ES2648638B1 - Circulating microRNAs as biomarkers of Primary Antiphospholipid Syndrome - Google Patents
Circulating microRNAs as biomarkers of Primary Antiphospholipid Syndrome Download PDFInfo
- Publication number
- ES2648638B1 ES2648638B1 ES201630725A ES201630725A ES2648638B1 ES 2648638 B1 ES2648638 B1 ES 2648638B1 ES 201630725 A ES201630725 A ES 201630725A ES 201630725 A ES201630725 A ES 201630725A ES 2648638 B1 ES2648638 B1 ES 2648638B1
- Authority
- ES
- Spain
- Prior art keywords
- seq
- mir
- phc
- index
- value
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
MicroARNs circulantes como biomarcadores clínicos del síndrome antifosfolípido primario.#Uso de los microARNs: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, y miR-15a para el diagnóstico, clasificación y/o seguimiento en un individuo o sujeto que sufra potencialmente síndrome antifosfolípido primario, método de obtención de datos útiles para el diagnóstico, clasificación y/o seguimiento del síndrome antifosfolípido primario en un individuo o sujeto que sufra potencialmente síndrome antifosfolípido, kit o dispositivo, microarray y usos.Circulating microRNAs as clinical biomarkers of primary antiphospholipid syndrome. # Use of microRNAs: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and miR-15a for diagnosis, classification and / or monitoring in an individual or subject potentially suffering from primary antiphospholipid syndrome, method of obtaining useful data for the diagnosis, classification and / or monitoring of primary antiphospholipid syndrome in an individual or subject potentially suffering from antiphospholipid syndrome, kit or device, microarray and uses.
Description
55
1010
15fifteen
20twenty
2525
3030
DESCRIPCIÓNDESCRIPTION
MicroARNs circulantes como biomarcadores del Síndrome Antifosfolípido Primario CAMPO DE LA INVENCIÓNCirculating microRNAs as biomarkers of the Primary Antiphospholipid Syndrome FIELD OF THE INVENTION
La presente invención se encuentra dentro del campo de la Biología Molecular y la Medicina Clínica, y específicamente se refiere a un método de obtención de datos útiles para el diagnóstico, clasificación y/o seguimiento de pacientes con síndrome antifosfolípido primario (APS, del inglés primary antiphospholipid syndrome), así como para la tipificación de la patología aterotrombótica que sufren dichos pacientes.The present invention is within the field of Molecular Biology and Clinical Medicine, and specifically refers to a method of obtaining useful data for the diagnosis, classification and / or monitoring of patients with primary antiphospholipid syndrome (APS). antiphospholipid syndrome), as well as for the typification of atherothrombotic pathology suffered by said patients.
ANTECEDENTES DE LA INVENCIÓNBACKGROUND OF THE INVENTION
El Sindrome Antifosfolípido es un desorden autoinmune, clasificado por ORPHANET como enfermedad rara (ORPHA80). Se caracteriza por el desarrollo de trombosis arteriales y/o venosas de repetición y/o una historia obstétrica con prematuridad y preeclampsia, en presencia de títulos elevados de anticuerpos antifosfolípido, principalmente anticuerpos anti cardiolipina de isotipo IgG o IgM, anti-B2glicoproteína I y anticoagulante Lúpico.Antiphospholipid Syndrome is an autoimmune disorder, classified by ORPHANET as a rare disease (ORPHA80). It is characterized by the development of arterial and / or venous thrombosis of recurrence and / or an obstetric history with prematurity and preeclampsia, in the presence of high titers of antiphospholipid antibodies, mainly IgG or IgM isotype anti-cardiolipin antibodies, anti-B2 glycoprotein I and anticoagulant Lupus
Diferentes estudios publicados por nuestro grupo de investigación han mostrado que el estatus protrombótico de los pacientes APS es el resultado de diversos mecanismos subyacentes, incluyendo la activación monocítica inducida por los anticuerpos antifosfolípido, los cuales generan disfunción mitocondrial y estrés oxidativo, y promueven la expresión alterada de un número de moléculas relacionadas con inflamación y trombosis, como el factor tisular y el factor de crecimiento endotelial vascular entre otros.Different studies published by our research group have shown that the prothrombotic status of APS patients is the result of various underlying mechanisms, including monocytic activation induced by antiphospholipid antibodies, which generate mitochondrial dysfunction and oxidative stress, and promote altered expression. of a number of molecules related to inflammation and thrombosis, such as tissue factor and vascular endothelial growth factor among others.
Recientemente, la tecnología genómica ha permitido explicar los mecanismosRecently, genomic technology has allowed explaining the mechanisms
fisiopatológicos que controlan la enfermedad vascular en pacientes APS, cómo estasPathophysiological control of vascular disease in APS patients, how are you
alteraciones pueden estar asociadas a estos desordenes autoinmunes, y su respuesta aalterations may be associated with these autoimmune disorders, and their response to
diferentes aproximaciones terapéuticas. Un importante y emergente mecanismo queDifferent therapeutic approaches. An important and emerging mechanism that
controla la expresión génica es la Epigenética. La Epigenética o regulación de la expresióncontrols gene expression is epigenetics. Epigenetics or expression regulation
génica mediante alteraciones independientes de la secuencia de ADN, está aportandogene by independent alterations of the DNA sequence, is contributing
nuevos enlaces entre la genómica y los factores ambientales. Comprende la metilación delNew links between genomics and environmental factors. It includes the methylation of
ADN, modificación de histonas y la actividad de los microARNs, los cuales actúan sobre losDNA, histone modification and the activity of microRNAs, which act on the
niveles de expresión génica y proteica. Los microARNs (miARNs o miR) son pequeñoslevels of gene and protein expression. The microRNAs (miRNAs or miR) are small
ácidos ribonucleicos ácidos (ARN) que juegan un papel crítico en la regulación génica aacidic ribonucleic acids (RNAs) that play a critical role in gene regulation to
nivel post-transcripcional. Los microARNs afectan de manera crucial al Sistema immune ypost-transcriptional level. MicroRNAs crucially affect the immune system and
parecen tener un papel relevante en la patogénesis de las enfermedades autoinmunes yseem to have a relevant role in the pathogenesis of autoimmune diseases and
cardiovasculares. Un número de estudios han analizado el perfil de expresión de microARNscardiovascular A number of studies have analyzed the expression profile of microRNAs
en células de sangre periférica, fluidos biológicos y tejidos de pacientes con Lupus. Estosin peripheral blood cells, biological fluids and tissues of patients with Lupus. These
22
55
1010
15fifteen
20twenty
2525
3030
trabajos han mostrado la existencia de una firma de miARNs asociadas con la actividad de la enfermedad. En el Síndrome Antifosfolípido (APS), existe hasta la fecha solo un artículo, publicado por nuestro grupo de investigación, que ha identificado dos microARNs como moduladores potenciales de la expresión del factor tisular (TF), el principal inductor de trombosis en pacientes APS. Diferentes estudios han mostrado que los microARNs son atractivos biomarcadores potenciales por diferentes razones:papers have shown the existence of a signature of miRNAs associated with disease activity. In the Antiphospholipid Syndrome (APS), there is to date only one article, published by our research group, that has identified two microRNAs as potential modulators of tissue factor expression (TF), the main thrombosis inducer in APS patients. Different studies have shown that microRNAs are attractive potential biomarkers for different reasons:
• Su perfil de expresión refleja procesos patológicos subyacentes.• Its expression profile reflects underlying pathological processes.
• Los microARNs pueden ser detectados en una variedad de fuentes, incluyendo tejidos, células sanguíneas y fluidos biológicos.• MicroRNAs can be detected in a variety of sources, including tissues, blood cells and biological fluids.
• En comparación con ARNs mensajeros (mARNs), son estables y resistentes a la degradación, debido a su pequeño tamaño y protección en complejos miARN- proteína o en microvesículas (i.e. exosomas) en sangre y fluidos biológicos.• In comparison to messenger RNAs (mRNAs), they are stable and resistant to degradation, due to their small size and protection in miRNA-protein complexes or microvesicles (i.e. exosomes) in blood and biological fluids.
Sin embargo, hasta la fecha ningún estudio ha evaluado el perfil de miARNS plasmáticos y su relación con la fisiopatología de la enfermedad. Así pues, el principal objetivo de este estudio, fue determinar el perfil de miARNs plasmáticos en APS, e identificar potenciales miARNs que puedan representar biomarcadores no invasivos para el diagnóstico y la tipificación de la patología aterotrombótica de pacientes APS.However, to date, no study has evaluated the profile of plasma miRNAs and their relationship with the pathophysiology of the disease. Thus, the main objective of this study was to determine the profile of plasma miRNAs in PHC, and identify potential miRNAs that may represent non-invasive biomarkers for the diagnosis and typing of atherothrombotic pathology of PHC patients.
BREVE DESCRIPCIÓN DE LA INVENCIÓNBRIEF DESCRIPTION OF THE INVENTION
Por tanto, un primer aspecto de la invención se refiere al uso simultáneo de los biomarcadores de microARNs: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, y miR-15a, o cualquiera de sus combinaciones, para el diagnóstico, clasificación y/o seguimiento del síndrome antifosfolípido primario (APS).Therefore, a first aspect of the invention relates to the simultaneous use of microRNA biomarkers: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and miR -15a, or any combination thereof, for the diagnosis, classification and / or monitoring of the primary antiphospholipid syndrome (PHC).
Un segundo aspecto de la invención se refiere a un método de obtención de datos útiles para el diagnóstico, clasificación y/o seguimiento de un individuo o sujeto que potencialmente sufra del APS que comprende:A second aspect of the invention relates to a method of obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from PHC comprising:
a) cuantificar el producto de expresión de los biomarcadores miR-124, miR-145, miR- 20a, miR-296, miR-34a, miR-374, miR-19b, y/o miR-15a en una muestra biológica aislada de dicho individuo.a) quantify the expression product of the biomarkers miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and / or miR-15a in an isolated biological sample of said individual.
En una realización preferida de este aspecto de la invención, el primer método de la invención además comprende:In a preferred embodiment of this aspect of the invention, the first method of the invention further comprises:
b) calcular el índice A según la ecuación:b) calculate the index A according to the equation:
55
1010
15fifteen
20twenty
donde: P0 = -7,01449, fr= 1,13676, P2= 0,16051, P3= 0,19897, P4= 0,20980, P5= 0,13676, xi = -log2 (miR20a/miR145), x2 = -log2 (miR145/miR296), x3 = -log2 (miR374/miR34a), x4 = -log2 (miR374/miR124) y x5 = edad del paciente,where: P0 = -7,01449, fr = 1,13676, P2 = 0,16051, P3 = 0,19897, P4 = 0.20980, P5 = 0.13676, xi = -log2 (miR20a / miR145), x2 = -log2 (miR145 / miR296), x3 = -log2 (miR374 / miR34a), x4 = -log2 (miR374 / miR124) and x5 = patient age,
c) calcular los índices B1, B2 y/o B3 según las ecuaciones:c) calculate the indices B1, B2 and / or B3 according to the equations:
B1 = -log2 (miR19b/miR15a); B2 = -log2 (miR20a/miR374); B3 = -log2 (miR374/miR34a)B1 = -log2 (miR19b / miR15a); B2 = -log2 (miR20a / miR374); B3 = -log2 (miR374 / miR34a)
d) calcular los índices C1 y/o C2 según las ecuaciones:d) calculate the C1 and / or C2 indices according to the equations:
C1 = -log2 (miR19b/miR124); C2 = -log2 (miR19a/miR296)C1 = -log2 (miR19b / miR124); C2 = -log2 (miR19a / miR296)
asignando en cada ecuación los valores de los biomarcadores correspondientes obtenidos en el paso (a).assigning in each equation the values of the corresponding biomarkers obtained in step (a).
Un tercer aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante segundo método de la invención, queA third aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereinafter the second method of the invention, which
comprende los pasos (a) y (b) según el primer método de la invención, y ademásIt comprises steps (a) and (b) according to the first method of the invention, and also
comprende:understands:
e) clasificar al individuo del paso (a) en el grupo de individuos con APS cuando el valor del índice A del paso (b) sea preferiblemente mayor que 0,4, más preferiblemente mayor que 0,5, y aún más preferiblemente mayor que 0,6.e) classify the individual of step (a) in the group of individuals with APS when the value of the index A of step (b) is preferably greater than 0.4, more preferably greater than 0.5, and even more preferably greater than 0.6.
Un cuarto aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante tercer método de la invención, queA fourth aspect of the invention relates to a method for diagnosis, classification and / or follow-up of PHC, hereinafter the third method of the invention, which
comprende los pasos (a) y (c) según el primer método de la invención, y ademásIt comprises steps (a) and (c) according to the first method of the invention, and also
comprende:understands:
55
1010
15fifteen
20twenty
2525
3030
f) clasificar al individuo del paso (a) en el grupo de individuos con APS con trombosis arterial cuando el valor del índice B2 del paso (c) sea preferiblemente mayor que 4,9, más preferiblemente mayor que 5,2, y aún más preferiblemente mayor que 5,542.f) classify the individual from step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably greater than 4.9, more preferably greater than 5.2, and even more preferably greater than 5,542.
Un quinto aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante cuarto método de la invención, queA fifth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereinafter the fourth method of the invention, which
comprende los pasos (a) y (c) según el primer método de la invención, y ademásIt comprises steps (a) and (c) according to the first method of the invention, and also
comprende:understands:
g) clasificar al individuo del paso (a) en el grupo de individuos con APS con trombosis venosa cuando el valor del índice B2 del paso (c) sea preferiblemente menor que 5,742, más preferiblemente menor que 5,642, y aún más preferiblemente menor o igual que 5,542 y cuando el valor del índice B3 del paso (c) sea preferiblemente menor que -0,165, más preferiblemente menor que -0,265, y aún más preferiblemente menor o igual que -0,356.g) classify the individual from step (a) in the group of individuals with PHC with venous thrombosis when the B2 index value of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542 and when the value of the B3 index of step (c) is preferably less than -0,165, more preferably less than -0,265, and even more preferably less than or equal to -0,356.
