ES2590220B1 - PRODUCTION OF MICROBIAL OILS WITH HIGH CONTENT IN OIL ACID - Google Patents

Abstract

Production of microbial oils with high oleic acid content. # The present invention relates to the production of oleic acid by culturing a microorganism of the Rhodosporidium toruloides species, by inserting a gene encoding an enzyme with delta-9 activity. desaturase and / or a gene that encodes an enzyme with C {sub, 16} 3-ketoacyl-CoA synthase activity that allows to produce oleic acid in the presence of different carbon sources.

Description

PRODUCTION OF MICROBIAL OILS WITH HIGH CONTENT IN OIL ACID

FIELD OF THE INVENTION

The present invention relates to the production of microbial oils with a high oleic acid content by culturing a microorganism in the presence of different carbon sources.

BACKGROUND OF THE INVENTION

Over the past two decades, a renewed interest has emerged in the use of lubricants based on vegetable oils due to increased environmental concerns and regulatory standards. One study estimates that 50% of all lubricants sold globally end up in the environment due to losses during use, spills and volatility (Horner, D. 2002. J Synth Lubr, 18: 327-347).

Only engine oils, some 16 million liters of used oil worldwide, represent one of the most important challenges. Some studies have determined that 40% of these oils are lost by use, either by losses on the roads or because they burn in the combustion chamber. These oils are, by definition, impossible to collect.

The global consumption of lubricants in 2011 was 31 million tons with the projection of reaching 42 million tons in 2018, due to a compound annual growth rate of 2.5%. Although the current consumption of biolubricants is small, approximately 1% of the market, its consumption is expected to grow at a rate of 6.7% during the 2013-2018 period. Specifically, high growth of ester base oils for green lubricants is expected for the automobile engine market, particularly in Asia, where there is a greater need to improve performance, less frequent oil changes and environmental concerns and regulations.

It is widely recognized that vegetable oils have several inherent advantages over petroleum-derived oils as raw materials for the formulation of lubricants. Vegetable oils have excellent lubricity due to their polar functionality, a high viscosity index and high flash points. In addition, these oils are biodegradable so they have no negative impact on the environment. However, vegetable oils have important limitations for use as lubricants in a wide range of applications due to their low thermal and oxidative stability (Erham et al. 2006. Indust Crops Products, 24: 292-299). With the objective of solving these deficiencies, several strategies are carried out, which include the use of different additives, although these do not in many cases achieve the required properties. Therefore, much of the work has focused on chemical modifications of the structure and composition of fatty acids (Schneider, M. 2006. J Sci Food Agri, 86: 1769-1780).

Many of these chemical processes are based on the elimination of unsaturation sites through their functionalization. Chemical modifications of oleic acid derivatives include alkylation, radical addition, aCylation, aminoalkylation, co-oligomerization, hydroformylation and acyloxylation (Schneider, M. 2006. J Sci Food Agri, 86: 1769-1780; Vijayendran, B. 2014. Indust Biotechnol, 10: 64-68).

Documents US6316649, US8372301, W02012040175 and W02013002910 describe the formation of stolids by chemical bonding of different types of unsaturated fatty acids. These stolids can be subsequently esterified with long chain alcohols to produce branched esters as, for example, is detailed in W02013184255. These esters have excellent properties that rival mineral based oils that are used as the basis in the formulation of motor oils. Another strategy is the use of epoxidized vegetable oils as raw material for the production of mono / di-esters with excellent lubricity, cold flow and high viscosity index (US 8357634, US 8575081 and US8410033).

The attack on unsaturation sites is another strategy to modify vegetable oils and produce base oils for lubricants. The olefinic metathesis reaction developed by Elevance (W02013163071, W02014164597) has been successfully applied to obtain base molecules, from vegetable oils, with a certain structure, weight and ramifications.

The recent availability of soy, sunflower, safflower and rapeseed oils with a high content of oleic acid have been a new field of work for these developments. These oils have been recognized as very attractive raw materials for the development of biolubricants, hydraulic fluids and oils for electrical transformers due to their excellent thermal and oxidative stability (Castro et al. 2006. JADeS, 83: 47-52; lng, A. 2009. Proceedings 01 the 53rd Annual Meeting 01 the ISSS; EP2406357). For this reason, in recent years the development of soybean crop lines with an oil with a high oleic acid content (> 75% of total fatty acids) has been the objective of companies such as Mansanto (Vistive Gold ™) or DupontlPioneer (Plenish TM). Another recent advance is that achieved by the National Science Agency of Australia (CSIRO) which has received approval to carry out its first field trials with carcamo capable of producing oil with a very high content of oleic acid (> 90% of total fatty acids). This high concentration of oleic was achieved by the development of a gene silencing technology through interference RNA that prevents the formation of linolenic acid. However, in all these cases, these are still trials with very low productions.

The world production of vegetable oils in 2011 reached 146 million tons. Most of this amount is distributed among palm oils (32%), soy (29%), rapeseed (16%) and sunflower (8%). About 79% of these oils (115 MT / year) are used for food and 21% (31 MT / year) for industrial applications. According to estimates (Carlsson et al. 2011. Eur J Lipid Sci Technol, 113: 812-831) in 2030 the global oil needs will triple (390 MT / year) due to population increase and higher caloric consumption ( 150 MT / year for human food) and, above all, for the increase in the use of oils for industrial applications (240 MT / year). This increase in production will not be possible with current oil crops. Therefore, the production of oils and their derivatives (fatty acids, fatty alcohols, methyl esters, etc.) by microorganisms can be a good alternative source for the future obtaining of these products from sustainable and renewable raw materials.

The enzyme delta-9 desaturase (delta-9 FAD) in yeasts is located in the endoplasmic reticular membrane and uses fatty acids esterified to Co-A as substrates to produce monounsaturated fatty acids. The products of this protein are palmitoleic (C16: 1) and oleic (C18: 1) acids that are formed from palmityl-CoA (C16: 0) and stearyl-CoA, respectively.

Oleaginous microorganisms that include bacteria, yeasts, cyanobacteria, microalgae and filamentous fungi are defined by their ability to accumulate at least 20% of their dry weight in the form of lipids (Ratledge and Wynn. 2002. Avd Appl Microbiol, 51 : 1-51; Ratledge 2004. Biochemie, 86: 807-815). This characteristic makes these microorganisms considered as very attractive candidates to be used as host strains for the production of oils or compounds derived from them as fatty acids or alcohols.

Oleaginous bacteria have been the least studied to date because their lipid content is relatively lower than in yeasts, cyanobacteria, microalgae and filamentous fungi; and they are also limited by their low growth rates. The cyanobacteria and oleaginous microalgae are attractive hosts for the production of oils and fatty acid derivatives mainly because of their photosynthetic capacity that allows them to convert solar energy and recycle CO2. However, both types are technically difficult to manipulate and their culture and growth processes are more complicated than those of bacteria, yeasts and fungi. These difficulties are those that have prevented its use in the production of fatty acid derived compounds through metabolic engineering. Similarly, the exploitation of oleaginous filamentous fungi as production organisms has also been impeded by the lack of efficient transformation techniques.

There is therefore a need in the state of the art to achieve high performance, production and productivity of oils of microbial origin with a specific composition, and to achieve that these processes can become competitive with those used today.

SUMMARY OF THE INVENTION

The authors of the present invention have genetically modified a microorganism of the Rhodosporidium toruloides strain, by inserting their own or heterologous genes that encode an enzyme with delta-9 desaturase activity, or an enzyme with C16 3-ketoacyl-CoA synthase activity that allows produce oils with a high oleic acid content. The production of oil through the use of said microorganism is above 50 gIL and the oleic acid content is greater than 70% of the total fatty acids present.

Therefore, in a first aspect, the present invention relates to a microorganism of the genetically modified Rhodosporidium toruloides species with at least one gene selected from a group consisting of: a gene encoding an enzyme with delta-9 desaturase activity and a gene that encodes an enzyme with C16 3-ketoacetyl-CoA synthase activity.

In another aspect, the present invention relates to a process for obtaining a microbial biomass enriched in oil rich in oleic acid comprising:

i) culturing the microorganism of the invention in a culture medium comprising at least one carbon source and at least one nitrogen source under conditions suitable for the growth of said microorganism; Y

ii) separate the microbial biomass from the culture broth.

In another aspect, the invention relates to a microbial biomass enriched in oil rich in oleic acid obtained by the process for obtaining a microbial biomass enriched in oil rich in oleic acid of the invention.

In another aspect, the present invention relates to a process for obtaining an oil-enriched preparation rich in oleic acid comprising:

i) culturing the microorganism in a culture medium comprising at least one source of carbon and at least one source of nitrogen under conditions suitable for the growth of said microorganism;

ii) separate the microbial biomass from the culture broth; and iii) extracting the oleic acid-rich oil from the microbial biomass obtained in step (ii).

In another aspect, the present invention relates to a process for obtaining biolubricants comprising:

i) obtain a microbial biomass enriched in oil rich in oleic acid

according to the present invention ii) refining the oil rich in oleic acid obtained in step i) iii) converting the oil rich in oleic acid obtained in step (ii) in

Biolubricants

Finally, the invention relates to the use of the microorganism of the invention to obtain a microbial biomass enriched in oil rich in oleic acid. The present invention also relates to the use of the microorganism of the invention to obtain a preparation enriched in oil rich in oleic acid. The present invention also relates to the use of the microorganism of the invention to obtain biolubricants.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1: Integrative cassettes in Rhodosporidium toruloides Figure 2: Increase of oleic acid in clones of Rhodosporidium toruloides containing elongase 1 (Elo1 Rt). Figure 3: Increase of oleic acid in clones of Rhodosporidium toruloides containing delta-9 desaturase (ó9Rt). Figure 4: Increase in oleic acid in R. toruloides T124-347 containing elongase 1 (Elo1 Rt) and containing delta-9 desaturase (D.9Rt).

