ES2417879T3 - Antisense modulation of apolipoprotein B expression - Google Patents
Antisense modulation of apolipoprotein B expression Download PDFInfo
- Publication number
- ES2417879T3 ES2417879T3 ES10180483T ES10180483T ES2417879T3 ES 2417879 T3 ES2417879 T3 ES 2417879T3 ES 10180483 T ES10180483 T ES 10180483T ES 10180483 T ES10180483 T ES 10180483T ES 2417879 T3 ES2417879 T3 ES 2417879T3
- Authority
- ES
- Spain
- Prior art keywords
- apolipoprotein
- acid
- compound
- oligonucleotide
- oligonucleotides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/13—Decoys
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/582—Recycling of unreacted starting or intermediate materials
Abstract
Un compuesto oligonucleótido antisentido de 20 bases nucleicas de longitud que tiene una secuencia de bases nucleicas como se expone en la SEQ ID NO: 247 y que comprende 5-metilcitidina en las bases nucleicas 2, 3, 5, 9, 12, 15, 17, 19 y 20, en el que cada enlace internucleósido es un enlace fosforotioato, las bases nucleicas 1-5 y 16-20 comprenden una modificació.A 20 nucleic length antisense oligonucleotide compound having a nucleic base sequence as set forth in SEQ ID NO: 247 and comprising 5-methylcytidine at nucleic bases 2, 3, 5, 9, 12, 15, 17 , 19 and 20, in which each internucleoside bond is a phosphorothioate bond, nucleic bases 1-5 and 16-20 comprise a modification.
Description
Modulación antisentido de la expresión de la apolipoproteína B Antisense modulation of apolipoprotein B expression
Campo de la invención Field of the Invention
La presente invención proporciona composiciones y métodos para modular la expresión de la apolipoproteína B. 5 Esta invención se refiere a oligonucleótidos que pueden hibridar específicamente con ácidos nucleicos que codifican la apolipoproteína B. Se ha mostrado que dichos compuestos modulan la expresión de la apolipoproteína B. The present invention provides compositions and methods for modulating the expression of apolipoprotein B. This invention relates to oligonucleotides that can specifically hybridize to nucleic acids encoding apolipoprotein B. Such compounds have been shown to modulate expression of apolipoprotein B.
Antecedentes de la invención Background of the Invention
Las lipoproteínas son partículas globulares de tipo micela que consisten en un núcleo no polar de acilgliceroles y ésteres de colesterilo rodeado de un recubrimiento anfifílico de proteína, fosfolípidos y colesterol. Las lipoproteínas Lipoproteins are micellar globular particles consisting of a non-polar nucleus of acylglycerols and cholesteryl esters surrounded by an amphiphilic coating of protein, phospholipids, and cholesterol. Lipoproteins
10 se han clasificado en 5 amplias categorías basándose en sus propiedades funcionales y físicas: quilomicrones, que transportan lípidos de la dieta del intestino a los tejidos; lipoproteínas de muy baja densidad (VLDL); lipoproteínas de densidad intermedia (IDL); lipoproteínas de baja densidad (LDL); todas ellas transportan triacilgliceroles y colesterol desde el hígado a los tejidos; y las lipoproteínas de alta densidad (HDL), que transportan el colesterol endógeno desde los tejidos al hígado. 10 have been classified into 5 broad categories based on their functional and physical properties: chylomicrons, which transport lipids from the diet of the intestine to the tissues; very low density lipoproteins (VLDL); intermediate density lipoproteins (IDL); low-density lipoprotein (LDL); all of them transport triacylglycerols and cholesterol from the liver to the tissues; and high-density lipoproteins (HDL), which transport endogenous cholesterol from the tissues to the liver.
15 Las partículas de lipoproteínas experimentan un procesamiento metabólico continuo y tienen propiedades y composiciones variables. Las densidades de las lipoproteínas aumentan sin disminuir el diámetro de la partícula debido a que la densidad de los recubrimientos exteriores es menor que la del núcleo interior. Los componentes proteicos de las lipoproteínas se conocen como apolipoproteínas. Al menos 9 apolipoproteínas están distribuidas en cantidades significativas entre las diferentes lipoproteínas humanas. Lipoprotein particles undergo continuous metabolic processing and have variable properties and compositions. Lipoprotein densities increase without decreasing particle diameter because the density of the outer coatings is less than that of the inner core. The protein components of lipoproteins are known as apolipoproteins. At least 9 apolipoproteins are distributed in significant amounts among the different human lipoproteins.
20 La apolipoproteína B (también conocida como ApoB, apolipoproteína B-100; ApoB-100, apolipoproteína B-48; ApoB48 y antígeno Ag(x)), es una glicoproteína grande que tiene una función indispensable en el ensamblaje y la secreción de lípidos y en el transporte y la captación mediada por receptor, y la entrega de distintas clases de lipoproteínas. La importancia de la apolipoproteína B se extiende a una variedad de funciones, desde la absorción y el procesamiento de los lípidos de la dieta a la regulación de los niveles de lipoproteínas circulantes (Davidson y 20 Apolipoprotein B (also known as ApoB, apolipoprotein B-100; ApoB-100, apolipoprotein B-48; ApoB48 and Ag (x) antigen), is a large glycoprotein that has an indispensable function in the assembly and secretion of lipids and in receptor-mediated transport and uptake, and delivery of different classes of lipoproteins. The importance of apolipoprotein B extends to a variety of functions, from the absorption and processing of lipids from the diet to the regulation of circulating lipoprotein levels (Davidson and
25 Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). Esta última propiedad está en la base de su importancia en términos de susceptibilidad a la aterosclerosis, que se correlaciona mucho con la concentración ambiente de lipoproteínas que contienen apolipoproteína B (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). 25 Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). This latter property is at the basis of its importance in terms of susceptibility to atherosclerosis, which is highly correlated with the ambient concentration of lipoproteins containing apolipoprotein B (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169- 193).
En los mamíferos existen dos formas de apolipoproteína B. La ApoB-100 representa la proteína de longitud completa que contiene 4536 restos de aminoácidos, sintetizada exclusivamente en el hígado humano (Davidson y Shelness, In mammals there are two forms of apolipoprotein B. ApoB-100 represents the full-length protein containing 4536 amino acid residues, synthesized exclusively in the human liver (Davidson and Shelness,
30 Annu. Rev. Nutr., 2000, 20, 169-193). Una forma truncada, conocida como apoB-48, es colineal con los 2152 restos de aminoácidos terminales y se sintetiza en el intestino delgado de todos los mamíferos (Davidson y Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). 30 Annu. Rev. Nutr., 2000, 20, 169-193). A truncated form, known as apoB-48, is collinear with the 2,152 terminal amino acid residues and is synthesized in the small intestine of all mammals (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193) .
La apoB-100 es el principal componente proteico de LDL y contiene el dominio necesario para la interacción de esta especie de lipoproteína con el receptor de LDL. Además, la apoB-100 contiene un resto de cisteína no emparejado ApoB-100 is the main protein component of LDL and contains the domain necessary for the interaction of this lipoprotein species with the LDL receptor. Furthermore, apoB-100 contains an unpaired cysteine residue.
35 que media la interacción con la apolipoproteína (a) y genera otra lipoproteína distinta aterogénica llamada lipoproteína Lp(a) (Davidson y Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). 35 that mediates the interaction with apolipoprotein (a) and generates a different atherogenic lipoprotein called Lp (a) lipoprotein (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193).
En los seres humanos, la apoB-48 circula asociada con los quilomicrones y los restos de quilomicrones y estas partículas son eliminadas por un receptor distinto conocido como proteína relacionada con el receptor de LDL (Davidson y Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). La apoB-48 se puede considerar como una adaptación In humans, apoB-48 circulates in association with chylomicrons and chylomicron residues and these particles are removed by a distinct receptor known as the LDL receptor-related protein (Davidson and Shelness, Annu. Rev. Nutr., 2000 , 20, 169-193). ApoB-48 can be considered as an adaptation
40 crucial por la cual el lípido de la dieta es suministrado desde el intestino delgado al hígado, mientras que la apoB100 participa en el transporte y el suministro de colesterol plasmático endógeno (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). 40 crucial by which dietary lipid is supplied from the small intestine to the liver, while apoB100 participates in the transport and supply of endogenous plasma cholesterol (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193).
La base por la cual el gen estructural común de la apolipoproteína B produce dos isoformas de proteína distintas es un proceso conocido como edición del ARN. Un sitio específico de reacción de edición de citosina en uracilo produce The basis by which the common structural gene for apolipoprotein B produces two distinct protein isoforms is a process known as RNA editing. A specific site of cytosine editing reaction in uracil produces
45 un codón de parada UAA y terminación de la traducción de la apolipoproteína B para producir ApoB-48 (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). A UAA stop codon and translation termination of apolipoprotein B to produce ApoB-48 (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193).
La apolipoproteína B se clonó en 1985 (Law et al., Proc. Natl. Acad. Sci. U. S. A., 1985, 82, 8340-8344) y se cartografió en el cromosoma 2p23-2p24 en 1986 (Deeb et al., Proc. Natl. Acad. Sci. U. S. A., 1986, 83, 419-422). Apolipoprotein B was cloned in 1985 (Law et al., Proc. Natl. Acad. Sci. USA, 1985, 82, 8340-8344) and mapped to chromosome 2p23-2p24 in 1986 (Deeb et al., Proc. Natl. Acad. Sci. USA, 1986, 83, 419-422).
En la patente de EE.UU. 5.786.206 se describen y reivindican métodos y composiciones para determinar el nivel de In U.S. Patent No. 5,786,206 discloses and claims methods and compositions for determining the level of
50 lipoproteínas de baja densidad (LDL) en el plasma que incluye secuencias de ADN aisladas que codifican regiones del epítopo de la apolipoproteína B-100 (Smith et al., 1998). 50 low-density lipoprotein (LDL) in plasma including isolated DNA sequences encoding regions of the apolipoprotein B-100 epitope (Smith et al., 1998).
Se encontró que ratones transgénicos que expresan la apolipoproteína B humana y alimentados con una dieta alta en grasa, desarrollaban niveles altos de colesterol en el plasma y presentaban un aumento de 11 veces de las lesiones ateroscleróticas frente a las crías de la misma camada no transgénicas (Kim and Young, J. Lipid Res., It was found that transgenic mice expressing human apolipoprotein B and fed a high fat diet, developed high levels of cholesterol in plasma and had an 11-fold increase in atherosclerotic lesions compared to offspring of the same non-transgenic litter ( Kim and Young, J. Lipid Res.,
1998, 39, 703-723; Nishina et al., J. Lipid Res., 1990, 31, 859-869). 1998, 39, 703-723; Nishina et al., J. Lipid Res., 1990, 31, 859-869).
Además, los ratones transgénicos que expresan formas truncadas de la apolipoproteína B se han usado para identificar las características estructurales carboxilo terminales de la ApoB-100 que son necesarias para las interacciones con la apolipoproteína(a) para generar la partícula de lipoproteína Lp(a) e investigar características estructurales de la región de unión al receptor de LDL de la ApoB-100 (Kim and Young, J. Lipid Res., 1998, 39, 703723; McCormick et al., J. Biol. Chem., 1997, 272, 23616-23622). Furthermore, transgenic mice expressing truncated forms of apolipoprotein B have been used to identify the carboxyl terminal structural features of ApoB-100 that are necessary for interactions with apolipoprotein (a) to generate the lipoprotein particle Lp (a). and investigate structural features of the ApoB-100 LDL receptor binding region (Kim and Young, J. Lipid Res., 1998, 39, 703723; McCormick et al., J. Biol. Chem., 1997, 272 , 23616-23622).
Se han generado ratones con el gen de la apolipoproteína B desactivado (que llevan alteraciones tanto en la ApoB100 como la ApoB-48) que están protegidos frente al desarrollo de hipercolesterolemia cuando se alimentan con una dieta alta en grasa (Farese et al., Proc. Natl. Acad. Sci. U. S. A., 1995, 92, 1774-1778; Kim and Young, J. Lipid Res., 1998, 39, 703-723). La incidencia de la aterosclerosis se ha investigado en ratones que expresan exclusivamente ApoB-100 o ApoB-48 y se encontró que la susceptibilidad a la aterosclerosis dependía de los niveles totales de colesterol. El que los ratones sintetizaran ApoB-100 o ApoB-48 no afectaba a la extensión de la aterosclerosis, indicando que probablemente no hay una diferencia importante en la aterogenicidad intrínseca de la ApoB-100 frente a la ApoB-48 (Kim and Young, J. Lipid Res., 1998, 39, 703-723; Veniant et al., J. Clin. Invest., 1997, 100, 180-188). Mice have been generated with the apolipoprotein B gene turned off (which carry alterations in both ApoB100 and ApoB-48) that are protected against the development of hypercholesterolemia when fed with a high fat diet (Farese et al., Proc Natl. Acad. Sci. USA, 1995, 92, 1774-1778; Kim and Young, J. Lipid Res., 1998, 39, 703-723). The incidence of atherosclerosis has been investigated in mice that express exclusively ApoB-100 or ApoB-48 and it was found that susceptibility to atherosclerosis depended on total cholesterol levels. The fact that mice synthesized ApoB-100 or ApoB-48 did not affect the extent of atherosclerosis, indicating that there is probably no significant difference in the intrinsic atherogenicity of ApoB-100 versus ApoB-48 (Kim and Young, J Lipid Res., 1998, 39, 703-723; Veniant et al., J. Clin. Invest., 1997, 100, 180-188).
Niveles plasmáticos elevados de lipoproteína Lp(a) que contiene apoB-100, están asociados con un mayor riesgo de aterosclerosis y sus manifestaciones, que pueden incluir la hipercolesterolemia (Seed et al., N. Engl. J. Med., 1990, 322, 1494-1499), infarto de miocardio (Sandkamp et al., Clin. Chem., 1990, 36, 20-23) y trombosis (Nowak-Gottl et al., Pediatrics, 1997, 99, E11). Elevated plasma levels of Lp (a) lipoprotein containing apoB-100 are associated with an increased risk of atherosclerosis and its manifestations, which may include hypercholesterolemia (Seed et al., N. Engl. J. Med., 1990, 322 , 1494-1499), myocardial infarction (Sandkamp et al., Clin. Chem., 1990, 36, 20-23) and thrombosis (Nowak-Gottl et al., Pediatrics, 1997, 99, E11).
En la concentración plasmática de Lp(a) influye mucho los factores hereditarios y es refractaria a la mayoría de los fármacos y a la manipulación de la dieta (Katan and Beynen, Am. J. Epidemiol., 1987, 125, 387-399; Vessby et al., Atherosclerosis, 1982, 44, 61-71). La terapia farmacológica de los niveles de Lp(a) elevados ha tenido un éxito solo moderado y la aféresis sigue siendo la modalidad terapéutica más eficaz (Hajjar and Nachman, Annu. Rev. Med., 1996, 47, 423-442). Plasma Lp (a) concentration is highly influenced by hereditary factors and is refractory to most drugs and diet manipulation (Katan and Beynen, Am. J. Epidemiol., 1987, 125, 387-399; Vessby et al., Atherosclerosis, 1982, 44, 61-71). Pharmacological therapy of elevated Lp (a) levels has been only moderately successful, and apheresis remains the most effective therapeutic modality (Hajjar and Nachman, Annu. Rev. Med., 1996, 47, 423-442).
En la patente de EE.UU. 6.156.315 y la correspondiente publicación PCT WO 99/18986 se describe y reivindica un método para inhibir la unión del LDL a la matriz de los vasos sanguíneos en un sujeto, que comprende administrar al sujeto una cantidad eficaz de un anticuerpo o un fragmento del mismo, que es capaz de unirse a la región amino terminal de la apolipoproteína B, inhibiendo así la unión de la lipoproteína de baja densidad a la matriz de los vasos sanguíneos (Goldberg and Pillarisetti, 2000; Goldberg and Pillarisetti, 1999). In U.S. Patent No. 6,156,315 and corresponding PCT publication WO 99/18986 describe and claim a method of inhibiting LDL binding to the matrix of blood vessels in a subject, comprising administering to the subject an effective amount of an antibody or a fragment of the itself, which is capable of binding to the amino terminal region of apolipoprotein B, thereby inhibiting the binding of low-density lipoprotein to the matrix of blood vessels (Goldberg and Pillarisetti, 2000; Goldberg and Pillarisetti, 1999).
En la patente de EE.UU. 6.096.516 se describen y reivindican vectores que contienen anticuerpos recombinantes murinos que codifican el ADNc que se une a la ApoB-100 humana con el fin de diagnóstico y tratamiento de enfermedades cardiovasculares (Kwak et al., 2000). In U.S. Patent No. 6,096,516 vectors are described and claimed to contain murine recombinant antibodies encoding cDNA that binds to human ApoB-100 for the purpose of diagnosis and treatment of cardiovascular disease (Kwak et al., 2000).
En la solicitud de patente europea EP 911344 publicada el 28 de abril, 1999 (y que corresponde a la patente de EE.UU. 6.309.844 se describe y reivindica un anticuerpo monoclonal que se une específicamente a la ApoB-48 y no se une específicamente a la ApoB-100, que es útil para el diagnóstico y la terapia de la hiperlipidemia y la esclerosis arterial (Uchida and Kurano, 1998). In European patent application EP 911344 published on April 28, 1999 (and corresponding to US patent 6,309,844) a monoclonal antibody is specifically described and claimed that specifically binds to ApoB-48 and does not bind specifically ApoB-100, which is useful for the diagnosis and therapy of hyperlipidemia and arterial sclerosis (Uchida and Kurano, 1998).
En la publicación PCT WO 01/30354 se describen y reivindican métodos de tratamiento de un paciente con un trastorno cardiovascular, que comprenden administrar una cantidad terapéuticamente eficaz de un compuesto a dicho paciente, en el que dicho compuesto actúa durante un periodo de tiempo para reducir las concentraciones plasmáticas de apolipoproteína B o lipoproteínas que contienen apolipoproteína B estimulando una ruta de degradación de la apolipoproteína B (Fisher and Williams, 2001). Methods of treating a patient with a cardiovascular disorder are described and claimed in PCT publication WO 01/30354, comprising administering a therapeutically effective amount of a compound to said patient, wherein said compound acts for a period of time to reduce plasma concentrations of apolipoprotein B or lipoproteins containing apolipoprotein B stimulating a pathway of degradation of apolipoprotein B (Fisher and Williams, 2001).
En la patente de EE.UU. 5.220.006 se describe y reivindica una secuencia de ADN que actúa en cis clonada que media la supresión de apolipoproteína B aterogénica (Ross et al., 1993). In U.S. Patent No. 5,220,006 a cloned cis-acting DNA sequence that mediates suppression of atherogenic apolipoprotein B is described and claimed (Ross et al., 1993).
En la publicación PCT WO 01/12789 se describe y reivindica un ribozima que escinde el ARNm de ApoB-100 específicamente en la posición 6679 (Chan et al., 2001). PCT publication WO 01/12789 describes and claims a ribozyme that cleaves ApoB-100 mRNA specifically at position 6679 (Chan et al., 2001).
Tang et al., Chinese Journal of Arteriosclerosis, 1999, 7(4) describen experimentos que usan oligodesoxinucleótidos antisentido dirigidos a la apolipoproteína B en células hepáticas de rata. Tang et al., Chinese Journal of Arteriosclerosis, 1999, 7 (4) describe experiments using antisense oligodeoxynucleotides targeting apolipoprotein B in rat liver cells.
Eggerman et al., Federal Register, 2000, 65(110) discuten experimentos que usan oligodesoxinucleótidos antisentido dirigidos a la apolipoproteína B en células hepáticas humanas. Eggerman et al., Federal Register, 2000, 65 (110) discuss experiments using antisense oligodeoxynucleotides targeting apolipoprotein B in human liver cells.
Hasta la fecha, las estrategias dirigidas a inhibir la función de la apolipoproteína B se han limitado a la aféresis de Lp(a), anticuerpos, fragmentos de anticuerpos y ribozimas. Sin embargo, con excepción de la aféresis de Lp(a), estas estrategias de investigación no se han ensayado como protocolos terapéuticos. Por consiguiente, sigue existiendo una necesidad desde hace tiempo de agentes adicionales capaces de inhibir de forma eficaz la función de la apolipoproteína B. To date, strategies aimed at inhibiting apolipoprotein B function have been limited to apheresis for Lp (a), antibodies, antibody fragments, and ribozymes. However, with the exception of Lp (a) apheresis, these research strategies have not been tested as therapeutic protocols. Accordingly, a long-standing need remains for additional agents capable of effectively inhibiting the function of apolipoprotein B.
Está surgiendo la tecnología antisentido como un medio eficaz de reducir la expresión de productos génicos específicos y por lo tanto puede llegar a ser singularmente útil en una serie de aplicaciones terapéuticas, de diagnóstico y de investigación que implican la modulación de la expresión de la apolipoproteína B. Antisense technology is emerging as an effective means of reducing the expression of specific gene products and therefore may prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications involving modulation of apolipoprotein B expression. .
La presente invención proporciona composiciones y métodos para modular la expresión de la apolipoproteína B, incluyendo la inhibición de la isoforma alternativa de la apolipoproteína B, la ApoB-48. The present invention provides compositions and methods for modulating expression of apolipoprotein B, including inhibition of the alternative apolipoprotein B isoform, ApoB-48.
5 Compendio de la invención 5 Compendium of the invention
La invención proporciona un compuesto oligonucleótido antisentido de 20 bases nucleicas de longitud que tiene una secuencia de bases nucleicas como se expone en la SEQ ID NO: 247 y que comprende 5-metilcitidina en las bases nucleicas 2, 3, 5, 9, 12, 15, 17, 19 y 20, en donde cada enlace internucleósido es un enlace fosforotioato, las bases nucleicas 1-5 y 16-20 comprenden una modificación 2'-metoxietoxi, y las bases nucleicas 6-15 son The invention provides a 20 nucleic base long antisense oligonucleotide compound having a nucleic base sequence as set forth in SEQ ID NO: 247 and comprising 5-methylcytidine at nucleic bases 2, 3, 5, 9, 12, 15, 17, 19 and 20, where each internucleoside bond is a phosphorothioate bond, nucleic bases 1-5 and 16-20 comprise a 2'-methoxyethoxy modification, and nucleic bases 6-15 are
10 desoxinucleótidos. 10 deoxynucleotides.
La invención también proporciona una composición que comprende el compuesto oligonucleótido antisentido de la invención y un vehículo o diluyente farmacéuticamente aceptable. The invention also provides a composition comprising the antisense oligonucleotide compound of the invention and a pharmaceutically acceptable carrier or diluent.
La invención también proporciona el compuesto oligonucleótido antisentido de la invención o la composición de la invención, para usar en la terapia o profilaxis de una enfermedad. The invention also provides the antisense oligonucleotide compound of the invention or the composition of the invention, for use in the therapy or prophylaxis of a disease.
15 La invención también proporciona el compuesto oligonucleótido antisentido de la invención o la composición de la invención, para usar en el tratamiento de la hipercolesterolemia en un ser humano. The invention also provides the antisense oligonucleotide compound of the invention or the composition of the invention, for use in the treatment of hypercholesterolemia in a human.
La invención también proporciona el compuesto oligonucleótido antisentido de la invención o la composición de la invención, para usar en el tratamiento de una enfermedad cardiovascular, tal como la aterosclerosis, en un ser humano. The invention also provides the antisense oligonucleotide compound of the invention or the composition of the invention, for use in the treatment of cardiovascular disease, such as atherosclerosis, in a human.
20 La invención también proporciona el compuesto oligonucleótido antisentido de la invención o la composición de la invención, para usar en el tratamiento de la hiperlipidemia en un ser humano. The invention also provides the antisense oligonucleotide compound of the invention or the composition of the invention, for use in treating hyperlipidemia in a human.
La invención también proporciona el compuesto oligonucleótido antisentido de la invención o la composición de la invención, para usar en el tratamiento de la diabetes en un ser humano. The invention also provides the antisense oligonucleotide compound of the invention or the composition of the invention, for use in the treatment of diabetes in a human.
La invención también proporciona el compuesto oligonucleótido antisentido de la invención o la composición de la 25 invención, para usar en el tratamiento de la obesidad en un ser humano. The invention also provides the antisense oligonucleotide compound of the invention or the composition of the invention, for use in the treatment of obesity in a human.
La invención también proporciona el uso del compuesto oligonucleótido antisentido de la invención en la preparación de un medicamento para tratar la hipercolesterolemia en un ser humano. The invention also provides the use of the antisense oligonucleotide compound of the invention in the preparation of a medicament for treating hypercholesterolemia in a human.
La invención también proporciona el uso del compuesto oligonucleótido antisentido de la invención en la preparación de un medicamento para tratar una enfermedad cardiovascular, tal como la aterosclerosis, en un ser humano. The invention also provides the use of the antisense oligonucleotide compound of the invention in the preparation of a medicament for treating cardiovascular disease, such as atherosclerosis, in a human.
30 La invención también proporciona el uso del compuesto oligonucleótido antisentido de la invención en la preparación de un medicamento para tratar la hiperlipidemia en un ser humano. The invention also provides the use of the antisense oligonucleotide compound of the invention in the preparation of a medicament for treating hyperlipidemia in a human.
La invención también proporciona el uso del compuesto oligonucleótido antisentido de la invención en la preparación de un medicamento para tratar la diabetes en un ser humano. The invention also provides the use of the antisense oligonucleotide compound of the invention in the preparation of a medicament for treating diabetes in a human.
La invención también proporciona el uso del compuesto oligonucleótido antisentido de la invención en la preparación 35 de un medicamento para tratar la obesidad en un ser humano. The invention also provides the use of the antisense oligonucleotide compound of the invention in the preparation of a medicament for treating obesity in a human.
Compendio de la descripción Summary of the description
La presente descripción se refiere a compuestos, en particular oligonucleótidos antisentido, que están dirigidos a un ácido nucleico que codifica la apolipoproteína B, y que modulan la expresión de la apolipoproteína B. También se describen composiciones farmacéuticas y otras composiciones que comprenden los compuestos de la descripción. 40 Además, se describen métodos para modular la expresión de la apolipoproteína B en células o tejidos, que comprenden poner en contacto dichas células o tejidos con uno o más compuestos antisentido o composiciones de la descripción. Además se describen métodos de tratamiento de un animal, en particular un ser humano, que se sospecha que tiene o es propenso a tener una enfermedad o afección asociada con la expresión de la apolipoproteína B, por administración de una cantidad terapéutica o profilácticamente eficaz de uno o más The present disclosure relates to compounds, in particular antisense oligonucleotides, that are directed to a nucleic acid encoding apolipoprotein B, and that modulate expression of apolipoprotein B. Pharmaceutical compositions and other compositions comprising the compounds of the description. In addition, methods are described for modulating the expression of apolipoprotein B in cells or tissues, which comprise contacting said cells or tissues with one or more antisense compounds or compositions of the description. In addition, methods of treating an animal, particularly a human, suspected of having or prone to having a disease or condition associated with apolipoprotein B expression, by administration of a therapeutically or prophylactically effective amount of one, are described. or more
45 compuestos antisentido o composiciones de la descripción. Antisense compounds or compositions of the description.
En particular, en la presente memoria se describe un compuesto de 8 a 50 bases nucleicas de longitud dirigido a una molécula de ácido nucleico que codifica la apolipoproteína B, en el que dicho compuesto hibrida específicamente con e inhibe la expresión de una molécula de ácido nucleico que codifica la apolipoproteína B, comprendiendo dicho compuesto al menos 8 bases nucleicas contiguas de cualquiera de las SEQ ID NO: 127-134, 136, 138-174, 176-317, In particular, herein is described a compound 8 to 50 nucleic bases in length targeting a nucleic acid molecule encoding apolipoprotein B, wherein said compound specifically hybridizes with and inhibits the expression of a nucleic acid molecule encoding apolipoprotein B, said compound comprising at least 8 contiguous nucleic bases of any of SEQ ID NO: 127-134, 136, 138-174, 176-317,
También se describe en la presente memoria un compuesto de 8 a 50 bases nucleicas de longitud, que hibrida específicamente con al menos una parte de 8 bases nucleicas de un sitio activo en una molécula de ácido nucleico que codifica la apolipoproteína B, comprendiendo dicho compuesto al menos 8 bases nucleicas contiguas de cualquiera de las SEQ ID NO: 127-134, 136, 138-174, 176-317, 319-321, 323-333, 335-339, 341-374, 376-416, 418500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839, 842, 843 y 845-854, siendo dicho sitio activo una región en dicho ácido nucleico, en el que la unión de dicho compuesto a dicho sitio inhibe significativamente la expresión de la apolipoproteína B comparado con un control. Also disclosed herein is a compound 8 to 50 nucleic bases in length, specifically hybridizing to at least an 8 nucleic base portion of an active site in a nucleic acid molecule encoding apolipoprotein B, said compound comprising minus 8 contiguous nuclei bases of any of SEQ ID NO: 127-134, 136, 138-174, 176-317, 319-321, 323-333, 335-339, 341-374, 376-416, 418500, 502 -510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839, 842, 843 and 845-854, said active site being a region in said nucleic acid, wherein the binding of said compound to said site significantly inhibits apolipoprotein B expression compared to a control.
También se describe en la presente memoria un compuesto de 8 a 50 bases nucleicas de longitud dirigido a una molécula de ácido nucleico que codifica la apolipoproteína B, en el que dicho compuesto hibrida específicamente con dicho ácido nucleico e inhibe la expresión de la apolipoproteína B, en el que la apolipoproteína B es codificada por un polinucleótido seleccionado del grupo que consiste en: (a) SEQ ID NO: 3 y (b) y una variante natural del polinucleótido que codifica la apolipoproteína B que hibrida con el complemento del polinucleótido (a) en condiciones restrictivas, comprendiendo dicho compuesto al menos 8 bases nucleicas contiguas de una cualquiera de las SEQ ID NO: 127-134, 136, 138-174, 176-317, 319-321, 323-333, 335-339, 341-374, 376-416, 418-500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839, 842, 843 y 845-854. Also disclosed herein is a compound 8 to 50 nucleic bases in length targeting a nucleic acid molecule encoding apolipoprotein B, wherein said compound specifically hybridizes to said nucleic acid and inhibits expression of apolipoprotein B, wherein apolipoprotein B is encoded by a polynucleotide selected from the group consisting of: (a) SEQ ID NO: 3 and (b) and a natural variant of the polynucleotide encoding apolipoprotein B that hybridizes to polynucleotide complement (a ) under stringent conditions, said compound comprising at least 8 contiguous nucleic bases of any one of SEQ ID NO: 127-134, 136, 138-174, 176-317, 319-321, 323-333, 335-339, 341 -374, 376-416, 418-500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839, 842, 843 and 845-854.
También se describe en la presente memoria un compuesto de 8 a 50 bases nucleicas de longitud dirigido a una molécula de ácido nucleico que codifica la apolipoproteína B, en el que dicho compuesto hibrida específicamente con dicho ácido nucleico e inhibe la expresión de la apolipoproteína B, en el que la apolipoproteína B es codificada por un polinucleótido seleccionado del grupo que consiste en la SEQ ID NO: 3 y SEQ ID NO: 17, comprendiendo dicho compuesto al menos 8 bases nucleicas contiguas de uno cualquiera de las SEQ ID NO: 127-134, 136, 138174, 176-317, 319-321, 323-333, 335-339, 341-374, 376-416, 418-500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839 842, 843 y 845-854. Also disclosed herein is a compound 8 to 50 nucleic bases in length targeting a nucleic acid molecule encoding apolipoprotein B, wherein said compound specifically hybridizes to said nucleic acid and inhibits expression of apolipoprotein B, wherein apolipoprotein B is encoded by a polynucleotide selected from the group consisting of SEQ ID NO: 3 and SEQ ID NO: 17, said compound comprising at least 8 contiguous nucleic bases of any one of SEQ ID NO: 127- 134, 136, 138174, 176-317, 319-321, 323-333, 335-339, 341-374, 376-416, 418-500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839 842, 843, and 845-854.
También se describe en la presente memoria un compuesto de 8 a 50 bases nucleicas de longitud dirigido a una molécula de ácido nucleico que codifica la apolipoproteína B, en el que dicho compuesto hibrida específicamente con un sitio activo en dicho ácido nucleico e inhibe la expresión de la apolipoproteína B, comprendiendo dicho compuesto al menos 8 bases nucleicas contiguas de cualquiera de las SEQ ID NO: 127-134, 136, 138-174, 176-317, 319-321, 323-333, 335-339, 341-374, 376-416, 418-500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839, 842, 843 y 845-854, siendo dicho sitio activo una región en dicho ácido nucleico, en el que la unión de dicho compuesto a dicho sitio inhibe significativamente la expresión de la apolipoproteína B comparado con un control. Also disclosed herein is a compound 8 to 50 nucleic bases in length targeting a nucleic acid molecule encoding apolipoprotein B, wherein said compound specifically hybridizes to an active site on said nucleic acid and inhibits the expression of apolipoprotein B, said compound comprising at least 8 contiguous nucleic bases of any of SEQ ID NO: 127-134, 136, 138-174, 176-317, 319-321, 323-333, 335-339, 341-374 , 376-416, 418-500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839, 842, 843 and 845 -854, said active site being a region in said nucleic acid, in which the binding of said compound to said site significantly inhibits the expression of apolipoprotein B compared to a control.
También se describe en la presente memoria un compuesto mimético oligonucleótido de 8 a 50 bases nucleicas de longitud dirigido a una molécula de ácido nucleico que codifica la apolipoproteína B, en el que dicho compuesto hibrida específicamente con dicho ácido nucleico e inhibe la expresión de la apolipoproteína B, comprendiendo dicho compuesto al menos 8 bases nucleicas contiguas de cualquiera de las SEQ ID NO: 127-134, 136, 138-174, 176-317, 319-321, 323-333, 335-339, 341-374, 376-416, 418-500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839, 842, 843 y 845-854. Also disclosed herein is an 8 to 50 nucleic base length oligonucleotide mimetic compound targeting a nucleic acid molecule encoding apolipoprotein B, wherein said compound specifically hybridizes to said nucleic acid and inhibits apolipoprotein expression. B, said compound comprising at least 8 contiguous nucleic bases of any of SEQ ID NO: 127-134, 136, 138-174, 176-317, 319-321, 323-333, 335-339, 341-374, 376 -416, 418-500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839, 842, 843, and 845-854 .
También se describe en la presente memoria un compuesto antisentido de 8 a 50 bases nucleicas de longitud, en el que dicho compuesto específicamente hibrida con los nucleótidos 2920-3420 expuestos en la SEQ ID NO: 3, e inhibe la expresión del ARNm que codifica la apolipoproteína B humana después de 16 a 24 h en al menos 30%, en células HepG2 al 80% de confluencia en un cultivo en una concentración 150 nM. En algunos aspectos, el compuesto antisentido de 8 a 50 bases nucleicas de longitud hibrida con los nucleótidos 3230-3288 expuestos en la SEQ ID NO: 3 e inhibe la expresión del ARNm que codifica la apolipoproteína B humana después de 16 a 24 h en al menos 30%, en células HepG2 al 80% de confluencia en un cultivo en una concentración 150 nM. En otro aspecto, los compuestos inhiben la expresión del ARNm que codifica la apolipoproteína B en al menos 50%, después de 16 a 24 en células HepG2 al 80% de confluencia en una concentración 150 nM. Also described herein is an antisense compound 8 to 50 nucleic bases in length, wherein said compound specifically hybridizes to nucleotides 2920-3420 set forth in SEQ ID NO: 3, and inhibits the expression of the mRNA encoding the human apolipoprotein B after 16 to 24 h in at least 30%, in HepG2 cells at 80% confluence in a culture at a concentration of 150 nM. In some respects, the 8 to 50 nucleic base antisense compound in length hybridizes to nucleotides 3230-3288 set forth in SEQ ID NO: 3 and inhibits expression of the mRNA encoding human apolipoprotein B after 16 to 24 h in al minus 30%, in HepG2 cells at 80% confluence in a culture at a concentration of 150 nM. In another aspect, the compounds inhibit apolipoprotein B encoding mRNA expression by at least 50%, after 16-24 in HepG2 cells at 80% confluence at a concentration of 150 nM.
En un aspecto, los compuestos de la descripción están dirigidos a una molécula de ácido nucleico que codifica la apolipoproteína B, en el que dicho compuesto hibrida específicamente con e inhibe la expresión de la forma larga de la apolipoproteína B, la ApoB-100. En otro aspecto, los compuestos hibridan específicamente con dicho ácido nucleico e inhiben la expresión del ARNm que codifica la apolipoproteína B en al menos 5%, en células HepG2 al 80% de confluencia en cultivo a una concentración óptima. En otro aspecto más, los compuestos inhiben la expresión del ARNm que codifica la apolipoproteína B en al menos 10%, al menos 15%, al menos 20%, al menos 25%, al menos 30%, al menos 35%, al menos 40%, o al menos 50%. In one aspect, the compounds of the description are directed to a nucleic acid molecule encoding apolipoprotein B, wherein said compound specifically hybridizes with and inhibits the expression of the long form of apolipoprotein B, ApoB-100. In another aspect, the compounds specifically hybridize with said nucleic acid and inhibit the expression of apolipoprotein B encoding mRNA by at least 5%, in HepG2 cells at 80% confluence in culture at an optimal concentration. In yet another aspect, the compounds inhibit apolipoprotein B encoding mRNA expression by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, or at least 50%.
En otro aspecto, los compuestos son oligonucleótidos antisentido, y en un aspecto, el compuesto tiene una secuencia que comprende la SEQ ID NO: 224, el oligonucleótido antisentido hibrida con una región complementaria al SEQ ID NO: 224, el compuesto comprende la SEQ ID NO: 224, el compuesto consiste esencialmente en la SEQ ID NO: 224 o el compuesto consiste en la SEQ ID NO: 224. In another aspect, the compounds are antisense oligonucleotides, and in one aspect, the compound has a sequence comprising SEQ ID NO: 224, the antisense oligonucleotide hybridizes to a region complementary to SEQ ID NO: 224, the compound comprises SEQ ID NO: 224, the compound consists essentially of SEQ ID NO: 224 or the compound consists of SEQ ID NO: 224.
En otro aspecto, el compuesto tiene una secuencia que comprende la SEQ ID NO: 247, el oligonucleótido antisentido hibrida con una región complementaria al SEQ ID NO: 247, el compuesto comprende la SEQ ID NO: 247, el compuesto consiste esencialmente en la SEQ ID NO: 247 o el compuesto consiste en la SEQ ID NO: 247. In another aspect, the compound has a sequence comprising SEQ ID NO: 247, the antisense oligonucleotide hybridizes with a complementary region to SEQ ID NO: 247, the compound comprises SEQ ID NO: 247, the compound consists essentially of SEQ ID NO: 247 or the compound consists of SEQ ID NO: 247.
En otro aspecto, el compuesto tiene una secuencia que comprende la SEQ ID NO: 319, el oligonucleótido antisentido hibrida con una región complementaria al SEQ ID NO: 319, el compuesto comprende la SEQ ID NO: 319, el compuesto consiste esencialmente en la SEQ ID NO: 319 o el compuesto consiste en la SEQ ID NO: 319. In another aspect, the compound has a sequence comprising SEQ ID NO: 319, the antisense oligonucleotide hybridizes with a complementary region to SEQ ID NO: 319, the compound comprises SEQ ID NO: 319, the compound consists essentially of SEQ ID NO: 319 or the compound consists of SEQ ID NO: 319.
En un aspecto, los compuestos comprenden al menos un enlace internucleósido modificado, y en otro aspecto, el enlace internucleósido es una unión fosforotioato. In one aspect, the compounds comprise at least one modified internucleoside bond, and in another aspect, the internucleoside bond is a phosphorothioate linkage.
En otro aspecto, los compuestos comprenden al menos un resto de azúcar modificado, y en un aspecto, el resto de azúcar modificado es un resto de 2'-O-metoxietil-azúcar. In another aspect, the compounds comprise at least one modified sugar residue, and in one aspect, the modified sugar residue is a 2'-O-methoxyethyl sugar residue.
En otro aspecto, los compuestos comprenden al menos una base nucleica modificada, y en un aspecto la base nucleica modificada es una 5-metilcitosina. In another aspect, the compounds comprise at least one modified nucleic base, and in one aspect the modified nucleic base is 5-methylcytosine.
En otro aspecto más, los compuestos son oligonucleótidos quiméricos. Los compuestos quiméricos preferidos incluyen los que tienen uno o más enlaces fosforotioato y que además comprenden alas de 2'-metoxietoxilnucleótido y un hueco de 10 bases nucleicas 2'-desoxinucleótidos. In yet another aspect, the compounds are chimeric oligonucleotides. Preferred chimeric compounds include those that have one or more phosphorothioate linkages and that further comprise 2'-methoxyethoxynucleotide wings and a 2'-deoxynucleotide 10 nucleic base gap.
En otro aspecto, los compuestos hibridan específicamente con e inhiben la expresión de una molécula de ácido nucleico que codifica una forma empalmada alternativamente de la apolipoproteína B. In another aspect, the compounds specifically hybridize to and inhibit the expression of a nucleic acid molecule encoding an alternately spliced form of apolipoprotein B.
También se describen en la presente memoria composiciones que comprenden un compuesto de la descripción y un vehículo o diluyente farmacéuticamente aceptable. En un aspecto, la composición comprende además un sistema de dispersión coloidal, y en otro aspecto, el compuesto en la composición es un oligonucleótido antisentido. En algunos aspectos, la composición comprende un compuesto antisentido de la descripción hibridado con una hebra complementaria. La hibridación de la cadena antisentido puede formar uno o más extremos romos o uno o más extremos salientes. En algunos aspectos, el extremo saliente comprende una base modificada. Compositions comprising a compound of the disclosure and a pharmaceutically acceptable carrier or diluent are also described herein. In one aspect, the composition further comprises a colloidal dispersion system, and in another aspect, the compound in the composition is an antisense oligonucleotide. In some aspects, the composition comprises an antisense compound of the disclosure hybridized to a complementary strand. Hybridization of the antisense strand can form one or more blunt ends or one or more protruding ends. In some respects, the protruding end comprises a modified base.
También se describen en la presente memoria métodos para inhibir la expresión de la apolipoproteína B en células o tejidos, que comprenden poner en contacto dichas células o tejidos con un compuesto de la descripción de modo que se inhiba la expresión de la apolipoproteína B. También se describen métodos para tratar un animal que tiene una enfermedad o afección asociada con la apolipoproteína B, que comprende administrar a dicho animal una cantidad terapéutica o profilácticamente eficaz de un compuesto de la descripción, de modo que se inhiba la expresión de la apolipoproteína B. En diferentes aspectos, la afección está asociada con el metabolismo anómalo de lípidos, la afección está asociada con el metabolismo anómalo de colesterol, la afección es la aterosclerosis, la afección es una afección metabólica común, la afección metabólica anómalo es la hiperlipidemia, la enfermedad es la diabetes, la diabetes es diabetes de tipo 2, la afección es la obesidad y/o la enfermedad es una enfermedad cardiovascular. Also disclosed herein are methods of inhibiting the expression of apolipoprotein B in cells or tissues, which comprises contacting said cells or tissues with a compound of the disclosure such that expression of apolipoprotein B is inhibited. disclose methods of treating an animal having an apolipoprotein B-associated disease or condition, comprising administering to said animal a therapeutically or prophylactically effective amount of a compound of the disclosure, so that expression of apolipoprotein B is inhibited. different aspects, the condition is associated with abnormal lipid metabolism, the condition is associated with abnormal cholesterol metabolism, the condition is atherosclerosis, the condition is a common metabolic condition, the abnormal metabolic condition is hyperlipidemia, the disease is diabetes, diabetes is type 2 diabetes, the condition is obesity and / or the disease is a disease cardiovascular age.
También se describen en la presente memoria métodos para modular los niveles de glucosa en un animal que comprenden administrar a dicho animal un compuesto de la descripción, y en un aspecto, el animal es un ser humano. En diferentes aspectos, los niveles de glucosa son niveles de glucosa plasmática, los niveles de glucosa son niveles de glucosa en el suero, y/o el animal es un animal diabético. Also disclosed herein are methods of modulating glucose levels in an animal comprising administering to said animal a compound of the disclosure, and in one aspect, the animal is a human. In different aspects, glucose levels are plasma glucose levels, glucose levels are serum glucose levels, and / or the animal is a diabetic animal.
También se describen en la presente memoria métodos para prevenir o retrasar el inicio de una enfermedad o afección asociada con la apolipoproteína B en un animal, que comprenden administrar a dicho animal una cantidad terapéutica o profilácticamente eficaz de un compuesto de la descripción. En un aspecto, el animal es un ser humano. En otros aspectos, la afección es una afección metabólica anómala, la afección metabólica anómala es la hiperlipidemia, la enfermedad es la diabetes, la diabetes es la diabetes de tipo 2, la afección es la obesidad, la afección es la aterosclerosis, la afección implica el metabolismo anómalo de lípidos, y/o la afección implica el metabolismo anómalo de colesterol. Also disclosed herein are methods of preventing or delaying the onset of a disease or condition associated with apolipoprotein B in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of a compound of the disclosure. In one aspect, the animal is a human being. In other respects, the condition is an abnormal metabolic condition, the abnormal metabolic condition is hyperlipidemia, the disease is diabetes, diabetes is type 2 diabetes, the condition is obesity, the condition is atherosclerosis, the condition involves abnormal lipid metabolism, and / or the condition involves abnormal cholesterol metabolism.
También se describen en la presente memoria métodos para prevenir o retrasar el inicio de un aumento de los niveles de glucosa en un animal, que comprenden administrar a dicho animal una cantidad terapéutica o profilácticamente eficaz de un compuesto de la descripción. En un aspecto, el animal es un ser humano. En otros aspectos, los niveles de glucosa son niveles de glucosa en el suero y/o los niveles de glucosa son niveles de glucosa plasmática. Also disclosed herein are methods of preventing or delaying the onset of increased glucose levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of a compound of the disclosure. In one aspect, the animal is a human being. In other aspects, glucose levels are serum glucose levels and / or glucose levels are plasma glucose levels.
También se describen en la presente memoria métodos para modular los niveles de colesterol en el suero en un animal, que comprenden administrar a dicho animal una cantidad terapéutica o profilácticamente eficaz de un compuesto de la descripción. En un aspecto, el animal es un ser humano. Also disclosed herein are methods of modulating serum cholesterol levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of a compound of the disclosure. In one aspect, the animal is a human being.
También se describen en la presente memoria métodos para modular los niveles de lipoproteínas en un animal, que comprenden administrar a dicho animal una cantidad terapéutica o profilácticamente eficaz de un compuesto de la descripción. En un aspecto, el animal es un ser humano. En otros aspectos, la lipoproteína es VLDL, la lipoproteína es HDL, y/o la lipoproteína es LDL. Also described herein are methods of modulating lipoprotein levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of a compound of the disclosure. In one aspect, the animal is a human being. In other aspects, the lipoprotein is VLDL, the lipoprotein is HDL, and / or the lipoprotein is LDL.
También se describen en la presente memoria métodos para modular los niveles de triglicéridos en el suero en un animal, que comprenden administrar a dicho animal una cantidad terapéutica o profilácticamente eficaz de un Also described herein are methods of modulating serum triglyceride levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of a
compuesto de la descripción. En un aspecto, el animal es un ser humano. compound of the description. In one aspect, the animal is a human being.
También se describe en la presente memoria el uso de un compuesto de la descripción para fabricar un medicamento para el tratamiento de una enfermedad o afección asociada con la expresión de la apolipoproteína B, un medicamento para el tratamiento de una afección asociada con el metabolismo anómalo de lípidos, un medicamento para el tratamiento de una afección asociada con el metabolismo anómalo del colesterol, un medicamento para el tratamiento de la aterosclerosis, un medicamento para el tratamiento de la hiperlipidemia, un medicamento para el tratamiento de la diabetes, un medicamento para el tratamiento de la diabetes de tipo 2, un medicamento para el tratamiento de la obesidad, un medicamento para el tratamiento de una enfermedad cardiovascular, un medicamento para prevenir o retrasar el inicio de niveles aumentados de glucosa, un medicamento para prevenir o retrasar el inicio de niveles aumentados de glucosa en el suero, un medicamento para prevenir o retrasar el inicio de niveles aumentados de glucosa plasmática, un medicamento para modular los niveles de colesterol en el suero, un medicamento para modular los niveles de lipoproteínas en el suero, un medicamento para modular los niveles de VLDL en el suero, un medicamento para modular los niveles de HDL en el suero y/o un medicamento para modular los niveles de LDL en el suero, un medicamento para modular los niveles de triglicéridos en el suero. Also disclosed herein is the use of a compound of the disclosure for making a medicament for the treatment of a disease or condition associated with the expression of apolipoprotein B, a medicament for the treatment of a condition associated with abnormal metabolism of lipids, a medicine to treat a condition associated with abnormal cholesterol metabolism, a medicine to treat atherosclerosis, a medicine to treat hyperlipidemia, a medicine to treat diabetes, a medicine to treat type 2 diabetes, a medicine to treat obesity, a medicine to treat cardiovascular disease, a medicine to prevent or delay the onset of increased glucose levels, a medicine to prevent or delay the onset of levels serum glucose levels, a medicine to prevent or delay the onset of leveling s increased plasma glucose, a drug to modulate serum cholesterol levels, a drug to modulate serum lipoprotein levels, a drug to modulate serum VLDL levels, a drug to modulate HDL levels in serum and / or a medicine to modulate serum LDL levels, a medicine to modulate serum triglyceride levels.
En otro aspecto, se describen en la presente memoria métodos para reducir los niveles de lipoproteínas circulantes, que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B. En otro aspecto, se describen en la presente memoria métodos para reducir el transporte de lipoproteínas, que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B. También se describen en la presente memoria métodos para reducir la absorción/adsorción de lipoproteínas, que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B. In another aspect, methods for reducing circulating lipoprotein levels are described herein, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce expression of apolipoprotein B. In another aspect, Methods for reducing lipoprotein transport are described herein, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Methods for reducing the expression of apolipoprotein B are also described herein. absorption / adsorption of lipoproteins, comprising the step of administering to an individual an amount of a compound of the description sufficient to reduce the expression of apolipoprotein B.
En otro aspecto, se describen en la presente memoria métodos para reducir los niveles de triglicéridos circulantes, que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de la apolipoproteína B. También se describen métodos para reducir el transporte de triglicéridos, que comprende la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de la apolipoproteína B. También se describen en la presente memoria métodos para reducir la absorción/adsorción de triglicéridos, que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de la apolipoproteína B. In another aspect, methods for reducing circulating triglyceride levels are described herein, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce expression of apolipoprotein B. Methods are also described. for reducing triglyceride transport, which comprises the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Methods for reducing the absorption / adsorption of triglycerides are also described herein. , which comprise the step of administering to an individual an amount of a compound of the description sufficient to reduce the expression of apolipoprotein B.
En otro aspecto, se describen en la presente memoria métodos para reducir los niveles de colesterol circulantes, incluyendo ésteres de colesterilo y/o colesterol no esterificado, que comprenden la etapas de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B También se contemplan métodos para reducir el transporte de colesterol, incluyendo ésteres de colesterilo y/o colesterol no esterificado, que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B. También se describen en la presente memoria métodos para reducir la absorción/adsorción de colesterol, incluyendo ésteres de colesterilo y/o colesterol no esterificado, que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B. In another aspect, methods for reducing circulating cholesterol levels, including cholesteryl esters and / or non-esterified cholesterol, are described herein, comprising the steps of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression Methods for reducing cholesterol transport, including cholesterol esters and / or non-esterified cholesterol, are also contemplated, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Methods for reducing cholesterol absorption / adsorption, including cholesterol esters and / or non-esterified cholesterol, are also described herein, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B.
También se describen en la presente memoria métodos para reducir los niveles de lípidos circulantes, que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B. También se describen en la presente memoria, métodos para reducir el transporte de lípidos en el plasma, que comprende la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de la apolipoproteína B. Además se describen en la presente memoria métodos para reducir la absorción/adsorción de lípidos, que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B. Also described herein are methods of reducing circulating lipid levels, which comprise the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Also described herein, Methods for reducing plasma lipid transport, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Also described herein are methods of reducing absorption. / lipid adsorption, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B.
También se describen en la presente memoria métodos para reducir los niveles de lípidos de la dieta, que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B. También se describen métodos para reducir el transporte de lípidos de la dieta, que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B, así como métodos para reducir la absorción/adsorción de lípidos de la dieta que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B Also described herein are methods of reducing dietary lipid levels, which comprise the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Also described are methods of reducing dietary lipid transport, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression, as well as methods of reducing the absorption / adsorption of dietary lipids comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression
También se describen en la presente memoria métodos para reducir los niveles de ácidos grasos circulantes, que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B. También se describen en la presente memoria métodos para reducir el transporte de ácidos grasos, que comprende la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de la apolipoproteína B. También se contemplan métodos para reducir la absorción de ácidos grasos, que comprende la etapa de administrar a un individuo una cantidad de un Also described herein are methods of reducing circulating fatty acid levels, which comprise the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. They are also described herein. methods of reducing fatty acid transport, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce expression of apolipoprotein B. Methods of reducing fatty acid absorption are also contemplated, comprising the stage of administering to an individual an amount of a
compuesto de la descripción suficiente para reducir la expresión de la apolipoproteína B. compound of the description sufficient to reduce the expression of apolipoprotein B.
También se describen en la presente memoria métodos para reducir los reactantes de fase aguda circulantes, que comprenden las etapas de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B. En otro aspecto, se describen en la presente memoria métodos para reducir el transporte de reactantes de fase aguda, que comprenden las etapas de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B, así como métodos para reducir la absorción de reactantes de fase aguda que comprenden las etapas de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B Also described herein are methods of reducing circulating acute phase reactants, which comprise the steps of administering to an individual an amount of a compound of the disclosure sufficient to reduce expression of apolipoprotein B. In another aspect, they are described in The present specification methods to reduce the transport of acute phase reactants, comprising the steps of administering to an individual an amount of a compound of the description sufficient to reduce the expression of apolipoprotein B, as well as methods to reduce the absorption of reactants from acute phase comprising the steps of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression
También se describen en la presente memoria métodos para reducir los quilomicrones circulantes que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B, métodos para reducir el transporte de quilomicrones que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B, y métodos para reducir la absorción de quilomicrones que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína Also disclosed herein are methods of reducing circulating chylomicrons comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression, methods of reducing chylomicron transport comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression, and methods of reducing the absorption of chylomicrons comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein expression
B. B.
También se describen en la presente memoria métodos para reducir las partículas remanantes de quilomicrones circulantes que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B, métodos para reducir el transporte de remanentes de quilomicrones que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B, y métodos para reducir la absorción de remanentes de quilomicrones que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B. Also disclosed herein are methods of reducing circulating chylomicron remanufactured particles comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression, methods of reducing the transport of remnants of chylomicrons comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression, and methods of reducing the absorption of chylomicron remnants comprising the step of administering to an individual an amount of a compound of the description sufficient to reduce the expression of apolipoprotein B.
También se describen en la presente memoria métodos para reducir el VLDL, LDL, LDL, y/o HDL circulantes que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B. Igualmente, se describen en la presente memoria métodos para reducir el transporte de VLDL, LDL, LDL y/o HDL que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B, además de métodos para reducir la absorción de VLDL, IDL, LDL y/o HDL que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B. Also disclosed herein are methods of reducing circulating VLDL, LDL, LDL, and / or HDL, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Similarly, methods for reducing VLDL, LDL, LDL and / or HDL transport are described herein, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression, in addition to methods to reduce the absorption of VLDL, IDL, LDL and / or HDL comprising the step of administering to an individual an amount of a compound of the description sufficient to reduce the expression of apolipoprotein B.
En otro aspecto más, se describen en la presente memoria métodos para tratar una afección asociada con la expresión de apolipoproteína B que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para reducir la expresión de apolipoproteína B, seleccionada dicha afección de hiperlipoproteínemia, hiperlipoproteínemia familiar de tipo 3 (disbetalipoproteínemia familiar), e hiperalfalipoproteínemia familiar; hiperlipidemia, hiperlipidemias mixtas, hiperlipidemia tipo lipoproteína múltiple, e hiperlipidemia combinada familiar; hipertrigliceridemia, hipertrigliceridemia familiar, y lipoproteína lipasa familiar; hipercolesterolemia, hipercolesterolemia familiar, hipercolesterolemia poligénica, y apolipoproteína B defectuosa familiar; trastornos cardiovasculares incluyendo aterosclerosis y enfermedad arterial coronaria; enfermedad vascular periférica; enfermedad de von Gierke (enfermedad de almacenamiento del glucógeno, tipo I); lipodistrofias (formas congénita y adquirida); síndrome de Cushing; enanismo ateliótico sexual (deficiencia de la hormona del crecimiento aislada); diabetes mellitus; hipertiroidismo; hipertensión; anorexia nerviosa; síndrome de Werner; porfiria intermitente aguda; cirrosis biliar primaria; obstrucción biliar extrahepática; hepatitis aguda; hepatoma; lupus eritematoso sistémico; gammapatías monoclonales (incluyendo mieloma, mieloma múltiple, macroglobulinemia y linfoma); endocrinopatías; obesidad; síndrome nefrótico; síndrome metabólico; inflamación; hipotiroidismo; uremia (hiperuricemia); impotencia; enfermedad hepática obstructiva; hipercalcemia idiopática; disglobulinemia; niveles de insulina elevados; síndrome X; contractura de Dupuytren; y enfermedad de Alzheimer y demencia. In yet another aspect, methods of treating a condition associated with apolipoprotein B expression are described herein which comprise the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B, selected said condition of hyperlipoproteinemia, type 3 familial hyperlipoproteinemia (familial dysbetalipoproteinemia), and familial hyperalfalipoproteinemia; hyperlipidemia, mixed hyperlipidemias, multiple lipoprotein-type hyperlipidemia, and familial combined hyperlipidemia; hypertriglyceridemia, familial hypertriglyceridemia, and familial lipoprotein lipase; hypercholesterolemia, familial hypercholesterolemia, polygenic hypercholesterolemia, and familial defective apolipoprotein B; cardiovascular disorders including atherosclerosis and coronary artery disease; peripheral vascular disease; von Gierke's disease (glycogen storage disease, type I); lipodystrophies (congenital and acquired forms); Cushing's syndrome; sexual ateliotic dwarfism (isolated growth hormone deficiency); Mellitus diabetes; hyperthyroidism; hypertension; anorexia nervosa; Werner's syndrome; acute intermittent porphyria; primary biliary cirrhosis; extrahepatic biliary obstruction; acute hepatitis; hepatoma; systemic lupus erythematosus; monoclonal gammopathies (including myeloma, multiple myeloma, macroglobulinemia, and lymphoma); endocrinopathies; obesity; nephrotic syndrome; metabolic syndrome; inflammation; hypothyroidism; uremia (hyperuricemia); impotence; obstructive liver disease; idiopathic hypercalcemia; dysglobulinemia; elevated insulin levels; syndrome X; Dupuytren's contracture; and Alzheimer's disease and dementia.