Un sexto aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante quinto método de la invención, queA sixth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereinafter the fifth method of the invention, which
comprende los pasos (a) y (c) según el primer método de la invención, y ademásIt comprises steps (a) and (c) according to the first method of the invention, and also
comprende:understands:
h) clasificar al individuo del paso (a) en el grupo de individuos con APS con trombosis arterial cuando el valor del índice B2 del paso (c) sea preferiblemente menor que 5,742, más preferiblemente menor que 5,642, y aún más preferiblemente menor o igual que 5,542 y cuando el valor del índice B3 del paso (c) se encuentra preferiblemente en el rango entre (0,556, 0,736), más preferiblemente en el rango entre (-0,456, 0,636), y aún más preferiblemente entre (-0,356, 0,536].h) classify the individual of step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542 and when the value of the B3 index of step (c) is preferably in the range between (0.556, 0.736), more preferably in the range between (-0.456, 0.636), and even more preferably between (-0.356, 0.536 ].
Un séptimo aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante sexto método de la invención, que comprende los pasos (a) y (c) según el primer método de la invención, y además comprende:A seventh aspect of the invention relates to a method for the diagnosis, classification and / or follow-up of PHC, hereafter referred to as the sixth method of the invention, comprising steps (a) and (c) according to the first method of the invention, and also comprises:
i) clasificar al individuo del paso (a) en el grupo de individuos con APS con trombosis arterial cuando el valor del índice B2 del paso (c) sea preferiblemente menor que 5,742, más preferiblemente menor que 5,642, y aún más preferiblemente menor o igual que 5,542, cuando el valor del índice B3 del paso (c) sea preferiblemente mayor que 0,336, más preferiblemente mayor que 0,436, y aún más preferiblemente mayor que 0,536, y cuando el valor del índice B1 del paso (c) sea preferiblemente menor que 5,152, más preferiblementei) classify the individual of step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542, when the value of the index B3 of step (c) is preferably greater than 0.336, more preferably greater than 0.436, and even more preferably greater than 0.536, and when the value of index B1 of step (c) is preferably less than 5,152, more preferably
menor que 5,052, y aún más preferiblemente menor o igual que 4,952.less than 5,052, and even more preferably less than or equal to 4,952.
55
55
1010
15fifteen
20twenty
2525
3030
Un octavo aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante séptimo método de la invención, que comprende los pasos (a) y (c) según el primer método de la invención, y además comprende:An eighth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereafter referred to as the seventh method of the invention, which comprises steps (a) and (c) according to the first method of the invention, and also comprises:
j) clasificar al individuo del paso (a) en el grupo de individuos con APS con trombosis arterial cuando el valor del índice B2 del paso (c) sea preferiblemente menor que 5,742, más preferiblemente menor que 5,642, y aún más preferiblemente menor o igual que 5,542, cuando el valor del índice B3 del paso (c) sea preferiblemente mayor que 0,336, más preferiblemente mayor que 0,436, y aún más preferiblemente mayor que 0,536, y cuando el valor del índice B1 del paso (c) sea preferiblemente mayor que 4,752, más preferiblemente mayor que 4,852, y aún más preferiblemente mayor que 4,952.j) classify the individual of step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542, when the value of index B3 of step (c) is preferably greater than 0.336, more preferably greater than 0.436, and even more preferably greater than 0.536, and when the value of index B1 of step (c) is preferably greater than 4,752, more preferably greater than 4,852, and even more preferably greater than 4,952.
Un noveno aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante octavo método de la invención, que comprende los pasos (a) y (d) según el primer método de la invención, y además comprende:A ninth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereafter referred to as the eighth method of the invention, comprising steps (a) and (d) according to the first method of the invention, and also comprises:
k) clasificar al individuo del paso (a) en el grupo de individuos con APS con aterosclerosis o ecodoppler patológico cuando el valor del índice C1 del paso (d) sea preferiblemente menor que 13,198, más preferiblemente menor que 12,198, y aún más preferiblemente menor o igual que 11,198 y cuando el valor del índice C2 del paso (d) sea preferiblemente mayor que 5,690, más preferiblemente mayor que 6,690, y aún más preferiblemente sea mayor que 7,690.k) classify the individual from step (a) in the group of individuals with PHC with atherosclerosis or pathological echodoppler when the value of the C1 index of step (d) is preferably less than 13,198, more preferably less than 12,198, and even more preferably less or equal to 11,198 and when the value of the C2 index of step (d) is preferably greater than 5,690, more preferably greater than 6,690, and even more preferably greater than 7,690.
En una realización preferida de cualquiera de los aspectos de la invención, la muestra biológica aislada del paso (a) es una muestra de plasma, suero u orina. Preferiblemente la muestra biológica aislada del paso (a) es una muestra de plasma.In a preferred embodiment of any aspect of the invention, the biological sample isolated from step (a) is a plasma, serum or urine sample. Preferably the biological sample isolated from step (a) is a plasma sample.
Un décimo aspecto de la invención se refiere a un kit o dispositivo, de ahora en adelante kit o dispositivo de la invención, que comprende los elementos necesarios para detectar los niveles de expresión de los microARNs: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, y miR-15a, tal y como se han definido en el primer aspecto de la invención.A tenth aspect of the invention relates to a kit or device, hereafter kit or device of the invention, comprising the elements necessary to detect the expression levels of the microRNAs: miR-124, miR-145, miR- 20a, miR-296, miR-34a, miR-374, miR-19b, and miR-15a, as defined in the first aspect of the invention.
En una realización preferida de este aspecto de la invención, el kit o dispositivo de la invención comprende cebadores, sondas y/o anticuerpos capaces de cuantificar el producto de expresión los microARN: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR- 19b, y miR-15a, y donde:In a preferred embodiment of this aspect of the invention, the kit or device of the invention comprises primers, probes and / or antibodies capable of quantifying the microRNA expression product: miR-124, miR-145, miR-20a, miR- 296, miR-34a, miR-374, miR-19b, and miR-15a, and where:
55
1010
15fifteen
20twenty
2525
3030
- los cebadores o primers son secuencias de polinucleótidos de entre 10 y 30 pares de- primers or primers are polynucleotide sequences of between 10 and 30 pairs of
bases, más preferiblemente de entre 15 y 25 pares de bases, aún más preferiblemente de entre 18 y 22 pares de bases, y aún mucho más preferiblemente de alrededor de 20 pares de bases, que presentan una identidad de al menos un 80%, más preferiblemente de al menos un 90%, aún más preferiblemente de al menos un 95%, aún mucho más preferiblemente de al menos un 98%, y particularmente de un 100%, con un fragmento de las secuencias complementarias a la SEQ ID N°: 1, SEQ ID N°: 2, SEQ ID N°: 3, SEQ ID N°: 4, SEQ ID N°: 5, SEQ ID N°: 6, SEQ ID N°: 7, SEQ ID N°: 8, SEQ ID N°: 9, SEQ ID N°: 10,bases, more preferably between 15 and 25 base pairs, even more preferably between 18 and 22 base pairs, and even more preferably about 20 base pairs, which have an identity of at least 80%, more preferably at least 90%, even more preferably at least 95%, still much more preferably at least 98%, and particularly 100%, with a fragment of the sequences complementary to SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8 , SEQ ID N °: 9, SEQ ID N °: 10,
SEQ ID N°: 11, SEQ ID N°: 12, SEQ ID N°: 13, SEQ ID N°: 14, SEQ ID N°: 15, SEQ ID N°:SEQ ID N °: 11, SEQ ID N °: 12, SEQ ID N °: 13, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °:
16.16.
- las sondas son secuencias de polinucleótidos de entre 80 y 1100 pares de bases, más- the probes are sequences of polynucleotides of between 80 and 1100 base pairs, plus
preferiblemente de entre 100 y 1000 pares de bases, y aún más preferiblemente de entre 200 y 500 pares de bases, que presentan una identidad de al menos un 80%, más preferiblemente de al menos un 90%, aún más preferiblemente de al menos un 95%, aún mucho más preferiblemente de al menos un 98%, y particularmente de un 100%, con un fragmento de las secuencias complementarias a la SEQ ID N°: 1, SEQ ID N°: 2, SEQ ID N°: 3, SEQ ID N°: 4, SEQ ID N°: 5, SEQ ID N°: 6, SEQ ID N°: 7, SEQ ID N°: 8, SEQ ID N°: 9,preferably between 100 and 1000 base pairs, and even more preferably between 200 and 500 base pairs, which have an identity of at least 80%, more preferably of at least 90%, even more preferably of at least one 95%, even more preferably at least 98%, and particularly 100%, with a fragment of the sequences complementary to SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3 , SEQ ID N °: 4, SEQ ID N °: 5, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8, SEQ ID N °: 9,
SEQ ID N°: 10, SEQ ID N°: 11, SEQ ID N°: 12, SEQ ID N°: 13, SEQ ID N°: 14, SEQ ID N°:SEQ ID N °: 10, SEQ ID N °: 11, SEQ ID N °: 12, SEQ ID N °: 13, SEQ ID N °: 14, SEQ ID N °:
15, SEQ ID N°: 16.15, SEQ ID N °: 16.
- los anticuerpos son capaces de unirse a una región formada por cualquiera de las secuencias nucleotídicas SEQ ID N°: 1, SEQ ID N°: 2, SEQ ID N°: 3, SEQ ID N°: 4, SEQ ID N°: 5, SEQ ID N°: 6, SEQ ID N°: 7, SEQ ID N°: 8, SEQ ID N°: 9, SEQ ID N°: 10, SEQ ID N°: 11, SEQ ID N°: 12, SEQ ID N°: 13, SEQ ID N°: 14, SEQ ID N°: 15, SEQ ID N°: 16.- the antibodies are capable of binding to a region formed by any of the nucleotide sequences SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 5, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8, SEQ ID N °: 10, SEQ ID N °: 11, SEQ ID N °: 12 , SEQ ID N °: 13, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 16.
Un décimo primer aspecto de la invención, se refiere a un microarray, de ahora en adelante microarray de la invención, que comprende oligonucleótidos o microarreglos de canal único diseñados a partir de las secuencias nucleotídicas SEQ ID N°: 1, SEQ ID N°: 2, SEQ ID N°: 3, SEQ ID N°: 4, SEQ ID N°: 5, SEQ ID N°: 6, SEQ ID N°: 7, SEQ ID N°: 8, SEQ ID N°: 9, SEQ ID N°: 10, SEQ ID N°: 11, SEQ ID N°: 12, SEQ ID N°: 13, SEQ ID N°: 14, SEQ ID N°: 15, SEQ ID N°: 16.A eleventh aspect of the invention relates to a microarray, hereafter referred to as a microarray of the invention, comprising oligonucleotides or single channel microarrays designed from the nucleotide sequences SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8, SEQ ID N °: 9 , SEQ ID N °: 10, SEQ ID N °: 11, SEQ ID N °: 12, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 15, SEQ ID N °: 16.
Un décimo segundo aspecto de la invención se refiere al uso del kit o dispositivo de la invención o del microarray de la invención, para la obtención de datos útiles para el diagnóstico, clasificación y/o seguimiento de un individuo o sujeto que potencialmente sufra APS.A twelfth aspect of the invention relates to the use of the kit or device of the invention or the microarray of the invention, for obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from PHC.
DESCRIPCIÓN DE LAS FIGURASDESCRIPTION OF THE FIGURES
Figura 1. A. miARNs diferencialmente expresados en el plasma de pacientes APS vs Controles Diagrama de barras de los miARNs diferencialmente expresados en plasma de pacientes APS en relación a donantes sanos, identificados mediante un PCR-array. B. 5 Ingenuity Pathway Analysis (IPA). Clasificación funcional de los microARNs utilizando el software.Figure 1. A. differentially expressed miRNAs in the plasma of APS patients vs. Controls Bar chart of differentially expressed miRNAs in plasma of APS patients in relation to healthy donors, identified by a PCR-array. B. 5 Ingenuity Pathway Analysis (IPA). Functional classification of microRNAs using the software.
Figura 2. A y B. Modelo de combinación de los ratios de microARNs que discrimina APS de donantes sanos y curva ROC.Figure 2. A and B. Combination model of the microRNA ratios that discriminates APS from healthy donors and ROC curve.
Figura 3. A y B. Modelo de combinación de los ratios de microARNs que discrimina 10 pacientes APS con trombosis arterias y venosa y curva ROC.Figure 3. A and B. Combination model of the microRNA ratios that discriminates 10 APS patients with arterial and venous thrombosis and ROC curve.
Figura 4. A y B. Modelo de combinación de los ratios de microARNs que discrimina pacientes APS con ecodoppler patológico y normal y curva ROC.Figure 4. A and B. Combination model of the microRNA ratios that discriminates APS patients with pathological and normal echodoppler and ROC curve.
Figura 5. Tablas de correlación entre ratios de microARNs y parámetros relacionados con autoinmunidad, inflamación y enfermedad cardiovascular.Figure 5. Correlation tables between microRNA ratios and parameters related to autoimmunity, inflammation and cardiovascular disease.
15 Figura 6. A y B. Diagramas de barras mostrando asociaciones estadísticas entre ratios de microARNs y ocurrencia de perdidas fetales y positividad para anticuerpos antifosfolípido.15 Figure 6. A and B. Bar diagrams showing statistical associations between ratios of microRNAs and occurrence of fetal losses and positivity for antiphospholipid antibodies.
DESCRIPCIÓN DETALLADA DE LA INVENCIÓNDETAILED DESCRIPTION OF THE INVENTION
Los autores de la presente invención han analizado los niveles de microARNs en muestras de plasma de pacientes con síndrome antifosfolípido primario en comparación con otros 20 pacientes sanos. Los resultados indican que los microARNs presentes en el plasma pueden ser usados como marcadores de un sistema diagnóstico, clasificación y/o seguimiento del síndrome antifosfolípido primario.The authors of the present invention have analyzed the levels of microRNAs in plasma samples of patients with primary antiphospholipid syndrome compared to 20 other healthy patients. The results indicate that the microRNAs present in the plasma can be used as markers of a diagnostic system, classification and / or monitoring of the primary antiphospholipid syndrome.