Detailed description of the invention

In a first aspect, the present invention relates to a microorganism, in

hereinafter "microorganism of the invention", of the genetically modified Rhodosporidium torufoides species with at least one gene selected from a group consisting of: a gene that encodes an enzyme with delta-9 desaturase activity and a gene that encodes an enzyme with C16 activity 3-ketoacyl-CoA synthase.

The term "gene", as used herein, refers to a deoxyribonucleotide chain that encodes a protein. In a particular embodiment of the invention, said term refers to a deoxyribonucleotide chain encoding an enzyme with delta-9 desaturase activity. In another particular embodiment of the invention, said term refers to a deoxyribonucleotide chain that encodes an enzyme with C16 3-ketoacyl-CoA synthase activity.

The term "enzyme", in the context of the present invention, refers to a protein that functions as a highly selective catalyst, accelerating both the speed and the specificity of the metabolic reaction for which it is specific.

In particular, the microorganism of the invention is a genetically modified microorganism. The term "genetically modified microorganism" as used herein, refers to a microorganism whose genetic material has been altered using genetic engineering techniques. Accordingly, said genetically modified microorganism expresses an enzyme that has a delta-9 desaturase activity activity and / or a C16 3-ketoacyl-CoA synthase activity, compared to a corresponding unmodified control microorganism of the same strain. In the context of the present invention, the enzyme having delta-9 desalurase activity may be encoded by a gene encoding said enzyme in R. toruloides or in another organism. Also, in the context of the present invention, the enzyme having C'6 3-ketoacyl CoA synthase activity may be encoded by a gene encoding said enzyme in R. toruloides or in another organism.

Generally, the gene encoding an enzyme that has delta-9 desaturase activity or the gene that encodes an enzyme that has C'6 3-ketoacyl-CoA synthase activity can be introduced into the microorganism in any suitable form, for example, comprised in a vector, a plasmid or as a naked nucleic acid. After being introduced into the microorganism, the gene can be expressed exogenously if it is expressed in a vector / plasmid in the microorganism [ie, outside of the microbial chromosome (s)), or it can be incorporate into the microbial chromosome (s) by random (ectopic) or homologous recombination or any other suitable method known in the state of the art. Appropriate techniques that allow genetic transformation in yeasts include but are not limited to:

Transformation of spheroplasts that involves removing the cell wall of the yeast and putting the spheroplasts in contact with the plasmid in the presence of PEG. Transformation with U +, which involves the treatment of yeast cells with monovalent alkaline cations (Na +, K +, Rb +, Cs + and U +) in combination with PEG to stimulate the uptake of AON by intact cells. Gene bombardment that involves bombarding cells with microprojectiles coated with exogenous DNA. Electroporation, which involves administering electrical pulses to yeasts that produces the opening of pores in the spheroplast membrane and intact yeast cells. Agrobacterium tumefaciens-mediated transformation (ATMT) is based on the use of the gene transfer capacity that A. tumefaciens naturally possesses.

Transformals are grown in a suitable nutrient medium and under selection conditions to ensure retention of endogenous DNA. The insertion of the gene encoding an acyl-CoA reductase into said transformants can be determined by any

appropriate molecular biology technique for this, for example, by Southern blot or PCR. Conventional methods of detecting and quantifying the expression of a gene can be found, for example, in Sambrook et al. , 2001. "Molecular cloning: a Laboratory Manual", 3rd ed., Cold Spring Harbar Laboratory Press, N.Y., Vol. 1-3.

The term "delta-9 desaturase", "stearoyl-CoA desaturase", "stearoyl-CoA 9 desaturase", "acyl-CoA desaturase", or "fatty acid desaturase", as used herein, is refers to a polypeptide that belongs to the EC enzyme family

1.14.19.1 and which catalyzes the introduction of a double bond in the delta-9 position of a fatty acid chain. In a particular embodiment, said enzyme catalyzes the introduction of a double bond in palmitic or stearic acid giving rise to palmitoleic acid or oleic acid, respectively. In a preferred embodiment of the invention, the enzyme with delta-9 desaturase activity of the invention catalyzes the introduction of a double bond in stearic acid giving as the final product of the reaction oleic acid.

The term "C'e 3-ketoacyl-coA synthase», "acyl-Coa elongasa", "beta-ketoacil CoA synthase", "3oxoacil CoA synthase very long chain", ° "fatty acid elongase" as it is used herein, refers to a polypeptide belonging to the EC enzyme family 2.3.1.199 and which catalyzes the addition of two carbons to a 16-carbon fatty acid at its carboxyl end. Thus, the enzyme with C'6 3-ketoacylCoA synthase activity of the invention is capable of elongating a 16-carbon fatty acid in two carbon atoms, to give rise to an 18-carbon fatty acid.

Preferably, the enzyme with C'6 3-ketoacyl-CoA synthase activity catalyzes the aforementioned elongation reaction using 16 carbon fatty acids as the sole substrate. In a particular and preferred embodiment of the invention, said enzyme uses as a single substrate stearic acid, that is, it has absolute specificity for said substrate, oleic acid being obtained as a product of the elongation reaction. However, enzymes with C'6 3-ketoacyl-CoA synthase activity suitable for use in the present invention also include those enzymes that have specificity for more than one substrate, in which case they have a substantially higher specificity over fatty acids of 16 atoms. of carbon than on carbon atoms of greater (for example, fatty acids of 18 carbon atoms) or of shorter length (for example, fatty acids of 14 carbon atoms) Thus, enzymes with C'6 3-ketoacyl-CoA synthase activity Suitable for use in the present invention include those that show a specificity against fatty acids of 16 carbon atoms that is at least 1.5 times, at least 3 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 8 times, at least 9 times, at least 10 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 60 times, at least 70 times, at least 80 times, at least 90 times, at least 100 times or more with respect to the specificity against fatty acids of 18 carbon atoms. This definition also includes enzymes that catalyze the addition of two carbons to a 16-carbon fatty acid at its carboxyl end with a specificity greater than the specificity they present for a fatty acid of 1, 2, 3, 4, 5, 6, 7 , 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20 carbons or more. The term "specificity", as used herein, refers to the efficiency with which the enzyme transforms a particular substrate into the reaction product. The term "greater specificity", as used herein, refers to the efficiency with which the enzyme of the invention transforms a 16-carbon fatty acid, in particular stearic acid, into the reaction product , that is to say in an 18-carbon fatty acid, in particular in oleic acid, it is at least 1.5 times, at least 3 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 8 times, at least 9 times, at least 10 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 60 times, at least 70 times, at least 80 times, at least 90 times, at least 100 times or more, greater than the specificity of said enzyme by a fatty acid whose length is not 16 carbons, in particular by a 18-carbon fatty acid, such as a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,11,12, 13,14,15,17,18, 19, fatty acid 20 carbons or more in one preferred embodiment, it is understood that an enzyme with C16 3-ketoacyl-CoA synthase activity is specific against a substrate of 16 carbon atoms, its substrate specificity is higher than that observed against a substrate with a different number of carbon atoms and that present at the same number of unsaturations as the substrate of 16 carbon atoms.

The specificity of an enzyme can be determined by measuring the specificity constant (Kcat / Km). The person skilled in the art knows that the preferred substrates for enzymes are those for which the Km values are low and the Kcat values high in comparison with substrates for which it shows no specificity or for which it shows a lower specificity. The determination of the specificity of the enzyme with C16 3-ketoacyl-CoA synthase activity of the invention can be determined, for example by quantifying the

number of substrate molecules transformed into product per unit time (Kcat) in the presence of different substrates and dividing said value by the concentration of each of said substrates at which the reaction rate is half the maximum speed (Km) . By way of illustration, the specificity of the enzyme with e16 3-ketoacyl-CoA synthase activity of the invention by a 16-carbon fatty acid versus the specificity of said enzyme by an 18-carbon fatty acid can be determined by comparing the concentration ratio of the 18-carbon fatty acid / the concentration of the 16-carbon fatty acid at which the reaction rate is half the maximum speed versus the ratio of the 20-carbon fatty acid concentration / the acid concentration 18 fatty

10 carbons at which the reaction rate is half the maximum speed. The concentration of a fatty acid can be determined by any technique known in the state of the art appropriate for this as spectrophotomatic or chromatographic techniques.

The term "fatty acids", as used herein, refers to

Biomolecules of lipid nature formed by a long linear hydrocarbon chain, of different length or number of carbon atoms having an alkyl group at one end and an acid group at the other end. Said term includes saturated fatty acids and unsaturated fatty acids. The former do not have double bonds in the hydrocarbon chain that forms them and are flexible and solid at room temperature while

20 that, the latter have double or triple bonds, are rigid at the level of these bonds and have a liquid or viscous temperature at room temperature. In this last group, we can also differentiate between monounsaturated fatty acids or MUFA (from English "monounsaturated fatfy acid ') and polyunsaturated fatty acids or PUFA (from English" polyunsaturated fatty acid').