También se describen en la presente memoria métodos para reducir el riesgo de una afección que comprenden las etapas de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para inhibir la expresión de apolipoproteína B, seleccionada dicha afección de embarazo; claudicación intermitente; gota; y enfermedad por toxicidad de mercurio y amalgamas. Also disclosed herein are methods of reducing the risk of a condition comprising the steps of administering to an individual an amount of a compound of the disclosure sufficient to inhibit apolipoprotein B expression, selected from said pregnancy condition; intermittent claudication; gout; and mercury toxicity disease and amalgam.
También se describen en la presente memoria métodos para inhibir la unión de partículas de colesterol al endotelio vascular que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para inhibir la expresión de apolipoproteína B, y como resultado también se describen en la presente memoria métodos para reducir el riesgo de: (i) oxidación de partículas de colesterol; (ii) unión de monocitos al endotelio vascular; (iii) diferenciación de monocitos en macrófagos; (iv) ingestión por macrófagos de partículas de lípidos oxidadas y liberación de citoquinas (incluyendo, pero sin limitar, IL-1, TNF-alfa, TGF-beta); (v) formación de plaquetas de lesiones de fibrograsa fibrosa e inflamación; (vi) lesiones del endotelio que conducen a coágulos; y (vii) coágulos que conducen a infarto de miocardio o accidente cerebrovascular, que también comprenden las etapas de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para inhibir la expresión de apolipoproteína B. Also disclosed herein are methods of inhibiting the binding of cholesterol particles to the vascular endothelium comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to inhibit apolipoprotein B expression, and as a result also describe herein methods to reduce the risk of: (i) oxidation of cholesterol particles; (ii) binding of monocytes to the vascular endothelium; (iii) differentiation of monocytes into macrophages; (iv) macrophage ingestion of oxidized lipid particles and cytokine release (including, but not limited to, IL-1, TNF-alpha, TGF-beta); (v) platelet formation of fibrous fibrous fat lesions and inflammation; (vi) endothelial lesions that lead to clots; and (vii) clots leading to myocardial infarction or stroke, which also comprise the steps of administering to an individual an amount of a compound of the disclosure sufficient to inhibit the expression of apolipoprotein B.
También se describen en la presente memoria métodos para reducir la hiperlipidemia asociada con alcoholismo, tabaco, uso de anticonceptivos orales, uso de glucocorticoides, uso de agentes de bloqueo beta-adrenérgicos, o uso de isotretinoína (ácido 13-cis-retinoico) que comprenden la etapa de administrar a un individuo una cantidad de un compuesto de la descripción suficiente para inhibir la expresión de apolipoproteína B Also described herein are methods of reducing hyperlipidemia associated with alcoholism, tobacco, use of oral contraceptives, use of glucocorticoids, use of beta-adrenergic blocking agents, or use of isotretinoin (13-cis-retinoic acid) comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to inhibit apolipoprotein B expression
También se describe en la presente memoria un compuesto oligonucleótidos antisentido de 8 a 50 bases nucleicas de longitud que comprende al menos 8 nucleótidos contiguos de la SEQ ID NO: 247 y que tiene una longitud de al menos 12 o al menos de 14 a 30 bases nucleicas. Also described herein is an antisense oligonucleotide compound 8 to 50 nucleic bases in length comprising at least 8 contiguous nucleotides of SEQ ID NO: 247 and having a length of at least 12 or at least 14 to 30 bases nucleic.
La invención proporciona un compuesto oligonucleótido antisentido de 20 bases nucleicas de longitud que tiene una secuencia de bases nucleicas como se expone en la SEQ ID NO: 247 y que comprende 5-metilcitidina en las bases nucleicas 2, 3, 5, 9, 12, 15, 17, 19 y 20, en el que cada enlace internucleósido es un enlace fosforotioato, las bases nucleicas 1-5 y 16-20 comprenden una modificación 2'-metoxietoxilo, y las bases nucleicas 6-15 son desoxinucleótidos. The invention provides a 20 nucleic base long antisense oligonucleotide compound having a nucleic base sequence as set forth in SEQ ID NO: 247 and comprising 5-methylcytidine at nucleic bases 2, 3, 5, 9, 12, 15, 17, 19 and 20, where each internucleoside bond is a phosphorothioate bond, nucleic bases 1-5 and 16-20 comprise a 2'-methoxyethoxy modification, and nucleic bases 6-15 are deoxynucleotides.
También se describe en la presente memoria un compuesto que comprende una primera cadena de bases nucleicas, de 8 a 50 bases nucleicas de longitud y que comprende una secuencia de al menos 8 bases nucleicas contiguas de la secuencia expuesta en la SEQ ID NO: 3, hibridada con una segunda cadena de bases nucleicas, de 8 a 50 bases nucleicas de longitud, y que comprende una secuencia suficientemente complementaria de la primera cada para permitir así la hibridación estable, inhibiendo dicho compuesto la expresión del ARNm que codifica la apolipoproteína B después de 16 a 24 h, en al menos 30% o al menos 50%, en células HepG2 al 80% de confluencia en cultivos en una concentración 100 nM. Also described herein is a compound comprising a first strand of nucleic bases, 8 to 50 nucleic bases in length and comprising a sequence of at least 8 contiguous nucleic bases from the sequence set forth in SEQ ID NO: 3, hybridized with a second nucleic base chain, 8 to 50 nucleic bases in length, and comprising a sequence sufficiently complementary to the first one each to allow stable hybridization, said compound inhibiting the expression of the mRNA encoding apolipoprotein B after 16 to 24 h, at least 30% or at least 50%, in HepG2 cells at 80% confluence in cultures at a concentration of 100 nM.
Se describe además una vesícula, tal como un liposoma, que comprende un compuesto o composición de la descripción. Further disclosed is a vesicle, such as a liposome, comprising a compound or composition of the disclosure.
Los métodos preferidos de administración de los compuestos o composiciones de la descripción, a un animal son por vía intravenosa, subcutánea u oral. La administración se puede repetir. Preferred methods of administering the compounds or compositions of the disclosure to an animal are intravenous, subcutaneous, or oral. Administration can be repeated.
También se describe en la presente memoria un método para reducir la secreción de lipoproteína (a) por lo hepatocitos, que comprende (a) poner en contacto los hepatocitos con una cantidad de una composición que comprende un compuesto no catalítico de 8 a 50 bases nucleicas de longitud que hibrida específicamente con el ARNm que codifica la apolipoproteína B humana e inhibe la expresión del ARNm después de 16 a 24 h, en al menos 30% o al menos 50%, en células HepG2 al 80% de confluencia en cultivos en una concentración 150 nM, en el que al menos dicha cantidad es eficaz para inhibir la expresión de la apolipoproteína B en los hepatocitos; y (b) medir la secreción de la lipoproteína (a) por los hepatocitos. Also disclosed herein is a method of reducing hepatocyte secretion of lipoprotein (a), comprising (a) contacting hepatocytes with an amount of a composition comprising a non-catalytic compound of 8 to 50 nucleic bases in length that specifically hybridizes to the mRNA encoding human apolipoprotein B and inhibits mRNA expression after 16 to 24 h, at least 30% or at least 50%, in HepG2 cells at 80% confluence in cultures in a 150 nM concentration, in which at least said amount is effective to inhibit the expression of apolipoprotein B in hepatocytes; and (b) measure the secretion of lipoprotein (a) by hepatocytes.
También se describe en la presente memoria un método para tratar una afección asociada con la expresión de la apolipoproteína B en un primate, tal como un ser humano, que comprende administrar al primate una cantidad terapéutica o profilácticamente eficaz de un compuesto no catalítico de 8 a 50 bases nucleicas de longitud que hibrida específicamente con el ARNm que codifica la apolipoproteína B humana e inhibe la expresión del ARNm después de 16 a 24 h, en al menos 30% o al menos 50%, en células HepG2 al 80% de confluencia en cultivos en una concentración 150 nM. Also disclosed herein is a method of treating a condition associated with the expression of apolipoprotein B in a primate, such as a human, which comprises administering to the primate a therapeutically or prophylactically effective amount of a non-catalytic compound of 8 to 50 nucleic bases in length that hybridizes specifically to the mRNA encoding human apolipoprotein B and inhibits mRNA expression after 16 to 24 h, at least 30% or at least 50%, in HepG2 cells at 80% confluence in cultures at a concentration of 150 nM.
También se describe en la presente memoria un método para reducir la expresión de la apolipoproteína B en el hígado de un animal, que comprende administrar al animal entre 2 mg/kg y 20 mg/kg de un compuesto no catalítico de 8 a 50 bases nucleicas de longitud que hibrida específicamente con el ARNm que codifica la apolipoproteína B humana en al menos 30% o al menos 50%, en células HepG2 al 80% de confluencia en cultivos en una concentración 150 nM. Also described herein is a method of reducing the expression of apolipoprotein B in the liver of an animal, which comprises administering to the animal between 2 mg / kg and 20 mg / kg of a non-catalytic compound from 8 to 50 nucleic bases. in length that hybridizes specifically to the mRNA encoding human apolipoprotein B by at least 30% or at least 50%, in HepG2 cells at 80% confluence in cultures at a concentration of 150 nM.
También se describe un método para fabricar un compuesto de la descripción que comprende hibridar específicamente in vitro una primera cadena de bases nucleicas que comprende una secuencia de al menos 8 bases nucleicas contiguas de la secuencia expuesta en la SEQ ID NO:3 con una segunda cadena de bases nucleicas que comprende una secuencia suficientemente complementaria de dicha primera cadena de forma que permite la hibridación estable. Also disclosed is a method of making a compound of the disclosure comprising specifically hybridizing a first nucleic base chain in vitro comprising a sequence of at least 8 contiguous nucleic bases of the sequence set forth in SEQ ID NO: 3 with a second chain nucleic base comprising a sequence sufficiently complementary to said first strand so as to allow stable hybridization.
También se describe en la presente memoria el uso de un compuesto de la descripción en la fabricación de un medicamento para el tratamiento de todas y cada una de las afecciones descritas en la presente memoria. Also described herein is the use of a compound of the disclosure in the manufacture of a medicament for the treatment of each and every condition described herein.
Descripción detallada de la invención Detailed description of the invention
La presente invención usa compuestos oligómeros, específicamente oligonucleótidos antisentido, para usar en la modulación de la función de moléculas de ácido nucleico que codifican la apolipoproteína B, modulando finalmente la cantidad de apolipoproteína B producida. Esto se logra proporcionando compuestos antisentido que hibridan específicamente con uno o más ácidos nucleicos que codifican la apolipoproteína B. Como se usa en la presente memoria, las expresiones "ácido nucleico diana" y "ácido nucleico que codifica la apolipoproteína B" abarcan ADN que codifica la apolipoproteína B, ARN (incluyendo pre-ARNm y ARNm) transcritos a partir de dicho ADN, y también ADNc derivado de dicho ARN. La hibridación específica de un compuesto oligomérico con un ácido nucleico diana interfiere con la función normal del ácido nucleico. Esta modulación de la función de un ácido nucleico diana por compuestos con los que hibrida específicamente se denomina "antisentido". Las funciones del ADN con las que se va a interferir incluyen la replicación y transcripción. Las funciones del ARN con las que se va a interferir incluyen todas las funciones vitales tales como, por ejemplo, translocación del ARN al sitio de traducción de proteínas, The present invention uses oligomeric compounds, specifically antisense oligonucleotides, for use in modulating the function of nucleic acid molecules encoding apolipoprotein B, ultimately modulating the amount of apolipoprotein B produced. This is accomplished by providing antisense compounds that specifically hybridize to one or more nucleic acids encoding apolipoprotein B. As used herein, the terms "target nucleic acid" and "nucleic acid encoding apolipoprotein B" encompass DNA encoding apolipoprotein B, RNA (including pre-mRNA and mRNA) transcribed from said DNA, and also cDNA derived from said RNA. The specific hybridization of an oligomeric compound with a target nucleic acid interferes with the normal function of the nucleic acid. This modulation of the function of a target nucleic acid by compounds with which it specifically hybridizes is called "antisense." The DNA functions to be interfered with include replication and transcription. The functions of the RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the protein translation site,
5 traducción de proteínas a partir de ARN, empalme del ARN para dar una o más especies de ARNm y actividad catalítica en la que puede estar implicado o ser facilitada por el ARN. El efecto global de dicha interferencia con la función del ácido nucleico diana es la modulación de la expresión de la apolipoproteína B. En el contexto de la presente invención, "modulación" significa un aumento (estimulación) o una disminución (inhibición) de la expresión de un gen. En el contexto de la presente invención, la inhibición es la forma preferida de modulación de la expresión génica y el ARNm es una diana preferida. 5 translation of proteins from RNA, splicing of RNA to give one or more species of mRNA, and catalytic activity in which RNA may be involved or facilitated. The overall effect of such interference with target nucleic acid function is modulation of apolipoprotein B expression. In the context of the present invention, "modulation" means an increase (stimulation) or decrease (inhibition) of expression of a gene. In the context of the present invention, inhibition is the preferred form of modulation of gene expression and mRNA is a preferred target.
Se prefiere dirigirse a ácidos nucleicos específicos para el procedimiento antisentido. "Dirigir" un compuesto antisentido a un ácido nucleico particular, en el contexto de esta invención, es un procedimiento de múltiples etapas. El procedimiento normalmente empieza con la identificación de una secuencia de ácido nucleico cuya función se va a modular. Este puede ser, por ejemplo, un gen celular (o ARNm transcrito a partir del gen) cuya expresión está 15 asociada con un trastorno o estado patológico particular, o una molécula de ácido nucleico de un agente infeccioso. En la presente invención, la diana es una molécula de ácido nucleico que codifica la apolipoproteína B. El proceso de dirigir también incluye determinar un sitio o sitios en este gen para que se produzca la interacción antisentido de modo que resulte el efecto deseado, p. ej., la detección o modulación de la expresión de la proteína. En el contexto de la presente descripción, un sitio intragénico preferido es la región que abarca el codón de inicio o terminación de la traducción del marco de lectura abierto (ORF) del gen. Puesto que como se conoce en la técnica el codón de inicio de la traducción típicamente es 5'-AUG (en moléculas de ARNm transcritas; 5'-ATG en la correspondiente molécula de ADN), el codón de inicio de la traducción también se denomina "codón AUG", el "codón de inicio" o el "codón de inicio AUG". Una minoría de genes tienen un codón de inicio de la traducción que tiene la secuencia de ARN 5'-GUG, 5'-UUG o 5'-CUG, y se ha mostrado que 5'-AUA, 5'-ACG y 5'-CUG funcionan in vivo. Por lo tanto, las 25 expresiones "codón de inicio de la traducción" y "codón de inicio" pueden abarcar muchas secuencias de codones, incluso aunque el aminoácido iniciador en cada caso típicamente es metionina (en eucariotas) o formilmetionina (en procariotas). También se sabe en la técnica que los genes eucariotas y procariotas pueden tener dos o más codones de inicio alternativos, cualquiera de los cuales se puede usar preferiblemente para el inicio de la traducción en un tipo de célula o tejido particular, o en un conjunto particular de condiciones. En el contexto de la invención, "codón de inicio" y "codón de inicio de la traducción" se refiere al codón o codones que se usan in vivo para iniciar la traducción de una molécula de ARNm transcrita a partir de un gen que codifica la apolipoproteína B, independientemente de la Targeting specific nucleic acids is preferred for the antisense procedure. "Targeting" an antisense compound to a particular nucleic acid, in the context of this invention, is a multi-step procedure. The procedure normally begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule of an infectious agent. In the present invention, the target is a nucleic acid molecule that encodes apolipoprotein B. The targeting process also includes determining a site or sites in this gene for antisense interaction to occur so that the desired effect results, e.g. eg, detection or modulation of protein expression. In the context of the present description, a preferred intragenic site is the region spanning the translation start or stop codon of the gene's open reading frame (ORF). Since the translation start codon is typically known in the art as 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation start codon is also called "AUG codon", the "start codon" or the "AUG start codon". A minority of genes have a translation start codon that has the 5'-GUG, 5'-UUG or 5'-CUG RNA sequence, and it has been shown that 5'-AUA, 5'-ACG and 5 ' -CUG works in vivo. Therefore, the terms "translation start codon" and "start codon" can encompass many codon sequences, even though the initiator amino acid in each case is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes can have two or more alternative start codons, either of which can preferably be used for translation initiation in a particular cell or tissue type, or in a particular set of conditions. In the context of the invention, "start codon" and "translation start codon" refers to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding the apolipoprotein B, regardless of the
o las secuencias de dichos codones. or the sequences of said codons.
También se conoce en la técnica, que un codón de terminación de la traducción (o "codón de parada") de un gen puede tener una de tres secuencias, es decir, 5'-UAA, 5'-UAG y 5'-UGA (las correspondientes secuencias de ADN It is also known in the art, that a translation stop codon (or "stop codon") of a gene can have one of three sequences, ie 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences
35 son 5'-TAA, 5'-TAG y 5'-TGA, respectivamente). Las expresiones "región del codón de inicio" y "región del codón de inicio de la traducción", se refieren a una parte de dicho ARNm o gen que abarca desde aproximadamente 25 a aproximadamente 50 nucleótidos contiguos en cualquier dirección (es decir, 5' o 3') desde un codón de inicio de la traducción. De forma similar, las expresiones "región del codón de parada" y "región del codón de terminación de la traducción", se refieren a una parte de dicho ARNm o gen que abarca desde aproximadamente 25 a aproximadamente 50 nucleótidos contiguos en cualquier dirección (es decir, 5' o 3') desde un codón de terminación de la traducción. 35 are 5'-TAA, 5'-TAG and 5'-TGA, respectively). The terms "start codon region" and "translation start codon region" refer to a part of said mRNA or gene spanning from about 25 to about 50 contiguous nucleotides in either direction (ie 5 ' or 3 ') from a translation start codon. Similarly, the terms "stop codon region" and "translation stop codon region" refer to a part of said mRNA or gene that spans from about 25 to about 50 contiguous nucleotides in either direction (is say 5 'or 3') from a translation stop codon.
El marco de lectura abierto (ORF) o "región codificante", que se sabe en la técnica que se refiere a la región entre el codón de inicio de la traducción y el codón de terminación de la traducción, también es una región que puede ser una región diana de forma eficaz. Otras regiones diana incluyen la región 5' no traducida (5'UTR), que se sabe en la The open reading frame (ORF) or "coding region", which is known in the art to refer to the region between the translation start codon and the translation stop codon, is also a region that can be a target region efficiently. Other target regions include the 5 'untranslated region (5'UTR), which is known in the
45 técnica que se refiere a la parte de un ARNm en la dirección 5' desde el codón de inicio de la traducción, y por lo tanto incluye los nucleótidos entre el sitio de la caperuza 5' y el codón de inicio de la traducción de un ARNm o los correspondientes nucleótidos en el gen, y la región 3' no traducida (3'UTR) que se sabe en la técnica que se refiere a la parte de un ARNm en la dirección 3' desde el codón de terminación de la traducción, y por lo tanto incluye nucleótidos entre el codón de terminación de la traducción y el extremo 3' de un ARNm o los correspondientes nucleótidos en el gen. La caperuza 5' de un ARNm comprende un resto de guanosina N7-metilado unido al resto más extremo 5' del ARNm mediante un enlace trifosfato 5'-5'La región de la caperuza 5' de un ARNm se considera que incluye la propia estructura de la caperuza 5' así como los primeros 50 nucleótidos adyacentes a la caperuza. La región de la caperuza 5' también puede ser una región diana preferida. A technique that refers to the part of an mRNA in the 5 'direction from the translation start codon, and therefore includes the nucleotides between the 5' cap site and the translation start codon of a MRNA or the corresponding nucleotides in the gene, and the 3 'untranslated region (3'UTR) known in the art that refers to the part of an mRNA in the 3' direction from the translational stop codon, and therefore includes nucleotides between the translation termination codon and the 3 'end of an mRNA or the corresponding nucleotides in the gene. The 5 'cap of an mRNA comprises an N7-methylated guanosine residue linked to the 5' most extreme residue of the mRNA via a 5'-5'-triphosphate bond The 5 'cap region of an mRNA is considered to include the structure itself of the 5 'cap as well as the first 50 nucleotides adjacent to the cap. The 5 'cap region may also be a preferred target region.
Aunque algunos ARNm eucariotas son traducidos directamente, muchos contienen una o más regiones, conocidas Although some eukaryotic mRNAs are translated directly, many contain one or more regions, known
55 como "intrones" que son escindidas de un transcrito antes de ser traducidas. El resto de las regiones (y por lo tanto traducidas) se conocen como "exones" y son empalmadas entre sí para formar una secuencia de ARNm continua. Los sitios de empalme del ARNm, es decir, las uniones intrón-exón, también pueden ser regiones diana preferidas, y son particularmente útiles en situaciones en las que en la enfermedad está implicado el empalme aberrante, o cuando está implicado en la enfermedad un exceso de producción de un producto de empalme de ARNm particular. Las uniones de fusiones aberrantes debidas a reordenamientos o eliminaciones también son dianas preferidas. También se ha encontrado que los intrones también pueden ser regiones diana eficaces, y por lo tanto preferidas, para los compuestos antisentido dirigidos, por ejemplo, a ADN o pre-ARNm. 55 as "introns" that are cleaved from a transcript before being translated. The rest of the regions (and therefore translated) are known as "exons" and are spliced together to form a continuous mRNA sequence. MRNA splice sites, i.e., intron-exon junctions, may also be preferred target regions, and are particularly useful in situations where aberrant splicing is involved in disease, or when excess disease is involved in disease of production of a particular mRNA splicing product. Aberrant fusion junctions due to rearrangements or deletions are also preferred targets. It has also been found that introns can also be effective, and therefore preferred, target regions for antisense compounds targeting, for example, DNA or pre-mRNA.
Se han identificado uno o más sitios diana, y se eligen oligonucleótidos que son suficientemente complementarios de la diana, es decir, hibridan suficientemente bien y con suficiente especificidad, para dar el efecto deseado. One or more target sites have been identified, and oligonucleotides that are sufficiently complementary to the target, that is, hybridize well enough and with sufficient specificity, are chosen to give the desired effect.
En el contexto de esta invención, "hibridación" significa enlace de hidrógeno, que puede ser enlace de hidrógeno de Watson-Crick, Hoogsteen o Hoogsteen inversos. Por ejemplo, la adenina y la timina son bases nucleicas 5 complementarias que se aparean mediante la formación de enlaces hidrógeno. "Complementario," como se usa en la presente memoria, se refiere a la capacidad para el apareamiento preciso entre dos nucleótidos. Por ejemplo, si un nucleótido en una determinada posición de un oligonucleótido es capaz de forman enlace de hidrógeno con un nucleótido en la misma posición de una molécula de ADN o ARN, entonces se considera que el nucleótido y el ADN In the context of this invention, "hybridization" means hydrogen bond, which may be Watson-Crick, Hoogsteen or reverse Hoogsteen hydrogen bond. For example, adenine and thymine are complementary nucleic bases that mate by forming hydrogen bonds. "Complementary," as used herein, refers to the ability for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of forming a hydrogen bond with a nucleotide at the same position of a DNA or RNA molecule, then the nucleotide and DNA are considered
o ARN son complementarios entre sí en esa posición. El oligonucleótido y el ADN o ARN son complementarios entre or RNAs are complementary to each other in that position. The oligonucleotide and DNA or RNA are complementary between
10 sí cuando un número suficiente de posiciones correspondientes en cada molécula están ocupadas por nucleótidos que pueden formar enlaces de hidrógeno unos con otros. Por lo tanto, "que puede hibridar específicamente" y "complementario" son términos que se usan para indicar un grado suficiente de complementariedad o apareamiento preciso de modo que se produce una unión específica y estable entre los oligonucleótidos y al ADN o ARN diana. Se entiende en la técnica que la secuencia de un compuesto antisentido no es necesario que sea 100% 10 yes when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can form hydrogen bonds with each other. Therefore, "specifically capable of hybridizing" and "complementary" are terms used to indicate a sufficient degree of complementarity or precise pairing so that a specific and stable binding occurs between the oligonucleotides and the target DNA or RNA. It is understood in the art that the sequence of an antisense compound need not be 100%.
15 complementaria de la de su ácido nucleico diana para que puede hibridar específicamente. Un compuesto antisentido puede hibridar específicamente cuando la unión del compuesto a la molécula de ADN o ARN diana interfiere con la función normal del ADN o ARN diana para producir una pérdida de utilidad, y hay un grado suficiente de complementariedad para evitar la unión no específica del compuesto antisentido a las secuencias que no son diana en condiciones en las que se desea la unión específica, es decir, en condiciones fisiológicas en el caso de 15 complementary to that of its target nucleic acid so that it can specifically hybridize. An antisense compound can specifically hybridize when the compound's binding to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause loss of utility, and there is a sufficient degree of complementarity to prevent nonspecific binding of the antisense compound to non-target sequences under conditions where specific binding is desired, i.e. under physiological conditions in the case of
20 ensayos in vivo o tratamiento terapéutico, y en el caso de ensayos in vitro, en condiciones en las que se realizan los ensayos. 20 in vivo tests or therapeutic treatment, and in the case of in vitro tests, under conditions in which the tests are carried out.
Los compuestos antisentido y otros compuestos de la invención que hibridan con la diana e inhiben la expresión de la diana, se identifican mediante experimentación, y las secuencias de estos compuestos se identifican en lo sucesivo como realizaciones preferidas de la invención. Los sitios diana de los que estas secuencias preferidas son Antisense compounds and other compounds of the invention that hybridize to the target and inhibit expression of the target, are identified by experimentation, and the sequences of these compounds are hereinafter identified as preferred embodiments of the invention. The target sites from which these preferred sequences are
25 complementarias se denominan en lo sucesivo "sitios activos" y por lo tanto son sitios preferidos para usar como dianas. Por lo tanto, otra realización de la invención abarca compuestos que hibridan con estos sitios activos. Complementary sites are hereinafter referred to as "active sites" and are therefore preferred sites for use as targets. Therefore, another embodiment of the invention encompasses compounds that hybridize to these active sites.
Los compuestos antisentido normalmente se usan como reactivos de investigación y diagnóstico. Por ejemplo, los oligonucleótidos antisentido que son capaces de inhibir la expresión génica con exquisita especificidad, los usan a menudo los expertos en la técnica para elucidar la función de genes particulares. Los compuestos antisentido Antisense compounds are normally used as research and diagnostic reagents. For example, antisense oligonucleotides that are capable of inhibiting gene expression with exquisite specificity are often used by those skilled in the art to elucidate the function of particular genes. Antisense compounds
30 también se usan, por ejemplo, para distinguir entre funciones de diferentes miembros de una ruta biológica. Por lo tanto, la modulación antisentido se ha aprovechado para uso en investigación. 30 are also used, for example, to distinguish between functions of different members of a biological pathway. Therefore, antisense modulation has been exploited for research use.
Para usar en kits y en diagnóstico, los compuestos antisentido de la presente invención, solos o en combinación con otros compuestos antisentido o compuestos terapéuticos, se pueden usar como herramientas en análisis diferencial y/o combinatorio para elucidar patrones de expresión de una parte o del complemento entero de genes expresados For use in kits and in diagnostics, the antisense compounds of the present invention, alone or in combination with other antisense compounds or therapeutic compounds, can be used as tools in differential and / or combinatorial analysis to elucidate expression patterns of a part or the integer complement of expressed genes
35 en células y tejidos. 35 in cells and tissues.
Se comparan los patrones de expresión en células o tejidos tratados con uno o más compuestos antisentido con células o tejidos de control no tratados con compuestos antisentido y se analizan los diferentes niveles de expresión génica en los patrones producidos en lo que se refiere, por ejemplo, a la asociación con la enfermedad, ruta de señalización, localización celular, nivel de expresión, tamaño, estructura o función de los genes examinados. Los Expression patterns in cells or tissues treated with one or more antisense compounds are compared with control cells or tissues not treated with antisense compounds and the different levels of gene expression in the patterns produced are analyzed for, for example, to the association with the disease, signaling route, cellular location, level of expression, size, structure or function of the examined genes. The
40 análisis se pueden llevar a cabo en células estimuladas o no estimuladas y en presencia o ausencia de otros compuestos que afectan a los patrones de expresión. Analysis can be carried out on stimulated or non-stimulated cells and in the presence or absence of other compounds that affect expression patterns.
Los ejemplos de métodos de análisis de expresión génica conocidos en la técnica, incluyen matrices y micromatrices de ADN (Brazma and Vilo, FEBS Lett., 2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE (análisis en serie de la expresión génica) (Madden, et al., Drug Discov. Today, 2000, 5, 415-425), READS (amplificación con 45 enzimas de restricción de ADNc digeridos) (Prashar and Weissman, Methods Enzymol., 1999, 303, 258-72), TOGA (análisis de expresión génica total) (Sutcliffe, et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 1976-81), matrices de proteínas y proteómica (Celis, et al., FEBS Lett., 2000, 480, 2-16; Jungblut, et al., Electrophoresis, 1999, 20, 210010), secuenciación de marcador de secuencia expresado (EST) (Celis, et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57), huella dactilar de ARN sustractiva (SuRF) (Fuchs, et al., Anal. Biochem., Examples of gene expression analysis methods known in the art include DNA matrices and microarrays (Brazma and Vilo, FEBS Lett., 2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480 , 2-16), SAGE (serial analysis of gene expression) (Madden, et al., Drug Discov. Today, 2000, 5, 415-425), READS (amplification with 45 digested cDNA restriction enzymes) ( Prashar and Weissman, Methods Enzymol., 1999, 303, 258-72), TOGA (analysis of total gene expression) (Sutcliffe, et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 1976-81) , protein matrices and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16; Jungblut, et al., Electrophoresis, 1999, 20, 210010), expressed sequence marker sequencing (EST) ( Celis, et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57), subtractive RNA fingerprint (SuRF) (Fuchs, et al., Anal. Biochem.,
50 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41, 203-208), clonación sustractiva, presentación diferencial (DD) (Jurecic and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), hibridación genómica comparativa (Carulli, et al., J. Cell Biochem. Suppl., 1998, 31, 286-96), técnicas de FISH (hibridación in situ fluorescente) (Going and Gusterson, Eur. J. Cancer, 1999, 35, 1895-904) y métodos de espectrometría de masas (revisados en To, Comb. Chem. High Throughput Screen, 2000, 3, 235-41). 50 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41, 203-208), subtractive cloning, differential presentation (DD) (Jurecic and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative genomic hybridization ( Carulli, et al., J. Cell Biochem. Suppl., 1998, 31, 286-96), FISH techniques (fluorescent in situ hybridization) (Going and Gusterson, Eur. J. Cancer, 1999, 35, 1895-904 ) and mass spectrometry methods (reviewed in To, Comb. Chem. High Throughput Screen, 2000, 3, 235-41).
55 La especificidad y sensibilidad del compuesto antisentido también la aprovechan los expertos en la técnica para usos terapéuticos. Se han usado oligonucleótidos antisentido como restos terapéuticos en el tratamiento de estados patológicos en animales y el hombre. Los fármacos de oligonucleótidos antisentido, incluyendo ribozimas, se han administrado de forma segura y eficaz a seres humanos y actualmente están en marcha numerosos ensayos clínicos. Por lo tanto, está establecido que los oligonucleótidos pueden ser modalidades terapéuticas útiles que se 55 The specificity and sensitivity of the antisense compound is also exploited by those skilled in the art for therapeutic uses. Antisense oligonucleotides have been used as therapeutic residues in the treatment of disease states in animals and man. Antisense oligonucleotide drugs, including ribozymes, have been safely and effectively administered to humans and numerous clinical trials are currently underway. Therefore, it is established that oligonucleotides may be useful therapeutic modalities that are
60 pueden configurar para ser útiles en regímenes de tratamiento para el tratamiento de células, tejidos y animales, en especial seres humanos. 60 can be configured to be useful in treatment regimens for the treatment of cells, tissues and animals, especially humans.
En el contexto de esta invención, el término "oligonucleótido" se refiere a un oligómero o un polímero de ácido ribonucleico (ARN) o ácido desoxirribonucleico (ADN) o miméticos de los mismos. Por tanto, este término incluye oligonucleótidos compuestos por bases nucleicas presentes en la naturaleza, azúcares y enlaces internucleósidos In the context of this invention, the term "oligonucleotide" refers to an oligomer or a polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. Therefore, this term includes oligonucleotides composed of naturally occurring nucleic bases, sugars, and internucleoside linkages.
5 covalentes (cadena principal) (ARN y ADN), así como oligonucleótidos que tienen porciones que no son de origen natural que actúan de manera similar (miméticos de oligonucleótidos). Con frecuencia se prefieren los miméticos de oligonucleótidos frente a las formas naturales debido a las propiedades deseables tales como, por ejemplo, mayor captación celular, mayor afinidad por el ácido nucleico diana y mayor estabilidad en presencia de nucleasas. 5 covalent (main chain) (RNA and DNA), as well as oligonucleotides that have similarly acting, non-naturally occurring portions (oligonucleotide mimetics). Oligonucleotide mimetics are often preferred over natural forms because of desirable properties such as, for example, increased cell uptake, increased affinity for target nucleic acid, and increased stability in the presence of nucleases.
Aunque los oligonucleótidos antisentido son una forma preferida de compuesto antisentido, la presente descripción Although antisense oligonucleotides are a preferred form of antisense compound, the present description
10 incluye otros compuestos antisentido oligómeros, incluyendo, pero sin limitar miméticos de oligonucleótidos tal como se describe a continuación. Los compuestos antisentido de acuerdo con esta descripción comprenden de aproximadamente 8 a aproximadamente 50 bases nucleicas (es decir, de aproximadamente 8 a aproximadamente 50 nucleósidos unidos). Los compuestos antisentido particularmente preferidos son oligonucleótidos antisentido, incluso más preferiblemente los que comprenden de aproximadamente 12, aproximadamente 14, aproximadamente 10 includes other antisense oligomeric compounds, including, but not limited to, oligonucleotide mimetics as described below. Antisense compounds according to this disclosure comprise from about 8 to about 50 nucleic bases (ie, from about 8 to about 50 bound nucleosides). Particularly preferred antisense compounds are antisense oligonucleotides, even more preferably those comprising from about 12, about 14, about
15 20 a aproximadamente 30 bases nucleicas. Los compuestos antisentido incluyen ribozimas, oligonucleótidos de secuencia guía externa (EGS) (oligozimas) y otros ARN catalíticos cortos u oligonucleótidos catalíticos que hibridan con el ácido nucleico diana y modulan su expresión. En realizaciones preferidas, el compuesto antisentido es un oligonucleótido no catalítico, es decir, no depende de una propiedad catalítica del oligonucleótido para su actividad moduladora. Los compuestos antisentido de la invención pueden incluir moléculas bicatenarias en las que una 15 20 to about 30 nucleic bases. Antisense compounds include ribozymes, external guide sequence oligonucleotides (EGS) (oligozymes), and other short catalytic RNAs or catalytic oligonucleotides that hybridize to the target nucleic acid and modulate its expression. In preferred embodiments, the antisense compound is a non-catalytic oligonucleotide, that is, it does not depend on a catalytic property of the oligonucleotide for its modulating activity. The antisense compounds of the invention can include double-stranded molecules in which a
20 primera cadena es hibridada establemente con una segunda cadena. The first chain is stably hybridized with a second chain.
Tal y como se conoce en la técnica, un nucleósido es una combinación de base-azúcar. La porción de base del nucleósido es normalmente una base heterocíclica. Las dos clases más comunes de tales bases heterocíclicas son las purinas y las pirimidinas. Los nucleótidos son nucleósidos que incluyen además un grupo fosfato unido covalentemente a la porción de azúcar del nucleósido. Para aquellos nucleósidos que incluyen un azúcar 25 pentofuranosilo, el grupo fosfato puede estar unido al resto 2', 3' o 5' hidroxilo del azúcar. En la formación de oligonucleótidos, los grupos fosfato enlazan covalentemente nucleósidos entre sí, para formar un compuesto polimérico lineal. A su vez, los extremos respectivos de esta estructura polimérica lineal se pueden unir además para formar una estructura circular, sin embargo, en general se prefieren las estructuras lineales abiertas. Dentro de la estructura del oligonucleótido, los grupos fosfato se conocen comúnmente como los que forman la cadena principal As known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are purines and pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently attached to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group may be attached to the 2 ', 3' or 5 'hydroxyl moiety of the sugar. In oligonucleotide formation, phosphate groups covalently link nucleosides together, to form a linear polymeric compound. In turn, the respective ends of this linear polymeric structure can further be joined to form a circular structure, however open linear structures are generally preferred. Within the structure of the oligonucleotide, phosphate groups are commonly known as those that form the main chain
30 de internucleósidos del oligonucleótido. El enlace normal o cadena principal de ARN y ADN es un enlace fosfodiéster 3' a 5'. 30 of oligonucleotide internucleosides. The normal link or backbone of RNA and DNA is a 3 'to 5' phosphodiester bond.
Los ejemplos específicos de compuestos antisentido útiles en esta invención incluyen oligonucleótidos que contienen cadenas principales modificadas o enlaces internucleósidos no naturales. Tal y como se define en esta memoria descriptiva, los oligonucleótidos que tienen cadenas principales modificadas incluyen los que conservan un Specific examples of antisense compounds useful in this invention include oligonucleotides containing modified backbones or unnatural internucleoside linkages. As defined in this specification, oligonucleotides that have modified backbones include those that retain a
35 átomo de fósforo en la cadena principal y los que no tienen un átomo de fósforo en la cadena principal. A los efectos de esta memoria descriptiva, y a veces como referencia en la técnica, los oligonucleótidos modificados que no tienen un átomo de fósforo en su cadena principal internucleosídica, también se pueden considerar oligonucleósidos. 35 phosphorus atom in the main chain and those without a phosphorus atom in the main chain. For the purposes of this specification, and sometimes for reference in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone, can also be considered oligonucleosides.
Las cadenas principales de oligonucleótidos modificadas preferidas incluyen, por ejemplo, fosforotioatos, fosforotioatos quirales, fosforoditioatos, fosfotriésteres, aminoalquil-fosfotriésteres, fosfonatos de metilo y otros 40 alquilos incluyendo fosfonatos de 3'-alquileno, fosfonatos de 5'-alquileno y fosfonatos quirales, fosfinatos, fosforamidatos incluyendo 3'-amino-fosforamidato y aminoalquilfosforamidatos, tionofosforamidatos, tionoalquilfosfonatos, tionoalquilfosfotriésteres, selenofosfatos y boranofosfatos que tienen enlaces 3'-5' normales, análogos de estos unidos 2'-5', y aquellos que tienen polaridad inversa en la que uno o más enlaces internucleótidos es un enlace 3' a 3', 5' a 5' o 2' a 2'. Los oligonucleótidos preferidos que tienen polaridad inversa comprenden un Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl phosphonates and other 40 alkyls including 3'-alkylene phosphonates, 5'-alkylene phosphonates, and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino-phosphoramidate and aminoalkyl phosphoramidates, thionophosphoramidates, thionoalkyl phosphonates, thionoalkyl phosphotristers, selenophosphates and boranophosphates that have normal 3'-5 'linkages, and those in reverse polarity that one or more internucleotide linkages is a 3 'to 3', 5 'to 5' or 2 'to 2' link. Preferred oligonucleotides having reverse polarity comprise a
45 enlace sencillo de 3' a 3' en el enlace internucleótido más extremo 3', es decir un solo resto de nucleósido inverso que puede ser sin base (la base nucleica no está o tiene un grupo hidroxilo en su lugar). También están incluidas diferentes sales, sales mixtas u formas de ácido libre. Single 3 'to 3' bond at the most 3 'internucleotide bond, ie a single reverse nucleoside residue that may be baseless (the nucleic base is absent or has a hydroxyl group in place). Also included are different salts, mixed salts, or forms of free acid.
Las patentes de Estados Unidos representativas que enseñan la preparación de los enlaces que contienen fósforo anteriores incluyen, peso sin limitar, las patentes de EE.UU.: 3.687.808; 4.469.863; 4.476.301; 5.023.243; 5.177.196; Representative United States patents teaching the preparation of the above phosphorous-containing bonds include, without limitation, US Patents: 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196;
50 5.188.897; 5.264.423; 5.276.019; 5.278.302; 5.286.717; 5.321.131; 5.399.676; 5.405.939; 5.453.496; 5.455.233; 5.466.677; 5.476.925; 5.519.126; 5.536.821; 5.541.306; 5.550.111; 5.563.253; 5.571.799; 5.587.361; 5.194.599; 5.565.555; 5.527.899; 5.721.218; 5.672.697 y 5.625.050. 50 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050.
Las cadenas principales de oligonucleótidos modificadas que no incluyen un átomo de fósforo en las mismas tienen cadenas principales que están formadas por uniones internucleósidos de alquilo de cadena corta o cicloalquilo, 55 uniones internucleósidos de heteroátomo mixto o cicloalquilo, o una o más uniones internucleósidos heteroatómico de cadena corta o heterocíclico. Estos incluyen los que tienen uniones morfolino (formadas en parte de la parte de azúcar de un nucleósido); cadenas principales de siloxano; cadenas principales de sulfuro, sulfóxido y sulfona; cadenas principales de formacetilo y tioformacetilo; cadenas principales de metilenformacetilo y tioformacetilo; cadenas principales de riboacetilo; cadenas principales que contienen alqueno; cadenas principales de sulfamato; 60 cadenas principales de metilenimino y metilenhidrazino; cadenas principales de sulfonato y sulfonamida; cadenas Modified oligonucleotide backbones that do not include a phosphorous atom therein have backbones that consist of internucleoside linkages of short-chain alkyl or cycloalkyl, 55 internucleoside linkages of mixed or cycloalkyl heteroatoms, or one or more heteroatomic internucleoside linkages of short chain or heterocyclic. These include those that have morpholino linkages (formed in part of the sugar part of a nucleoside); siloxane backbones; main chains of sulfide, sulfoxide and sulfone; formacetyl and thioformacetyl backbones; methyleneformacetyl and thioformacetyl backbones; riboacetyl backbones; alkene-containing backbones; sulfamate backbones; 60 methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; chains
principales de amida; y otras que tienen partes con componentes N, O, S y CH2 mezclados. amide principals; and others that have parts with mixed N, O, S, and CH2 components.
Las patentes de Estados Unidos representativas que enseñan la preparación de los oligonucleósidos anteriores incluyen, peso sin limitar, las patentes de EE.UU.: 5.034.506; 5.166.315; 5.185.444; 5.214.134; 5.216.141; 5.235.033; 5.264.562; 5.264.564; 5.405.938; 5.434.257; 5.466.677; 5.470.967; 5.489.677; 5.541.307; 5.561.225; Representative United States patents that teach the preparation of the above oligonucleosides include, without limitation, US Patents: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5 5.596.086; 5.602.240; 5.610.289; 5.602.240; 5.608.046; 5.610.289; 5.618.704; 5.623.070; 5.663.312; 5.633.360; 5.677.437; 5.792.608; 5.646.269 y 5.677.439. 5 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439.
En otros miméticos de oligonucleótidos preferidos, tanto el azúcar como el enlace internucleósido, es decir, la cadena principal, de las unidades de nucleótidos se sustituyenten por grupos nuevos. Las unidades de bases se mantienen para la hibridación con un compuesto diana de ácido nucleico apropiado. Uno de dichos compuestos 10 oligómeros, un mimético de oligonucleótido que se ha mostrado que tiene excelentes propiedades de hibridación, se denonima un ácido nucleico peptídico (PNA). En los compuestos PNA, la cadena principal-azúcar de un oligonucleótido se sustituyen con una cadena principal que contiene amida, en particular una cadena principal de aminoetilglicina. Las bases nucleicas se conservan y se unen directa o indirectamente a átomos de nitrógeno aza de la parte de amida de la cadena principal. Las patentes de Estados Unidos representativas que enseñan la 15 preparación de compuestos PNA incluyen, pero sin limitar, las patentes de EE.UU.: 5.539.082; 5.714.331; y In other preferred oligonucleotide mimetics, both the sugar and the internucleoside link, ie, the backbone, of the nucleotide units are replaced by new groups. Base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomer compound, an oligonucleotide mimetic which has been shown to have excellent hybridization properties, is called a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an oligonucleotide is replaced with an amide-containing backbone, in particular an aminoethylglycine backbone. Nucleic bases are conserved and attached directly or indirectly to nitrogen atoms in the amide part of the main chain. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, US Patents: 5,539,082; 5,714,331; and
5.719.262. Se pueden encontrar enseñanzas adicionales de compuestos PNA en Nielsen et al., Science, 1991, 254, 1497-1500. 5,719,262. Additional teachings of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.
Las realizaciones más preferidas de la invención son oligonucleótidos con cadenas principales de fosforotioato y oligonucleósidos con cadenas principales con heteroátomos, y en particular -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2The most preferred embodiments of the invention are phosphorothioate backbone oligonucleotides and heteroatom backbone oligonucleosides, and in particular -CH2-NH-O-CH2-, -CH2-N (CH3) -O-CH2
20 [conocido como cadena principal de metilen(metilimino) o MMI], -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- y O-N(CH3)-CH2-CH2- [en los que la cadena principal de fosfodiéster natural está representada como -O-P-O-CH2-] en la patente de EE.UU. citadas antes 5.489.677, y las cadenas principales de amida de la patente de EE.UU. citada antes 5.602.240. También se prefieren los oligonucleótidos que tienen estructuras de cadena principal de morfolino de la patente de EE.UU. citadas antes 5.034.506. 20 [known as methylene (methylimino) backbone or MMI], -CH2-ON (CH3) -CH2-, -CH2-N (CH3) -N (CH3) -CH2- and ON (CH3) -CH2-CH2 - [in which the natural phosphodiester backbone is represented as -OPO-CH2-] in US Pat. cited above 5,489,677, and the amide backbones of US Pat. previously cited 5,602,240. Oligonucleotides having morpholino backbone structures of US Pat. cited above 5,034,506.
25 Los oligonucleótidos modificados también pueden contener uno o más restos de azúcar sustituidos. Los oligonucleótidos preferidos comprenden uno de los siguientes en la posición 2': OH; F; O-, S-, o N-alquilo; O-, S-, o N-alquenilo; O-, S- o N-alquinilo; o O-alquil-O-alquilo, en los que el alquilo, alquenilo y alquinilo pueden ser alquilo de C1 a C10 o alquenilo y alquinilo de C2 a C10 sustituidos o no sustituidos. Se prefieren en particular O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, y O(CH2)nON[(CH2)nCH3)]2, en los que n y m son de The modified oligonucleotides can also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2 'position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, where the alkyl, alkenyl and alkynyl can be C1 to C10 alkyl or substituted or unsubstituted C2 to C10 alkenyl and alkynyl. O [(CH2) nO] mCH3, O (CH2) nOCH3, O (CH2) nNH2, O (CH2) nCH3, O (CH2) nONH2, and O (CH2) nON [(CH2) nCH3)] are particularly preferred. 2, in which n and m are
30 aproximadamente 1 a aproximadamente 10. Otros oligonucleótidos preferidos comprenden uno de los siguientes en la posición 2': alquilo inferior C1 a C10, alquilo inferior sustituido, alquenilo, alquinilo, alcarilo, aralquilo, O-alcarilo o Oaralquilo, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocicloalquilo, heterocicloalcarilo, aminoalquilamino, polialquilamino, sililo sustituido, un grupo de escisión de ARN, un grupo indicador, un intercalante, un grupo para mejorar las propiedades farmacocinéticas de un oligonucleótido, o un grupo About 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2 'position: C1-C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or Oaralkyl, SH, SCH3, OCN , Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an indicator group, an intercalant, a group to improve the pharmacokinetic properties of an oligonucleotide, or a group
35 para mejorar las propiedades farmacodinámicas de un oligonucleótido, y otros sustituyentes que tienen propiedades similares. Una modificación preferida incluye 2'-metoxietoxi (2'-O-CH2CH2OCH3, también conocida como 2'-O-(2metoxietil) o 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) es decir, un grupo alcoxialcoxi. Una modificación preferida adicional incluye 2'-dimetilaminooxietoxi, es decir un grupo O(CH2)2ON(CH3)2, también conocido como 2'-DMAOE, como se describe en los ejemplos a continuación, y 2'-dimetilaminoetoxietoxi (también 35 to improve the pharmacodynamic properties of an oligonucleotide, and other substituents that have similar properties. A preferred modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O- (2methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486 -504) ie, an alkoxyalkoxy group. A further preferred modification includes 2'-dimethylaminooxyethoxy, i.e. an O (CH2) 2ON (CH3) 2 group, also known as 2'-DMAOE, as described in the examples below, and 2'-dimethylaminoethoxyethoxy (also
40 conocido en la técnica como 2'-O-dimetilaminoetoxietilo o 2'-DMAEOE), es decir, 2'-O-CH2-O-CH2-N(CH2)2, también descrito en los ejemplos a continuación. Known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e. 2'-O-CH2-O-CH2-N (CH2) 2, also described in the examples below.
Una modificación preferida adicional incluye ácidos nucleicos bloqueados (LNA) en los que el grupo 2'-hidroxilo está unido al átomo de carbono 3' o 4' del anillo de azúcar formando así un resto de azúcar bicíclico. La unión preferiblemente es un grupo metileno (-CH2-)n que forma puente con el átomo de oxígeno en 2' y el átomo de A further preferred modification includes blocked nucleic acids (LNA) in which the 2'-hydroxyl group is attached to the 3 'or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene (-CH2-) n group that bridges the 2 'oxygen atom and the
45 carbono en 4' en el que n es 1 ó 2. Los LNA y su preparación se describe en el documento WO 98/39352 y WO 99/14226. The 4 'carbon where n is 1 or 2. LNAs and their preparation are described in WO 98/39352 and WO 99/14226.
Otras modificaciones preferidas incluyen 2'-metoxi (2'-O-CH3), 2'-aminopropoxi (2'-OCH2CH2CH2NH2), 2'-alilo (2'-CH2-CH=CH2), 2'-O-alilo (2'-O-CH2-CH=CH2) y 2'-fluoro (2'-F). La modificación en 2' puede estar en la posición arabino (superior) o la posición ribo (inferior). Una modificación en 2'-arabino preferida es 2'-F. También se pueden 50 hacer modificaciones similares en otras posiciones en el oligonucleótido, en particular en la posición 3' del azúcar en el nucleótido 3' terminal o en los oligonucleótidos unidos 2'-5' y la posición 5' del nucleótido 5' terminal. Los oligonucleótidos también pueden tener miméticos de azúcares tales como restos ciclobutilo en lugar el azúcar pentafuranosilo. Las patentes de Estados Unidos representativas que enseñan la preparación de dichas estructuras de azúcar modificadas incluyen, pero sin limitar, las patentes de EE.UU.: 4.981.957; 5.118.800; 5.319.080; Other preferred modifications include 2'-methoxy (2'-O-CH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), 2'-allyl (2'-CH2-CH = CH2), 2'-O-allyl ( 2'-O-CH2-CH = CH2) and 2'-fluoro (2'-F). The 2 'modification may be in the arabino (top) position or the ribo (bottom) position. A preferred 2'-arabino modification is 2'-F. Similar modifications can also be made at other positions on the oligonucleotide, particularly at the 3 'position of the sugar at the 3' terminal nucleotide or at the 2'-5 'linked oligonucleotides and the 5' position of the 5 'terminal nucleotide. Oligonucleotides can also have sugar mimetics such as cyclobutyl residues instead of pentafuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, US Patents: 4,981,957; 5,118,800; 5,319,080;
55 5.359.044; 5.393.878; 5.446.137; 5.466.786; 5.514.785; 5.519.134; 5.567.811; 5.576.427; 5.591.722; 5.597.909; 5.610.300; 5.627.053; 5.639.873; 5.646.265; 5.658.873; 5.670.633; 5.792.747; y 5.700.920. 55 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920.
Los oligonucleótidos también pueden incluir modificaciones o sustituciones de bases nucleicas (denominadas frecuentemente en la técnica simplemente como "bases"). Tal y como se emplea en la presente memoria, las bases nucleicas "no modificadas" o "naturales" incluyen las bases púricas adenina (A) y guanina (G), y las bases 60 pirimidínicas timina (T), citosina (C) y uracilo (U). Las bases nucleicas modificadas incluyen otras bases nucleicas naturales o sintéticas tales como 5-metilcitosina (5-me-C), 5-hidroximetil-citosina, xantina, hipoxantina, 2aminoadenina, derivados 6-metilo y otros alquilo de adenina y guanina, derivados 2-propilo y otros alquilo de adenina y guanina, 2-tiouracilo, 2-tiotimina y 2-tiocitosina, 5-halogenouracilo y citosina, derivados 5-propinilo (-C≡C-CH3) de uracilo y citosina y otros derivados de alquinilo de bases pirimidínicas, 6-azo-uracilo, citosina y timina, 55 uracilo (pseudouracilo), 4-tiouracilo, 8-halógeno, 8-amino, 8-tiol, 8-tioalquilo, 8-hidroxilo y otras 8-sustituidas adeninas y guaninas, 5-halógeno en particular 5-bromo, 5-trifluorometilo y otros 5-sustituido uracilos y citosinas, 7metilguanina y 7-metiladenina, 2-F-adenina, 2-amino-adenina, 8-azaguanina y 8-azaadenina, 7-desazaguanina y 7desazaadenina y 3-deaazaguanina y 3-desazaadenina. Las bases nucleicas modificadas adicionales incluyen pirimidinas tricícicas tales como fenoxazina-citidina (1H-pirimido[5,4-b][1,4]benzoxazin-2(3H)-ona), fenotiazinacitidina (1H-pirimido[5,4-b][1,4]benzotiazin-2(3H)-ona), pinzas G tales como una fenoxazina-citidina sustituida (p. ej. 9-(2-aminoetoxi)-H-pirimido[5,4-b][1,4]benzoxazin-2(3H)-ona), carbazol-citidina (2H-pirimido[4,5-b]indol-2-ona), piridoindol-citidina (H-pirido[3',2':4,5]pirrolo[2,3-d]pirimidin-2-ona). Las bases nucleicas modificadas también pueden incluir aquellas en las que la base púrica o pirimidínica es sustituida por otros heterociclos, por ejemplo, 7-desazaadenina, 7-desazaguanosina, 2-aminopiridina y 2-piridona. Ácidos nucleicos adicionales incluyen los descritos en la 15 patente de EE.UU. nº 3.687.808, los descritos en The Concise Enciclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, aquellos descritos por Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, y aquellos descritos por Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B., ed., CRC Press, 1993. Algunos de estas bases nucleicas son particularmente útiles para aumentar la afinidad de unión de los compuestos oligómeros de la invención. Estas incluyen pirimidinas 5-sustituidas, 6-azapirimidinas y purinas N-2, N-6 y O-6 sustituidas, incluyendo 2-aminopropiladenina, 5-propiniluracilo y 5-propinilcitosina. Se ha mostrado que las sustituciones 5-metilcitosina aumentan la estabilidad del ácido nucleico dúplex en 0,6-1,2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) y actualmente son las sustituciones de bases preferidas, incluso más en particular cuando se combinan con modificaciones 2'-OOligonucleotides can also include nucleic base modifications or substitutions (often referred to in the art simply as "bases"). As used herein, "unmodified" or "natural" nucleic bases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleic bases include other natural or synthetic nucleic bases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl-cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, derivatives 2 -propyl and other alkyls of adenine and guanine, 2-thiouracil, 2-thiothimine and 2-thiocytosine, 5-halogenouracil and cytosine, 5-propynyl (-C≡C-CH3) derivatives of uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo-uracil, cytosine, and thymine, 55 uracil (pseudouracil), 4-thiouracil, 8-halogen, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines , 5-halogen in particular 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7- desazaguanine and 7desazaadenine and 3-deaazaguanine and 3-deazaadenine. Additional modified nucleic bases include tricyclic pyrimidines such as phenoxazine-cytidine (1H-pyrimido [5.4-b] [1,4] benzoxazin-2 (3H) -one), phenothiazinacytidine (1H-pyrimido [5.4-b ] [1,4] benzothiazin-2 (3H) -one), G forceps such as a substituted phenoxazine-cytidine (eg 9- (2-aminoethoxy) -H-pyrimido [5,4-b] [1 , 4] benzoxazin-2 (3H) -one), carbazol-cytidine (2H-pyrimido [4,5-b] indole-2-one), pyridoindol-cytidine (H-pyrido [3 ', 2': 4, 5] pyrrolo [2,3-d] pyrimidin-2-one). Modified nucleic bases can also include those in which the puric or pyrimidine base is replaced by other heterocycles, for example, 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Additional nucleic acids include those described in US Pat. No. 3,687,808, those described in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those described by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those described by Sanghvi, YS, Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., ed., CRC Press, 1993. Some of these nucleic bases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase duplex nucleic acid stability by 0.6-1.2 ° C (Sanghvi, YS, Crooke, ST and Lebleu, B., eds., Antisense Research and Applications, CRC Press , Boca Raton, 1993, pp. 276-278) and are currently the preferred base substitutions, even more particularly when combined with 2'-O modifications
25 metoxietilo en el azúcar. 25 methoxyethyl in sugar.