BIOMARCADORES DE LA INVENCIÓNBIOMARKERS OF THE INVENTION
Por tanto, un primer aspecto de la invención se refiere al uso de los biomarcadores de 25 microARNs: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, miR-15a, o cualquiera de sus combinaciones, para el diagnóstico, clasificación y/o seguimiento del síndrome antifosfolípido primario (APS), de ahora en adelante biomarcadores de la invención. En una realización preferida, el uso de los microARNs es simultáneo.Therefore, a first aspect of the invention relates to the use of biomarkers of 25 microRNAs: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, miR- 15a, or any combination thereof, for the diagnosis, classification and / or monitoring of the primary antiphospholipid syndrome (APS), hereinafter biomarkers of the invention. In a preferred embodiment, the use of microRNAs is simultaneous.
55
1010
15fifteen
20twenty
2525
3030
Los biomarcadores de la invención pueden usarse simultáneamente, por separado o en cualquier combinación de los mismos para el diagnóstico, clasificación y/o seguimiento del APS.The biomarkers of the invention can be used simultaneously, separately or in any combination thereof for the diagnosis, classification and / or monitoring of PHC.
En una realización preferida de este aspecto de la invención, se utilizan conjuntos de ratios entre los biomarcadores de la invención para el diagnóstico, clasificación y/o seguimiento del APS. Preferiblemente, los conjuntos de ratios formados entre biomarcadores de la invención para el diagnóstico, clasificación y/o seguimiento del APS usados son:In a preferred embodiment of this aspect of the invention, sets of ratios between the biomarkers of the invention are used for the diagnosis, classification and / or monitoring of PHC. Preferably, the sets of ratios formed between biomarkers of the invention for the diagnosis, classification and / or monitoring of the APS used are:
• miR-20a/miR-145, miR-145/miR-296, miR-374/miR34a y miR374/124,• miR-20a / miR-145, miR-145 / miR-296, miR-374 / miR34a and miR374 / 124,
• miR-19b/miR-15a, miR-20a/miR-374 y miR-374/miR-34a,• miR-19b / miR-15a, miR-20a / miR-374 and miR-374 / miR-34a,
• miR-19b/miR-124 y miR-15a/miR-296.• miR-19b / miR-124 and miR-15a / miR-296.
El término “microARN” se refiere a ARN monocatenario de aproximadamente 22 nucleótidos de longitud, no codificantes para proteínas y generados de transcriptos endógenos que pueden formar estructuras en forma de horquilla (Lee et al., 2004. Embo. Journal, 23 (20), 4051-4060). Los microARNs conforman una gran familia de genes reguladores postranscripcionales que controlan muchos procesos celulares y del desarrollo en eucariotas, cumpliendo una gran cantidad de funciones. Se estima que el 30% de todos los genes humanos son regulados por mecanismos dependientes de microARNs (Rajewsky N. 2006. Nature Genetics, 38, Suppl: S8-13) y que un solo microARN puede regular alrededor de 200 diferentes transcriptos que pueden funcionar en diferentes vías en la célula (Krek et al., 2005, Nature Genetics, 37 (5), 495-500), así como que un mismo ARNm puede ser regulado por múltiples microARNs (Cai et al., 2009. Genomics Proteomics Bioinformatics, 7 (4), 147-154).The term "microRNA" refers to single stranded RNA approximately 22 nucleotides in length, non-coding for proteins and generated from endogenous transcripts that can form hairpin-shaped structures (Lee et al., 2004. Embo. Journal, 23 (20) , 4051-4060). The microRNAs make up a large family of post-transcriptional regulatory genes that control many cellular and eukaryotic development processes, fulfilling a large number of functions. It is estimated that 30% of all human genes are regulated by mechanisms dependent on microRNAs (Rajewsky N. 2006. Nature Genetics, 38, Suppl: S8-13) and that a single microRNA can regulate about 200 different transcripts that can work in different pathways in the cell (Krek et al., 2005, Nature Genetics, 37 (5), 495-500), as well as that the same mRNA can be regulated by multiple microRNAs (Cai et al., 2009. Genomics Proteomics Bioinformatics , 7 (4), 147-154).
El término “Síndrome Antifosfolípido Primario” es un desorden autoinmune caracterizado por la asociación de una historia obstétrica, con pérdidas fetales o prematuridad y preeclampsia, y trombosis vasculares de tipo arterial y/o venoso. La trombosis es la complicación más severa del síndrome. Se trata de la trombofilia adquirida más frecuente, responsable del 20% de los accidentes cerebrovasculares y del 18% de los infartos de miocardio en menores de 50 años.The term "Primary Antiphospholipid Syndrome" is an autoimmune disorder characterized by the association of an obstetric history, with fetal losses or prematurity and preeclampsia, and vascular thrombosis of arterial and / or venous type. Thrombosis is the most severe complication of the syndrome. It is the most frequent acquired thrombophilia, responsible for 20% of strokes and 18% of myocardial infarctions in children under 50 years.
Los marcadores serológicos de este síndrome son los anticuerpos antifosfolípido, principalmente anticuerpos anticardiolipina (ACAs) o anticoagulante lúpico. Los ACAs se unen sobre la superficie celular principalmente a través de una proteína de unión fosfolipídica, la B2GPI y la protrombina.The serological markers of this syndrome are antiphospholipid antibodies, mainly anticardiolipin antibodies (ACAs) or lupus anticoagulant. ACAs bind on the cell surface primarily through a phospholipid binding protein, B2GPI and prothrombin.
55
1010
15fifteen
20twenty
2525
3030
Se han propuesto numerosos mecanismos para explicar los procesos protrombóticos/proinflamatorios asociados al APS, aunque la patogénesis parece ser multifactorial. Un proceso esencial es la activación monocítica inducida por los anticuerpos antifosfolípido (ACA), la cual promueve un aumento de la actividad procoagulante, mediante la activación del principal receptor activador de la coagulación sanguínea, el Factor Tisular, cuya expresión se halla incrementada en los monocitos de estos pacientes (Cuadrado MJ, et al., 1997. Arthrítis Rheum., 40:834-41). La señalización intracelular asociada a dicha activación está mediada por los receptores activados por proteasas (PARs, -mediadores de respuestas criticas para la trombosis, hemostasia y procesos inflamatorios y participantes en el desarrollo de arteriosclerosis), cuya expresión se encuentra también incrementada en los monocitos de los pacientes con SAF (López-Pedrera et al., Arthritis Rheum. 2010; 62:869- 77). En estudios recientes, se ha descrito que dicha señalización intracelular, inducida por los ACAs, implica la activación constitutiva de MAPK y NFkB (López-Pedrera et al. 2006. Arthritis Rheum. 54:301-11), así como la promoción de la expresión del factor de crecimiento vascular endotelial (VEGF) y su receptor Flt1 (Cuadrado MJ, et al. 2006. J. Thromb. Haemost. 4:2461-69). La sobreexpresión de dichos mediadores protromboticos y proinflamatorios conducen a un estado pro-trombotico y al desarrollo de aterosclerosis acelerada en estos pacientes.Numerous mechanisms have been proposed to explain the prothrombotic / pro-inflammatory processes associated with PHC, although the pathogenesis appears to be multifactorial. An essential process is the monocytic activation induced by the antiphospholipid antibodies (ACA), which promotes an increase in procoagulant activity, by activating the main blood coagulation activating receptor, the Tissue Factor, whose expression is increased in monocytes of these patients (Square MJ, et al., 1997. Arthrítis Rheum., 40: 834-41). Intracellular signaling associated with such activation is mediated by protease activated receptors (PARs, -mediators of critical responses to thrombosis, hemostasis and inflammatory processes and participants in the development of arteriosclerosis), whose expression is also increased in monocytes of patients with FAS (López-Pedrera et al., Arthritis Rheum. 2010; 62: 869-77). In recent studies, it has been described that such intracellular signaling, induced by ACAs, involves the constitutive activation of MAPK and NFkB (López-Pedrera et al. 2006. Arthritis Rheum. 54: 301-11), as well as the promotion of expression of endothelial vascular growth factor (VEGF) and its Flt1 receptor (Square MJ, et al. 2006. J. Thromb. Haemost. 4: 2461-69). Overexpression of these prothrombotic and proinflammatory mediators leads to a pro-thrombotic state and the development of accelerated atherosclerosis in these patients.
El control de los factores de riesgo de trombosis es pues crucial en los pacientes APS. El tratamiento tradicional de la trombosis se ha basado principalmente en la administración continuada de anticoagulantes. No obstante, el riesgo de sangrado es elevado y la ocurrencia de recurrencias es aun frecuente. Así pues, es necesaria la búsqueda de nuevas alternativas terapéuticas para el manejo de la afectación aterotrombótica en estos pacientes.The control of thrombosis risk factors is therefore crucial in APS patients. Traditional thrombosis treatment has been based primarily on continued administration of anticoagulants. However, the risk of bleeding is high and the occurrence of recurrences is still frequent. Thus, the search for new therapeutic alternatives for the management of atherothrombotic involvement in these patients is necessary.
MÉTODOS DE LA INVENCIÓNMETHODS OF THE INVENTION
Un segundo aspecto de la invención se refiere a un método de obtención de datos útiles para el diagnóstico, clasificación y/o seguimiento de un individuo o sujeto que potencialmente sufra del APS, de ahora en adelante primer método de la invención, que comprende:A second aspect of the invention relates to a method of obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from PHC, hereinafter the first method of the invention, comprising:
a) obtener una muestra biológica aislada de un individuo,a) obtain an isolated biological sample from an individual,
a’) cuantificar el producto de expresión del miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, y/o miR-15a,a ’) quantify the expression product of miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and / or miR-15a,
o alternativamente,or alternatively
55
1010
15fifteen
20twenty
2525
3030
a) cuantificar el producto de expresión de los biomarcadores miR-124, miR-145, miR- 20a, miR-296, miR-34a, miR-374, miR-19b, y/o miR-15a en una muestra biológica aislada de dicho individuo.a) quantify the expression product of the biomarkers miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and / or miR-15a in an isolated biological sample of said individual.
Aunque preferiblemente se cuantifica el producto de expresión de los 8 microARNs simultáneamente, para la obtención de datos útiles para el diagnóstico, clasificación y/o seguimiento de un individuo o sujeto que potencialmente sufra APS, la detección de cualquiera de ellos y, preferiblemente de las ratios: miR-20a/miR-145, miR-145/miR-296, miR-374/miR34a, miR374/124, miR-19b/miR-15a, miR-20a/miR-374, miR-374/miR-34a, miR-19b/miR-124 y miR-15a/miR-296, resulta informativo.Although the expression product of the 8 microRNAs is preferably quantified simultaneously, in order to obtain useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from APS, the detection of any of them and, preferably of ratios: miR-20a / miR-145, miR-145 / miR-296, miR-374 / miR34a, miR374 / 124, miR-19b / miR-15a, miR-20a / miR-374, miR-374 / miR- 34a, miR-19b / miR-124 and miR-15a / miR-296, is informative.
El término "producto de expresión”, también denominado "producto génico” se refiere al material bioquímico, ya sea ARN (por ejemplo microARN) o proteína, resultante de la expresión de un gen. Algunas veces se usa una medida de la cantidad de producto génico para inferir qué tan activo es un gen.The term "expression product", also called "gene product" refers to the biochemical material, either RNA (for example microRNA) or protein, resulting from the expression of a gene. Sometimes a measure of the amount of gene product is used to infer how active a gene is.
La cuantificación del producto de expresión de los microARNs, o la detección de la expresión de sus correspondientes genes, puede realizarse por cualquiera de los métodos conocidos en el estado de la técnica. Preferiblemente, la cuantificación se realiza mediante PCR a tiempo real (Q-RT-PCR).The quantification of the expression product of the microRNAs, or the detection of the expression of their corresponding genes, can be carried out by any of the methods known in the state of the art. Preferably, the quantification is performed by real-time PCR (Q-RT-PCR).
La medida de los niveles de expresión de un gen, preferiblemente de manera cuantitativa, está basada en una señal que se obtiene directamente de los transcritos de dichos genes (ARNm, microARN, etc.), y que está correlacionada directamente con el número de moléculas de ARN producidas por los genes. Dicha señal - a la que también podemos referirnos como señal de intensidad - puede obtenerse, por ejemplo, midiendo un valor de intensidad de una propiedad química o física de dichos productos. Por otro lado, se podría realizar mediante medida indirecta que se refiere a la medida obtenida de un componente secundario o un sistema de medida biológica (por ejemplo la medida de respuestas celulares, ligandos, "etiquetas” o productos de reacción enzimática).The measurement of the expression levels of a gene, preferably quantitatively, is based on a signal that is obtained directly from the transcripts of said genes (mRNA, microRNA, etc.), and that is directly correlated with the number of molecules of RNA produced by genes. Said signal - which we can also refer to as an intensity signal - can be obtained, for example, by measuring an intensity value of a chemical or physical property of said products. On the other hand, it could be done by indirect measurement that refers to the measurement obtained from a secondary component or a biological measurement system (for example the measurement of cellular responses, ligands, "tags" or enzymatic reaction products).