The term "oleic acid" or "cis-9-actadienoic acid", as used herein, refers to a monounsaturated fatty acid of the omega 9 series typical of vegetable oils such as olive oil, avocado oil etc. and whose empirical formula is C18H340.,

In a particular and preferred embodiment of the invention, the gene encoding the enzyme that has delta-9 desaturase activity and / or the gene that has C16 3-ketoacyl-CoA synthase activity is a gene of the R. toruloides species.

In another particular embodiment of the invention, the gene encoding the enzyme that has delta-9 desaturase activity and / or the gene that has C16 3-ketoacyl-CoA synthase activity has codons optimized for expression in the recombinant microorganism, i.e. in R.

toruloids

The term "optimized codons ~, as used herein, refers to the alteration of codons in nucleic acid molecules to reflect the use of codons typical of the host organism without altering the DNA-encoded polypeptide, to improve expression. The software methods and tools for codon optimization are well known in the state of the art.

Codons are known in the art that can be used for gene expression in R. toruloides. Illustrative non-limiting examples of optimized codons that can be employed for gene expression in include: UUU, UUC, UUA, UUG, CUU, CUC, CUA, AUU, AUC, AUG, GUU, GUC, GUA or GUG (Codon usage database , data souree: NCBI-GenBank). In this context of the invention, the genetically modified microorganism is grown under the appropriate conditions that allow the expression of the gene that has delta-9 desaturase activity and activity and / or of the gene that has C16 3-ketoacyl-CoA synthase activity in this way. , produce oleic acid. Suitable culture media for the appropriate growth of different microorganisms are well known in the art. Normally said culture media comprise carbon sources, such as glucose, xylose, sucrose, glycerin, and appropriate nitrogen sources such as, for example, yeast extract, peptone, ammonium salts, macerated corn liquid, urea or sodium glutamate

Preferably, said gene is introduced into a replicative DNA expression or construct vector that allows the expression of the gene encoding an enzyme with delta-9 desaturase activity and / or the expression of the gene encoding an enzyme with C16 3-ketoacylCoA synthase activity according to the present invention and which includes a transcriptional unit comprising the assembly of (1) genetic element (s) that plays a regulatory role in gene expression, for example, promoters, operators or enhancers, operatively linked to (2) the sequence of the gene that encodes an enzyme with activity with delta-9 desaturase activity and / or the sequence of the gene that encodes an enzyme with C16 3-ketoacyl-CoA synthase activity according to the invention and that is transcribed to messenger RNA and it is translated into protein and (3) sequences suitable for initiating and terminating transcription and translation. Vectors that can be used in the context of the present invention typically include a genetic marker, an origin of replication in bacteria.

or yeasts, multiple cloning sites and a genetic marker. The genetic marker is usually a gene that confers resistance to an antibiotic, for example ampicillin or

geneticin, or alternatively, an auxotrophic marker in the case of yeasts. Such regulatory elements may include an operator sequence to control transcription. The ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants can be further incorporated. DNA regions are operably linked when they are functionally related to each other. For example, the DNA for a signal peptide is operably linked to the DNA for a polypeptide if it is expressed as a precursor that participates in the secretion of the polypeptide; a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to allow translation. The regulatory sequences useful for the present invention may be nuclear promoter sequences or, alternatively, enhancer sequences and / or regulatory sequences that increase the expression of the nucleotide sequence, suppressor sequences, transcriptional start sites, transcriptional stop sites, sites of polyadenylation and the like. A large number of expression control sequences are known in the art and can be used according to the present invention.

In the case of eukaryotic cells, these normally comprise promoters that ensure the initiation of transcription and optionally poly-A signals that ensure termination of transcription and stabilization of the transcript. Commonly used promoters are the scrofular mosaic virus promoter, the polyubiquitin promoter and the actin promoter for ubiquitous expression. The promoter can be constitutive or inducible. If desired, the constant expression of the gene, then a constitutive promoter is used. An "inducible" promoter is used when a regulated expression of the gene is desired depending on the physiological or developmental conditions. Typical promoters for expression in yeast cells include, but are not limited to:

Constitutive promoters such as, for example, the alcohol dehydrogenase (ADH1) promoter, the 1-0 elongation factor promoter (TEF) and the gene promoter encoding the triose phosphate isomerase (TPI), the glyceraldehyde promoter 3-phosphate dehydrogenase (GPD) and the 3-phosphoglycerate kinase (GPK) promoter, the MRP7 promoter and the alcohol oxidase promoter (AOX1). Inducible promoters such as, for example, the metallothionein promoter (CUP1), whose expression is regulated by the addition of copper to the culture medium, the promoter of the gene encoding the FUS1 gene or the FUS2 gene, whose expression is active in the presence of pheromones (to the factor o) as described in US5063154, the TET promoter, whose expression is regulated in the presence of tetracyclines, the GAL 1-10, GALL, GALS promoters that are activated in the presence of galactose, the estrogen-inducible VP16-ER promoter, and the phosphatase promoter (PH05) whose expression is activated in the presence of phosphate and the HSP150 heat shock protein promoter, whose expression is activated at high temperature. Repressible promoters such as, for example, the promoter of the enolase gene (ENO-1) of S. cerevisiae, whose expression can be repressed when the microorganism is grown in a non-fermentable carbon source, as well as promoters whose expression is subjected under glucose repression so that the expression will be repressed when part of the lactose has been hydrolyzed and the concentration of glucose in the medium begins to increase, the glyceraldehyde-3-phosphate dehydrogenase (ADH2 / GAP) promoter from R.toruJoides , and the galactokinase promoter (GAL 1).

Preferably, in those cases where heterologous protein is suspected of being toxic to the host cell, the promoter used to regulate its expression is preferably an inducible promoter so that the expression of the protein of interest can be delayed until they have been delayed. reached sufficient levels of biomass. In a preferred embodiment, the gene that codes for the enzyme with delta-9 desaturase activity and / or the gene that codes for an enzyme with C16 3-ketoacyl-CoA synthase activity capable of increasing the concentration of oleic acid according to the present invention, it is expressed under the control of a constitutive promoter. When constructing suitable expression plasmids, the termination sequences associated with these genes are also ligated into the 3 'expression vector of the desired sequence to be expressed to provide mRNA polyadenylation and termination. Other promoters, which have the additional advantage of transcription controlled by growth conditions are the promoter region for alcohol dehydrogenase-2, isocytochrome C, acid phosphatase, degrading enzymes associated with nitrogen metabolism, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase , and enzymes responsible for the use of maltose and galactose. Any plasmid vector containing a promoter, origin of replication and termination compatible with yeast, is suitable.

Yeast vectors suitable for the present invention can be based on the following types of plasmids:

Multicopy autonomous plasmids: these plasmids contain sequences that allow multiple copies of these vectors to be generated. These sequences can be called 21-1 such as the one that appears in episomal plasmids (YEp or

Yeast episomal plasmids) or ARS-like sequences such as those that appear in replication plasmids (YRps or yeast replication plasmids), Examples of plasmid-based vectors of this type are p426GPD, p416GPD, p426TEF, p423GPD, p425GPD, p424GPD or p426GAL, YEp24 AND YEplac. Single copy autonomous plasmids: plasmids containing the ARS1 autonomous replication sequence and a centromeric sequence (CEN4). Plasmids of this type include centromeric plasmids (YCps or yeast centromeric plasmids). Integration plasmids: plasmids that can be integrated into the genome of the host cell. Plasmids of this type include integration plasmids (YIPs)

or yeast integration plasmids). Examples of plasmid-based vectors of this lipo are pRS303, pRS304, pRS305 or pRS306 and the like.

In an even more particular and preferred embodiment of the invention, said genes encoding enzymes with delta-9 desaturase and / or C16 3-ketoacyl-CoA synthase activity are expressed under control of the R. toruloides glycerol-3-phosphate dehydrogenase promoter.

Preferred embodiments of the invention contemplate the use of terminator sequences. The term "terminator sequence", as used in the present invention, refers to an AON sequence located at the end of a transcriptional unit that signals the termination of transcription. Terminators are untranslated AON sequences that contain a polyadenylation signal, which facilitates the addition of polyadenylate sequences to the 3'end of a primary transcript. Terminator sequences are known to those skilled in the art. Illustrative and non-limiting examples of terminator sequences that may be employed in accordance with the present invention include the terminator of the nopaline synthase gene of Agrobacterium tumefaciens (t-nos) or the terminator of the gene 358 of the cauliflower mosaic virus (CaMV), In an even more preferred embodiment of the invention the terminator is the terminator of the A. tumefaciens nos gene.

As mentioned above, the invention contemplates embodiments wherein the vectors used for the expression of the gene encoding enzyme with delta-9 desaturase activity and / or of the gene encoding the enzyme with C16 3-ketoacyl-CoA synthase activity in R. toruloides comprises a genetic marker, such as a gene that confers resistance to an antibiotic. If desired, the expression of said gene can be optimized for expression in R. toruloides by the use of promoter, terminator and codon sequences optimized for yeast expression. Examples of such sequences have been mentioned above herein. In

A preferred embodiment, said promoter and terminator sequences are different from the promoters and terminators used for the correct expression of the genes encoding the delta-9 desaturase and / or 3-ketoacyl-CoA synthase enzymes in the microorganism of the invention.

In a particular and preferred embodiment of the invention, the gene encoding an enzyme with delta-9 desaturase activity is the delta-9 desaturase gene isolated from R. toruJoides whose enzyme comprises the sequence shown in SEa ID NO: 1 or a functionally variant equivalent of it.