Las patentes de Estados Unidos representativas que enseñan la preparación de las bases nucleicas indicadas antes, así como otras bases nucleicas modificadas incluyen, pero sin limitar, la patente de EE.UU. 3.687.808 indicada antes, así como las patentes de EE.UU.: 4.845.205; 5.130.302; 5.134.066; 5.175.273; 5.367.066; 5.432.272; 5.457.187; 5.459.255; 5.484.908; 5.502.177; 5.525.711; 5.552.540; 5.587.469; 5.594.121. 5.596.091. 5.614.617; 5.645.985; 5.830.653; 5.763.588; 6.005.096; y 5.681.941, y patente de Estados Unidos 5.750.692. Representative United States patents that teach the preparation of the nucleic bases indicated above, as well as other modified nucleic bases include, but are not limited to, US Pat. 3,687,808 indicated above, as well as US Patents: 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121. 5,596,091. 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, and U.S. Patent 5,750,692.
Otra modificación de los oligonucleótidos de la invención implica la unión química al oligonucleótido de uno o más restos o conjugados que potencian la actividad, distribución celular o captación celular del oligonucleótido. Los compuestos de la invención pueden incluir grupos conjugados unidos covalentemente a grupos funcionales tales como grupos hidroxilo primarios o secundarios. Los grupos conjugados de la invención incluyen intercalantes, 35 moléculas indicadoras, poliaminas, poliamidas, polietilenglicoles, poliéteres, grupos que potencian las propiedades farmacodinámicas de los oligómeros, y grupos que potencian las propiedades farmacocinéticas de los oligómeros. Los grupos conjugados típicos incluyen colesteroles, lípidos, fosfolípidos, biotina, fenazina, folato, fenantridina, antraquinona, acridina, fluoresceínas, rodaminas, cumarinas y colorantes. Los grupos que potencian las propiedades farmacodinámicas, en el contexto de esta invención, incluyen grupos que mejoran la captación de oligómeros, potencian la resistencia de los oligómeros a la degradación, y/o refuerzan la hibridación específica de secuencia con el ARN. Los grupos que potencian las propiedades farmacocinéticas, en el contexto de esta invención, incluyen grupos que mejoran la captación del oligómero, distribución, metabolismo o excreción. Los grupos conjugados representativos se describen en la solicitud de patente internacional PCT/US92/09196, presentada el 23 de octubre, 1992. Los restos conjugados incluyen, pero sin limitar, restos lipídicos tales como un resto de colesterol (Letsinger et 45 al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), ácido cólico (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), un tioéter, p. ej., hexil-S-tritiltiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), un tiocolesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), una cadena alifática, p. ej., restos dodecanodiol o undecilo (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), un fosfolípido, p. ej., di-hexadecil-rac-glicerol o trietilamonio 1,2-di-O-hexadecil-rac-glicero-3-H-fosfonato (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), una poliamina o una cadena de polietilenglicol (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), o ácido adamantano-acético (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), un resto palmitilo (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), o un resto octadecilamina o hexilaminocarbonil-oxicolesterol (Crooke Another modification of the oligonucleotides of the invention involves chemical binding to the oligonucleotide of one or more residues or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. The compounds of the invention can include conjugated groups covalently linked to functional groups such as primary or secondary hydroxyl groups. The conjugated groups of the invention include intercalating, 35 reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of the oligomers, and groups that enhance the pharmacokinetic properties of the oligomers. Typical conjugated groups include cholesterol, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance pharmacodynamic properties, in the context of this invention, include groups that enhance oligomer uptake, enhance resistance of oligomers to degradation, and / or enhance sequence-specific hybridization to RNA. Groups that enhance pharmacokinetic properties, in the context of this invention, include groups that enhance oligomer uptake, distribution, metabolism, or excretion. Representative conjugated groups are described in international patent application PCT / US92 / 09196, filed October 23, 1992. Conjugated residues include, but are not limited to, lipid residues such as a cholesterol residue (Letsinger et 45 al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, p. eg, hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765- 2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g. eg, dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie , 1993, 75, 49-54), a phospholipid, e.g. eg, di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycerol-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane-acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl residue (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylaminocarbonyl- residue. oxycholesterol (Crooke
55 et al., J. Pharmacol. Exp. Ther. , 1996, 277, 923-937). Los oligonucleótidos de la invención también se pueden conjugar con sustancias que son fármacos activos, por ejemplo, aspirina, warfarina, fenilbutazona, ibuprofeno, suprofeno, fenbufeno, ketoprofeno, (S)-(+)-pranoprofeno, carprofeno, dansilsarcosina, ácido 2,3,5-triyodobenzoico, ácido flufenámico, ácido folínico, una benzotiadiazida, clorotiazida, una diazepina, indometicina, un barbitúrico, una cefalosporina, un fármaco sulfa, un antidiabético, un antibacteriano o un antibiótico. Los conjugados de oligonucleótido-fármaco y su preparación se describen en la solicitud de patente de Estados Unidos 09/334,130 (presentada el 15 de junio, 1999). 55 et al., J. Pharmacol. Exp. Ther. , 1996, 277, 923-937). The oligonucleotides of the invention can also be conjugated with substances that are active drugs, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S) - (+) - pranoprofen, carprofen, dansylsarcosine, acid 2, 3,5-triiodobenzoic, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicine, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in US patent application 09 / 334,130 (filed June 15, 1999).
Las patentes de Estados Unidos representativas que enseñan la preparación de dichos conjugados de oligonucleótidos incluyen, peso sin limitar, las patentes de EE.UU.: 4.828.979; 4.948.882; 5.218.105; 5.525.465; Representative United States patents that teach the preparation of such oligonucleotide conjugates include, without limitation, US Patents: 4,828,979; 4,948,882; 5,218,105; 5,525,465;
5.541.313; 5.545.730; 5.552.538; 5.578.717. 5.580.731. 5.580.731; 5.591.584; 5.109.124; 5.118.802; 5.138.045; 5.414.077; 5.486.603; 5.512.439; 5.578.718; 5.608.046; 4.587.044; 4.605.735; 4.667.025; 4.762.779; 4.789.737; 4.824.941; 4.835.263; 4.876.335; 4.904.582; 4.958.013; 5.082.830; 5.112.963; 5.214.136; 5.082.830; 5.112.963; 5.214.136; 5.245.022; 5.254.469; 5.258.506; 5.262.536; 5.272.250; 5.292.873; 5.317.098; 5.371.241. 5.391.723. 5,541,313; 5,545,730; 5,552,538; 5,578,717. 5,580,731. 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241. 5,391,723.
5.416.203. 5.451.463. 5.510.475; 5.512.667; 5.514.785; 5.565.552; 5.567.810; 5.574.142; 5.585.481; 5.587.371; 5.595.726; 5.597.696; 5.599.923; 5.599.928 y 5.688.941. 5,416,203. 5,451,463. 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.
No es necesario que todas las posiciones en un compuesto dado sean modificadas de forma uniforme, y se puede incorporaran más de una de las modificaciones mencionadas antes en un solo compuesto o incluso en un solo nucleósido en un oligonucleótido. La presente invención también incluye compuestos antisentido que son compuestos quiméricos. Compuestos antisentido "quiméricos" o "quimeras", en el contexto de esta invención, son compuestos antisentido, en particular oligonucleótidos, que contienen dos o más regiones químicamente distintas, cada una compuesta de al menos una unidad monomérica, es decir, un nucleótido en el caso de un compuesto oligonucleótido. Estos oligonucleótidos contienen típicamente al menos una región en la que el oligonucleótido se modifica de modo que confiere al oligonucleótido una resistencia incrementada frente a la degradación con nucleasas, una mayor captación celular y/o un aumento de la afinidad de la unión con el ácido nucleico diana. Una región adicional del oligonucleótido puede servir como sustrato para enzimas capaces de escindir ARN:ADN o híbridos de ARN:ARN. A modo de ejemplo, la ARNasa H es una endonucleasa celular que escinde la cadena de ARN de un dúplex de ARN:ADN. Por lo tanto, la activación de la RNasa H, produce la escisión del ARN diana, potenciando así mucho la eficacia de la inhibición de la expresión génica por el oligonucleótido. Por consiguiente, a menudo se pueden obtener resultados comparables con oligonucleótidos más cortos cuando se usan oligonucleótidos quiméricos, comparado con fosforotioatos de desoxioligonucleótidos que hibridan con la misma región diana. La escisión del ARN diana se puede detectar rutinariamente mediante electroforesis en gel y, si es necesario, técnicas asociadas de hibridación de ácidos nucleicos, conocidas en la técnica. It is not necessary that all positions in a given compound be uniformly modified, and more than one of the aforementioned modifications can be incorporated into a single compound or even a single nucleoside in an oligonucleotide. The present invention also includes antisense compounds that are chimeric compounds. In the context of this invention, "chimeric" or "chimera" antisense compounds are antisense compounds, in particular oligonucleotides, that contain two or more chemically distinct regions, each consisting of at least one monomer unit, that is, a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region in which the oligonucleotide is modified so that it gives the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity for nucleic acid. Diana. An additional region of the oligonucleotide can serve as a substrate for enzymes capable of cleaving RNA: DNA or RNA: RNA hybrids. As an example, RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA: DNA duplex. Therefore, activation of RNase H results in cleavage of the target RNA, thereby greatly enhancing the efficacy of inhibition of gene expression by the oligonucleotide. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to deoxyoligonucleotide phosphorothioates that hybridize to the same target region. Cleavage of the target RNA can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
Los compuestos antisentido quiméricos de la invención se pueden formar como estructuras compuestas de dos o más oligonucleótidos, oligonucleótidos modificados, oligonucleósidos y/o miméticos de oligonucleótidos como se ha descrito anteriormente. Dichos compuestos también se han denominado en la técnica híbridos o gápmeros. Documentos de patentes representativas de Estados Unidos que describen la preparación de dichas estructuras híbridas incluyen, pero no se limitan a: 5.013.830; 5.149.797; 5.220.007; 5.256.775; 5.366.878; 5.403.711; 5.491.133; 5.565.350; 5.623.065; 5.652.355; 5.652.356; y 5.700.922. The chimeric antisense compounds of the invention can be formed as structures consisting of two or more oligonucleotides, modified oligonucleotides, oligonucleosides, and / or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gammers. Representative United States patent documents that describe the preparation of such hybrid structures include, but are not limited to: 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922.
Los compuestos antisentido usados de acuerdo con esta invención se pueden preparar convenientemente y de manera rutinaria mediante la técnica bien conocida de síntesis en fase sólida. El equipo para dicha síntesis se puede obtener de varios vendedores que incluyen, por ejemplo, Applied Biosystems (Foster City, CA). Se puede emplear adicional o alternativamente cualquier otro medio para dicha síntesis conocido en la técnica. Es bien conocido el uso de técnicas similares para preparar oligonucleótidos tales como los fosforotioatos y los derivados alquilados. Antisense compounds used in accordance with this invention can be conveniently and routinely prepared by the well-known technique of solid phase synthesis. Equipment for such synthesis can be obtained from various vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may be used additionally or alternatively. The use of similar techniques to prepare oligonucleotides such as phosphorothioates and alkylated derivatives is well known.
Los compuestos antisentido de la invención se sintetizan in vitro y no incluyen composiciones de compuestos antisentido de origen biológico, o construcciones de vectores genéticos diseñadas para dirigir la síntesis in vivo de moléculas antisentido. The antisense compounds of the invention are synthesized in vitro and do not include compositions of biologically derived antisense compounds, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.
Los compuestos de la invención también se pueden mezclar, encapsular, conjugar o asociar de otra forma con otras moléculas, estructuras de moléculas o mezclas de compuestos, tal como por ejemplo, liposomas, moléculas dirigidas al receptor, formulaciones por vía oral, rectal, tópica u otras, para ayudar a la captación, distribución y/o absorción. Las patentes de Estados Unidos representativas que enseñan la preparación de dichas formulaciones que ayudan a la captación, distribución y/o absorción incluyen, pero sin limitar, las patentes de EE.UU.: 5.108.921; 5.354.844; 5.416.016; 5.459.127; 5.521.291; 5.543.158; 5.547.932; 5.583.020; 5.591.721; 4.426.330; 4.534.899; 5.013.556; 5.108.921; 5.213.804; 5.227.170; 5.264.221; 5.356.633; 5.395.619; 5.416.016; 5.417.978; 5.462.854; 5.469.854; 5.512.295; 5.527.528; 5.534.259; 5.543.152; 5.556.948; 5.580.575; y 5.595.756. The compounds of the invention may also be mixed, encapsulated, conjugated, or otherwise associated with other molecules, molecule structures, or mixtures of compounds, such as, for example, liposomes, receptor-directed molecules, oral, rectal, and topical formulations. or others, to help the capture, distribution and / or absorption. Representative United States patents that teach the preparation of such uptake, distribution and / or absorption aids include, but are not limited to, US Patents: 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756.
Los compuestos antisentido de la invención abarcan cualquier sal, éster o sal de dicho éster o cualquier otro compuesto farmacéuticamente aceptable, que tras la administración a un animal, incluyendo un ser humano, es capaz de proporcionar (directa o indirectamente) el metabolito biológicamente activo o resto del mismo. Por consiguiente, por ejemplo, la descripción señala también profármacos y sales farmacéuticamente aceptables de los compuestos de la invención, sales farmacéuticamente aceptables de dichos profármacos, y otros bioequivalentes. The antisense compounds of the invention encompass any salt, ester or salt of said ester or any other pharmaceutically acceptable compound, which upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or rest of it. Accordingly, for example, the description also discloses prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of said prodrugs, and other bioequivalents.
El término "profármaco" indica un agente terapéutico que se prepara en una forma inactiva y que se convierte en una forma activa (es decir, fármaco) dentro del cuerpo, o de sus células, por la acción de enzimas endógenas u otros productos químicos y/o condiciones. En particular, las versiones de profármacos de los oligonucleótidos de la invención se preparan como derivados de SATE [(S-acetil-2-tioetil)fosfato] de acuerdo con los métodos descritos en el documento WO 93/24510 de Gosselin et al., publicado el 9 de diciembre 1993 o en los documentos WO 94/26764 y U.S 5.770.713 de Imbach et al. The term "prodrug" indicates a therapeutic agent that is prepared in an inactive form and that is converted to an active form (ie, drug) within the body, or its cells, by the action of endogenous enzymes or other chemicals, and / or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods described in WO 93/24510 of Gosselin et al., published December 9, 1993 or in WO 94/26764 and US 5,770,713 to Imbach et al.
La expresión "sales farmacéuticamente aceptables" se refiere a sales fisiológica y farmacéuticamente aceptables de los compuestos de la invención: es decir, sales que conservan la actividad biológica deseada del compuesto original y no confieren efectos toxicológicos no deseados al mismo. The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: that is, salts that retain the desired biological activity of the original compound and do not confer undesired toxicological effects thereto.
Las sales de adición de base farmacéuticamente aceptables se forman con metales o aminas, tales como metales alcalinos y alcalinotérreos o aminas orgánicas. Los ejemplos de metales usados como cationes son sodio, potasio, magnesio, calcio y similares. Los ejemplos de aminas adecuadas son N,N'-dibenciletilendiamina, cloroprocaína, colina, dietanolamina, diciclohexilamina, etilendiamina, N-metilglucamina, y procaína (véase, por ejemplo, Berge et 5 al., "Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19). Las sales de adición de base de dichos compuestos ácidos se preparan poniendo en contacto la forma de ácido libre con una cantidad suficiente de la base deseada para producir la sal en la forma convencional. La forma de ácido libre se puede regenerar poniendo en contacto la forma de sal con un ácido y aislando el ácido libre de la forma convencional. Las formas de ácido libre difieren algo de sus respectivas formas de sal en algunas propiedades físicas tales como la solubilidad en disolventes polares, pero por lo demás las sales son equivalentes a sus respectivos ácidos libres para los propósitos de la presente invención. Como se usa en la presente memoria, una "sal de adición farmacéuticamente" incluye una sal farmacéuticamente aceptable de una forma ácida de uno de los componentes de las composiciones de la invención. Estas incluyen sales de ácidos orgánicos e inorgánicos de las aminas. Las sales de ácido preferidas son hidrocloruros, acetatos, salicilatos, nitratos y fosfatos. Otras sales farmacéuticamente aceptables son bien conocidas 15 para los expertos en la técnica, e incluyen sales básicas de una variedad de ácidos inorgánicos y orgánicos, tales como, por ejemplo, con ácidos inorgánicos, tales como, por ejemplo ácido clorhídrico, ácido bromhídrico, ácido sulfúrico o ácido fosfórico; con ácidos orgánicos carboxílicos, sulfónicos, sulfo o fosfo, o ácidos sulfámicos Nsustituidos, por ejemplo, ácido acético, ácido propiónico, ácido glicólico, ácido succínico, ácido maleico, ácido hidroximaleico, ácido metilmaleico, ácido fumárico, ácido málico, ácido tartárico, ácido láctico, ácido oxálico, ácido glucónico, ácido glucárico, ácido glucurónico, ácido cítrico, ácido benzoico, ácido cinámico, ácido mandélico, ácido salicílico, ácido 4-aminosalicíclico, ácido 2-fenoxibenzoico, ácido 2-acetoxibenzoico, ácido enbónico, ácido nicotínico Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium, and the like. Examples of suitable amines are N, N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, eg, Berge et 5 al., "Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19). The base addition salts of such acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional way. The free acid form can be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional way. The free acid forms differ somewhat from their respective salt forms in some physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acids for the purposes of the present invention. As used herein, a "pharmaceutically added salt" includes a pharmaceutically acceptable salt of an acidic form of one of the components of the compositions of the invention. These include organic and inorganic acid salts of the amines. Preferred acid salts are hydrochlorides, acetates, salicylates, nitrates, and phosphates. Other pharmaceutically acceptable salts are well known to those skilled in the art, and include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as, for example, hydrochloric acid, hydrobromic acid, acid sulfuric or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids, or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, acid lactic, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, enbonic acid, nicotinic acid
o ácido isonicotínico; con aminoácidos, tales como los 20 alfa-aminoácidos implicados en la síntesis de proteínas en la naturaleza, por ejemplo ácido glutámico o ácido aspártico, y también ácido fenilacético, ácido metanosulfónico, ácido etanosulfónico, ácido 2-hidroxietanosulfónico, ácido etano-1,2-disulfónico, ácido bencenosulfónico, ácido 4or isonicotinic acid; with amino acids, such as the 20 alpha-amino acids involved in the synthesis of proteins in nature, for example glutamic acid or aspartic acid, and also phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, ethane-1,2 acid -disulfonic, benzenesulfonic acid, acid 4
25 metilbencenosulfónico, ácido naftaleno-2-sulfónico, ácido naftaleno-1,5-disulfónico, 2- o 3-fosforoglicerato, glucosa6-fosfato, ácido N-ciclohexilsulfámico (con la formación de ciclamatos), o con otros compuestos orgánicos ácidos, tales como ácido ascórbico. Las sales farmacéuticamente aceptables de los compuestos también se pueden preparar con un catión farmacéuticamente aceptable. Los cationes farmacéuticamente aceptables son bien conocidos para los expertos en la técnica, e incluyen cationes alcalinos, alcalinotérreos, de amonio y amonio cuaternario. También son posibles los carbonatos e hidrogenocarbonatos. 25 methylbenzenesulfonic, naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or 3-phosphoroglycerate, glucose6-phosphate, N-cyclohexylsulfamic acid (with the formation of cyclamates), or with other acidic organic compounds, such as ascorbic acid. The pharmaceutically acceptable salts of the compounds can also be prepared with a pharmaceutically acceptable cation. Pharmaceutically acceptable cations are well known to those skilled in the art, and include alkali, alkaline earth, ammonium, and quaternary ammonium cations. Carbonates and hydrogencarbonates are also possible.
Para los oligonucleótidos, los ejemplos preferidos de sales farmacéuticamente aceptables incluyen pero no se limitan a (a) sales formadas con cationes tales como sodio, potasio, amonio, calcio, magnesio, poliaminas tales como espermina y espermidina, etc.; (b) sales de adición de ácido formadas con ácidos inorgánicos, por ejemplo, ácido clorhídrico, ácido bromhídrico, ácido sulfúrico, ácido fosfórico, ácido nítrico y similares; (c) sales formadas con For oligonucleotides, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, calcium, magnesium, polyamines such as spermine and spermidine, etc .; (b) acid addition salts formed with inorganic acids, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like; (c) salts formed with
35 ácidos orgánicos tales como, por ejemplo, ácido acético, ácido oxálico, ácido tartárico, ácido succínico, ácido maleico, ácido fumárico, ácido glucónico, ácido cítrico, ácido málico, ácido ascórbico, ácido benzoico, ácido tánico, ácido palmítico, ácido algínico, ácido poliglutámico, ácido naftalenosulfónico, ácido metanosulfónico, ácido ptoluenosulfónico, ácido naftalenodisulfónico, ácido poligalacturónico, y similares; y (d) sales formadas a partir de aniones elementales tales como cloro, bromo y yodo. Organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid , polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, ptoluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine.
Los compuestos antisentido de la presente invención se pueden usar para el diagnóstico, tratamiento terapéutico, profiláctico y como reactivos y kits de investigación. Para tratamientos terapéuticos, un animal, preferiblemente un ser humano que se sospecha que tiene una enfermedad o trastorno que se puede tratar por modulación de la expresión de la apolipoproteína B, se trata por administración de compuestos antisentido de acuerdo con esta invención. Los compuestos de la invención se pueden usar en composiciones farmacéuticas añadiendo una cantidad The antisense compounds of the present invention can be used for diagnosis, therapeutic, prophylactic treatment and as reagents and research kits. For therapeutic treatments, an animal, preferably a human who is suspected of having a disease or disorder that can be treated by modulation of apolipoprotein B expression, is treated by administration of antisense compounds in accordance with this invention. The compounds of the invention can be used in pharmaceutical compositions by adding an amount
45 eficaz de un compuesto antisentido a un diluyente o vehículo farmacéuticamente aceptable adecuado. El uso de los compuestos antisentido y los métodos de la invención también pueden ser útiles de forma profiláctica, p. ej., para prevenir o retrasar la infección, inflamación o formación de tumor, por ejemplo. Effectiveness of an antisense compound to a suitable pharmaceutically acceptable diluent or vehicle. The use of antisense compounds and the methods of the invention may also be useful prophylactically, e.g. eg, to prevent or delay infection, inflammation, or tumor formation, for example.
Los compuestos antisentido de la invención son útiles para la investigación y el diagnóstico, porque estos compuestos hibridan con ácidos nucleicos que codifican la apolipoproteína B, permitiendo construir fácilmente los ensayos de tipo sándwich y otros ensayos para explotar este hecho. La hibridación de los oligonucleótidos antisentido de esta invención con un ácido nucleico que codifica la apolipoproteína B, se puede detectar por medios conocidos en la técnica. Dichos medios pueden incluir la conjugación de una enzima al oligonucleótido, radiomarcaje del oligonucleótido o cualquier otro medio de detección adecuado. También se pueden preparar kits que usan dichos medios de detección para detectar el nivel de apolipoproteína B en una muestra. The antisense compounds of the invention are useful for research and diagnosis, because these compounds hybridize to nucleic acids encoding apolipoprotein B, making it possible to easily construct sandwich-type assays and other assays to exploit this fact. Hybridization of the antisense oligonucleotides of this invention with a nucleic acid encoding apolipoprotein B can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide, or any other suitable detection means. Kits can also be prepared using such detection means to detect the level of apolipoprotein B in a sample.
55 La presente invención también incluye composiciones farmacéuticas y formulaciones que incluyen compuestos antisentido de la invención. Las composiciones farmacéuticas de la presente invención se pueden administrar en una serie de formas dependiendo de si se desea tratamiento local o sistémico y de la zona que se va a tratar. La administración puede ser tópica (incluyendo oftálmica y en membranas mucosas incluyendo el suministro vaginal y rectal), pulmonar, p. ej., por inhalación o insuflación de polvos o aerosoles, incluyendo con nebulizador; intratraqueal, intranasal, epidérmica y transdérmica), oral o parenteral. La administración parenteral incluye inyección o infusión intravenosa, intraaerterial, subcutánea, intraperitoneal o intramuscular; o administración intracraneal, p. ej., intratecal The present invention also includes pharmaceutical compositions and formulations including antisense compounds of the invention. The pharmaceutical compositions of the present invention can be administered in a number of ways depending on whether local or systemic treatment is desired and the area to be treated. Administration can be topical (including ophthalmic and on mucous membranes including vaginal and rectal delivery), pulmonary, e.g. eg, by inhalation or insufflation of powders or aerosols, including with nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraaerterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; or intracranial administration, e.g. eg, intrathecal
o intraventricular. Se cree que los oligonucleótidos con al menos una modificación 2'-O-metoxietilo son particularmente útiles para la administración oral. or intraventricular. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration.
Las composiciones farmacéuticas y formulaciones para la administración tópica pueden incluir parches intradérmicos, pomadas, lociones, cremas, geles, gotas, supositorios, pulverizadores, líquidos y polvos. Los vehículos farmacéuticos convencionales, bases acuosas, en polvo u oleosas, espesantes y similares pueden ser necesarios o convenientes. También pueden ser útiles los preservativos recubiertos, guantes y similares. Las 5 formulaciones típicas preferidas incluyen aquellas en las que los oligonucleótidos de la invención están mezclados con un agente de suministro tópico tal como lípidos, liposomas, ácidos grasos, ésteres de ácidos grasos, esteroides, agentes de quelación y tensioactivos. Los lípidos y liposomas preferidos incluyen los neutros (p. ej. dioleoilfosfatidiletanolamina DOPE, dimiristoilfosfatidil-colina DMPC, diestearoilfosfatidil-colina), negativos (p. ej. dimiristoilfosfatidilglicerol DMPG) y catiónicos (p. ej. dioleoiltetrametilaminopropilo DOTAP y dioleoilfosfatidil-etanolamina DOTMA). Los oligonucleótidos de la invención se pueden encapsular en liposomas o pueden formar complejos con los mismos, en particular con liposomas catiónicos. Alternativamente, los oligonucleótidos pueden formar complejos con lípidos, en particular con lípidos catiónicos. Los ácidos grasos y ésteres preferidos incluyen, pero sin limitar, ácido araquidónico, ácido oleico, ácido eicosanoico, ácido láurico, ácido caprílico, ácido cáprico, ácido mirístico, ácido palmítico, ácido esteárico, ácido linoleico, ácido linolénico, dicaprato, tricaprato, monooleína, dilaurina, gliceril-1Pharmaceutical compositions and formulations for topical administration may include intradermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powdered or oily bases, thickeners, and the like may be necessary or convenient. Coated condoms, gloves, and the like may also be useful. Typical 5 preferred formulations include those in which the oligonucleotides of the invention are mixed with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Preferred lipids and liposomes include neutrals (eg, dioleoylphosphatidylethanolamine DOPE, dimethystoylphosphatidylcholine DMPC, distearoylphosphatidylcholine), negative (eg, dimethylaphosphatidyl-dimethylaphylotropyl-diolethyl-ethoyl-ylothioyl-diolyl-diolethylatropyloyl-diolethylpyrolyl)), and cationic (eg. . The oligonucleotides of the invention can be encapsulated in liposomes or complexed therewith, in particular with cationic liposomes. Alternatively, the oligonucleotides can complex with lipids, in particular with cationic lipids. Preferred fatty acids and esters include, but are not limited to, arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein , dilaurin, glyceryl-1
15 monocaprato, 1-dodecilazacicloheptan-2-ona, una acilcarnitina, una acilcolina, o un éster de alquilo C1-10 (p. ej. miristato de isopropilo IPM), monoglicérido, diglicérico o sus sales farmacéuticamente aceptables. Las formulaciones tópicas se describen en detalle en la solicitud de patente de Estados Unidos 09/315.298 presentada el 20 de mayo, 1999. Monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C1-10 alkyl ester (eg isopropyl myristate IPM), monoglyceride, diglycerol or its pharmaceutically acceptable salts. Topical formulations are described in detail in US Patent Application 09 / 315,298 filed on May 20, 1999.
Las composiciones y formulaciones para la administración oral incluyen polvos o gránulos, micropartículas, nanopartículas, suspensiones o disoluciones en agua o medio no acuoso, cápsulas, cápsulas de gel, sobres, comprimidos o minicomprimidos. Pueden ser convenientes los espesantes, agentes de sabor, diluyentes, emulsionantes, ayudantes de dispersión o aglutinantes. Las formulaciones orales preferidas son aquellas en las que los oligonucleótidos de la invención se administran junto con uno o más tensioactivos potenciadores de la penetración o quelantes. Los tensioactivos preferidos incluyen ácidos grasos y/o ésteres o sus sales, ácidos biliares 25 y/o sus sales. Los ácidos/sales biliares preferidos incluyen ácido quenodesoxicólico (CDCA) y ácido ursodesoxiquenodesoxicólico (UDCA), ácido cólico, ácido deshidrocólico, ácido desoxicólico, ácido glucólico, ácido glicólico, ácido glicodesoxicólico, ácido taurocólico, ácido taurodesoxicólico, tauro-24,25-dihidro-fusidato de sodio, glicodihidrofusidato de sodio. Los ácidos grasos preferidos incluyen ácido araquidónico, ácido undecanoico, ácido oleico, ácido láurico, ácido caprílico, ácido cáprico, ácido mirístico, ácido palmítico, ácido esteárico, ácido linoleico, ácido linolénico, dicaprato, tricaprato, monooleína, dilaurina, 1-monocaprato de glicerilo, 1-dodecilazacicloheptan-2ona, una acilcarnitina, una acilcolina, o un monoglicérido, un diglicérido o una de sus sales farmacéuticamente aceptable (p. ej., de sodio). También se prefieren combinaciones de potenciadores de la penetración, por ejemplo, ácidos grasos/sales en combinación con ácido biliares/sales. Una combinación particularmente preferida es la sal de sodio del ácido láurico, ácido cáprico y UDCA. Otros potenciadores de la penetración incluyen el éter polioxietilen-9Compositions and formulations for oral administration include powders or granules, microparticles, nanoparticles, suspensions or solutions in water or non-aqueous medium, capsules, gel capsules, sachets, tablets or mini-tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids, or binders may be convenient. Preferred oral formulations are those in which the oligonucleotides of the invention are administered in conjunction with one or more penetration enhancing or chelating surfactants. Preferred surfactants include fatty acids and / or esters or their salts, bile acids 25 and / or their salts. Preferred bile acids / salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocolic acid, deoxycholic acid, glycolic acid, glycolic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, tauro-24,25-dihydro -sodium fusidate, sodium glycidihydrofusidate. Preferred fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capic acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, 1-monocaprate of glyceryl, 1-dodecylazacycloheptan-2one, an acylcarnitine, an acylcholine, or a pharmaceutically acceptable monoglyceride, diglyceride, or one of its salts (eg, sodium). Combinations of penetration enhancers are also preferred, eg, fatty acids / salts in combination with bile acids / salts. A particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA. Other penetration enhancers include polyoxyethylene-9 ether.
35 laurilo, éter de polioxietilen-20-cetilo. Los oligonucleótidos de la invención se pueden suministrar por vía oral en forma granular incluyendo partículas secadas por atomización, o complejadas para formar micro o nanopartículas. Los agentes de complejación de oligonucleótidos incluyen: Lauryl, polyoxyethylene-20-cetyl ether. The oligonucleotides of the invention can be delivered orally in granular form including spray-dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents include:
poliaminoácidos; poliiminas; poliacrilatos; polialquilacrilatos, polioxetanos, polialquilcianoacrilatos; gelatinas cationiazadas, albúminas, almidones, acrilatos, polietilenglicoles (PEG) y almidones; polialquilcianoacrilatos; poliiminas derivatizadas con DEAE, pululanos, celulosas y almidones. Los agentes de complejación particularmente preferidos incluyen quitosán, N-trimetilquitosán, poli-L-lisina, polihistidina, poliornitina, poliesperminas, protamina, polivinilpiridina, politiodietilaminometiletileno P (TDAE), poliaminoestireno (e.g. p-amino), poli(cianoacrilato de metilo), poli(cianoacrilato de etilo), poli(cianoacrilato de butilo), poli(cianoacrilato de isobutilo), poli(cianoacrilato de isohexilo), metacrilato de DEAE, hexilacrilato de DEAE, DEAE-acrilamida, DEAE-albúmina y DEAE-dextrano, polyamino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxetanes, polyalkylcyanoacrylates; cationised jellies, albumins, starches, acrylates, polyethylene glycols (PEG) and starches; polyalkylcyanoacrylates; polyimines derivatized with DEAE, pullulans, cellulose and starches. Particularly preferred complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P (TDAE), polyaminostyrene (eg p-amino), poly (cyanoacrylate) poly (ethyl cyanoacrylate), poly (butyl cyanoacrylate), poly (isobutyl cyanoacrylate), poly (isohexyl cyanoacrylate), DEAE methacrylate, DEAE hexy acrylamide, DEAE-albumin and DEAE-DEAE
45 polimetilacrilato, polihexilacrilato, poli(D,L-ácido láctico), poli(ácido DL-láctico-co-glicólico) (PLGA), alginato, y polietilenglicol (PEG). Se describen otras formulaciones orales para oligonucleótidos y su preparación en detalle en las solicitudes de Estados Unidos 08/886.829 (presentada el 1 de julio, 1997), 09/108.673 (presentada el 1 de julio, 1998), 09/256.515 (presentada el 23 de febrero, 1999), 09/082.624 (presentada el 21 de mayo, 1998) y 09/315.298 (presentada el 20 de mayo, 1999). Polymethylacrylate, polyhexylacrylate, poly (D, L-lactic acid), poly (DL-lactic-co-glycolic acid) (PLGA), alginate, and polyethylene glycol (PEG). Other oral formulations for oligonucleotides and their preparation are described in detail in U.S. Applications 08 / 886,829 (filed July 1, 1997), 09 / 108,673 (filed July 1, 1998), 09 / 256,515 (filed February 23, 1999), 09 / 082,624 (filed May 21, 1998) and 09 / 315,298 (filed May 20, 1999).
Las composiciones y formulaciones para la administración parenteral, intratecal o intraventricular pueden incluir disoluciones acuosas estériles, que pueden contener también tampones, diluyentes y otros aditivos adecuados tales como, pero sin limitar, potenciadores de la penetración, compuestos vehículos y otros vehículos o excipientes farmacéuticamente aceptables. Compositions and formulations for parenteral, intrathecal, or intraventricular administration may include sterile aqueous solutions, which may also contain buffers, diluents, and other suitable additives such as, but not limited to, penetration enhancers, vehicle compounds, and other pharmaceutically acceptable carriers or excipients. .
Las composiciones farmacéuticas de la presente invención incluyen, pero sin limitar, disoluciones, emulsiones y The pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and
55 formulaciones que contienen liposomas. Estas composiciones se pueden generar a partir de una variedad de componentes que incluyen, pero sin limitar, líquidos preformados, sólidos autoemulsionantes y semisólidos autoemulsionantes. 55 formulations containing liposomes. These compositions can be generated from a variety of components including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids.
Las formulaciones farmacéuticas de la presente invención, que pueden presentarse convenientemente en forma farmacéutica unitaria, se pueden preparar de acuerdo con técnicas convencionales bien conocidas en la industria farmacéutica. Tales técnicas incluyen la etapa de asociar los principios activos con el(los) vehículo(s) farmacéutico(s) o excipiente(s). En general, las formulaciones se preparan asociando de manera uniforme e íntima, los principios activos con vehículos líquidos o vehículos sólidos finamente divididos, o ambos, y después, si es necesario, moldeando el producto. The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of associating the active ingredients with the pharmaceutical vehicle (s) or excipient (s). In general, the formulations are prepared by uniformly and intimately associating the active ingredients with liquid vehicles or finely divided solid vehicles, or both, and then, if necessary, molding the product.
Las composiciones de la presente invención se pueden formular en cualquiera de muchas formas farmacéuticas posibles, tales como, pero sin limitar, comprimidos, cápsulas, cápsulas de gel, jarabes líquidos, geles blandos, supositorios y enemas. Las composiciones de la presente invención también pueden formularse como suspensiones The compositions of the present invention can be formulated in any of many possible dosage forms, such as, but not limited to, tablets, capsules, gel caps, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention can also be formulated as suspensions
5 en medios acuosos, no acuosos o mixtos. Las suspensiones acuosas pueden contener además sustancias que aumentan la viscosidad de la suspensión que incluyen, por ejemplo, carboximetilcelulosa sódica, sorbitol y/o dextrano. La suspensión también puede contener estabilizantes. 5 in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethyl cellulose, sorbitol and / or dextran. The suspension may also contain stabilizers.
En una realización de la presente invención, las composiciones farmacéuticas se pueden formular y usar en forma de espumas. Las formas farmacéuticas incluyen formulaciones tales como, pero sin limitar, emulsiones, In one embodiment of the present invention, the pharmaceutical compositions can be formulated and used in the form of foams. Dosage forms include formulations such as, but not limited to, emulsions,
10 microemulsiones, cremas, gelatinas y liposomas. Aunque son de naturaleza básicamente similar, estas formulaciones varían en los componentes y la consistencia del producto final. La preparación de dichas composiciones y formulaciones en general es conocida para el experto en la técnica farmacéutica y de la formulación, y se puede aplicar a la formulación de las composiciones de la presente invención. 10 microemulsions, creams, gelatins and liposomes. Although basically similar in nature, these formulations vary in the components and consistency of the final product. The preparation of such compositions and formulations in general is known to the person skilled in the pharmaceutical and formulation art, and can be applied to the formulation of the compositions of the present invention.
Emulsiones Emulsions
15 Las composiciones de la presente invención se pueden preparar y formular como emulsiones. Las emulsiones son sistemas típicamente heterogéneos de un líquido disperso en otro en forma de gotas que normalmente superan 0,1 μm de diámetro (Idson, en Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, en Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems from one liquid dispersed to another in the form of droplets that normally exceed 0.1 µm in diameter (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc. , New York, NY, volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, Volume 1, p. 245; Block in Pharmaceutical Dosage Forms,
20 Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., en Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 301). Las emulsiones son con frecuencia sistemas bifásicos que comprenden dos fases líquidas inmiscibles íntimamente mezcladas y dispersadas entre sí. En general, las emulsiones pueden ser de la forma agua en aceite (ag/ac) o de aceite en agua (ac/ag). Cuando una fase acuosa se divide finamente y se dispersa como gotas minúsculas en una fase oleosa voluminosa, 20 Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., In Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions can be in the form of water in oil (ag / ac) or oil in water (ac / ag). When an aqueous phase is finely divided and dispersed as tiny droplets into a bulky oil phase,
25 la composición resultante se llama una emulsión de agua en aceite (ag/ac). Alternativamente, cuando una fase oleosa se divide finamente y se dispersa como gotas minúsculas en una fase acuosa voluminosa, la composición resultante se llama una emulsión de aceite en agua (ac/ag). Las emulsiones pueden contener componentes adicionales además de las fases dispersas y el fármaco activo, que pueden estar presentes como una disolución en la fase acuosa, la fase oleosa o él mismo como una fase separada. También pueden estar presentes excipientes The resulting composition is called a water-in-oil (ag / ac) emulsion. Alternatively, when an oil phase is finely divided and dispersed as tiny droplets into a bulky aqueous phase, the resulting composition is called an oil-in-water (ac / ag) emulsion. The emulsions may contain additional components in addition to the dispersed phases and the active drug, which may be present as a solution in the aqueous phase, the oil phase, or itself as a separate phase. Excipients may also be present
30 farmacéuticos tales como emulsionantes, estabilizantes, colorantes y antioxidantes, en las emulsiones, según sea necesario. Las emulsiones farmacéuticas también pueden ser múltiples emulsiones que están compuestas de más de dos fases tal como, por ejemplo, en el caso de emulsiones de aceite en agua en aceite (ac/ag/ac) y de agua en aceite en agua (ag/ac/ag). Dichas formulaciones complejas a menudo proporcionan ciertas ventajas que las emulsiones binarias sencillas no proporcionan. Las emulsiones múltiples en las que pequeñas gotas de aceite Pharmaceuticals such as emulsifiers, stabilizers, colorants, and antioxidants, in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are composed of more than two phases such as, for example, in the case of oil-in-oil-in-oil (ac / ag / ac) and water-in-oil-in-water (ag / ac / ag). Such complex formulations often provide certain benefits that simple binary emulsions do not. Multiple emulsions in which small drops of oil
35 individuales de una emulsión de ac/ag encierran gotas de agua pequeñas constituyen una emulsión de ag/ac/ag. De la misma forma, un sistema de pequeñas gotas de aceite encerradas en glóbulos de agua esterilizada en una fase de aceite continua proporciona una emulsión de ac/ag/ac. Individuals of an ac / ag emulsion enclose small water droplets make up an ag / ac / ag emulsion. In the same way, a system of small oil droplets enclosed in globules of sterilized water in a continuous oil phase provides an ac / ag / ac emulsion.
Las emulsiones se caracterizan por tener poca o no tener estabilidad termodinámica. A menudo, la fase dispersa o discontinua de la emulsión está bien dispersa en la fase externa o continua y se mantiene en esta forma mediante 40 emulsionantes o por la viscosidad de la formulación. Cualquiera de las fases de la emulsión puede ser un semisólido Emulsions are characterized by having little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed in the external or continuous phase and is maintained in this form by 40 emulsifiers or by the viscosity of the formulation. Either phase of the emulsion can be a semi-solid
o un sólido, como es el caso de bases de pomadas y cremas de tipo emulsión. Otros medios para estabilizar emulsiones implican el uso de emulsionantes que se pueden incorporan en cualquier de las fases de la emulsión. Los emulsionantes se pueden clasificar ampliamente en 4 categorías: tensioactivos sintéticos, emulsionantes naturales, bases de absorción y sólidos finamente dispersos (Idson, in Pharmaceutical Dosage Forms, Lieberman, or a solid, as is the case of ointment bases and emulsion-type creams. Other means of stabilizing emulsions involve the use of emulsifiers that can be incorporated into any of the phases of the emulsion. Emulsifiers can be broadly classified into 4 categories: synthetic surfactants, natural emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman,
45 Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). 45 Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
Los tensioactivos sintéticos, conocidos también como agentes tensioactivos, han encontrado un amplio campo de aplicación en la formulación de emulsiones y se han revisado en la bibliografía (Rieger, en Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, en Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, 50 volume 1, p. 199). Los tensioactivos son típicamente anfifílicos y comprenden una parte hidrófila y una hidrófoba. La relación de la naturaleza hidrófila a la hidrófoba del tensioactivo se ha denominado el equilibrio hidrófilo/lipófilo (HLB) y es una herramienta valiosa para clasificar y seleccionar tensioactivos en la preparación de formulaciones. Los tensioactivos se pueden clasificar en diferentes clases basándose en la naturaleza del grupo hidrófilo: no iónicos, aniónicos, catiónicos y anfóteros (Rieger, en Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Synthetic surfactants, also known as surfactants, have found a wide field of application in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, NY, 1988, 50 volume 1 , p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic part. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophilic / lipophilic balance (HLB) and is a valuable tool for classifying and selecting surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
55 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285). 55 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).
Los emulsionantes naturales usados en formulaciones de emulsiones incluyen lanolina, cera de abeja, fosfátidos, lecitina y goma arábiga. Las bases de absorción tienen propiedades hidrófilas de modo que se pueden empapar en agua para formar emulsiones de ag/ac que todavía retienen la consistencia semisólida, tal como lanolina anhidra y vaselina hidrófila. También se han usado los sólidos finamente divididos como buenos emulsionantes, en especial 60 en combinación con tensioactivos en preparaciones viscosas. Estos incluyen sólidos inorgánicos polares, tales como Natural emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin, and gum arabic. Absorption bases have hydrophilic properties so that they can be soaked in water to form ag / ac emulsions that still retain semisolid consistency, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers, especially 60 in combination with surfactants in viscous preparations. These include polar inorganic solids, such as
hidróxidos de metales pesados, arcillas que no se hinchan tales como bentonita, atapulguita, hectorita, caolín, montmorillonita, silicato de aluminio coloidal y silicato de aluminio y magnesio coloidal, pigmentos, y sólidos no polares tales como carbón o triestearato de glicerilo. heavy metal hydroxides, non-swelling clays such as bentonite, attapulguite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments, and non-polar solids such as carbon or glyceryl triestearate.
También están incluidos una gran variedad de materiales no emulsionantes en formulaciones en emulsión y contribuyen a las propiedades de las emulsiones. Estos incluyen grasas, aceites, ceras, ácidos grasos, alcoholes grasos, ésteres grasos, humectantes, coloides hidrófilos, conservantes y antioxidantes (Block, en Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, en Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). A wide variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of the emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc. , New York, NY, volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199) .
Los coloides hidrófilos o hidrocoloides incluyen gomas naturales y polímeros sintéticos tales como polisacáridos (por ejemplo, goma arábiga, agar, ácido algínico, carragenano, goma guar, goma de karaya y tragacanto), derivados de celulosa (por ejemplo, carboximetilcelulosa y carboxipropilcelulosa) y polímeros sintéticos (por ejemplo, carbómeros, éteres de celulosa y polímeros de carboxivinilo). Estos se dispersan o hinchan en agua para formar disoluciones coloidales que estabilizan las emulsiones formando películas interfaciales fuertes alrededor de las pequeñas gotas de la fase dispersa y aumentando la viscosidad de la fase externa. Hydrophilic or hydrocolloid colloids include natural gums and synthetic polymers such as polysaccharides (for example, gum arabic, agar, alginic acid, carrageenan, guar gum, karaya gum and tragacanth), cellulose derivatives (for example, carboxymethyl cellulose and carboxypropyl cellulose) and synthetic polymers (eg, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize the emulsions by forming strong interfacial films around the small droplets of the dispersed phase and increasing the viscosity of the external phase.
Puesto que las emulsiones a menudo contienen una serie de ingredientes tales como hidratos de carbono, proteínas, esteroles y fosfátidos, que pueden soportar fácilmente el desarrollo de microbios, estas formulaciones a menudo incorporan conservantes. Los conservantes usados habitualmente incluidos en las formulaciones en emulsión incluyen metilparabeno, propilparabeno, sales de amonio cuaternario, cloruro de benzalconio, ésteres del ácido p-hidroxibenzoico, y ácido bórico. También se añaden habitualmente antioxidantes a las formulaciones en emulsión para prevenir el deterioro de la formulación. Los antioxidantes usados pueden ser depuradores de radicales libres tales como tocoferoles, galatos de alquilo, hidroxianisol butilado, hidroxitolueno butilado o agentes de reducción tales como ácido ascórbico y metabisulfito sódico, y compuestos sinérgicos de antioxidantes tales como ácido cítrico, ácido tartárico y lecitina. Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols, and phosphatides, which can easily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also routinely added to emulsion formulations to prevent deterioration of the formulation. The antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene or reducing agents such as ascorbic acid and sodium metabisulfite, and synergistic compounds of antioxidants such as citric acid, tartaric acid and lecithin.
La aplicación de las formulaciones en emulsión por vía dermatológica, oral y parenteral y los métodos para su fabricación han sido revisados en la bibliografía (Idson, en Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Las formulaciones en emulsión para el suministro oral se han usado muy ampliamente debido a la facilidad de uso de la formulación, y la eficacia desde el punto de vista de la absorción y la biodisponibilidad. (Rosoff, en Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, en Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Los laxantes de base de aceite mineral, las vitaminas solubles en aceite y preparaciones nutritivas de alto contenido en grasa están entre los materiales que se han administrado habitualmente por vía oral en forma de emulsiones de ac/ag. The application of the dermatological, oral and parenteral emulsion formulations and the methods for their manufacture have been reviewed in the literature (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc ., New York, NY, volume 1, p. 199). Emulsion formulations for oral delivery have been used very widely because of the ease of use of the formulation, and the efficacy from the point of view of absorption and bioavailability. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199). Mineral oil-based laxatives, oil-soluble vitamins and high-fat nutritional preparations are among the materials that have been routinely administered orally in the form of ac / ag emulsions.
En una realización de la presente invención, las composiciones de oligonucleótidos y ácidos nucleicos se formulan como microemulsiones. Una microemulsión se puede definir como un sistema de agua, aceite y compuesto anfifílico, que es una sola disolución líquida termodinámicamente estable y ópticamente isótropa (Rosoff, en Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Típicamente, las microemulsiones son sistemas que se preparan dispersando primero un aceite en una disolución acuosa de tensioactivo y después añadiendo una cantidad suficiente de un cuarto componente, en general un alcohol de longitud de cadena intermedia para formar un sistema transparente. Por lo tanto, las microemulsiones también se han descrito como dispersiones termodinámicamente estables, isotrópicamente transparentes de dos líquidos inmiscibles que están estabilizados mediante películas interfaciales de moléculas tensioactivas (Leung and Shah, en: Controlled Release of Drugs: polimers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Las microemulsiones normalmente se preparan por una combinación de tres a cinco componentes que incluyen aceite, agua, tensioactivo, cotensioactivo y electrolito. El que la microemulsión sea del tipo de agua en aceite (ag/ac) o de aceite en agua (ac/ag) depende de las propiedades del aceite y el tensioactivo usados y de la estructura y el empaquetamiento geométrico de las cabezas polares y colas hidrocarbonadas de las moléculas de tensioactivo (Schott, en Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 271). In an embodiment of the present invention, the oligonucleotide and nucleic acid compositions are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and amphiphilic compound, which is a single thermodynamically stable and optically isotropic liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245). Typically, microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain length alcohol, to form a clear system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically transparent dispersions of two immiscible liquids that are stabilized by interfacial films of surfactant molecules (Leung and Shah, in: Controlled Release of Drugs: polymers and Aggregate Systems, Rosoff, M ., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions are normally prepared by a combination of three to five components including oil, water, surfactant, co-surfactant, and electrolyte. Whether the microemulsion is of the water-in-oil (ag / ac) or oil-in-water (ac / ag) type depends on the properties of the oil and surfactant used and the structure and geometric packing of the polar heads and tails hydrocarbons of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 271).
Se ha estudiado ampliamente el procedimiento fenomenológico que usa diagramas de fases y ha dado un conocimiento exhaustivo al experto en la técnica, de cómo formular microemulsiones (Rosoff, en Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Comparadas con las emulsiones normales, las microemulsiones ofrecen la ventaja de solubilizar fármacos insolubles en agua en una formulación de pequeñas gotas termodinámicamente estable que se forman espontáneamente. The phenomenological procedure using phase diagrams has been extensively studied and the expert in the art has been given comprehensive knowledge of how to formulate microemulsions (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker , Inc., New York, NY, volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335). Compared to normal emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable small droplets that spontaneously form.
Los tensioactivos usados en la preparación de microemulsiones incluyen, pero sin limitar, tensioactivos iónicos, tensioactivos no iónicos, Brij 96, éteres de polioxietileno y oleilo, ésteres de ácido graso y poliglicerol, monolaurato de tetraglicerol (ML310), monooleato de tetraglicerol (MO310), monooleato de hexaglicerol (PO310), pentaoleato de Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, nonionic surfactants, Brij 96, polyoxyethylene and oleyl ethers, fatty acid and polyglycerol esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310) , hexaglycerol monooleate (PO310),
hexaglicerol (PO500), monocaprato de decaglicerol (MCA750), monooleato de decaglicerol (MO750), sesquioleato de decaglicerol (SO750), decaoleato de decaglicerol (DA0750), solos o combinados con cotensioactivos. El cotensioactivo, normalmente un alcohol de cadena corta tal como etanol, 1-propanol y 1-butanol, sirve para aumentar la fluidez interfacial penetrando en la película de tensioactivo y por consiguiente creando una película desordenada debido al espacio vacío generado entre las moléculas de tensioactivo. Sin embargo, las microemulsiones se pueden preparar sin usar cotensioactivos y los sistemas de microemulsión autoemulsionantes exentos de alcohol son conocidos en la técnica. La fase acuosa típicamente puede ser, pero sin limitar, agua, una disolución acuosa del fármaco, glicerol, PEG300, PEG400, poligliceroles, propilenglicoles, y derivados del etilenglicol. La fase de aceite puede incluir, pero sin limitar, materiales tales como Captex 300, Captex 355, Capmul MCM, ésteres de ácidos grasos, mono, di y triglicéridos de cadena media (C8-C12), ésteres de ácido graso y glicerilo polioxietilado, alcoholes grasos, glicéridos poliglicolizados, glicéridos C8-C10 poliglicolizados, aceites vegetales y aceite de silicona. hexaglycerol (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sesquioleate (SO750), decaglycerol decaoleate (DA0750), alone or in combination with co-surfactants. The co-surfactant, typically a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase interfacial fluidity by penetrating the surfactant film and thereby creating a disordered film due to the void space generated between the surfactant molecules. . However, microemulsions can be prepared without using co-surfactants, and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase typically can be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and ethylene glycol derivatives. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, esters of fatty acids, mono, di, and medium chain triglycerides (C8-C12), fatty acid esters, and polyoxyethylated glyceryl, fatty alcohols, polyglycolized glycerides, polyglycolylated C8-C10 glycerides, vegetable oils and silicone oil.
Las microemulsiones son particularmente interesantes desde el punto de vista de la solubilización del fármaco y la absorción potenciada de los fármacos. Se han propuesto microemulsiones basadas en lípidos (tanto de ac/ag como de ag/ac) para potenciar la biodisponibilidad oral de fármacos, incluyendo péptidos (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Las microemulsiones proporcionan ventajas de mejor solubilización del fármaco, protección del fármaco frente a la hidrólisis enzimática, posible potenciación de la absorción de fármaco debido a alteraciones inducidas por el tensioactivo en la fluidez y permeabilidad de la membrana, facilidad de preparación, facilidad de administración oral frente a las formas farmacéuticas sólidas, mejor potencia clínica, y menor toxicidad (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). A menudo las microemulsiones se pueden formar de manera espontánea cuando sus componentes se ponen juntos a temperatura ambiente. Esto puede ser particularmente ventajoso cuando se formulan fármacos, péptidos u oligonucleótidos termolábiles. Las microemulsiones también han sido eficaces en el suministro transdérmico de componentes activos tanto en aplicaciones cosméticas como farmacéuticas. Se espera que las composiciones en microemulsión y las formulaciones de la presente invención faciliten la mayor absorción sistémica de oligonucleótidos y ácidos nucleicos del tracto gastrointestinal, así como que mejore la captación celular local de oligonucleótidos y ácidos nucleicos en el tracto gastrointestinal, vagina, cavidad bucal y otras zonas de administración. Microemulsions are particularly interesting from the point of view of drug solubilization and enhanced drug absorption. Lipid-based microemulsions (both ac / ag and ag / ac) have been proposed to enhance oral bioavailability of drugs, including peptides (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions provide advantages of better drug solubilization, protection of the drug against enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration vs. solid dosage forms, better clinical potency, and less toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Microemulsions can often form spontaneously when their components are put together at room temperature. This can be particularly advantageous when formulating heat labile drugs, peptides, or oligonucleotides. Microemulsions have also been effective in transdermal delivery of active components in both cosmetic and pharmaceutical applications. The microemulsion compositions and formulations of the present invention are expected to facilitate increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve local cellular uptake of oligonucleotides and nucleic acids in the gastrointestinal tract, vagina, oral cavity. and other administration areas.
Las microemulsiones de la presente invención también pueden contener componentes y aditivos adicionales tales como monoestearato de sorbitán (Grill 3), Labrasol, y potenciadores de la penetración para mejorar las propiedades de la formulación y potenciar la absorción de los oligonucleótidos y ácidos nucleicos de la presente invención. Los potenciadores de la penetración usados en las microemulsiones de la presente invención se pueden clasificar como pertenecientes a una de cinco amplias categorías: tensioactivos, ácidos grasos, sales biliares, agentes quelantes y no tensioactivos no quelantes (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Cada una de estas clases se ha discutido antes. The microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the formulation properties and enhance the absorption of the oligonucleotides and nucleic acids herein. invention. The penetration enhancers used in the microemulsions of the present invention can be classified as belonging to one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed before.
Liposomas Liposomes
Hay muchas estructuras de tensioactivos organizadas además de las microemulsiones que se han estudiado y usado para la formulación de fármacos. Estos incluyen monocapas, micelas, bicapas y vesículas. Las vesículas, tales como los liposomas, han atraído un gran interés debido a su especificidad y a la duración de la acción que ofrecen, desde el punto de vista de suministro del fármaco. Como se usa en la presente invención, el término "liposoma" significa una vesícula compuesta de lípidos anfifílicos dispuestos en una bicapa o bicapas esféricas. There are many organized surfactant structures in addition to microemulsions that have been studied and used for drug formulation. These include monolayers, micelles, bilayers, and vesicles. Vesicles, such as liposomes, have attracted great interest due to their specificity and the duration of action they offer, from the point of view of drug delivery. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.
Los liposomas son vesículas unilamelares o multilamelares que tienen una membrana formada de un material lipófilo y un interior acuoso. La parte acuosa contiene la composición que se va a liberar. Los liposomas catiónicos tienen la ventaja de poder fusionarse con la pared celular. Los liposomas no catiónicos, aunque no pueden fusionarse de forma tan eficaz con la pared celular, son atrapados por macrófagos in vivo. Liposomes are unilamellar or multilamellar vesicles that have a membrane made of a lipophilic material and an aqueous interior. The aqueous part contains the composition to be released. Cationic liposomes have the advantage of being able to fuse with the cell wall. Although non-cationic liposomes cannot fuse as effectively with the cell wall, they are trapped by macrophages in vivo.
Con el fin de cruzar la piel intacta de mamífero, las vesículas lipídicas deben pasar a través de una serie de poros finos, cada uno con un diámetro menor de 50 nm, bajo la influencia de un gradiente transdérmico adecuado. Por lo tanto, es deseable usar un liposoma que sea muy deformable y pueda pasar a través de dichos poros finos. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each less than 50 nm in diameter, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome that is highly deformable and can pass through such fine pores.
Otras ventajas de los liposomas incluyen: los liposomas obtenidos de fosfolípidos naturales son biocompatibles y biodegradables; los liposomas pueden incorporar una amplia variedad de fármacos solubles en agua y lípidos; los liposomas pueden proteger los fármacos encapsulados en sus compartimentos internos frente al metabolismo y la degradación (Rosoff, en Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). En la preparación de formulaciones de liposomas son importantes las consideraciones sobre la carga superficial del lípido, el tamaño de vesícula y el volumen acuoso de los liposomas. Other advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide variety of lipid and water soluble drugs; liposomes can protect drugs encapsulated in their internal compartments against metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1 , p. 245). In preparing liposome formulations considerations on lipid surface charge, gallbladder size, and aqueous volume of liposomes are important.
