ES2648638B1 - Circulating microRNAs as biomarkers of Primary Antiphospholipid Syndrome - Google Patents

Abstract

Circulating microRNAs as clinical biomarkers of primary antiphospholipid syndrome. # Use of microRNAs: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and miR-15a for diagnosis, classification and / or monitoring in an individual or subject potentially suffering from primary antiphospholipid syndrome, method of obtaining useful data for the diagnosis, classification and / or monitoring of primary antiphospholipid syndrome in an individual or subject potentially suffering from antiphospholipid syndrome, kit or device, microarray and uses.

Description

5

10

fifteen

twenty

25

30

DESCRIPTION

Circulating microRNAs as biomarkers of the Primary Antiphospholipid Syndrome FIELD OF THE INVENTION

The present invention is within the field of Molecular Biology and Clinical Medicine, and specifically refers to a method of obtaining useful data for the diagnosis, classification and / or monitoring of patients with primary antiphospholipid syndrome (APS). antiphospholipid syndrome), as well as for the typification of atherothrombotic pathology suffered by said patients.

BACKGROUND OF THE INVENTION

Antiphospholipid Syndrome is an autoimmune disorder, classified by ORPHANET as a rare disease (ORPHA80). It is characterized by the development of arterial and / or venous thrombosis of recurrence and / or an obstetric history with prematurity and preeclampsia, in the presence of high titers of antiphospholipid antibodies, mainly IgG or IgM isotype anti-cardiolipin antibodies, anti-B2 glycoprotein I and anticoagulant Lupus

Different studies published by our research group have shown that the prothrombotic status of APS patients is the result of various underlying mechanisms, including monocytic activation induced by antiphospholipid antibodies, which generate mitochondrial dysfunction and oxidative stress, and promote altered expression. of a number of molecules related to inflammation and thrombosis, such as tissue factor and vascular endothelial growth factor among others.

Recently, genomic technology has allowed explaining the mechanisms

Pathophysiological control of vascular disease in APS patients, how are you

alterations may be associated with these autoimmune disorders, and their response to

Different therapeutic approaches. An important and emerging mechanism that

controls gene expression is epigenetics. Epigenetics or expression regulation

gene by independent alterations of the DNA sequence, is contributing

New links between genomics and environmental factors. It includes the methylation of

DNA, histone modification and the activity of microRNAs, which act on the

levels of gene and protein expression. The microRNAs (miRNAs or miR) are small

acidic ribonucleic acids (RNAs) that play a critical role in gene regulation to

post-transcriptional level. MicroRNAs crucially affect the immune system and

seem to have a relevant role in the pathogenesis of autoimmune diseases and

cardiovascular A number of studies have analyzed the expression profile of microRNAs

in peripheral blood cells, biological fluids and tissues of patients with Lupus. These

2

5

10

fifteen

twenty

25

30

papers have shown the existence of a signature of miRNAs associated with disease activity. In the Antiphospholipid Syndrome (APS), there is to date only one article, published by our research group, that has identified two microRNAs as potential modulators of tissue factor expression (TF), the main thrombosis inducer in APS patients. Different studies have shown that microRNAs are attractive potential biomarkers for different reasons:

• Its expression profile reflects underlying pathological processes.

• MicroRNAs can be detected in a variety of sources, including tissues, blood cells and biological fluids.

• In comparison to messenger RNAs (mRNAs), they are stable and resistant to degradation, due to their small size and protection in miRNA-protein complexes or microvesicles (i.e. exosomes) in blood and biological fluids.

However, to date, no study has evaluated the profile of plasma miRNAs and their relationship with the pathophysiology of the disease. Thus, the main objective of this study was to determine the profile of plasma miRNAs in PHC, and identify potential miRNAs that may represent non-invasive biomarkers for the diagnosis and typing of atherothrombotic pathology of PHC patients.

BRIEF DESCRIPTION OF THE INVENTION

Therefore, a first aspect of the invention relates to the simultaneous use of microRNA biomarkers: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and miR -15a, or any combination thereof, for the diagnosis, classification and / or monitoring of the primary antiphospholipid syndrome (PHC).

A second aspect of the invention relates to a method of obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from PHC comprising:

a) quantify the expression product of the biomarkers miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and / or miR-15a in an isolated biological sample of said individual.

In a preferred embodiment of this aspect of the invention, the first method of the invention further comprises:

b) calculate the index A according to the equation:

5

10

fifteen

twenty

image 1

where: P0 = -7,01449, fr = 1,13676, P2 = 0,16051, P3 = 0,19897, P4 = 0.20980, P5 = 0.13676, xi = -log2 (miR20a / miR145), x2 = -log2 (miR145 / miR296), x3 = -log2 (miR374 / miR34a), x4 = -log2 (miR374 / miR124) and x5 = patient age,

c) calculate the indices B1, B2 and / or B3 according to the equations:

B1 = -log2 (miR19b / miR15a); B2 = -log2 (miR20a / miR374); B3 = -log2 (miR374 / miR34a)

d) calculate the C1 and / or C2 indices according to the equations:

C1 = -log2 (miR19b / miR124); C2 = -log2 (miR19a / miR296)

assigning in each equation the values of the corresponding biomarkers obtained in step (a).

A third aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereinafter the second method of the invention, which

It comprises steps (a) and (b) according to the first method of the invention, and also

understands:

e) classify the individual of step (a) in the group of individuals with APS when the value of the index A of step (b) is preferably greater than 0.4, more preferably greater than 0.5, and even more preferably greater than 0.6.

A fourth aspect of the invention relates to a method for diagnosis, classification and / or follow-up of PHC, hereinafter the third method of the invention, which

It comprises steps (a) and (c) according to the first method of the invention, and also

understands:

5

10

fifteen

twenty

25

30

f) classify the individual from step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably greater than 4.9, more preferably greater than 5.2, and even more preferably greater than 5,542.

A fifth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereinafter the fourth method of the invention, which

It comprises steps (a) and (c) according to the first method of the invention, and also

understands:

g) classify the individual from step (a) in the group of individuals with PHC with venous thrombosis when the B2 index value of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542 and when the value of the B3 index of step (c) is preferably less than -0,165, more preferably less than -0,265, and even more preferably less than or equal to -0,356.

A sixth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereinafter the fifth method of the invention, which

It comprises steps (a) and (c) according to the first method of the invention, and also

understands:

h) classify the individual of step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542 and when the value of the B3 index of step (c) is preferably in the range between (0.556, 0.736), more preferably in the range between (-0.456, 0.636), and even more preferably between (-0.356, 0.536 ].