In another particular embodiment, the gene that oodifies an enzyme with C16 3-ketoacyl-CoA synthase activity is the R. toruloides Elo1 gene whose enzyme comprises the sequence shown in SEQ ID NO: 2 or a functionally equivalent variant thereof.

The term "is from" or "isolated from" means that the gene or enzyme encoded by said gene is substantially separated or purified from a gene or enzyme encoded in the cell of the organism in which said gene or encoded polypeptide is produced. of natural form. Thus, the term isolated encompasses genes purified by standard purification methods for nucleic acids or encoded proteins. The term also comprises genes or enzymes encoded by said genes prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids or the encoded polypeptide thereof.

The term "functionally equivalent variant" as used herein, refers to all those polypeptides derived from the enzyme sequence with delta-9 desaturase activity shown in SEa ID NO: 1, or from the sequence of the enzyme with C16 3-ketoacyl-CoA synthase activity shown in SEQ 1 D NO: 2 by modification, insertion and / or deletion of one or more amino acids as long as the function of said enzyme is substantially maintained. Specifically, the functionally equivalent variants will maintain the ability to increase the concentration of oleic acid from 16-carbon acids, particularly palmitic and stearic acid. Methods for determining the production of oleic acid from said precursors are known in the state of the art. By way of illustration, the determination of oleic acid production can be carried out by any method that allows the detection of organic components in a sample, such as chromatographic methods including gas chromatography and mass chromatography. Techniques that allow the extraction of oil from the cellular interior are known in the state of the art and include mechanical extraction methods such as pressing and solid-liquid chemical extraction methods.

Functionally equivalent variants of said delta-9 desalurase include those showing at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least one 95%, at least 96%, at least 97%, at least 98% or at least 99% amino acid sequence identity with respect to the SEO ID NO: 1 sequence of said delta-9 desaturase indicated above .

Functionally equivalent variants of said 3-ketoacyl-CoA synthase include those showing at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% At least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at at least 95%, at least 96%, at least 97%, at least 98% or at least 99% amino acid sequence identity with respect to the SEO ID NO: 2 sequence of said C16 3-ketoacyl -CoA synthase indicated above.

The degree of identity between two amino acid sequences can be determined by conventional methods mentioned in the context of the first method of the invention such as, for example, BLAST (Altschul SF et al. Basic Local Alignment Search Tooi. J Mol Biol. 1990 Oct 5; 215 (3): 403-10). The person skilled in the art will understand that the amino acid sequences referred to in this description can be chemically modified, for example, by chemical modifications that are physiologically relevant, such as phosphorylations, acetylations, etc.

In a preferred embodiment of the invention, said gene encoding an enzyme with delta-9 desaturase activity consists of the sequence shown in SEa ID NO: 1.

In another preferred embodiment of the invention, said gene encoding an enzyme with C16 3-ketoacyl-CoA synthase activity consists of the sequence shown in SEO ID NO: 2.

In a particular embodiment, the microorganism of the invention refers to a mutant of the Rhodosporidium toruloides strain CECT 13085. The term "strain", as used herein, refers to a genetic variant or subtype of an organism. determined.

The strain Rhodosporidium toruloides CECT 13085 refers to a microorganism of the Rhodosporidium toruloides species that has the ability to grow in the presence of biomass hydrolysates without deloxify and / or has the ability to melabolize xiloS8. Said strain is deposited in the Spanish Type Culture Collection (CECT) dated May 7, 2013. The characteristics of said strain are described in patent application ES2526617A1.

In a particular embodiment, the FAD gene of the microorganism of the invention is not functional. The term "FAD2", as used herein, refers to the gene encoding the enzyme with delta-12 desaturase activity that catalyzes the introduction of a double bond at the delta-12 position of palmitic acid or oleic acid. . In a preferred embodiment of the invention, said gene encodes an enzyme with delta-12 desaturase activity whose sequence is shown in the SEO ID NO: 3 sequence.

The expression "the FAD2 gene is not functional" as used herein, refers to said gene encoding an FAD2 protein whose ability to introduce a double bond at the delta-12 position of the carbon chain of acids palmitic or oleic, it is diminished with respect to the ability to carry out said synthesis by a protein encoded by said functional FAD2 gene. According to the present invention, the microorganism of the invention has a non-functional FAD2 gene if the ability to introduce a double bond in the delta-12 position of the carbon chain of palmitic or oleic acids by the FAD2 protein encoded by said gene Non-functional FAD2 is reduced by at least 50%, at least 60%, at least 70%, at least 80% at least 90%, at least 95% or more with respect to said synthesis performed by a gene FAD2 functional. The FAD2 gene of R. toruloides, preferably of R. toruJoides CECT 13085 may be non-functional due to a mutation in the sequence of said gene.

The expression "FAD2 gene is not to work also refers to said gene being absent in the genome of the microorganism of the invention, a consequence of a total deletion of the sequence of said gene. In a preferred embodiment of the invention, the microorganism of the The invention presents the deleted FAD2 gene in its entirety.The determination of the functionality of the FAD2 gene in R. loruloides, preferably in R. loruloides CECT 13085, can be carried out by any method known in the state of the art that allows to detect the activity Enzyme FAD2.

The term "mutation" refers to substitutions, insertions or deletions that occur at the level of the nucleotide sequence. By "insertion" is meant the gain of one or more nucleotides. Within the insertion there are duplications that consist of the repetition of a segment of DNA inside a sequence, which can occur three (triplication) or more times. By "deletion" as used herein, the loss of one or more nucleotides is understood. Deletions can be total or partial. The term "totar deletion of the sequence of a gene, as used in the present invention, refers to the loss of 100% of the nucleotides that constitute the nucleotide sequence of said gene. The term "partial deletion of the sequence of a gene, as used in the present invention" refers to the loss of at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40% , 50%, 60%, 70%, 80%, 90% or 99% of the nucleotides that make up the nucleotide sequence of said gene. As one skilled in the art knows, there are appropriate methods in the art for performing mutations in the sequence of a gene such as site-directed mutagenesis by PCR or site-directed mutagenesis by PCR on a plasmid.

In an even more particular embodiment, the KU70 gene and / or the KUBO gene of the microorganism of the invention, preferably of the strain R. toruloides CECT 13085, is not functional.

The term "KU70", as used herein refers to the R. toruloides gene that encodes a protein that participates in non-homologous recombination during the DNA repair process. The KU70 sequence of R. toruloides is deposited in the GenBank database (version of May 27, 2014) under number KF850470.

The term "KU70 gene is not functional", as used herein, refers to the said gene encoding a KU70 protein whose binding capacity to damaged DNA and / or whose ability to recruit proteins involved in the repair of said DNA is diminished with respect to the ability to perform said function by a protein encoded by said functional Ku70 gene. According to the present invention, the microorganism of the invention has a non-functional KU70 gene if the aforementioned capacity is reduced by at least 50%, at least 60%, at least 70%, at least 80% at least 90%, at least 95% or more with respect to said synthesis performed by a functional KU70 gene. The KU70 gene of R. toruloides, preferably of R. toruloides CECT 13085 may be non-functional due to a mutation in the sequence of said gene.

In another preferred embodiment according to the present invention, the expression "KU70 gene is not functional" also means that said gene is absent in the master gene of the microorganism of the invention, resulting from a total deletion of the sequence of said gene. . In a preferred embodiment of the invention, the microorganism of the invention has the KU70 gene completely deleted. The determination of the functionality of the KU70 gene in R. toruloides, preferably in R. toruloides CECT 13085, can be carried out by any method known in the state of the art that allows to detect the enzymatic activity of KU70.

The term "KU80", as used herein refers to the R. toruloides gene that encodes a protein that participates in non-homologous recombination during the DNA repair process. The KU80 sequence of R. toruloides is deposited in the GenBank database (May 27, 2014 version) under number KF850471.

The term "KUBO gene is not functional", as used herein, refers to said gene encoding a KU80 protein whose binding capacity to damaged DNA and / or whose ability to recruit proteins involved in the repair of said DNA is diminished with respect to the ability to perform said function by a protein encoded by said functional KUBO gene. According to the present invention, the microorganism of the invention has a non-functional KUBO gene if the aforementioned capacity is reduced by at least 50%, at least 60%, at least 70%, at least 80% at least 90%, at least 95% or more with respect to said synthesis performed by a functional KU80 gene. The KUBO gene of R. toruloides, preferably of R. toruloides CECT 13085 may be non-functional due to a mutation in the sequence of said gene.

In another preferred embodiment according to the present invention, the expression "KUBO gene is not functional" also means that said gene is absent in the genome of the microorganism of the invention, a consequence of a total deletion of the sequence of said gene. In a preferred embodiment of the invention, the microorganism of the invention has the KU80 gene completely deleted. The determination of the functionality of the KU70 gene in R. toruloides, preferably in R. toruloides CECT 13085, can be carried out by any method known in the state of the art that allows to detect the enzymatic activity of KU80.

Procedure to obtain a microbial biomass enriched in oil rich in oleic acid

In another aspect, the present invention relates to a process for obtaining a microbial biomass enriched in oil rich in oleic acid, hereinafter "first process of the invention", which comprises

i) culturing the microorganism of the invention in a culture medium that

comprises at least one source of carbon and at least one source of

nitrogen, under conditions suitable for the growth of said

microorganism, and

ii) separate the microbial biomass from the culture broth,

The term "microbial biomass", as used in the present invention, refers to the biological material of living or recently living organisms, in particular of the microorganism of the invention, and to organic matter originated in a biological, spontaneous or provoked biological process. , usable as a source of energy. As a renewable energy source, biomass can be used directly or indirectly, after conversion into another type of product such as biofuel. In the particular case of the present invention, microbial biomass is rich in oleic acid.