Los liposomas son útiles para la transferencia y suministro de principios activos al sitio de acción. Debido a que la membrana liposomal es estructuralmente similar a las membranas biológicas, cuando se aplican liposomas a un tejido, los liposomas empiezan a fusionarse con las membranas celulares. A medida que la fusión del liposoma y la célula avanza, el contenido del liposoma se vacía en la célula donde el agente activo puede actuar. Liposomes are useful for the transfer and supply of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes begin to fuse with the cell membranes. As the fusion of the liposome and the cell progresses, the content of the liposome empties into the cell where the active agent can act.
Las formulaciones liposomales han sido el centro de una investigación exhaustiva como modo de liberación de muchos fármacos. Hay cada vez más pruebas de que para la administración tópica, los liposomas presentan varias ventajas frente a otras formulaciones. Dichas ventajas incluyen menos efectos secundarios relacionados con la alta absorción sistémica del fármaco administrado, mayor acumulación del fármaco administrado en la diana deseada, y Liposomal formulations have been the focus of extensive research as a mode of release for many drugs. There is increasing evidence that for topical administration, liposomes have several advantages over other formulations. Such advantages include fewer side effects related to the high systemic absorption of the administered drug, greater accumulation of the administered drug in the desired target, and
5 la capacidad de administrar una amplia variedad de fármacos, tanto hidrófilos como hidrófobos, a la piel. 5 the ability to deliver a wide variety of drugs, both hydrophilic and hydrophobic, to the skin.
Varias publicaciones han detallado la capacidad de los liposomas para suministrar agentes a la piel, incluyendo ADN de alto peso molecular. Se han administrado a la piel compuestos que incluyen analgésicos, anticuerpos, hormonas y ADN de alto peso molecular. La mayoría de las aplicaciones se dirigían a la epidermis superior. Several publications have detailed the ability of liposomes to deliver agents to the skin, including high molecular weight DNA. Compounds including pain relievers, antibodies, hormones and high molecular weight DNA have been administered to the skin. Most applications were directed at the upper epidermis.
Los liposomas están en dos clases amplias. Los liposomas catiónicos son liposomas con carga positiva que Liposomes are in two broad classes. Cationic liposomes are positively charged liposomes that
10 interaccionan con moléculas de ADN con carga negativa para formar un complejo estable. El complejo de ADN/liposoma con carga positiva se une a la superficie celular con carga negativa y es internalizado en un endosoma. Debido al pH ácido dentro del endosoma, los liposomas se rompen liberando su contenido al citoplasma celular (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985). 10 interact with negatively charged DNA molecules to form a stable complex. The positively charged DNA / liposome complex binds to the negatively charged cell surface and is internalized into an endosome. Due to the acidic pH within the endosome, the liposomes rupture releasing their contents into the cellular cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).
Los liposomas que son sensibles al pH o tienen carga negativa, atrapan ADN más que formar complejo con él. Liposomes that are pH sensitive or negatively charged trap DNA rather than complex with it.
15 Puesto que tanto el ADN como el lípido están cargados de forma similar, se produce repulsión en lugar de formación de complejo. No obstante, algo de ADN es atrapado dentro del interior acuoso de estos liposomas. Los liposomas sensibles al pH se han usado para suministrar ADN que codifica el gen de la timidina quinasa a monocapas celulares en cultivo. Se detectó la expresión del gen endógeno en las células diana (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274). Since both DNA and lipid are similarly charged, repulsion occurs rather than complex formation. However, some DNA is trapped within the aqueous interior of these liposomes. PH sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cultured cell monolayers. Expression of the endogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).
20 Uno de los tipos principales de composiciones de liposomas incluyen fosfolípidos distintos de la fosfatidilcolina natural. Por ejemplo, se pueden formar composiciones de liposomas neutros a partir de dimiristoil-fosfatidilcolina (DMPC) o dipalmitoil-fosfatidilcolina (DPPC). Las composiciones de liposomas aniónicos en general se forman a partir de dimiristoil-fosfatidilglicerol, mientras que los liposomas fusogénicos aniónicos se forman principalmente a partir de dioleoil-fosfatidiletanolamina (DOPE). Otro tipo de composición de liposomas está formada por One of the main types of liposome compositions includes phospholipids other than natural phosphatidylcholine. For example, neutral liposome compositions can be formed from dimyristoyl-phosphatidylcholine (DMPC) or dipalmitoyl-phosphatidylcholine (DPPC). Anionic liposome compositions are generally formed from dimyristoyl-phosphatidylglycerol, while anionic fusogenic liposomes are primarily formed from dioleoyl-phosphatidylethanolamine (DOPE). Another type of liposome composition is formed by
25 fosfatidilcolina (PC), tal como por ejemplo, PC de soja y PC de huevo. Otro tipo está formado por mezclas de fosfolípidos y/o fosfatidilcolina y/o colesterol. Phosphatidylcholine (PC), such as for example soy PC and egg PC. Another type is formed by mixtures of phospholipids and / or phosphatidylcholine and / or cholesterol.
Varios estudios han evaluado el suministro tópico de formulaciones liposomales de fármacos a la piel. La aplicación de liposomas que contenían interferón en la piel de cobayas dio como resultado una reducción de las ampollas del herpes cutáneo, mientras que el suministro de interferón por otra vía (p. ej., como una disolución o una emulsión) no Several studies have evaluated the topical delivery of liposomal drug formulations to the skin. The application of liposomes containing interferon to the skin of guinea pigs resulted in a reduction of blisters of herpes cutaneous, while the supply of interferon by another route (eg, as a solution or an emulsion) did not
30 era eficaz (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Además, un estudio adicional ensayó la eficacia del interferón administrado como parte de una formulación liposomal frente a la administración del interferón usando un sistema acuoso, y concluyó que la formulación liposomal era superior a la administración acuosa (du Plessis et al., Antiviral Research, 1992, 18, 259-265). 30 was effective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Furthermore, a further study tested the efficacy of interferon administered as part of a liposomal formulation versus administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265).
Los sistemas liposomales no iónicos también se han examinado para determinar su utilidad en el suministro de Nonionic liposomal systems have also been examined to determine their utility in supplying
35 fármacos a la piel, en particular sistemas de comprenden tensioactivo no iónico y colesterol. Se usaron formulaciones liposomales no iónicas que comprendían Novasome™ I (dilaurato de glicerilo/colesterol/éter de estearilo y polioxietileno-10) y Novasome™ II (diestearato de glicerilo/colesterol/éter de estearilo y polioxietileno-10) para suministrar ciclosporina A en la dermis de la piel de ratón. Los resultados indicaron que dichos sistemas liposomales no iónicos eran eficaces para facilitar la deposición de la ciclosporina A en diferentes capas de la piel 35 drugs to the skin, in particular systems comprise non-ionic surfactant and cholesterol. Nonionic liposomal formulations comprising Novasome ™ I (glyceryl dilaurate / cholesterol / stearyl ether and polyoxyethylene-10) and Novasome ™ II (glyceryl distearate / cholesterol / stearyl ether and polyoxyethylene-10) were used to supply cyclosporin A in the dermis of mouse skin. The results indicated that these nonionic liposomal systems were effective in facilitating the deposition of cyclosporin A in different layers of the skin.
40 (Hu et al. S.T.P. Pharma. Sci., 1994, 4, 6, 466). 40 (Hu et al. S.T.P. Pharma. Sci., 1994, 4, 6, 466).
Los liposomas también incluyen liposomas "estéricamente estabilizados", un término que como se usa en la presente memoria, se refiere a liposomas que comprenden uno o más lípidos especializados que, cuando se incorporan a los liposomas, dan como resultado tiempos de vida en la circulación potenciados con respecto a liposomas que carecen de dichos lípidos especializados. Los ejemplos de liposomas estéricamente estabilizados 45 son aquellos en los que parte del lípido que forma la vesícula del liposoma (A) comprende uno o más glucolípidos, tales como monosialogangliósido GM1, o (B) se derivatiza con uno o más polímeros hidrófilos, tal como un resto de polietilenglicol (PEG). Sin querer estar ligado a ninguna teoría en particular, se cree en la técnica que, al menos para los liposomas estéricamente estabilizados que contienen gangliósidos, esfingomielina o lípidos derivatizados con PEG, la semivida en la circulación potenciada de estos liposomas estéricamente estabilizados deriva de una menor Liposomes also include "sterically stabilized" liposomes, a term that as used herein, refers to liposomes that comprise one or more specialized lipids that, when incorporated into liposomes, result in shelf life in circulation. enhanced with respect to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the lipid that forms the liposome vesicle (A) comprises one or more glycolipids, such as monosialoganglioside GM1, or (B) is derivatized with one or more hydrophilic polymers, such as a residue of polyethylene glycol (PEG). Without wishing to be bound by any particular theory, it is believed in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes is derived from a lower
50 captación en las células del sistema reticuloendotelial (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765). Uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).
Se conocen en la técnica diferentes liposomas que comprenden uno o más glucolípidos. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) describieron la capacidad del monosialogangliósido GM1, sulfato de galactocerebrósido y fosfatidilinositol para mejorar las semividas en la sangre de los liposomas. Estos hallazgos 55 fueron expuestos por Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). La patente de EE.UU. nº Different liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) described the ability of monosialoganglioside GM1, galactocerebroside sulfate, and phosphatidylinositol to improve the blood half-lives of liposomes. These findings 55 were exposed by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). US patent no.
4.837.028 y la publicación internacional WO 88/04924, ambos de Allen et al., describen liposomas que comprenden 4,837,028 and International Publication WO 88/04924, both by Allen et al., Describe liposomes comprising
(1) esfingomielina y (2) el gangliósido GM1 o un éster sulfato de galactocerebrósido. La patente de EE.UU. nº (1) sphingomyelin and (2) GM1 ganglioside or a galactocerebroside sulfate ester. US patent no.
5.543.152 (Webb et al.) describe liposomas que comprenden esfingomielina. Los liposomas que comprenden 1,2-sndimiristoilfosfatidilcolina se describen en la publicación internacional WO 97/13499 (Lim et al.). 5,543,152 (Webb et al.) Describe liposomes comprising sphingomyelin. Liposomes comprising 1,2-syndysyristoylphosphatidylcholine are described in International Publication WO 97/13499 (Lim et al.).
En la técnica se conocen muchos liposomas que comprenden lípidos derivatizados con uno o más polímeros hidrófilos y métodos para su preparación. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) describían liposomas que comprenden un detergente no iónico, 2C1215G, que contiene un resto de PEG. Illum et al. (FEBS Lett., 1984, 167, 79) observaron que el recubrimiento hidrófilo de partículas de poliestireno con glicoles poliméricos 5 daba como resultado semividas en la sangre potenciadas. Describen fosfolípidos sintéticos modificados por unión de grupos carboxílicos de polialquilenglicoles (p. ej., PEG) Sears (patentes de EE.UU. nº 4.426.330 y 4.534.899). Klibanov et al. (FEBS Lett., 1990, 268, 235) describían experimentos que demostraban que los liposomas que comprendían fosfatidiletanolamina (PE) derivatizada con PEG o estearato de PEG tenían aumentos significativos de las semividas en la circulación sanguínea. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extendieron dichas observaciones a otros fosfolípidos derivatizados con PEG, p. ej., DSPE-PEG, formado por la combinación de diestearoilfosfatidiletanolamina (DSPE) y PEG. Se describen liposomas que tienen restos PEG unidos de forma covalente a su superficie externa en la patente europea nº EP 0 445 131 B1 y la publicación internacional WO 90/04384 de Fisher. Las composiciones de liposomas que contienen 1-20 por ciento en moles de PE derivatizado con PEG, y los métodos para su uso, los describen Woodle et al. (patentes de EE.UU. nº 5.013.556 y 5.356.633) y Many liposomes comprising lipids derivatized with one or more hydrophilic polymers and methods for their preparation are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C1215G, containing a PEG residue. Illum et al. (FEBS Lett., 1984, 167, 79) observed that the hydrophilic coating of polystyrene particles with polymeric glycols 5 resulted in enhanced blood half-lives. They describe synthetic phospholipids modified by binding of carboxylic groups of polyalkylene glycols (eg, PEG) Sears (US Patent Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments showing that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate had significant increases in half-lives in the bloodstream. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended these observations to other PEG-derivatized phospholipids, e.g. eg, DSPE-PEG, formed by the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having PEG moieties covalently attached to their outer surface are described in European Patent No. EP 0 445 131 B1 and Fisher International Publication WO 90/04384. Liposome compositions containing 1-20 mole percent PE derivatized with PEG, and methods for their use, are described by Woodle et al. (U.S. Patent Nos. 5,013,556 and 5,356,633) and
15 Martin et al. (patente de EE.UU. nº 5.213.804 y patente europea nº EP 0496813 B1). Se describen liposomas que comprenden una serie de conjugados de lípido-polímero en la publicación internacional WO 91/05545 y la patente de EE.UU. nº 5.225.212 (ambas de Martin et al.) y en la publicación internacional WO 94/20073 (Zalipsky et al.). Se describen liposomas que comprenden lípidos de ceramida modificados con PEG en la publicación internacional WO 96/10391 (Choi et al.). Las patentes de EE.UU. nº 5.540.935 (Miyazaki et al.) y 5.556.948 (Tagawa et al.) describen liposomas que contienen PEG que pueden estar además derivatizados con restos funcionales en sus superficies. 15 Martin et al. (US Patent No. 5,213,804 and European Patent No. EP 0496813 B1). Liposomes comprising a series of lipid-polymer conjugates are described in International Publication WO 91/05545 and US Pat. No. 5,225,212 (both by Martin et al.) and in international publication WO 94/20073 (Zalipsky et al.). Liposomes comprising PEG-modified ceramide lipids are described in International Publication WO 96/10391 (Choi et al.). US patents Nos. 5,540,935 (Miyazaki et al.) and 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that may also be derivatized with functional residues on their surfaces.
Se conoce un número limitado de liposomas que comprenden ácidos nucleicos en la técnica. La publicación internacional WO 96/40062 de Thierry et al. describe métodos para encapsular ácidos nucleicos de alto peso molecular en liposomas. La patente de EE.UU. nº 5.264.221 de Tagawa et al. describe liposomas unidos a proteínas y afirma que el contenido de dichos liposomas puede incluir un ARN antisentido. La patente de EE.UU. nº 5.665.710 A limited number of liposomes comprising nucleic acids are known in the art. International publication WO 96/40062 by Thierry et al. describes methods for encapsulating high molecular weight nucleic acids in liposomes. US patent No. 5,264,221 to Tagawa et al. describes protein-bound liposomes and states that the content of such liposomes may include antisense RNA. US patent No. 5,665,710
25 de Rahman et al. describe determinados métodos para encapsular oligodesoxinucleótidos en liposomas. La publicación internacional WO 97/04787 de Love et al. describe liposomas que comprenden oligonucleótidos antisentido dirigidos al gen raf. 25 of Rahman et al. describes certain methods for encapsulating oligodeoxynucleotides in liposomes. International publication WO 97/04787 of Love et al. describes liposomes comprising antisense oligonucleotides targeting the raf gene.
Los transferosomas son otro tipo más de liposomas, y son agregados de lípidos muy deformables que son candidatos atractivos para vehículos de suministro de fármacos. Los transferosomas se pueden describir como pequeñas gotas lipídicas que son tan deformables que pueden penetrar fácilmente a través de los poros que son más pequeños que las gotas pequeñas. Los transferosomas se pueden adaptar al entorno en el que se usan, p. ej., son autooptimizantes (se adaptan a la forma de los poros en la piel), autorreparadores, con frecuencia alcanzan sus objetivos sin fragmentación, y a menudo autocargables. Para hacer transferosomas se pueden añadir activadores de borde de superficie, normalmente tensioactivos, a una composición de liposomas convencional. Los transferosomas Transferosomes are yet another type of liposome, and are highly deformable lipid aggregates that are attractive candidates for drug delivery vehicles. Transferosomes can be described as tiny lipid droplets that are so deformable that they can easily penetrate through pores that are smaller than tiny droplets. Transferosomes can be adapted to the environment in which they are used, e.g. For example, they are self-optimizing (adapt to the shape of pores in the skin), self-repairing, often reach their targets without fragmentation, and often self-loading. To make transferosomes, surface edge activators, usually surfactants, can be added to a conventional liposome composition. Transferosomes
35 se han usado para suministrar albúmina de suero a la piel. Se ha mostrado que el suministro mediado por transferosoma de la albúmina de suero es tan eficaz como la inyección subcutánea de una disolución que contiene albúmina de suero. 35 have been used to deliver serum albumin to the skin. Transferosome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
Los tensioactivos tienen una amplia aplicación en formulaciones tales como emulsiones (incluyendo microemulsiones) y liposomas. El modo más común de clasificar y ordenar las propiedades de muchos tipos diferentes de tensioactivos, tanto naturales como sintéticos, es mediante el uso del equilibrio hidrófilo/lipófilo (HLB). La naturaleza del grupo hidrófilo (conocido también como la "cabeza") proporciona el medio más útil para clasificar los diferentes tipos de tensioactivos usados en las formulaciones (Rieger, en Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285). Surfactants have wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way to classify and order the properties of many different types of surfactants, both natural and synthetic, is through the use of the hydrophilic / lipophilic balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means of classifying the different types of surfactants used in the formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988 , p. 285).
Si la molécula de tensioactivo no está ionizada, se clasifica como un tensioactivo no iónico. Los tensioactivos no If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Surfactants do not
45 iónicos tienen una amplia aplicación en productos farmacéuticos y cosméticos y se pueden usar en un amplio intervalo de valores de pH. En general, sus valores de HLB están en el intervalo de 2 a aproximadamente 18 dependiendo de su estructura. Los tensioactivos no iónicos incluyen ésteres no iónicos tales como ésteres de etilenglicol, ésteres de propilenglicol, ésteres de glicerilo, ésteres de poliglicerilo, ésteres de sorbitán, ésteres de sacarosa y ésteres etoxilados. Las alcanolamidas no iónicas y los éteres tales como alcoholes grasos etoxilados, alcoholes propoxilados y polímeros de bloques etoxilados/propoxilados también están incluidos en esta clase. Los tensioactivos de polioxietileno son los miembros más populares de la clase de tensioactivos no iónicos. Ionic 45 have a wide application in pharmaceutical and cosmetic products and can be used in a wide range of pH values. In general, its HLB values are in the range of 2 to about 18 depending on its structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as ethoxylated fatty alcohols, propoxylated alcohols, and ethoxylated / propoxylated block polymers are also included in this class. Polyoxyethylene surfactants are the most popular members of the class of nonionic surfactants.
Si la molécula de tensioactivo lleva una carga negativa cuando se disuelve o dispersa en agua, el tensioactivo se clasifica como aniónico. Los tensioactivos aniónicos incluyen carboxilatos tales como jabones, lactilatos de acilo, acilamidas de aminoácidos, ésteres de ácido sulfúrico tales como sulfatos de alquilo y sulfatos de alquilo etoxilados, If the surfactant molecule carries a negative charge when dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, amino acid acylamides, esters of sulfuric acid such as alkyl sulfates, and ethoxylated alkyl sulfates,
55 sulfonatos tales como alquilbencenosulfonatos, acil-isetionatos, acil-tauratos y sulfosuccinatos y fosfatos. Los miembros más importantes de la clase de tensioactivos aniónicos son los sulfatos de alquilo y los jabones. Sulfonates such as alkyl benzenesulfonates, acyl isethionates, acyl taurates, and sulfosuccinates and phosphates. The most important members of the class of anionic surfactants are alkyl sulfates and soaps.
Si la molécula de tensioactivo lleva una carga positiva cuando se disuelve o dispersa en agua, el tensioactivo se clasifica como catiónico. Los tensioactivos catiónicos incluyen sales de amonio cuaternario y aminas etoxiladas. Las sales de amonio cuaternario son los miembros de esta clase más usados. If the surfactant molecule carries a positive charge when dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most widely used members of this class.
Si la molécula de tensioactivo tiene la capacidad de llevar una carga positiva o negativa, el tensioactivo se clasifica If the surfactant molecule has the ability to carry a positive or negative charge, the surfactant is classified
como anfótero. Los tensioactivos anfóteros incluyen derivados de ácido acrílico, alquilamidas sustituidas, Nalquilbetaínas y fosfátidos. as an amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, Nalkyl betaines and phosphatides.
Se ha revisado el uso de tensioactivos en fármacos, formulaciones y en emulsiones (Rieger, en Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285). The use of surfactants in drugs, formulations, and emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).
Potenciadores de la penetración Penetration enhancers
En una realización, la presente invención usa diferentes potenciadores de la penetración para producir el suministro eficaz de ácidos nucleicos, en particular de oligonucleótidos, en la piel de animales. La mayoría de los fármacos están presentes en disolución tanto en formas ionizada como no ionizada. Sin embargo, normalmente solo los fármacos solubles en lípidos o lipófilos cruzan fácilmente las membranas celulares. Se ha descubierto que incluso fármacos no lipófilos pueden cruzar las membranas celulares si la membrana que se va a cruzar se trata con un potenciador de la penetración. Además de añadir la difusión de fármacos no lipófilos a través de las membranas celulares, los potenciadores de la penetración también potencian la permeabilidad de fármacos lipófilos. In one embodiment, the present invention uses different penetration enhancers to produce the effective delivery of nucleic acids, in particular oligonucleotides, into the skin of animals. Most drugs are present in solution in both ionized and non-ionized forms. However, typically only lipid-soluble or lipophilic drugs readily cross cell membranes. It has been found that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to adding the diffusion of non-lipophilic drugs through cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
Los potenciadores de la penetración se pueden clasificar como pertenecientes a una de cinco amplias categorías, es decir, tensioactivos, ácidos grasos, sales biliares, agentes quelantes y no tensioactivos no quelantes (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Cada una de las clases mencionadas antes de potenciadores de la penetración se describen a continuación con mayor detalle. Penetration enhancers can be classified as belonging to one of five broad categories, that is, surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991 , p.92). Each of the classes mentioned before of penetration enhancers are described in more detail below.
Tensioactivos: En relación con la presente invención, los tensioactivos (o "agentes tensioactivos") son entidades químicas que, cuando se disuelven en una disolución acuosa, reducen la tensión superficial de la disolución o la tensión interfacial entre la disolución acuosa y otro líquido, con el resultado de que se potencia la absorción de los oligonucleótidos a través de la mucosa. Además de las sales biliares y los ácidos grasos, estos potenciadores de la penetración incluyen, por ejemplo, laurilsulfato sódico, éter de laurilo y polioxietileno-9 y éter de cetilo y polioxietileno-20) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); y emulsiones de productos químicos perfluorados FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252). Surfactants: In relation to the present invention, surfactants (or "surfactants") are chemical entities that, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that the absorption of the oligonucleotides through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, lauryl ether, and polyoxyethylene-9 and cetyl ether and polyoxyethylene-20) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and FC-43 perfluorinated chemical emulsions. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
Ácidos grasos: Los diferentes ácidos grasos y sus derivados que actúan como potenciadores de la penetración incluyen, por ejemplo, ácido oleico, ácido láurico, ácido cáprico (ácido n-decanoico), ácido míristico, ácido palmítico, ácido esteárico, ácido linoleico, ácido linolénico, dicaprato, tricaprato, monooleína (1-monooleoil-rac-glicerol), dilaurina, ácido caprílico, ácido araquidónico, 1-monocaprato de glicerol, 1-dodecilazacicloheptan-2-ona, acilcarnitinas, acilcolinas, ésteres de alquilo C1-10 de los mismos (p. ej., metilo, isopropilo y t-butilo), y mono y diglicéridos de los mismos (es decir, oleato, laurato, caprato, miristato, palmitato, estearato, linoleato, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654). Fatty acids: Different fatty acids and their derivatives that act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, acid linolenic, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurine, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C1-alkyl esters the same (eg, methyl, isopropyl, and t-butyl), and mono and diglycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al. , Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).
Sales biliares: La función fisiológica de la bilis incluye el facilitar la dispersión y absorción de lípidos y vitaminas solubles en grasa (Brunton, capítulo 38 en: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Diferentes sales biliares naturales y sus derivados sintéticos actúan como potenciadores de la penetración. Por lo tanto la expresión "sales biliares" incluye cualquiera de los componentes naturales de la bilis así como cualquiera de sus derivados sintéticos. Las sales biliares de la invención incluyen, por ejemplo, ácido cólico (o sus sal de sodio farmacéuticamente aceptable, colato de sodio), ácido deshidrocólico (deshidrocolato de sodio), ácido desoxicólico (desoxicolato de sodio), ácido glucólico (glucolato de sodio), ácido glicólico (glicocolato de sodio), ácido glicodesoxicólico (glicodesoxicolato de sodio), ácido taurocólico (taurocolato de sodio), ácido taurodesoxicólico (taurodesoxicolato de sodio), ácido quenodesoxicólico (quenodesoxicolato de sodio), ácido ursodesoxicólico (UDCA), tauro-24,25-dihidrofusidato de sodio (STDHF), glicodihidrofusidato de sodio y éter de laurilo y polioxietileno-9 (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, capítulo 39 en: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583). Bile Salts: The physiological role of bile includes facilitating the dispersion and absorption of fat-soluble lipids and vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Different natural bile salts and their synthetic derivatives act as penetration enhancers. Therefore the expression "bile salts" includes any of the natural components of bile as well as any of its synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocolic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glycolic acid (sodium glucolate) , glycolic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), , Sodium 25-dihydrofusidate (STDHF), Sodium Lauryl Ether Glycol Dihydrofusidate and Polyoxyethylene-9 (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 in: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al. , J. Pharm. Exp. The r., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).
Agentes quelantes: Los agentes quelantes, como se usa en relación con la presente invención, se pueden definir como compuestos que retiran iones metálicos de la disolución formando complejos con los mismos, con el resultado de que se potencia la absorción de los oligonucleótidos a través de la mucosa. En relación con su uso como potenciadores de la penetración en la presente invención, los agentes quelantes tienen la ventaja añadida de que también sirven como inhibidores de DNasa, ya que la mayoría de las ADN nucleasas caracterizadas requieren un ion metálico divalente para la catálisis y por lo tanto son inhibidas por los agentes quelantes (Jarrett, J. Chromatogr., 1993, 618, 315-339). Los agentes quelantes de la invención incluyen, pero sin limitar, etilendiaminatetraacetato de sodio (EDTA), ácido cítrico, salicilatos (p. ej., salicilato, 5-metoxisalicilato y homovanilato de sodio), derivados de Nacilo del colágeno, derivados de laureth-9 y N-aminoacilo de beta-dicetonas (enaminas)(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51). Chelating Agents: Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metal ions from the solution by forming complexes therewith, with the result that the absorption of the oligonucleotides is enhanced through the mucosa. In relation to their use as penetration enhancers in the present invention, chelating agents have the added advantage that they also serve as DNase inhibitors, since most characterized DNA nucleases require a divalent metal ion for catalysis and for therefore they are inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Chelating agents of the invention include, but are not limited to, sodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (eg, salicylate, 5-methoxysalicylate, and sodium homovanilate), derivatives of collagen Nacyl, derivatives of laureth- 9 and N-aminoacyl of beta-diketones (enamines) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).
No tensioactivos no quelantes: Como se usa en la presente memoria, los compuestos potenciadores de la penetración no tensioactivos no quelantes se pueden definir como compuestos que demuestran actividad insignificante como agentes quelantes o como tensioactivos pero que, no obstante, potencian la absorción de oligonucleótidos a través de la mucosa digestiva (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). Esta clase de potenciadores de la penetración incluye, por ejemplo, ureas cíclicas insaturadas, Non-chelating Non-Surfactants: As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate negligible activity as chelating agents or as surfactants but, nevertheless, enhance the absorption of oligonucleotides to through the digestive mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas,
5 derivados de 1-alquil- y 1-alquenilazaciclo-alcanona (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); y agentes antiinflamatorios no esteroideos tales como diclofenaco de sodio, indometacina y fenilbutazona (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626). 5 derivatives of 1-alkyl- and 1-alkenylazacyclocycloalkanone (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin, and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).
También se pueden añadir agentes que potencian la captación de oligonucleótidos a nivel celular a las composiciones farmacéuticas y otras composiciones de la presente invención. Por ejemplo, se sabe que los lípidos Agents that enhance oligonucleotide uptake at the cellular level may also be added to the pharmaceutical compositions and other compositions of the present invention. For example, lipids are known to
10 catiónicos, tales como la lipofectina (Junichi et al, patente de EE.UU. nº 5.705.188), derivados de glicerol catiónicos y moléculas policatiónicas tales como la polilisina (Lollo et al., solicitud PCT WO 97/30731), también potencian la captación celular de oligonucleótidos. Cationics, such as lipofectin (Junichi et al, US Patent No. 5,705,188), cationic glycerol derivatives and polycationic molecules such as polylysine (Lollo et al., PCT application WO 97/30731), also enhance cellular uptake of oligonucleotides.
Se pueden usar otros agentes para potenciar la penetración de los ácidos nucleicos administrados, incluyendo glicoles tales como etilenglicol y propilenglicol, pirroles tales como 2-pirrol, azonas y terpenos tales como limoneno y Other agents can be used to enhance the penetration of administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrroles such as 2-pyrrole, azones, and terpenes such as limonene and
15 mentona. 15 chin.
Vehículos Vehicles
Algunas composiciones de la presente invención también incorporan compuestos vehículo en la formulación. Como se usa en la presente memoria, "compuesto vehículo" o "vehículo" se puede referir a un ácido nucleico o análogo del mismo, que es inerte (es decir, no tiene actividad biológica por sí mismo) pero es reconocido como un ácido nucleico 20 por procesos in vivo que reducen la biodisponibilidad del ácido nucleico que tiene actividad biológica, por ejemplo degradando el ácido nucleico biológicamente activo o promoviendo su eliminación de la circulación. La coadministración de un ácido nucleico y un compuesto vehículo, típicamente con un exceso de esta última sustancia, puede dar como resultado una reducción sustancial de la cantidad de ácido nucleico recuperado en el hígado, riñón u otros depósitos extracirculatorios, supuestamente debido a la competición entre el compuesto Some compositions of the present invention also incorporate vehicle compounds into the formulation. As used herein, "vehicle compound" or "vehicle" can refer to a nucleic acid or analog thereof, which is inert (ie, does not have biological activity by itself) but is recognized as a nucleic acid 20 by in vivo processes that reduce the bioavailability of nucleic acid having biological activity, for example by degrading biologically active nucleic acid or promoting its elimination from circulation. Co-administration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction in the amount of nucleic acid recovered in the liver, kidney or other extracirculatory deposits, presumably due to competition between the compound
25 vehículo y el ácido nucleico por un receptor común. Por ejemplo, la recuperación de un oligonucleótido parcialmente fosforotioato en tejido hepático se puede reducir cuando se coadministra con ácido poliinosínico, sulfato de dextrano, ácido policitidílico o ácido 4-acetamido-4'-isotiociano-estilbeno-2,2'-disulfónico (Miyao et al., Antisense Res. Dev., 1995, 5; 115-121; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183). 25 vehicle and nucleic acid by a common receptor. For example, the recovery of a partially phosphorothioate oligonucleotide in liver tissue can be reduced when co-administered with polyinosinic acid, dextran sulfate, polycytidylic acid or 4-acetamido-4'-isothiocyanyl-2,2'-disulfonic acid (Miyao et al., Antisense Res. Dev., 1995, 5; 115-121; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).
Excipientes Excipients
30 A diferencia de un compuesto vehículo, un "vehículo farmacéutico" o "excipiente" es un disolvente farmacéuticamente aceptable, agente de suspensión o cualquier otro vehículo farmacológicamente inerte para suministrar uno o más ácidos nucleicos a un animal. El excipiente puede ser líquido o sólido y se selecciona, con la forma de administración planeada en mente, de modo que proporcione el volumen, consistencia, etc. deseados, cuando se combina con un ácido nucleico y los otros componentes de una composición farmacéutica dada. Los 30 Unlike a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert carrier to deliver one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned administration form in mind, to provide volume, consistency, etc. desired, when combined with a nucleic acid and the other components of a given pharmaceutical composition. The
35 vehículos farmacéuticos típicos incluyen, pero sin limitar, agentes aglutinantes (p. ej., almidón de maíz pregelatinizado, polivinilpirrolidona o hidroxipropilmetilcelulosa, etc.); cargas (p. ej., lactosa y otros azúcares, celulosa microcristalina, pectina, gelatina, sulfato de calcio, etilcelulosa, poliacrilatos o hidrogenofosfato de calcio, etc.); lubricantes (p. ej., estearato de magnesio, talco, sílice, dióxido de silicio coloidal, ácido esteárico, estearatos metálicos, aceites vegetales hidrogenados, almidón de maíz, polietilenglicoles, benzoato sódico, acetato sódico, Typical pharmaceutical carriers include, but are not limited to, binding agents (eg, pregelatinized corn starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (eg, lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (eg, magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate,
40 etc.); disgregantes (p. ej., almidón, glicolato sódico de almidón, etc.); y agentes humectantes (p. ej., laurilsulfato sódico, etc.). 40 etc.); disintegrants (eg, starch, sodium starch glycolate, etc.); and wetting agents (eg, sodium lauryl sulfate, etc.).
Los excipientes orgánicos o inorgánicos farmacéuticamente aceptables adecuados para la administración no parenteral que no reaccionan de forma perjudicial con ácidos nucleicos también se pueden usar para formular las composiciones de la presente invención. Los vehículos farmacéuticamente aceptables adecuados incluyen, pero sin Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration that do not react deleteriously with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not
45 limitar, agua, disoluciones salinas, alcoholes, polietilenglicoles, gelatina, lactosa, amilosa, estearato de magnesio, talco, ácido silícico, parafina viscosa, hidroximetilcelulosa, polivinilpirrolidona y similares. Limit, water, saline solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinylpyrrolidone and the like.
Las formulaciones para administración tópica de ácidos nucleicos puede incluir disoluciones acuosas estériles y no estériles, disoluciones no acuosas en disolventes comunes tales como alcoholes, o disoluciones de los ácidos nucleicos en bases líquidas u oleosas sólidas. Las disoluciones pueden contener tampones, diluyentes y otros Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of nucleic acids in solid liquid or oily bases. The solutions can contain buffers, diluents and others
50 aditivos adecuados. Se pueden usar excipientes orgánicos o inorgánicos farmacéuticamente aceptables adecuados para la administración no parenteral que no reaccionen de forma perjudicial con ácidos nucleicos. 50 suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration that do not react adversely with nucleic acids can be used.
Los excipientes farmacéuticamente aceptables incluyen, pero sin limitar, agua, disoluciones salinas, alcohol, polietilenglicoles, gelatina, lactosa, amilosa, estearato de magnesio, talco, ácido silícico, parafina viscosa, hidroximetilcelulosa, polivinilpirrolidona y similares. Pharmaceutically acceptable excipients include, but are not limited to, water, saline solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinylpyrrolidone, and the like.
55 Suministro en pulsos 55 Supply in pulses
Los compuestos de la presente invención también se pueden administrar por suministro en pulsos. "Suministro en pulsos" se refiere a una formulación farmacéutica que suministra un primer pulso de fármaco combinado con un The compounds of the present invention can also be administered by pulse delivery. "Pulse delivery" refers to a pharmaceutical formulation that delivers a first pulse of drug combined with a
potenciador de la penetración y un segundo pulso de potenciador de la penetración para promover la absorción del fármaco que no se ha absorbido tras la liberación de potenciador de la penetración con el primer pulso. penetration enhancer and a second pulse of penetration enhancer to promote absorption of drug that has not been absorbed after the release of penetration enhancer with the first pulse.
Una realización de la presente invención es una formulación oral de liberación retardada para la absorción intestinal de fármaco potenciada, que comprende: An embodiment of the present invention is a delayed-release oral formulation for enhanced intestinal drug absorption, comprising:
- (a)(to)
- una primera población de partículas de vehículo que comprenden dicho fármaco y un potenciador de la penetración, en el que dicho fármaco y dicho potenciador de la penetración son liberados en un primer sitio en el intestino; y a first population of carrier particles comprising said drug and a penetration enhancer, wherein said drug and said penetration enhancer are released at a first site in the intestine; and
- (b)(b)
- una segunda población de partículas de vehículo que comprenden un potenciador de la penetración y un recubrimiento o matriz de liberación retardada, en el que el potenciador de la penetración es liberado en un segundo sitio en el intestino, más abajo del primero sitio, de modo que la absorción del fármaco es potenciada cuando el fármaco alcanza el segundo sitio. a second population of carrier particles comprising a penetration enhancer and a delayed release coating or matrix, in which the penetration enhancer is released at a second site in the intestine, below the first site, so that drug absorption is enhanced when the drug reaches the second site.
Alternativamente, el potenciador de la penetración en (a) y (b) es diferente. Alternatively, the penetration enhancer in (a) and (b) is different.
Esta potenciación se obtiene por encapsulación de al menos dos poblaciones de partículas de vehículo. La primera población de partículas de vehículo comprende una sustancia biológicamente activa y un potenciador de la penetración, y la segunda (y opcionalmente adicional) población de partículas de vehículo comprende un potenciador de la penetración y un recubrimiento o matriz para la liberación retardada. This enhancement is obtained by encapsulating at least two populations of vehicle particles. The first population of vehicle particles comprises a biologically active substance and a penetration enhancer, and the second (and optionally additional) population of vehicle particles comprises a penetration enhancer and a coating or matrix for delayed release.
Un "efecto del primer paso" que se aplica a los fármacos administrados por vía oral es la degradación debido a la acción del ácido gástrico y diferentes enzimas digestivas. Un medio para mejorar los efectos de eliminación del primer paso es aumentar la dosis del fármaco administrado, compensando de esta forma la proporción de fármaco perdido en la eliminación del primer paso. Aunque esto se puede lograr fácilmente con la administración i.v., por ejemplo, simplemente proporcionando más fármaco a un animal, otros factores influyen en la biodisponibilidad de los fármacos administrados por medios no parenterales. Por ejemplo, un fármaco se puede degradar enzimática o químicamente en el canal alimentario o el torrente sanguíneo y/o puede ser impermeable o permeable frente a diferentes membranas mucosas. A "first-pass effect" that is applied to orally administered drugs is degradation due to the action of gastric acid and different digestive enzymes. One means of enhancing the first-pass elimination effects is to increase the dose of the drug administered, thereby compensating for the proportion of drug lost in the first-pass elimination. Although this can be easily accomplished with IV administration, for example, simply by providing more drug to an animal, other factors influence the bioavailability of drugs administered by non-parenteral means. For example, a drug can be enzymatically or chemically degraded in the alimentary canal or bloodstream and / or it can be impermeable or permeable against different mucous membranes.
Se contempla también que estas composiciones farmacéuticas son capaces de potenciar la absorción de sustancias biológicamente activas cuando se administran por vía rectal, vaginal, nasal o pulmonar. También se contempla que la liberación de la sustancia biológicamente activa se puede lograr en cualquier parte del tracto gastrointestinal. These pharmaceutical compositions are also contemplated to be capable of enhancing the absorption of biologically active substances when administered rectally, vaginally, nasally or pulmonary. It is also contemplated that the release of the biologically active substance can be accomplished anywhere in the gastrointestinal tract.
Las composiciones farmacéuticas líquidas de oligonucleótidos se pueden preparar mediante la combinación del oligonucleótido con un vehículo adecuado, por ejemplo, agua estéril exenta de pirógenos o disolución salina. Se pueden incluir opcionalmente otros compuestos terapéuticos. Liquid pharmaceutical oligonucleotide compositions can be prepared by combining the oligonucleotide with a suitable vehicle, eg sterile pyrogen-free water or saline. Other therapeutic compounds may optionally be included.
La presente invención también contempla el uso de composiciones sólidas en partículas. Dichas composiciones preferiblemente comprenden partículas de oligonucleótido que son de tamaño respirable. Dichas partículas se puede preparar, por ejemplo, moliendo el oligonucleótido seco por medios convencionales, por ejemplo con un mortero y mano de mortero, y después pasando la composición en polvo resultante a través de un tamiz de malla nº 400 para separar las partículas grandes y los aglomerados. Una composición sólida en partículas compuesta de un oligonucleótido activo puede contener opcionalmente un dispersante que sirve para facilitar la formación de un aerosol, por ejemplo lactosa. The present invention also contemplates the use of solid particulate compositions. Such compositions preferably comprise oligonucleotide particles that are respirable in size. Such particles can be prepared, for example, by grinding the dried oligonucleotide by conventional means, for example with a mortar and pestle, and then passing the resulting powder composition through a # 400 mesh screen to separate large particles and the agglomerates. A solid particulate composition composed of an active oligonucleotide may optionally contain a dispersant that serves to facilitate the formation of an aerosol, for example lactose.
De acuerdo con la presente invención, las composiciones de oligonucleótidos se pueden aerolizar. La aerolización de partículas líquidas se puede producir por cualquier medio adecuado, tal como un nebulizador. Véase, por ejemplo, la patente de EE.UU. nº 4.501.729. Los nebulizadores son dispositivos disponibles en el comercio que transforman disoluciones o suspensiones en un aerosol de tipo niebla terapéutico por medio de la aceleración de un gas comprimido, típicamente aire y oxígeno, a través de un orificio Venturi estrecho o mediante agitación ultrasónica. Los nebulizadores adecuados incluyen los vendidos por Blairex® con los nombres PARI LC PLUS, PARI DURA-NEB 2000, PARI-BABY Size, compresor PARI PRONEB con LC PLUS, sistema compresor/nebulizador PARI WALKHALER, nebulizador reutilizable PARI LC PLUS y PARI LC Jet+ ®Nebulizer. In accordance with the present invention, the oligonucleotide compositions can be aerosolized. Liquid particle aerosolization can occur by any suitable means, such as a nebulizer. See, for example, US Pat. No. 4,501,729. Nebulizers are commercially available devices that transform solutions or suspensions into a therapeutic mist-type aerosol by acceleration of a compressed gas, typically air and oxygen, through a narrow Venturi orifice or by ultrasonic agitation. Suitable nebulizers include those sold by Blairex® under the names PARI LC PLUS, PARI DURA-NEB 2000, PARI-BABY Size, PARI PRONEB compressor with LC PLUS, PARI WALKHALER compressor / nebulizer system, PARI LC PLUS reusable nebulizer and PARI LC Jet + ®Nebulizer.
Las formulaciones de ejemplo para usar en los nebulizadores consisten en un oligonucleótido en un líquido, tal como agua estéril exenta de pirógenos, o disolución salina, en la que el oligonucleótido comprende hasta aproximadamente 40% en p/p de la formulación. Preferiblemente, el oligonucleótido comprende menos de 20% en p/p. Si se desea, se pueden añadir a la composición aditivos adicionales tales como conservantes (por ejemplo, hidroxibenzoato de metilo), antioxidantes, y agentes de sabor. Example formulations for use in nebulizers consist of an oligonucleotide in a liquid, such as sterile pyrogen-free water, or saline, in which the oligonucleotide comprises up to about 40% w / w of the formulation. Preferably, the oligonucleotide comprises less than 20% w / w. If desired, additional additives such as preservatives (eg, methyl hydroxybenzoate), antioxidants, and flavoring agents can be added to the composition.
Las partículas sólidas que comprenden un oligonucleótido también se pueden aerolizar usando cualquier generador de aerosol de medicamento en partículas sólidas conocido en la técnica. Dichos generadores de aerosoles producen partículas respirables, como se ha descrito antes, y además producen dosis medidas reproducibles por unidad de volumen del aerosol. Los generadores de aerosoles de partículas sólidas adecuados incluyen insufladores e inhaladores dosificadores. Los inhaladores dosificadores se usan en la técnica y son útiles en la presente invención. Solid particles comprising an oligonucleotide can also be aerosolized using any solid particle drug aerosol generator known in the art. Such aerosol generators produce respirable particles, as described above, and also produce reproducible measured doses per unit volume of the aerosol. Suitable solid particle aerosol generators include insufflators and metered dose inhalers. Metered dose inhalers are used in the art and are useful in the present invention.
Preferiblemente, los aerosoles de líquidos o sólidos se producen a una velocidad de aproximadamente 10 a 150 litros por minuto, más preferiblemente de aproximadamente 30 a 150 litros por min y los más preferiblemente aproximadamente 60 litros por min. Preferably, liquid or solid aerosols are produced at a rate of from about 10 to 150 liters per minute, more preferably from about 30 to 150 liters per minute, and most preferably about 60 liters per minute.
La biodisponibilidad potenciada de las sustancias biológicamente activas también se logra mediante la administración oral de las composiciones y los métodos de la presente invención. El término "biodisponibilidad" se refiere a una medición de qué parte de un fármaco administrado llega al sistema circulatorio cuando se usa un modo de administración no parenteral para introducir el fármaco en un animal. Enhanced bioavailability of biologically active substances is also achieved by oral administration of the compositions and methods of the present invention. The term "bioavailability" refers to a measurement of how much of an administered drug reaches the circulatory system when a non-parenteral mode of administration is used to introduce the drug into an animal.
Los potenciadores de la penetración incluyen, pero sin limitar, miembros de clases moleculares tales como tensioactivos, ácidos grasos, sales biliares, agentes quelantes y moléculas no tensioactivas no quelantes. (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Los vehículos son moléculas inertes que se pueden incluir en las composiciones de la presente invención para que interfieran con los procesos que conducen a la reducción de los niveles del fármaco biodisponible. Penetration enhancers include, but are not limited to, members of molecular classes such as surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactant molecules. (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Carriers are inert molecules that can be included in the compositions of the present invention to interfere with the processes leading to the reduction of levels of the bioavailable drug.
Otros componentes Other components
Las composiciones de la presente invención pueden contener adicionalmente otros componentes auxiliares encontrados convencionalmente en composiciones farmacéuticas, en sus niveles de uso establecidos en la técnica. Así, por ejemplo, las composiciones pueden contener materiales adicionales, compatibles, farmacéuticamente activos tales como, por ejemplo, agentes antipruríticos, astringentes, anestésicos locales o antiinflamatorios, o pueden contener materiales adicionales útiles en la formulación física de diversas formas farmacéuticas de las composiciones de la presente invención, tales como colorantes, agentes de sabor, conservantes, antioxidantes, opacificantes, agentes espesantes y estabilizantes. Sin embargo, dichos materiales, cuando se añaden, no deberían interferir indebidamente con las actividades biológicas de los componentes de las composiciones de la presente invención. Las formulaciones pueden esterilizarse y, si se desea, mezclarse con agentes auxiliares, por ejemplo, agentes lubricantes, conservantes, estabilizantes, humectantes, emulsionantes, sales para influir en la presión osmótica, tampones, colorantes, agentes de sabor y/o sustancias aromáticas y similares, que no interaccionan perjudicialmente con el o los ácidos nucleicos de la formulación. The compositions of the present invention may additionally contain other auxiliary components conventionally found in pharmaceutical compositions, at their use levels established in the art. Thus, for example, the compositions may contain additional, compatible, pharmaceutically active materials such as, for example, antipruritic, astringent, local anesthetic or anti-inflammatory agents, or they may contain additional materials useful in the physical formulation of various pharmaceutical forms of the compositions of the present invention, such as colorants, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents, and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, for example, lubricating agents, preservatives, stabilizers, humectants, emulsifiers, salts to influence osmotic pressure, buffers, colorants, flavoring agents and / or aromatic substances and similar, which do not harmfully interact with the nucleic acid (s) of the formulation.
Las suspensiones acuosas pueden contener sustancias que aumentan la viscosidad de la suspensión que incluyen, por ejemplo, carboximetilcelulosa sódica, sorbitol y/o dextrano. La suspensión también puede contener estabilizantes. Aqueous suspensions may contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethyl cellulose, sorbitol and / or dextran. The suspension may also contain stabilizers.
Algunas realizaciones de la invención proporcionan composiciones farmacéuticas que contienen (a) uno o más compuestos antisentido, y (b) uno o más de otros agentes quimioterapéuticos que funcionan por un mecanismo que no es antisentido. Los ejemplos de dichos agentes quimioterapéuticos incluyen, pero sin limitar, daunorubicina, daunomicina, dactinomicina, doxorubicina, epirubicina, idarubicina, esorubicina, bleomicina, mafosfamida, ifosfamida, arabinósido de citosina, bis-cloroetilnitrosourea, busulfano, mitomicina C, actinomicina D, mitramicina, prednisona, hidroxiprogesterona, testosterona, tamoxifeno, dacarbazina, procarbazina, hexametilmelamina, pentametilmelamina, mitoxantrona, amsacrina, clorambucilo, metilciclohexilnitrosourea, mostazas nitrogenadas, melfalán, ciclofosfamida, 6-mercaptopurina, 6-tioguanina, citarabina, 5-azacitidina, hidroxiurea, desoxicoformicina, 4hidroxiperoxiciclofosforamida, 5-fluorouracilo (5-FU), 5-fluorodesoxiuridina (5-FUdR), metotrexato (MTX), colchicina, taxol, vincristina, vinblastina, etopósido (VP-16), trimetrexato, irinotecán, topotecán, gemcitabina, tenipósido, cisplatino y dietilstilbestrol (DES). Véase, en general, The Merck Manual of Diagnosis and Therapy, 15th Ed. 1987, pp. 1206-1228, Berkow et al., eds., Rahway, N.J. Cuando se usan con los compuestos de la invención, dichos agentes quimioterapéuticos se pueden usar de forma individual (p. ej., 5-FU y oligonucleótido), secuencial (p. ej., 5-FU y oligonucleótido durante un periodo de tiempo seguido de MTX y oligonucleótido), o en combinación con uno o más de otros de dichos agentes quimioterapéuticos (p. ej., 5-FU, MTX y oligonucleótido, o 5-FU, radioterapia y oligonucleótido). Los fármacos antiinflamatorios, incluyendo, pero sin limitar, fármacos antiinflamatorios no esteroideos y corticosteroides, y fármacos antivíricos, incluyendo, pero sin limitar, ribivirina, vidarabina, aciclovir y ganciclovir, también se pueden combinar en composiciones de la invención. Véase, en general, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, N.J., páginas 2499-2506 y 46-49, respectivamente). Otros agentes quimioterapéuticos que no son de tipo antisentido también están dentro del alcance de esta invención. Se pueden usar dos o más compuestos combinados juntos o de forma secuencial. Some embodiments of the invention provide pharmaceutical compositions containing (a) one or more antisense compounds, and (b) one or more other chemotherapeutic agents that function by a non-antisense mechanism. Examples of such chemotherapeutic agents include, but are not limited to, daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, maphosphamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosourea, bis-chloroethylnitrosourea, busin prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentametilmelamina, mitoxantrone, amsacrine, chlorambucil, metilciclohexilnitrosourea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4hidroxiperoxiciclofosforamida , 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). See generally The Merck Manual of Diagnosis and Therapy, 15th Ed. 1987, pp. 1206-1228, Berkow et al., Eds., Rahway, N.J. When used with the compounds of the invention, such chemotherapeutic agents can be used individually (eg, 5-FU and oligonucleotide), sequentially (eg, 5-FU and oligonucleotide for a period of time followed MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (eg, 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including, but not limited to, non-steroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including, but not limited to, ribivirine, vidarabine, acyclovir, and ganciclovir, can also be combined in compositions of the invention. See generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., Eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively). Other chemotherapeutic agents that are not of the antisense type are also within the scope of this invention. Two or more compounds can be used combined together or sequentially.
En otra realización relacionada, las composiciones de la invención pueden contener uno o más compuestos antisentido, en particular oligonucleótidos, dirigidos a un primer ácido nucleico y uno o más compuestos antisentido adicionales dirigidos a un segundo ácido nucleico diana. Se conocen numerosos ejemplos de compuestos antisentido en la técnica. Se pueden usar dos o más compuestos combinados juntos o de forma secuencial. In another related embodiment, the compositions of the invention may contain one or more antisense compounds, in particular oligonucleotides, directed to a first nucleic acid and one or more additional antisense compounds directed to a second target nucleic acid. Numerous examples of antisense compounds are known in the art. Two or more compounds can be used combined together or sequentially.
La formulación de las composiciones terapéuticas y su posterior administración se cree que se basa en la experiencia de los expertos en la técnica. La dosificación depende de la gravedad y la sensibilidad del estado patológico que se va a tratar, durando el curso del tratamiento desde varios días a varios meses, o hasta que se realice la cura o se logre una disminución del estado patológico. Los esquemas de dosificación óptimos se pueden calcular a partir de mediciones de la acumulación de fármaco en el cuerpo del paciente. Los expertos en la técnica pueden determinar fácilmente las dosificaciones óptimas, metodologías de dosificación y tasas de repetición. Las The formulation of the therapeutic compositions and their subsequent administration is believed to be based on the experience of those skilled in the art. The dosage depends on the severity and sensitivity of the disease state to be treated, lasting the course of treatment from several days to several months, or until the cure is performed or a decrease in the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the patient's body. Those of skill in the art can easily determine optimal dosages, dosing methodologies, and repetition rates. The
dosificaciones óptimas pueden variar dependiendo de la potencia relativa de los oligonucleótidos individuales, y en general se puede calcular basándose en las CE50 encontradas eficaces en modelos animales in vitro e in vivo. En general, la dosificación es de 0,01 ug a 100 g por kg de peso corporal, y se puede dar una o más veces al día, de forma semanal, mensual o anual, o incluso una vez cada 2 a 20 años. Los expertos en la técnica pueden calcular fácilmente la frecuencia de repetición para la dosificación basándose en los tiempos de permanencia medidos y las concentraciones de fármaco en los fluidos corporales o tejidos. Después del tratamiento satisfactorio, puede ser conveniente que el paciente siga una terapia de mantenimiento para prevenir la recurrencia del estado patológico, en el que el oligonucleótido se administra en dosis de mantenimiento, en el intervalo de 0,01 ug a 100 g por kg de peso corporal, una o más veces al día, hasta una vez cada 20 años. Optimal dosages can vary depending on the relative potency of the individual oligonucleotides, and can generally be calculated based on the EC50 found effective in in vitro and in vivo animal models. In general, the dosage is 0.01 ug to 100 g per kg of body weight, and can be given one or more times a day, weekly, monthly or annually, or even once every 2 to 20 years. Those of skill in the art can easily calculate the repeat rate for dosing based on the measured residence times and drug concentrations in body fluids or tissues. After successful treatment, it may be desirable for the patient to follow maintenance therapy to prevent recurrence of the disease state, in which the oligonucleotide is administered in maintenance doses, in the range of 0.01 ug to 100 g per kg of body weight, one or more times a day, up to once every 20 years.
Terapia de Combinación Combination Therapy
La invención también proporciona métodos de terapia de combinación, en la que se administran uno o más compuestos de la invención y uno o más compuestos terapéuticos/profilácticos para tratar una afección y/o un estado patológico como se describe en el presente documento. En diferentes aspectos, el o los compuestos de la invención y el o los compuestos terapéuticos/profilácticos se coadministran en forma de una mezcla, o se administran de forma individual. En un aspecto, la vía de administración es la misma para el o los compuestos de la invención y el o los compuestos terapéuticos/profilácticos, mientras que en otros compuestos, el o los compuestos de la invención y el o los compuestos terapéuticos/profilácticos se administran por diferentes vías. En una realización, las dosificaciones del o de los compuestos de la invención y el o los compuestos terapéuticos/profilácticos son cantidades que son terapéutica o profilácticamente eficaces para cada compuesto cuando se administran individualmente. Alternativamente, la administración combinada permite el uso de dosificaciones menores que las que se requerirían para lograr un efecto terapéutico o profiláctico si se administraran individualmente, y dichos métodos son útiles para disminuir uno o más efectos secundarios del compuesto de dosis reducida. The invention also provides combination therapy methods, in which one or more compounds of the invention and one or more therapeutic / prophylactic compounds are administered to treat a condition and / or disease state as described herein. In different aspects, the compound (s) of the invention and the therapeutic / prophylactic compound (s) are co-administered in the form of a mixture, or are administered individually. In one aspect, the route of administration is the same for the compound (s) of the invention and the therapeutic / prophylactic compound (s), while in other compounds, the compound (s) of the invention and the therapeutic / prophylactic compound (s) are administered by different routes. In one embodiment, the dosages of the compound (s) of the invention and the therapeutic / prophylactic compound (s) are amounts that are therapeutically or prophylactically effective for each compound when administered individually. Alternatively, the combined administration allows the use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if administered individually, and such methods are useful in decreasing one or more side effects of the reduced dose compound.
En un aspecto, se administran un compuesto de la presente invención y uno o más de los otros compuestos terapéuticos/profilácticos eficaces para tratar una afección, en el que ambos compuestos actúan por el mismo o por diferentes mecanismos. El o los compuestos terapéuticos/profilácticos incluyen, pero sin limitar, resinas secuestrantes de sales biliares (p. ej., colestiramina, colestipol y hidrocloruro de colesevelam), inhibidores de la HMGCoA-reductasa (p. ej., lovastatina, cerivastatina, prevastatina, atorvastatina, simvastatina, y fluvastatina), ácido nicotínico, derivados del ácido fíbrico (p. ej., clofibrato, gemfibrozil, fenofibrato, bezafibrato, y ciprofibrato), probucol, neomicina, dextrotiroxina, ésteres de estanoles vegetales, inhibidores de la absorción de colesterol (p. ej., ezetimiba), implitapida, inhibidores de transportadores de ácidos biliares (transportadores apicales de ácidos biliares dependientes de sodio), reguladores de CYP7a hepático, productos terapéuticos de sustitución de estrógenos (p. ej., tamoxigen), y antiinflamatorios (p. ej., glucocorticoides). In one aspect, a compound of the present invention and one or more of the other therapeutic / prophylactic compounds effective in treating a condition are administered, in which both compounds act by the same or different mechanisms. The therapeutic / prophylactic compound (s) include, but are not limited to, bile salt sequestering resins (eg, cholestyramine, cholestipol, and colesevelam hydrochloride), HMGCoA-reductase inhibitors (eg, lovastatin, cerivastatin, prevastatin , atorvastatin, simvastatin, and fluvastatin), nicotinic acid, fibric acid derivatives (eg, clofibrate, gemfibrozil, fenofibrate, bezafibrate, and ciprofibrate), probucol, neomycin, dextrothyroxine, esters of plant absorption cholesterol (eg, ezetimibe), implitapide, bile acid transporter inhibitors (apical sodium-dependent bile acid transporters), regulators of liver CYP7a, estrogen replacement therapeutics (eg, tamoxigen), and anti-inflammatory drugs (eg glucocorticoids).