La técnica preferiblemente utilizada es la llamada reacción en cadena de la polimerasa (PCR) en tiempo real. Según esta técnica, utilizando oligonucleótidos, enzimas, cebadores y solución tampón, se amplifica de forma exponencial un fragmento de ADN original. Esta técnica es llevada a cabo en un aparato llamado termociclador que mantiene la temperatura necesaria en cada una de las etapas que conforman un ciclo. La detección en tiempo real se basa en la utilización de marcadores fluorescentes (sondas) que se unen a todas las secuencias de doble cadena de ADN formadas en los ciclos de la reacción de PCR. Una vezThe technique preferably used is the so-called real-time polymerase chain reaction (PCR). According to this technique, using an oligonucleotide, enzymes, primers and buffer solution, an original DNA fragment is exponentially amplified. This technique is carried out in an apparatus called thermocycler that maintains the necessary temperature in each of the stages that make up a cycle. Real-time detection is based on the use of fluorescent markers (probes) that bind to all double stranded DNA sequences formed in the cycles of the PCR reaction. One time
1010
15fifteen
20twenty
que el marcador se une al ácido nucleico de doble cadena, éste emite una señal fluorescente que se procesa en tiempo real (Walter et al., 2002, Science, 296, 557-559). El ciclo al cual la emisión de la intensidad del marcador fluorescente supera un umbral determinado es llamado Ct. Los niveles de expresión de un microARN son calculados comoSince the marker binds to the double stranded nucleic acid, it emits a fluorescent signal that is processed in real time (Walter et al., 2002, Science, 296, 557-559). The cycle at which the emission of the fluorescent marker intensity exceeds a certain threshold is called Ct. The expression levels of a microRNA are calculated as
2"Ct2 "Ct
En una realización preferida de este aspecto de la invención, el primer método de la invención además comprende:In a preferred embodiment of this aspect of the invention, the first method of the invention further comprises:
b) calcular el índice A según la ecuación:b) calculate the index A according to the equation:
donde: Po = -7,01449, Pi= 1,13676, P2= 0,16051, P3= 0,19897, P4= 0,20980, P5= 0,13676, xi = -log2 (miR20a/miR145), x2 = -log2 (miR145/miR296), x3 = -log2 (miR374/miR34a), x4 = -log2 (miR374/miR124) y x5 = edad del paciente,where: Po = -7,01449, Pi = 1,13676, P2 = 0,16051, P3 = 0,19897, P4 = 0.20980, P5 = 0.13676, xi = -log2 (miR20a / miR145), x2 = -log2 (miR145 / miR296), x3 = -log2 (miR374 / miR34a), x4 = -log2 (miR374 / miR124) and x5 = patient age,
c) calcular los índices B1, B2 y/o B3 según las ecuaciones:c) calculate the indices B1, B2 and / or B3 according to the equations:
B1 = -log2 (miR19b/miR15a); B2 = -log2 (miR20a/miR374); B3 = -log2 (miR374/miR34a)B1 = -log2 (miR19b / miR15a); B2 = -log2 (miR20a / miR374); B3 = -log2 (miR374 / miR34a)
d) calcular los índices C1 y/o C2 según las ecuaciones:d) calculate the C1 and / or C2 indices according to the equations:
C1 = -log2 (miR19b/miR124); C2 = -log2 (miR19a/miR296)C1 = -log2 (miR19b / miR124); C2 = -log2 (miR19a / miR296)
asignando en cada ecuación los valores de los biomarcadores correspondientes obtenidos en el paso (a).assigning in each equation the values of the corresponding biomarkers obtained in step (a).
De esta manera, para el cálculo de los índices de la invención A-C hay que considerar que el valor de los cocientes entre los biomarcadores de microARNs (miRX/miRY) se obtiene mediante el log2(2"CtX/2"CtY), donde miRX o X se refiere al microARN indicado en el numerador y miRY o Y indicado microARN en el denominador.Thus, for the calculation of the indices of the invention AC it is necessary to consider that the value of the quotients between the biomarkers of microRNAs (miRX / miRY) is obtained by log2 (2 "CtX / 2" CtY), where miRX or X refers to the microRNA indicated in the numerator and miRY or Y indicated microRNA in the denominator.
55
1010
15fifteen
20twenty
2525
3030
Un tercer aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante segundo método de la invención, queA third aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereinafter the second method of the invention, which
comprende los pasos (a) y (b) según el primer método de la invención, y ademásIt comprises steps (a) and (b) according to the first method of the invention, and also
comprende:understands:
e) clasificar al individuo del paso (a) en el grupo de individuos con APS cuando el valor del índice A del paso (b) sea preferiblemente mayor que 0,4, más preferiblemente mayor que 0,5, y aún más preferiblemente mayor que 0,6.e) classify the individual of step (a) in the group of individuals with APS when the value of the index A of step (b) is preferably greater than 0.4, more preferably greater than 0.5, and even more preferably greater than 0.6.
Un cuarto aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante tercer método de la invención, queA fourth aspect of the invention relates to a method for diagnosis, classification and / or follow-up of PHC, hereinafter the third method of the invention, which
comprende los pasos (a) y (c) según el primer método de la invención, y ademásIt comprises steps (a) and (c) according to the first method of the invention, and also
comprende:understands:
f) clasificar al individuo del paso (a) en el grupo de individuos con APS con trombosis arterial cuando el valor del índice B2 del paso (c) sea preferiblemente mayor que 4,9, más preferiblemente mayor que 5,2, y aún más preferiblemente mayor que 5,542.f) classify the individual from step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably greater than 4.9, more preferably greater than 5.2, and even more preferably greater than 5,542.
Un quinto aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante cuarto método de la invención, queA fifth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereinafter the fourth method of the invention, which
comprende los pasos (a) y (c) según el primer método de la invención, y ademásIt comprises steps (a) and (c) according to the first method of the invention, and also
comprende:understands:
g) clasificar al individuo del paso (a) en el grupo de individuos con APS con trombosis venosa cuando el valor del índice B2 del paso (c) sea preferiblemente menor que 5,742, más preferiblemente menor que 5,642, y aún más preferiblemente menor o igual que 5,542 y cuando el valor del índice B3 del paso (c) sea preferiblemente menor que -0,165, más preferiblemente menor que -0,265, y aún más preferiblemente menor o igual que -0,356.g) classify the individual from step (a) in the group of individuals with PHC with venous thrombosis when the B2 index value of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542 and when the value of the B3 index of step (c) is preferably less than -0,165, more preferably less than -0,265, and even more preferably less than or equal to -0,356.
Un sexto aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante quinto método de la invención, queA sixth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereinafter the fifth method of the invention, which
comprende los pasos (a) y (c) según el primer método de la invención, y ademásIt comprises steps (a) and (c) according to the first method of the invention, and also
comprende:understands:
h) clasificar al individuo del paso (a) en el grupo de individuos con APS con trombosis arterial cuando el valor del índice B2 del paso (c) sea preferiblemente menor que 5,742, más preferiblemente menor que 5,642, y aún más preferiblemente menor o igual que 5,542 y cuando el valor del índice B3 del paso (c) se encuentra preferiblemente en el rango entre (0,556, 0,736), más preferiblemente en el rango entre (-0,456, 0,636), y aún másh) classify the individual of step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542 and when the value of the B3 index of step (c) is preferably in the range between (0.556, 0.736), more preferably in the range between (-0.456, 0.636), and even more
55
1010
15fifteen
20twenty
2525
3030
preferiblemente entre (-0,356, 0,536], indicando el corchete que el valor 0,536 está incluido en el intervalo.preferably between (-0.356, 0.536], the bracket indicating that the value 0.536 is included in the range.
Un séptimo aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante sexto método de la invención, que comprende los pasos (a) y (c) según el primer método de la invención, y además comprende:A seventh aspect of the invention relates to a method for the diagnosis, classification and / or follow-up of PHC, hereafter referred to as the sixth method of the invention, comprising steps (a) and (c) according to the first method of the invention, and also comprises:
i) clasificar al individuo del paso (a) en el grupo de individuos con APS con trombosis arterial cuando el valor del índice B2 del paso (c) sea preferiblemente menor que 5,742, más preferiblemente menor que 5,642, y aún más preferiblemente menor o igual que 5,542, cuando el valor del índice B3 del paso (c) sea preferiblemente mayor que 0,336, más preferiblemente mayor que 0,436, y aún más preferiblemente mayor que 0,536, y cuando el valor del índice B1 del paso (c) sea preferiblemente menor que 5,152, más preferiblemente menor que 5,052, y aún más preferiblemente menor o igual que 4,952.i) classify the individual of step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542, when the value of the index B3 of step (c) is preferably greater than 0.336, more preferably greater than 0.436, and even more preferably greater than 0.536, and when the value of index B1 of step (c) is preferably less than 5,152, more preferably less than 5,052, and even more preferably less than or equal to 4,952.
Un octavo aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante séptimo método de la invención, que comprende los pasos (a) y (c) según el primer método de la invención, y además comprende:An eighth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereafter referred to as the seventh method of the invention, which comprises steps (a) and (c) according to the first method of the invention, and also comprises:
j) clasificar al individuo del paso (a) en el grupo de individuos con APS con trombosis arterial cuando el valor del índice B2 del paso (c) sea preferiblemente menor que 5,742, más preferiblemente menor que 5,642, y aún más preferiblemente menor o igual que 5,542, cuando el valor del índice B3 del paso (c) sea preferiblemente mayor que 0,336, más preferiblemente mayor que 0,436, y aún más preferiblemente mayor que 0,536, y cuando el valor del índice B1 del paso (c) sea preferiblemente mayor que 4,752, más preferiblemente mayor que 4,852, y aún más preferiblemente mayor que 4,952.j) classify the individual of step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542, when the value of index B3 of step (c) is preferably greater than 0.336, more preferably greater than 0.436, and even more preferably greater than 0.536, and when the value of index B1 of step (c) is preferably greater than 4,752, more preferably greater than 4,852, and even more preferably greater than 4,952.
El término "APS con trombosis arterial” se refiere a pacientes que han presentado episodios de trombosis en alguna zona del árbol arterial (TA). La TA más común en el APS ocurre en el cerebro, manifestándose como accidente cerebro-vascular establecido o un ataque isquémico transitorio. Estos eventos isquémicos pueden ser recurrentes y múltiples, progresando el paciente hacia un estado de demencia vascular. Otros tipos de eventos trombóticos arteriales se presentan en el mesenterio, y su expresión clínica es la de una angina o de necrosis intestinal; en las extremidades, manifestándose como una gangrena, o coronario, con angina o infarto de miocardio. Se han descrito adicionalmente algunos casos de hipertensión severa asociada con trombosis arterial renal y glomerular.The term "APS with arterial thrombosis" refers to patients who have had episodes of thrombosis in some area of the arterial tree (AT). The most common AT in the APS occurs in the brain, manifesting itself as an established cerebrovascular accident or an attack Transient ischemic These ischemic events can be recurrent and multiple, progressing the patient towards a state of vascular dementia Other types of arterial thrombotic events occur in the mesentery, and their clinical expression is that of an angina or intestinal necrosis; extremities, manifesting as a gangrene, or coronary, with angina or myocardial infarction Some cases of severe hypertension associated with renal and glomerular arterial thrombosis have been described.
55
1010
15fifteen
20twenty
2525
3030
El término "APS con trombosis venosa” se refiere a pacientes que han presentado episodios de trombosis en alguna zona del árbol venoso (TV). La trombosis venosa profunda es la manifestación trombótica de tipo venoso más frecuentemente asociada con el APS; es a menudo recurrente y puede llevar a tromboembolismo pulmonar en la tercera parte de los pacientes. Otras formas menos comunes son las trombosis de las venas renales, el síndrome de Budd-Chiari, el compromiso de las venas porta o mesentérica o de las glándulas suprarrenales, que puede derivar en hemorragias e insuficiencia. Tambien se ha informado la trombosis de la vena central de la retina.The term "APS with venous thrombosis" refers to patients who have had episodes of thrombosis in some area of the venous tree (TV). Deep vein thrombosis is the thrombotic manifestation of the venous type most frequently associated with APS; it is often recurrent and can lead to pulmonary thromboembolism in a third of the patients.Other less common forms are thrombosis of the renal veins, Budd-Chiari syndrome, the involvement of the portal or mesenteric veins or the adrenal glands, which can derive in hemorrhages and insufficiency Thrombosis of the central vein of the retina has also been reported.
Un noveno aspecto de la invención se refiere a un método para el diagnóstico, clasificación y/o seguimiento del APS, de ahora en adelante octavo método de la invención, que comprende los pasos (a) y (d) según el primer método de la invención, y además comprende:A ninth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereafter referred to as the eighth method of the invention, comprising steps (a) and (d) according to the first method of the invention, and also comprises:
k) clasificar al individuo del paso (a) en el grupo de individuos con APS con aterosclerosis o ecodoppler patológico cuando el valor del índice C1 del paso (d) sea preferiblemente menor que 13,198, más preferiblemente menor que 12,198, y aún más preferiblemente menor o igual que 11,198 y cuando el valor del índice C2 del paso (d) sea preferiblemente mayor que 5,690, más preferiblemente mayor que 6,690, y aún más preferiblemente sea mayor que 7,690.k) classify the individual from step (a) in the group of individuals with PHC with atherosclerosis or pathological echodoppler when the value of the C1 index of step (d) is preferably less than 13,198, more preferably less than 12,198, and even more preferably less or equal to 11,198 and when the value of the C2 index of step (d) is preferably greater than 5,690, more preferably greater than 6,690, and even more preferably greater than 7,690.
En pacientes APS también se detecta la presencia de “aterosclerosis” o “ecodoppler patológico” (síndrome caracterizado por el depósito e infiltración de sustancias lipídicas en la capa íntima de las paredes de las arterias de mediano y grueso calibre que deriva en el cierre del vaso y el desarrollo de trombosis), facilitada por la presencia de autoanticuerpos de tipo anti-cardiolipina de isotipo IgG en estos pacientes.In the APS patients, the presence of "atherosclerosis" or "pathological echodoppler" (syndrome characterized by the deposition and infiltration of lipid substances in the intimate layer of the walls of the medium and thick caliber arteries that results in the closure of the vessel is also detected and the development of thrombosis), facilitated by the presence of IgG isotype anti-cardiolipin autoantibodies in these patients.
En una realización preferida de cualquiera de los aspectos de la invención, la muestra biológica aislada del paso (a) es una muestra de plasma, suero u orina. Preferiblemente la muestra biológica aislada del paso (a) es una muestra de plasma.In a preferred embodiment of any aspect of the invention, the biological sample isolated from step (a) is a plasma, serum or urine sample. Preferably the biological sample isolated from step (a) is a plasma sample.
Una “muestra biológica aislada” incluye, pero sin limitarnos a, células, tejidos y/o fluidos biológicos de un organismo, obtenidos mediante cualquier método conocido por un experto en la materia. Preferiblemente, la muestra biológica aislada del paso (a) es una muestra de plasma.An "isolated biological sample" includes, but is not limited to, cells, tissues and / or biological fluids of an organism, obtained by any method known to a person skilled in the art. Preferably, the biological sample isolated from step (a) is a plasma sample.