The term "oil", as used herein, refers to a fatty composition formed by acylglycerides, ie esters in which one, two or three fatty acid molecules bind to a glycerin molecule, forming monoglycerides, diglycerides and triglycerides, respectively. In addition, said oil may comprise free fatty acids, and other fat-soluble substances such as phospholipids, sphingolipids or sterols. Typically, the oil is composed of triacylglycerols in more than 90% of the total composition.

The term "microbial biomass enriched in oil rich in oleic acid", as used in the present invention, refers to a microbial biomass with a content of

oil rich in oleic acid of at least 40%, at least 50%, at least 60% or at least 70% of its total dry weight. Said term also refers to a microbial biomass whose oleic acid content represents at least 65% (w / w), at least 70% (w / w), at least 75% (w / w), at least 80% (w / w), or at least 85% (w / w) with respect to the total fatty acids of said microorganism. In a particular embodiment of the invention, oleic acid represents at least 70% (w / w) with respect to the total fatty acids of said microorganism. Techniques for determining the content of fatty acids, particularly oleic acid, have been mentioned above in the context of the first aspect of the invention.

The term "microorganism of the invention", as well as particular and preferred embodiments thereof, have been detailed in the context of the first aspect of the invention and apply equally to the first process of the invention.

In a first stage, the first process of the invention comprises culturing the microorganism of the invention in a culture medium comprising at least one carbon source and at least one nitrogen source, under conditions suitable for the growth of said microorganism.

The term "cultivate", as used in the present invention, refers to the process of planting, maintaining and causing microorganisms to develop on suitable culture media.

The term "culture medium", as used in the present invention, refers to a liquid, semi-solid or solid medium that has the necessary nutrients to allow, under favorable conditions of pH, temperature and oxygenation, growth of microorganisms. In a particular embodiment, the culture medium is a liquid medium. Culture media suitable for growing microorganisms are widely known in the art. Among other nutrients, the culture medium comprises a carbon source and a nitrogen source. Non-limiting examples of culture media suitable for carrying out the first process of the invention include MB03-2 medium (NH4 composition N03 0.7 gIL, CaCI2.2H20 0.4 gIL, MgS04 .7H20 0.4 gIL, KH 2P04 0.75 gIL, macerated liquid corn 9.6 gIL at pH6, glycerin 110 gIL), medium MB03-7 (composition NH.NO, 0.28 giL, CaCI, .2H, O 0.4 giL, MgSO • .7H, O 0.4 giL, KH, PO. 0.75 giL , yeast extract 1.5 giL, glucose 40 giL, pH 5), medium MB03-10 (composition NH.NO, 0.28 giL, CaCI, .2H, O 0.4 giL, MgSO •. 7H, O 0.4 giL, KH, PO 0.75 giL, yeast extract 3 giL,

peptone 1.5 gIL, glucose 40 gIL pH5), medium MB03-11 (hydrolyzed composition of wheat straw with a sugar content of 110 giL, macerated corn liquid 9.6 gIL at pH6).

In a particular embodiment, the carbon source is a lignocellulosic biomass hydrolyzate.

The term "biomass hydrolyzate", as used herein, refers to any saccharification product, which contains the sugars produced in the saccharification process, the remains of non-hydrolyzed biomass and the enzymes used for the hydrolysis of said Biomes8.

The term "saccharification" or "hydrolysis of biomass", as used herein, refers to the production of fermentable sugars from polysaccharides.

The term "fermentable sugar ~, as used herein, refers to oligosaccharides and monosaccharides that can be used as a carbon source by a microorganism in the fermentation process to obtain products such as ethanol.

The terms "biomass" and "biomass substrate ~, as used herein, refer to any material suitable for use in saccharification reactions. These terms include but are not limited to materials comprising cellulose (for for example, cellulosic biomass, cellulosic raw material and cellulosic substrate), lignin or the combination of cellulose and lignin.The biomass may be derived from plants, animals or microorganisms and may include, but is not limited to agricultural, industrial and forest residues, agricultural wastes and municipal and terrestrial and aquatic crops for energy purposes Examples of biomass substrates include but are not limited to wood, wood pulp, paper pulp, corn fiber, corn grain, corn cobs, crop residues such as leaves of corn, corn stubble, grasses, wheat, wheat straw, barley, barley straw, hay, rice, rice straw, millet, paper waste, paper, residu Processing of pulp, woody or herbaceous, fruit pulp ° vegetable, grain distillate products, herbs, rice husks, cotton, hemp, flax, sisal, cane bagasse, sorghum, soy, millet, components obtained from the grinding of grains, trees, branches, roots, leaves, wood shavings, sawdust, shrubs and bushes, vegetables, fruits and flowers and any combination thereof. In some embodiments, the biomass comprises but is not limited to cultivated plants (for example, herbs, including C4 grasses, such as rod grass, spinal grass, rye grass, Miscanthus, ribbon grass or combinations thereof), processing residues of sugar, for example but not limited to, bagasse (for example, sugarcane bagasse, beet pulp (for example, sugar beet), or a combination thereof), agricultural residues (for example, soybean stubble, stubble corn, corn fiber, rice straw, cane sugar, rice, rice husks, barley straw, corn cobs, wheat straw, canola straw, oat straw, oat shells, corn fiber, hemp, flax, sisal, cotton or any combination thereof), fruit pulp, vegetable pulp, grain distillate products, forest biomass (e.g. wood, wood pulp, fiber, recycled wood pulp fibers, sawdust wood du ra, such as poplar wood, softwood or a combination thereof).

In some embodiments, the biomass comprises cellulosic waste material and / or forest residues including but not limited to paper and paper pulp processing waste, municipal paper waste, newspaper, cardboard and the like. In some embodiments, the biomass comprises a kind of fiber while in other alternative embodiments, the biomass comprises a mixture of fibers that originate from different biomass. In some embodiments, the biomass may also comprise transgenic plants that express ligninase and / or cellulases.

The term Ubiomasa ~ includes any living or dead biological material that contains polysaccharides as substrates including but not limited to cellulose, starch, other forms of long-chain carbohydrate polymers and combinations thereof. It may or may not be completely formed from glucose or xylose, and optionally, it may contain other pentose or hexose monomers. Xylose is an aldopentose that contains five carbon atoms and an aldehyde group. It is the precursor sugar of hemicellulose and is often the main component of biomass. In some embodiments, the substrate is suspended before pretreatment. In some embodiments, the consistency of the suspension is between about 2% and about 30% and more typically between about 4% and about 15%. In some embodiments, the suspension is washed or treated with acid before pretreatment. In some embodiments, the suspension is dehydrated by any suitable method to reduce the consumption of water and chemicals before pretreatment. Examples of dehydration devices include, but are not limited to pressurized screw presses, pressurized filters and extruders.

A biomass substrate is "pretreated" when it has undergone physical and / or chemical procedures to facilitate saccharification. In some embodiments, the biomass substrate is "pretreated" or "treated" to increase the susceptibility of said biomass to cellulose hydrolysis by employing methods known in the state of the art, such as physical-chemical pretreatment methods. (for example, treatment with ammonium, pretreatment with dilute acid, pretreatment with diluted alkali, solvent exposure, steam explosion, milling, extrusion), biological pretreatment methods (for example, the application of lignin-solubilizing microorganisms) and combinations of the same.

Grinding consists of a process of crushing plant matter until it is reduced to particles of different sizes that can be separated by mechanical procedures.

Extrusion is a process whereby plant material is forced to flow under one or more of a variety of mixing, heating and shearing conditions, through a nozzle designed to shape or expand the ingredients. It can be made cold where the material is extruded without expansion or hot or hot, where the macromolecules of the components lose their discontinuous native structure and a continuous and viscous mass is formed that dextrinizes and gelatinizes the starch, the proteins are denatured, the proteins are denatured inactivate the enzymes responsible for possible deterioration, some non-nutritional compounds are destroyed and the microbial load is destroyed.

Acid hydrolysis consists in treating the plant material with acids such as sulfuric acid or hydrochloric acid using high temperatures. Through this process, cellulose hydrolysis is favored but requires pH neutralization at the end of hydrolysis to allow subsequent growth of microorganisms.

The alkali treatment consists of the addition of diluted bases to the plant biomass. The efficiency of this procedure depends on the lignin content of the materials. Diluted sodium hydroxide produces a swelling, allowing an increase in the internal surface area reducing the degree of polymerization and crystallinity of the cellulose, causing the separation of the structural junctions between lignin and carbohydrates.

The treatment with organic solvents consists of using solvents such as methanol, ethanol or acetone to break the bonds of lignin and cellulose. The removal of solvents from the system is necessary, since they inhibit the growth of organisms.

Treatment with ionic liquids (for example, with a solution of sodium chloride) favors cellulose degradation because the hydrogen and oxygen atoms that are part of it interact separately with the solvent so that

It causes the breakdown of hydrogen bonding bonds between cellulose chains.

The steam explosion treatment consists of treating the biomass with saturated steam at a temperature of 160-260 ° C (0.69-4.83 MPa) for a certain time that will depend on the type of plant material of origin.