Por consiguiente, la invención proporciona además el uso de un compuesto de la invención y uno o más de otro u otros compuestos terapéuticos/profilácticos como se describe en la presente memoria, en la fabricación de un medicamento para el tratamiento y/o la prevención de una enfermedad o afección como se describe en la presente memoria. Accordingly, the invention further provides the use of a compound of the invention and one or more of another or other therapeutic / prophylactic compounds as described herein, in the manufacture of a medicament for the treatment and / or prevention of a disease or condition as described herein.
Suministro dirigido Directed supply
En otro aspecto, se proporcionan métodos para dirigir un compuesto de la invención a un tejido, órgano o sitio específicos del cuerpo. Los ejemplos de dianas incluyen hígado, pulmón, riñón, corazón y placas ateroscleróticas en un vaso sanguíneo. Los métodos para dirigir compuestos son bien conocidos en la técnica. In another aspect, methods are provided for targeting a compound of the invention to a specific tissue, organ, or site in the body. Examples of targets include liver, lung, kidney, heart, and atherosclerotic plaques in a blood vessel. Methods of directing compounds are well known in the art.
En una realización el compuesto se dirige por administración directa o local. Por ejemplo, cuando se dirige a un vaso sanguíneo, el compuesto se administra directamente a la parte relevante del vaso desde el interior del lumen, p. ej., balón simple o doble balón, o a través de la túnica adventicia con material que ayuda a la liberación lenta del compuesto, p. ej., un sistema de gel plurónico como describen Simons et al., Nature 359: 67-70 (1992). Otras técnicas de liberación lenta para el suministro local del compuesto a un vaso incluyen el recubrimiento de una prótesis endovascular con el compuesto. Se describen métodos de suministro de compuestos antisentido a un vaso sanguíneo en la patente de EE.UU. nº 6.159.946. In one embodiment the compound is directed by direct or local administration. For example, when targeting a blood vessel, the compound is administered directly to the relevant part of the vessel from within the lumen, e.g. eg, single balloon or double balloon, or through the adventitic robe with material that aids in the slow release of the compound, eg. eg, a pluronic gel system as described by Simons et al., Nature 359: 67-70 (1992). Other slow-release techniques for local delivery of the compound to a vessel include coating a stent with the compound. Methods of supplying antisense compounds to a blood vessel are described in US Pat. No. 6,159,946.
Cuando se dirige a un tejido u órgano particular, el compuesto se puede administrar en o alrededor de ese tejido u órgano. Por ejemplo, la patente de EE.UU. nº 6.547.787, describe métodos y dispositivos para dirigir agentes terapéuticos al corazón. En un aspecto, la administración se produce por la inyección directa o por inyección a un vaso sanguíneo asociado con el tejido u órgano. Por ejemplo, cuando se dirige al hígado, el compuesto se puede administrar por inyección o infusión a través de la vena porta. When targeted to a particular tissue or organ, the compound can be administered to or around that tissue or organ. For example, US Patent No. No. 6,547,787, describes methods and devices for targeting therapeutic agents to the heart. In one aspect, administration occurs by direct injection or by injection into a blood vessel associated with the tissue or organ. For example, when directed to the liver, the compound can be administered by injection or infusion through the portal vein.
En otro aspecto, se proporcionan métodos para dirigir un compuesto que incluyen asociar el compuesto con un agente que dirige la captura del compuesto por uno o más tipos de células. Los agentes de ejemplo incluyen lípidos y estructuras basadas en lípidos tales como liposomas, en general en combinación con un resto que se dirige al órgano o tejido específico tal como, por ejemplo, un anticuerpo, un receptor de superficie celular, un ligando para un receptor de superficie celular, un polisacárido, un fármaco, una hormona, un hapteno, un lípido especial y un ácido nucleico como se describe en la patente de EE.UU. nº 6.495.532. La patente de EE.UU. nº 5.399.331, describe el acoplamiento de proteínas a liposomas mediante el uso de un agente de reticulación que tiene al menos un grupo maleimido y una función reactiva con amina. Las patentes de EE.UU. nº 4.885.172, 5.059.421 y 5.171.578, describen proteínas que se unen a liposomas mediante el uso de glicoproteína estreptavidina y recubrimiento de In another aspect, methods of targeting a compound are provided including associating the compound with an agent that directs capture of the compound by one or more cell types. Exemplary agents include lipids and lipid-based structures such as liposomes, generally in combination with a specific organ or tissue targeting moiety such as, for example, an antibody, a cell surface receptor, a ligand for a receptor cell surface, a polysaccharide, a drug, a hormone, a hapten, a special lipid, and a nucleic acid as described in US Pat. No. 6,495,532. US patent No. 5,399,331, describes the coupling of proteins to liposomes by use of a crosslinking agent having at least one maleimido group and amine reactive function. US patents Nos. 4,885,172, 5,059,421, and 5,171,578, describe proteins that bind to liposomes by using streptavidin glycoprotein and coating of
5 liposomas directores con polisacáridos. Otros agentes directores basados en lípidos incluyen, por ejemplo, micelas y productos cristalinos como se describe en la patente de EE.UU. nº 6.217.886. 5 directing liposomes with polysaccharides. Other lipid-based targeting agents include, for example, micelles and crystalline products as described in US Pat. No. 6,217,886.
En otro aspecto, los agentes directores incluyen mircroesferas poliméricas porosas que derivan de poliésteres copolímeros y homopolímeros que contienen enlaces éster hidrolizables que son biodegradables, como se describe en la patente de EE.UU. nº 4.818.542. Los poliésteres típicos incluyen poli(ácido glicólico) (PGA) y poli(ácido láctico) 10 (PLA), y copolímeros de glicólido y L(-lactida) (PGL), que son particularmente adecuados para los métodos y las composiciones de la presente invención, en cuanto que presentan una baja toxicidad humana y son biodegradables. El poliéster u otro polímero, oligómero o copolímero particular usado como matriz polimérica de la microesfera no es crítico y se puede usar una variedad de polímeros dependiendo de la porosidad, consistencia, forma y distribución de tamaños deseados. Otros polímeros o copolímeros biodegradables o bioerosionables incluyen, por ejemplo, 15 gelatina, agar, almidón de maíz, arabinogalactano, albúmina, colágeno, materiales naturales y sintéticos, tales como poli(ε-caprolactona), poli(ε-caprolactona-CO-ácido láctico), poli(ε-caprolactona-CO-ácido glicólico), poli(ácido βhidroxibutírico), poli(óxido de etileno), polietileno, poli(2-cianoacrilato de alquilo), (p. ej., metilo, etilo, butilo), hidrogeles tales como poli(metacrilato de hidroxietilo), poliamidas (p. ej., poliacrilamida), poli(aminoácidos) (es decir, L-leucina, ácido L-aspártico, L-aspartato de β-metilo, L-aspartato de β-bencilo, ácido glutámico), poli(2-hidroxietil-DLIn another aspect, directing agents include porous polymeric mycrospheres derived from copolymer polyesters and homopolymers containing hydrolyzable ester linkages that are biodegradable, as described in US Patent No. 5,200,300. No. 4,818,542. Typical polyesters include poly (glycolic acid) (PGA) and poly (lactic acid) 10 (PLA), and glycolide and L (-lactide) copolymers (PGL), which are particularly suitable for the methods and compositions herein. invention, insofar as they have low human toxicity and are biodegradable. The polyester or other particular polymer, oligomer or copolymer used as the polymeric matrix of the microsphere is not critical and a variety of polymers can be used depending on the desired porosity, consistency, shape and size distribution. Other biodegradable or bioerodible polymers or copolymers include, for example, gelatin, agar, corn starch, arabinogalactan, albumin, collagen, natural and synthetic materials, such as poly (ε-caprolactone), poly (ε-caprolactone-CO-acid lactic), poly (ε-caprolactone-CO-glycolic acid), poly (β-hydroxybutyric acid), poly (ethylene oxide), polyethylene, poly (alkyl 2-cyanoacrylate), (eg methyl, ethyl, butyl ), hydrogels such as poly (hydroxyethyl methacrylate), polyamides (eg, polyacrylamide), poly (amino acids) (i.e. L-leucine, L-aspartic acid, β-methyl L-aspartate, L-aspartate of β-benzyl, glutamic acid), poly (2-hydroxyethyl-DL
20 aspartamida), poli(éster urea), poli(L-fenilalanina/etilenglicol/1,6-diisocianatohexano) y poli(metacrilato de metilo). Los polímeros naturales y sintéticos de ejemplo adecuados para la liberación dirigida están disponibles en el comercio o se pueden obtener por reacciones de polimerización por condensación a partir de monómeros, comonómeros u oligómeros adecuados. 20 aspartamide), poly (ester urea), poly (L-phenylalanine / ethylene glycol / 1,6-diisocyanatohexane) and poly (methyl methacrylate). Exemplary natural and synthetic polymers suitable for targeted release are either commercially available or can be obtained by condensation polymerization reactions from suitable monomers, comonomers or oligomers.
En otra realización más, la patente de EE.UU. nº 6.562.864 describe catequinas, incluyendo isómeros epi y otros In yet another embodiment, US Pat. No. 6,562,864 describes catechins, including epi isomers and others
25 isómeros carbocatiónicos y derivados de los mismos, que como monómeros, dímeros y multímeros mayores, pueden formar complejos con agentes bioactivos catiónicos y nucleófilos para usar como agentes de suministro. Los multímeros de catequinas tienen una fuerte afinidad por proteínas polares, tales como las que residen en el endotelio vascular, y en membranas celulares/orgánulos y son particularmente útiles para el suministro dirigido de agentes bioactivos para seleccionar sitios in vivo. En el tratamiento de enfermedades y trastornos vasculares, tales Carbocationic isomers and derivatives thereof, which as major monomers, dimers, and multimers, can complex with cationic and nucleophilic bioactive agents for use as delivery agents. Catechin multimers have a strong affinity for polar proteins, such as those that reside in the vascular endothelium, and in cell membranes / organelles, and are particularly useful for the targeted delivery of bioactive agents to select sites in vivo. In the treatment of vascular diseases and disorders, such
30 como la aterosclerosis y enfermedades de las arterias coronarias, el suministro de agentes incluye multímeros de catequinas sustituidas, incluyendo multímeros de catequinas amidadas que se forman por reacción entre catequina y restos que contienen nitrógeno tales como amoniaco. Like atherosclerosis and coronary artery disease, the supply of agents includes substituted catechin multimers, including amidated catechin multimers that are formed by reaction between catechin and nitrogen containing moieties such as ammonia.
Otras estrategias para el suministro dirigido de la invención incluyen ADEPT (terapia enzimática con profármaco dirigido por anticuerpo), GDEPT (EPT dirigido por genes) y VDEPT (EPT dirigido por virus) como se describe en la Other strategies for targeted delivery of the invention include ADEPT (antibody-directed prodrug enzyme therapy), GDEPT (gene-directed EPT), and VDEPT (virus-directed EPT) as described in
35 patente de EE.UU. nº 6.433.012. 35 US patent No. 6,433,012.
La presente invención proporciona además dispositivos médicos y kits para el suministro dirigido, en la que el dispositivo es, por ejemplo, una jeringa, una prótesis endovascular o catéter. Los kits incluyen un dispositivo para administrar un compuesto y un recipiente que comprende un compuesto de la invención. En un aspecto, el compuesto está precargado en el dispositivo. En otras realizaciones, el kit proporciona instrucciones para los The present invention further provides medical devices and kits for targeted delivery, wherein the device is, for example, a syringe, stent, or catheter. The kits include a device for administering a compound and a container comprising a compound of the invention. In one aspect, the compound is preloaded on the device. In other embodiments, the kit provides instructions for
40 métodos de administración del compuesto y dosificaciones. Las patentes de EE.UU. que describen dispositivos y kits médicos para el suministro de compuestos antisentido incluyen las patentes de EE.UU. nº 6.368.356; 6.344.035; 6.344.028; 6.287.285; 6.200.304; 5.824.049; 5.749.915; 5.674.242; 5.670.161; 5.609.629; 5.593.974; y 5.470.307. 40 compound administration methods and dosages. US patents Describing medical devices and kits for supplying antisense compounds include US Pat. No. 6,368,356; 6,344,035; 6,344,028; 6,287,285; 6,200,304; 5,824,049; 5,749,915; 5,674,242; 5,670,161; 5,609,629; 5,593,974; and 5,470,307.
Aunque la presente invención ha sido descrita con especificidad de acuerdo con ciertas realizaciones, los siguientes ejemplos sirven solamente para ilustrar la invención y no están destinados a limitar la misma. Although the present invention has been specifically described in accordance with certain embodiments, the following examples serve only to illustrate the invention and are not intended to limit the invention.
45 Ejemplos 45 Examples
Ejemplo 1 Example 1
Nucleósido-fosforamiditas para la síntesis de oligonucleótidos desoxi y 2'-alcoxi-amiditas Nucleoside-phosphoramidites for the synthesis of deoxy and 2'-alkoxy-amidite oligonucleotides
Las 2'-desoxi y 2'-metoxi-beta-cianoetildiisopropil-fosforamiditas se adquirieron en fuentes comerciales (p. ej. Chemgenes, Needham MA o Glen Research, Inc. Sterling VA). Otras nucleósido-amiditas sustituidas con 2'-O-alcoxi The 2'-deoxy and 2'-methoxy-beta-cyanoethyldiisopropyl phosphoramidites were purchased from commercial sources (eg Chemgenes, Needham MA or Glen Research, Inc. Sterling VA). Other 2'-O-alkoxy-substituted nucleoside-amidites
50 se prepararon como se describe en la patente de EE.UU. 5.506.351. Para los oligonucleótidos sintetizados usando 2'-alcoxi-amiditas, se usó el ciclo estándar para oligonucleótidos no modificados, excepto que la etapa de espera después del suministro de pulso de tetrazol y base se aumentó a 360 s. 50 were prepared as described in US Pat. 5,506,351. For oligonucleotides synthesized using 2'-alkoxy-amidites, the standard cycle for unmodified oligonucleotides was used, except that the waiting step after tetrazol and base pulse delivery was increased to 360 s.
Los oligonucleótidos que contenían 5-metil-2'-desoxicitidina (5-Me-C) se sintetizaron según los métodos publicados [Sanghvi, et. al., Nucleic Acids Research, 1993, 21, 3197-3203] usando fosforamiditas disponibles en el comercio Oligonucleotides containing 5-methyl-2'-deoxycytidine (5-Me-C) were synthesized according to published methods [Sanghvi, et. al., Nucleic Acids Research, 1993, 21, 3197-3203] using commercially available phosphoramidites
55 (Glen Research, Sterling VA o ChemGenes, Needham MA). 55 (Glen Research, Sterling VA or ChemGenes, Needham MA).
2'-Fluoro-amiditas 2'-Fluoro-amidites
2'-Fluorodesoxiadenosina-amiditas 2'-Fluorodeoxydenosine-amidites
Los 2'-fluoro-oligonucleótidos se sintetizaron como se ha descrito previamente [Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841] y patente de Estados Unidos 5.670.633. Brevemente, el nucleósido protegido N6-benzoil-2'desoxi-2'-fluoroadenosina se sintetizó usando la 9-beta-D-arabinofuranosiladenina disponible en el comercio como material de partida y modificando los procedimientos de la bibliografía de modo que se introdujera el átomo 2'-alfafluoro por un desplazamiento SN2 de un grupo 2'-beta-tritilo. Por lo tanto, la N6-benzoil-9-beta-Darabinofuranosiladenina se protegió selectivamente con rendimiento moderado como el 3',5'-ditetrahidropiranilo (THP) intermedio. La desprotección de los grupos THP y N6-benzoilo se llevó a cabo usando metodologías convencionales y métodos convencionales para obtener el 5'-dimetoxitritil-(DMT) y 5'-DMT-3'-fosforamidita intermedios. The 2'-fluoro-oligonucleotides were synthesized as previously described [Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841] and US Patent 5,670,633. Briefly, the protected nucleoside N6-benzoyl-2'-deoxy-2'-fluoroadenosine was synthesized using commercially available 9-beta-D-arabinofuranosiladenine as a starting material and modifying the literature procedures so that the atom was introduced 2'-alphafluoro by an SN2 shift of a 2'-beta-trityl group. Therefore, N6-benzoyl-9-beta-Darabinofuranosiladenine was selectively protected with moderate yield as the intermediate 3 ', 5'-ditetrahydropyranil (THP). The deprotection of the THP and N6-benzoyl groups was carried out using standard methodologies and standard methods to obtain the intermediate 5'-dimethoxytryl- (DMT) and 5'-DMT-3'-phosphoramidite.
2'-Fluorodesoxiguanosina 2'-Fluorodeoxyguanosine
La síntesis de la 2'-desoxi-2'-fluoroguanosina se llevó a cabo usando 9-beta-D-arabinofuranosilguanina protegida con tetraisopropildisiloxanilo (TPDS) como material de partida, y conversión a la diisobutirilarabinofuranosilguanosina intermedia. A la desprotección del grupo TPDS le siguió la protección del grupo hidroxilo con THP para dar la arabinofuranosilguanina protegida con diisobutiril-di-THP. A la O-desacetilación selectiva y formación de triflato le siguió el tratamiento del producto bruto con fluoruro, y después desprotección de los grupos THP. Synthesis of 2'-deoxy-2'-fluoroguanosine was carried out using tetraisopropyldisiloxanyl-protected 9-beta-D-arabinofuranosylguanine (TPDS) as the starting material, and conversion to intermediate diisobutyrylarabinofuranosylguanosine. Deprotection of the TPDS group was followed by protection of the hydroxyl group with THP to give the diisobutyryl-di-THP protected arabinofuranosylguanine. Selective O-deacetylation and triflate formation was followed by treatment of the crude product with fluoride, and then deprotection of the THP groups.
Se usaron metodologías convencionales para obtener las 5'-DMT- y 5'-DMT-3'-fosforamiditas. Conventional methodologies were used to obtain the 5'-DMT- and 5'-DMT-3'-phosphoramidites.
2'-Fluorouridina 2'-Fluorouridine
La síntesis de la 2'-desoxi-2'-fluorouridina se llevó a cabo por modificación de un procedimiento de la bibliografía, en el que el 2,2'-anhidro-1-beta-D-arabinofuranosiluracilo se trató con fluoruro de hidrógeno-piridina al 70%. Se usaron procedimientos convencionales para obtener las 5'-DMT- y 5'-DMT-3'-fosforamiditas. The synthesis of 2'-deoxy-2'-fluorouridine was carried out by modification of a procedure in the literature, in which 2,2'-anhydro-1-beta-D-arabinofuranosiluracil was treated with hydrogen fluoride -pyridine 70%. Conventional procedures were used to obtain the 5'-DMT- and 5'-DMT-3'-phosphoramidites.
2'-Fluorodesoxicitidina 2'-Fluorodeoxycytidine
La 2'-desoxi-2'-fluorocitidina se sintetizó por aminación de 2'-desoxi-2'-fluorouridina, seguido de protección selectiva para dar N4-benzoil-2'-desoxi-2'-fluorocitidina. Se usaron procedimientos convencionales para obtener las 5'-DMT-y 5'-DMT-3'-fosforamiditas. 2'-Deoxy-2'-fluorocytidine was synthesized by amination of 2'-deoxy-2'-fluorouridine, followed by selective protection to give N4-benzoyl-2'-deoxy-2'-fluorocytidine. Conventional procedures were used to obtain the 5'-DMT- and 5'-DMT-3'-phosphoramidites.
Amiditas modificadas con 2'-O-(2-metoxietilo) 2'-O- (2-methoxyethyl) modified amidites
Las nucleósido-amiditas sustituidas con 2'-O-metoxietilo se preparan como sigue, o alternativamente, de acuerdo con los métodos de Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504. 2'-O-methoxyethyl substituted nucleoside amidites are prepared as follows, or alternatively, according to the methods of Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504.
2,2'-Anhidro[1-(beta-D-arabinofuranosil)-5-metiluridina] 2,2'-Anhydro [1- (beta-D-arabinofuranosyl) -5-methyluridine]
Se añadieron 5-metiluridina (ribosiltimina, disponible en el comercio en Yamasa, Choshi, Japón) (72,0 g, 0,279 M), carbonato de difenilo (90,0 g, 0,420 M) y bicarbonato sódico (2,0 g, 0,024 M) a DMF (300 ml). La mezcla se calentó a la temperatura de reflujo, con agitación dejando que se liberara de una forma controlada el dióxido de carbono gaseoso formado. Después de 1 h, la disolución ligeramente oscurecida se concentró a presión reducida. El jarabe resultante se vertió en éter dietílico (2,5 litros), con agitación. El producto formó una goma. El éter se decantó y el residuo se disolvió en la mínima cantidad de metanol (aproximadamente 400 ml). La disolución se vertió en éter dietílico de nueva aportación (2,5 litros) para dar una goma rígida. El éter dietílico se decantó y la goma se secó en un horno con vacío (60°C a 1 mm de Hg durante 24 h) para dar un sólido que se trituró hasta un polvo marrón claro (57 g, 85% de rendimiento bruto). El espectro de RMN estaba de acuerdo con la estructura, contaminada con fenol en forma de su sal de sodio (aproximadamente 5%). El material se usó como estaba para las reacciones posteriores (o se purificó más por cromatografía en columna usando un gradiente de metanol en acetato de etilo (10-25%) para dar un sólido blanco, p.f. 222-4°C). 5-Methyluridine (ribosiltimine, commercially available from Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenyl carbonate (90.0 g, 0.420 M), and sodium bicarbonate (2.0 g,) were added. 0.024 M) to DMF (300 ml). The mixture was heated to reflux temperature, with stirring allowing the formed carbon dioxide gas to be released in a controlled manner. After 1 h, the slightly darkened solution was concentrated under reduced pressure. The resulting syrup was poured into diethyl ether (2.5 liters), with stirring. The product formed a gum. The ether was decanted and the residue was dissolved in the smallest amount of methanol (approximately 400 ml). The solution was poured into fresh diethyl ether (2.5 liters) to give a stiff gum. The diethyl ether was decanted and the gum was dried in a vacuum oven (60 ° C at 1mm Hg for 24h) to give a solid which was ground to a light brown powder (57g, 85% crude yield) . The NMR spectrum was in agreement with the structure, contaminated with phenol in the form of its sodium salt (approximately 5%). The material was used as is for subsequent reactions (or further purified by column chromatography using a gradient of methanol in ethyl acetate (10-25%) to give a white solid, mp 222-4 ° C).
2'-O-Metoxietil-5-metiluridina 2'-O-Methoxyethyl-5-methyluridine
Se añadieron 2,2'-anhidro-5-metiluridina (195 g, 0,81 M), tris(2-metoxietil)borato (231 g, 0,98 M) y 2-metoxietanol (1,2 litros) en un recipiente de presión de acero inoxidable de 2 litros y se puso en un baño de aceite previamente calentado a 160°C. Después de calentar durante 48 h a 155-160°C, el recipiente se abrió y la disolución se evaporó hasta sequedad y se trituró con MeOH (200 ml). El residuo se suspendió en acetona caliente (1 litro). Las sales insolubles se filtraron, se lavaron con acetona (150 ml) y el filtrado se evaporó. El residuo (280 g) se disolvió en CH3CN (600 ml) y se evaporó. Una columna de gel de sílice (3 kg) se empaquetó en CH2Cl2/acetona/MeOH (20:5:3) que contenía Et3NH al 0,5%. El residuo se disolvió en CH2Cl2 (250 ml) y se adsorbió sobre sílice (150 g) antes de cargarlo en la columna. El producto se eluyó con el disolvente de empaquetamiento para dar 160 g (63%) de producto. Se obtuvo material adicional volviendo a tratar las fracciones impuras. 2,2'-Anhydro-5-methyluridine (195 g, 0.81 M), tris (2-methoxyethyl) borate (231 g, 0.98 M) and 2-methoxyethanol (1.2 liters) were added in a 2 liter stainless steel pressure vessel and placed in an oil bath previously heated to 160 ° C. After heating for 48 hr at 155-160 ° C, the container was opened and the solution was evaporated to dryness and triturated with MeOH (200 ml). The residue was suspended in hot acetone (1 liter). Insoluble salts were filtered, washed with acetone (150 ml) and the filtrate was evaporated. The residue (280 g) was dissolved in CH3CN (600 ml) and evaporated. A column of silica gel (3 kg) was packed in CH2Cl2 / acetone / MeOH (20: 5: 3) containing 0.5% Et3NH. The residue was dissolved in CH2Cl2 (250 ml) and adsorbed on silica (150 g) before loading on the column. The product was eluted with the packaging solvent to give 160 g (63%) of product. Additional material was obtained by re-treating the impure fractions.
2'-O-Metoxietil-5'-O-dimetoxitritil-5-metiluridina 2'-O-Methoxyethyl-5'-O-dimethoxytryl-5-methyluridine
La 2'-O-Metoxietil-5-metiluridina (160 g, 0,506 M) se coevaporó con piridina (250 ml) y el residuo seco se disolvió en piridina (1,3 litros). Se añadió una primera parte alícuota de cloruro de dimetoxitritilo (94,3 g, 0,278 M) y la mezcla se agitó a temperatura ambiente durante 1 hora. Se añadió una segunda parte alícuota de cloruro de dimetoxitritilo 5 (94,3 g, 0,278 M) y la reacción se agitó durante una hora adicional. Después se añadió metanol (170 ml) para parar la reacción. La HPLC mostró la presencia de aproximadamente 70% de producto. Se evaporó el disolvente y se trituró con CH3CN (200 ml). El residuo se disolvió en CHCl3 (1,5 litros) y se extrajo con 2x500 ml de disolución saturada de NaHCO3 y 2x500 ml de disolución saturada de NaCl. La fase orgánica se secó sobre Na2SO4, se filtró y se evaporó. Se obtuvieron 275 g de residuo. El residuo se purificó en una columna de gel de sílice de 3,5 kg 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was coevaporated with pyridine (250 ml) and the dry residue was dissolved in pyridine (1.3 liters). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the mixture was stirred at room temperature for 1 hour. A second aliquot of dimethoxytrityl chloride 5 (94.3g, 0.278M) was added and the reaction stirred for an additional hour. Then methanol (170 ml) was added to stop the reaction. HPLC showed the presence of approximately 70% product. Solvent was evaporated and triturated with CH3CN (200 ml). The residue was dissolved in CHCl3 (1.5 liters) and extracted with 2x500 ml of saturated NaHCO3 solution and 2x500 ml of saturated NaCl solution. The organic phase was dried over Na2SO4, filtered and evaporated. 275 g of residue were obtained. The residue was purified on a 3.5 kg silica gel column
10 empaquetada y eluida con EtOAc/hexano/acetona (5:5:1) que contenía Et3NH al 0,5%. Las fracciones puras se evaporaron para dar 164 g de producto. Se obtuvieron aproximadamente 20 g adicionales de las fracciones impuras para dar un rendimiento total de 183 g (57%). Packaged and eluted with EtOAc / hexane / acetone (5: 5: 1) containing 0.5% Et3NH. The pure fractions were evaporated to give 164 g of product. Approximately 20 additional g of the impure fractions were obtained to give a total yield of 183 g (57%).
3'-O-Acetil-2'-O-metoxietil-5'-O-dimetoxitritil-5-metiluridina 3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine
Se combinaron la 2'-O-metoxietil-5'-O-dimetoxitritil-5-metiluridina (106 g, 0,167 M), DMF/piridina (750 ml de una 2'-O-methoxyethyl-5'-O-dimethoxytryl-5-methyluridine (106 g, 0.167 M), DMF / pyridine (750 ml of a
15 mezcla 3:1 preparada a partir de 562 ml de DMF y 188 ml de piridina) y anhídrido acético (24,38 ml, 0,258 M) y se agitaron a temperatura ambiente durante 24 h. La reacción se siguió por TLC inactivando primero la muestra de TLC por adición de MeOH. Tras completarse la reacción, que se juzga por la TLC, se añadió MeOH (50 ml) y la mezcla se evaporó a 35°C. El residuo se disolvió en CHCl3 (800 ml) y se extrajo con 2x200 ml de disolución saturada de bicarbonato sódico y 2x200 ml de disolución saturada de NaCl. Las capas acuosas se volvieron a extraer con 200 ml 3: 1 mixture prepared from 562 ml of DMF and 188 ml of pyridine) and acetic anhydride (24.38 ml, 0.258 M) and stirred at room temperature for 24 h. The reaction was followed by TLC by first quenching the TLC sample by addition of MeOH. After completion of the reaction, which is judged by TLC, MeOH (50 ml) was added and the mixture was evaporated at 35 ° C. The residue was dissolved in CHCl3 (800 ml) and extracted with 2x200 ml of saturated sodium bicarbonate solution and 2x200 ml of saturated NaCl solution. The aqueous layers were re-extracted with 200 ml
20 de CHCl3. Las capas orgánicas combinadas se secaron con sulfato sódico y se evaporaron para dar 122 g del residuo (aproximadamente 90% de producto). El residuo se purificó en una columna de gel de sílice de 3,5 kg y se eluyó usando EtOAc/hexano (4:1). Las fracciones de producto puro se evaporaron para dar 96 g (84%). Se recuperaron 1,5 g adicionales de las últimas fracciones. CHCl3. The combined organic layers were dried with sodium sulfate and evaporated to give 122 g of the residue (approximately 90% product). The residue was purified on a 3.5 kg silica gel column and eluted using EtOAc / hexane (4: 1). The pure product fractions were evaporated to give 96 g (84%). An additional 1.5 g of the last fractions was recovered.
3'-O-Acetil-2'-O-metoxietil-5'-O-dimetoxitritil-5-metil-4-triazoluridina 3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triazoluridine
25 Se preparó una primera disolución disolviendo 3'-O-acetil-2'-O-metoxietil-5'-O-dimetoxitritil-5-metiluridina (96 g, 0,144 M) en CH3CN (700 ml) y se dejó aparte. Se añadió trietilamina (189 ml, 1,44 M) a una disolución de triazol (90 g, 1,3 M) en CH3CN (1 litro), se enfrió a -5°C y se agitó durante 0,5 h usando un agitador de varilla. Se añadió gota a gota POCl3 a lo largo de un periodo de 30 min, a la disolución agitada mantenida a 0-10°C, y la mezcla resultante se agitó durante 2 h adicionales. Se añadió gota a gota la primera disolución, a lo largo de un periodo de 45 min, a esta A first solution was prepared by dissolving 3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytryl-5-methyluridine (96g, 0.144M) in CH3CN (700ml) and set aside. Triethylamine (189 ml, 1.44 M) was added to a solution of triazole (90 g, 1.3 M) in CH3CN (1 liter), cooled to -5 ° C and stirred for 0.5 h using a rod stirrer. POCl3 was added dropwise over a period of 30 min, to the stirred solution maintained at 0-10 ° C, and the resulting mixture was stirred for an additional 2 h. The first solution was added dropwise, over a period of 45 min, to this
30 última disolución. La mezcla de reacción resultante se almacenó durante la noche en una habitación fría. Las sales se filtraron de la mezcla de reacción y se evaporó la disolución. El residuo se disolvió en EtOAc (1 litro) y los sólidos insolubles se separaron por filtración. El filtrado se lavó con 1x300 ml de NaHCO3 y 2x300 ml de disolución saturada de NaCl, se secó sobre sulfato magnésico y se evaporó. El residuo se trituró con EtOAc para dar el compuesto del título. 30 last dissolution. The resulting reaction mixture was stored overnight in a cold room. The salts were filtered from the reaction mixture and the solution was evaporated. The residue was dissolved in EtOAc (1 liter) and the insoluble solids were separated by filtration. The filtrate was washed with 1x300 ml of NaHCO3 and 2x300 ml of saturated NaCl solution, dried over magnesium sulfate and evaporated. The residue was triturated with EtOAc to give the title compound.
35 2'-O-Metoxietil-5'-O-dimetoxitritil-5-metilcitidina 2'-O-Methoxyethyl-5'-O-dimethoxytryl-5-methylcytidine
Una disolución de 3'-O-acetil-2'-O-metoxietil-5'-O-dimetoxitritil-5-metil-4-triazoluridina (103 g, 0,141 M) en dioxano (500 ml) y NH4OH (30 ml) se agitó durante 2 h. La disolución de dioxano se evaporó y el residuo se destiló azeotrópicamente con MeOH (2x200 ml). El residuo se disolvió en MeOH (300 ml) y se transfirió a un recipiente de presión de acero inoxidable de 2 litros. Se añadió MeOH (400 ml) saturado con NH3 gaseoso y el recipiente se A solution of 3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triazoluridine (103g, 0.141M) in dioxane (500ml) and NH4OH (30ml) stirred for 2 h. The dioxane solution was evaporated and the residue was azeotropically distilled with MeOH (2x200 ml). The residue was dissolved in MeOH (300 ml) and transferred to a 2 liter stainless steel pressure vessel. MeOH (400 ml) saturated with NH3 gas was added and the vessel was
40 calentó a 100°C durante 2 h (la TLC mostró la conversión completa). El contenido del recipiente se evaporó hasta sequedad y el residuo se disolvió en EtOAc (500 ml) y se lavó una vez con disolución saturada de NaCl (200 ml). Las capas orgánicas se secaron sobre sulfato sódico y el disolvente se evaporó para dar 85 g (95%) del compuesto del título. 40 heated at 100 ° C for 2 h (TLC showed complete conversion). The contents of the container were evaporated to dryness and the residue was dissolved in EtOAc (500 ml) and washed once with saturated NaCl solution (200 ml). The organic layers were dried over sodium sulfate, and the solvent was evaporated to give 85 g (95%) of the title compound.
N4-benzoil-2'-O-metoxietil-5'-O-dimetoxitritil-5-metil-citidina N4-benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-cytidine
45 Se disolvió 2'-O-metoxietil-5'-O-dimetoxitritil-5-metilcitidina (85 g, 0,134 M) en DMF (800 ml) y se añadió anhídrido benzoico (37,2 g, 0,165 M) con agitación. Después de agitar durante 3 h, la TLC mostraba que la reacción se había completado en aproximadamente 95%. El disolvente se evaporó y el residuo se destiló azeotrópicamente con MeOH (200 ml). El residuo se disolvió en CHCl3 (700 ml) y se extrajo con disolución saturada de NaHCO3 (2x300 ml) y disolución saturada de NaCl (2x300 ml), se secó sobre MgSO4 y se evaporó para dar el residuo (96 g). El residuo se 2'-O-methoxyethyl-5'-O-dimethoxytryl-5-methylcytidine (85g, 0.134M) was dissolved in DMF (800ml) and benzoic anhydride (37.2g, 0.165M) was added with stirring. After stirring for 3 hr, TLC showed that the reaction was approximately 95% complete. The solvent was evaporated and the residue was azeotropically distilled with MeOH (200 ml). The residue was dissolved in CHCl3 (700 ml) and extracted with saturated NaHCO3 solution (2x300 ml) and saturated NaCl solution (2x300 ml), dried over MgSO4 and evaporated to give the residue (96 g). The residue is
50 cromatografió en una columna de sílice de 1,5 kg usando EtOAc/hexano (1:1) que contenía Et3NH al 0,5% como disolvente de elución. Las fracciones del producto puro se evaporaron para dar 90 g (90%) del compuesto del título. Chromatographed on a 1.5 kg silica column using EtOAc / hexane (1: 1) containing 0.5% Et3NH as the elution solvent. The pure product fractions were evaporated to give 90 g (90%) of the title compound.
N4-benzoil-2'-O-metoxietil-5'-O-dimetoxitritil-5-metil-citidina-3'-amidita N4-benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-cytidine-3'-amidite
Se disolvió N4-benzoil-2'-O-metoxietil-5'-O-dimetoxitritil-5-metilcitidina (74 g, 0,10 M) en CH2Cl2 (1 litro). Se añadieron tetrazol diisopropilamina (7,1 g) y 2-cianoetoxi-tetra-(isopropil)fosfito (40,5 ml, 0,123 M) con agitación en 55 atmósfera de nitrógeno. La mezcla resultante se agitó durante 20 h a temperatura ambiente (la TLC mostró que la reacción se había completado en un 95%). La mezcla de reacción se extrajo con disolución saturada de NaHCO3 (1x300 ml) y disolución saturada de NaCl (3x300 ml). Los lavados acuosos se volvieron a extraer con CH2Cl2 (300 N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (74 g, 0.10 M) was dissolved in CH2Cl2 (1 liter). Diisopropylamine tetrazole (7.1 g) and 2-cyanoethoxy-tetra- (isopropyl) phosphite (40.5 ml, 0.123 M) were added with stirring under nitrogen atmosphere. The resulting mixture was stirred for 20 h at room temperature (TLC showed that the reaction was 95% complete). The reaction mixture was extracted with saturated NaHCO3 solution (1x300 ml) and saturated NaCl solution (3x300 ml). The aqueous washes were re-extracted with CH2Cl2 (300
ml), y los extractos se combinaron, se secaron sobre MgSO4 y se concentraron. El residuo obtenido se cromatografió en una columna de sílice de 1,5 kg usando EtOAc/hexano (3:1) como disolvente de elución. Las fracciones puras del producto se combinaron para dar 90,6 g (87%) del compuesto del título. ml), and the extracts were combined, dried over MgSO4 and concentrated. The obtained residue was chromatographed on a 1.5 kg silica column using EtOAc / hexane (3: 1) as the elution solvent. The pure product fractions were combined to give 90.6 g (87%) of the title compound.
2'-O-(Aminooxietil)-nucleósido-amiditas y 2'-O-(dimetilaminooxietil)-nucleósido-amiditas 2'-O- (Aminooxyethyl) -nucleoside-amidites and 2'-O- (dimethylaminooxyethyl) -nucleoside-amidites
5 2'-(Dimetilaminooxietoxi)-nucleósido-amiditas 5 2 '- (Dimethylaminooxyethoxy) -nucleoside-amidites
Las 2'-(dimetilaminooxietoxi)-nucleósido-amiditas [también conocidas en la técnica como 2'-O-(dimetilaminooxietil)nucleósido-amiditas] se preparan como se describe en los siguientes párrafos. Las nucleósido-amiditas de adenosina, citidina y guanosina se preparan de forma similar a la timidina (5-metiluridina) excepto que las aminas exocíclicas se protegen con un resto benzoilo en el caso de la adenosina y citidina y con un isobutirilo en el caso de The 2'- (dimethylaminooxyethoxy) -nucleoside-amidites [also known in the art as 2'-O- (dimethylaminooxyethyl) nucleoside-amidites] are prepared as described in the following paragraphs. The nucleoside-amidites of adenosine, cytidine, and guanosine are prepared similarly to thymidine (5-methyluridine) except that the exocyclic amines are protected with a benzoyl residue in the case of adenosine and cytidine and with an isobutyryl in the case of
10 la guanosina. Guanosine.
5'-O-terc-Butildifenilsilil-O2-2'-anhidro-5-metiluridina 5'-O-tert-Butyldiphenylsilyl-O2-2'-anhydro-5-methyluridine
Se disolvieron O2-2'-anhidro-5-metiluridina (Pro. Bio. Sint., Varese, Italia, 100,0 g, 0,416 mmol), dimetilaminopiridina (0,66 g, 0,013 eq, 0,0054 mmol) en piridina seca (500 ml) a temperatura ambiente en atmósfera de argón y con agitación mecánica. Se añadió terc-butildifenilclorosilano (125,8 g, 119,0 ml, 1,1 eq, 0,458 mmol) en una porción. La 15 reacción se agitó durante 16 h a temperatura ambiente. La TLC (Rf 0,22, acetato de etilo) indicó una reacción completa. La disolución se concentró a presión reducida hasta un aceite espeso. Este se repartió entre diclorometano (1 litro) y disolución saturada de bicarbonato sódico (2x1 litro) y salmuera (1 litro). La capa orgánica se secó sobre sulfato sódico y se concentró a presión reducida hasta un aceite espeso. El aceite se disolvió en una mezcla de acetato de etilo y éter dietílico 1:1 (600 ml) y la disolución se enfrió a -10°C. El producto cristalino O2-2'-Anhydro-5-methyluridine (Pro. Bio. Sint., Varese, Italy, 100.0 g, 0.416 mmol), dimethylaminopyridine (0.66 g, 0.013 eq, 0.0054 mmol) were dissolved in pyridine Dry (500 ml) at room temperature under an argon atmosphere and with mechanical agitation. Tert-Butyldiphenylchlorosilane (125.8 g, 119.0 ml, 1.1 eq, 0.458 mmol) was added in one portion. The reaction was stirred for 16 hr at room temperature. TLC (Rf 0.22, ethyl acetate) indicated a complete reaction. The solution was concentrated under reduced pressure to a thick oil. This was partitioned between dichloromethane (1 liter) and saturated sodium bicarbonate solution (2x1 liter) and brine (1 liter). The organic layer was dried over sodium sulfate and concentrated under reduced pressure to a thick oil. The oil was dissolved in a mixture of ethyl acetate and diethyl ether 1: 1 (600 ml) and the solution was cooled to -10 ° C. The crystalline product
20 resultante se recogió por filtración, se lavó con éter dietílico (3x200 ml) y se secó (40°C, 1 mm de Hg, 24 h) hasta 149 g (74,8%) de sólido blanco. La TLC y la RMN estaban de acuerdo con el producto puro. The resulting was collected by filtration, washed with diethyl ether (3x200 ml) and dried (40 ° C, 1 mm Hg, 24 h) to 149 g (74.8%) of white solid. TLC and NMR were in agreement with the pure product.
5'-O-terc-Butildifenilsilil-2'-O-(2-hidroxietil)-5-metiluridina 5'-O-tert-Butyldiphenylsilyl-2'-O- (2-hydroxyethyl) -5-methyluridine
En un reactor de presión sin agitación, de acero inoxidable de 2 litros, se añadió borano en tetrahidrofurano (1,0 M, 2,0 eq, 622 ml). En la campana extractora y con agitación manual, se añadió con cuidado primero etilenglicol (350 25 ml, exceso) hasta que disminuyó la evolución de hidrógeno gaseoso. Se añadieron 5'-O-terc-butildifenilsilil-O2-2'anhidro-5-metiluridina (149 g, 0,311 mol) y bicarbonato sódico (0,074 g, 0,003 eq) con agitación manual. El reactor se cerró herméticamente y se calentó en un baño de aceite hasta que se alcanzó una temperatura interior de 160ºC y después se mantuvo durante 16 h (presión < 7 kg/cm2). El recipiente de reacción se enfrió a temperatura ambiente y se abrió. La TLC (Rf 0,67 para el producto deseado y Rf 0,82 para el producto secundario ara-T, acetato de etilo) 30 indicaba una conversión al producto de aproximadamente 70%. Con el fin de evitar la formación de producto secundario adicional, se detuvo la reacción, se concentró a presión reducida (de 10 a 1 mm de Hg) en un baño de agua caliente (40-100°C) con las condiciones más extremas usadas para separar el etilenglicol. [Alternativamente, una vez que el disolvente de bajo punto de ebullición se ha separado, la disolución que queda se puede repartir entre acetato de etilo y agua. El producto estará en la fase orgánica]. El residuo se purificó por cromatografía en Borane in tetrahydrofuran (1.0M, 2.0eq, 622ml) was added to a 2-liter stainless steel non-stirring pressure reactor. In the fume hood and with manual agitation, ethylene glycol (350 25 ml, excess) was carefully added first until the evolution of hydrogen gas decreased. 5'-O-tert-Butyldiphenylsilyl-O2-2'anhydro-5-methyluridine (149g, 0.311mol) and sodium bicarbonate (0.074g, 0.003eq) were added with manual stirring. The reactor was hermetically sealed and heated in an oil bath until an internal temperature of 160 ° C was reached and then held for 16 h (pressure <7 kg / cm2). The reaction vessel was cooled to room temperature and opened. TLC (Rf 0.67 for the desired product and Rf 0.82 for the ara-T by-product, ethyl acetate) 30 indicated a conversion to the product of approximately 70%. In order to avoid the formation of additional secondary product, the reaction was stopped, concentrated under reduced pressure (10 to 1 mm Hg) in a hot water bath (40-100 ° C) with the most extreme conditions used to separate ethylene glycol. [Alternatively, once the low-boiling solvent has been removed, the remaining solution can be partitioned between ethyl acetate and water. The product will be in the organic phase]. The residue was purified by chromatography on
35 columna (2 kg de gel de sílice, gradiente de acetato de etilo-hexanos de 1:1 a 4:1). Se combinaron las fracciones adecuadas, se separaron los productos volátiles y se secaron para dar el producto en forma de una espuma blanca crujiente (84 g, 50%), material de partida contaminado (17,4 g) y material de partida puro reutilizable 20 g. El rendimiento basado en el material de partida menos puro recuperado era de 58%. La TLC y la RMN estaban de acuerdo con 99% de producto puro. 35 column (2 kg silica gel, ethyl acetate-hexanes gradient from 1: 1 to 4: 1). The appropriate fractions were combined, the volatiles were separated and dried to give the product as a crisp white foam (84g, 50%), contaminated starting material (17.4g), and reusable pure starting material. g. The yield based on the recovered least pure starting material was 58%. TLC and NMR were in agreement with 99% pure product.
40 2'-O-([2-ftalimidoxi)etil]-5'-t-butildifenilsilil-5-metiluridina 2'-O - ([2-phthalimidoxy) ethyl] -5'-t-butyldiphenylsilyl-5-methyluridine
Se mezcló la 5'-O-terc-butildifenilsilil-2'-O-(2-hidroxietil)-5-metiluridina (20 g, 36,98 mmol) con trifenilfosfina (11,63 g, 44,36 mmol) y N-hidroxiftalimida (7,24 g, 44,36 mmol). Después se secó sobre P2O5 con alto vacío durante dos días a 40°C. La mezcla de reacción se barrió con argón y se añadió THF seco (369,8 ml, Aldrich, botella con cierre hermético seguro) para dar una disolución transparente. Se añadió gota a gota azodicarboxilato de dietilo (6,98 ml, 45 44,36 mmol) a la mezcla de reacción. La velocidad de adición se mantiene de forma que la coloración rojo oscuro resultante acaba de bajar antes de añadir la siguiente gota. Tras completarse la adición, la reacción se agitó durante 4 h. En ese momento, la TLC mostró que la reacción se había completado (acetato de etilo:hexano, 60:40). El disolvente se evaporó a vacío. El residuo obtenido se puso en una columna ultrarrápida con acetato de etilo:hexano (60:40), para dar la 2'-O-([2-ftalimidoxi)etil]-5'-t-butildifenilsilil-5-metiluridina en forma de una espuma blanca (21,819 5'-O-tert-Butyldiphenylsilyl-2'-O- (2-hydroxyethyl) -5-methyluridine (20g, 36.98mmol) was mixed with triphenylphosphine (11.63g, 44.36mmol) and N -hydroxyphthalimide (7.24 g, 44.36 mmol). It was then dried over P2O5 under high vacuum for two days at 40 ° C. The reaction mixture was flushed with argon and dry THF (369.8 mL, Aldrich, securely sealed bottle) was added to give a clear solution. Diethyl azodicarboxylate (6.98 ml, 45 44.36 mmol) was added dropwise to the reaction mixture. The addition rate is maintained such that the resulting dark red coloration has just dropped before adding the next drop. After the addition was complete, the reaction was stirred for 4 h. At that time, TLC showed that the reaction was complete (ethyl acetate: hexane, 60:40). Solvent was evaporated in vacuo. The residue obtained was placed on a flash column with ethyl acetate: hexane (60:40), to give 2'-O - ([2-phthalimidoxy) ethyl] -5'-t-butyldiphenylsilyl-5-methyluridine as of a white foam (21,819
50 g, 86%). 50 g, 86%).
5'-O-terc-Butildifenilsilil-2'-O-[(2-formadoximinooxi)etil]-5-metiluridina 5'-O-tert-Butyldiphenylsilyl-2'-O - [(2-formedximinoxyxy) ethyl] -5-methyluridine
Se disolvió 2'-O-([2-ftalimidoxi)etil]-5'-t-butildifenilsilil-5-metiluridina (3,1 g, 4,5 mmol) en CH2Cl2 seco (4,5 ml) y se añadió gota a gota metilhidrazina (300 ml, 4,64 mmol) de -10°C a 0°C. Después de 1 h, la mezcla se filtró, el filtrado se lavó con CH2Cl2 enfriado con hielo y las fases orgánicas combinadas se lavaron con agua, salmuera y se secaron 55 sobre Na2SO4. La disolución se concentró para dar la 2'-O-(aminooxietil)timidina, que después se disolvió en MeOH (67,5 ml). A esta se le añadió formaldehído (disolución acuosa al 20%, 1,1 eq.) y la mezcla resultante se agitó durante 1 h. El disolvente se separó a vacío; el residuo se cromatografió para dar la 5'-O-terc-butildifenilsilil-2'-O-[(22'-O - ([2-Phthalimidoxy) ethyl] -5'-t-butyldiphenylsilyl-5-methyluridine (3.1g, 4.5mmol) was dissolved in dry CH2Cl2 (4.5ml) and drop was added methylhydrazine (300 ml, 4.64 mmol) dropwise from -10 ° C to 0 ° C. After 1 hr, the mixture was filtered, the filtrate was washed with ice cold CH2Cl2, and the combined organic phases were washed with water, brine, and dried over Na2SO4. The solution was concentrated to give 2'-O- (aminooxyethyl) thymidine, which was then dissolved in MeOH (67.5 ml). To this was added formaldehyde (20% aqueous solution, 1.1 eq.) And the resulting mixture was stirred for 1 h. The solvent was removed in vacuo; the residue was chromatographed to give 5'-O-tert-butyldiphenylsilyl-2'-O - [(2
formadoximinooxi)etil]-5-metiluridina en forma de una espuma blanca (1,95 g, 78%). Formedximinooxy) ethyl] -5-methyluridine as a white foam (1.95 g, 78%).
5'-O-terc-butildifenilsilil-2'-O-[N,N-dimetilaminooxietil]-5-metiluridina 5'-O-tert-butyldiphenylsilyl-2'-O- [N, N-dimethylaminooxyethyl] -5-methyluridine
Se disolvió la 5'-O-terc-butildifenilsilil-2'-O-[(2-formadoximinooxi)etil]-5-metiluridina (1,77 g, 3,12 mmol) en una disolución de p-toluenosulfonato de piridinio 1 M (PPTS) en MeOH seco (30,6 ml). Se añadió cianoborohidruro sódico (0,39 g, 6,13 mmol) a esta disolución a 10ºC en atmósfera inerte. La mezcla de reacción se agitó durante 10 minutos a 10ºC. Después de esto, el recipiente de reacción se retiró del baño de hielo y se agitó a temperatura ambiente durante 2 h, la reacción se siguió por TLC (MeOH al 5% en CH2Cl2). Se añadió disolución acuosa de NaHCO3 (al 5%, 10 ml) y se extrajo con acetato de etilo (2x20 ml). La fase de acetato de etilo se secó sobre Na2SO4 anhidro, y se evaporó a sequedad. El residuo se disolvió en una disolución de PPTS 1 M en MeOH (30,6 ml). Se añadió formaldehído (al 20% en p/p, 30 ml, 3,37 mmol) y la mezcla de reacción se agitó a temperatura ambiente durante 10 min. La mezcla de reacción se enfrió a 10ºC en un baño de hielo, se añadió cianoborohidruro sódico (0,39 g, 6,13 mmol) y la mezcla de reacción se agitó a 10ºC durante 10 min. Después de 10 min, la mezcla de reacción se retiró del baño de hielo y se agitó a temperatura ambiente durante 2 h. Se añadió a la mezcla de reacción disolución de NaHCO3 al 5% (25 ml) y se extrajo con acetato de etilo (2x25 ml). La capa de acetato de etilo se secó sobre Na2SO4 anhidro y se evaporó a sequedad. El residuo obtenido se purificó por cromatografía en columna ultrarrápida y se eluyó con MeOH al 5% en CH2Cl2 para dar la 5'-O-terc-butildifenilsilil-2'-O-[N,Ndimetilaminooxietil]-5-metiluridina en forma de una espuma blanca (14,6 g, 80%). 5'-O-tert-Butyldiphenylsilyl-2'-O - [(2-formaximinooxy) ethyl] -5-methyluridine (1.77g, 3.12mmol) was dissolved in a solution of pyridinium p-toluenesulfonate 1 M (PPTS) in dry MeOH (30.6 ml). Sodium cyanoborohydride (0.39 g, 6.13 mmol) was added to this solution at 10 ° C under an inert atmosphere. The reaction mixture was stirred for 10 minutes at 10 ° C. After this, the reaction vessel was removed from the ice bath and stirred at room temperature for 2 hr, the reaction was followed by TLC (5% MeOH in CH2Cl2). Aqueous NaHCO3 solution (5%, 10 ml) was added and extracted with ethyl acetate (2x20 ml). The ethyl acetate phase was dried over anhydrous Na2SO4, and evaporated to dryness. The residue was dissolved in a solution of 1M PPTS in MeOH (30.6 ml). Formaldehyde (20% w / w, 30 ml, 3.37 mmol) was added and the reaction mixture was stirred at room temperature for 10 min. The reaction mixture was cooled to 10 ° C in an ice bath, sodium cyanoborohydride (0.39g, 6.13mmol) was added and the reaction mixture was stirred at 10 ° C for 10 min. After 10 min, the reaction mixture was removed from the ice bath and stirred at room temperature for 2 h. 5% NaHCO3 solution (25 ml) was added to the reaction mixture and extracted with ethyl acetate (2x25 ml). The ethyl acetate layer was dried over anhydrous Na2SO4 and evaporated to dryness. The residue obtained was purified by flash column chromatography and eluted with 5% MeOH in CH2Cl2 to give 5'-O-tert-butyldiphenylsilyl-2'-O- [N, Ndimethylaminooxyethyl] -5-methyluridine in the form of a white foam (14.6 g, 80%).
2'-O-(Dimetilaminooxietil)-5-metiluridina 2'-O- (Dimethylaminooxyethyl) -5-methyluridine
Se disolvió trihidrofluoruro de trietilamina (3,91 ml, 24,0 mmol) en THF seco y trietilamina (1,67 ml, 12 mmol, seco, conservado sobre KOH). Después, la mezcla de trietilamina-2HF se añadió a la 5'-O-terc-butildifenilsilil-2'-O-[N,Ndimetilaminooxietil]-5-metiluridina (1,40 g, 2,4 mmol) y se agitó a temperatura ambiente durante 24 h. La reacción se siguió por TLC (MeOH al 5% en CH2Cl2). El disolvente se separó a vacío y el residuo se puso en una columna ultrarrápida con MeOH al 10% en CH2Cl2 para dar la 2'-O-(dimetilaminooxietil)-5-metiluridina (766 mg, 92,5%). Triethylamine trihydrofluoride (3.91 ml, 24.0 mmol) was dissolved in dry THF and triethylamine (1.67 ml, 12 mmol, dry, preserved over KOH). The triethylamine-2HF mixture was then added to 5'-O-tert-butyldiphenylsilyl-2'-O- [N, N-dimethylaminooxyethyl] -5-methyluridine (1.40g, 2.4mmol) and stirred at room temperature for 24 h. The reaction was followed by TLC (5% MeOH in CH2Cl2). The solvent was removed in vacuo and the residue was placed on a flash column with 10% MeOH in CH2Cl2 to give 2'-O- (dimethylaminooxyethyl) -5-methyluridine (766 mg, 92.5%).
5'-O-DMT-2'-O-(dimetilaminooxietil)-5-metiluridina 5'-O-DMT-2'-O- (dimethylaminooxyethyl) -5-methyluridine
La 2'-O-(dimetilaminooxietil)-5-metiluridina (750 mg, 2,17 mmol) se secó sobre P2O5 con alto vacío durante la noche a 40°C. Después se coevaporó con piridina anhidra (20 ml). El residuo obtenido se disolvió en piridina (11 ml) en atmósfera de argón. Se añadieron 4-dimetilaminopiridina (26,5 mg, 2,60 mmol), cloruro de 4,4'-dimetoxitritilo (880 mg, 2,60 mmol) a la mezcla y la reacción se agitó a temperatura ambiente hasta que todo el material de partida había desaparecido. La piridina se separó a vacío y el residuo se cromatografió y se eluyó con MeOH al 10% en CH2Cl2 (que contenía unas gotas de piridina) para dar la 5'-O-DMT-2'-O-(dimetilamino-oxietil)-5-metiluridina (1,13 g, 80%). 2'-O- (dimethylaminooxyethyl) -5-methyluridine (750mg, 2.17mmol) was dried over P2O5 under high vacuum overnight at 40 ° C. It was then coevaporated with anhydrous pyridine (20 ml). The obtained residue was dissolved in pyridine (11 ml) under an argon atmosphere. 4-Dimethylaminopyridine (26.5mg, 2.60mmol), 4,4'-dimethoxytrityl chloride (880mg, 2.60mmol) were added to the mixture and the reaction was stirred at room temperature until all material starting it had disappeared. The pyridine was removed in vacuo and the residue was chromatographed and eluted with 10% MeOH in CH2Cl2 (containing a few drops of pyridine) to give the 5'-O-DMT-2'-O- (dimethylamino-oxyethyl) - 5-methyluridine (1.13 g, 80%).