Los métodos de la invención pueden desarrollarse independientemente o conjuntamente, en cualquier combinación de los mismos.The methods of the invention can be developed independently or together, in any combination thereof.
55
1010
15fifteen
20twenty
2525
3030
Los pasos (a), (b), (c), (d), (e), (f), (g), (h), (i), (j) y/o (k) de los métodos descritos anteriormente pueden ser total o parcialmente automatizados, por ejemplo, por medio de un equipo robótico sensor para la cuantificación del paso (a) o el cálculo computarizado de cualquiera de los índices de los pasos (b), (c) y/o (d), o la clasificación computarizada en los pasos (e), (f), (g), (h), (i), (j) y/o (k).Steps (a), (b), (c), (d), (e), (f), (g), (h), (i), (j) and / or (k) of the methods described above can be totally or partially automated, for example, by means of a robotic sensor device for the quantification of step (a) or the computerized calculation of any of the indices of steps (b), (c) and / or ( d), or the computerized classification in steps (e), (f), (g), (h), (i), (j) and / or (k).
KIT O DISPOSITIVO DE LA INVENCIÓN, MICROARRAYDE LA INVENCIÓN Y USOSKIT OR DEVICE OF THE INVENTION, MICROARRAYDE OF THE INVENTION AND USES
Un décimo aspecto de la invención se refiere a un kit o dispositivo, de ahora en adelante kit o dispositivo de la invención, que comprende los elementos necesarios para detectar los niveles de expresión de los microARNs: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, y miR-15a, tal y como se han definido en el primer aspecto de la invención.A tenth aspect of the invention relates to a kit or device, hereafter kit or device of the invention, comprising the elements necessary to detect the expression levels of the microRNAs: miR-124, miR-145, miR- 20a, miR-296, miR-34a, miR-374, miR-19b, and miR-15a, as defined in the first aspect of the invention.
En una realización preferida de este aspecto de la invención, el kit o dispositivo de la invención comprende cebadores, sondas y/o anticuerpos capaces de cuantificar el producto de expresión los microARN: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR- 19b, y miR-15a, y donde:In a preferred embodiment of this aspect of the invention, the kit or device of the invention comprises primers, probes and / or antibodies capable of quantifying the microRNA expression product: miR-124, miR-145, miR-20a, miR- 296, miR-34a, miR-374, miR-19b, and miR-15a, and where:
- los cebadores o primers son secuencias de polinucleótidos de entre 10 y 30 pares de bases, más preferiblemente de entre 15 y 25 pares de bases, aún más preferiblemente de entre 18 y 22 pares de bases, y aún mucho más preferiblemente de alrededor de 20 pares de bases, que presentan una identidad de al menos un 80%, más preferiblemente de al menos un 90%, aún más preferiblemente de al menos un 95%, aún mucho más preferiblemente de al menos un 98%, y particularmente de un 100%, con un fragmento de las secuencias complementarias a la SEQ ID N°: 1, SEQ ID N°: 2, SEQ ID N°: 3, SEQ ID N°: 4, SEQ ID N°: 5, SEQ ID N°: 6, SEQ ID N°: 7, SEQ ID N°: 8, SEQ ID N°: 9, SEQ ID N°: 10, SEQ ID N°: 11, SEQ ID N°: 12, SEQ ID N°: 13, SEQ ID N°: 14, SEQ ID N°: 15, SEQ ID N°: 16.- primers or primers are polynucleotide sequences of between 10 and 30 base pairs, more preferably between 15 and 25 base pairs, even more preferably between 18 and 22 base pairs, and still much more preferably about 20 base pairs, which have an identity of at least 80%, more preferably at least 90%, even more preferably at least 95%, still much more preferably at least 98%, and particularly 100 %, with a fragment of the sequences complementary to SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 5, SEQ ID N ° : 6, SEQ ID No.: 7, SEQ ID No.: 8, SEQ ID No.: 9, SEQ ID No.: 10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 16.
- las sondas son secuencias de polinucleótidos de entre 80 y 1100 pares de bases, más preferiblemente de entre 100 y 1000 pares de bases, y aún más preferiblemente de entre 200 y 500 pares de bases, que presentan una identidad de al menos un 80%, más preferiblemente de al menos un 90%, aún más preferiblemente de al menos un 95%, aún mucho más preferiblemente de al menos un 98%, y particularmente de un 100%, con un fragmento de las secuencias complementarias a la SEQ ID N°: 1, SEQ ID N°: 2, SEQ ID N°: 3, SEQ ID N°: 4, SEQ ID N°: 5, SEQ ID N°: 6, SEQ ID N°: 7, SEQ ID N°: 8, SEQ ID N°: 9,- the probes are polynucleotide sequences of between 80 and 1100 base pairs, more preferably between 100 and 1000 base pairs, and even more preferably between 200 and 500 base pairs, which have an identity of at least 80% , more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, and particularly 100%, with a fragment of the sequences complementary to SEQ ID N °: 1, SEQ ID No.: 2, SEQ ID No.: 3, SEQ ID No.: 4, SEQ ID No.: 5, SEQ ID No.: 6, SEQ ID No.: 7, SEQ ID No. : 8, SEQ ID N °: 9,
SEQ ID N°: 10, SEQ ID N°: 11, SEQ ID N°: 12, SEQ ID N°: 13, SEQ ID N°: 14, SEQ ID N°: 15, SEQ ID N°: 16.SEQ ID N °: 10, SEQ ID N °: 11, SEQ ID N °: 12, SEQ ID N °: 13, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 16.
- los anticuerpos son capaces de unirse a una región formada por cualquiera de las secuencias nucleotídicas SEQ ID N°: 1, SEQ ID N°: 2, SEQ ID N°: 3, SEQ ID N°: 4, SEQ ID 5 N°: 5, SEQ ID N°: 6, SEQ ID N°: 7, SEQ ID N°: 8, SEQ ID N°: 9, SEQ ID N°: 10, SEQ ID N°:- the antibodies are capable of binding to a region formed by any of the nucleotide sequences SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID 5 N ° : 5, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8, SEQ ID N °: 9, SEQ ID N °: 10, SEQ ID N °:
11, SEQ ID N°: 12, SEQ ID N°: 13, SEQ ID N°: 14, SEQ ID N°: 15, SEQ ID N°: 16.11, SEQ ID N °: 12, SEQ ID N °: 13, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 16.
En otra realización preferida de este aspecto de la invención, los anticuerpos están modificados. En otra realización preferida de este aspecto de la invención, el anticuerpo es humano, humanizado o sintético. En otra realización preferida, el anticuerpo es monoclonal 10 y/o se encuentra marcado con un fluorocromo. Preferiblemente, el fluorocromo se selecciona de la lista que comprende Fluoresceína (FITC), Tetrametilrodamina y derivados, Ficoeritrina (PE), PerCP, Cy5, Texas, aloficocianina, o cualquiera de sus combinaciones.In another preferred embodiment of this aspect of the invention, the antibodies are modified. In another preferred embodiment of this aspect of the invention, the antibody is human, humanized or synthetic. In another preferred embodiment, the antibody is monoclonal 10 and / or is labeled with a fluorochrome. Preferably, the fluorochrome is selected from the list comprising Fluorescein (FITC), Tetramethylrodamine and derivatives, Phycoerythrin (PE), PerCP, Cy5, Texas, allophycocyanin, or any combination thereof.
Tabla 1. microARNs de la invención.Table 1. microRNAs of the invention.
- Nombre del gen Gene name
- Gen ID Nombre del miARN Secuencia del gen Secuencia del miARN Gene ID MiRNA name Gene sequence MiRNA sequence
- microARN-124a (MIR124A) microRNA-124a (MIR124A)
- 406907 hsa-miR-124-3p SEQ ID NO: 1 SEQ ID NO: 9 406907 hsa-miR-124-3p SEQ ID NO: 1 SEQ ID NO: 9
- microARN-145 (MIR145) microRNA-145 (MIR145)
- 406937 hsa-miR145-5p SEQ ID NO: 2 SEQ ID NO: 10 406937 hsa-miR145-5p SEQ ID NO: 2 SEQ ID NO: 10
- microARN-20a (MIR20A) microRNA-20a (MIR20A)
- 406982 hsa-miR20a-5p SEQ ID NO: 3 SEQ ID NO: 11 406982 hsa-miR20a-5p SEQ ID NO: 3 SEQ ID NO: 11
- microARN-296 (MIR296) microRNA-296 (MIR296)
- 407022 hsa-miR296-5p SEQ ID NO: 4 SEQ ID NO: 12 407022 hsa-miR296-5p SEQ ID NO: 4 SEQ ID NO: 12
- microRNA-34a (MIR34a) microRNA-34a (MIR34a)
- 447040 hsa-miR34a-5p SEQ ID NO: 5 SEQ ID NO: 13 447040 hsa-miR34a-5p SEQ ID NO: 5 SEQ ID NO: 13
- microRNA-374a (MIR374A) microRNA-374a (MIR374A)
- 442919 hsa-miR374a-5p SEQ ID NO: 6 SEQ ID NO: 14 442919 hsa-miR374a-5p SEQ ID NO: 6 SEQ ID NO: 14
- microRNA-19b (MIR19b) microRNA-19b (MIR19b)
- 406980 hsa-miR19b-3p SEQ ID NO: 7 SEQ ID NO: 15 406980 hsa-miR19b-3p SEQ ID NO: 7 SEQ ID NO: 15
- microRNA-15A (MIR15A) microRNA-15A (MIR15A)
- 406948 hsa-miR15a-5p SEQ ID NO: 8 SEQ ID NO: 16 406948 hsa-miR15a-5p SEQ ID NO: 8 SEQ ID NO: 16
En el contexto de la presente invención, los genes MIR124A, MIR145, MIR20A, MIR296, MIR34a, MIR374A, MIR19b y MIR15A se definen también por una secuencia de nucleótidos o polinucleótido, que constituye la secuencia codificante de los microARNs recogidas 5 respectivamente en las SEQ ID recogidas en la tabla 1, y que comprendería a diversas variantes procedentes de:In the context of the present invention, the genes MIR124A, MIR145, MIR20A, MIR296, MIR34a, MIR374A, MIR19b and MIR15A are also defined by a nucleotide sequence or polynucleotide, which constitutes the coding sequence of the microRNAs collected respectively in SEQ IDs listed in table 1, and which would include various variants from:
a) moléculas de ácido nucleico que codifican un microARN que comprende la secuencia nucleotídica de la SEQ ID recogidas en la tabla 1,a) nucleic acid molecules encoding a microRNA comprising the nucleotide sequence of SEQ ID listed in table 1,
b) moléculas de ácido nucleico cuya cadena complementaria híbrida con la secuencia 10 polinucleotídica de a),b) nucleic acid molecules whose complementary hybrid chain with the polynucleotide sequence of a),
c) moléculas de ácido nucleico cuya secuencia difiere de a) y/o b) debido a la degeneración del código genético,c) nucleic acid molecules whose sequence differs from a) and / or b) due to the degeneracy of the genetic code,
d) moléculas de ácido nucleico que codifican un microARN que comprende la secuencia nucleotídica con una identidad de al menos un 80%, un 90%, un 95%, un 98% o un 99% cond) nucleic acid molecules encoding a microRNA comprising the nucleotide sequence with an identity of at least 80%, 90%, 95%, 98% or 99% with
15 las SEQ ID recogidas en la tabla 1, respectivamente, y en las que el microARN codificado por dichos ácidos nucleicos posee la actividad y las características estructurales de los15 the SEQ IDs listed in Table 1, respectively, and in which the microRNA encoded by said nucleic acids possesses the activity and structural characteristics of the
microARNs MIR124A, MIR145, MIR20A, MIR296, MIR34a, MIR374A, MIR19b y MIR15A. Entre dichas moléculas de ácido nucleico se encuentra las recogidas en las SEQ ID indicadas en la tabla1.microRNAs MIR124A, MIR145, MIR20A, MIR296, MIR34a, MIR374A, MIR19b and MIR15A. Among these nucleic acid molecules are those collected in the SEQ IDs indicated in table 1.