A seventh aspect of the invention relates to a method for the diagnosis, classification and / or follow-up of PHC, hereafter referred to as the sixth method of the invention, comprising steps (a) and (c) according to the first method of the invention, and also comprises:

i) classify the individual of step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542, when the value of the index B3 of step (c) is preferably greater than 0.336, more preferably greater than 0.436, and even more preferably greater than 0.536, and when the value of index B1 of step (c) is preferably less than 5,152, more preferably

less than 5,052, and even more preferably less than or equal to 4,952.

5

5

10

fifteen

twenty

25

30

An eighth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereafter referred to as the seventh method of the invention, which comprises steps (a) and (c) according to the first method of the invention, and also comprises:

j) classify the individual of step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542, when the value of index B3 of step (c) is preferably greater than 0.336, more preferably greater than 0.436, and even more preferably greater than 0.536, and when the value of index B1 of step (c) is preferably greater than 4,752, more preferably greater than 4,852, and even more preferably greater than 4,952.

A ninth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereafter referred to as the eighth method of the invention, comprising steps (a) and (d) according to the first method of the invention, and also comprises:

k) classify the individual from step (a) in the group of individuals with PHC with atherosclerosis or pathological echodoppler when the value of the C1 index of step (d) is preferably less than 13,198, more preferably less than 12,198, and even more preferably less or equal to 11,198 and when the value of the C2 index of step (d) is preferably greater than 5,690, more preferably greater than 6,690, and even more preferably greater than 7,690.

In a preferred embodiment of any aspect of the invention, the biological sample isolated from step (a) is a plasma, serum or urine sample. Preferably the biological sample isolated from step (a) is a plasma sample.

A tenth aspect of the invention relates to a kit or device, hereafter kit or device of the invention, comprising the elements necessary to detect the expression levels of the microRNAs: miR-124, miR-145, miR- 20a, miR-296, miR-34a, miR-374, miR-19b, and miR-15a, as defined in the first aspect of the invention.

In a preferred embodiment of this aspect of the invention, the kit or device of the invention comprises primers, probes and / or antibodies capable of quantifying the microRNA expression product: miR-124, miR-145, miR-20a, miR- 296, miR-34a, miR-374, miR-19b, and miR-15a, and where:

5

10

fifteen

twenty

25

30

- primers or primers are polynucleotide sequences of between 10 and 30 pairs of

bases, more preferably between 15 and 25 base pairs, even more preferably between 18 and 22 base pairs, and even more preferably about 20 base pairs, which have an identity of at least 80%, more preferably at least 90%, even more preferably at least 95%, still much more preferably at least 98%, and particularly 100%, with a fragment of the sequences complementary to SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8 , SEQ ID N °: 9, SEQ ID N °: 10,

SEQ ID N °: 11, SEQ ID N °: 12, SEQ ID N °: 13, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °:

16.

- the probes are sequences of polynucleotides of between 80 and 1100 base pairs, plus

preferably between 100 and 1000 base pairs, and even more preferably between 200 and 500 base pairs, which have an identity of at least 80%, more preferably of at least 90%, even more preferably of at least one 95%, even more preferably at least 98%, and particularly 100%, with a fragment of the sequences complementary to SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3 , SEQ ID N °: 4, SEQ ID N °: 5, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8, SEQ ID N °: 9,

SEQ ID N °: 10, SEQ ID N °: 11, SEQ ID N °: 12, SEQ ID N °: 13, SEQ ID N °: 14, SEQ ID N °:

15, SEQ ID N °: 16.

- the antibodies are capable of binding to a region formed by any of the nucleotide sequences SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 5, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8, SEQ ID N °: 10, SEQ ID N °: 11, SEQ ID N °: 12 , SEQ ID N °: 13, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 16.

A eleventh aspect of the invention relates to a microarray, hereafter referred to as a microarray of the invention, comprising oligonucleotides or single channel microarrays designed from the nucleotide sequences SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8, SEQ ID N °: 9 , SEQ ID N °: 10, SEQ ID N °: 11, SEQ ID N °: 12, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 15, SEQ ID N °: 16.

A twelfth aspect of the invention relates to the use of the kit or device of the invention or the microarray of the invention, for obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from PHC.

DESCRIPTION OF THE FIGURES

Figure 1. A. differentially expressed miRNAs in the plasma of APS patients vs. Controls Bar chart of differentially expressed miRNAs in plasma of APS patients in relation to healthy donors, identified by a PCR-array. B. 5 Ingenuity Pathway Analysis (IPA). Functional classification of microRNAs using the software.

Figure 2. A and B. Combination model of the microRNA ratios that discriminates APS from healthy donors and ROC curve.

Figure 3. A and B. Combination model of the microRNA ratios that discriminates 10 APS patients with arterial and venous thrombosis and ROC curve.

Figure 4. A and B. Combination model of the microRNA ratios that discriminates APS patients with pathological and normal echodoppler and ROC curve.

Figure 5. Correlation tables between microRNA ratios and parameters related to autoimmunity, inflammation and cardiovascular disease.

15 Figure 6. A and B. Bar diagrams showing statistical associations between ratios of microRNAs and occurrence of fetal losses and positivity for antiphospholipid antibodies.

DETAILED DESCRIPTION OF THE INVENTION

The authors of the present invention have analyzed the levels of microRNAs in plasma samples of patients with primary antiphospholipid syndrome compared to 20 other healthy patients. The results indicate that the microRNAs present in the plasma can be used as markers of a diagnostic system, classification and / or monitoring of the primary antiphospholipid syndrome.

BIOMARKERS OF THE INVENTION

Therefore, a first aspect of the invention relates to the use of biomarkers of 25 microRNAs: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, miR- 15a, or any combination thereof, for the diagnosis, classification and / or monitoring of the primary antiphospholipid syndrome (APS), hereinafter biomarkers of the invention. In a preferred embodiment, the use of microRNAs is simultaneous.

5

10

fifteen

twenty

25

30

The biomarkers of the invention can be used simultaneously, separately or in any combination thereof for the diagnosis, classification and / or monitoring of PHC.

In a preferred embodiment of this aspect of the invention, sets of ratios between the biomarkers of the invention are used for the diagnosis, classification and / or monitoring of PHC. Preferably, the sets of ratios formed between biomarkers of the invention for the diagnosis, classification and / or monitoring of the APS used are:

• miR-20a / miR-145, miR-145 / miR-296, miR-374 / miR34a and miR374 / 124,

• miR-19b / miR-15a, miR-20a / miR-374 and miR-374 / miR-34a,

• miR-19b / miR-124 and miR-15a / miR-296.

The term "microRNA" refers to single stranded RNA approximately 22 nucleotides in length, non-coding for proteins and generated from endogenous transcripts that can form hairpin-shaped structures (Lee et al., 2004. Embo. Journal, 23 (20) , 4051-4060). The microRNAs make up a large family of post-transcriptional regulatory genes that control many cellular and eukaryotic development processes, fulfilling a large number of functions. It is estimated that 30% of all human genes are regulated by mechanisms dependent on microRNAs (Rajewsky N. 2006. Nature Genetics, 38, Suppl: S8-13) and that a single microRNA can regulate about 200 different transcripts that can work in different pathways in the cell (Krek et al., 2005, Nature Genetics, 37 (5), 495-500), as well as that the same mRNA can be regulated by multiple microRNAs (Cai et al., 2009. Genomics Proteomics Bioinformatics , 7 (4), 147-154).