Treatment with lignin-solubilizing microorganisms consists in treating biomass with microorganisms that produce enzymes capable of degrading lignocellulosic material such as, for example, Trichoderma reesei, Fusarium oxysporium, Piptopus belulinus, Penicillum echinalalum, Penicillum purpurogenum, Aspergillus nius, Aspergillus nius Anaeromyces sp., Caecomices sp., Cyllamcyces sp., Neocallimastix sp., Orpinomyces sp., Piromyces sp., Sporotrichum thermophile, Scytalidium thermophillu, Thermonospora cubata, Rhodosporillum rubrum, Cellulomonas fimi, Clostridiumcousmuscususususus, Pyramidus, Accus , Saccharophagus degradans, etc.

As the person skilled in the art will understand, lignocellulosic biomass hydrolyzate can be obtained from different plant origins or by-products thereof. The term "by-product", as used in the present invention, refers to the product resulting from subjecting said plant to physical and / or chemical procedures. In a particular embodiment, the culture medium comprises as a carbon source a hydrolyzate of lignocellulosic biomass that is obtained from wheat straw, sugarcane bagasse, empty bunches of oil palm, pruning palm oil, fiber palm oil , vine pruning, olive pruning and combinations thereof. In a preferred embodiment, said hydrolyzate comes from wheat straw. In another preferred embodiment, said hydrolyzate comes from cane bagasse. In another preferred embodiment, said hydrolyzate comes from empty bunches of oil palm.

Preferably, said combinations of hydrolysates mentioned above have at least 5%, at least 10%, at least 20%, at least 30%, at least 40% hydrolyzed lignocellulosic biomass.

In another particular embodiment, the carbon source used for the cultivation of the microorganism of the invention is derived from a mixture of a lignocellulosic biomass hydrolyzate and glycerol. As the person skilled in the art will understand, the proportion of hydrolyzate and glycerol may vary so that the growth and lipid production conditions of the microorganism of the invention are optimal. Thus, preferably the ratio of biomass hydrolyzate: glycerin is 60:40; more preferably, the ratio of biomass hydrolyzate: glycerin is 70:30; and even more preferably the ratio of biomass hydrolyzate: glycerin is 75:25.

In another particular embodiment, the carbon source is selected from the group consisting of glucose, glycerol, glycerin, molasses, xylose, arabinose, mannose, fructose, acetate, starches and combinations thereof. In a preferred embodiment, the carbon source is glucose. In another preferred embodiment, the carbon source is xylose. In a more preferred embodiment, the concentration of xylose in the culture medium is 20 gi l. In another more preferred embodiment, the concentration of xylose in the medium is 40 gil.

In another particular embodiment, the source of the nitrogen source is selected from the group consisting of yeast extract, peptone, macerated corn liquid, urea, sodium glutamate, different inorganic nitrogen sources, such as ammonium salts and combinations thereof. . In a preferred embodiment, the nitrogen source is an ammonium salt, preferably ammonium chloride.

In another particular embodiment, the culture medium comprises solid inhibitors. The term "solid inhibitors", as used in the present invention, refers to compounds that inhibit microbial metabolism and negatively affect the growth of the organism. In a more particular embodiment, said solid inhibitors come from the degradation of the biomass without detoxifying (for example, they come from the degradation of lignocellulose) and are selected from the group consisting of acetic acid, formic acid, levulinic acid, cumaric acid , ferulic acid, succinic acid, 4-hydroxybenzaldehyde, vanillin, vanillic acid, syringaldehyde, 4-hydroxybenzoic acid, catechol, guaiacol, syringic acid, furfural, 5-hydroxymethylfurfural and combinations thereof. Suitable methods for determining the ability of a strain of R. toruJoides to grow in the presence of solid inhibitors from undetoxified biomass hydrolysates include, for example, methods that allow the microorganism to adapt to a culture medium in which it is increased. progressively the concentration of inhibitors.

Additionally, if desired, the culture medium comprises other specific means to achieve the production of the desired meta bolite. Said culture media are widely known in the state of the art and preparing them constitutes routine practice for the person skilled in the art. Typically, the culture is subjected to metabolic stress, so as to produce and accumulate large amounts of fatty acids intracellularly. Metabolic stress can be induced by an excess of carbon source in relation to the source of nitrogen in the culture medium. Triglyceride accumulation occurs when a carbon source is in excess and the nitrogen source limits growth. Under these growth conditions, the cells use the carbon source for the synthesis of neutral lipids and their intermediates (acyl-CoA). In preferred embodiments, the microorganism of the invention is genetically engineered to favor the accumulation of oleic acid with at least one gene selected from a group consisting of a gene that encodes an enzyme with delta-9 desaturase activity and a gene that encodes an enzyme with 3-ketoacyl-CoA synthase activity and, with the deletion of the FAD2 gene.

Methods for the cultivation of microorganisms are standard in the art and are widely known to those skilled in the art. Cultivation can be carried out in flasks or bioreactors until maximum oleic acid production is achieved. The duration of the crop is variable, although typically the culture is carried out for 5 days.

The term "conditions suitable for the growth of the microorganism of the invention", as used in the present invention, refers to conditions that support the growth of the microorganism of the invention. Such conditions may include pH, nutrients, temperature, humidity, oxygenation, environment and other factors.

In a particular embodiment, the conditions suitable for the growth of said microorganism of step i) comprise

a temperature in a range between 18 oC and 37 oC, preferably between 23 oC and 32

oC, more preferably between 28 oC and 30 ° C,

a dissolved oxygen concentration of at least 20%, and / or

constant agitation

The conditions under which the culture of the microorganism of the invention is carried out can be adjusted to increase the percentage of oil per unit of dry weight in the resulting microbial biomass. For example, it is possible to grow the microorganism in the presence of limiting concentrations of some nutrient, such as nitrogen, phosphorus or sulfur while maintaining an excess of the carbon source. The limitation of the

Nitrogen source allows to increase the biomass oil yield per unit of dry weight. The microorganism can be cultivated under conditions limiting some of the nutrients during the whole time of cultivation or it can be cultivated by alternating culture cycles in limiting concentrations and culture cycles without limiting concentrations.

The cultivation according to the first process of the invention is carried out until the desired amount of biomass has been reached and / or until the biomass contains the desired intracellular amount of oleic acid rich oil. The person skilled in the art will understand that it is possible to carry out a crop monitoring to determine the amount of biomass reached over time (for example, by determining the optical density at 600 nm or by determining the solid weight by unit volume of culture). The person skilled in the art will understand that it is possible to carry out a crop monitoring to determine the percentage of oleic acid that accumulate in the biomass over time (for example, by determining the amount of oleic acid per unit of dough in the culture using any method appropriate for this known in the state of the art).

Once the desired amount of biomass and / or the intracellular amount of oil rich in desired oleic acid has been reached, in a second stage, the first process of the invention comprises separating the microbial biomass from the culture broth. The cells are collected by any of the procedures commonly used for this purpose, such as centrifugation, filtration, decantation, flotation or sedimentation, additionally aided by flocculation or evaporation to remove part or all of the water or the medium from the aqueous fraction of the culture medium.

In a particular embodiment, the second stage of the first process of the invention is carried out by a method selected from the group consisting of filtration, microfiltration, centrifugation, pressure, settling and combinations thereof.

In a particular embodiment, the first process of the invention further comprises drying the microbial biomass obtained in the second stage.

Microbial biomass

In another aspect, the present invention also relates to oil-rich microbial biomass rich in oleic acid obtainable according to the first process of the invention, hereinafter referred to as "microbial biomass of the invention". The term "microbial biomass" has been described in the second aspect of the invention and is applied equally in the present aspect.

In a particular embodiment, the oil-rich biomass rich in oleic acid has an oil content of at least 40% of the dry weight, at least 50% of the dry weight, at least 60% of the dry weight, or at least 70% of the dry weight.

In a particular embodiment, the oleic acid content is at least 65% (w / w), at least 70% (w / w), at least 75% (w / w), at least 80% ( w / w) or at least 85% (w / w) with respect to the total fatty acids of the microorganism of the invention.

Procedure to obtain a preparation enriched in oil rich in oleic acid

In another aspect, the present invention relates to a process for obtaining a preparation enriched in oil rich in oleic acid, hereinafter "second method of the invention", comprising:

i) culturing the microorganism of the invention in a culture medium that

comprises at least one source of carbon and at least one source of

nitrogen, under conditions suitable for the growth of said

microorganism,

ii) separate the microbial biomass from the culture broth,

iii) extract the oil rich in oleic acid from the microbial biomass obtained in the

stage (iii).

The first stage of the second process of the invention comprises culturing the microorganism of the invention in a culture medium comprising at least one carbon source and at least one nitrogen source, under conditions suitable for the growth of said microorganism. The terms "microorganism of the invention",

"cu Itiv ar", quantitative measure "," c "or" n "d" ic "i" or "n" e "s _-- 'a" d "e" c "u" a "d" a "s '---" p "a" ra' ---- 'e "l ---' c" r "e" c "-im" i "e" n "to" -, d ,, e ,, 1

~

microorganism of the invention »," microbial biomass »as well as the particular and preferred embodiments of said terms have been detailed above and are interpreted in the same manner in the context of the second process of the invention.

The second stage of the second process of the invention comprises separating the microbial biomass from the culture broth. Microbial biomass can be separated from the culture broth by any appropriate method known in the state of the art. Methods that allow microbial biomass to be separated from the culture broth have been detailed in the context of the first process of the invention. Such methods include but are not limited to filtration, microfiltration, centrifugation, pressure, decantation and combinations thereof.

The term "culture broth", as used herein, refers to the culture medium obtained after cultivation of the microorganism of the invention and comprising nutrients from the culture medium and compounds produced by the microorganism of the invention as a consequence of its metabolism.