5'-O-DMT-2'-O-(2-N,N-dimetilaminooxietil)-5-metiluridina-3'-[(2-cianoetil)-N,N-diisopropilfosforamidita] 5'-O-DMT-2'-O- (2-N, N-dimethylaminooxyethyl) -5-methyluridine-3 '- [(2-cyanoethyl) -N, N-diisopropylphosphoramidite]
La 5'-O-DMT-2'-O-(dimetilaminooxietil)-5-metiluridina (1,08 g, 1,67 mmol) se coevaporó con tolueno (20 ml). Al residuo se le añadió N,N-diisopropilamina tetrazónido (0,29 g, 1,67 mmol) y se secó sobre P2O5 con alto vacío durante la noche a 40°C. Después la mezcla de reacción se disolvió en acetonitrilo anhidro (8,4 ml) y se añadió 2cianoetil-N,N,N1,N1-tetraisopropilfosforamidita (2,12 ml, 6,08 mmol). La mezcla de reacción se agitó a temperatura ambiente durante 4 h en atmósfera inerte. La evolución de la reacción se siguió por TLC (hexano:acetato de etilo 1:1). El disolvente se evaporó, después el residuo se disolvió en acetato de etilo (70 ml) y se lavó con disolución acuosa de NaHCO3 al 5% (40 ml). La capa de acetato de etilo se secó sobre Na2SO4 anhidro y se concentró. El residuo obtenido se cromatografió (acetato de etilo como eluyente) para dar la 5'-O-DMT-2'-O-(2-N,Ndimetilaminooxietil)-5-metiluridina-3'-[(2-cianoetil)-N,N-diisopropilfosforamidita] en forma de una espuma (1,04 g, 74,9%). 5'-O-DMT-2'-O- (dimethylaminooxyethyl) -5-methyluridine (1.08g, 1.67mmol) was coevaporated with toluene (20ml). To the residue was added N, N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) and dried over P2O5 under high vacuum overnight at 40 ° C. Then the reaction mixture was dissolved in anhydrous acetonitrile (8.4 ml) and 2-cyanoethyl-N, N, N1, N1-tetraisopropylphosphoramidite (2.12 ml, 6.08 mmol) was added. The reaction mixture was stirred at room temperature for 4 h under an inert atmosphere. The evolution of the reaction was followed by TLC (1: 1 hexane: ethyl acetate). The solvent was evaporated, then the residue was dissolved in ethyl acetate (70 ml) and washed with 5% aqueous NaHCO3 solution (40 ml). The ethyl acetate layer was dried over anhydrous Na2SO4 and concentrated. The obtained residue was chromatographed (ethyl acetate as eluant) to give 5'-O-DMT-2'-O- (2-N, Ndimethylaminooxyethyl) -5-methyluridine-3 '- [(2-cyanoethyl) -N , N-diisopropylphosphoramidite] as a foam (1.04 g, 74.9%).
2'-(Aminooxietoxi)-nucleósido-amiditas 2 '- (Aminooxyethoxy) -nucleoside-amidites
Las 2'-(aminooxietoxi)-nucleósido-amiditas [también conocidas en la técnica como 2'-O-(aminooxietil)-nucleósidoamiditas] se preparan como se describe en los siguiente párrafos. Las nucleósido-amiditas de adenosina, citidina y timidina se preparan como sigue. The 2'- (aminooxyethoxy) -nucleoside-amidites [also known in the art as 2'-O- (aminooxyethyl) -nucleosidoamidites] are prepared as described in the following paragraphs. The nucleoside-amidites of adenosine, cytidine, and thymidine are prepared as follows.
N2-isobutiril-6-O-difenilcarbamoil-2'-O-(2-etilacetil)-5'-O-(4,4'-dimetoxitritil)guanosina-3'-[(2-cianoetil)-N,Ndiisopropilfosforamidita] N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O- (2-ethylacetyl) -5'-O- (4,4'-dimethoxytryl) guanosine-3 '- [(2-cyanoethyl) -N, Ndiisopropylphosphoramidite]
El análogo de 2'-O-aminooxietil-guanosina se puede obtener por 2'-O-alquilación selectiva de la diaminopurinaribósido. Se pueden adquirir cantidades de multigramos de diaminopurina-ribósido en Schering AG (Berlín) para proporcionar la 2'-O-(2-etilacetil)-diaminopurina-ribósido junto con una cantidad minoritaria del isómero 3'. El 2'-O-(2etilacetil)-diaminopurina-ribósido se puede resolver y convertir en la 2'-O-(2-etilacetil)guanosina por tratamiento con adenosina desaminasa. (McGee, D. P. C., Cook, P. D., Guinosso, C. J., publicación internacional WO 94/02501 A1 940203.) Los procedimientos de protección convencionales darían la 2'-O-(2-etilacetil)-5'-O-(4,4'dimetoxitritil)guanosina y la 2-N-isobutiril-6-O-difenilcarbamoil-2'-O-(2-etilacetil)-5'-O-(4,4'-dimetoxitritil)guanosina que se puede reducir para dar la 2-N-isobutiril-6-O-difenilcarbamoil-2'-O-(2-hidroxietil)-5'-O-(4,4'-dimetoxitritil)guanosina. The 2'-O-aminooxyethyl-guanosine analog can be obtained by selective 2'-O-alkylation of diaminopurinariboside. Multigrams of diaminopurine riboside can be purchased from Schering AG (Berlin) to provide 2'-O- (2-ethylacetyl) -diaminopurine riboside together with a minor amount of the 3 'isomer. 2'-O- (2ethylacetyl) -diaminopurine-riboside can be resolved and converted to 2'-O- (2-ethylacetyl) guanosine by treatment with adenosine deaminase. (McGee, DPC, Cook, PD, Guinosso, CJ, International Publication WO 94/02501 A1 940203.) Conventional protection procedures would give 2'-O- (2-ethylacetyl) -5'-O- (4.4 'dimethoxytryl) guanosine and 2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O- (2-ethylacetyl) -5'-O- (4,4'-dimethoxytryl) guanosine which can be reduced to give the 2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O- (2-hydroxyethyl) -5'-O- (4,4'-dimethoxytryl) guanosine.
Como antes, el grupo hidroxilo se puede desplazar mediante la N-hidroxiftalimida por una reacción de Mitsunobu, y se puede formar la fosforamidita del nucleósido protegido de la forma habitual para dar la 2-N-isobutiril-6-Odifenilcarbamoil-2'-O-([2-ftalmidoxi]etil)-5'-O-(4,4'-dimetoxitritil)guanosina-3'-[(2-cianoetil)-N,Ndiisopropilfosforamidita]. As before, the hydroxyl group can be displaced by N-hydroxyphthalimide by a Mitsunobu reaction, and phosphoramidite from the protected nucleoside can be formed in the usual way to give 2-N-isobutyryl-6-Odiphenylcarbamoyl-2'-O - ([2-phthamidoxy] ethyl) -5'-O- (4,4'-dimethoxytryl) guanosine-3 '- [(2-cyanoethyl) -N, Ndiisopropylphosphoramidite].
2'-dimetilaminoetoxietoxi (2'-DMAEOE)-nucleósido-amiditas 2'-dimethylaminoethoxyethoxy (2'-DMAEOE) -nucleoside-amidites
Las 2'-dimetilaminoetoxietoxi-nucleósido-amiditas (también conocidas en la técnica como 2'-O-dimetilaminoetoxietilo, es decir, 2'-O-CH2-O-CH2-N-(CH2)2, o 2'-DMAEOE-nucleósido-amiditas) se preparan como sigue. Otras nucleósidoamiditas se preparan de forma similar. The 2'-dimethylaminoethoxyethoxy-nucleoside-amidites (also known in the art as 2'-O-dimethylaminoethoxyethyl, i.e. 2'-O-CH2-O-CH2-N- (CH2) 2, or 2'-DMAEOE- nucleoside-amidites) are prepared as follows. Other nucleosidoamidites are prepared in a similar way.
2'-O-[2(2-N,N-dimetilaminoetoxi)etil]-5-metil-uridina 2'-O- [2 (2-N, N-dimethylaminoethoxy) ethyl] -5-methyl-uridine
El 2[2-(dimetilamino)etoxi]etanol (Aldrich, 6,66 g, 50 mmol) se añade lentamente a una disolución de borano en tetrahidrofurano (1 M, 10 ml, 10 mmol) con agitación en una bomba de 100 ml. Al disolverse el sólido evoluciona hidrógeno gaseoso. Se añaden O2-, 2'-anhidro-5-metiluridina (1,2 g, 5 mmol) y bicarbonato sódico (2,5 mg) y la bomba se cierra herméticamente, se pone en un baño de aceite y se calienta a 155°C durante 26 h. La bomba se enfría a temperatura ambiente. La disolución bruta se concentra y el residuo se reparte entre agua (200 ml) y hexanos (200 ml). El exceso de fenol se extrae en la capa de hexano. La capa acuosa se extrae con acetato de etilo (3x200 ml) y las capas orgánicas combinadas se lavan una vez con agua, se secan sobre sulfato sódico anhidro y se concentran. El residuo se pasa por una columna de gel de sílice usando metanol/cloruro de metileno 1:20 (que tenía 2% de trietilamina) como eluyente. Al concentrar las fracciones de la columna, se forma un sólido incoloro que se recoge para dar el compuesto del título en forma de un sólido blanco. 2 [2- (Dimethylamino) ethoxy] ethanol (Aldrich, 6.66 g, 50 mmol) is added slowly to a solution of borane in tetrahydrofuran (1M, 10 mL, 10 mmol) with stirring in a 100 mL pump . As the solid dissolves, gaseous hydrogen evolves. O2-, 2'-anhydro-5-methyluridine (1.2g, 5mmol) and sodium bicarbonate (2.5mg) are added and the pump is sealed, placed in an oil bath and heated to 155 ° C for 26 h. The pump cools down to room temperature. The crude solution is concentrated and the residue is partitioned between water (200 ml) and hexanes (200 ml). Excess phenol is removed in the hexane layer. The aqueous layer is extracted with ethyl acetate (3x200 ml) and the combined organic layers are washed once with water, dried over anhydrous sodium sulfate and concentrated. The residue is passed through a column of silica gel using 1:20 methanol / methylene chloride (which had 2% triethylamine) as the eluent. By concentrating the column fractions, a colorless solid forms which is collected to give the title compound as a white solid.
5'-O-Dimetoxitritil-2'-O-[2(2-N,N-dimetilaminoetoxi)-etil)]-5-metil-uridina 5'-O-Dimethoxytryl-2'-O- [2 (2-N, N-dimethylaminoethoxy) -ethyl)] - 5-methyl-uridine
A 0,5 g (1,3 mmol) de 2'-O-[2(2-N,N-dimetilamino-etoxi)etil)]-5-metil-uridina en piridina anhidra (8 ml), se añaden trietilamina (0,36 ml) y cloruro de dimetoxitritilo (DMT-Cl, 0,87 g, 2 eq.) y se agita durante 1 h. La mezcla de reacción se vierte en agua (200 ml) y se extrae con CH2Cl2 (2x200 ml). Las capas de CH2Cl2 combinadas se lavan con disolución saturada de NaHCO3, seguido de disolución saturada de NaCl y se secan sobre sulfato sódico anhidro. La evaporación del disolvente seguido de cromatografía en gel de sílice usando MeOH:CH2Cl2:Et3N (20:1, v/v, con 1% de trietilamina) da el compuesto del título. To 0.5 g (1.3 mmol) of 2'-O- [2 (2-N, N-dimethylamino-ethoxy) ethyl)] - 5-methyl-uridine in anhydrous pyridine (8 ml), triethylamine is added (0.36 ml) and dimethoxytrityl chloride (DMT-Cl, 0.87 g, 2 eq.) And stir for 1 h. The reaction mixture is poured into water (200 ml) and extracted with CH2Cl2 (2x200 ml). The combined CH2Cl2 layers are washed with saturated NaHCO3 solution, followed by saturated NaCl solution, and dried over anhydrous sodium sulfate. Evaporation of the solvent followed by chromatography on silica gel using MeOH: CH2Cl2: Et3N (20: 1, v / v, with 1% triethylamine) gives the title compound.
5'-O-Dimetoxitritil-2'-O-[2(2-N,N-dimetilamioetoxi)-etil)]-5-metil-uridina-3'-O-(cianoetil-N,N-diisopropil)fosforamidita 5'-O-Dimethoxytryl-2'-O- [2 (2-N, N-dimethylamioethoxy) -ethyl)] - 5-methyl-uridine-3'-O- (cyanoethyl-N, N-diisopropyl) phosphoramidite
Se añaden diisopropilaminotetrazólido (0,6 g) y 2-cianoetoxi-N,N-diisopropil-fosforamidita (1,1 ml, 2 eq.) a una disolución de 5'-O-dimetoxitritil-2'-O-[2(2-N,N-dimetilaminoetoxi)etil)]-5-metiluridina (2,17 g, 3 mmol) disuelta en CH2Cl2 (20 ml) en atmósfera de argón. La mezcla de reacción se agita durante la noche y se evapora el disolvente. El residuo resultante se purifica por cromatografía en columna ultrarrápida de gel de sílice con acetato de etilo como eluyente para dar el compuesto del título. Diisopropylaminotetrazolide (0.6 g) and 2-cyanoethoxy-N, N-diisopropyl-phosphoramidite (1.1 ml, 2 eq.) Are added to a solution of 5'-O-dimethoxytryl-2'-O- [2 ( 2-N, N-dimethylaminoethoxy) ethyl)] - 5-methyluridine (2.17 g, 3 mmol) dissolved in CH2Cl2 (20 ml) under argon atmosphere. The reaction mixture is stirred overnight and the solvent is evaporated. The resulting residue is purified by flash column chromatography on silica gel with ethyl acetate as the eluent to give the title compound.
Ejemplo 2 Example 2
Síntesis de oligonucleótidos Oligonucleotide synthesis
Los oligonucleótidos no sustituidos y sustituidos con fosfodiéster (P=O) se sintetizan en un sintetizador de ADN automático (Applied Biosystems modelo 380B) usando la química convencional de la fosforamidita con oxidación por yodo. The unsubstituted and phosphodiester substituted oligonucleotides (P = O) are synthesized on an automated DNA synthesizer (Applied Biosystems model 380B) using standard phosphoramidite chemistry with iodine oxidation.
Los fosforotioatos (P=S) se sintetizan como los oligonucleótidos fosfodiéster excepto que la botella de oxidación estándar se sustituyó por disolución de 1,1-dióxido de 3H-1,2-benzoditiol-3-ona 0,2 M en acetonitrilo para la tiación escalonada de los enlaces fosfito. La etapa de espera de la tiación se aumentó a 68 s y le siguió la etapa de rematado. Después de escisión de la columna de CPG y desbloqueo en hidróxido de amonio concentrado a 55°C (18 h), los oligonucleótidos se purificaron por precipitación dos veces con 2,5 volúmenes de etanol a partir de una disolución de NaCl 0,5 M. Los fosfinatos de oligonucleótidos se preparan como se describe en la patente de EE.UU. nº 5.508.270. Phosphorothioates (P = S) are synthesized as phosphodiester oligonucleotides except that the standard oxidation bottle was replaced by 0.2M solution of 3H-1,2-benzodithiol-3-one 1,1-dioxide in acetonitrile for staggered thiation of phosphite bonds. The waiting stage of tiation was increased to 68 s and the finishing stage followed. After cleavage of the CPG column and deblocking in concentrated ammonium hydroxide at 55 ° C (18 h), the oligonucleotides were purified by precipitation twice with 2.5 volumes of ethanol from a 0.5 M NaCl solution Oligonucleotide phosphinates are prepared as described in US Pat. No. 5,508,270.
Los alquilfosfonatos de oligonucleótidos se preparan como se describe en la patente de EE.UU. nº 4.469.863. Oligonucleotide alkyl phosphonates are prepared as described in US Patent No. No. 4,469,863.
Los 3'-desoxi-3'-metilen-fosfonatos de oligonucleótidos se preparan como se describe en las patentes de EE.UU. nº The oligonucleotide 3'-deoxy-3'-methylene phosphonates are prepared as described in US Pat. no.
5.610.289 o 5.625.050. 5,610,289 or 5,625,050.
Las fosforamiditas de oligonucleótidos se preparan como se describe en la patente de EE.UU. 5.256.775 o patente de EE.UU. 5.366.878. Oligonucleotide phosphoramidites are prepared as described in US Pat. 5,256,775 or U.S. Patent 5,366,878.
Los alquilfosfonotioato de oligonucleótidos se preparan como se describe en las solicitudes PCT publicadas PCT/US94/00902 y PCT/US93/06976 (publicadas como WO 94/17093 y WO 94/02499, respectivamente). Oligonucleotide alkyl phosphonothioate is prepared as described in published PCT applications PCT / US94 / 00902 and PCT / US93 / 06976 (published as WO 94/17093 and WO 94/02499, respectively).
Los 3'-desoxi-3'-amino-fosforamidatos de oligonucleótidos se preparan como se describe en la patente de EE.UU. The oligonucleotide 3'-deoxy-3'-amino-phosphoramidates are prepared as described in US Pat.
5.476.925. 5,476,925.
Los fosfotriésteres de oligonucleótidos se preparan como se describe en la patente de EE.UU. 5.023.243. Oligonucleotide phosphotriesters are prepared as described in US Pat. 5,023,243.
Los borano-fosfatos de oligonucleótidos se preparan como se describe en las patentes de EE.UU. 5.130.302 y Oligonucleotide borane phosphates are prepared as described in US Pat. 5,130,302 and
5.177.198. 5,177,198.
5 Ejemplo 3 5 Example 3
Síntesis de oligonucleósidos Oligonucleoside synthesis
Los oligonucleósidos unidos a metilenmetilimino, también identificados como oligonucleósidos unidos a MMI, oligonucleósidos unidos a metilendimetilhidrazo, también identificados como oligonucleósidos unidos a MDH, y oligonucleósidos unidos a metilencarbonilamino, también identificados como oligonucleósidos unidos a amida-3, y Methylenemethylimino-linked oligonucleosides, also identified as MMI-linked oligonucleosides, methylenedimethylhydrazo-linked oligonucleosides, also identified as MDH-linked oligonucleosides, and methylene-carbonylamino-linked oligonucleosides, also identified as amide-3-linked oligonucleosides, and
10 oligonucleósidos unidos a metilenaminocarbonilo, también identificados como oligonucleósidos unidos a amida-4, así como compuestos de cadena principal mixta que tienen, por ejemplo, uniones que alternan MMI y P=O o P=S se preparan como se describe en las patentes de EE.UU. 5.378.825, 5.386.023, 5.489.677, 5.602.240 y 5.610.289. 10 methyleneaminocarbonyl-linked oligonucleosides, also identified as amide-4-linked oligonucleosides, as well as mixed main chain compounds having, for example, alternating MMI and P = O or P = S linkages are prepared as described in US Patent Nos. USA 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289.
Los oligonucleósidos unidos a formacetal y tioformacetal se preparan como se describe en las patentes de EE.UU. The formacetal and thioformacetal linked oligonucleosides are prepared as described in US Pat.
5.264.562 y 5.264.564. 5,264,562 and 5,264,564.
15 Los oligonucleósidos unidos a óxido de etileno se preparan como se describe en la patente de EE.UU. 5.223.618. Oligonucleosides bound to ethylene oxide are prepared as described in US Pat. 5,223,618.
Ejemplo 4 Example 4
Síntesis de PNA PNA synthesis
Los ácidos nucleicos peptídicos (PNA) se preparan de acuerdo con cualquiera de diferentes procedimientos citados en Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 20 1996, 4, 5-23. También se pueden preparar de acuerdo con las patentes de EE.UU. 5.539.082, 5.700.922, y Peptide nucleic acids (PNA) are prepared according to any of several different procedures cited in Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 20 1996, 4, 5-23. They can also be prepared according to US Pat. 5,539,082, 5,700,922, and
5.719.262. 5,719,262.
Ejemplo 5 Example 5
Síntesis de oligonucleótidos quiméricos Synthesis of chimeric oligonucleotides
Los oligonucleótidos, oligonucleósidos u oligonucleótidos/oligonucleósidos mixtos quiméricos de la invención pueden The chimeric oligonucleotides, oligonucleosides, or mixed oligonucleotides / oligonucleosides of the invention can
25 ser de varios tipos. Estos incluyen un primer tipo en el que el segmento "hueco" de los nucleósidos ligados se sitúa entre los segmentos ala de 5' y 3' de nucleósidos unidos y un segundo tipo de "extremo abierto" en donde el segmento "huceo" se encuentra en el extremo, ya sea 3' o 5' terminal del compuesto oligomérico. Los oligonucleótidos del primer tipo también se conocen en la técnica como “gápmeros” u oligonucleótidos con hueco. Los oligonucleótidos del segundo tipo se conocen también en la técnica como "hemímeros" o "alámeros". 25 be of various kinds. These include a first type in which the "hollow" segment of linked nucleosides is located between the 5 'and 3' wing segments of linked nucleosides and a second type of "open end" where the "huceo" segment is located at the end, either 3 'or 5' terminal of the oligomeric compound. Oligonucleotides of the first type are also known in the art as "gapmers" or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as "hemimers" or "alphas".
30 [2'-O-Me]-[2'-desoxi]-[2'-O-Me] Oligonucleótidos fosforotioatos quiméricos 30 [2'-O-Me] - [2'-deoxy] - [2'-O-Me] Chimeric phosphorothioate oligonucleotides
Los oligonucleótidos quiméricos que tienen segmentos de oligonucleótido 2'-O-alquil-fosforotioato y 2'-desoxifosforotioato se sintetizan usando un sintetizador de ADN automático Applied Biosystems modelo 380B, como antes. Los oligonucleótidos se sintetizan usando el sintetizador automático y la 2'-desoxi-5'-dimetoxitritil-3'-O-fosforamidita para la parte de ADN y la 5'-dimetoxitritil-2'-O-metil-3'-O-fosforamidita para las alas 5' y 3'. El ciclo de síntesis 35 convencional se modifican aumentando la etapa de espera después del suministro de tetrazol y base a 600 s, repetido cuatro veces para el ARN y dos veces para el 2'-O-metilo. El oligonucleótido completamente protegido se escinde del soporte y el grupo fosfato se desprotege en amoniaco/etanol 3:1 a temperatura ambiente durante la noche y después se liofiliza hasta sequedad. Después se hace el tratamiento en amoniaco metanólico durante 24 h a temperatura ambiente para desproteger todas las bases y la muestra se liofiliza hasta sequedad otra vez. El Chimeric oligonucleotides having 2'-O-alkyl-phosphorothioate and 2'-deoxyphosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems Model 380B automated DNA synthesizer, as above. The oligonucleotides are synthesized using the automatic synthesizer and the 2'-deoxy-5'-dimethoxytryl-3'-O-phosphoramidite for the DNA part and the 5'-dimethoxytryl-2'-O-methyl-3'-O- phosphoramidite for the 5 'and 3' wings. The conventional synthesis cycle is modified by increasing the waiting step after tetrazole and base supply to 600 s, repeated four times for RNA and twice for 2'-O-methyl. The fully protected oligonucleotide is cleaved from the support and the phosphate group is deprotected in 3: 1 ammonia / ethanol at room temperature overnight and then lyophilized to dryness. The treatment is then done in methanolic ammonia for 24 h at room temperature to deprotect all the bases and the sample is lyophilized to dryness again. The
40 sedimento se vuelve a suspender en TBAF 1 M en THF durante 24 h a temperatura ambiente para desproteger las posiciones 2'. Después, la reacción se inactiva con TEAA 1 M y después la muestra se reduce a 1/2 de volumen mediante Rotavac antes de desalar en una columna de exclusión por tamaños G25. Después se analiza en el oligómero recuperado por espectrofotometría el rendimiento y la pureza por electroforesis capilar y espectrometría de masas. The pellet is resuspended in 1M TBAF in THF for 24 hr at room temperature to deprotect the 2 'positions. The reaction is then quenched with 1M TEAA and then the sample is reduced to 1/2 volume by Rotavac before desalting on a G25 size exclusion column. The yield and purity are then analyzed on the recovered oligomer spectrophotometrically by capillary electrophoresis and mass spectrometry.
45 [2'-O-(2-Metoxietil)]-[2'-desoxi]-(2'-O-(metoxietil)]-oligonucleótidos fosforotioatos quiméricos 45 [2'-O- (2-Methoxyethyl)] - [2'-deoxy] - (2'-O- (methoxyethyl)] - chimeric phosphorothioate oligonucleotides
Los [2'-O-(2-metoxietil)]-[2'-desoxi]-[-2'-O-(metoxietil)]-oligonucleótidos fosforotioato quiméricos se prepararon igual que el procedimiento anterior para el 2'-O-metil-oligonucleótido quimérico, sustituyendo las 2'-O-metil-amiditas por 2'O-(metoxietil)-amiditas. The [2'-O- (2-methoxyethyl)] - [2'-deoxy] - [- 2'-O- (methoxyethyl)] - chimeric phosphorothioate oligonucleotides were prepared in the same way as for the 2'-O- chimeric methyl-oligonucleotide, substituting 2'-O-methyl-amidites for 2'-O- (methoxyethyl) -amidites.
[2'-O-(2-Metoxietil)fosfodiéster]-[2'-desoxi-fosforotioato]-[2'-O-(2-metoxietil)-fosfodiéster]-oligonucleótidos quiméricos [2'-O- (2-Methoxyethyl) phosphodiester] - [2'-deoxy-phosphorothioate] - [2'-O- (2-methoxyethyl) -phosphodiester] -chimeric oligonucleotides
50 Los [2'-O-(2-metoxietil-fosfodiéster]-[2'-desoxi fosforotioato]-[2'-O-(metoxietil)-fosfodiéster]-oligonucleótidos The [2'-O- (2-methoxyethyl-phosphodiester] - [2'-deoxy phosphorothioate] - [2'-O- (methoxyethyl) -phosphodiester] -oligonucleotides
quiméricos se preparan igual que por el procedimiento anterior para los 2'-O-metil-oligonucleótidos quiméricos sustituyendo las 2'-O-metil-amiditas por 2'-O-(metoxietil)-amiditas, oxidación con yodo para generar los enlaces internucleótidos fosfodiéster dentro de las partes de ala para las estructuras quiméricas y sulfuración usando 1,1dióxido de 3,H-1,2-benzoditiol-3-ona (Beaucage Reagent) para generar los enlaces internucleótidos fosforotioato para la región interna del centro. Chimeric are prepared the same as by the previous procedure for the chimeric 2'-O-methyl-oligonucleotides substituting 2'-O- (methoxyethyl) -amidites for the 2'-O-methyl-amidites, oxidation with iodine to generate the internucleotide bonds phosphodiester within the wing portions for chimeric structures and sulfidation using 3, H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the inner center region.
Otros oligonucleótidos quiméricos, oligonucleósidos quiméricos y oligonucleótidos/oligonucleósidos mixtos quiméricos se sintetizan de acuerdo con la patente de Estados Unidos 5.623.065. Other chimeric oligonucleotides, chimeric oligonucleosides, and chimeric mixed oligonucleotides / oligonucleosides are synthesized according to US Patent 5,623,065.
Ejemplo 6 Example 6
Aislamiento de oligonucleótidos Oligonucleotide isolation
Tras la escisión de la columna de vidrio de poros controlados (Applied Biosystems) y el desbloqueo en hidróxido de amonio concentrado a 55°C durante 18 h, los oligonucleótidos u oligonucleósidos se purifican por precipitación dos veces en NaCl 0,5 M con 2,5 volúmenes de etanol. Los oligonucleótidos sintetizados se analizaron por electroforesis en gel de poliacrilamida en geles desnaturalizantes y se consideró que al menos 85% era material de longitud completa. Las cantidades relativas de enlaces fosforotioato y fosfodiéster obtenidos se comprobó periódicamente por espectroscopía de resonancia magnética nuclear de 31P, y para algunos estudios los oligonucleótidos se purificaron por HPLC como describen Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171. Los resultados obtenidos con el material purificado por HPLC eran similares a los obtenidos con el material no purificado por HPLC. After cleavage of the controlled-pore glass column (Applied Biosystems) and unblocking in concentrated ammonium hydroxide at 55 ° C for 18 h, the oligonucleotides or oligonucleosides are purified by precipitation twice in 0.5M NaCl with 2, 5 volumes of ethanol. The synthesized oligonucleotides were analyzed by polyacrylamide gel electrophoresis on denaturing gels and at least 85% were considered to be full length material. The relative amounts of phosphorothioate and phosphodiester bonds obtained were periodically checked by 31P nuclear magnetic resonance spectroscopy, and for some studies the oligonucleotides were purified by HPLC as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162- 18171. The results obtained with the HPLC-purified material were similar to those obtained with the non-HPLC-purified material.
Ejemplo 7 Example 7
Síntesis de oligonucleótidos - Formato de placa de 96 pocillos Oligonucleotide Synthesis - 96-well Plate Format
Los oligonucleótidos se sintetizaron mediante la química de la fosforamidita P(III) en fase sólida en un sintetizador automático capaz de ensamblar 96 secuencias simultáneamente en un formato de 96 pocillos estándar. Los enlaces internucleótidos fosfodiéster se proporcionaron por oxidación con yodo acuoso. Los enlaces internucleótidos fosforotioato se generaron por sulfuración usando 1,1-dióxido de 3,H-1,2-benzoditiol-3-ona (Beaucage Reagent) en acetonitrilo anhidro. Las beta-cianoetildiisopropil-fosforamiditas con base protegida convencionales se adquirieron en proveedores comerciales (p. ej. PE-Applied Biosystems, Foster City, CA, o Pharmacia, Piscataway, NJ). Los nucleósidos no convencionales se sintetizan por métodos patentados o conocidos de la bibliografía. Se usan como las beta-cianoetildiisopropil-fosforamiditas de base protegida. Oligonucleotides were synthesized by solid phase phosphoramidite P (III) chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a standard 96-well format. Phosphodiester internucleotide linkages were provided by oxidation with aqueous iodine. The phosphorothioate internucleotide linkages were generated by sulfidation using 3, H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucage Reagent) in anhydrous acetonitrile. Conventional protected base beta-cyanoethyldiisopropyl phosphoramidites were purchased from commercial suppliers (eg, PE-Applied Biosystems, Foster City, CA, or Pharmacia, Piscataway, NJ). Unconventional nucleosides are synthesized by proprietary or known literature methods. They are used as the protected base beta-cyanoethyldiisopropyl-phosphoramidites.
Los oligonucleótidos se escindieron del soporte y se desprotegieron con NH4OH concentrado a temperatura elevada (55-60°C) durante 12-16 h y después el producto liberado se secó a vacío. Después, el producto seco se volvió a suspender en agua estéril para dar una placa madre, a partir de la cual se diluyen todas las muestras de placa analíticas y de ensayo usando pipetas robóticas. The oligonucleotides were excised from the support and deprotected with concentrated NH4OH at elevated temperature (55-60 ° C) for 12-16 h and then the released product was dried in vacuo. The dried product was then resuspended in sterile water to give a mother plate, from which all test and analytical plate samples are diluted using robotic pipettes.
Ejemplo 8 Example 8
Análisis de oligonucleótidos - Formato de placa de 96 pocillos Oligonucleotide Analysis - 96-well Plate Format
La concentración de oligonucleótidos en cada pocillo se evaluó por dilución de las muestras y espectroscopía de absorción UV. La integridad de la longitud completa de los productos individuales se evaluó por electroforesis capilar (CE) en el formato de 96 pocillos (Beckman P/ACE™ NDQ) o, para las muestras preparadas individualmente, en un aparato comercial de CE (p. ej., Beckman P/ACE™ 5000, ABI 270). La composición de bases y de la cadena principal se confirmó por análisis de masas de los compuestos usando espectroscopía de masas por electropulverización. Todas las placas de ensayo se diluyeron a partir de la placa madre usando pipetas robóticas de un canal y múltiples canales. Se consideró que las placas eran aceptables si al menos 85% de los compuestos de la placa eran al menos 85% de la longitud completa. The concentration of oligonucleotides in each well was evaluated by dilution of the samples and UV absorption spectroscopy. The integrity of the full length of the individual products was evaluated by capillary electrophoresis (CE) in the 96-well format (Beckman P / ACE ™ NDQ) or, for samples prepared individually, in a commercial CE apparatus (eg. ., Beckman P / ACE ™ 5000, ABI 270). The composition of bases and of the main chain was confirmed by mass analysis of the compounds using electrospray mass spectroscopy. All test plates were diluted from the mother plate using robotic single and multi channel pipettes. Plates were considered acceptable if at least 85% of the compounds on the plate were at least 85% of the full length.
Ejemplo 9 Example 9
Cultivo celular y tratamiento de oligonucleótidos Cell culture and oligonucleotide treatment
El efecto de los compuestos antisentido en la expresión del ácido nucleico diana se puede ensayar en cualquiera de una variedad de tipos de células, con la condición de que el ácido nucleico diana esté presente en niveles medibles. Esto se puede determinar de forma rutinaria usando, por ejemplo PCR o análisis de transferencia Northern. Los siguientes 7 tipos de células se proporcionan solo con propósitos ilustrativos, pero se pueden usar rutinariamente otros tipos de células, con la condición de que la diana sea expresada en el tipo de célula elegido. Esto se puede determinar fácilmente por métodos rutinarios en la técnica, por ejemplo, análisis de transferencia Northern, ensayos de protección de ribonucleasa, o RT-PCR. The effect of antisense compounds on expression of the target nucleic acid can be tested in any of a variety of cell types, provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example PCR or Northern blot analysis. The following 7 cell types are provided for illustrative purposes only, but other cell types may be routinely used, provided that the target is expressed in the chosen cell type. This can be readily determined by routine methods in the art, eg, Northern blot analysis, ribonuclease protection assays, or RT-PCR.
Células T-24: T-24 cells:
La línea celular de carcinoma de células transicionales de vejiga humanas T-24 se obtuvo de la American Type Culture Collection (ATCC) (Manassas, VA). Las células T-24 se cultivaron de forma rutinaria en medio basal The T-24 human transitional cell bladder cell carcinoma cell line was obtained from the American Type Culture Collection (ATCC) (Manassas, VA). T-24 cells were routinely cultured in basal medium
completo McCoy 5A (Gibco/Life Technologies, Gaithersburg, MD) complementado con suero de ternero fetal al 10% (Gibco/Life Technologies, Gaithersburg, MD), penicilina 100 unidades por ml, y estreptomicina 100 microgramos por ml (Gibco/Life Technologies, Gaithersburg, MD). Se realizaron pases de las células de forma rutinaria por tripsinización y dilución cuando alcanzaron 90% de confluencia. Las células se sembraron en placas de 96 pocillos (Falcon-Primaria nº 3872) con una densidad de 7000 células/pocillo para usar en análisis de RT-PCR. McCoy 5A Complete (Gibco / Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco / Life Technologies, Gaithersburg, MD), penicillin 100 units per ml, and streptomycin 100 micrograms per ml (Gibco / Life Technologies , Gaithersburg, MD). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded in 96-well plates (Falcon-Primary # 3872) with a density of 7000 cells / well for use in RT-PCR analysis.
Para los análisis de transferencia Northern y otros análisis, las células se pueden sembrar en placas de tejido tisular de 100 mm u otras convencionales y tratar de forma similar, usando volúmenes de medio y el oligonucleótido adecuados. For Northern blot analysis and other analyzes, cells can be seeded into 100mm or other conventional tissue tissue plates and treated in a similar manner, using volumes of medium and the appropriate oligonucleotide.
Células A549: A549 cells:
La línea celular de carcinoma de pulmón humano A549 se obtuvo de la American Type Culture Collection (ATCC) (Manassas, VA). Las células A549 se cultivaron de forma rutinaria en medio basal DMEM (Gibco/Life Technologies, Gaithersburg, MD) complementado con suero de ternero fetal al 10% (Gibco/Life Technologies, Gaithersburg, MD), penicilina 100 unidades por ml y estreptomicina 100 microgramos por ml (Gibco/Life Technologies, Gaithersburg, MD). Se realizaron pases de las células de forma rutinaria por tripsinización y dilución cuando alcanzaron 90% de confluencia. The A549 human lung carcinoma cell line was obtained from the American Type Culture Collection (ATCC) (Manassas, VA). A549 cells were routinely cultured in DMEM basal medium (Gibco / Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco / Life Technologies, Gaithersburg, MD), penicillin 100 units per ml, and streptomycin 100 micrograms per ml (Gibco / Life Technologies, Gaithersburg, MD). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence.
Células NHDF: NHDF cells:
Los fibroblastos dérmicos neonatales humanos (NHDF) se obtuvieron de Clonetics Corporation (Walkersville MD). Las NHDF se mantuvieron de forma rutinaria en medio de crecimiento de fibroblastos (Clonetics Corporation, Walkersville MD) complementado como recomienda el proveedor. Las células se mantuvieron hasta 10 pases según recomendaba el proveedor. Human neonatal dermal fibroblasts (NHDF) were obtained from the Clonetics Corporation (Walkersville MD). NHDFs were routinely maintained in fibroblast growth medium (Clonetics Corporation, Walkersville MD) supplemented as recommended by the supplier. Cells were maintained for up to 10 passages as recommended by the provider.
Células HEK: HEK cells:
Los queratinocitos embrionarios humanos (HEK) se obtuvieron de Clonetics Corporation (Walkersville MD). Los HEK se mantuvieron de forma rutinaria en medio de crecimiento de queratinocitos (Clonetics Corporation, Walkersville MD) formulado como recomendaba el proveedor. Las células se mantuvieron de forma rutinaria hasta 10 pases según recomendaba el proveedor. Human embryonic keratinocytes (HEK) were obtained from the Clonetics Corporation (Walkersville MD). HEKs were routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville MD) formulated as recommended by the supplier. Cells were routinely maintained for up to 10 passages as recommended by the provider.
Células HepG2: HepG2 cells:
La línea celular de hepatoblastoma humano HepG2 se obtuvo de la American Type Culture Collection (Manassas, VA). Las células HepG2 se cultivaron de forma rutinaria en MEM de Eagle complementado con suero de ternero fetal al 10%, aminoácidos no esenciales y piruvato sódico 1 mM (Gibco/Life Technologies, Gaithersburg, MD). Se realizaron pases de las células de forma rutinaria por tripsinización y dilución cuando alcanzaron 90% de confluencia. Las células se sembraron en placas de 96 pocillos (Falcon-Primaria nº 3872) con una densidad de 7000 células/pocillo para usar en análisis de RT-PCR. The HepG2 human hepatoblastoma cell line was obtained from the American Type Culture Collection (Manassas, VA). HepG2 cells were routinely cultured in Eagle's MEM supplemented with 10% fetal calf serum, non-essential amino acids, and 1 mM sodium pyruvate (Gibco / Life Technologies, Gaithersburg, MD). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded in 96-well plates (Falcon-Primary # 3872) with a density of 7000 cells / well for use in RT-PCR analysis.
Para los análisis de transferencia Northern u otros análisis, las células se pueden sembrar en placas de tejido tisular de 100 mm u otras convencionales y tratar de forma similar, usando volúmenes de medio y el oligonucleótido adecuados. For Northern blot analysis or other analyzes, cells can be seeded into 100mm or other conventional tissue tissue plates and treated in a similar manner, using volumes of medium and the appropriate oligonucleotide.
Células AML12: AML12 cells:
La línea celular AML12 (hepática de ratón alfa 12) se estableció a partir de hepatocitos de un ratón (cepa CD1, línea MT42) transgénico para TGF alfa humano. Las células se cultivan en una mezcla 1:1 de medio Eagle modificado por Dulbecco y medio F12 de Ham con insulina 0,005 mg/ml, transferrina 0,005 mg/ml, selenio 5 ng/ml, y dexametasona 40 ng/ml, y 90%; suero bovino fetal al 10%. Para el subcultivo, el medio gastado se separa y se añade medio reciente de disolución de tripsina al 0,25%, EDTA al 0,03%. Se añade disolución de tripsina reciente (de 1 a 2 ml) y el cultivo se deja asentar a temperatura ambiente hasta que las células se desprenden. The AML12 cell line (mouse hepatic alpha 12) was established from mouse hepatocytes (strain CD1, line MT42) transgenic for human TGF alpha. Cells are grown in a 1: 1 mixture of Dulbecco's Modified Eagle's Medium and Ham's F12 Medium with 0.005 mg / ml insulin, 0.005 mg / ml transferrin, 5 ng / ml selenium, and 40 ng / ml dexamethasone, and 90% ; 10% fetal bovine serum. For the subculture, the spent medium is removed and fresh 0.25% trypsin dissolution medium, 0.03% EDTA is added. Fresh trypsin solution (1 to 2 ml) is added and the culture is allowed to settle at room temperature until the cells are shed.
Se realizaron pases de las células de forma rutinaria por tripsinización y dilución cuando alcanzaron 90% de confluencia. Las células se sembraron en placas de 96 pocillos (Falcon-Primaria nº 3872) con una densidad de 7000 células/pocillo para usar en análisis de RT-PCR. Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded in 96-well plates (Falcon-Primary # 3872) with a density of 7000 cells / well for use in RT-PCR analysis.
Para los análisis de transferencia Northern u otros análisis, las células se pueden sembrar en placas de tejido tisular de 100 mm u otras convencionales y tratar de forma similar, usando volúmenes de medio y el oligonucleótido adecuados. For Northern blot analysis or other analyzes, cells can be seeded into 100mm or other conventional tissue tissue plates and treated in a similar manner, using volumes of medium and the appropriate oligonucleotide.
Hepatocitos primarios de ratón: Primary mouse hepatocytes:
Los hepatocitos primarios de ratón se prepararon a partir de ratones CD-1 adquiridos en Charles River Labs (Wilmington, MA) y se cultivaron de forma rutinaria en medio de adherencia de hepatocitos (Gibco) complementado con suero bovino fetal al 10% (Gibco/Life Technologies, Gaithersburg, MD), dexametasona 250 nM (Sigma), e insulina 10 nM (Sigma). Las células se sembraron en placas de 96 pocillos (Falcon-Primaria nº 3872) con una densidad de 10000 células/pocillo para usar en análisis de RT-PCR. Primary mouse hepatocytes were prepared from CD-1 mice purchased from Charles River Labs (Wilmington, MA) and routinely cultured in hepatocyte adherence medium (Gibco) supplemented with 10% fetal bovine serum (Gibco / Life Technologies, Gaithersburg, MD), 250 nM dexamethasone (Sigma), and 10 nM insulin (Sigma). Cells were plated in 96-well plates (Falcon-Primary # 3872) at a density of 10,000 cells / well for use in RT-PCR analysis.
Para el análisis por transferencia Northern u otros análisis, las células se cultivan en placas de cultivo celular de 100 mm u otras convencionales recubiertas con colágeno de cola de rata (200 ug/ml) (Becton Dickinson) y se tratan de forma similar usando los volúmenes de medio y el oligonucleótido adecuados. For Northern blot analysis or other analyzes, cells are grown in 100 mm cell culture dishes or other conventional plates coated with rat tail collagen (200 ug / ml) (Becton Dickinson) and treated similarly using the volumes of suitable medium and oligonucleotide.
5 Células Hep3B: 5 Hep3B cells:
La línea celular de carcinoma hepatocelular humano Hep3B se obtuvo de la American Type Culture Collection (Manassas, VA). Las células Hep3B se cultivaron de forma rutinaria en MEM de Dulbeccos con alto contenido en glucosa complementado con suero de ternero fetal al 10%, L-glutamina e hidrocloruro de piridoxina (Gibco/Life Technologies, Gaithersburg, MD). Se realizaron pases de las células de forma rutinaria por tripsinización y dilución The Hep3B human hepatocellular carcinoma cell line was obtained from the American Type Culture Collection (Manassas, VA). Hep3B cells were routinely cultured in high glucose Dulbeccos MEM supplemented with 10% fetal calf serum, L-glutamine and pyridoxine hydrochloride (Gibco / Life Technologies, Gaithersburg, MD). Cells were routinely passaged by trypsinization and dilution
10 cuando alcanzaron 90% de confluencia. Las células se sembraron en placas de 24 pocillos (Falcon-Primaria nº 3846) con una densidad de 50.000 células/pocillo para usar en análisis de RT-PCR. 10 when they reached 90% confluence. Cells were plated into 24-well plates (Falcon-Primary # 3846) with a density of 50,000 cells / well for use in RT-PCR analysis.
Para los análisis de transferencia Northern u otros análisis, las células se pueden sembrar en placas de tejido tisular de 100 mm u otras convencionales y tratar de forma similar, usando volúmenes de medio y el oligonucleótido adecuados. For Northern blot analysis or other analyzes, cells can be seeded into 100mm or other conventional tissue tissue plates and treated in a similar manner, using volumes of medium and the appropriate oligonucleotide.
15 Hepatocitos primarios de conejo: 15 Primary rabbit liver cells:
Los hepatocitos primarios de conejo se adquirieron en Invitro Technologies (Gaithersburg, MD) y se mantuvieron en medio Eagle modificado por Dulbecco (Gibco). Cuando se adquirieron, las células se habían sembrado en placas de 96 pocillos para usar en análisis de RT-PCR y eran confluentes. Rabbit primary hepatocytes were purchased from Invitro Technologies (Gaithersburg, MD) and maintained in Dulbecco's modified Eagle medium (Gibco). When purchased, cells had been seeded in 96-well plates for use in RT-PCR analysis and were confluent.
Para los análisis de transferencia Northern u otros análisis, las células se pueden sembrar en placas de tejido tisular For Northern blot analysis or other analyzes, cells can be plated on tissue tissue plates
20 de 100 mm u otras convencionales y tratar de forma similar, usando volúmenes de medio y el oligonucleótido adecuados. 20 of 100 mm or other conventional ones and treat in a similar way, using volumes of medium and the appropriate oligonucleotide.
Células HeLa: HeLa cells:
La línea celular de carcinoma epiteloide HeLa se obtuvo de la American Tissue Type Culture Collection (Manassas, VA). Las células HeLa se cultivaron de forma rutinaria en DMEM, con alto contenido de glucosa (Invitrogen 25 Corporation, Carlsbad, CA) complementado con suero bovino fetal al 10% (Invitrogen Corporation, Carlsbad, CA). Las células se sembraron en placas de 24 pocillos (Falcon-Primaria nº 3846) con una densidad de 50.000 células/pocillo para usar en análisis de RT-PCR. Se realizaron pases de las células de forma rutinaria por tripsinización y dilución cuando alcanzaron 90% de confluencia. Las células se sembraron en placas de 96 pocillos (Falcon-Primaria nº 3872) con una densidad de 5.000 células/pocillo para usar en análisis de RT-PCR. Para los The HeLa epiteloid carcinoma cell line was obtained from the American Tissue Type Culture Collection (Manassas, VA). HeLa cells were routinely cultured in high glucose DMEM (Invitrogen 25 Corporation, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitrogen Corporation, Carlsbad, CA). Cells were plated into 24-well plates (Falcon-Primary # 3846) with a density of 50,000 cells / well for use in RT-PCR analysis. Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were plated in 96-well plates (Falcon-Primary # 3872) with a density of 5,000 cells / well for use in RT-PCR analysis. For the
30 análisis de transferencia Northern u otros análisis, las células se pueden sembrar en placas de tejido tisular de 100 mm u otras convencionales y tratar de forma similar, usando volúmenes de medio y el oligonucleótido adecuados. With Northern blot analysis or other assays, cells can be seeded into 100mm or other conventional tissue tissue plates and treated in a similar manner, using volumes of suitable medium and oligonucleotide.
Células epiteliales mamarias humanas: Human mammary epithelial cells:
Las células epiteliales mamarias humanas normales (HMEC) se obtuvieron de la American Type Culture Collection (Manassas VA). Las HMEC se cultivaron de forma rutinaria en DMEM con bajo contenido en glucosa (Gibco/Life 35 Technologies, Gaithersburg, MD) complementado con suero de ternero fetal al 10% (Gibco/Life Technologies, Gaithersburg, MD). Se realizaron pases de las células de forma rutinaria por tripsinización y dilución cuando alcanzaron 90% de confluencia. Las células se sembraron en placas de 96 pocillos (Falcon-Primaria nº 353872, BD Biosciences, Bedford, MA) con una densidad de 7000 células/pocillo para usar en análisis de RT-PCR. Para los análisis de transferencia Northern u otros análisis, las células se pueden sembrar en placas de tejido tisular de 100 Normal human mammary epithelial cells (HMEC) were obtained from the American Type Culture Collection (Manassas VA). HMECs were routinely cultured in low glucose DMEM (Gibco / Life 35 Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco / Life Technologies, Gaithersburg, MD). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were plated in 96-well plates (Falcon-Primary # 353872, BD Biosciences, Bedford, MA) at a density of 7000 cells / well for use in RT-PCR analysis. For Northern blot analysis or other analyzes, cells can be plated on 100 tissue tissue plates
40 mm u otras convencionales y tratar de forma similar, usando volúmenes de medio y el oligonucleótido adecuados. 40 mm or other conventional ones and treat in a similar way, using volumes of medium and the appropriate oligonucleotide.
Tratamiento con compuestos antisentido: Treatment with antisense compounds:
Cuando las células alcanzaron 80% de confluencia, se trataron con el oligonucleótido. Para las células cultivadas en placas de 96 pocillos, los pocillos se lavaron una vez con 200 μl de medio OPTI-MEM™-1 reducido en suero (Gibco BRL) y se trataron con 130 μl de OPTI-MEM™-1 que contenían 3,75 μg/ml de LIPOFECTIN™ (Gibco BRL) y la When the cells reached 80% confluence, they were treated with the oligonucleotide. For cells grown in 96-well plates, the wells were washed once with 200 µl serum-reduced OPTI-MEM ™ -1 medium (Gibco BRL) and treated with 130 µl OPTI-MEM ™ -1 containing 3 , 75 μg / ml LIPOFECTIN ™ (Gibco BRL) and the
45 concentración deseada del oligonucleótido. Después de 4-7 h de tratamiento, el medio se sustituyó por medio de nueva aportación. Las células se recogieron 16-24 h después del tratamiento con oligonucleótido. 45 desired concentration of the oligonucleotide. After 4-7 h of treatment, the medium was replaced with fresh medium. Cells were harvested 16-24 hr after oligonucleotide treatment.
La concentración del oligonucleótido usado varía de una línea celular a otra. Para determinar la concentración óptima de oligonucleótido para una línea celular particular, las células se trataron con un oligonucleótido de control positivo en un intervalo de concentraciones. Para células humanas el oligonucleótido de control positivo es ISIS 50 13920, TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1, un 2'-O-metoxietil-gápmero (los 2'-O-metoxietilos se muestran en negrita) con una cadena principal de fosforotioato que se dirige a H-ras humano. Para células de ratón The concentration of the oligonucleotide used varies from one cell line to another. To determine the optimal oligonucleotide concentration for a particular cell line, cells were treated with a positive control oligonucleotide over a concentration range. For human cells the positive control oligonucleotide is ISIS 50 13920, TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1, a 2'-O-methoxyethyl-gapmer (the 2'-O-methoxyethyl is shown in bold) with a phosphorothioate backbone that He is targeting human H-ras. For mouse cells
o rata el oligonucleótido de control positivo es ISIS 15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 2, un 2'-Ometoxietil-gápmero (los 2'-O-metoxietilo se muestran en negrita) con una cadena principal de fosforotioato que se dirige a c-raf tanto de ratón como de rata. La concentración del oligonucleótido de control positivo que da como or rat the positive control oligonucleotide is ISIS 15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 2, a 2'-Omethoxyethyl-gapmer (2'-O-methoxyethyl shown in bold) with a phosphorothioate backbone that targets c -raf both mouse and rat. The concentration of the positive control oligonucleotide that gives as
resultado 80% de inhibición del ARNm de c-Ha-ras (para ISIS 13920) o c-raf (para ISIS 15770) se usa entonces como concentración de cribado para nuevos oligonucleótidos en experimentos posteriores para esa línea celular. Si no se alcanza el 80% de inhibición, se usa entonces la concentración más baja del oligonucleótido de control positivo que da como resultado 60% de inhibición del ARNm de H-ras o c-raf, como concentración de cribado de oligonucleótidos en experimentos posteriores para esa línea celular. Si no se alcanza el 60% de inhibición, se considera que esa línea celular particular no es adecuada para los experimentos de transfección de oligonucleótidos. Las concentraciones de oligonucleótidos antisentido usadas en la presente memoria son de 5 nM a 300 nM. Result 80% inhibition of c-Ha-ras (for ISIS 13920) or c-raf (for ISIS 15770) mRNA is then used as a screening concentration for new oligonucleotides in subsequent experiments for that cell line. If 80% inhibition is not reached, then the lowest concentration of the positive control oligonucleotide that results in 60% inhibition of the H-ras or c-raf mRNA is used as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not reached, that particular cell line is considered unsuitable for oligonucleotide transfection experiments. The antisense oligonucleotide concentrations used herein are from 5 nM to 300 nM.
Ejemplo 10 Example 10
Análisis de la inhibición por el oligonucleótido de la expresión de la apolipoproteína B Analysis of oligonucleotide inhibition of apolipoprotein B expression
La modulación antisentido de la expresión de la apolipoproteína B se puede ensayar en una variedad de formas conocidas en la técnica. Por ejemplo, los niveles de ARNm de la apolipoproteína B se pueden cuantificar por, p. ej., análisis de transferencia Northern, reacción en cadena de la polimerasa competitiva (PCR) o PCR en tiempo real (RT-PCR). Actualmente se prefiere la PCR cuantitativa en tiempo real. El análisis de ARN se puede realizar en el ARN celular total o poli(A)+ ARNm. Los métodos de aislamiento del ARN se enseñan, por ejemplo, en Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 y 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. El análisis Northern es rutinario en la técnica y se enseña, por ejemplo, en Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc., 1996. La (PCR) cuantitativa en tiempo real se puede llevar a cabo de forma conveniente usando el sistema de detección de secuencias ABI PRISM™ 7700 disponible en PE-Applied Biosystems, Foster City, CA, y usarlo de acuerdo con las instrucciones del fabricante. Antisense modulation of apolipoprotein B expression can be tested in a variety of ways known in the art. For example, apolipoprotein B mRNA levels can be quantified by, e.g. eg, Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Quantitative real-time PCR is currently preferred. RNA analysis can be performed on total cellular RNA or poly (A) + mRNA. RNA isolation methods are taught, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Northern analysis is routine in the art and is taught, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc., 1996. Quantitative real-time PCR can be conveniently carried out using the ABI PRISM ™ 7700 Sequence Detection System available from PE-Applied Biosystems, Foster City, CA, and use it according to the manufacturer's instructions.
Los niveles de proteína de la apolipoproteína B se pueden cuantificar en una variedad de formas bien conocidas en la técnica, tales como inmunoprecipitación, análisis de transferencia Western (inmunotransferencia), ELISA o separación de células activadas por fluorescencia (FACS). Los anticuerpos dirigidos contra la apolipoproteína B se pueden identificar y obtener a partir de una variedad de fuentes, tales como el catálogo MSRS de anticuerpos (Aerie Corporation, Birmingham, MI), o se pueden preparar por métodos convencionales de generación de anticuerpos. Los métodos para preparar antisueros policlonales se enseñan, por ejemplo, en Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. La preparación de anticuerpos monoclonales se enseña, por ejemplo, en Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc., 1997. Apolipoprotein B protein levels can be quantified in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblot), ELISA, or fluorescence activated cell sorting (FACS). Antibodies directed against apolipoprotein B can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared by conventional antibody generation methods. Methods for preparing polyclonal antisera are taught, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. The preparation of monoclonal antibodies is taught, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.
Los métodos de inmunoprecipitación son convencionales en la técnica, y se pueden encontrar, por ejemplo, en Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley & Sons, Inc., 1998. El análisis de transferencia Western (inmunotransferencia) es convencional en la técnica y se puede encontrar, por ejemplo, en Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Los ensayos de inmunoabsorción con enzimas ligadas (ELISA) son convencionales en la técnica, y se pueden encontrar, por ejemplo, en Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991. Immunoprecipitation methods are conventional in the art, and can be found, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley & Sons, Inc., 1998. Western blot analysis (immunoblot) is conventional in the art and can be found, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Bound enzyme immunosorbent assays (ELISA) are standard in the art, and can be found, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991.
Ejemplo 11 Example 11
Aislamiento de poli(A)+ ARNm Isolation of poly (A) + mRNA
El poli(A)+ ARNm se aisló de acuerdo con Miura et al., Clin. Chem., 1996, 42, 1758-1764. Se enseñan otros métodos de aislamiento de poli(A)+ ARNm, por ejemplo, en Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Brevemente, para cultivar células en placas de 96 pocillos, se eliminó el medio de crecimiento de las células y cada pocillo se lavó con 200 μl de PBS frío. Se añadieron 60 μl de tampón de lisis (Tris-HCl 10 mM a pH 7,6, EDTA 1 mM, NaCl 0,5 M, NP-40 al 0,5%, complejo de vanadil-ribonucleósido 20 mM) a cada pocillo, la placa se agitó suavemente y después se incubó a temperatura ambiente durante 5 min. Se transfirieron 55 μl de lisato a placas de 96 pocillos recubiertas con Oligo d(T) (AGCT Inc., Irvine CA). Las placas se incubaron durante 60 min a temperatura ambiente, se lavaron 3 veces con 200 μl de tampón de lavado (Tris-HCl 10 mM a pH 7,6, EDTA 1 mM, NaCl 0,3 M). Después del lavado final, la placa se transfirió a toallas de papel para separar el exceso de tampón de lavado y se secaron al aire durante 5 min. Se añadieron a cada pocillos 60 μl de tampón de elución (Tris-HCl 5 mM a pH 7,6), precalentado a 70°C, la placa se incubó en una placa caliente a 90ºC durante 5 min, y después el eluato se transfirió a una placa nueva de 96 pocillos. Poly (A) + mRNA was isolated according to Miura et al., Clin. Chem., 1996, 42, 1758-1764. Other methods of isolating poly (A) + mRNA are taught, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Briefly, to grow cells in 96-well plates, the growth medium was removed from the cells and each well was washed with 200 µl cold PBS. 60 µl of lysis buffer (10mM Tris-HCl pH 7.6, 1mM EDTA, 0.5M NaCl, 0.5% NP-40, 20mM vanadyl-ribonucleoside complex) were added to each well , the plate was gently shaken and then incubated at room temperature for 5 min. 55 µl of lysate were transferred to Oligo d (T) coated 96-well plates (AGCT Inc., Irvine CA). Plates were incubated for 60 min at room temperature, washed 3 times with 200 µl of wash buffer (10mM Tris-HCl pH 7.6, 1mM EDTA, 0.3M NaCl). After the final wash, the plate was transferred to paper towels to remove excess wash buffer and air dried for 5 min. 60 µl of elution buffer (5mM Tris-HCl pH 7.6), preheated to 70 ° C, was added to each well, the plate was incubated on a hot plate at 90 ° C for 5 min, and then the eluate was transferred to a new 96-well plate.
Las células cultivadas en placas de 100 mm u otras convencionales se pueden tratar de forma similar, usando volúmenes adecuados de todas las disoluciones. Cells grown in 100mm plates or other conventional plates can be treated similarly, using adequate volumes of all solutions.