The term "Primary Antiphospholipid Syndrome" is an autoimmune disorder characterized by the association of an obstetric history, with fetal losses or prematurity and preeclampsia, and vascular thrombosis of arterial and / or venous type. Thrombosis is the most severe complication of the syndrome. It is the most frequent acquired thrombophilia, responsible for 20% of strokes and 18% of myocardial infarctions in children under 50 years.

The serological markers of this syndrome are antiphospholipid antibodies, mainly anticardiolipin antibodies (ACAs) or lupus anticoagulant. ACAs bind on the cell surface primarily through a phospholipid binding protein, B2GPI and prothrombin.

5

10

fifteen

twenty

25

30

Numerous mechanisms have been proposed to explain the prothrombotic / pro-inflammatory processes associated with PHC, although the pathogenesis appears to be multifactorial. An essential process is the monocytic activation induced by the antiphospholipid antibodies (ACA), which promotes an increase in procoagulant activity, by activating the main blood coagulation activating receptor, the Tissue Factor, whose expression is increased in monocytes of these patients (Square MJ, et al., 1997. Arthrítis Rheum., 40: 834-41). Intracellular signaling associated with such activation is mediated by protease activated receptors (PARs, -mediators of critical responses to thrombosis, hemostasis and inflammatory processes and participants in the development of arteriosclerosis), whose expression is also increased in monocytes of patients with FAS (López-Pedrera et al., Arthritis Rheum. 2010; 62: 869-77). In recent studies, it has been described that such intracellular signaling, induced by ACAs, involves the constitutive activation of MAPK and NFkB (López-Pedrera et al. 2006. Arthritis Rheum. 54: 301-11), as well as the promotion of expression of endothelial vascular growth factor (VEGF) and its Flt1 receptor (Square MJ, et al. 2006. J. Thromb. Haemost. 4: 2461-69). Overexpression of these prothrombotic and proinflammatory mediators leads to a pro-thrombotic state and the development of accelerated atherosclerosis in these patients.

The control of thrombosis risk factors is therefore crucial in APS patients. Traditional thrombosis treatment has been based primarily on continued administration of anticoagulants. However, the risk of bleeding is high and the occurrence of recurrences is still frequent. Thus, the search for new therapeutic alternatives for the management of atherothrombotic involvement in these patients is necessary.

METHODS OF THE INVENTION

A second aspect of the invention relates to a method of obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from PHC, hereinafter the first method of the invention, comprising:

a) obtain an isolated biological sample from an individual,

a ’) quantify the expression product of miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and / or miR-15a,

or alternatively

5

10

fifteen

twenty

25

30

a) quantify the expression product of the biomarkers miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and / or miR-15a in an isolated biological sample of said individual.

Although the expression product of the 8 microRNAs is preferably quantified simultaneously, in order to obtain useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from APS, the detection of any of them and, preferably of ratios: miR-20a / miR-145, miR-145 / miR-296, miR-374 / miR34a, miR374 / 124, miR-19b / miR-15a, miR-20a / miR-374, miR-374 / miR- 34a, miR-19b / miR-124 and miR-15a / miR-296, is informative.

The term "expression product", also called "gene product" refers to the biochemical material, either RNA (for example microRNA) or protein, resulting from the expression of a gene. Sometimes a measure of the amount of gene product is used to infer how active a gene is.

The quantification of the expression product of the microRNAs, or the detection of the expression of their corresponding genes, can be carried out by any of the methods known in the state of the art. Preferably, the quantification is performed by real-time PCR (Q-RT-PCR).

The measurement of the expression levels of a gene, preferably quantitatively, is based on a signal that is obtained directly from the transcripts of said genes (mRNA, microRNA, etc.), and that is directly correlated with the number of molecules of RNA produced by genes. Said signal - which we can also refer to as an intensity signal - can be obtained, for example, by measuring an intensity value of a chemical or physical property of said products. On the other hand, it could be done by indirect measurement that refers to the measurement obtained from a secondary component or a biological measurement system (for example the measurement of cellular responses, ligands, "tags" or enzymatic reaction products).

The technique preferably used is the so-called real-time polymerase chain reaction (PCR). According to this technique, using an oligonucleotide, enzymes, primers and buffer solution, an original DNA fragment is exponentially amplified. This technique is carried out in an apparatus called thermocycler that maintains the necessary temperature in each of the stages that make up a cycle. Real-time detection is based on the use of fluorescent markers (probes) that bind to all double stranded DNA sequences formed in the cycles of the PCR reaction. One time

10

fifteen

twenty

Since the marker binds to the double stranded nucleic acid, it emits a fluorescent signal that is processed in real time (Walter et al., 2002, Science, 296, 557-559). The cycle at which the emission of the fluorescent marker intensity exceeds a certain threshold is called Ct. The expression levels of a microRNA are calculated as

2 "Ct

In a preferred embodiment of this aspect of the invention, the first method of the invention further comprises:

b) calculate the index A according to the equation:

image2

where: Po = -7,01449, Pi = 1,13676, P2 = 0,16051, P3 = 0,19897, P4 = 0.20980, P5 = 0.13676, xi = -log2 (miR20a / miR145), x2 = -log2 (miR145 / miR296), x3 = -log2 (miR374 / miR34a), x4 = -log2 (miR374 / miR124) and x5 = patient age,

c) calculate the indices B1, B2 and / or B3 according to the equations:

B1 = -log2 (miR19b / miR15a); B2 = -log2 (miR20a / miR374); B3 = -log2 (miR374 / miR34a)

d) calculate the C1 and / or C2 indices according to the equations:

C1 = -log2 (miR19b / miR124); C2 = -log2 (miR19a / miR296)

assigning in each equation the values of the corresponding biomarkers obtained in step (a).

Thus, for the calculation of the indices of the invention AC it is necessary to consider that the value of the quotients between the biomarkers of microRNAs (miRX / miRY) is obtained by log2 (2 "CtX / 2" CtY), where miRX or X refers to the microRNA indicated in the numerator and miRY or Y indicated microRNA in the denominator.

5

10

fifteen

twenty

25

30

A third aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereinafter the second method of the invention, which

It comprises steps (a) and (b) according to the first method of the invention, and also

understands:

e) classify the individual of step (a) in the group of individuals with APS when the value of the index A of step (b) is preferably greater than 0.4, more preferably greater than 0.5, and even more preferably greater than 0.6.

