosis of Hypertension Arterial Pulmonary 2. Method for the determination of the prognosis in subjects diagnosed with Pulmonary Arterial Hypertension according to claim 1, characterized by comprising the following stages: i) determine the genetic profile of patients diagnosed with Pulmonary Arterial Hypertension, sequencing the genes BMPR2, ACVRL1 and ENG, associated with the disease, and obtain the corresponding genetic profile of a biological sample of a subject with pulmonary arterial hypertension; ii) in vitro analysis of the genetic profile by means of luciferase assays and hybrid minigenes, in order to identify pathogenic mutations of the genetic variants identified in the genes BMPR2, ACVRL1 and ENG determined in step (i), therefore it is an indicative of a genetic Severe Pulmonary Arterial Hypertension when: - They are classified as pathogenic mutations those gbnicas variants, located in the 5'UTR region, which after the luciferase assay produce an alteration of transcriptional activity greater than 10%; - They are classified as pathogenic mutations those genetic variants that affect the mechanism of splicing after anblisis by hybridized minigenes. Method according to any of claims 1 to 2, characterized in that the biological sample is a sample of biopsy, tissues, cells or fluids, for example blood, saliva, plasma, serum, secretions, milk, preferably a blood sample peripheral . 4. Method according to any of claims 1 to 2, wherein a patient is classified as a patient with a high risk of developing pulmonary arterial hypertension with severe prognosis if it is a carrier of one or more pathogenic mutations of the genes BMPR2, ACVRL1 and ENG. 5. Method for designing personalized therapy for a subject diagnosed with pulmonary arterial hypertension with severe prognosis, according to the method according to any of claims 1 to 4, wherein those subjects with pathogenic mutations of the genes BMPR2, ACVRL1 and ENG should be treated with a combination of drugs that affect different routes that include treatments that act on the route of endothelin, of calcium channels and on the TGF- pathway (3. 6. Kit according to any of the preceding claims comprising the reagents necessary to genotype the BMPR2, ACVRL1 and ENG genes , associated with the Arterial Pulmonary Hypertensing, which will allow knowing the genetic stock of the subjects. Kit according to any of the preceding claims, which also comprises the reagents necessary to be able to functionally analyze the identified genetic variants by luciferase assays and hybrid minigenes, after the genetic analysis of BMPR2, ACVRL1 and ENG, to classify them according to their pathogenicity. 8. Use of a kit according to any of the preceding claims, to predict whether a subject diagnosed with Pulmonary Arterial Hypertension is indicative of a severe prognosis of Pulmonary Arterial Hypertension. 9. Use of a kit according to any of the preceding claims, for selecting a subject diagnosed with Pulmonary Arterial Hypertension for an individual therapy comprising determining whether said subject is classified as a patient with a severe prognosis of Pulmonary Arterial Hypertension, in which the Classification of said subject as a patient with a severe prognosis of Pulmonary Arterial Hypertensing selects said subject for said individual therapy.