The third stage of the second process of the invention comprises extracting the oil rich in oleic acid from the microbial biomass obtained in the second stage of said process.

Suitable methods for extracting the oil include any method of mechanical extraction and within these, any method of solid-liquid or chemical mechanical extraction known in the state of the art.

In a particular embodiment, the mechanical extraction method is performed using screw press, French press or ball mill.

Thus, in another particular embodiment, the solid-liquid extraction method is performed using a water immiscible organic solvent. The term "organic solvent", as used in the present invention, refers to a substance that dissolves a solute whose molecules contain carbon atoms. The term "water immiscible organic solvent", as used in the present invention, refers to an organic solvent with little or no ability to mix with water. Non-limiting examples of water-immiscible organic solvents include n-hexane, ethyl acetate, petroleum ether, ethyl ether, tert-butyl methyl ether, ethyl acetate, acetone, ethyl methyl ketone, benzene, toluene, xylene. Thus, in a preferred embodiment, said water immiscible organic solvent is selected from the group consisting of n-hexane, ethyl acetate, petroleum ether, ethyl ether and combinations thereof.

In a particular embodiment, the second process of the invention further comprises drying the microbial biomass obtained in the second stage.

Procedure to obtain biolubricants

The oleic acid enriched preparation obtained from the microbial biomass according to the present invention can be chemically processed to produce products of interest in the industry.

Therefore, in another aspect, the present invention relates to a process for obtaining biolubricants from the oil-rich preparation rich in oleic acid, obtained according to the second process of the invention, hereinafter referred to as "third process of the invention ~ , which includes:

i) obtain an oil-rich preparation rich in oleic acid from

the microbial biomass of the invention;

ii) refine the oil rich in oleic acid obtained in step (i)

iii) convert the oil rich in oleic acid obtained in step (ii) into

Biolubricants

The term ubiolubricant ", as used in the present invention, refers to a lubricant that is derived from biomass, such as animal, plant or microbial waste that is not toxic to animal life or to aquatic life and which can be degraded by the action of microorganisms in a relatively short period of time.In a preferred embodiment of the invention said biolubricants are obtained from a microbial biomass rich in oleic acid. The term "microbial biomass enriched in oil rich in oleic acid "has been previously defined in the context of the first method of the invention and applies equally in the context of the third method of the invention.

In a first stage, the third process of the invention comprises obtaining a preparation enriched in oil rich in oleic acid according to the process of the second aspect of the invention.

In a second stage, the third process of the invention comprises refining the oil rich in oleic acid obtained from the second process of the invention.

The term "refining" or "refining", as used in the present invention, refers to the process of purification of a chemical substance obtained many times from a natural resource. Numerous methods are known in the state of the art for the refining of substances. For example, oil refining, such as an oil rich in oleic acid, is often achieved through distillation or fractionation. A gas can also be refined in this way by cooling or compressing it until liquefaction. Gases and liquids can also be refined by extraction with a solvent that dissolves the substance of interest or impurities.

In a particular embodiment, the oil rich in oleic acid obtained according to the second process of the invention is refined by alcoholysis in acidic medium. In this reaction a catalyst can be used to improve the speed and the final yield. The alcoholysis in acidic medium is carried out using an acid as catalyst. Acidification can be performed by using any acid such as, for example, hydrochloric acid or phosphoric acid. The alcohol used in the reaction is preferably in excess between 5 and 40 times with respect to the microbial biomass from which the preparation enriched in oil rich in oleic acid is obtained. Typically, the reaction is allowed to proceed with constant stirring for 20 to 36 hours at a temperature between 40 and 70De. Preferably, the alcoholysis is carried out with alcohols having 1, 2, 3 or 4 carbons, with methanol being the most preferred alcohol.

In a third stage, the third process of the invention comprises converting the oil rich in refined oleic acid obtained in step ii) into biolubricants. The person skilled in the art will understand that there are numerous processes in the art for converting fatty acids, such as oleic acid into biolubricants that include, without limitation the procedures shown in US8357643 82. Such methods are based on a stage of chemical modification of the fatty acids obtaining epoxy derivatives in the presence of a basic catalyst for obtaining a diester, followed by a hydrogenation step that gives rise to mono alcohols and acylation that ultimately generates monoesters.

Typically, chemical modifications made to said free fatty acids include alkylation reactions, addition of a radical, acylation, eno reactions, aminoalkylation, co-oligomerization, hydroformylation, epoxidation and yyloxylation.

By way of illustration, non-limiting the obtaining of biolubricants according to the third stage of said third process of the invention can be carried out by a first step of expoxidation of fatty acids and a second step where a reaction between said fatty acids modified with carboxylic anhydrides in the presence of a catalyst giving rise to a biolubricant. Said third stage can also be carried out by a first step of expoxidation of the fatty acids, a second step of hydrogenation of said fatty acids thus obtaining an intermediate with hydroxyl groups and a third step of acylation of said hydroxyl groups with an acylating agent having as a result obtaining a biolubricant. Typically, basic catalysts comprise a tertiary amine such as triethylamine.

Uses of the invention

In another aspect, the present invention relates to the use of the microorganism of the invention, hereinafter "first use of the invention", to obtain an oil-enriched microbial biomass rich in oleic acid according to the first process of the invention.

In another aspect, the present invention relates to the use of the microorganism of the invention, hereinafter "second use of the invention", to obtain a preparation enriched in oil rich in oleic acid according to the second process of the invention.

In another aspect, the present invention relates to the use of the microorganism of the invention, hereinafter "third use of the invention", to obtain biolubricants according to the third process of the invention

The terms "microorganism", "microbial biomass", "biolubricants" and their particularities have been described in the context of the microorganism and the first process of the invention, and are applicable to the first, second and third use of the invention. Likewise, the particular and preferred embodiments of the microorganism and the second method of the invention are equally applicable.

The invention is described in detail below by means of the following examples, which are to be interpreted as merely illustrative and not limiting the scope of the invention.

EXAMPLES

Example 1: Construction of integrative cassettes in Rhodosporidium toruloides.

From the genome sequence of R. toruloides, the gene encoding the enzyme with 69 desaturase activity corresponding to SEQ ID NO: 1 was synthesized. The 1650 bp fragment obtained was cloned into a vector under the control of the glycerol promoter -3-R. toruloides phosphate dehydrogenase and the Tnos terminator of Agrobacterium tumefaciens resulting in pNEOL 121. Next, the pNEOL 121 vector was digested with the mitochondrial endonuclease I-Scel and the expression cassette, containing the promoter, the gene Ll9Rt Y Tnos, was cloned into the vector pNEOL85, originating the vector pNE0L122. The pNEOL85 vector contains another cassette containing the genetics resistance gene with codon use of R. toruloides (G418Rt) under the control of the phosphoglycerate kinase promoter of

R. toruloides (pPGK) and the T35S terminator of the cauliflower mosaic virus. Finally, vector pNEOL 122 was cut with Pacl and a 5 kb fragment, bearing the two expression cassettes, was cloned into plasmid pNEOL57 giving rise to the integrative cassette pNE0L124 (Figure 1 a).

From the genome sequence of R. toruloides, the gene encoding an enzyme with j3-ketoacyl-CoA synthase (elongase) activity was synthesized. The sequence of this polypeptide is that shown in SEO ID NO: 2. The 990 bp fragment obtained was cloned into a vector under the control of the glycerol-3-phosphate dehydrogenase promoter of R. toruJoides and the Tnos terminator of Agrobacterium tumefaciens giving rise to pNE0L114. Next, the pNEOL 114 vector was digested with the mitochondrial endonuclease I-Scel and the expression cassette, containing the promoter, the elo1Rt and Tnos gene, was cloned into the pNEOL77 vector, originating the pNEOL 115 vector. The pNEOL77 vector contains another Cassette containing the hygromycin resistance gene with codon use of R. toruJoides (hphRt) under the control of the promoter of the phosphoglycerate kinase of R. toruJoides (pPGK) and the T35S terminator of the cauliflower mosaic virus. Finally, vector pNEOL 115 was cut with Pacl and a fragment of 4600 bp, carrying the two expression cassettes, was cloned into plasmid pNEOL 105 giving rise to the integrative cassette pNEOL 116 (Figure 1b).

Example 2: Transformation of R. toruloides The transformation of R. toruloides CECT 13085 was performed using the Agrobacterium tumefaciens-mediated transformation system (ATMT). For this, the pre-inoculum of A. tumefaciens was grown by carrying the integrative plasmid in the MM growth medium (prepared according to Hooykaas and cO /., 1979) and the pre-inoculum of R. toru / oides CECT 13085 in YPD medium (yeast extract 10g / L, glucose 20g / L, peptone 20g / L) for 24h. From the pre-inoculum of Agrobacterium, 10 mL of MI medium is inoculated (prepared according to Bundock et al., 1995) supplemented in acetosyringone at 200 IJM with an initial D0660 of 0.5, and incubated 6h at 30 ° C, with stirring 250 rpm In parallel, the strain R. toruloides CECT 13085 is inoculated in 10 mL of YPO with an initial 00600 of 1.5. After 6h of incubation, 1001J1 of each culture are collected and a co-culture is carried out on a 0.45 IJm nitrocellulose membrane in MI medium supplemented in 200 IJM acetosyringone, incubated at 25 ° C for 72h. Next, the co-culture or transformation mixture is collected with 2 mL of YPO medium and seeded in Petri dishes with YPO medium supplemented with cefotaxime (200 IJg / mL) and geneticin (35 IJg / mL) or hygromycin (40

~ g / mL).