A fourth aspect of the invention relates to a method for diagnosis, classification and / or follow-up of PHC, hereinafter the third method of the invention, which

It comprises steps (a) and (c) according to the first method of the invention, and also

understands:

f) classify the individual from step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably greater than 4.9, more preferably greater than 5.2, and even more preferably greater than 5,542.

A fifth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereinafter the fourth method of the invention, which

It comprises steps (a) and (c) according to the first method of the invention, and also

understands:

g) classify the individual from step (a) in the group of individuals with PHC with venous thrombosis when the B2 index value of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542 and when the value of the B3 index of step (c) is preferably less than -0,165, more preferably less than -0,265, and even more preferably less than or equal to -0,356.

A sixth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereinafter the fifth method of the invention, which

It comprises steps (a) and (c) according to the first method of the invention, and also

understands:

h) classify the individual of step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542 and when the value of the B3 index of step (c) is preferably in the range between (0.556, 0.736), more preferably in the range between (-0.456, 0.636), and even more

5

10

fifteen

twenty

25

30

preferably between (-0.356, 0.536], the bracket indicating that the value 0.536 is included in the range.

A seventh aspect of the invention relates to a method for the diagnosis, classification and / or follow-up of PHC, hereafter referred to as the sixth method of the invention, comprising steps (a) and (c) according to the first method of the invention, and also comprises:

i) classify the individual of step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542, when the value of the index B3 of step (c) is preferably greater than 0.336, more preferably greater than 0.436, and even more preferably greater than 0.536, and when the value of index B1 of step (c) is preferably less than 5,152, more preferably less than 5,052, and even more preferably less than or equal to 4,952.

An eighth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereafter referred to as the seventh method of the invention, which comprises steps (a) and (c) according to the first method of the invention, and also comprises:

j) classify the individual of step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is preferably less than 5,742, more preferably less than 5,642, and even more preferably less than or equal than 5,542, when the value of index B3 of step (c) is preferably greater than 0.336, more preferably greater than 0.436, and even more preferably greater than 0.536, and when the value of index B1 of step (c) is preferably greater than 4,752, more preferably greater than 4,852, and even more preferably greater than 4,952.

The term "APS with arterial thrombosis" refers to patients who have had episodes of thrombosis in some area of the arterial tree (AT). The most common AT in the APS occurs in the brain, manifesting itself as an established cerebrovascular accident or an attack Transient ischemic These ischemic events can be recurrent and multiple, progressing the patient towards a state of vascular dementia Other types of arterial thrombotic events occur in the mesentery, and their clinical expression is that of an angina or intestinal necrosis; extremities, manifesting as a gangrene, or coronary, with angina or myocardial infarction Some cases of severe hypertension associated with renal and glomerular arterial thrombosis have been described.

5

10

fifteen

twenty

25

30

The term "APS with venous thrombosis" refers to patients who have had episodes of thrombosis in some area of the venous tree (TV). Deep vein thrombosis is the thrombotic manifestation of the venous type most frequently associated with APS; it is often recurrent and can lead to pulmonary thromboembolism in a third of the patients.Other less common forms are thrombosis of the renal veins, Budd-Chiari syndrome, the involvement of the portal or mesenteric veins or the adrenal glands, which can derive in hemorrhages and insufficiency Thrombosis of the central vein of the retina has also been reported.

A ninth aspect of the invention relates to a method for the diagnosis, classification and / or monitoring of PHC, hereafter referred to as the eighth method of the invention, comprising steps (a) and (d) according to the first method of the invention, and also comprises:

k) classify the individual from step (a) in the group of individuals with PHC with atherosclerosis or pathological echodoppler when the value of the C1 index of step (d) is preferably less than 13,198, more preferably less than 12,198, and even more preferably less or equal to 11,198 and when the value of the C2 index of step (d) is preferably greater than 5,690, more preferably greater than 6,690, and even more preferably greater than 7,690.

In the APS patients, the presence of "atherosclerosis" or "pathological echodoppler" (syndrome characterized by the deposition and infiltration of lipid substances in the intimate layer of the walls of the medium and thick caliber arteries that results in the closure of the vessel is also detected and the development of thrombosis), facilitated by the presence of IgG isotype anti-cardiolipin autoantibodies in these patients.

In a preferred embodiment of any aspect of the invention, the biological sample isolated from step (a) is a plasma, serum or urine sample. Preferably the biological sample isolated from step (a) is a plasma sample.

An "isolated biological sample" includes, but is not limited to, cells, tissues and / or biological fluids of an organism, obtained by any method known to a person skilled in the art. Preferably, the biological sample isolated from step (a) is a plasma sample.

The methods of the invention can be developed independently or together, in any combination thereof.

5

10

fifteen

twenty

25

30

Steps (a), (b), (c), (d), (e), (f), (g), (h), (i), (j) and / or (k) of the methods described above can be totally or partially automated, for example, by means of a robotic sensor device for the quantification of step (a) or the computerized calculation of any of the indices of steps (b), (c) and / or ( d), or the computerized classification in steps (e), (f), (g), (h), (i), (j) and / or (k).

KIT OR DEVICE OF THE INVENTION, MICROARRAYDE OF THE INVENTION AND USES

A tenth aspect of the invention relates to a kit or device, hereafter kit or device of the invention, comprising the elements necessary to detect the expression levels of the microRNAs: miR-124, miR-145, miR- 20a, miR-296, miR-34a, miR-374, miR-19b, and miR-15a, as defined in the first aspect of the invention.

In a preferred embodiment of this aspect of the invention, the kit or device of the invention comprises primers, probes and / or antibodies capable of quantifying the microRNA expression product: miR-124, miR-145, miR-20a, miR- 296, miR-34a, miR-374, miR-19b, and miR-15a, and where:

- primers or primers are polynucleotide sequences of between 10 and 30 base pairs, more preferably between 15 and 25 base pairs, even more preferably between 18 and 22 base pairs, and still much more preferably about 20 base pairs, which have an identity of at least 80%, more preferably at least 90%, even more preferably at least 95%, still much more preferably at least 98%, and particularly 100 %, with a fragment of the sequences complementary to SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 5, SEQ ID N ° : 6, SEQ ID No.: 7, SEQ ID No.: 8, SEQ ID No.: 9, SEQ ID No.: 10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 16.

- the probes are polynucleotide sequences of between 80 and 1100 base pairs, more preferably between 100 and 1000 base pairs, and even more preferably between 200 and 500 base pairs, which have an identity of at least 80% , more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, and particularly 100%, with a fragment of the sequences complementary to SEQ ID N °: 1, SEQ ID No.: 2, SEQ ID No.: 3, SEQ ID No.: 4, SEQ ID No.: 5, SEQ ID No.: 6, SEQ ID No.: 7, SEQ ID No. : 8, SEQ ID N °: 9,

SEQ ID N °: 10, SEQ ID N °: 11, SEQ ID N °: 12, SEQ ID N °: 13, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 16.