Secuencias de la invención:Sequences of the invention:
5 SEQ ID NO: 1:5 SEQ ID NO: 1:
AGGCCTCTCTCTCCGTGTTCACAGCGGACCTTGATTTAAATGTCCATACAATTAAGGCACAGGCCTCTCTCTCCGTGTTCACAGCGGACCTTGATTTAAATGTCCATACAATTAAGGCAC
GCGGTGAATGCCAAGAATGGGGCTGGCGGTGAATGCCAAGAATGGGGCTG
SEQ ID NO: 2:SEQ ID NO: 2:
CACCTTGTCCTCACGGTCCAGTTTTCCCAGGAATCCCTTAGATGCTAAGATGGGGATTC 10 CTGGAAATACTGTTCTTGAGGTCATGGTTCACCTTGTCCTCACGGTCCAGTTTTCCCAGGAATCCCTTAGATGCTAAGATGGGGATTC 10 CTGGAAATACTGTTCTTGAGGTCATGGTT
SEQ ID NO: 3:SEQ ID NO: 3:
GTAGCACTAAAGTGCTTATAGTGCAGGTAGTGTTTAGTTATCTACTGCATTATGAGCACTGTAGCACTAAAGTGCTTATAGTGCAGGTAGTGTTTAGTTATCTACTGCATTATGAGCACT
TAAAGTACTGCTAAAGTACTGC
SEQ ID NO: 4:SEQ ID NO: 4:
15 AGGACCCTTCCAGAGGGCCCCCCCTCAATCCTGTTGTGCCTAATTCAGAGGGTTGGGT GGAGGCTCTCCTGAAGGGCTCT15 AGGACCCTTCCAGAGGGCCCCCCCTCAATCCTGTTGTGCCTAATTCAGAGGGTTGGGT GGAGGCTCTCCTGAAGGGCTCT
SEQ ID NO: 5:SEQ ID NO: 5:
GGCCAGCTGTGAGTGTTTCTTTGGCAGTGTCTTAGCTGGTTGTTGTGAGCAATAGTAAG G AAGCAATCAGCAAGTATACTGCCCTAGAAGTGCTGCACGTTGTGGGGCCCGGCCAGCTGTGAGTGTTTCTTTGGCAGTGTCTTAGCTGGTTGTTGTGAGCAATAGTAAG G AAGCAATCAGCAAGTATACTGCCCTAGAAGTGCTGCACGTTGTGGGGCCC
20 SEQ ID NO: 6:20 SEQ ID NO: 6:
TACATCGGCCATTATAATACAACCTGATAAGTGTTATAGCACTTATCAGATTGTATTGTAATACATCGGCCATTATAATACAACCTGATAAGTGTTATAGCACTTATCAGATTGTATTGTAA
TTGTCTGTGTATTGTCTGTGTA
SEQ ID NO: 7:SEQ ID NO: 7:
CACTGTTCTATGGTTAGTTTTGCAGGTTTG CATCCAGCTGTGTGATATTCTGCTGTGCAA 25 ATCCATGCAAAACTGACTGTGGTAGTGCACTGTTCTATGGTTAGTTTTGCAGGTTTG CATCCAGCTGTGTGATATTCTGCTGTGCAA 25 ATCCATGCAAAACTGACTGTGGTAGTG
SEQ ID NO: 8:SEQ ID NO: 8:
CCTTGGAGTAAAGTAGCAGCACATAATGGTTTGTGGATTTTGAAAAGGTGCAGGCCATA T TGTGCTGCCTCAAAAATACAAGGCCTTGGAGTAAAGTAGCAGCACATAATGGTTTGTGGATTTTGAAAAGGTGCAGGCCATA T TGTGCTGCCTCAAAAATACAAGG
SEQ ID NO: 9:SEQ ID NO: 9:
UAAGGCACGCGGUGAAUGCC 5 SEQ ID NO: 10:UAAGGCACGCGGUGAAUGCC 5 SEQ ID NO: 10:
GUCCAGUUUUCCCAGGAAUCCCU SEQ ID NO: 11:GUCCAGUUUUCCCAGGAAUCCCU SEQ ID NO: 11:
UAAAGUGCUUAUAGUGCAGGUAG SEQ ID NO: 12:UAAAGUGCUUAUAGUGCAGGUAG SEQ ID NO: 12:
10 AGGGCCCCCCCUCAAUCCUGU SEQ ID NO: 13:10 AGGGCCCCCCCUCAAUCCUGU SEQ ID NO: 13:
UGGCAGUGUCUUAGCUGGUUGU SEQ ID NO: 14:UGGCAGUGUCUUAGCUGGUUGU SEQ ID NO: 14:
UUAUAAUACAACCUGAUAAGUG 15 SEQ ID NO: 15:UUAUAAUACAACCUGAUAAGUG 15 SEQ ID NO: 15:
UGUGCAAAUCCAUGCAAAACUGA SEQ ID NO: 16:UGUGCAAAUCCAUGCAAAACUGA SEQ ID NO: 16:
UAGCAGCACAUAAUGGUUUGUGUAGCAGCACAUAAUGGUUUGUG
El kit además puede contener, sin ningún tipo de limitación, tampones, soluciones de 20 extracción de proteínas, agentes para prevenir la contaminación, inhibidores de la degradación de las proteínas, etc.The kit may also contain, without any limitation, buffers, protein extraction solutions, agents to prevent contamination, inhibitors of protein degradation, etc.
Por otro lado, el kit o dispositivo de la invención puede incluir todos los soportes y recipientes necesarios para su puesta en marcha y optimización. Preferiblemente, el kit comprende además las instrucciones para llevar a cabo cualquiera de los métodos de la 25 invención.On the other hand, the kit or device of the invention can include all the supports and containers necessary for its implementation and optimization. Preferably, the kit further comprises instructions for carrying out any of the methods of the invention.
El kit de la invención puede incluir controles positivos y/o negativos. El kit además puedeThe kit of the invention may include positive and / or negative controls. The kit can also
20twenty
55
1010
15fifteen
20twenty
2525
3030
contener, sin ningún tipo de limitación, tampones, soluciones de extracción de proteínas, agentes para prevenir la contaminación, inhibidores de la degradación de las proteínas, etc.contain, without any limitation, buffers, protein extraction solutions, agents to prevent contamination, inhibitors of protein degradation, etc.
En otra realización preferida de este aspecto de la invención, el kit o dispositivo de la invención es un kit de partes, que comprende un componente A, formado por un dispositivo para la recogida de la muestra del paso a), y un componente B, formado por los elementos necesarios para llevar a cabo el análisis cuantitativo en la muestra del paso a) o cualquiera de los métodos de la invención.In another preferred embodiment of this aspect of the invention, the kit or device of the invention is a kit of parts, comprising a component A, formed by a device for collecting the sample from step a), and a component B, formed by the elements necessary to carry out the quantitative analysis in the sample from step a) or any of the methods of the invention.
En una realización preferida el kit o dispositivo de la invención comprende oligonucleótidos. En otra realización preferida, los oligonucleótidos presentan modificaciones en alguno de sus nucleótidos, como por ejemplo, pero sin limitarnos a, nucleótidos que tengan alguno de sus átomos con un isótopo radiactivo, normalmente 32P o tritio, nucleótidos marcados inmunológicamente, como por ejemplo con una molécula de digoxigenina, y/o inmovilizadas en una membrana. Varias posibilidades son conocidas en el estado de la técnica.In a preferred embodiment the kit or device of the invention comprises oligonucleotides. In another preferred embodiment, the oligonucleotides have modifications in some of their nucleotides, such as, but not limited to, nucleotides having any of their atoms with a radioactive isotope, usually 32P or tritium, immunologically labeled nucleotides, such as with a Digoxigenin molecule, and / or immobilized on a membrane. Several possibilities are known in the state of the art.
Un décimo primer aspecto de la invención, se refiere a un microarray, de ahora en adelante microarray de la invención, que comprende oligonucleótidos o microarreglos de canal único diseñados a partir de las secuencias nucleotídicas SEQ ID N°: 1, SEQ ID N°: 2, SEQ ID N°: 3, SEQ ID N°: 4, SEQ ID N°: 5, SEQ ID N°: 6, SEQ ID N°: 7, SEQ ID N°: 8, SEQ ID N°: 9, SEQ ID N°: 10, SEQ ID N°: 11, SEQ ID N°: 12, SEQ ID N°: 13, SEQ ID N°: 14, SEQ ID N°: 15, SEQ ID N°: 16.A eleventh aspect of the invention relates to a microarray, hereafter referred to as a microarray of the invention, comprising oligonucleotides or single channel microarrays designed from the nucleotide sequences SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8, SEQ ID N °: 9 , SEQ ID N °: 10, SEQ ID N °: 11, SEQ ID N °: 12, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 15, SEQ ID N °: 16.
Así, por ejemplo, las secuencias de oligonucleótidos pueden ser construidas en la superficie un chip mediante el elongamiento secuencial de una cadena en crecimiento con un sólo nucleótido utilizando fotolitografía. Así, los oligonucleótidos son anclados por el extremo 3' mediante un método de activación selectiva de nucleótidos, protegidos por un reactivo fotolábil, mediante la incidencia selectiva de luz a través de una fotomáscara. La fotomáscara puede ser física o virtual.Thus, for example, oligonucleotide sequences can be constructed on the surface of a chip by sequential elongation of a growing chain with a single nucleotide using photolithography. Thus, the oligonucleotides are anchored at the 3 'end by a method of selective activation of nucleotides, protected by a photolabile reagent, by the selective incidence of light through a photomask. The photomask can be physical or virtual.
Así, las sondas de oligonucleótidos pueden ser de entre 10 y 100 nucleótidos, más preferiblemente, de entre 20 y 70 nucleótidos, y aún más preferiblemente, de entre 24 y 30 nucleótidos.Thus, oligonucleotide probes can be between 10 and 100 nucleotides, more preferably, between 20 and 70 nucleotides, and even more preferably, between 24 and 30 nucleotides.
La síntesis in situ sobre un soporte sólido (por ejemplo, vidrio), podría hacerse mediante tecnología chorro de tinta (ink-jet), lo que requiere sondas más largas. Los soportes podrían ser, pero sin limitarse a, filtros o membranas de NC o nylon (cargadas), silicio, o Portas de vidrio para microscopios cubiertos con aminosilanos, polilisina, aldehídos o epoxy. La sondaSynthesis in situ on a solid support (for example, glass) could be done using ink-jet technology, which requires longer probes. The supports could be, but not limited to, filters or membranes of NC or nylon (charged), silicon, or glass slides for microscopes covered with aminosilanes, polylysine, aldehydes or epoxy. Probe
55
1010
15fifteen
20twenty
2525
3030
es cada una de las muestras del chip. El target es la muestra a analizar: miARN, ARN mensajero, ARN total, un fragmento de PCR, etc.It is each of the chip samples. The target is the sample to be analyzed: miRNA, messenger RNA, total RNA, a PCR fragment, etc.
En una realización preferida de este aspecto de la invención, el microarray de la invención presenta oligonucleótidos modificados, como se han descrito en el anterior aspecto de la invención.In a preferred embodiment of this aspect of the invention, the microarray of the invention has modified oligonucleotides, as described in the previous aspect of the invention.
Un décimo segundo aspecto de la invención se refiere al uso del kit o dispositivo de la invención o del microarray de la invención, para la obtención de datos útiles para el diagnóstico, clasificación y/o seguimiento de un individuo o sujeto que potencialmente sufra APS.A twelfth aspect of the invention relates to the use of the kit or device of the invention or the microarray of the invention, for obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from PHC.
La invención se extiende también a programas de ordenador adaptados para que cualquier medio de procesamiento pueda llevar a la práctica los métodos de la invención. Tales programas pueden tener la forma de código fuente, código objeto, una fuente intermedia de código y código objeto, por ejemplo, como en forma parcialmente compilada, o en cualquier otra forma adecuada para uso en la puesta en práctica de los procesos según la invención. Los programas de ordenador también abarcan aplicaciones en la nube basadas en dicho procedimiento.The invention also extends to computer programs adapted so that any processing means can implement the methods of the invention. Such programs may have the form of source code, object code, an intermediate source of code and object code, for example, as in partially compiled form, or in any other form suitable for use in the implementation of the processes according to the invention . Computer programs also cover cloud applications based on that procedure.
Un décimo tercer aspecto de la invención se refiere a un programa de ordenador que comprende instrucciones de programa para hacer que un ordenador lleve a la práctica el procedimiento de acuerdo con cualquiera de los métodos de la invención.A thirteenth aspect of the invention relates to a computer program comprising program instructions to make a computer carry out the process according to any of the methods of the invention.
En particular, la invención abarca programas de ordenador dispuestos sobre o dentro de una portadora. La portadora puede ser cualquier entidad o dispositivo capaz de soportar el programa. Cuando el programa va incorporado en una señal que puede ser transportada directamente por un cable u otro dispositivo o medio, la portadora puede estar constituida por dicho cable u otro dispositivo o medio. Como variante, la portadora podría ser un circuito integrado en el que va incluido el programa, estando el circuito integrado adaptado para ejecutar, o para ser utilizado en la ejecución de, los procesos correspondientes.In particular, the invention encompasses computer programs arranged on or within a carrier. The carrier can be any entity or device capable of supporting the program. When the program is incorporated into a signal that can be directly transported by a cable or other device or medium, the carrier may be constituted by said cable or other device or means. As a variant, the carrier could be an integrated circuit in which the program is included, the integrated circuit being adapted to execute, or to be used in the execution of, the corresponding processes.
Por ejemplo, los programas podrían estar incorporados en un medio de almacenamiento, como una memoria ROM, una memoria CD ROM o una memoria ROM de semiconductor, una memoria USB, o un soporte de grabación magnética, por ejemplo, un disco flexible o un disco duro. Alternativamente, los programas podrían estar soportados en una señal portadora transmisible. Por ejemplo, podría tratarse de una señal eléctrica u óptica que podría transportarse a través de cable eléctrico u óptico, por radio o por cualesquiera otros medios.For example, the programs could be incorporated into a storage medium, such as a ROM, a CD ROM or a semiconductor ROM, a USB memory, or a magnetic recording medium, for example, a floppy disk or a disk Lasted. Alternatively, the programs could be supported on a transmissible carrier signal. For example, it could be an electrical or optical signal that could be transported through an electrical or optical cable, by radio or by any other means.
55
1010
15fifteen
20twenty
2525
3030
Un décimo cuarto aspecto de la invención se refiere a un medio de almacenamiento legible por un ordenador que comprende instrucciones de programa capaces de hacer que un ordenador lleve a cabo los pasos de cualquiera de los métodos de la invención.A fourteenth aspect of the invention relates to a computer-readable storage medium comprising program instructions capable of having a computer perform the steps of any of the methods of the invention.
Un décimo quinto aspecto de la invención se refiere a una señal transmisible que comprende instrucciones de programa capaces de hacer que un ordenador lleve a cabo los pasos de cualquiera de los métodos de la invención.A fifteenth aspect of the invention relates to a transmissible signal comprising program instructions capable of having a computer perform the steps of any of the methods of the invention.