Ejemplo 12 Example 12
Aislamiento de ARN total Isolation of total RNA
El ARN total se aisló usando el kit RNEASY 96™ y tampones adquiridos en Qiagen Inc. (Valencia CA) siguiendo los procedimientos descritos por el fabricante. Brevemente, para cultivar células en placas de 96 pocillos, se eliminó el medio de crecimiento de las células y cada pocillo se lavó con 200 μl de PBS frío. Se añadieron 100 μl de tampón RLT a cada pocillo y la placa se agitó enérgicamente durante 20 segundos. Después se añadieron 100 μl de etanol al 70% a cada pocillo y el contenido se mezcló cargando y descargando la pipeta 3 veces. Después las muestras se transfirieron a la placa de 96 pocillos RNEASY 96™ unida a un colector QIAVAC™ equipado con una bandeja de Total RNA was isolated using the RNEASY 96 ™ kit and buffers purchased from Qiagen Inc. (Valencia CA) following the procedures described by the manufacturer. Briefly, to grow cells in 96-well plates, the growth medium was removed from the cells and each well was washed with 200 µl cold PBS. 100 µl of RLT buffer was added to each well and the plate was shaken vigorously for 20 seconds. Then 100 µl of 70% ethanol was added to each well and the contents were mixed by loading and unloading the pipette 3 times. The samples were then transferred to the RNEASY 96 ™ 96-well plate attached to a QIAVAC ™ collector equipped with a
5 recolección de residuos unida a una fuente de vacío. Se aplicó vacío durante 15 s. Se añadió 1 ml de tampón RW1 a cada pocillo de la placa RNEASY 96™ y se volvió a aplicar el vacío durante 15 segundos. Después, se añadió 1 ml de tampón RPE a cada pocillo de la placa RNEASY 96™ y se aplicó el vacío durante un periodo de 15 segundos. Después se repitió el lavado con RPE y se aplicó vacío durante 10 min adicionales. Después se retiró la placa del colector QIAVAC™ y se transfirió en seco sobre toallas de papel. Después, la placa se volvió a unir al colector QIAVAC™ equipado con una rejilla con una rejilla de tubos de recolección que contenía tubos de recolección de 1,2 ml. El ARN después se eluyó añadiendo con pipeta 60 μl de agua en cada pocillo, incubando durante 1 min y después aplicando el vacío durante 30 segundos. La etapa de elución se repitió con 60 μl adicionales de agua. 5 waste collection attached to a vacuum source. Vacuum was applied for 15 s. 1 ml of RW1 buffer was added to each well of the RNEASY 96 ™ plate and the vacuum was reapplied for 15 seconds. Then, 1 ml of RPE buffer was added to each well of the RNEASY 96 ™ plate and the vacuum was applied over a period of 15 seconds. The RPE wash was then repeated and vacuum was applied for an additional 10 min. The QIAVAC ™ collector plate was then removed and dry transferred onto paper towels. The plate was then reattached to the QIAVAC ™ manifold equipped with a rack with a collection tube rack containing 1.2 ml collection tubes. The RNA was then eluted by pipetting 60 µl of water into each well, incubating for 1 min and then applying the vacuum for 30 seconds. The elution step was repeated with an additional 60 µl of water.
Las etapas de pipeteo y elución repetitivas se pueden automatizar con un equipo QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia CA). Esencialmente, después de la lisis de las células en la placa de cultivo, la placa se transfiere a la The repetitive pipetting and elution steps can be automated with a QIAGEN Bio-Robot 9604 kit (Qiagen, Inc., Valencia CA). Essentially, after lysis of the cells in the culture plate, the plate is transferred to the
15 plataforma del robot donde se llevan a cabo las etapas de pipeteo, tratamiento con DNasa y elución. 15 robot platform where the pipetting, DNase treatment and elution stages are carried out.
Ejemplo 13 Example 13
Análisis por PCR cuantitativa en tiempo real de los niveles de ARNm de la apolipoproteína B Real-time quantitative PCR analysis of apolipoprotein B mRNA levels
La cuantificación de los niveles de ARNm de apolipoproteína B se determinaron usando el sistema de detección de secuencia ABI PRISM™ 7700 (PE-Applied Biosystems, Foster City, CA) de acuerdo con las instrucciones del fabricante. Este es un sistema de detección de fluorescencia, no basado en gel, en tubo cerrado, que permite la cuantificación de alta capacidad de los productos de la reacción en cadena de la polimerasa (PCR) en tiempo real. A diferencia de la PCR convencional, en la que los productos de amplificación son cuantificados después de completarse la PCR, los productos en la PCR cuantitativa en tiempo real son cuantificados cuando se acumulan. Esto se lleva a cabo incluyendo en la reacción de la PCR una sonda de oligonucleótido que se reasocia 25 específicamente entre los cebadores de la PCR directo e inverso, y contiene dos colorantes fluorescentes. Un colorante indicador (p. ej., JOE, FAM, o VIC, obtenido de Operon Technologies Inc., Alameda, CA o PE-Applied Biosystems, Foster City, CA) se une al extremo 5' de la sonda y un colorante atenuador (p. ej., TAMRA, obtenido de Operon Technologies Inc., Alameda, CA o PE-Applied Biosystems, Foster City, CA) se une al extremo 3' de la sonda. Cuando la sonda y el colorante están intactos, la emisión del colorante indicador es atenuada por la proximidad del colorante atenuador de 3'. Durante la amplificación, la reasociación de la sonda con la secuencia diana crea un sustrato que puede ser escindido por la actividad de 5'-exonucleasa de la polimerasa Taq. Durante la fase de extensión del ciclo de amplificación de la PCR, la escisión de la sonda por la polimerasa Taq libera el colorante indicador del resto de la sonda (y por lo tanto el resto atenuador) y se genera una señal fluorescente específica de la secuencia. Con cada ciclo, son escindidas moléculas indicadoras adicionales de sus respectivas Quantification of apolipoprotein B mRNA levels were determined using the ABI PRISM ™ 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. This is a closed tube, non-gel based fluorescence detection system that enables high-capacity quantification of polymerase chain reaction (PCR) products in real time. Unlike conventional PCR, in which amplification products are quantified after PCR is complete, products in quantitative real-time PCR are quantified when accumulated. This is accomplished by including in the PCR reaction an oligonucleotide probe that specifically anneals between the forward and reverse PCR primers, and contains two fluorescent dyes. An indicator dye (eg JOE, FAM, or VIC, obtained from Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA) binds to the 5 'end of the probe and an attenuator dye (eg, TAMRA, obtained from Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA) binds to the 3 'end of the probe. When the probe and dye are intact, the emission of the indicator dye is attenuated by the proximity of the 3 'quenching dye. During amplification, reassociation of the probe with the target sequence creates a substrate that can be cleaved by the 5'-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the indicator dye from the rest of the probe (and therefore the quencher residue) and a sequence specific fluorescent signal is generated . With each cycle, additional indicator molecules are cleaved from their respective
35 sondas, y se controla la intensidad de la fluorescencia a intervalos regulares mediante óptica láser incorporada en el sistema de detección de secuencias ABI PRISM™ 7700. En cada ensayo, una serie de reacciones paralelas que contienen diluciones seriadas de ARNm de muestras de control no tratadas genera una curva patrón que se usa para cuantificar el porcentaje de inhibición después del tratamiento de las muestras de ensayo con oligonucleótido antisentido. 35 probes, and fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM ™ 7700 Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from control samples did not Treated generates a standard curve that is used to quantify the percent inhibition after treatment of the test samples with antisense oligonucleotide.
Antes del análisis por PCR cuantitativa, se evalúa la capacidad de los conjuntos cebador-sonda específicos para el gen diana que se esta midiendo, para "multiplexar" con una reacción de amplificación de GAPDH. En el multiplexado, tanto el gen diana como el gen de referencia interno GAPDH son amplificados simultáneamente en una sola muestra. En este análisis, el ARNm aislado de células no tratadas se diluye de forma seriada. Cada dilución se amplifica en presencia de conjuntos de cebador-sonda específicos solo para GAPDH, solo para el gen diana Prior to quantitative PCR analysis, the ability of the primer-probe sets specific for the target gene being measured is evaluated to "multiplex" with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal reference gene GAPDH are simultaneously amplified in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific only for GAPDH, only for the target gene
45 ("plexado individual"), o para ambos (multiplexado). Después de la amplificación por PCR, se generan las curvas patrón de la señal de ARNm de GADPH y diana como una función de la dilución, a partir de las muestras tanto de plexado individual como multiplexadas. Si tanto la pendiente como el coeficiente de correlación de las señales de GADPH y de la diana generados a partir de las muestras multiplexadas están dentro del 10% de sus valores correspondientes generados a partir de muestras de plexado individual, el conjunto de cebador-sonda específico para esa diana se considera que se puede multiplexar. También se conocen otros métodos de PCR en la técnica. 45 ("individual plexing"), or for both (multiplexing). Following PCR amplification, the standard curves of the GADPH and target mRNA signal are generated as a function of dilution, from both the single and multiplexed plexing samples. If both the slope and the correlation coefficient of the GADPH and target signals generated from the multiplexed samples are within 10% of their corresponding values generated from individual plexed samples, the specific primer-probe set for that target it is considered that it can be multiplexed. Other PCR methods are also known in the art.
Los reactivos de la PCR se obtuvieron de PE-Applied Biosystems, Foster City, CA. Las reacciones de RT-PCR se llevaron a cabo añadiendo 25 μl de cóctel de PCR (1x tampón A TAQMAN™, MgCl2 5,5 mM, 300 μM de cada uno de dATP, dCTP y dGTP, dUTP 600 μM, 100 nM de cada uno del cebador directo, cebador inverso y sonda, 1,25 unidades de AMPLITAQ GOLD™, y 12,5 unidades de transcriptasa inversa MuLV) a placas de 96 pocillos que The PCR reagents were obtained from PE-Applied Biosystems, Foster City, CA. RT-PCR reactions were carried out by adding 25 µl of PCR cocktail (1x A TAQMAN ™ buffer, 5.5 mM MgCl2, 300 µM each of dATP, dCTP and dGTP, 600 µM dUTP, 100 nM of each one from the forward primer, reverse primer and probe, 1.25 units of AMPLITAQ GOLD ™, and 12.5 units of MuLV reverse transcriptase) to 96-well plates that
55 contenían 25 μl de disolución de ARN total. La reacción en RT se llevó a cabo por incubación durante 30 min a 48°C. Después de una incubación de 10 min a 95ºC para activar la AMPLITAQ GOLD™, se llevaron a cabo 40 ciclos de un protocolo de PCR en dos etapas: 95°C durante 15 segundos (desnaturalización) seguido de 60°C durante 1,5 minutos (reasociación/extensión). 55 contained 25 µl of total RNA solution. The RT reaction was carried out by incubation for 30 min at 48 ° C. After a 10 min incubation at 95 ° C to activate AMPLITAQ GOLD ™, 40 cycles of a two-step PCR protocol were performed: 95 ° C for 15 seconds (denaturation) followed by 60 ° C for 1.5 minutes (reassociation / extension).
Las cantidades del gen diana obtenidas por la RT-PCR en tiempo real se normalizaron usando el nivel de expresión de GAPDH, un gen cuya expresión es constante, o por cuantificación del ARN total usando RiboGreen™ (Molecular Amounts of the target gene obtained by real-time RT-PCR were normalized using the expression level of GAPDH, a gene whose expression is constant, or by quantification of total RNA using RiboGreen ™ (Molecular
Probes, Inc. Eugene, OR). La expresión de GAPDH se cuantifica por la RT-PCR en tiempo real, llevándola a cabo simultáneamente con la diana, multiplexado, o por separado. El ARN total se cuantifica usando el reactivo de cuantificación de ARN RiboGreen™ de Molecular Probes. Los métodos de cuantificación del ARN por RiboGreen™ se enseñan en Jones, L.J., et al, Analytical Biochemistry, 1998, 265, 368-374. Probes, Inc. Eugene, OR). GAPDH expression is quantified by real-time RT-PCR, carried out simultaneously with the target, multiplexed, or separately. Total RNA is quantified using the Molecular Probes RiboGreen ™ RNA Quantification Reagent. RiboGreen ™ RNA quantification methods are taught in Jones, L.J., et al, Analytical Biochemistry, 1998, 265, 368-374.
En este ensayo, se añaden mediante pipeta 175 μl de reactivo de trabajo RiboGreen™ (reactivo RiboGreen™ diluido 1:2865 en Tris-HCl 10 mM, EDTA 1 mM, a pH 7,5) a una placa de 96 pocillos que contienen 25 μl de ARN celular purificado. La placa se lee en un aparato CytoFluor 4000 (PE Applied Biosystems) con excitación a 480 nm y emisión a 520 nm. In this assay, 175 µl of RiboGreen ™ working reagent (RiboGreen ™ reagent diluted 1: 2865 in 10mM Tris-HCl, 1mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 25 µl of purified cellular RNA. The plate is read on a CytoFluor 4000 apparatus (PE Applied Biosystems) with excitation at 480 nm and emission at 520 nm.
Las sondas y cebadores para la apolipoproteína B humana se diseñaron para hibridar con una secuencia de apolipoproteína B humana, usando la información de la secuencia publicada (número de acceso en GenBank NM_000384.1, incorporada en la presente memoria como SEQ ID NO: 3). Para la apolipoproteína B humana los cebadores de la PCR eran: cebador directo: TGCTAAAGGCACATATGGCCT (SEQ ID NO: 4) cebador inverso: CTCAGGTTGGACTCTCCATTGAG (SEQ ID NO: 5) y la sonda de la PCR era: FAM-CTTGTCAGAGGGATCCTAACACTGGCCG-TAMRA (SEQ ID NO: 6) donde FAM (PE-Applied Biosystems, Foster City, CA) es el colorante indicador fluorescente y TAMRA (PE-Applied Biosystems, Foster City, CA) es el colorante atenuador. Para la GAPDH humana los cebadores de la PCR eran: cebador directo: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 7) cebador inverso: GAAGATGGTGATGGGATTTC (SEQ ID NO: 8) y la sonda de la PCR era: 5' JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID NO: 9) donde JOE (PE-Applied Biosystems, Foster City, CA) es el colorante indicador fluorescente y TAMRA (PE-Applied Biosystems, Foster City, CA) es el colorante atenuador. Probes and primers for human apolipoprotein B were designed to hybridize to a sequence of human apolipoprotein B, using the published sequence information (GenBank accession number NM_000384.1, incorporated herein as SEQ ID NO: 3) . For human apolipoprotein B the PCR primers were: forward primer: TGCTAAAGGCACATATGGCCT (SEQ ID NO: 4) reverse primer: CTCAGGTTGGACTCTCCATTGAG (SEQ ID NO: 5) and the PCR probe was: FAM-CTTGTCAGAGGGATCCTAACGTG NO: 6) where FAM (PE-Applied Biosystems, Foster City, CA) is the fluorescent indicator dye and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye. For human GAPDH the PCR primers were: forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 7) reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 8) and the PCR probe was: 5 'JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID NO: 9) where JOE (PE-Applied Biosystems, Foster City, CA) is the fluorescent indicator dye and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye.
Las sondas y cebadores para la apolipoproteína B de ratón se diseñaron para hibridar con una secuencia de apolipoproteína B de ratón, usando la información de la secuencia publicada (número de acceso en GenBank M35186, incorporada en la presente memoria como SEQ ID NO: 10). Para la apolipoproteína B de ratón los cebadores de la PCR eran: cebador directo: CGTGGGCTCCAGCATTCTA (SEQ ID NO: 11) cebador inverso: AGTCATTTCTGCCTTTGCGTC (SEQ ID NO: 12) y la sonda de la PCR era: FAM-CCAATGGTCGGGCACTGCTCAA-TAMRA SEQ ID NO: 13) donde FAM (PE-Applied Biosystems, Foster City, CA) es el colorante indicador fluorescente y TAMRA (PE-Applied Biosystems, Foster City, CA) es el colorante atenuador. Para la GAPDH de ratón los cebadores de la PCR eran: cebador directo: GGCAAATTCAACGGCACAGT (SEQ ID NO: 14) cebador inverso: GGGTCTCGCTCCTGGAAGAT (SEQ ID NO:15) y la sonda de la PCR era: 5' JOE-AAGGCCGAGAATGGGAAGCTTGTCATC-TAMRA 3' (SEQ ID NO: 16) donde JOE (PE-Applied Biosystems, Foster City, CA) es el colorante indicador fluorescente y TAMRA (PE-Applied Biosystems, Foster City, CA) es el colorante atenuador. Probes and primers for mouse apolipoprotein B were designed to hybridize with a mouse apolipoprotein B sequence, using the published sequence information (GenBank accession number M35186, incorporated herein as SEQ ID NO: 10) . For mouse apolipoprotein B the PCR primers were: forward primer: CGTGGGCTCCAGCATTCTA (SEQ ID NO: 11) reverse primer: AGTCATTTCTGCCTTTGCGTC (SEQ ID NO: 12) and the PCR probe was: FAM-CCAATGGTCGGGCACTGCTCAA-T NO: 13) where FAM (PE-Applied Biosystems, Foster City, CA) is the fluorescent indicator dye and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye. For mouse GAPDH the PCR primers were: forward primer: GGCAAATTCAACGGCACAGT (SEQ ID NO: 14) reverse primer: GGGTCTCGCTCCTGGAAGAT (SEQ ID NO: 15) and the PCR probe was: 5 'JOE-AAGGCCGAGAATGGGAAGCTTTC '(SEQ ID NO: 16) where JOE (PE-Applied Biosystems, Foster City, CA) is the fluorescent indicator dye and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye.
Ejemplo 14 Example 14
Análisis de transferencia Northern de los niveles de ARNm de la apolipoproteína B Northern blot analysis of apolipoprotein B mRNA levels
Dieciocho horas después del tratamiento antisentido, las monocapas celulares se lavaron dos veces con PBS frío y se lisaron en 1 ml de RNAZOL™ (TEL-TEST "B" Inc., Friendswood, TX). El ARN total se preparó siguiendo los protocolos recomendados por el fabricante. Se fraccionaron 20 microgramos de ARN total por electroforesis por geles de agarosa al 1,2% que contenían 1,1% de formaldehído usando un sistema de tampón MOPS (AMRESCO, Inc. Solon, OH). El ARN se transfirió del gel a las membranas de nailon HYBOND™-N+ (Amersham Pharmacia Biotech, Piscataway, NJ) mediante transferencia capilar durante la noche usando un sistema de tampón de transferencia Northern/Southern (TEL-TEST "B" Inc., Friendswood, TX). La transferencia de ARN se confirmó por visualización UV. Las membranas se fijaron por reticulación UV usando un reticulador UV STRATALINKER™ UV Crosslinker 2400 (Stratagene, Inc, La Jolla, CA) y después se trataron con la sonda usando disolución de hibridación QUICKHYB™ (Stratagene, La Jolla, CA) usando las recomendaciones del fabricante para condiciones restrictivas. Eighteen hours after antisense treatment, the cell monolayers were washed twice with cold PBS and lysed in 1 ml of RNAZOL ™ (TEL-TEST "B" Inc., Friendswood, TX). Total RNA was prepared following the manufacturer's recommended protocols. 20 micrograms of total RNA was fractionated by electrophoresis by 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, OH). RNA was transferred from the gel to HYBOND ™ -N + nylon membranes (Amersham Pharmacia Biotech, Piscataway, NJ) by capillary transfer overnight using a Northern / Southern transfer buffer system (TEL-TEST "B" Inc., Friendswood, TX). RNA transfer was confirmed by UV visualization. Membranes were fixed by UV crosslinking using a STRATALINKER ™ UV Crosslinker 2400 UV crosslinker (Stratagene, Inc, La Jolla, CA) and then probe treated using QUICKHYB ™ hybridization solution (Stratagene, La Jolla, CA) using the recommendations from the manufacturer for restrictive conditions.
Para detectar la apolipoproteína B humana, se preparó una sonda específica de la apolipoproteína B humana por PCR usando el cebador directo TGCTAAAGGCACATATGGCCT (SEQ ID NO: 4) y el cebador inverso CTCAGGTTGGACTCTCCATTGAG (SEQ ID NO: 5). Para normalizar las variaciones en la eficacia de la carga y transferencia, las membranas se cortaron en tiras y se trataron con sondas para el ARN de la gliceraldehído-3fosfato deshidrogenasa (GAPDH) humana (Clontech, Palo Alto, CA). To detect human apolipoprotein B, a human apolipoprotein B specific probe was prepared by PCR using the TGCTAAAGGCACATATGGCCT forward primer (SEQ ID NO: 4) and the CTCAGGTTGGACTCTCCATTGAG reverse primer (SEQ ID NO: 5). To normalize variations in loading and transfer efficiency, membranes were cut into strips and treated with probes for human glyceraldehyde-3phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, CA).
Para detectar la apolipoproteína B de ratón, se preparó una sonda específica de apolipoproteína B humana por PCR usando el cebador directo CGTGGGCTCCAGCATTCTA (SEQ ID NO: 11) y el cebador inverso AGTCATTTCTGCCTTTGCGTC (SEQ ID NO: 12). Para normalizar las variaciones en la eficacia de la carga y transferencia, las membranas se cortaron en tiras y se trataron con sondas para el ARN de la gliceraldehído-3fosfato deshidrogenasa (GAPDH) de ratón (Clontech, Palo Alto, CA). To detect mouse apolipoprotein B, a human apolipoprotein B specific probe was prepared by PCR using the forward primer CGTGGGCTCCAGCATTCTA (SEQ ID NO: 11) and reverse primer AGTCATTTCTGCCTTTGCGTC (SEQ ID NO: 12). To normalize variations in loading and transfer efficiency, membranes were cut into strips and treated with probes for mouse glyceraldehyde-3phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, CA).
Las membranas hibridadas se visualizaron y cuantificaron usando el Software fosfoRIMAGER™ y IMAGEQUANT™ V3.3 (Molecular Dynamics, Sunnyvale, CA). Los datos se normalizaron para los niveles de GAPDH en los controles no tratados. Hybridized membranes were visualized and quantified using the phosphoRIMAGER ™ and IMAGEQUANT ™ V3.3 Software (Molecular Dynamics, Sunnyvale, CA). Data were normalized for GAPDH levels in untreated controls.
Ejemplo 15 Example 15
Inhibición antisentido de la expresión de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi Antisense inhibition of human apolipoprotein B expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
Se diseñó una serie de oligonucleótidos para dirigir a diferentes regiones del ARN de la apolipoproteína B humana, A series of oligonucleotides were designed to target different regions of human apolipoprotein B RNA,
5 usando la secuencia publicada (número de acceso en GenBank NM_000384.1, incorporada en el presente documento como SEQ ID NO: 3). Los oligonucleótidos se muestran en la Tabla 1. El "sitio diana" indica el número del primer nucleótido (más 5') en la secuencia diana particular, al que se une el oligonucleótido. Todos los compuestos en la tabla 1 son oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud, compuestos de una región de "hueco" central que consiste en 10 2'-desoxinucleótidos, que está flanqueada en ambos lados 5 using the published sequence (GenBank accession number NM_000384.1, incorporated herein as SEQ ID NO: 3). The oligonucleotides are shown in Table 1. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 1 are chimeric oligonucleotides ("gammers") 20 nucleotides in length, composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which are flanked on both sides
10 (direcciones 5' y 3') por "alas" de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE) nucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todos los residuos de citidina son 5-metilcitidinas. Se analizó el efecto de los compuestos en los niveles de ARNm de la apolipoproteína B humana en células HepG2 por PCR en tiempo real cuantitativa, como se describe en otros ejemplos en la presente memoria. Los datos son medias de dos experimentos en los que las 10 (5 'and 3' directions) for 5-nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels in HepG2 cells was analyzed by quantitative real-time PCR, as described in other examples herein. Data are means of two experiments in which the
15 células HepG2 se trataron con los compuestos de la tabla 1 en concentración 150 nM. Si está presente, "N.D." indica "no hay datos". 15 HepG2 cells were treated with the compounds in Table 1 in 150 nM concentration. If present, "N.D." indicates "no data".
Tabla 1 Table 1
Inhibición de los niveles de ARNm de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi Inhibition of mRNA levels of human apolipoprotein B by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 147780 147780
- 5'UTR 3 1 CCGCAGGTCCCGGTGGGAAT 40 17 5'UTR 3 one CCGCAGGTCCCGGTGGGAAT 40 17
- 147781 147781
- 5'UTR 3 21 ACCGAGAAGGGCACTCAGCC 35 18 5'UTR 3 twenty-one ACCGAGAAGGGCACTCAGCC 35 18
- 147782 147782
- 5'UTR 3 71 GCCTCGGCCTCGCGGCCCTG 67 19 5'UTR 3 71 GCCTCGGCCTCGCGGCCCTG 67 19
- 147783 147783
- Codón de inicio 3 114 TCCATCGCCAGCTGCGGTGG N.D. 20 Start codon 3 114 TCCATCGCCAGCTGCGGTGG N.D. twenty
- 147784 147784
- Codificante 3 151 CAGCGCCAGCAGCGCCAGCA 70 21 Coding 3 151 CAGCGCCAGCAGCGCCAGCA 70 twenty-one
- 147785 147785
- Codificante 3 181 GCCCGCCAGCAGCAGCAGCA 29 22 Coding 3 181 GCCCGCCAGCAGCAGCAGCA 29 22
- 147786 147786
- Codificante 3 321 CTTGAATCAGCAGTCCCAGG 34 23 Coding 3 321 CTTGAATCAGCAGTCCCAGG 3. 4 2. 3
- 147787 147787
- Codificante 3 451 CTTCAGCAAGGCTTTGCCCT N.D. 24 Coding 3 451 CTTCAGCAAGGCTTTGCCCT N.D. 24
- 147788 147788
- Codificante 3 716 TTTCTGTTGCCACATTGCCC 95 25 Coding 3 716 TTTCTGTTGCCACATTGCCC 95 25
- 147789 147789
- Codificante 3 911 GGAAGAGGTGTTGCTCCTTG 24 26 Coding 3 911 GGAAGAGGTGTTGCTCCTTG 24 26
- 147790 147790
- Codificante 3 951 TGTGCTACCATCCCATACTT 33 27 Coding 3 951 TGTGCTACCATCCCATACTT 33 27
- 147791 147791
- Codificante 3 1041 TCAAATGCGAGGCCCATCTT N.D. 28 Coding 3 1041 TCAAATGCGAGGCCCATCTT N.D. 28
- 147792 147792
- Codificante 3 1231 GGACACCTCAATCAGCTGTG 26 29 Coding 3 1231 GGACACCTCAATCAGCTGTG 26 29
- 147793 147793
- Codificante 3 1361 TCAGGGCCACCAGGTAGGTG N.D. 30 Coding 3 1361 TCAGGGCCACCAGGTAGGTG N.D. 30
- 147794 147794
- Codificante 3 1561 GTAATCTTCATCCCCAGTGC 47 31 Coding 3 1561 GTAATCTTCATCCCCAGTGC 47 31
- 147795 147795
- Codificante 3 1611 TGCTCCATGGTTTGGCCCAT N.D. 32 Coding 3 1611 TGCTCCATGGTTTGGCCCAT N.D. 32
- 147796 147796
- Codificante 3 1791 GCAGCCAGTCGCTTATCTCC 8 33 Coding 3 1791 GCAGCCAGTCGCTTATCTCC 8 33
- 147797 147797
- Codificante 3 2331 GTATAGCCAAAGTGGTCCAC N.D. 34 Coding 3 2331 GTATAGCCAAAGTGGTCCAC N.D. 3. 4
- 147798 147798
- Codificante 3 2496 CCCAGGAGCTGGAGGTCATG N.D. 35 Coding 3 2496 CCCAGGAGCTGGAGGTCATG N.D. 35
- 147799 147799
- Codificante 3 2573 TTGAGCCCTTCCTGATGACC N.D. 36 Coding 3 2573 TTGAGCCCTTCCTGATGACC N.D. 36
- 147800 147800
- Codificante 3 2811 ATCTGGACCCCACTCCTAGC N.D. 37 Coding 3 2811 ATCTGGACCCCACTCCTAGC N.D. 37
- 147801 147801
- Codificante 3 2842 CAGACCCGACTCGTGGAAGA 38 38 Coding 3 2842 CAGACCCGACTCGTGGAAGA 38 38
- 147802 147802
- Codificante 3 3367 GCCCTCAGTAGATTCATCAT N.D. 39 Coding 3 3367 GCCCTCAGTAGATTCATCAT N.D. 39
- 147803 147803
- Codificante 3 3611 GCCATGCCACCCTGTTGGAA N.D. 40 Coding 3 3611 GCCATGCCACCCTGTTGGAA N.D. 40
- 147804 147804
- Codificante 3 3791 AACCCACGTGCCGGAAAGTC N.D. 41 Coding 3 3791 AACCCACGTGCCGGAAAGTC N.D. 41
- 147805 147805
- Codificante 3 3841 AGTCCCAGATGCCTTCTGAA N.D. 42 Coding 3 3841 AGTCCCAGATGCCTTCTGAA N.D. 42
- 147806 147806
- Codificante 3 4281 ATGTGGTAACGAGCCCGAAG 100 43 Coding 3 4281 ATGTGGTAACGAGCCCGAAG 100 43
- 147807 147807
- Codificante 3 4391 GGCGTAGAGACCGATCACAT 25 44 Coding 3 4391 GGCGTAGAGACCGATCACAT 25 44
- 147808 147808
- Codificante 3 4641 GTGTTAGGATCCCTCTGACA N.D. 45 Coding 3 4641 GTGTTAGGATCCCTCTGACA N.D. Four. Five
- 147809 147809
- Codificante 3 5241 CCCAGTGATAGCTCTGTGAG 60 46 Coding 3 5241 CCCAGTGATAGCTCTGTGAG 60 46
- 147810 147810
- Codificante 3 5355 ATTTCAGCATATGAGCCCAT 0 47 Coding 3 5355 ATTTCAGCATATGAGCCCAT 0 47
- 147811 147811
- Codificante 3 5691 CCCTGAACCTTAGCAACAGT N.D. 48 Coding 3 5691 CCCTGAACCTTAGCAACAGT N.D. 48
- 147812 147812
- Codificante 3 5742 GCTGAAGCCAGCCCAGCGAT N.D. 49 Coding 3 5742 GCTGAAGCCAGCCCAGCGAT N.D. 49
- 147813 147813
- Codificante 3 5891 ACAGCTGCCCAGTATGTTCT N.D. 50 Coding 3 5891 ACAGCTGCCCAGTATGTTCT N.D. fifty
- 147814 147814
- Codificante 3 7087 CCCAATAAGATTTATAACAA 34 51 Coding 3 7087 CCCAATAAGATTTATAACAA 3. 4 51
- 147815 147815
- Codificante 3 7731 TGGCCTACCAGAGACAGGTA 45 52 Coding 3 7731 TGGCCTACCAGAGACAGGTA Four. Five 52
- 147816 147816
- Codificante 3 7841 TCATACGTTTAGCCCAATCT 100 53 Coding 3 7841 TCATACGTTTAGCCCAATCT 100 53
- 147817 147817
- Codificante 3 7901 GCATGGTCCCAAGGATGGTC 0 54 Coding 3 7901 GCATGGTCCCAAGGATGGTC 0 54
- 147818 147818
- Codificante 3 8491 AGTGATGGAAGCTGCGATAC 30 55 Coding 3 8491 AGTGATGGAAGCTGCGATAC 30 55
- 147819 147819
- Codificante 3 9181 ATGAGCATCATGCCTCCCAG N.D. 56 Coding 3 9181 ATGAGCATCATGCCTCCCAG N.D. 56
- 147820 147820
- Codificante 3 9931 GAACACATAGCCGAATGCCG 100 57 Coding 3 9931 GAACACATAGCCGAATGCCG 100 57
- 147821 147821
- Codificante 3 10263 GTGGTGCCCTCTAATTTGTA N.D. 58 Coding 3 10263 GTGGTGCCCTCTAATTTGTA N.D. 58
- 147822 147822
- Codificante 3 10631 CCCGAGAAAGAACCGAACCC N.D. 59 Coding 3 10631 CCCGAGAAAGAACCGAACCC N.D. 59
- 147823 147823
- Codificante 3 10712 TGCCCTGCAGCTTGACTGAA 19 60 Coding 3 10712 TGCCCTGCAGCTTGACTGAA 19 60
- 147824 147824
- Codificante 3 11170 GAAATCCCATAAGCTCTTGT N.D. 61 Coding 3 11170 GAAATCCCATAAGCTCTTGT N.D. 61
- 147825 147825
- Codificante 3 12301 AGAAGCTGCCTCTTCTTCCC 72 62 Coding 3 12301 AGAAGCTGCCTCTTCTTCCC 72 62
- 147826 147826
- Codificante 3 12401 TCAGGGTGAGCCCTGTGTGT 80 63 Coding 3 12401 TCAGGGTGAGCCCTGTGTGT 80 63
- 147827 147827
- Codificante 3 12471 CTAATGGCCCCTTGATAAAC 13 64 Coding 3 12471 CTAATGGCCCCTTGATAAAC 13 64
- 147828 147828
- Codificante 3 12621 ACGTTATCCTTGAGTCCCTG 12 65 Coding 3 12621 ACGTTATCCTTGAGTCCCTG 12 65
- 147829 147829
- Codificante 3 12741 TATATCCCAGGTTTCCCCGG 64 66 Coding 3 12741 TATATCCCAGGTTTCCCCGG 64 66
- 147830 147830
- Codificante 3 12801 ACCTGGGACAGTACCGTCCC N.D. 67 Coding 3 12801 ACCTGGGACAGTACCGTCCC N.D. 67
- 147831 147831
- 3'UTR 3 13921 CTGCCTACTGCAAGGCTGGC 0 68 3'UTR 3 13921 CTGCCTACTGCAAGGCTGGC 0 68
- 147832 147832
- 3'UTR 3 13991 AGAGACCTTCCGAGCCCTGG N.D. 69 3'UTR 3 13991 AGAGACCTTCCGAGCCCTGG N.D. 69
- 147833 147833
- 3'UTR 3 14101 ATGATACACAATAAAGACTC 25 70 3'UTR 3 14101 ATGATACACAATAAAGACTC 25 70
Como se muestra en la tabla 1, las SEQ ID NO 17, 18, 19, 21, 23, 25, 27, 31, 38, 43, 46, 51, 52, 53, 55, 57, 62, 63 y 66 demostraron al menos 30% de inhibición de la expresión de la apolipoproteína B humana en este ensayo y por lo tanto se prefieren. Los sitios diana de los que estas secuencias preferidas son complementarias se denominan en el presente documento "sitios activos" y por lo tanto son sitios preferidos para dirigir los compuestos de la presente As shown in Table 1, SEQ ID NOs 17, 18, 19, 21, 23, 25, 27, 31, 38, 43, 46, 51, 52, 53, 55, 57, 62, 63, and 66 demonstrated at least 30% inhibition of human apolipoprotein B expression in this assay and are therefore preferred. The target sites to which these preferred sequences are complementary are referred to herein as "active sites" and are therefore preferred sites for targeting the compounds herein
5 descripción. Puesto que la apolipoproteína B existe en dos formas en mamíferos (ApoB-48 y ApoB-100) que son colineales en el extremo amino, los oligonucleótidos antisentido que se dirigen a los nucleótidos 1-6530 hibridan con ambas formas, mientras que los que se dirigen a los nucleótidos 6531-14121 son específicos de la forma larga de la apolipoproteína B. 5 description. Since apolipoprotein B exists in two mammalian forms (ApoB-48 and ApoB-100) that are collinear at the amino terminus, antisense oligonucleotides that target nucleotides 1-6530 hybridize to both forms, whereas those that are target nucleotides 6531-14121 are specific to the long form of apolipoprotein B.
Ejemplo 16 Example 16
10 Inhibición antisentido de la expresión de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi - Estudio de dosis-respuesta 10 Antisense Inhibition of Human Apolipoprotein B Expression by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap - Dose-response Study
Un subconjunto de oligonucleótidos antisentido del ejemplo 15 se investigaron más en estudios de dosis y respuesta. Las dosis de tratamiento eran 50, 150 y 250 nM. Se analizó el efecto de los compuestos en los niveles de ARNm de la apolipoproteína B humana en células HepG2 por PCR en tiempo real cuantivativa, como se describe en A subset of antisense oligonucleotides from Example 15 were further investigated in dose-response studies. The treatment doses were 50, 150 and 250 nM. The effect of the compounds on human apolipoprotein B mRNA levels in HepG2 cells was analyzed by quantitative real-time PCR, as described in
15 otros ejemplos en la presente memoria. Los datos son medias de dos experimentos y se muestran en la tabla 2. 15 other examples herein. Data are means from two experiments and are shown in Table 2.
Tabla 2 Table 2
Inhibición de los niveles de ARNm de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi Inhibition of mRNA levels of human apolipoprotein B by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
- Porcentaje de inhibición Inhibition percentage
- nº de ISIS ISIS number
- 50 nM 150 nM 250 nM 50 nM 150 nM 250 nM
- 147788 147788
- 54 63 72 54 63 72
- 147806 147806
- 23 45 28 2. 3 Four. Five 28
- 147816 147816
- 25 81 65 25 81 65
- 147820 147820
- 10 0 73 10 0 73
20 Ejemplo 17 20 Example 17
Inhibición antisentido de la expresión de la apolipoproteína B de ratón por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi Antisense inhibition of mouse apolipoprotein B expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
Se diseñó una serie de oligonucleótidos para dirigir a diferentes regiones del ARN de la apolipoproteína B de ratón, usando la secuencia publicada (número de acceso en GenBank M35186, incorporada en el presente documento 25 como SEQ ID NO: 10). Los oligonucleótidos se muestran en la Tabla 3. El "sitio diana" indica el número del primer nucleótido (más 5') en la secuencia diana particular, al que se une el oligonucleótido. Todos los compuestos en la tabla 3 son oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud, compuestos de una región de "hueco" central que consiste en 10 2'-desoxinucleótidos, que está flanqueada en ambos lados (direcciones 5' y 3') por "alas" de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE) nucleótidos. Los enlaces A series of oligonucleotides were designed to target different regions of mouse apolipoprotein B RNA, using the published sequence (GenBank accession number M35186, incorporated herein by SEQ ID NO: 10). The oligonucleotides are shown in Table 3. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 3 are 20 nucleotide long chimeric oligonucleotides ("gammers"), composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5 'directions and 3 ') by "wings" of 5 nucleotides. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. The links
30 internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todos los residuos de citidina son 5-metilcitidinas. Se analizó el efecto de los compuestos en los niveles de ARNm de la apolipoproteína B de ratón en hepatocitos primarios de ratón por PCR en tiempo real cuantitativa, como se describe en otros ejemplos en la presente memoria. Los hepatocitos primarios de ratón se trataron con los compuestos 150 mM de la tabla 3. Los datos son medias de dos experimentos. Si está presente, "N.D." indica "no hay datos". Internucleosides (main chain) are phosphorothioate (P = S) linkages throughout the entire oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on mouse apolipoprotein B mRNA levels in primary mouse hepatocytes was analyzed by quantitative real-time PCR, as described in other examples herein. Primary mouse hepatocytes were treated with the 150 mM compounds in Table 3. Data are means from two experiments. If present, "N.D." indicates "no data".
Tabla 3 Table 3
Inhibición de los niveles de ARNm de la apolipoproteína B de ratón por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi Inhibition of mouse apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 147475 147475
- Codificante 10 13 ATTGTATGTGAGAGGTGAGG 79 71 Coding 10 13 ATTGTATGTGAGAGGTGAGG 79 71
- 147476 147476
- Codificante 10 66 GAGGAGATTGGATCTTAAGG 13 72 Coding 10 66 GAGGAGATTGGATCTTAAGG 13 72
- 147477 147477
- Codificante 10 171 CTTCAAATTGGGACTCTCCT N.D 73 Coding 10 171 CTTCAAATTGGGACTCTCCT N.D 73
- 147478 147478
- Codificante 10 211 TCCAGGAATTGAGCTTGTGC 78 74 Coding 10 211 TCCAGGAATTGAGCTTGTGC 78 74
- 147479 147479
- Codificante 10 238 TTCAGGACTGGAGGATGAGG N.D 75 Coding 10 238 TTCAGGACTGGAGGATGAGG N.D 75
- 147480 147480
- Codificante 10 291 TCTCACCCTCATGCTCCATT 54 76 Coding 10 291 TCTCACCCTCATGCTCCATT 54 76
- 147481 147481
- Codificante 10 421 TGACTGTCAAGGGTGAGCTG 24 77 Coding 10 421 TGACTGTCAAGGGTGAGCTG 24 77
- 147482 147482
- Codificante 10 461 GTCCAGCCTAGGAACACTCA 59 78 Coding 10 461 GTCCAGCCTAGGAACACTCA 59 78
- 147483 147483
- Codificante 10 531 ATGTCAATGCCACATGTCCA N.D 79 Coding 10 531 ATGTCAATGCCACATGTCCA N.D 79
- 147484 147484
- Codificante 10 581 TTCATCCGAGAAGTTGGGAC 49 80 Coding 10 581 TTCATCCGAGAAGTTGGGAC 49 80
- 147485 147485
- Codificante 10 601 ATTTGGGACGAATGTATGCC 64 81 Coding 10 601 ATTTGGGACGAATGTATGCC 64 81
- 147486 147486
- Codificante 10 711 AGTTGAGGAAGCCAGATTCA N.D 82 Coding 10 711 AGTTGAGGAAGCCAGATTCA N.D 82
- 147487 147487
- Codificante 10 964 TTCCCAGTCAGCTTTAGTGG 73 83 Coding 10 964 TTCCCAGTCAGCTTTAGTGG 73 83
- 147488 147488
- Codificante 10 1023 AGCTTGCTTGTTGGGCACGG 72 84 Coding 10 1023 AGCTTGCTTGTTGGGCACGG 72 84
- 147489 147489
- Codificante 10 1111 CCTATACTGGCTTCTATGTT 5 85 Coding 10 1111 CCTATACTGGCTTCTATGTT 5 85
- 147490 147490
- Codificante 10 1191 TGAACTCCGTGTAAGGCAAG N.D 86 Coding 10 1191 TGAACTCCGTGTAAGGCAAG N.D 86
- 147491 147491
- Codificante 10 1216 GAGAAATCCTTCAGTAAGGG 71 87 Coding 10 1216 GAGAAATCCTTCAGTAAGGG 71 87
- 147492 147492
- Codificante 10 1323 CAATGGAATGCTTGTCACTG 68 88 Coding 10 1323 CAATGGAATGCTTGTCACTG 68 88
- 147493 147493
- Codificante 10 1441 GCTTCATTATAGGAGGTGGT 41 89 Coding 10 1441 GCTTCATTATAGGAGGTGGT 41 89
- 147494 147494
- Codificante 10 1531 ACAACTGGGATAGTGTAGCC 84 90 Coding 10 1531 ACAACTGGGATAGTGTAGCC 84 90
- 147495 147495
- Codificante 10 1631 GTTAGGACCAGGGATTGTGA 0 91 Coding 10 1631 GTTAGGACCAGGGATTGTGA 0 91
- 147496 147496
- Codificante 10 1691 ACCATGGAAAACTGGCAACT 19 92 Coding 10 1691 ACCATGGAAAACTGGCAACT 19 92
- 147497 147497
- Codificante 10 1721 TGGGAGGAAAAACTTGAATA N.D 93 Coding 10 1721 TGGGAGGAAAAACTTGAATA N.D 93
- 147498 147498
- Codificante 10 1861 TGGGCAACGATATCTGATTG 0 94 Coding 10 1861 TGGGCAACGATATCTGATTG 0 94
- 147499 147499
- Codificante 10 1901 CTGCAGGGCGTCAGTGACAA 29 95 Coding 10 1901 CTGCAGGGCGTCAGTGACAA 29 95
- 147500 147500
- Codificante 10 1932 GCATCAGACGTGATGTTCCC N.D 96 Coding 10 1932 GCATCAGACGTGATGTTCCC N.D 96
- 147501 147501
- Codificante 10 2021 CTTGGTTAAACTAATGGTGC 18 97 Coding 10 2021 CTTGGTTAAACTAATGGTGC 18 97
- 147502 147502
- Codificante 10 2071 ATGGGAGCATGGAGGTTGGC 16 98 Coding 10 2071 ATGGGAGCATGGAGGTTGGC 16 98
- 147503 147503
- Codificante 10 2141 AATGGATGATGAAACAGTGG 26 99 Coding 10 2141 AATGGATGATGAAACAGTGG 26 99
- 147504 147504
- Codificante 10 2201 ATCAATGCCTCCTGTTGCAG N.D 100 Coding 10 2201 ATCAATGCCTCCTGTTGCAG N.D 100
- 147505 147505
- Codificante 10 2231 GGAAGTGAGACTTTCTAAGC 76 101 Coding 10 2231 GGAAGTGAGACTTTCTAAGC 76 101
- 147506 147506
- Codificante 10 2.281 AGGAAGGAACTCTTGATATT 58 102 Coding 10 2,281 AGGAAGGAACTCTTGATATT 58 102
- 147507 147507
- Codificante 10 2321 ATTGGCTTCATTGGCAACAC 81 103 Coding 10 2321 ATTGGCTTCATTGGCAACAC 81 103
- 147759 147759
- Codificante 10 1 AGGTGAGGAAGTTGGAATTC 19 104 Coding 10 one AGGTGAGGAAGTTGGAATTC 19 104
- 147760 147760
- Codificante 10 121 TTGTTCCCTGAAGTTGTTAC N.D 105 Coding 10 121 TTGTTCCCTGAAGTTGTTAC N.D 105
- 147761 147761
- Codificante 10 251 GTTCATGGATTCCTTCAGGA 45 106 Coding 10 251 GTTCATGGATTCCTTCAGGA Four. Five 106
- 147762 147762
- Codificante 10 281 ATGCTCCATTCTCACATGCT 46 107 Coding 10 281 ATGCTCCATTCTCACATGCT 46 107
- 147763 147763
- Codificante 10 338 TGCGACTGTGTCTGATTTCC 34 108 Coding 10 338 TGCGACTGTGTCTGATTTCC 3. 4 108
- 147764 147764
- Codificante 10 541 GTCCCTGAAGATGTCAATGC 97 109 Coding 10 541 GTCCCTGAAGATGTCAATGC 97 109
- 147765 147765
- Codificante 10 561 AGGCCCAGTTCCATGACCCT 59 110 Coding 10 561 AGGCCCAGTTCCATGACCCT 59 110
- 147766 147766
- Codificante 10 761 GGAGCCCACGTGCTGAGATT 59 111 Coding 10 761 GGAGCCCACGTGCTGAGATT 59 111
- 147767 147767
- Codificante 10 801 CGTCCTTGAGCAGTGCCCGA 5 112 Coding 10 801 CGTCCTTGAGCAGTGCCCGA 5 112
- 147768 147768
- Codificante 10 1224 CCCATATGGAGAAATCCTTC 24 113 Coding 10 1224 CCCATATGGAGAAATCCTTC 24 113
- 147769 147769
- Codificante 10 1581 CATGCCTGGAAGCCAGTGTC 89 114 Coding 10 1581 CATGCCTGGAAGCCAGTGTC 89 114
- 147770 147770
- Codificante 10 1.741 GTGTTGAATCCCTTGAAATC 67 115 Coding 10 1,741 GTGTTGAATCCCTTGAAATC 67 115
- 147771 147771
- Codificante 10 1781 GGTAAAGTTGCCCATGGCTG 68 116 Coding 10 1781 GGTAAAGTTGCCCATGGCTG 68 116
- 147772 147772
- Codificante 10 1841 GTTATAAAGTCCAGCATTGG 78 117 Coding 10 1841 GTTATAAAGTCCAGCATTGG 78 117
- 147773 147773
- Codificante 10 1931 CATCAGACGTGATGTTCCCT 85 118 Coding 10 1931 CATCAGACGTGATGTTCCCT 85 118
- 147774 147774
- Codificante 10 1956 TGGCTAGTTTCAATCCCCTT 84 119 Coding 10 1956 TGGCTAGTTTCAATCCCCTT 84 119
- 147775 147775
- Codificante 10 2002 CTGTCATGACTGCCCTTTAC 52 120 Coding 10 2002 CTGTCATGACTGCCCTTTAC 52 120
- 147776 147776
- Codificante 10 2091 GCTTGAAGTTCATTGAGAAT 92 121 Coding 10 2091 GCTTGAAGTTCATTGAGAAT 92 121
- 147777 147777
- Codificante 10 2291 TTCCTGAGAAAGGAAGGAAC N.D 122 Coding 10 2291 TTCCTGAGAAAGGAAGGAAC N.D 122
- 147778 147778
- Codificante 10 2331 TCAGATATACATTGGCTTCA 14 123 Coding 10 2331 TCAGATATACATTGGCTTCA 14 123
Como se muestra en la tabla 3, las SEQ ID No 71, 74, 76, 78, 81, 83, 84, 87, 88, 90, 101, 102, 103, 109, 111, 111, 114, 115, 116, 117, 118, 119, 120 y 121 demostraron al menos 50% de inhibición de la expresión de la apolipoproteína B de ratón en este ensayo y por lo tanto son preferidas. Los sitios diana de los que estas secuencias preferidas son complementarias se denominan en el presente documento "sitios activos" y por lo tanto son sitios preferidos para dirigir los compuestos de la presente descripción. As shown in Table 3, SEQ ID No. 71, 74, 76, 78, 81, 83, 84, 87, 88, 90, 101, 102, 103, 109, 111, 111, 114, 115, 116, 117, 118, 119, 120 and 121 demonstrated at least 50% inhibition of mouse apolipoprotein B expression in this assay and are therefore preferred. Target sites to which these preferred sequences are complementary are referred to herein as "active sites" and are therefore preferred sites for targeting the compounds of the present disclosure.
Ejemplo 18 Example 18
5 Inhibición antisentido de la expresión de la apolipoproteína B de ratón por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi - Estudio de dosis-respuesta 5 Antisense Inhibition of Mouse Apolipoprotein B Expression by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap - Dose-response Study
Un subconjunto de oligonucleótidos antisentido del ejemplo 17 se investigaron más en estudios de dosis y respuesta. Las dosis de tratamiento eran 50, 150 y 300 nM. Se analizó el efecto de los compuestos en los niveles de ARNm de la apolipoproteína B de ratón en células hepatocitos primarios por PCR en tiempo real cuantitativa, como A subset of antisense oligonucleotides from Example 17 were further investigated in dose-response studies. The treatment doses were 50, 150 and 300 nM. The effect of the compounds on mouse apolipoprotein B mRNA levels in primary hepatocyte cells was analyzed by quantitative real-time PCR, such as
10 se describe en otros ejemplos en la presente memoria. Los datos son medias de dos experimentos y se muestran en la tabla 4. 10 is described in other examples herein. Data are means from two experiments and are shown in Table 4.
Tabla 4 Table 4
Inhibición de los niveles de ARNm de la apolipoproteína B de ratón por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi Inhibition of mouse apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
- Porcentaje de inhibición Inhibition percentage
- nº de ISIS ISIS number
- 50 nM 50 nM 300 nM 50 nM 50 nM 300 nM
- 147483 147483
- 56 88 89 56 88 89
- 147764 147764
- 48 84 90 48 84 90
- 147769 147769
- 3 14 28 3 14 28
- 147776 147776
- 0 17 44 0 17 44
Ejemplo 19 Example 19
Análisis de transferencia Western de los niveles de la proteína apolipoproteína B Western blot analysis of apolipoprotein B protein levels
Se llevaron a cabo análisis de transferencia Western (análisis de inmunotransferencia) usando métodos convencionales. Las células se recogieron 16-20 h después del tratamiento con oligonucleótido, se lavaron una vez 20 con PBS, se suspendieron en tampón de Laemmli (100 !l/pocillo), se hirvieron durante 5 min y se cargaron en un gel de SDS-PAGE al 16%. Los geles se hicieron correr durante 1,5 h a 150 V, y se transfirieron a membrana para la transferencia Western. Se usó el anticuerpo primario adecuado dirigido contra la apolipoproteína B, con un anticuerpo secundario radiomarcado o con marcaje fluorescente dirigido contra el anticuerpo primario. Las bandas se visualizaron usando fosfoRIMAGER™ (Molecular Dynamics, Sunnyvale CA) o el sistema de detección de Western blot analysis (immunoblot analysis) was carried out using standard methods. Cells were harvested 16-20 h after oligonucleotide treatment, washed 20 times with PBS, suspended in Laemmli buffer (100 µl / well), boiled for 5 min, and loaded on SDS-gel. PAGE at 16%. Gels were run for 1.5 hr at 150 V, and membrane transferred for Western blotting. The appropriate primary antibody directed against apolipoprotein B, with a radiolabelled secondary antibody, or with fluorescent labeling directed against the primary antibody was used. The bands were visualized using fosfoRIMAGER ™ (Molecular Dynamics, Sunnyvale CA) or the detection system of
25 quimioluminiscente ECL+ (Amersham Biosciences, Piscataway, NJ). Chemiluminescent ECL + (Amersham Biosciences, Piscataway, NJ).
Ejemplo 20 Example 20
Efectos de la inhibición antisentido de la apolipoproteína B (ISIS 147764) en ratones C57BL/6: Animales magros frente a animales alimentados con dieta alta en grasa. Effects of antisense inhibition of apolipoprotein B (ISIS 147764) in C57BL / 6 mice: Lean animals versus animals fed a high fat diet.
Se usaron ratones C57BL/6, una cepa que se ha descrito que es susceptible a la formación de placas C57BL / 6 mice were used, a strain that has been described as susceptible to plaque formation
30 ateroscleróticas inducidas por hiperlipidemia, en los siguientes estudios para evaluar los oligonucleótidos antisentido como potenciales compuestos reductores de lípidos en ratones magros frente a alimentados con dieta alta en grasa. 30 atherosclerotic hyperlipidemia-induced in the following studies to evaluate antisense oligonucleotides as potential lipid-lowering compounds in lean mice versus those fed a high-fat diet.
Los ratones C57BL/6 macho se dividieron en dos grupos; (1) animales de control no manipulados genéticamente (animales magros) y (2) animales que recibían una dieta alta en grasa (60% de kcal de grasa). Los animales de control recibieron tratamiento salino y se mantuvieron con una dieta normal para roedores. Después de ayunar Male C57BL / 6 mice were divided into two groups; (1) non-genetically manipulated control animals (lean animals) and (2) animals that received a high-fat diet (60% kcal of fat). Control animals received saline treatment and were maintained on a normal rodent diet. After fasting
35 durante la noche, se administró a los ratones de cada grupo por vía intraperitoneal cada 3 días, disolución salina o ISIS 147764 50 mg/kg (SEQ ID No: 109) durante 6 semanas. Al terminar el estudio y 48 h después de las inyecciones finales, los animales se sacrificaron y se evaluaron los niveles de ARNm diana en el hígado, niveles de colesterol y triglicéridos, niveles de enzimas hepáticas y niveles de glucosa en el suero. Overnight, mice in each group were administered intraperitoneally every 3 days, saline or ISIS 147764 50 mg / kg (SEQ ID No: 109) for 6 weeks. At the end of the study and 48 h after the final injections, the animals were sacrificed and the target mRNA levels in the liver, cholesterol and triglyceride levels, liver enzyme levels and serum glucose levels were evaluated.
Los resultados de los estudios comparativos se muestran en la tabla 5. Tabla 5 Efectos del tratamiento con ISIS 147764 en los niveles de ARNm de apolipoproteína B, colesterol, lípidos, The results of the comparative studies are shown in Table 5. Table 5 Effects of ISIS 147764 treatment on apolipoprotein B mRNA levels, cholesterol, lipids,
triglicéridos, enzimas hepáticas y glucosa, en ratones magros y con dieta alta en grasa. triglycerides, liver enzymes and glucose, in lean mice and with a high fat diet.
- Grupo de Group of
- Porcentaje de cambio Percentage of change
- tratamiento treatment
- Lipoproteínas Enzimas hepáticas Lipoproteins Hepatic enzymes
- ARNm MRNA
- COL. VLDL LDL HDL TRIG. AST ALT GLUC. CABBAGE. VLDL LDL HDL TRIG. AST ALT GLUC.
- Control magros Lean control
- -73 -63 no hay cambios -64 -44 -34 ligera disminución no hay cambios no hay cambios -73 -63 there are no changes -64 -44 -3. 4 slight decrease there are no changes there are no changes
- Grupo de dieta alta en grasa High fat diet group
- -87 -67 no hay cambios -87 -65 no hay cambios ligera disminución ligero aumento -28 -87 -67 there are no changes -87 -65 there are no changes slight decrease slight increase -28
Es evidente a partir de estos datos, que el tratamiento con ISIS 147764 disminuyó el colesterol así como las lipoproteínas LDL y HDL y la glucosa en el suero tanto en ratones magros como en los de dieta alta en grasa, y que los efectos demostrados se deben, de hecho, a la inhibición de la expresión de la apolipoproteína B como apoya la disminución de los niveles de ARNm. No se observaron cambios significativos en los niveles de enzimas hepáticas, It is evident from these data that treatment with ISIS 147764 lowered cholesterol as well as LDL and HDL lipoproteins and serum glucose in both lean and high-fat diet mice, and that the demonstrated effects should be , in fact, to the inhibition of apolipoprotein B expression as it supports the decrease of mRNA levels. No significant changes in liver enzyme levels were observed,
10 lo que indica que el oligonucleótido antisentido no era tóxico para ninguno de los grupos de tratamiento. 10 indicating that the antisense oligonucleotide was not toxic to any of the treatment groups.
Ejemplo 21 Example 21
Efectos de la inhibición antisentido de la apolipoproteína B (ISIS 147764) en ratones alimentados con dieta alta en grasa; Estudio de la evolución temporal de 6 semanas Effects of antisense inhibition of apolipoprotein B (ISIS 147764) in mice fed a high-fat diet; Study of the temporal evolution of 6 weeks
Se llevó a cabo un estudio de la evolución temporal de 6 semanas para investigar más los efectos de ISIS 147764 15 en el metabolismo de lípidos y glucosa en ratones alimentados con dieta alta en grasa. A 6-week time course study was conducted to further investigate the effects of ISIS 147764 15 on lipid and glucose metabolism in mice fed the high-fat diet.