- the antibodies are capable of binding to a region formed by any of the nucleotide sequences SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID 5 N ° : 5, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8, SEQ ID N °: 9, SEQ ID N °: 10, SEQ ID N °:

11, SEQ ID N °: 12, SEQ ID N °: 13, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 16.

In another preferred embodiment of this aspect of the invention, the antibodies are modified. In another preferred embodiment of this aspect of the invention, the antibody is human, humanized or synthetic. In another preferred embodiment, the antibody is monoclonal 10 and / or is labeled with a fluorochrome. Preferably, the fluorochrome is selected from the list comprising Fluorescein (FITC), Tetramethylrodamine and derivatives, Phycoerythrin (PE), PerCP, Cy5, Texas, allophycocyanin, or any combination thereof.

Table 1. microRNAs of the invention.

 Gene name

 Gene ID MiRNA name Gene sequence MiRNA sequence

 microRNA-124a (MIR124A)

 406907 hsa-miR-124-3p SEQ ID NO: 1 SEQ ID NO: 9

 microRNA-145 (MIR145)

 406937 hsa-miR145-5p SEQ ID NO: 2 SEQ ID NO: 10

 microRNA-20a (MIR20A)

 406982 hsa-miR20a-5p SEQ ID NO: 3 SEQ ID NO: 11

 microRNA-296 (MIR296)

 407022 hsa-miR296-5p SEQ ID NO: 4 SEQ ID NO: 12

 microRNA-34a (MIR34a)

 447040 hsa-miR34a-5p SEQ ID NO: 5 SEQ ID NO: 13

 microRNA-374a (MIR374A)

 442919 hsa-miR374a-5p SEQ ID NO: 6 SEQ ID NO: 14

 microRNA-19b (MIR19b)

 406980 hsa-miR19b-3p SEQ ID NO: 7 SEQ ID NO: 15

 microRNA-15A (MIR15A)

 406948 hsa-miR15a-5p SEQ ID NO: 8 SEQ ID NO: 16

In the context of the present invention, the genes MIR124A, MIR145, MIR20A, MIR296, MIR34a, MIR374A, MIR19b and MIR15A are also defined by a nucleotide sequence or polynucleotide, which constitutes the coding sequence of the microRNAs collected respectively in SEQ IDs listed in table 1, and which would include various variants from:

a) nucleic acid molecules encoding a microRNA comprising the nucleotide sequence of SEQ ID listed in table 1,

b) nucleic acid molecules whose complementary hybrid chain with the polynucleotide sequence of a),

c) nucleic acid molecules whose sequence differs from a) and / or b) due to the degeneracy of the genetic code,

d) nucleic acid molecules encoding a microRNA comprising the nucleotide sequence with an identity of at least 80%, 90%, 95%, 98% or 99% with

15 the SEQ IDs listed in Table 1, respectively, and in which the microRNA encoded by said nucleic acids possesses the activity and structural characteristics of the

microRNAs MIR124A, MIR145, MIR20A, MIR296, MIR34a, MIR374A, MIR19b and MIR15A. Among these nucleic acid molecules are those collected in the SEQ IDs indicated in table 1.

Sequences of the invention:

5 SEQ ID NO: 1:

AGGCCTCTCTCTCCGTGTTCACAGCGGACCTTGATTTAAATGTCCATACAATTAAGGCAC

GCGGTGAATGCCAAGAATGGGGCTG

SEQ ID NO: 2:

CACCTTGTCCTCACGGTCCAGTTTTCCCAGGAATCCCTTAGATGCTAAGATGGGGATTC 10 CTGGAAATACTGTTCTTGAGGTCATGGTT

SEQ ID NO: 3:

GTAGCACTAAAGTGCTTATAGTGCAGGTAGTGTTTAGTTATCTACTGCATTATGAGCACT

TAAAGTACTGC

SEQ ID NO: 4:

15 AGGACCCTTCCAGAGGGCCCCCCCTCAATCCTGTTGTGCCTAATTCAGAGGGTTGGGT GGAGGCTCTCCTGAAGGGCTCT

SEQ ID NO: 5:

GGCCAGCTGTGAGTGTTTCTTTGGCAGTGTCTTAGCTGGTTGTTGTGAGCAATAGTAAG G AAGCAATCAGCAAGTATACTGCCCTAGAAGTGCTGCACGTTGTGGGGCCC

20 SEQ ID NO: 6:

TACATCGGCCATTATAATACAACCTGATAAGTGTTATAGCACTTATCAGATTGTATTGTAA

TTGTCTGTGTA

SEQ ID NO: 7:

CACTGTTCTATGGTTAGTTTTGCAGGTTTG CATCCAGCTGTGTGATATTCTGCTGTGCAA 25 ATCCATGCAAAACTGACTGTGGTAGTG

SEQ ID NO: 8:

CCTTGGAGTAAAGTAGCAGCACATAATGGTTTGTGGATTTTGAAAAGGTGCAGGCCATA T TGTGCTGCCTCAAAAATACAAGG

SEQ ID NO: 9:

UAAGGCACGCGGUGAAUGCC 5 SEQ ID NO: 10:

GUCCAGUUUUCCCAGGAAUCCCU SEQ ID NO: 11:

UAAAGUGCUUAUAGUGCAGGUAG SEQ ID NO: 12:

10 AGGGCCCCCCCUCAAUCCUGU SEQ ID NO: 13:

UGGCAGUGUCUUAGCUGGUUGU SEQ ID NO: 14:

UUAUAAUACAACCUGAUAAGUG 15 SEQ ID NO: 15:

UGUGCAAAUCCAUGCAAAACUGA SEQ ID NO: 16:

UAGCAGCACAUAAUGGUUUGUG

The kit may also contain, without any limitation, buffers, protein extraction solutions, agents to prevent contamination, inhibitors of protein degradation, etc.

On the other hand, the kit or device of the invention can include all the supports and containers necessary for its implementation and optimization. Preferably, the kit further comprises instructions for carrying out any of the methods of the invention.

The kit of the invention may include positive and / or negative controls. The kit can also

twenty

5

10

fifteen

twenty

25

30

contain, without any limitation, buffers, protein extraction solutions, agents to prevent contamination, inhibitors of protein degradation, etc.

In another preferred embodiment of this aspect of the invention, the kit or device of the invention is a kit of parts, comprising a component A, formed by a device for collecting the sample from step a), and a component B, formed by the elements necessary to carry out the quantitative analysis in the sample from step a) or any of the methods of the invention.

In a preferred embodiment the kit or device of the invention comprises oligonucleotides. In another preferred embodiment, the oligonucleotides have modifications in some of their nucleotides, such as, but not limited to, nucleotides having any of their atoms with a radioactive isotope, usually 32P or tritium, immunologically labeled nucleotides, such as with a Digoxigenin molecule, and / or immobilized on a membrane. Several possibilities are known in the state of the art.