The transformants were chopped in YPD medium supplemented with geneticin (35 IJg / mL) or hygromycin (40 IJg / mL). The cassette integration containing the .69Rt gene in the genome of

the

yeast be checked through PCR with oligonucleotides specific 021 +,

GGACTAGTCGCCGGGATGCCAACGTCGTT

(SEO ID NO: 4); 022-,

CCACTAGTAAATGTATAATTGCGGGACTC

(SEO ID NO: 5); Y with 074+,

TCTGCGTCAACTCGCTTGC (SEO ID NO: 6) and 074-, GCTCTTCAGCTGAGGGTCG (SEO ID NO: 7). The integration of the cassette containing the El01 Rt gene into the yeast genome was checked by PCR with the specific oligonucleotides 021+ and 022-, as well as with 081+, CAGTCCTCGTGCACMTATC (SEO ID NO: 8) and 081-, CAGCCTCGMGCTCGMGT (SEO ID NO: 9).

The presence of the cassettes in the yeast genome was also checked by hybridization. For this, genomic DNA of the transformants was cut with a restriction enzyme (Kpnl or 8glll) and in each case they were hybridized with specific probes for the o9Rt or El01 Rt genes. The probes were labeled according to the protocol described in Roche's kit (OfG High Prime ONA fabefing and detection Starter kit 1). Both hybridization and PCR assays confirmed the integration of expression cassettes in the genome of the different transformants.

Example 3: Production of oil enriched in oleic acid by expressing

Elo1 Rt.

Clones containing at least one copy of the Elo1Rt gene were grown in 500 mL flasks containing 100 mL of the following media: MB03-2 (NH4 composition N03 0.7 gIL,

CaCI, .2H, O 0.4 giL, MgSO •. 7H, OR 0.4 giL, KH, PO. 0.75 giL, macerated corn liquid 9.6

gIL at pH6, glycerin 110 gIL), and MB03-11 (biomass hydrolyzate with a sugar content of 110 gIL, macerated corn liquid 9.6 gIL at pH 6). The cultures grew at 250 rpm, 30De for 96 h. After the cultures, the cells were collected by centrifugation and the biomass of each flask was dried in an oven at 6 Soo for 24 hours. From the biomass of each flask, the oil content was determined by gravimetry by extraction with n-hexane. The fatty acid composition of the oils was determined

through CG-FID.

Figure 2 shows the results obtained in two of the culture media tested. Several of the clones analyzed showed a reduction in palmitic acid content (14-31%) and an increase in oleic acid content (4-11%) with respect to the strain

parental or control strain depending on the culture medium used.

Example 4: Production of oil enriched in oleic acid by expressing

A9Rt.

Clones containing at least one copy of the delta-9 desaturase gene were grown in 500 mL flasks containing 100 mL of the following media: MB03-2 (composition

NH.NO, 0.7 giL, CaCI, .2H, O 0.4 giL, MgSO •. 7H, OR 0.4 giL, KH, PO. 0.75 giL, macerated corn liquid 9.6 gIL at pH6, glycerin 110 gIL) and MB03-11 (biomass hydrolyzate with a sugar content of 100 gIL, macerated corn liquid 9.6 gIL at pH6). The cultures grew at 250 rpm, 30DC for 96h. The oil extraction and fatty acid composition were determined as indicated in example 3.

Figure 3 shows the results obtained with several clones in different culture media. Several of the clones analyzed showed a reduction in the content of stearic acid (20-46%) and an increase in the content of oleic acid (5-12%) with respect to

the parental strain depending on the culture medium used.

Example 5: Production of oil enriched in oleic acid in R. toruloides

by co-expression of an elongase (Elo1Rt) and a desaturase (.d9Rt).

The R. loruloides strain T124-347 (Figure 3) containing at least one copy of the delta-9 desaturase gene was transformed with the cassette pNEOL 116 containing the Elo1 Rt gene. The obtained clones were grown in 500 mL flasks containing 100 mL of the following 5 media: MB03-2 (composition NH, NO, 0.7 giL, CaCI, .2H, O 0.4 giL, MgSO, .7H, O OA giL, KH, PO, 0.75 giL, macerated liquid of corn 9.6 giL at pH6, glycerin 110 giL) and MB03-11 (biomass hydrolyzate with a sugar content of 110 gIL, macerated corn liquid 9.6 gIL at pH6). The cultures grew at 250 rpm, 30 ° C for 96 h. The oil extraction and fatty acid composition were determined as indicated in the example

10 3.

Figure 4 shows the results obtained by growing some clones in different culture media. Several of the clones analyzed showed a reduction in palmitic acid content (30-37%) and an increase in oleic acid content (20-27%) with

15 regarding the parental strain depending on the culture medium used.

Claims (24)

one.

A microorganism of the Rhodosporidium toruloides species genetically modified with at least one gene selected from a group consisting of: a gene that encodes an enzyme with delta-9-desaturase activity and a gene that encodes an enzyme with C16 3-ketoacyl-CoA activity synthase.

2.

A microorganism according to claim 1 wherein said gene is expressed under the control of a constitutive promoter.

3.

A microorganism according to claims 1 or 2, wherein said enzyme with delta-9-desaturase activity comprises the SEO sequence ID NO: 1 or a functionally equivalent variant thereof and wherein said enzyme with C16 3-ketoacyl-CoA synthase activity comprises the sequence in SEQ ID NO: 2, or a functionally equivalent variant thereof.

Four.

A microorganism according to claims 1 to 3 wherein the microorganism of the Rhodosporidium toruloides species in which the gene encoding an enzyme with delta-9-desaturase activity and / or a gene encoding an enzyme with C16 activity 3- has been introduced Ketoacyl-CoA synthase belongs to the strain R. toruloides CECT 13085.

5.

A process for obtaining a microbial biomass enriched in oil rich in oleic acid comprising:

i) culturing a microorganism according to any one of claims 1 to 4 in a culture medium comprising at least one carbon source and at least one nitrogen source under conditions suitable for the growth of said microorganism; Y ii) separate the microbial biomass from the culture broth.

6.

Process according to claim 5, wherein the carbon source is selected from the group consisting of glucose, sucrose, glycerol, molasses, xylose, arabinose, mannose, fructose, acetate and combinations thereof.

7.

Process according to claim 5, wherein the carbon source is a lignocellulosic biomass hydrolyzate.

8.

Method according to claim 7, wherein the hydrolyzate is obtained from wheat straw, sugar cane bagasse, corn bagasse, empty clusters of oil palm, oil palm pruning, oil palm fiber, vine pruning, pruning Olive tree and combinations thereof.

9.

Method according to claim 6, wherein the carbon source is glucose.

10.

Process according to claim 6, wherein the carbon source is xylose.

eleven . Process according to any one of claims 5 to 10, wherein the nitrogen source is selected from the group consisting of yeast extract, peptone, macerated corn liquid, urea, sodium glutamate, inorganic nitrogen sources and combinations thereof.

12.

Process according to claim 11, wherein the nitrogen source is an ammonium salt, preferably ammonium chloride.

13.

Process according to any of claims 5 to 12, wherein the culture medium contains solid inhibitors selected from: acetic acid, formic acid, levulinic acid, cumaric acid, ferulic acid, succinic acid, 4-hydroxybenzaldehyde, vanillin, vanillic acid, syringaldehyde , 4-hydroxybenzoic acid, catechol, guaiac, syringic acid, furfural, 5-hydroxymethylfurfural and combinations thereof.

14.

Process according to any one of claims 5 to 13, wherein the conditions suitable for the growth of said microorganism of step (i) comprise

temperature in a range between 18 oC and 37 oC, dissolved oxygen concentration of at least 20%, and / or constant agitation

fifteen.

Method according to any one of claims 5 to 14 wherein step (ii) is carried out by a method selected from the group consisting of filtration, microfiltration, centrifugation and combinations thereof.

16.

Process according to any of claims 5 to 15, further comprising drying the microbial biomass of step (ii).

17.

Process according to claim 5 wherein said oleic acid represents at least 70% (w / w) with respect to the total fatty acids of said microorganism.

18.

Microbial siamase enriched in oil rich in oleic acid obtainable according to the method of any of claims 5 to 17.

19.

Method for obtaining a preparation enriched in oil rich in oleic acid comprising:

twenty.

Method according to claim 19, wherein the extraction of step (iii) is

It is carried out by mechanical methods, by a solid-liquid extraction method or combinations thereof.

twenty-one.

Method according to claim 20, wherein the mechanical extraction method is performed using screw press, French press or ball mill.

22

Process according to claim 20, wherein the solid-liquid extraction method is performed using a water immiscible organic solvent.

2. 3.

Process according to claim 22, wherein said water immiscible organic solvent is selected from the group consisting of n-hexane, ethyl acetate, petroleum ether, ethyl ether and combinations thereof.

i)

culturing a microorganism according to any one of claims 1 to 4 in a

culture medium comprising at least one carbon source and at least

a source of nitrogen under conditions suitable for the growth of said

microorganism;

ii)

separate the microbial biomass from the culture broth; Y

iii)

extract the oil rich in oleic acid from the microbial biomass obtained in the

stage (ii).

A method according to any one of claims 19 to 23, further comprising drying the microbial biomass of step (ii). 25. Use of the microorganism according to claims 1 to 4 to obtain a biomass enriched in oil rich in oleic acid, to obtain a preparation enriched in oil rich in oleic acid or to obtain biolubricants.