Una "secuencia de ácido nucleico o polinucleótido” puede comprender las cinco bases que aparecen biológicamente (adenina, guanina, timina, citosina y uracilo) y/o bases distintas de las cinco que aparecen biológicamente. Estas bases pueden servir para distintos propósitos, por ejemplo, para estabilizar o desestabilizar la hibridación; para estimular o inhibir la degradación de la sonda; o como puntos de unión para restos detectables o restos de apantallamiento. Por ejemplo, un polinucleótido de la invención puede contener uno o más restos de base modificados, no estándar, derivatizados, incluyendo, pero sin limitarse a, N6- metil-adenina, N6-terc-butil-bencil-adenina, imidazol, imidazoles sustituidos, 5-fluorouracilo, 5-bromouracilo, 5-clorouracilo, 5-yodouracilo, hipoxantina, xantina, 4-acetilcitosina, 5- (carboxihidroximetil) uracilo, 5-carboximetilaminometil-2-tiouridina, 5-A "nucleic acid or polynucleotide sequence" may comprise the five bases that appear biologically (adenine, guanine, thymine, cytosine and uracil) and / or bases other than the five that appear biologically. These bases can serve different purposes, for example , to stabilize or destabilize hybridization; to stimulate or inhibit degradation of the probe; or as junction points for detectable moieties or screening moieties. For example, a polynucleotide of the invention may contain one or more modified base moieties, not standard, derivatized, including, but not limited to, N6-methyl-adenine, N6-tert-butyl-benzyl-adenine, imidazole, substituted imidazoles, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-
carboximetilaminometiluracilo, dihidrouracilo,beta-D-galactosilqueosina, inosina, N6- isopenteniladenina,1- metilguanina, 1-metilinosina, 2,2-dimetilguanina, 2-metiladenina, 2- metilguanina, 3-metilcitosina, 5-metilcitosina, N6-metiladenina, 7-metilguanina, 5- metilaminometiluracilo, 5-metoxiaminometil-2-tiouracilo, beta-D-manosilqueosina, 5'- metoxicarboximetiluracilo, 5-metoxiuracilo, 2-metiltio-N6-isopenteniladenina, ácido uracil-5- oxiacético, wybutoxosina, pesudouracilo, queosina, 2-tiocitosina, 5-metil-2-tiouracilo, 2- tiouracilo, 2-tiouracilo, 4-tiouracilo, 5-metiluracilo (es decir, timina), éster metílico del ácido uracil-5-oxiacético, 3-(3-amino-3-N-2-carboxipropil) uracilo, (acp3)w, 2,6-diaminopurina, y 5- propinil pirimidina. Otros ejemplos de restos de bases modificados, no estándar, o derivatizados pueden encontrarse en las Patentes de EEUU Nos. 6.001.611; 5.955.589; 5.844.106; 5.789.562; 5.750.343; 5.728.525; y 5.679.785. Además, una secuencia de ácido nucleico o polinucleótido puede comprender uno o más restos de azúcares modificados incluyendo, pero sin limitarse a, arabinosa, 2-fluoroarabinosa, xilulosa, y una hexosa.carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2- methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methylcytosine, N6 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylkeosine, 5'- methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5- oxyacetic acid, wybutoxyacyl, pestoxyrazine cheosin, 2-thiocytosine, 5-methyl-2-thiouracil, 2- thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil (i.e., thymine), uracil-5-oxyacetic acid methyl ester, 3- (3 -amino-3-N-2-carboxypropyl) uracil, (acp3) w, 2,6-diaminopurine, and 5- propynyl pyrimidine. Other examples of modified, non-standard, or derivatized base moieties can be found in US Pat. Nos. 6,001,611; 5,955,589; 5,844,106; 5,789,562; 5,750,343; 5,728,525; and 5,679,785. In addition, a nucleic acid or polynucleotide sequence may comprise one or more modified sugar moieties including, but not limited to, arabinose, 2-fluoroarabinous, xylulose, and a hexose.
Los términos "polinucleótido” y "ácido nucleico” se usan aquí de manera intercambiable, refiriéndose a formas poliméricas de nucleótidos de cualquier longitud, tanto ribonucleótidos (ARN ó RNA) como desoxirribonucleótidos (ADN ó DNA).The terms "polynucleotide" and "nucleic acid" are used interchangeably herein, referring to polymeric forms of nucleotides of any length, both ribonucleotides (RNA or RNA) and deoxyribonucleotides (DNA or DNA).
Los términos "secuencia aminoacídica”, "péptido”, "oligopéptido”, "polipéptido” y "proteína”The terms "amino acid sequence", "peptide", "oligopeptide", "polypeptide" and "protein"
se usan aquí de manera intercambiable, y se refieren a una forma polimérica dethey are used interchangeably here, and refer to a polymeric form of
232. 3
55
1010
15fifteen
20twenty
2525
3030
aminoácidos de cualquier longitud, que pueden ser codificantes o no codificantes, química o bioquímicamente modificados.amino acids of any length, which may be coding or non-coding, chemically or biochemically modified.
En la presente invención se entiende por variante o fragmento biológicamente activo, aquellas variantes o fragmentos de los péptidos indicados que tienen un efecto fisiológico, metabólico o inmunológico igual, o presentan la misma utilidad que los descritos. Esto es, son funcionalmente equivalentes. Dichos efectos se pueden determinar mediante métodos convencionales.The present invention means biologically active variant or fragment, those variants or fragments of the indicated peptides that have the same physiological, metabolic or immunological effect, or have the same utility as those described. That is, they are functionally equivalent. Such effects can be determined by conventional methods.
El término "identidad", tal y como se utiliza en esta memoria, hace referencia a Ia proporción de nucleótidos o aminoácidos idénticos entre dos secuencias nucleotídicas o aminoacídicas que se comparan. Los métodos de comparación de secuencias son conocidos en el estado de Ia técnica, e incluyen, aunque sin limitarse a ellos, el programa GAG, incluyendo GAP (Devereux et al., Nucleic Acids Research 12: 287 (1984) Genetics Computer Group University of Wisconsin, Madison, (Wl); BLAST, BLASTP o BLASTN, y FASTA (Altschul et al., 1999. J. Mol. Biol. 215: 403-410.The term "identity", as used herein, refers to the proportion of identical nucleotides or amino acids between two nucleotide or amino acid sequences that are compared. Sequence comparison methods are known in the state of the art, and include, but are not limited to, the GAG program, including GAP (Devereux et al., Nucleic Acids Research 12: 287 (1984) Genetics Computer Group University of Wisconsin, Madison, (Wl); BLAST, BLASTP or BLASTN, and FASTA (Altschul et al., 1999. J. Mol. Biol. 215: 403-410.
El término “individuo” o "sujeto", tal y como se utiliza en la descripción, se refiere a un animal, preferiblemente a un mamífero, y más preferiblemente a un ser humano. El término “individuo” en esta memoria, es sinónimo de “paciente”, y no pretende ser limitativo en ningún aspecto, pudiendo ser éste de cualquier edad, sexo y condición física. El individuo puede ser cualquiera, un individuo predispuesto a una enfermedad (por ejemplo, cáncer de pulmón) o un individuo que padece dicha enfermedad.The term "individual" or "subject", as used in the description, refers to an animal, preferably a mammal, and more preferably a human being. The term "individual" in this report is synonymous with "patient", and is not intended to be limiting in any aspect, and may be of any age, sex and physical condition. The individual can be anyone, an individual predisposed to a disease (for example, lung cancer) or an individual suffering from said disease.
A lo largo de la descripción y las reivindicaciones la palabra "comprende" y sus variantes no pretenden excluir otras características técnicas, aditivos, componentes o pasos. Para los expertos en la materia, otros objetos, ventajas y características de la invención se desprenderán en parte de la descripción y en parte de la práctica de la invención. Los siguientes ejemplos y dibujos se proporcionan a modo de ilustración, y no se pretende que sean limitativos de la presente invención.Throughout the description and the claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention. The following examples and drawings are provided by way of illustration, and are not intended to be limiting of the present invention.
EJEMPLO DE LA INVENCIÓNEXAMPLE OF THE INVENTION
El principal objetivo de este estudio fue determinar el perfil de miARNs circulantes en pacientes APS e identificar aquellos miARNs circulantes que pueden representar biomarcadores no invasivos para el diagnóstico y la tipificación del status aterotrombótico de la enfermedad, es decir, APS con trombosis arterial o APS con trombosis venosa y/o APS con aterosclerosis o ecodoppler patológico.The main objective of this study was to determine the profile of circulating miRNAs in APS patients and identify those circulating miRNAs that may represent non-invasive biomarkers for the diagnosis and typification of the atherothrombotic status of the disease, that is, APS with arterial thrombosis or APS with venous thrombosis and / or PHC with atherosclerosis or pathological echodoppler.
Tabla 1. Parámetros clínicos y de laboratorio de los sujetos incluidos en el estudio.Table 1. Clinical and laboratory parameters of the subjects included in the study.
- Pacientes APS Controles P APS Patients P Controls
- n=90 n=42 n = 90 n = 42
- Parámetros Clínicos Clinical Parameters
- Mujeres/Hombres Women Men
- 48/42 22/20 48/42 22/20
- Edad (años) Age (years)
- 51,2 ± 13,1 46,2 ± 13,4 n.s. 51.2 ± 13.1 46.2 ± 13.4 n.s.
- Trombosis arterial (n) Arterial thrombosis (n)
- 35/90 0 35/90 0
- Trombosis venosa (n) Venous thrombosis (n)
- 55/90 0 55/90 0
- Recurrencias (n) Recurrences (n)
- 37/90 0 37/90 0
- Abortos (n) Abortions (n)
- 23/90 0 23/90 0
- Obesidad (n) Obesity (n)
- 38/90 2/42 38/90 2/42
- CIMT patológica (n) Pathological IACML (n)
- 24/90 6/42 24/90 6/42
- Índice Tobillo-Brazo (ABI) (Izquierdo) Ankle-Arm Index (ABI) (Left)
- 1,3 ± 0,11 1,2 ± 0,09 0,02 1.3 ± 0.11 1.2 ± 0.09 0.02
- Índice Tobillo-Brazo (ABI) (Derecho) Ankle-Arm Index (ABI) (Right)
- 1,27 ± 0,11 1,2 ± 0,09 0,02 1.27 ± 0.11 1.2 ± 0.09 0.02
- Anticoagulante Lúpico positivo (n) Positive Lupus Anticoagulant (n)
- 85/90 0 85/90 0
- aCL IgG, GLP aCL IgG, LPG
- 23,4 ± 72 1,3 ± 1,1 0,00 23.4 ± 72 1.3 ± 1.1 0.00
- aCL IgM, MLP aCL IgM, MLP
- 21,8 ± 52 4,9 ± 5,2 0,00 21.8 ± 52 4.9 ± 5.2 0.00
- Anti-B2GPI, SGU Anti-B2GPI, SGU
- 5 ± 7,7 1 ± 0,7 0,02 5 ± 7.7 1 ± 0.7 0.02
- Antiagregantes, ASA/clopidogel (n) Antiplatelet agents, ASA / clopidogel (n)
- 30/90 0 30/90 0
- Anticoagulantes, warfarin/acenocoumarol (n) Anticoagulants, warfarin / acenocoumarol (n)
- 62/90 0 62/90 0
- Parámetros de laboratorio Laboratory parameters
- Colesterol total, mg/dL Total cholesterol, mg / dL
- 191,7 ± 32,06 190 ± 41,8 n.s. 191.7 ± 32.06 190 ± 41.8 n.s.
- Colesterol HDL, mg/dL HDL cholesterol, mg / dL
- 51,09 ± 12,4 55,4 ± 13,1 n.s. 51.09 ± 12.4 55.4 ± 13.1 n.s.
- Colesterol LDL, mg/dL LDL cholesterol, mg / dL
- 112,1 ± 33,2 118,1 ± 26,9 n.s. 112.1 ± 33.2 118.1 ± 26.9 n.s.
- Triglicéridos, mg/dL Triglycerides, mg / dL
- 155,1±163,2 88,3 ± 50,07 n.s. 155.1 ± 163.2 88.3 ± 50.07 n.s.
- VSG, mm/h VSG, mm / h
- 13,5 ± 13,6 10,2 ± 8,7 n.s. 13.5 ± 13.6 10.2 ± 8.7 n.s.
El estudio se llevó a cabo en 90 pacientes APS y 42 donantes sanos, cuyas características clínicas se muestran en la tabla 1. Se obtuvieron muestras de plasma de pacientes y 5 donantes sanos, en las que se determinaron varios parámetros relacionados con autoinmunidad, inflamación y enfermedad cardiovascular, incluyendo los niveles de la velocidad de sedimentación globular (VSG), el grosor de la íntima media carotídea (CIMT) y el índice tobillo-brazo (ABI).The study was carried out in 90 APS patients and 42 healthy donors, whose clinical characteristics are shown in Table 1. Plasma samples were obtained from patients and 5 healthy donors, in which several parameters related to autoimmunity, inflammation and cardiovascular disease, including the levels of erythrocyte sedimentation rate (ESR), the thickness of the carotid intimate media (IACML) and the ankle-arm index (ABI).
55
1010
15fifteen
20twenty
2525
3030
El análisis del perfil de miARNs en el plasma de pacientes APS se realizó mediante el "Human Serum & Plasma miRNA PCR array’ de Qiagen. Para ello, se realizó un pool con 2 ^l del ARN purificado del plasma de 10 pacientes APS, y otro pool con 2 ^l de ARN purificado del plasma de 10 donantes sanos. La purificación del ARN se realizó mediante el kit "miRNeasy Serum/plasma’’ de Qiagen a partir de 200 ^l de plasma a los que se le añadió 5 fmoles del cel-miR-39 como "spike in control’ en el momento de la extracción. Los niveles de expresión fueron analizados mediante un software específico de Qiagen y los datos se normalizaron respecto a la expresión del cel-miR-39. Posteriormente se realizaron estudios de validación de miARNs seleccionados en todos los individuos incluidos en el estudio mediante RT-PCR y sondas Taqman específicas.The analysis of the profile of miRNAs in the plasma of APS patients was performed using the "Human Serum & Plasma miRNA PCR array 'of Qiagen. To do this, a pool was made with 2 ^ l of the purified RNA from the plasma of 10 APS patients, and another pool with 2 ^ l of purified RNA from the plasma of 10 healthy donors. RNA purification was performed using the "miRNeasy Serum / plasma" kit from Qiagen from 200 ^ l of plasma to which 5 fmoles were added of cel-miR-39 as 'spike in control' at the time of extraction. Expression levels were analyzed using specific Qiagen software and the data were normalized with respect to the expression of cel-miR-39. validation studies of selected miRNAs in all individuals included in the study using RT-PCR and specific Taqman probes.
El análisis del PCR array en el plasma de pacientes APS mostró un incremento en los niveles de expresión de 19 miARNs, mientras que 20 se encontraron disminuidos (Figura 1A).The analysis of the PCR array in the plasma of APS patients showed an increase in the expression levels of 19 miRNAs, while 20 were found to be diminished (Figure 1A).