A eleventh aspect of the invention relates to a microarray, hereafter referred to as a microarray of the invention, comprising oligonucleotides or single channel microarrays designed from the nucleotide sequences SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8, SEQ ID N °: 9 , SEQ ID N °: 10, SEQ ID N °: 11, SEQ ID N °: 12, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 15, SEQ ID N °: 16.

Thus, for example, oligonucleotide sequences can be constructed on the surface of a chip by sequential elongation of a growing chain with a single nucleotide using photolithography. Thus, the oligonucleotides are anchored at the 3 'end by a method of selective activation of nucleotides, protected by a photolabile reagent, by the selective incidence of light through a photomask. The photomask can be physical or virtual.

Thus, oligonucleotide probes can be between 10 and 100 nucleotides, more preferably, between 20 and 70 nucleotides, and even more preferably, between 24 and 30 nucleotides.

Synthesis in situ on a solid support (for example, glass) could be done using ink-jet technology, which requires longer probes. The supports could be, but not limited to, filters or membranes of NC or nylon (charged), silicon, or glass slides for microscopes covered with aminosilanes, polylysine, aldehydes or epoxy. Probe

5

10

fifteen

twenty

25

30

It is each of the chip samples. The target is the sample to be analyzed: miRNA, messenger RNA, total RNA, a PCR fragment, etc.

In a preferred embodiment of this aspect of the invention, the microarray of the invention has modified oligonucleotides, as described in the previous aspect of the invention.

A twelfth aspect of the invention relates to the use of the kit or device of the invention or the microarray of the invention, for obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from PHC.

The invention also extends to computer programs adapted so that any processing means can implement the methods of the invention. Such programs may have the form of source code, object code, an intermediate source of code and object code, for example, as in partially compiled form, or in any other form suitable for use in the implementation of the processes according to the invention . Computer programs also cover cloud applications based on that procedure.

A thirteenth aspect of the invention relates to a computer program comprising program instructions to make a computer carry out the process according to any of the methods of the invention.

In particular, the invention encompasses computer programs arranged on or within a carrier. The carrier can be any entity or device capable of supporting the program. When the program is incorporated into a signal that can be directly transported by a cable or other device or medium, the carrier may be constituted by said cable or other device or means. As a variant, the carrier could be an integrated circuit in which the program is included, the integrated circuit being adapted to execute, or to be used in the execution of, the corresponding processes.

For example, the programs could be incorporated into a storage medium, such as a ROM, a CD ROM or a semiconductor ROM, a USB memory, or a magnetic recording medium, for example, a floppy disk or a disk Lasted. Alternatively, the programs could be supported on a transmissible carrier signal. For example, it could be an electrical or optical signal that could be transported through an electrical or optical cable, by radio or by any other means.

5

10

fifteen

twenty

25

30

A fourteenth aspect of the invention relates to a computer-readable storage medium comprising program instructions capable of having a computer perform the steps of any of the methods of the invention.

A fifteenth aspect of the invention relates to a transmissible signal comprising program instructions capable of having a computer perform the steps of any of the methods of the invention.

A "nucleic acid or polynucleotide sequence" may comprise the five bases that appear biologically (adenine, guanine, thymine, cytosine and uracil) and / or bases other than the five that appear biologically. These bases can serve different purposes, for example , to stabilize or destabilize hybridization; to stimulate or inhibit degradation of the probe; or as junction points for detectable moieties or screening moieties. For example, a polynucleotide of the invention may contain one or more modified base moieties, not standard, derivatized, including, but not limited to, N6-methyl-adenine, N6-tert-butyl-benzyl-adenine, imidazole, substituted imidazoles, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-

carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2- methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methylcytosine, N6 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylkeosine, 5'- methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5- oxyacetic acid, wybutoxyacyl, pestoxyrazine cheosin, 2-thiocytosine, 5-methyl-2-thiouracil, 2- thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil (i.e., thymine), uracil-5-oxyacetic acid methyl ester, 3- (3 -amino-3-N-2-carboxypropyl) uracil, (acp3) w, 2,6-diaminopurine, and 5- propynyl pyrimidine. Other examples of modified, non-standard, or derivatized base moieties can be found in US Pat. Nos. 6,001,611; 5,955,589; 5,844,106; 5,789,562; 5,750,343; 5,728,525; and 5,679,785. In addition, a nucleic acid or polynucleotide sequence may comprise one or more modified sugar moieties including, but not limited to, arabinose, 2-fluoroarabinous, xylulose, and a hexose.

The terms "polynucleotide" and "nucleic acid" are used interchangeably herein, referring to polymeric forms of nucleotides of any length, both ribonucleotides (RNA or RNA) and deoxyribonucleotides (DNA or DNA).

The terms "amino acid sequence", "peptide", "oligopeptide", "polypeptide" and "protein"

they are used interchangeably here, and refer to a polymeric form of

2. 3

5

10

fifteen

twenty

25

30

amino acids of any length, which may be coding or non-coding, chemically or biochemically modified.

The present invention means biologically active variant or fragment, those variants or fragments of the indicated peptides that have the same physiological, metabolic or immunological effect, or have the same utility as those described. That is, they are functionally equivalent. Such effects can be determined by conventional methods.

The term "identity", as used herein, refers to the proportion of identical nucleotides or amino acids between two nucleotide or amino acid sequences that are compared. Sequence comparison methods are known in the state of the art, and include, but are not limited to, the GAG program, including GAP (Devereux et al., Nucleic Acids Research 12: 287 (1984) Genetics Computer Group University of Wisconsin, Madison, (Wl); BLAST, BLASTP or BLASTN, and FASTA (Altschul et al., 1999. J. Mol. Biol. 215: 403-410.

The term "individual" or "subject", as used in the description, refers to an animal, preferably a mammal, and more preferably a human being. The term "individual" in this report is synonymous with "patient", and is not intended to be limiting in any aspect, and may be of any age, sex and physical condition. The individual can be anyone, an individual predisposed to a disease (for example, lung cancer) or an individual suffering from said disease.

Throughout the description and the claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention. The following examples and drawings are provided by way of illustration, and are not intended to be limiting of the present invention.

EXAMPLE OF THE INVENTION

The main objective of this study was to determine the profile of circulating miRNAs in APS patients and identify those circulating miRNAs that may represent non-invasive biomarkers for the diagnosis and typification of the atherothrombotic status of the disease, that is, APS with arterial thrombosis or APS with venous thrombosis and / or PHC with atherosclerosis or pathological echodoppler.

Table 1. Clinical and laboratory parameters of the subjects included in the study.