El análisis funcional, realizado utilizando el software Ingenuity Pathway, de los miRNAs alterados en el array reveló que un alto número de ellos tenían mARN dianas involucrados en procesos patológicos tales como enfermedad del sistema reproductor, desórdenes del tejido conectivo y respuesta inflamatoria (Figura 1B).The functional analysis, performed using the Ingenuity Pathway software, of the altered miRNAs in the array revealed that a high number of them had mRNA targets involved in pathological processes such as reproductive system disease, connective tissue disorders and inflammatory response (Figure 1B) .
Con el objetivo de identificar posibles biomarcadores específicos de enfermedad en APS, seleccionamos aquellos miARNs más diferencialmente expresados en el array y más directamente relacionados con los procesos fisiopatológicos del APS (miR 19b, miR-20a, miR-124, miR-206, miR-145a, miR-34a, miR-15a, miR-374a, miR-133b, miR-296, and miR- 210). Los resultados obtenidos tras analizar los niveles de expresión de los miARNs seleccionados mediante RT-PCR en la cohorte de 90 pacientes y 42 donantes sanos, mostró que diferentes ratios recíprocas de un perfil específico de miRNAs podía discriminar pacientes APS de donantes sanos (Figura 2).In order to identify possible disease-specific biomarkers in PHC, we select those miRNAs more differentially expressed in the array and more directly related to the physiopathological processes of PHC (miR 19b, miR-20a, miR-124, miR-206, miR- 145a, miR-34a, miR-15a, miR-374a, miR-133b, miR-296, and miR-210). The results obtained after analyzing the expression levels of the miRNAs selected by RT-PCR in the cohort of 90 patients and 42 healthy donors, showed that different reciprocal ratios of a specific profile of miRNAs could discriminate APS patients from healthy donors (Figure 2) .
El uso de ratios recíprocos es una aproximación que permite solventar el problema de la normalización de los datos de miARNs circulantes obtenidos mediante RT-PCR. Además, estos ratios presentan la ventaja de que en ciertos casos, miARNs cuya concentración está alterada en la patología en direcciones opuestas, pueden ser más efectivos en la clasificación de las poblaciones de estudio.The use of reciprocal ratios is an approach that allows solving the problem of the normalization of the data of circulating miRNAs obtained by RT-PCR. In addition, these ratios have the advantage that in certain cases, miRNAs whose concentration is altered in the pathology in opposite directions, may be more effective in the classification of study populations.
Así, se desarrolló un modelo que permite diferenciar pacientes APS de donantes sanos en base a los niveles de expresión de estos miARNs, seleccionando el grupo de miARNs (miARN-124, miARN-145, miARN-20a, miARN-296, miARN-34a and miARN-374) con elThus, a model was developed to differentiate APS patients from healthy donors based on the expression levels of these miRNAs, selecting the group of miRNAs (miRNA-124, miRNA-145, miRNA-20a, miRNA-296, miRNA-34a and miRNA-374) with the
55
1010
15fifteen
20twenty
2525
3030
mayor poder predictivo y combinándolos con la edad biológica del paciente. Este modelo fue evaluado mediante el análisis estadístico “10-fold crnss validation”, obteniendo un área bajo la curva ROC del 80% y una sensibilidad y especificidad del 80% y el 72%, respectivamente. (Figura 2).greater predictive power and combining them with the patient's biological age. This model was evaluated by means of the “10-fold crnss validation” statistical analysis, obtaining an area under the ROC curve of 80% and a sensitivity and specificity of 80% and 72%, respectively. (Figure 2).
También nos interesamos en la identificación miARNs circulantes que pudiesen servir como biomarcadores no invasivos útiles en la tipificación de aspectos clínicos relevantes para la patología aterotrombótica presente en estos pacientes.We are also interested in identifying circulating miRNAs that could serve as non-invasive biomarkers useful in typing clinical aspects relevant to atherothrombotic pathology present in these patients.
Encontramos que un grupo de 5 miARNs (15a, 19b, 20a, 34a, 374), permitían discriminar el tipo de trombosis sufrida por un paciente APS. De esta forma, desarrollamos un modelo que integraba ratios recíprocos de estos miARNs para poder discriminar la trombosis arterial de la venosa con una sensibilidad del 90%, especificidad del 80% y un área bajo la curva ROC de 82%, evaluado mediante el análisis estadístico “10-fold cross validation” (Figura 3).We found that a group of 5 miRNAs (15a, 19b, 20a, 34a, 374), allowed to discriminate the type of thrombosis suffered by an APS patient. In this way, we developed a model that integrated reciprocal ratios of these miRNAs to discriminate arterial vein thrombosis with a sensitivity of 90%, specificity of 80% and an area under the ROC curve of 82%, evaluated by statistical analysis "10-fold cross validation" (Figure 3).
Además, identificamos 4 miARNs (15a, 19b, 124, 296) cuyos ratios se asociaban con un incremento patológico del grosor de la íntima media carotídea. Construimos un modelo con estos miARNs que podía identificar un proceso de aterosclerosis temprana con un 69% de sensibilidad y 89% de especificidad, siendo el área bajo la curva ROC igual a 0.79 (Figura 4).In addition, we identified 4 miRNAs (15a, 19b, 124, 296) whose ratios were associated with a pathological increase in the thickness of the intimate carotid middle. We constructed a model with these miRNAs that could identify an early atherosclerosis process with 69% sensitivity and 89% specificity, the area under the ROC curve being 0.79 (Figure 4).
Para evaluar la relevancia de la expresión alterada de estos ratios de miARNs en el plasma de pacientes APS, realizamos diferentes estudios de correlación y asociación.To evaluate the relevance of the altered expression of these miRNA ratios in the plasma of APS patients, we performed different correlation and association studies.
Los estudios de correlación mostraron que diferentes ratios de los miARNs del plasma que integraban la firma en APS, correlacionaban significativamente con parámetros relacionados con autoinmunidad tales como los títulos de anticuerpos antifosfolípido. Además, los niveles de expresión de estos miARNs correlacionaron con marcadores inflamatorios como la velocidad de sedimentación globular (VSG), así como con parámetros relacionados con enfermedad cardiovascular como el índice tobillo-brazo (Figura 5).Correlation studies showed that different ratios of the plasma miRNAs that made up the firm in APS correlated significantly with parameters related to autoimmunity such as antiphospholipid antibody titres. In addition, the expression levels of these miRNAs correlated with inflammatory markers such as erythrocyte sedimentation rate (ESR), as well as with parameters related to cardiovascular disease such as the ankle-arm index (Figure 5).
Los estudios de asociación reflejaban que la relación entre diferentes miARNs de la firma en APS se asociaba con pérdidas fetales en estos pacientes. Además tres de estos microARNs estaban también asociados con la positividad para anticuerpos antifosfolípido (Figura 6).Association studies showed that the relationship between different miRNAs of the firm in PHC was associated with fetal losses in these patients. In addition, three of these microRNAs were also associated with positivity for antiphospholipid antibodies (Figure 6).
Para hallar la relevancia clínica de estos resultados, investigamos el impacto potencial de esta firma de miARNs en el plasma de los pacientes APS sobre sus mARN dianas relacionadas con procesos patológicos claves de esta condición autoimmune.To find the clinical relevance of these results, we investigated the potential impact of this signature of miRNAs in the plasma of APS patients on their mRNA targets related to key pathological processes of this autoimmune condition.
El análisis de las potenciales dianas, mediante el software Ingenuity Pathway, identificó un número de genes como dianas de al menos dos de los once miARNs que integran la firma. Este análisis generó una red de interacción que incluye los miARNs alterados en el plasma de los pacientes APS (en el centro) y sus dianas específicas, involucradas en procesos 5 patológicos como la enfermedad arterial coronaria, trombosis, abortos y disfunciónThe analysis of potential targets, using the Ingenuity Pathway software, identified a number of genes as targets of at least two of the eleven miRNAs that make up the firm. This analysis generated an interaction network that includes the altered miRNAs in the plasma of APS patients (in the center) and their specific targets, involved in pathological processes such as coronary artery disease, thrombosis, abortions and dysfunction.
cerebrovascular (Figura 7).cerebrovascular (Figure 7).
Entre estos mARN dianas, se reconocieron genes protrombóticos y proinflamatorios bien conocidos como participantes en dichos procesos patológicos, tales como el factor tisular 10 (F3), trombina (F2), VEGFA, FLT-1, MCP-1 (CCL2) o PPAR, entre otros.Among these mRNA targets, prothrombotic and pro-inflammatory genes were well known as participants in such pathological processes, such as tissue factor 10 (F3), thrombin (F2), VEGFA, FLT-1, MCP-1 (CCL2) or PPAR, among others.
En suma, nuestros datos sugieren que:In sum, our data suggest that:
Diversos miARNs, diferencialmente expresados en el plasma de pacientes APS, se asocian 15 con perfiles clínicos específicos de esta patología autoinmune. Hemos desarrolladoVarious miRNAs, differentially expressed in the plasma of APS patients, are associated with specific clinical profiles of this autoimmune pathology. We have developed
diferentes modelos que identifican una firma de miARNs definidos que pueden servir como biomarcadores para el diagnóstico y la tipificación del estatus aterotrombótico en APS.different models that identify a signature of defined miRNAs that can serve as biomarkers for the diagnosis and typing of atherothrombotic status in PHC.
Por lo tanto, los niveles circulantes de microARNs específicos pueden ser considerados herramientas útiles en la prevención y manejo de la enfermedad en pacientes APS.Therefore, the circulating levels of specific microRNAs can be considered useful tools in the prevention and management of the disease in PHC patients.
20twenty
Claims (14)
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
ES201630725A ES2648638B1 (en) | 2016-06-01 | 2016-06-01 | Circulating microRNAs as biomarkers of Primary Antiphospholipid Syndrome |
PCT/ES2017/070387 WO2017207855A1 (en) | 2016-06-01 | 2017-05-31 | Circulating micro-rnas as biomarkers for primary antiphospholipid syndrome |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
ES201630725A ES2648638B1 (en) | 2016-06-01 | 2016-06-01 | Circulating microRNAs as biomarkers of Primary Antiphospholipid Syndrome |
Publications (2)
Publication Number | Publication Date |
---|---|
ES2648638A1 ES2648638A1 (en) | 2018-01-04 |
ES2648638B1 true ES2648638B1 (en) | 2018-10-09 |
Family
ID=60478043
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
ES201630725A Expired - Fee Related ES2648638B1 (en) | 2016-06-01 | 2016-06-01 | Circulating microRNAs as biomarkers of Primary Antiphospholipid Syndrome |
Country Status (2)
Country | Link |
---|---|
ES (1) | ES2648638B1 (en) |
WO (1) | WO2017207855A1 (en) |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2016005354A1 (en) * | 2014-07-07 | 2016-01-14 | Ga Generic Assays Gmbh | Autoantibody profiling in aps |
-
2016
- 2016-06-01 ES ES201630725A patent/ES2648638B1/en not_active Expired - Fee Related
-
2017
- 2017-05-31 WO PCT/ES2017/070387 patent/WO2017207855A1/en active Application Filing
Also Published As
Publication number | Publication date |
---|---|
WO2017207855A1 (en) | 2017-12-07 |
ES2648638A1 (en) | 2018-01-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Stein et al. | A decade of research on the 17q12-21 asthma locus: piecing together the puzzle | |
Viatte et al. | Genetics of rheumatoid arthritis susceptibility, severity, and treatment response | |
Geisheker et al. | Hotspots of missense mutation identify neurodevelopmental disorder genes and functional domains | |
Ahmetov et al. | Genes and athletic performance: an update | |
Xiao et al. | Molecular mechanisms underlying noncoding risk variations in psychiatric genetic studies | |
Liu et al. | Comparative expression profiles of microRNA in left and right atrial appendages from patients with rheumatic mitral valve disease exhibiting sinus rhythm or atrial fibrillation | |
Cai et al. | STAT3-dependent transactivation of miRNA genes following Toxoplasma gondii infection in macrophage | |
JP2007506426A5 (en) | ||
Davenport et al. | Transcriptomic profiling facilitates classification of response to influenza challenge | |
JP2016507233A5 (en) | ||
Belizaire et al. | Clonal haematopoiesis and dysregulation of the immune system | |
CN105190314A (en) | Anti-TNF and anti-IL17 combination therapy biomarkers for inflammatory disease | |
Hu et al. | Transcriptomic analysis of Mandarin fish brain cells infected with infectious spleen and kidney necrosis virus with an emphasis on retinoic acid-inducible gene 1-like receptors and apoptosis pathways | |
Zhou et al. | A landscape of murine long non-coding RNAs reveals the leading transcriptome alterations in adipose tissue during aging | |
JP2022023083A (en) | Systems and methods for identifying and distinguishing genetic samples | |
Backes et al. | Blood born miRNAs signatures that can serve as disease specific biomarkers are not significantly affected by overall fitness and exercise | |
Vaknin-Dembinsky et al. | Circulating microRNAs as biomarkers for rituximab therapy, in neuromyelitis optica (NMO) | |
Wong et al. | Identification of novel microRNAs in the sheep heart and their regulation in heart failure | |
Xiao et al. | FCER1G and PTGS2 serve as potential diagnostic biomarkers of acute myocardial infarction based on integrated bioinformatics analyses | |
Kamoto et al. | Association of APOL1 renal disease risk alleles with Trypanosoma brucei rhodesiense infection outcomes in the northern part of Malawi | |
Pockar et al. | MiRNA as biomarker for uveitis-a systematic review of the literature | |
Tian et al. | Microarray expression and functional analysis of circular RNAs in the glomeruli of NZB/W F1 mice with lupus nephritis | |
Magalhães et al. | Dynamic changes of DNA methylation and lung disease in cystic fibrosis: lessons from a monogenic disease | |
CN113234815B (en) | Application of lncRNA molecule in GBM | |
Jiang et al. | Biomarkers (mRNAs and non-coding RNAs) for the diagnosis and prognosis of rheumatoid arthritis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
FG2A | Definitive protection |
Ref document number: 2648638 Country of ref document: ES Kind code of ref document: B1 Effective date: 20181009 |
|
FD2A | Announcement of lapse in spain |
Effective date: 20211202 |