 APS Patients P Controls

 n = 90 n = 42

 Clinical Parameters

 Women Men

 48/42 22/20

 Age (years)

 51.2 ± 13.1 46.2 ± 13.4 n.s.

 Arterial thrombosis (n)

 35/90 0

 Venous thrombosis (n)

 55/90 0

 Recurrences (n)

 37/90 0

 Abortions (n)

 23/90 0

 Obesity (n)

 38/90 2/42

 Pathological IACML (n)

 24/90 6/42

 Ankle-Arm Index (ABI) (Left)

 1.3 ± 0.11 1.2 ± 0.09 0.02

 Ankle-Arm Index (ABI) (Right)

 1.27 ± 0.11 1.2 ± 0.09 0.02

 Positive Lupus Anticoagulant (n)

 85/90 0

 aCL IgG, LPG

 23.4 ± 72 1.3 ± 1.1 0.00

 aCL IgM, MLP

 21.8 ± 52 4.9 ± 5.2 0.00

 Anti-B2GPI, SGU

 5 ± 7.7 1 ± 0.7 0.02

 Antiplatelet agents, ASA / clopidogel (n)

 30/90 0

 Anticoagulants, warfarin / acenocoumarol (n)

 62/90 0

 Laboratory parameters

 Total cholesterol, mg / dL

 191.7 ± 32.06 190 ± 41.8 n.s.

 HDL cholesterol, mg / dL

 51.09 ± 12.4 55.4 ± 13.1 n.s.

 LDL cholesterol, mg / dL

 112.1 ± 33.2 118.1 ± 26.9 n.s.

 Triglycerides, mg / dL

 155.1 ± 163.2 88.3 ± 50.07 n.s.

 VSG, mm / h

 13.5 ± 13.6 10.2 ± 8.7 n.s.

The study was carried out in 90 APS patients and 42 healthy donors, whose clinical characteristics are shown in Table 1. Plasma samples were obtained from patients and 5 healthy donors, in which several parameters related to autoimmunity, inflammation and cardiovascular disease, including the levels of erythrocyte sedimentation rate (ESR), the thickness of the carotid intimate media (IACML) and the ankle-arm index (ABI).

5

10

fifteen

twenty

25

30

The analysis of the profile of miRNAs in the plasma of APS patients was performed using the "Human Serum & Plasma miRNA PCR array 'of Qiagen. To do this, a pool was made with 2 ^ l of the purified RNA from the plasma of 10 APS patients, and another pool with 2 ^ l of purified RNA from the plasma of 10 healthy donors. RNA purification was performed using the "miRNeasy Serum / plasma" kit from Qiagen from 200 ^ l of plasma to which 5 fmoles were added of cel-miR-39 as 'spike in control' at the time of extraction. Expression levels were analyzed using specific Qiagen software and the data were normalized with respect to the expression of cel-miR-39. validation studies of selected miRNAs in all individuals included in the study using RT-PCR and specific Taqman probes.

The analysis of the PCR array in the plasma of APS patients showed an increase in the expression levels of 19 miRNAs, while 20 were found to be diminished (Figure 1A).

The functional analysis, performed using the Ingenuity Pathway software, of the altered miRNAs in the array revealed that a high number of them had mRNA targets involved in pathological processes such as reproductive system disease, connective tissue disorders and inflammatory response (Figure 1B) .

In order to identify possible disease-specific biomarkers in PHC, we select those miRNAs more differentially expressed in the array and more directly related to the physiopathological processes of PHC (miR 19b, miR-20a, miR-124, miR-206, miR- 145a, miR-34a, miR-15a, miR-374a, miR-133b, miR-296, and miR-210). The results obtained after analyzing the expression levels of the miRNAs selected by RT-PCR in the cohort of 90 patients and 42 healthy donors, showed that different reciprocal ratios of a specific profile of miRNAs could discriminate APS patients from healthy donors (Figure 2) .

The use of reciprocal ratios is an approach that allows solving the problem of the normalization of the data of circulating miRNAs obtained by RT-PCR. In addition, these ratios have the advantage that in certain cases, miRNAs whose concentration is altered in the pathology in opposite directions, may be more effective in the classification of study populations.

Thus, a model was developed to differentiate APS patients from healthy donors based on the expression levels of these miRNAs, selecting the group of miRNAs (miRNA-124, miRNA-145, miRNA-20a, miRNA-296, miRNA-34a and miRNA-374) with the

5

10

fifteen

twenty

25

30

greater predictive power and combining them with the patient's biological age. This model was evaluated by means of the “10-fold crnss validation” statistical analysis, obtaining an area under the ROC curve of 80% and a sensitivity and specificity of 80% and 72%, respectively. (Figure 2).

We are also interested in identifying circulating miRNAs that could serve as non-invasive biomarkers useful in typing clinical aspects relevant to atherothrombotic pathology present in these patients.

We found that a group of 5 miRNAs (15a, 19b, 20a, 34a, 374), allowed to discriminate the type of thrombosis suffered by an APS patient. In this way, we developed a model that integrated reciprocal ratios of these miRNAs to discriminate arterial vein thrombosis with a sensitivity of 90%, specificity of 80% and an area under the ROC curve of 82%, evaluated by statistical analysis "10-fold cross validation" (Figure 3).

In addition, we identified 4 miRNAs (15a, 19b, 124, 296) whose ratios were associated with a pathological increase in the thickness of the intimate carotid middle. We constructed a model with these miRNAs that could identify an early atherosclerosis process with 69% sensitivity and 89% specificity, the area under the ROC curve being 0.79 (Figure 4).

To evaluate the relevance of the altered expression of these miRNA ratios in the plasma of APS patients, we performed different correlation and association studies.

Correlation studies showed that different ratios of the plasma miRNAs that made up the firm in APS correlated significantly with parameters related to autoimmunity such as antiphospholipid antibody titres. In addition, the expression levels of these miRNAs correlated with inflammatory markers such as erythrocyte sedimentation rate (ESR), as well as with parameters related to cardiovascular disease such as the ankle-arm index (Figure 5).

Association studies showed that the relationship between different miRNAs of the firm in PHC was associated with fetal losses in these patients. In addition, three of these microRNAs were also associated with positivity for antiphospholipid antibodies (Figure 6).

To find the clinical relevance of these results, we investigated the potential impact of this signature of miRNAs in the plasma of APS patients on their mRNA targets related to key pathological processes of this autoimmune condition.

The analysis of potential targets, using the Ingenuity Pathway software, identified a number of genes as targets of at least two of the eleven miRNAs that make up the firm. This analysis generated an interaction network that includes the altered miRNAs in the plasma of APS patients (in the center) and their specific targets, involved in pathological processes such as coronary artery disease, thrombosis, abortions and dysfunction.

cerebrovascular (Figure 7).

Among these mRNA targets, prothrombotic and pro-inflammatory genes were well known as participants in such pathological processes, such as tissue factor 10 (F3), thrombin (F2), VEGFA, FLT-1, MCP-1 (CCL2) or PPAR, among others.

In sum, our data suggest that:

Various miRNAs, differentially expressed in the plasma of APS patients, are associated with specific clinical profiles of this autoimmune pathology. We have developed

different models that identify a signature of defined miRNAs that can serve as biomarkers for the diagnosis and typing of atherothrombotic status in PHC.

Therefore, the circulating levels of specific microRNAs can be considered useful tools in the prevention and management of the disease in PHC patients.

twenty

Claims (14)

5 10 fifteen twenty 25 30 35 1. - Simultaneous use of microRNA biomarkers: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and miR-15a for diagnosis, classification and / or follow-up of the primary antiphospholipid syndrome (PHC). 2. - A method of obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject that potentially suffers from PHC, which includes: a) quantify the expression product of the biomarkers miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and / or miR-15a in an isolated biological sample of said individual. 3. - The method according to the preceding claim, further comprising: b) calculate the index A according to the equation: one 5 image 1 where: P0 = -7,01449, Pi = 1,13676, P2 = 0,16051, P3 = 0,19897, P4 = 0.20980, P5 = 0.13676, xi = -log2 (miR20a / miR145), x2 = -log2 (miR145 / miR296), x3 = -log2 (miR374 / miR34a), x4 = -log2 (miR374 / miR124) and x5 = patient age, c) calculate the indices B1, B2 and / or B3 according to the equations: B1 = -log2 (miR19b / miR15a); B2 = -log2 (miR20a / miR374); B3 = -log2 (miR374 / miR34a) d) calculate the C1 and / or C2 indices according to the equations: C1 = -log2 (miR19b / miR124); C2 = -log2 (miR15a / miR296) assigning in each equation the values of the corresponding biomarkers obtained in step (a). 4. - A method for the diagnosis, classification and / or monitoring of PHC comprising steps (a) and (b) according to any of claims 2-3, and further comprising: e) classify the individual of step (a) in the group of individuals with PHC when the value of the index A of step (b) is greater than 0.6. 5. - A method for the diagnosis, classification and / or monitoring of PHC comprising steps (a) and (c) according to any of claims 2-3, and further comprising: image2 5 10 fifteen twenty 25 30 35 40 f) classify the individual of step (a) in the group of individuals with PHC with arterial thrombosis when the value of the B2 index of step (c) is greater than 5,542. 6. - A method for the diagnosis, classification and / or monitoring of PHC comprising steps (a) and (c) according to any of claims 2-3, and further comprising: g) classify the individual of step (a) in the group of individuals with PHC with venous thrombosis when the value of the B2 index of step (c) is less than or equal to 5,542 and when the value of the B3 index of step (c) is less than or equal to -0.356. 7. - A method for the diagnosis, classification and / or monitoring of PHC comprising steps (a) and (c) according to any of claims 2-3, and further comprising: h) classify the individual of step (a) in the group of individuals with PHC with arterial thrombosis when the value of the B2 index of step (c) is less than or equal to 5,542 and when the value of the B3 index of step (c) is preferably in the range between (-0.356, 0.536). 8. - A method for the diagnosis, classification and / or monitoring of PHC comprising steps (a) and (c) according to any of claims 2-3, and further comprising: i) classify the individual from step (a) in the group of individuals with APS with arterial thrombosis when the value of the B2 index of step (c) is less than or equal to 5,542, when the value of the B3 index of step (c) is greater than 0.536, and when the value of index B1 of step (c) is less than or equal to 4,952. 9. - A method for the diagnosis, classification and / or monitoring of PHC comprising steps (a) and (c) according to any of claims 2-3, and further comprising: j) classify the individual of step (a) in the group of individuals with PHC with venous thrombosis when the value of the B2 index of step (c) is less than or equal to 5,542, when the value of the B3 index of step (c) is greater than 0.536, and when the value of index B1 of step (c) is greater than 4,952. 10. - A method for the diagnosis, classification and / or monitoring of PHC comprising steps (a) and (d) according to any of claims 2-3, and further comprising: k) classify the individual of step (a) in the group of individuals with PHC with atherosclerosis or pathological echodoppler when the value of the C1 index of step (d) is less than or equal to 11,198 and when the value of the C2 index of step (d ) is greater than 7,690. 11. - The method according to any of claims 2-10, wherein the biological sample isolated from step (a) is a plasma, serum or urine sample, preferably the sample is plasma. 12. - A kit or device comprising the necessary elements to detect the levels of expression of the microRNAs: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and miR-15a, as defined in claim 1, wherein the kit or device comprises primers, probes and / or antibodies capable of quantifying the product. 5 10 fifteen twenty 25 30 35 microRNA expression: miR-124, miR-145, miR-20a, miR-296, miR-34a, miR-374, miR-19b, and miR-15a, and where: - primers or primers are polynucleotide sequences of between 10 and 30 base pairs, more preferably between 15 and 25 base pairs, even more preferably between 18 and 22 base pairs, and still much more preferably about 20 base pairs, which have an identity of at least 80%, more preferably at least 90%, even more preferably at least 95%, still much more preferably at least 98%, and particularly 100 %, with a fragment of the sequences complementary to SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 5, SEQ ID N ° : 6, SEQ ID No.: 7, SEQ ID No.: 8, SEQ ID No.: 9, SEQ ID No.: 10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 16. - the probes are polynucleotide sequences of between 80 and 1100 base pairs, more preferably between 100 and 1000 base pairs, and even more preferably between 200 and 500 base pairs, which have an identity of at least 80% , more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, and particularly 100%, with a fragment of the sequences complementary to SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 7, SEQ ID N ° : 8, SEQ ID N °: 9, SEQ ID N °: 10, SEQ ID N °: 11, SEQ ID N °: 12, SEQ ID N °: 14, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 16. - the antibodies are capable of binding to a region formed by any of the nucleotide sequences SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 5, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8, SEQ ID N °: 10, SEQ ID N °: 11, SEQ ID N °: 12 , SEQ ID N °: 13, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 16. 13. - A microarray comprising oligonucleotides or single channel microarrays designed from the nucleotide sequences SEQ ID N °: 1, SEQ ID N °: 2, SEQ ID N °: 3, SEQ ID N °: 4, SEQ ID N °: 5, SEQ ID N °: 6, SEQ ID N °: 7, SEQ ID N °: 8, SEQ ID N °: 9, SEQ ID N °: 10, SEQ ID N °: 11, SEQ ID N °: 12, SEQ ID N °: 13, SEQ ID N °: 14, SEQ ID N °: 15, SEQ ID N °: 16. 14. - Use of the kit or device as defined in claim 12 or of a microarray as defined in claim 13, for the diagnosis, classification and / or monitoring of PHC in an individual or subject who potentially suffers APS