Se evaluó en ratones C57BL/6 macho (n=8) que recibían una dieta alta en grasa (60% de kcal de grasa) a lo largo de un periodo de 6 semanas, los efectos del tratamiento con el oligonucleótido antisentido, ISIS 147764. Los animales de control recibieron tratamiento con disolución salina (50 mg/kg). Un subconjunto de animales recibió una dosis oral diaria (20 mg/kg) de atorvastatina de calcio (Lipitor®, Pfizer Inc.). Se administró a todos los ratones, 20 excepto los animales tratados con atorvastatina, por vía intraperitoneal cada 3 días (dos veces por semana), después de la noche en ayunas, 5, 25, 50 mg/kg de ISIS 147764 (SEQ ID No: 109) o disolución salina (50 mg/kg) durante 6 semanas. Se analizó el colesterol y las lipoproteínas en el suero en los tiempos de medición intermedios de 0, 2 y 6 semanas. Al terminar el estudio, los animales se sacrificaron 48 h después de las inyecciones finales y se evaluaron los niveles de ARNm diana en el hígado, niveles de colesterol, lipoproteína, triglicéridos, enzimas 25 hepáticas (AST y ALT) y glucosa en el suero, así como los pesos corporal, del hígado, bazo y almohadillas de grasa. Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) over a period of 6 weeks were evaluated for the effects of treatment with the antisense oligonucleotide, ISIS 147764. Control animals received treatment with saline solution (50 mg / kg). A subset of animals received a daily oral dose (20 mg / kg) of atorvastatin calcium (Lipitor®, Pfizer Inc.). All mice, 20 except atorvastatin-treated animals, were administered intraperitoneally every 3 days (twice weekly), after an overnight fast, 5, 25, 50 mg / kg of ISIS 147764 (SEQ ID No. : 109) or saline solution (50 mg / kg) for 6 weeks. Serum cholesterol and lipoproteins were analyzed at the intermediate measurement times of 0, 2 and 6 weeks. At the end of the study, the animals were sacrificed 48 h after the final injections and the levels of target mRNA in the liver, levels of cholesterol, lipoprotein, triglycerides, liver enzymes (AST and ALT) and glucose in serum were evaluated, as well as body, liver, spleen and fat pad weights.
Ejemplo 22 Example 22
Efectos de la inhibición antisentido de la apolipoproteína B (ISIS 147764) en ratones alimentados con dieta alta en grasa - expresión de ARNm en el hígado Effects of antisense inhibition of apolipoprotein B (ISIS 147764) in mice fed a high-fat diet - mRNA expression in the liver
Se evaluó en ratones C57BL/6 macho (n=8) que recibían una dieta alta en grasa (60% de kcal de grasa) a lo largo Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) were evaluated throughout
30 de un periodo de 6 semanas, los efectos de ISIS 147764 en la expresión de ARNm. Los animales de control recibieron tratamiento con disolución salina (50 mg/kg). Se administró a los ratones por vía intraperitoneal cada 3 días (dos veces por semana) 5, 25, 50 mg/kg de ISIS 147764 (SEQ ID No: 109) o disolución salina (50 mg/kg) durante 6 semanas. Al terminar el estudio, los animales se sacrificaron 48 h después de las inyecciones finales y se evaluaron los niveles de ARNm diana en el hígado. ISIS 147764 mostró un efecto de dosis-respuesta, reduciendo 30 of a 6-week period, the effects of ISIS 147764 on mRNA expression. Control animals received treatment with saline solution (50 mg / kg). Mice were administered intraperitoneally every 3 days (twice weekly) 5, 25, 50 mg / kg ISIS 147764 (SEQ ID No: 109) or saline (50 mg / kg) for 6 weeks. At the end of the study, the animals were sacrificed 48 h after the final injections and the target mRNA levels in the liver were evaluated. ISIS 147764 showed a dose-response effect, reducing
35 los niveles de ARNm en 15, 75 y 88% con dosis de 5, 25 y 50 mg/kg, respectivamente. 35 mRNA levels at 15, 75 and 88% with doses of 5, 25 and 50 mg / kg, respectively.
Las muestras de proteínas hepáticas recogidas al final del periodo de tratamiento se sometieron a análisis de inmunotransferencia usando un anticuerpo dirigido contra la proteínas apolipoproteína B de ratón (Gladstone Institute, San Francisco, CA). Estos datos demuestran que el tratamiento con ISIS 147764 disminuye la expresión de la proteína apolipoproteína B en el hígado, de una forma dependiente de la dosis, además de reducir los niveles de Liver protein samples collected at the end of the treatment period were subjected to immunoblot analysis using an antibody directed against mouse apolipoprotein B protein (Gladstone Institute, San Francisco, CA). These data demonstrate that treatment with ISIS 147764 decreases the expression of apolipoprotein B protein in the liver, in a dose-dependent manner, in addition to reducing levels of
40 ARNm. 40 mRNA.
Ejemplo 23 Example 23
Efectos de la inhibición antisentido de la apolipoproteína B (ISIS 147764) en los niveles de colesterol y triglicéridos en el suero Effects of antisense inhibition of apolipoprotein B (ISIS 147764) on serum cholesterol and triglycerides levels
Se evaluó en ratones C57BL/6 macho (n=8) que recibían una dieta alta en grasa (60% de kcal de grasa) a lo largo Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) were evaluated throughout
45 de un periodo de 6 semanas, los efectos de ISIS 147764 en los niveles de colesterol y triglicéridos en el suero. Los animales de control recibieron tratamiento con disolución salina (50 mg/kg). Se administró a los ratones por vía intraperitoneal cada 3 días (dos veces por semana) 5, 25, 50 mg/kg de ISIS 147764 (SEQ ID No: 109) o disolución salina (50 mg/kg) durante 6 semanas. 45 of a 6-week period, the effects of ISIS 147764 on serum cholesterol and triglyceride levels. Control animals received treatment with saline solution (50 mg / kg). Mice were administered intraperitoneally every 3 days (twice weekly) 5, 25, 50 mg / kg ISIS 147764 (SEQ ID No: 109) or saline (50 mg / kg) for 6 weeks.
Los niveles de colesterol en el suero se midieron a las 0, 2 y 6 semanas y estos datos se muestran en la tabla 6. Los valores en la tabla se expresan como porcentaje de inhibición y están normalizados respecto al control de disolución 5 salina. Serum cholesterol levels were measured at 0, 2 and 6 weeks and these data are shown in Table 6. The values in the table are expressed as percentage of inhibition and are normalized with respect to the control of saline dissolution.
Además del colesterol del suero, al final del estudio, los animales se sacrificaron 48 h después de las inyecciones finales y se evaluaron los niveles de triglicéridos. In addition to serum cholesterol, at the end of the study, animals were sacrificed 48 h after the final injections and triglyceride levels were assessed.
Los ratones tratados con ISIS 147764 mostraron una reducción tanto del colesterol en el suero (240 mg/dl para los animales de control y 225, 125 y 110 mg/dl para dosis de 5, 25 y 50 mg/kg, respectivamente) como de los Mice treated with ISIS 147764 showed a reduction in both serum cholesterol (240 mg / dl for control animals and 225, 125 and 110 mg / dl for doses of 5, 25 and 50 mg / kg, respectively) and of the
10 triglicéridos (115 mg/dl para animales de control y 125, 150 y 85 mg/dl para dosis de 5, 25 y 50 mg/kg, respectivamente) con respecto a los niveles normales al final de estudio. Estos datos también se compararon con los efectos de la atorvastatina de calcio con una dosis oral de 20 mg/kg, que mostró solo una mínima disminución del colesterol en el suero del 20% al terminar el estudio. 10 triglycerides (115 mg / dl for control animals and 125, 150 and 85 mg / dl for doses of 5, 25 and 50 mg / kg, respectively) with respect to the normal levels at the end of the study. These data were also compared with the effects of calcium atorvastatin at an oral dose of 20 mg / kg, which showed only a minimal decrease in serum cholesterol of 20% at the end of the study.
Tabla 6 Table 6
15 Porcentaje de inhibición de la apolipoproteína B en los niveles de colesterol por ISIS 147764 15 Percentage of inhibition of apolipoprotein B in cholesterol levels by ISIS 147764
- Porcentaje de inhibición Inhibition percentage
- tiempo weather
- Disolución salina 5 mg/kg 25 mg/kg 50 mg/kg Saline dissolution 5 mg / kg 25 mg / kg 50 mg / kg
- 0 semanas 0 weeks
- 0 0 0 0 0 0 0 0
- 2 semanas 2 weeks
- 0 5 12 20 0 5 12 twenty
- 6 semanas 6 weeks
- 0 10 45 55 0 10 Four. Five 55
Ejemplo 24 Example 24
Efectos de la inhibición antisentido de la apolipoproteína B (ISIS 147764) en los niveles de lipoproteína Effects of antisense inhibition of apolipoprotein B (ISIS 147764) on lipoprotein levels
Se evaluó en ratones C57BL/6 macho (n=8) que recibían una dieta alta en grasa (60% de kcal de grasa) a lo largo Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) were evaluated throughout
20 de un periodo de 6 semanas, los efectos de ISIS 147764 en los niveles de lipoproteínas (VLDL, LDL y HDL). Los animales de control recibieron tratamiento con disolución salina (50 mg/kg). Se administró a los ratones por vía intraperitoneal cada 3 días (dos veces por semana) 5, 25, 50 mg/kg de ISIS 147764 (SEQ ID No: 109) o disolución salina (50 mg/kg) durante 6 semanas. 20 of a 6-week period, the effects of ISIS 147764 on lipoprotein levels (VLDL, LDL, and HDL). Control animals received treatment with saline solution (50 mg / kg). Mice were administered intraperitoneally every 3 days (twice weekly) 5, 25, 50 mg / kg ISIS 147764 (SEQ ID No: 109) or saline (50 mg / kg) for 6 weeks.
Los niveles de lipoproteínas se midieron a las 0, 2 y 6 semanas y estos datos se muestran en la tabla 7. Los valores Lipoprotein levels were measured at 0, 2 and 6 weeks and these data are shown in Table 7. The values
25 en la tabla se expresan como porcentaje de inhibición y están normalizados respecto al control de disolución salina. Los valores negativos indican un aumento observado en los niveles de lipoproteínas. 25 in the table are expressed as percent inhibition and are normalized with respect to saline control. Negative values indicate an observed increase in lipoprotein levels.
Estos datos también se compararon con los efectos de la atorvastatina de calcio con una dosis oral diaria de 20 mg/kg a las 0, 2 y 6 semanas. These data were also compared with the effects of atorvastatin calcium at a daily oral dose of 20 mg / kg at 0, 2, and 6 weeks.
Estos datos demuestran que con una dosis de 50 mg/kg, ISIS 147764 es capaz de reducir todas las categorías de 30 lipoproteínas en el suero investigadas en una mayor extensión que la atorvastatina. These data demonstrate that at a dose of 50 mg / kg, ISIS 147764 is able to reduce all investigated serum lipoprotein 30 categories to a greater extent than atorvastatin.
Tabla 7 Table 7
Porcentaje de inhibición de la apolipoproteína B de ratón por ISIS 147764 en los niveles de lipoproteínas comparado con la atorvastatina Percentage of inhibition of mouse apolipoprotein B by ISIS 147764 in lipoprotein levels compared to atorvastatin
- Porcentaje de inhibición Inhibition percentage
- Dosis Dose
- Lipoproteína Lipoprotein
- Tiempo (semanas) disolución salina 5 mg/kg 25 mg/kg 50 mg/kg atorvastatina (20 mg/kg) Time (weeks) saline solution 5 mg / kg 25 mg / kg 50 mg / kg atorvastatin (20 mg / kg)
- VLDL VLDL
- 0 0 0 0 0 0 0 0 0 0 0 0
- 2 2
- 0 25 30 40 15 0 25 30 40 fifteen
- 6 6
- 0 10 -30 15 -5 0 10 -30 fifteen -5
- LDL LDL
- 0 0 0 0 0 0 0 0 0 0 0 0
- 2 2
- 0 -30 10 40 10 0 -30 10 40 10
- 6 6
- 0 -10 55 90 -10 0 -10 55 90 -10
- HDL HDL
- 0 0 0 0 0 0 0 0 0 0 0 0
- 2 2
- 0 5 10 10 15 0 5 10 10 fifteen
- 6 6
- 0 10 45 50 20 0 10 Four. Five fifty twenty
Ejemplo 25 Example 25
Efectos de la inhibición antisentido de la apolipoproteína B (ISIS 147764) en los niveles de AST y ALT en el suero Effects of antisense inhibition of apolipoprotein B (ISIS 147764) on serum AST and ALT levels
Se evaluó en ratones C57BL/6 macho (n=8) que recibían una dieta alta en grasa (60% de kcal de grasa) a lo largo de un periodo de 6 semanas, los efectos de ISIS 147764 en los niveles de enzimas hepáticas (AST y ALT). Los mayores niveles de las enzimas hepáticas ALT y AST indican toxicidad y daño hepático. Los animales de control recibieron tratamiento con disolución salina (50 mg/kg). Se administró a los ratones por vía intraperitoneal cada 3 días (dos veces por semana) 5, 25, 50 mg/kg de ISIS 147764 (SEQ ID No: 109) o disolución salina (50 mg/kg) durante 6 semanas. Los niveles de AST y ALT se midieron a las 6 semanas. Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) over a period of 6 weeks were evaluated for the effects of ISIS 147764 on liver enzyme levels ( AST and ALT). Higher levels of liver enzymes ALT and AST indicate toxicity and liver damage. Control animals received treatment with saline solution (50 mg / kg). Mice were administered intraperitoneally every 3 days (twice weekly) 5, 25, 50 mg / kg ISIS 147764 (SEQ ID No: 109) or saline (50 mg / kg) for 6 weeks. AST and ALT levels were measured at 6 weeks.
Los ratones tratados con ISIS 147764 no mostraron un cambio significativo en los niveles de AST a lo largo de la duración del estudio comparado con los controles de disolución salina (105, 70 y 80 UI/l para dosis de 5, 25 y 50 mg/kg, respectivamente, comparado con 65 UI/l para el control con disolución salina). Los ratones tratados con atorvastatina con una dosis oral diaria de 20 mg/kg tenían niveles de AST de 85 UI/l. Mice treated with ISIS 147764 did not show a significant change in AST levels over the duration of the study compared to saline controls (105, 70, and 80 IU / l for doses of 5, 25, and 50 mg / kg, respectively, compared to 65 IU / l for the control with saline solution). Mice treated with atorvastatin at a daily oral dose of 20 mg / kg had AST levels of 85 IU / l.
Los niveles de ALT aumentaron con todos los tratamientos con ISIS 147764 a lo largo de la duración del estudio comparado con los controles de disolución salina (50, 70 y 100 UI/l para dosis de 5, 25 y 50 mg/kg, respectivamente, comparado con 25 UI/l para controles de disolución salina). Los ratones tratados con atorvastatina con una dosis oral diaria de 20 mg/kg tenían niveles de AST de 40 UI/l. ALT levels increased with all ISIS 147764 treatments over the duration of the study compared with saline controls (50, 70, and 100 IU / l for doses of 5, 25, and 50 mg / kg, respectively, compared to 25 IU / l for saline controls). Mice treated with atorvastatin at a daily oral dose of 20 mg / kg had AST levels of 40 IU / l.
Ejemplo 26 Example 26
Efectos de la inhibición antisentido de la apolipoproteína B (ISIS 147764) en los niveles de glucosa en el suero Effects of antisense inhibition of apolipoprotein B (ISIS 147764) on serum glucose levels
Se evaluó en ratones C57BL/6 macho (n=8) que recibían una dieta alta en grasa (60% de kcal de grasa) a lo largo de un periodo de 6 semanas, los efectos de ISIS 147764 en los niveles de glucosa en el suero. Los animales de control recibieron tratamiento con disolución salina (50 mg/kg). Se administró a los ratones por vía intraperitoneal cada 3 días (dos veces por semana) 5, 25, 50 mg/kg de ISIS 147764 (SEQ ID No: 109) o disolución salina (50 mg/kg) durante 6 semanas. Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) over a period of 6 weeks were evaluated for the effects of ISIS 147764 on glucose levels in the serum. Control animals received treatment with saline solution (50 mg / kg). Mice were administered intraperitoneally every 3 days (twice weekly) 5, 25, 50 mg / kg ISIS 147764 (SEQ ID No: 109) or saline (50 mg / kg) for 6 weeks.
Al terminar el estudio, los animales se sacrificaron 48 h después de las inyecciones finales y se evaluaron los niveles de glucosa en el suero. ISIS 147764 mostró un efecto de dosis-respuesta, reduciendo los niveles de glucosa en el suero a 225, 190 y 180 mg/dl con dosis de 5, 25 y 50 mg/kg, respectivamente, comparado con el control de disolución salina de 300 mg/dl. Los ratones tratados con atorvastatina con una dosis oral diaria de 20 mg/kg tenían niveles de glucosa en el suero de 215 mg/dl. Estos datos demuestran que ISIS 147764 es capaz de reducir los niveles de glucosa en el suero en ratones alimentados con dieta alta en grasa. At the end of the study, the animals were sacrificed 48 h after the final injections and the serum glucose levels were evaluated. ISIS 147764 showed a dose-response effect, reducing serum glucose levels to 225, 190, and 180 mg / dl at doses of 5, 25, and 50 mg / kg, respectively, compared to the saline control of 300 mg / dl. Mice treated with atorvastatin at a daily oral dose of 20 mg / kg had serum glucose levels of 215 mg / dl. These data demonstrate that ISIS 147764 is able to reduce serum glucose levels in mice fed a high-fat diet.
Ejemplo 27 Example 27
Efectos de la inhibición antisentido de la apolipoproteína B (ISIS 147764) en el peso corporal, de bazo, hígado y almohadillas de grasa Effects of antisense inhibition of apolipoprotein B (ISIS 147764) on body weight, spleen, liver and fat pads
Se evaluó en ratones C57BL/6 macho (n=8) que recibían una dieta alta en grasa (60% de kcal de grasa) a lo largo de un periodo de 6 semanas, los efectos de ISIS 147764 en el peso corporal, de bazo, hígado y almohadillas de grasa.Los animales de control recibieron tratamiento con disolución salina (50 mg/kg). Se administró a los ratones por vía intraperitoneal cada 3 días (dos veces por semana) 5, 25, 50 mg/kg de ISIS 147764 (SEQ ID No: 109) o disolución salina (50 mg/kg) durante 6 semanas. Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) over a period of 6 weeks were evaluated for the effects of ISIS 147764 on body weight of the spleen , liver and fat pads. Control animals received treatment with saline solution (50 mg / kg). Mice were administered intraperitoneally every 3 days (twice weekly) 5, 25, 50 mg / kg ISIS 147764 (SEQ ID No: 109) or saline (50 mg / kg) for 6 weeks.
Al terminar el estudio, los animales se sacrificaron 48 h después de las inyecciones finales y se midieron los pesos corporal, de bazo, hígado y almohadillas de grasa. Estos datos se muestran en la tabla 8. Los valores se expresan como porcentaje de cambio en el peso corporal o peso del órgano comparado con los animales de control tratados con disolución salina. Los datos de los ratones tratados con atorvastatina con una dosis diaria de 20 mg/kg también se muestran en la tabla. Los valores negativos indicaban una disminución del peso. At the end of the study, the animals were sacrificed 48 h after the final injections and body, spleen, liver and fat pad weights were measured. These data are shown in Table 8. Values are expressed as percent change in body weight or organ weight compared to control animals treated with saline. Data from mice treated with atorvastatin at a daily dose of 20 mg / kg are also shown in the table. Negative values indicated a decrease in weight.
Tabla 8 Table 8
Efectos de la inhibición antisentido de la apolipoproteína B de ratón en el peso corporal y de órganos Effects of mouse apolipoprotein B antisense inhibition on body and organ weight
- Porcentaje de cambio Percentage of change
- Dosis Dose
- Atorvastatina Atorvastatin
- Tejido Tissue
- 5 mg/kg 25 mg/kg 50 mg/kg 20 mg/kg 5 mg / kg 25 mg / kg 50 mg / kg 20 mg / kg
- Peso corporal total Total body weight
- 5 5 -4 1 5 5 -4 one
- Bazo Spleen
- 10 10 46 10 10 10 46 10
- Hígado Liver
- 18 70 80 15 18 70 80 fifteen
- Grasa Grease
- 10 6 -47 7 10 6 -47 7
Estos datos muestran una disminución en la grasa a lo largo del intervalo de dosificación de ISIS 147764 contrarrestado por un aumento tanto del peso del bazo como del hígado con una dosis mayor para dar una disminución general del peso corporal total. These data show a decrease in fat over the ISIS 147764 dosing interval offset by an increase in both spleen and liver weight with a higher dose to give an overall decrease in total body weight.
Ejemplo 28 Example 28
Efectos de la inhibición antisentido de la apolipoproteína B (ISIS 147764) en ratones que no expresan B6.129P-Apoetm1Unc: Animales magros frente a animales alimentados con dieta alta en grasa. Effects of antisense inhibition of apolipoprotein B (ISIS 147764) in mice that do not express B6.129P-Apoetm1Unc: Lean animals versus animals fed a high fat diet.
Los ratones que no expresan B6.129P-ApoEtm1Unc (denominados en la presente memoria ratones que no expresan ApoE) obtenidos de The Jackson Laboratory (Bar Harbor, ME), son homocigóticos para la mutación Apoetm1Unc y muestran un aumento notable de los niveles totales de colesterol en el plasma que no son afectados por la edad o el sexo. Estos animales presentan estrías grasas en la aorta proximal a la edad de 3 meses. Estas lesiones aumentan con la edad y evolucionan a lesiones con menos lípidos pero células más alargadas, típico de un estadio más avanzado de la lesión preaterosclerótica. Mice not expressing B6.129P-ApoEtm1Unc (referred to herein as non-ApoE-expressing mice) obtained from The Jackson Laboratory (Bar Harbor, ME), are homozygous for the Apoetm1Unc mutation and show a marked increase in total levels of cholesterol in the plasma that are not affected by age or sex. These animals present fatty striae in the proximal aorta at the age of 3 months. These lesions increase with age and evolve into lesions with fewer lipids but more elongated cells, typical of a more advanced stage of pre-atherosclerotic injury.
La mutación en estos ratones reside en el gen de la apolipoproteína E (ApoE). La función principal de la proteína ApoE es transportar el colesterol y los triglicéridos por todo el cuerpo. Estabiliza la estructura de las lipoproteínas, se une al receptor de lipoproteína de baja densidad (LDLR) y proteínas relacionadas, y está presente en una subclase de HDL, proporcionándoles la capacidad para unirse al LDLR. La ApoE es expresada de forma más abundante en el hígado y el cerebro. Se usaron ratones hembra que no expresan B6.129P-Apoetm1Unc (ratones que no expresan ApoE) en los siguientes estudios para evaluar los oligonucleótidos antisentido como potenciales compuestos que reducen los lípidos. The mutation in these mice resides in the apolipoprotein E (ApoE) gene. The main function of the ApoE protein is to transport cholesterol and triglycerides throughout the body. It stabilizes the structure of lipoproteins, binds to the low-density lipoprotein receptor (LDLR) and related proteins, and is present in a subclass of HDL, giving them the ability to bind to LDLR. ApoE is most abundantly expressed in the liver and brain. Female mice that do not express B6.129P-Apoetm1Unc (mice that do not express ApoE) were used in the following studies to evaluate antisense oligonucleotides as potential lipid-lowering compounds.
Los ratones hembra que no expresan ApoE tenían edades comprendidas entre 5 y 7 semanas y se pusieron en una dieta normal durante 2 semanas antes de iniciar el estudio. Después, los ratones que no expresan ApoE se alimentaron a voluntad con una dieta con 60% de grasa, con 0,15% de colesterol añadido para inducir dislipidemia y obesidad. Los animales de control se mantuvieron con una dieta alta en grasa sin colesterol añadido. Después de ayunar durante la noche, se administró a los ratones de cada grupo por vía intraperitoneal cada 3 días, disolución salina, 50 mg/kg de un oligonucleótido antisentido de control (ISIS 29837; TCGATCTCCTTTTATGCCCG; SEQ. ID. NO. 124) o 5, 25 ó 50 mg/kg de ISIS 147764 (SEQ ID No: 109) durante 6 semanas. The female mice that do not express ApoE were between 5 and 7 weeks old and were put on a normal diet for 2 weeks before starting the study. The non-ApoE-expressing mice were then fed at will with a 60% fat diet, with 0.15% added cholesterol to induce dyslipidemia and obesity. Control animals were maintained on a high fat diet with no added cholesterol. After fasting overnight, mice in each group were administered intraperitoneally every 3 days, saline, 50 mg / kg of a control antisense oligonucleotide (ISIS 29837; TCGATCTCCTTTTATGCCCG; SEQ. ID. NO. 124) or 5, 25 or 50 mg / kg ISIS 147764 (SEQ ID No: 109) for 6 weeks.
El oligonucleótido de control es un oligonucleótido quimérico ("gápmeros") de 20 nucleótidos de longitud, compuesto de una región de "hueco" central que consiste en 10 2'-desoxinucleótidos, que está flanqueada en ambos lados (direcciones 5' y 3') por "alas" de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE) nucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todos los residuos de citidina son 5-metilcitidinas. The control oligonucleotide is a 20 nucleotide long chimeric oligonucleotide ("gammers"), composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5 'and 3' directions ) by "wings" of 5 nucleotides. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines.
Al terminar el estudio y 48 h después de las inyecciones finales, los animales se sacrificaron y se evaluaron los niveles de ARNm diana en el hígado por métodos de RT-PCR verificado por análisis de transferencia Northern, los niveles de glucosa, niveles de colesterol y lípidos por métodos de separación de HPLC y niveles de triglicéridos y enzimas hepáticas (realizados por LabCorp Preclinical Services; San Diego, CA). Los datos de los ratones que no expresan ApoE tratados con atorvastatina con una dosis diaria de 20 mg/kg, también se muestran en la tabla para comparar. At the end of the study and 48 h after the final injections, the animals were sacrificed and the target mRNA levels in the liver were evaluated by RT-PCR methods verified by Northern blot analysis, glucose levels, cholesterol levels and lipids by separation methods of HPLC and levels of triglycerides and liver enzymes (performed by LabCorp Preclinical Services; San Diego, CA). Data from non-ApoE-expressing mice treated with atorvastatin at a daily dose of 20 mg / kg are also shown in the table for comparison.
Los resultados de los estudios comparativos se muestran en la tabla 9. Los datos están normalizados respecto a controles de disolución salina. The results of the comparative studies are shown in Table 9. The data is normalized with respect to saline controls.
Tabla 9 Table 9
Efectos del tratamiento con ISIS 147764 en los niveles de ARNm de apolipoproteína B, colesterol, glucosa, lípidos, triglicéridos y enzimas hepáticas, en ratones que no expresan ApoE. Effects of ISIS 147764 treatment on apolipoprotein B mRNA levels, cholesterol, glucose, lipids, triglycerides and liver enzymes, in mice that do not express ApoE.
- Porcentaje de inhibición Inhibition percentage
- Dosis Dose
- Control Control
- 5 mg/kg 25 mg/kg 50 mg/kg atorvastatina (20 mg/kg) 5 mg / kg 25 mg / kg 50 mg / kg atorvastatin (20 mg / kg)
- ARNm MRNA
- 0 2 42 70 10 0 2 42 70 10
- Glucosa Glucose
- Niveles de glucosa (mg/dl) Glucose levels (mg / dl)
- 225 225
- 195 209 191 162 195 209 191 162
- Niveles de colesterol (mg/dl) Cholesterol levels (mg / dl)
- Colesterol Cholesterol
- 1750 1630 1750 1490 938 1750 1630 1750 1490 938
- Niveles de lipoproteínas (mg/dl) Lipoprotein levels (mg / dl)
- Lipoproteína Lipoprotein
- HDL 51 49 62 61 42 HDL 51 49 62 61 42
- LDL LDL
- 525 475 500 325 250 525 475 500 325 250
- VLDL VLDL
- 1190 1111 1194 1113 653 1190 1111 1194 1113 653
- Niveles de enzimas hepáticas (UI/l) Liver enzyme levels (IU / l)
- Enzimas hepáticas Hepatic enzymes
- AST 55 50 60 85 75 AST 55 fifty 60 85 75
- ALT ALT
- 56 48 59 87 76 56 48 59 87 76
5 Es evidente a partir de estos datos que el tratamiento con ISIS 147764 disminuía la glucosa y el colesterol así como todas las lipoproteínas investigadas (HDL, LDL y VLDL) en los ratones que no expresan ApoE. Además, estas disminuciones se correlacionan con una disminución en los niveles tanto de proteína como de ARN de apolipoproteína B, demostrando un mecanismo de acción de tipo antisentido. No se observaron cambios significativos en los niveles de enzimas hepáticas, lo que indica que el oligonucleótido antisentido no era tóxico para 5 It is evident from these data that treatment with ISIS 147764 lowered glucose and cholesterol as well as all investigated lipoproteins (HDL, LDL, and VLDL) in mice that do not express ApoE. Furthermore, these decreases are correlated with a decrease in both apolipoprotein B protein and RNA levels, demonstrating an antisense-type mechanism of action. No significant changes in liver enzyme levels were observed, indicating that the antisense oligonucleotide was not toxic to
10 ninguno de los grupos de tratamiento. 10 none of the treatment groups.
Ejemplo 29 Example 29
Inhibición antisentido de la expresión de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi: Oligonucleótidos adicionales Antisense Inhibition of Human Apolipoprotein B Expression by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap: Additional Oligonucleotides
Se diseñó otra serie de oligonucleótidos para dirigir a diferentes regiones del ARN de la apolipoproteína B humana, Another series of oligonucleotides was designed to target different regions of human apolipoprotein B RNA,
15 usando la secuencia publicada (número de acceso en GenBank NM_000384.1, incorporada en el presente documento como SEQ ID NO: 3). Los oligonucleótidos se muestran en la Tabla 10. El "sitio diana" indica el número del primer nucleótido (más 5') en la secuencia diana particular, al que se une el oligonucleótido. Todos los compuestos en la tabla 10 son oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud, compuestos de una región de "hueco" central que consiste en 10 2'-desoxinucleótidos, que está flanqueada en ambos lados 15 using the published sequence (GenBank accession number NM_000384.1, incorporated herein as SEQ ID NO: 3). The oligonucleotides are shown in Table 10. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 10 are 20 nucleotide long chimeric oligonucleotides ("gammers"), composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides
20 (direcciones 5' y 3') por "alas" de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE) nucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todos los residuos de citidina son 5-metilcitidinas. Se analizó el efecto de los compuestos en los niveles de ARNm de la apolipoproteína B humana en células HepG2 por PCR en tiempo real cuantitativa, como se describe en otros ejemplos en la presente memoria. Los datos son medias de dos experimentos en los que las 20 (5 'and 3' directions) for 5-nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels in HepG2 cells was analyzed by quantitative real-time PCR, as described in other examples herein. Data are means of two experiments in which the
25 células HepG2 se trataron con los compuestos de la tabla 10 en concentración 150 nM. Si está presente, "N.D." indica "no hay datos". 25 HepG2 cells were treated with the compounds in Table 10 in 150 nM concentration. If present, "N.D." indicates "no data".
Tabla 10 Table 10
Inhibición de los niveles de ARNm de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi Inhibition of mRNA levels of human apolipoprotein B by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 270985 270985
- 5'UTR 3 199 TTCCTCTTCGGCCCTGGCGC 75 124 5'UTR 3 199 TTCCTCTTCGGCCCTGGCGC 75 124
- 270986 270986
- codificante 3 299 CTCCACTGGAACTCTCAGCC 0 125 coding 3 299 CTCCACTGGAACTCTCAGCC 0 125
- 270987270987
- unión exón: exón 3 359 CCTCCAGCTCAACCTTGCAG 0 126 exon junction: exon 3 359 CCTCCAGCTCAACCTTGCAG 0 126
- 270988 270988
- codificante 3 429 GGGTTGAAGCCATACACCTC 6 127 coding 3 429 GGGTTGAAGCCATACACCTC 6 127
- 270989 270989
- unión exón: exón 3 509 CCAGCTTGAGCTCATACCTG 64 128 exon junction: exon 3 509 CCAGCTTGAGCTCATACCTG 64 128
- 270990 270990
- codificante 3 584 CCCTCTTGATGTTCAGGATG 42 129 coding 3 584 CCCTCTTGATGTTCAGGATG 42 129
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 270991 270991
- codificante 3 669 GAGCAGTTTCCATACACGGT 21 130 coding 3 669 GAGCAGTTTCCATACACGGT twenty-one 130
- 270992 270992
- codificante 3 699 CCCTTCCTCGTCTTGACGGT 8 131 coding 3 699 CCCTTCCTCGTCTTGACGGT 8 131
- 270993 270993
- codificante 3 756 TTGAAGCGATCACACTGCCC 69 132 coding 3 756 TTGAAGCGATCACACTGCCC 69 132
- 270994 270994
- codificante 3 799 GCCTTTGATGAGAGCAAGTG 51 133 coding 3 799 GCCTTTGATGAGAGCAAGTG 51 133
- 270995 270995
- codificante 3 869 TCCTCTTAGCGTCCAGTGTG 40 134 coding 3 869 TCCTCTTAGCGTCCAGTGTG 40 134
- 270996 270996
- codificante 3 1179 CCTCTCAGCTCAGTAACCAG 0 135 coding 3 1179 CCTCTCAGCTCAGTAACCAG 0 135
- 270997 270997
- codificante 3 1279 GCACTGAGGCTGTCCACACT 24 136 coding 3 1279 GCACTGAGGCTGTCCACACT 24 136
- 270998 270998
- codificante 3 1419 CGCTGATCCCTCGCCATGTT 1 137 coding 3 1419 CGCTGATCCCTCGCCATGTT one 137
- 270999 270999
- codificante 3 1459 GTTGACCGCGTGGCTCAGCG 76 138 coding 3 1459 GTTGACCGCGTGGCTCAGCG 76 138
- 271000 271000
- codificante 3 1499 GCAGCTCCTGGGTCCCTGTA 22 139 coding 3 1499 GCAGCTCCTGGGTCCCTGTA 22 139
- 271001 271001
- codificante 3 1859 CCCATGGTAGAATTTGGACA 53 140 coding 3 1859 CCCATGGTAGAATTTGGACA 53 140
- 271002 271002
- unión exón: exón 3 2179 AATCTCGATGAGGTCAGCTG 48 141 exon junction: exon 3 2179 AATCTCGATGAGGTCAGCTG 48 141
- 271003 271003
- codificante 3 2299 GACACCATCAGGAACTTGAC 46 142 coding 3 2299 GACACCATCAGGAACTTGAC 46 142
- 271004 271004
- codificante 3 2459 GCTCCTCTCCCAAGATGCGG 10 143 coding 3 2459 GCTCCTCTCCCAAGATGCGG 10 143
- 271005 271005
- codificante 3 2518 GGCACCCATCAGAAGCAGCT 32 144 coding 3 2518 GGCACCCATCAGAAGCAGCT 32 144
- 271006 271006
- codificante 3 2789 AGTCCGGAATGATGATGCCC 42 145 coding 3 2789 AGTCCGGAATGATGATGCCC 42 145
- 271007 271007
- codificante 3 2919 CTGAGCAGCTTGACTGGTCT 26 146 coding 3 2919 CTGAGCAGCTTGACTGGTCT 26 146
- 271008 271008
- codificante 3 3100 CCCGGTCAGCGGATAGTAGG 37 147 coding 3 3100 CCCGGTCAGCGGATAGTAGG 37 147
- 271010271010
- unión exón: exón 3 3449 TGTCACAACTTAGGTGGCCC 57 148 exon junction: exon 3 3449 TGTCACAACTTAGGTGGCCC 57 148
- 271011 271011
- codificante 3 3919 GTCTGGCAATCCCATGTTCT 51 149 coding 3 3919 GTCTGGCAATCCCATGTTCT 51 149
- 271012 271012
- codificante 3 4089 CCCACAGACTTGAAGTGGAG 55 150 coding 3 4089 CCCACAGACTTGAAGTGGAG 55 150
- 271013 271013
- codificante 3 4579 GAACTGCCCATCAATCTTGA 19 151 coding 3 4579 GAACTGCCCATCAATCTTGA 19 151
- 271014 271014
- codificante 3 5146 CCCAGAGAGGCCAAGCTCTG 54 152 coding 3 5146 CCCAGAGAGGCCAAGCTCTG 54 152
- 271015 271015
- codificante 3 5189 TGTGTTCCCTGAAGCGGCCA 43 153 coding 3 5189 TGTGTTCCCTGAAGCGGCCA 43 153
- 271016 271016
- codificante 3 5269 ACCCAGAATCATGGCCTGAT 19 154 coding 3 5269 ACCCAGAATCATGGCCTGAT 19 154
- 271017 271017
- codificante 3 6049 GGTGCCTGTCTGCTCAGCTG 30 155 coding 3 6049 GGTGCCTGTCTGCTCAGCTG 30 155
- 271018 271018
- codificante 3 6520 ATGTGAAACTTGTCTCTCCC 44 156 coding 3 6520 ATGTGAAACTTGTCTCTCCC 44 156
- 271019 271019
- codificante 3 6639 TATGTCTGCAGTTGAGATAG 15 157 coding 3 6639 TATGTCTGCAGTTGAGATAG fifteen 157
- 271020 271020
- codificante 3 6859 TTGAATCCAGGATGCAGTAC 35 158 coding 3 6859 TTGAATCCAGGATGCAGTAC 35 158
- 271021 271021
- codificante 3 7459 GAGTCTCTGAGTCACCTCAC 38 159 coding 3 7459 GAGTCTCTGAGTCACCTCAC 38 159
- 271022 271022
- codificante 3 7819 GATAGAATATTGCTCTGCAA 100 160 coding 3 7819 GATAGAATATTGCTCTGCAA 100 160
- 271023 271023
- codificante 3 7861 CCCTTGCTCTACCAATGCTT 44 161 coding 3 7861 CCCTTGCTCTACCAATGCTT 44 161
- 271025 271025
- codificante 3 8449 TCCATTCCCTATGTCAGCAT 16 162 coding 3 8449 TCCATTCCCTATGTCAGCAT 16 162
- 271026 271026
- codificante 3 8589 GACTCCTTCAGAGCCAGCGG 39 163 coding 3 8589 GACTCCTTCAGAGCCAGCGG 39 163
- 271027 271027
- codificante 3 8629 CCCATGCTCCGTTCTCAGGT 26 164 coding 3 8629 CCCATGCTCCGTTCTCAGGT 26 164
- 271028 271028
- codificante 3 8829 CGCAGGTCAGCCTGACTAGA 98 165 coding 3 8829 CGCAGGTCAGCCTGACTAGA 98 165
- 271030 271030
- codificante 3 9119 CAGTTAGAACACTGTGGCCC 52 166 coding 3 9119 CAGTTAGAACACTGTGGCCC 52 166
- 271031 271031
- codificante 3 10159 CAGTGTGATGACACTTGATT 49 167 coding 3 10159 CAGTGTGATGACACTTGATT 49 167
- 271032 271032
- codificante 3 10301 CTGTGGCTAACTTCAATCCC 22 168 coding 3 10301 CTGTGGCTAACTTCAATCCC 22 168
- 271033 271033
- codificante 3 10349 CAGTACTGTTATGACTACCC 34 169 coding 3 10349 CAGTACTGTTATGACTACCC 3. 4 169
- 271034 271034
- codificante 3 10699 CACTGAAGACCGTGTGCTCT 35 170 coding 3 10699 CACTGAAGACCGTGTGCTCT 35 170
- 271035 271035
- codificante 3 10811 TCGTACTGTGCTCCCAGAGG 23 171 coding 3 10811 TCGTACTGTGCTCCCAGAGG 2. 3 171
- 271036 271036
- codificante 3 10839 AAGAGGCCCTCTAGCTGTAA 95 172 coding 3 10839 AAGAGGCCCTCTAGCTGTAA 95 172
- 271037 271037
- codificante 3 11039 AAGACCCAGAATGAATCCGG 23 173 coding 3 11039 AAGACCCAGAATGAATCCGG 2. 3 173
- 271038 271038
- codificante 3 11779 GTCTACCTCAAAGCGTGCAG 29 174 coding 3 11779 GTCTACCTCAAAGCGTGCAG 29 174
- 271039 271039
- codificante 3 11939 TAGAGGCTAACGTACCATCT 4 175 coding 3 11939 TAGAGGCTAACGTACCATCT 4 175
- 271041 271041
- codificante 3 12149 CCATATCCATGCCCACGGTG 37 176 coding 3 12149 CCATATCCATGCCCACGGTG 37 176
- 271042 271042
- codificante 3 12265 AGTTTCCTCATCAGATTCCC 57 177 coding 3 12265 AGTTTCCTCATCAGATTCCC 57 177
- 271043 271043
- codificante 3 12380 CCCAGTGGTACTTGTTGACA 68 178 coding 3 12380 CCCAGTGGTACTTGTTGACA 68 178
- 271044 271044
- codificante 3 12526 CCCAGTGGTGCCACTGGCTG 22 179 coding 3 12526 CCCAGTGGTGCCACTGGCTG 22 179
- 271045 271045
- codificante 3 12579 GTCAACAGTTCCTGGTACAG 19 180 coding 3 12579 GTCAACAGTTCCTGGTACAG 19 180
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 271046 271046
- codificante 3 12749 CCCTAGTGTATATCCCAGGT 61 181 coding 3 12749 CCCTAGTGTATATCCCAGGT 61 181
- 271048 271048
- codificante 3 13009 CTGAAGATTACGTAGCACCT 7 182 coding 3 13009 CTGAAGATTACGTAGCACCT 7 182
- 271049 271049
- codificante 3 13299 GTCCAGCCAACTATACTTGG 54 183 coding 3 13299 GTCCAGCCAACTATACTTGG 54 183
- 271050 271050
- codificante 3 13779 CCTGGAGCAAGCTTCATGTA 42 184 coding 3 13779 CCTGGAGCAAGCTTCATGTA 42 184
- 281586 281586
- unión exón: exón 3 229 TGGACAGACCAGGCTGACAT 80 185 exon junction: exon 3 229 TGGACAGACCAGGCTGACAT 80 185
- 281587 281587
- codificante 3 269 ATGTGTACTTCCGGAGGTGC 77 186 coding 3 269 ATGTGTACTTCCGGAGGTGC 77 186
- 281588 281588
- codificante 3 389 TCTTCAGGATGAAGCTGCAG 80 187 coding 3 389 TCTTCAGGATGAAGCTGCAG 80 187
- 281589 281589
- codificante 3 449 TCAGCAAGGCTTTGCCCTCA 90 188 coding 3 449 TCAGCAAGGCTTTGCCCTCA 90 188
- 281590 281590
- codificante 3 529 CTGCTTCCCTTCTGGAATGG 84 189 coding 3 529 CTGCTTCCCTTCTGGAATGG 84 189
- 281591 281591
- codificante 3 709 TGCCACATTGCCCTTCCTCG 90 190 coding 3 709 TGCCACATTGCCCTTCCTCG 90 190
- 281592 281592
- codificante 3 829 GCTGATCAGAGTTGACAAGG 56 191 coding 3 829 GCTGATCAGAGTTGACAAGG 56 191
- 281593 281593
- codificante 3 849 TACTGACAGGACTGGCTGCT 93 192 coding 3 849 TACTGACAGGACTGGCTGCT 93 192
- 281594 281594
- codificante 3 889 GATGGCTTCTGCCACATGCT 74 193 coding 3 889 GATGGCTTCTGCCACATGCT 74 193
- 281595 281595
- codificante 3 1059 GATGTGGATTTGGTGCTCTC 76 194 coding 3 1059 GATGTGGATTTGGTGCTCTC 76 194
- 281596 281596
- codificante 3 1199 TGACTGCTTCATCACTGAGG 77 195 coding 3 1199 TGACTGCTTCATCACTGAGG 77 195
- 281597 281597
- codificante 3 1349 GGTAGGTGACCACATCTATC 36 196 coding 3 1349 GGTAGGTGACCACATCTATC 36 196
- 281598 281598
- codificante 3 1390 TCGCAGCTGCTGTGCTGAGG 70 197 coding 3 1390 TCGCAGCTGCTGTGCTGAGG 70 197
- 281599 281599
- unión exón: exón 3 1589 TTCCAATGACCCGCAGAATC 74 198 exon junction: exon 3 1589 TTCCAATGACCCGCAGAATC 74 198
- 281600 281600
- codificante 3 1678 GATCATCAGTGATGGCTTTG 52 199 coding 3 1678 GATCATCAGTGATGGCTTTG 52 199
- 281601 281601
- codificante 3 1699 AGCCTGGATGGCAGCTTTCT 83 200 coding 3 1699 AGCCTGGATGGCAGCTTTCT 83 200
- 281602 281602
- codificante 3 1749 GTCTGAAGAAGAACCTCCTG 84 201 coding 3 1749 GTCTGAAGAAGAACCTCCTG 84 201
- 281603 281603
- codificante 3 1829 TATCTGCCTGTGAAGGACTC 82 202 coding 3 1829 TATCTGCCTGTGAAGGACTC 82 202
- 281604 281604
- codificante 3 1919 CTGAGTTCAAGATATTGGCA 78 203 coding 3 1919 CTGAGTTCAAGATATTGGCA 78 203
- 281605 281605
- unión exón: exón 3 2189 CTTCCAAGCCAATCTCGATG 82 204 exon junction: exon 3 2189 CTTCCAAGCCAATCTCGATG 82 204
- 281606 281606
- codificante 3 2649 TGCAACTGTAATCCAGCTCC 86 205 coding 3 2649 TGCAACTGTAATCCAGCTCC 86 205
- 281607281607
- unión exón: exón 3 2729 CCAGTTCAGCCTGCATGTTG 84 206 exon junction: exon 3 2729 CCAGTTCAGCCTGCATGTTG 84 206
- 281608 281608
- codificante 3 2949 GTAGAGACCAAATGTAATGT 62 207 coding 3 2949 GTAGAGACCAAATGTAATGT 62 207
- 281609 281609
- codificante 3 3059 CGTTGGAGTAAGCGCCTGAG 70 208 coding 3 3059 CGTTGGAGTAAGCGCCTGAG 70 208
- 281610 281610
- unión exón: exón 3 3118 CAGCTCTAATCTGGTGTCCC 69 209 exon junction: exon 3 3118 CAGCTCTAATCTGGTGTCCC 69 209
- 281611 281611
- codificante 3 3189 CTGTCCTCTCTCTGGAGCTC 93 210 coding 3 3189 CTGTCCTCTCTCTGGAGCTC 93 210
- 281612 281612
- codificante 3 3289 CAAGGTCATACTCTGCCGAT 83 211 coding 3 3289 CAAGGTCATACTCTGCCGAT 83 211
- 281613 281613
- codificante 3 3488 GTATGGAAATAACACCCTTG 70 212 coding 3 3488 GTATGGAAATAACACCCTTG 70 212
- 281614 281614
- codificante 3 3579 TAAGCTGTAGCAGATGAGTC 63 213 coding 3 3579 TAAGCTGTAGCAGATGAGTC 63 213
- 281615 281615
- codificante 3 4039 TAGATCTCTGGAGGATTTGC 81 214 coding 3 4039 TAGATCTCTGGAGGATTTGC 81 214
- 281616 281616
- codificante 3 4180 GTCTAGAACACCCAGGAGAG 66 215 coding 3 4180 GTCTAGAACACCCAGGAGAG 66 215
- 281617 281617
- codificante 3 4299 ACCACAGAGTCAGCCTTCAT 89 216 coding 3 4299 ACCACAGAGTCAGCCTTCAT 89 216
- 281618 281618
- codificante 3 4511 AAGCAGACATCTGTGGTCCC 90 217 coding 3 4511 AAGCAGACATCTGTGGTCCC 90 217
- 281619 281619
- codificante 3 4660 CTCTCCATTGAGCCGGCCAG 96 218 coding 3 4660 CTCTCCATTGAGCCGGCCAG 96 218
- 281620 281620
- codificante 3 4919 CCTGATATTCAGAACGCAGC 89 219 coding 3 4919 CCTGATATTCAGAACGCAGC 89 219
- 281621 281621
- codificante 3 5009 CAGTGCCTAAGATGTCAGCA 53 220 coding 3 5009 CAGTGCCTAAGATGTCAGCA 53 220
- 281622 281622
- codificante 3 5109 AGCACCAGGAGACTACACTT 88 221 coding 3 5109 AGCACCAGGAGACTACACTT 88 221
- 281623 281623
- codificante 3 5212 CCCATCCAGACTGAATTTTG 59 222 coding 3 5212 CCCATCCAGACTGAATTTTG 59 222
- 281624 281624
- codificante 3 5562 GGTTCTAGCCGTAGTTTCCC 75 223 coding 3 5562 GGTTCTAGCCGTAGTTTCCC 75 223
- 281625 281625
- codificante 3 5589 AGGTTACCAGCCACATGCAG 94 224 coding 3 5589 AGGTTACCAGCCACATGCAG 94 224
- 281626 281626
- codificante 3 5839 ATGTGCATCGATGGTCATGG 88 225 coding 3 5839 ATGTGCATCGATGGTCATGG 88 225
- 281627 281627
- codificante 3 5869 CCAGAGAGCGAGTTTCCCAT 82 226 coding 3 5869 CCAGAGAGCGAGTTTCCCAT 82 226
- 281628 281628
- codificante 3 5979 CTAGACACGAGATGATGACT 81 227 coding 3 5979 CTAGACACGAGATGATGACT 81 227
- 281629 281629
- codificante 3 6099 TCCAAGTCCTGGCTGTATTC 83 228 coding 3 6099 TCCAAGTCCTGGCTGTATTC 83 228
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 281630 281630
- codificante 3 6144 CGTCCAGTAAGCTCCACGCC 82 229 coding 3 6144 CGTCCAGTAAGCTCCACGCC 82 229
- 281631 281631
- codificante 3 6249 TCAACGGCATCTCTCATCTC 88 230 coding 3 6249 TCAACGGCATCTCTCATCTC 88 230
- 281632 281632
- codificante 3 6759 TGATAGTGCTCATCAAGACT 75 231 coding 3 6759 TGATAGTGCTCATCAAGACT 75 231
- 281633 281633
- codificante 3 6889 GATTCTGATTTGGTACTTAG 73 232 coding 3 6889 GATTCTGATTTGGTACTTAG 73 232
- 281634 281634
- codificante 3 7149 CTCTCGATTAACTCATGGAC 81 233 coding 3 7149 CTCTCGATTAACTCATGGAC 81 233
- 281635 281635
- codificante 3 7549 ATACACTGCAACTGTGGCCT 89 234 coding 3 7549 ATACACTGCAACTGTGGCCT 89 2. 3. 4
- 281636 281636
- codificante 3 7779 GCAAGAGTCCACCAATCAGA 68 235 coding 3 7779 GCAAGAGTCCACCAATCAGA 68 235
- 281637 281637
- codificante 3 7929 AGAGCCTGAAGACTGACTTC 74 236 coding 3 7929 AGAGCCTGAAGACTGACTTC 74 236
- 281638 281638
- codificante 3 8929 TCCCTCATCTGAGAATCTGG 66 237 coding 3 8929 TCCCTCATCTGAGAATCTGG 66 237
- 281640 281640
- codificante 3 10240 CAGTGCATCAATGACAGATG 87 238 coding 3 10240 CAGTGCATCAATGACAGATG 87 238
- 281641 281641
- codificante 3 10619 CCGAACCCTTGACATCTCCT 72 239 coding 3 10619 CCGAACCCTTGACATCTCCT 72 239
- 281642 281642
- codificante 3 10659 GCCTCACTAGCAATAGTTCC 59 240 coding 3 10659 GCCTCACTAGCAATAGTTCC 59 240
- 281643 281643
- codificante 3 10899 GACATTTGCCATGGAGAGAG 61 241 coding 3 10899 GACATTTGCCATGGAGAGAG 61 241
- 281644 281644
- codificante 3 11209 CTGTCTCCTACCAATGCTGG 26 242 coding 3 11209 CTGTCTCCTACCAATGCTGG 26 242
- 281645 281645
- unión exón: exón 3 11979 TCTGCACTGAAGTCACGGTG 78 243 exon junction: exon 3 11979 TCTGCACTGAAGTCACGGTG 78 243
- 281646 281646
- codificante 3 12249 TCCCGGACCCTCAACTCAGT 76 244 coding 3 12249 TCCCGGACCCTCAACTCAGT 76 244
- 281648 281648
- 3'UTR 3 13958 GCAGGTCCAGTTCATATGTG 81 245 3'UTR 3 13958 GCAGGTCCAGTTCATATGTG 81 245
- 281649 281649
- 3'UTR 3 14008 GCCATCCTTCTGAGTTCAGA 76 246 3'UTR 3 14008 GCCATCCTTCTGAGTTCAGA 76 246
- 301012 301012
- unión exón: exón 3 3249 GCCTCAGTCTGCTTCGCACC 87 247 exon junction: exon 3 3249 GCCTCAGTCTGCTTCGCACC 87 247
- 301013 301013
- 5'UTR 3 3 CCCCGCAGGTCCCGGTGGGA 82 248 5'UTR 3 3 CCCCGCAGGTCCCGGTGGGA 82 248
- 301014 301014
- 5'UTR 3 6 CAGCCCCGCAGGTCCCGGTG 88 249 5'UTR 3 6 CAGCCCCGCAGGTCCCGGTG 88 249
- 301015 301015
- 5'UTR 3 23 CAACCGAGAAGGGCACTCAG 53 250 5'UTR 3 2. 3 CAACCGAGAAGGGCACTCAG 53 250
- 301016 301016
- 5'UTR 3 35 CCTCAGCGGCAGCAACCGAG 62 251 5'UTR 3 35 CCTCAGCGGCAGCAACCGAG 62 251
- 301017 301017
- 5'UTR 3 36 TCCTCAGCGGCAGCAACCGA 47 252 5'UTR 3 36 TCCTCAGCGGCAGCAACCGA 47 252
- 301018 301018
- 5'UTR 3 37 CTCCTCAGCGGCAGCAACCG 45 253 5'UTR 3 37 CTCCTCAGCGGCAGCAACCG Four. Five 253
- 301019 301019
- 5'UTR 3 39 GGCTCCTCAGCGGCAGCAAC 70 254 5'UTR 3 39 GGCTCCTCAGCGGCAGCAAC 70 254
- 301020 301020
- 5'UTR 3 43 GGCGGGCTCCTCAGCGGCAG 85 255 5'UTR 3 43 GGCGGGCTCCTCAGCGGCAG 85 255
- 301021 301021
- 5'UTR 3 116 GGTCCATCGCCAGCTGCGGT 89 256 5'UTR 3 116 GGTCCATCGCCAGCTGCGGT 89 256
- 301022 301022
- Codón de inicio 3 120 GGCGGGTCCATCGCCAGCTG 69 257 Start codon 3 120 GGCGGGTCCATCGCCAGCTG 69 257
- 301023 301023
- Codón de parada 3 13800 TAGAGGATGATAGTAAGTTC 69 258 Stop codon 3 13800 TAGAGGATGATAGTAAGTTC 69 258
- 301024 301024
- 3'UTR 3 13824 AAATGAAGATTTCTTTTAAA 5 259 3'UTR 3 13824 AAATGAAGATTTCTTTTAAA 5 259
- 301025 301025
- 3'UTR 3 13854 TATGTGAAAGTTCAATTGGA 76 260 3'UTR 3 13854 TATGTGAAAGTTCAATTGGA 76 260
- 301026 301026
- 3'UTR 3 13882 ATATAGGCAGTTTGAATTTT 57 261 3'UTR 3 13882 ATATAGGCAGTTTGAATTTT 57 261
- 301027 301027
- 3'UTR 3 13903 GCTCACTGTATGGTTTTATC 89 262 3'UTR 3 13903 GCTCACTGTATGGTTTTATC 89 262
- 301028 301028
- 3'UTR 3 13904 GGCTCACTGTATGGTTTTAT 93 263 3'UTR 3 13904 GGCTCACTGTATGGTTTTAT 93 263
- 301029 301029
- 3'UTR 3 13908 GGCTGGCTCACTGTATGGTT 90 264 3'UTR 3 13908 GGCTGGCTCACTGTATGGTT 90 264
- 301030 301030
- 3'UTR 3 13909 AGGCTGGCTCACTGTATGGT 90 265 3'UTR 3 13909 AGGCTGGCTCACTGTATGGT 90 265
- 301031 301031
- 3'UTR 3 13910 AAGGCTGGCTCACTGTATGG 90 266 3'UTR 3 13910 AAGGCTGGCTCACTGTATGG 90 266
- 301032 301032
- 3'UTR 3 13917 CTACTGCAAGGCTGGCTCAC 63 267 3'UTR 3 13917 CTACTGCAAGGCTGGCTCAC 63 267
- 301033 301033
- 3'UTR 3 13922 ACTGCCTACTGCAAGGCTGG 77 268 3'UTR 3 13922 ACTGCCTACTGCAAGGCTGG 77 268
- 301034 301034
- 3'UTR 3 13934 TGCTTATAGTCTACTGCCTA 88 269 3'UTR 3 13934 TGCTTATAGTCTACTGCCTA 88 269
- 301035 301035
- 3'UTR 3 13937 TTCTGCTTATAGTCTACTGC 82 270 3'UTR 3 13937 TTCTGCTTATAGTCTACTGC 82 270
- 301036 301036
- 3'UTR 3 13964 TTTGGTGCAGGTCCAGTTCA 88 271 3'UTR 3 13964 TTTGGTGCAGGTCCAGTTCA 88 271
- 301037 301037
- 3'UTR 3 13968 CAGCTTTGGTGCAGGTCCAG 90 272 3'UTR 3 13968 CAGCTTTGGTGCAGGTCCAG 90 272
- 301038 301038
- 3'UTR 3 13970 GCCAGCTTTGGTGCAGGTCC 86 273 3'UTR 3 13970 GCCAGCTTTGGTGCAGGTCC 86 273
- 301039 301039
- 3'UTR 3 13974 TGGTGCCAGCTTTGGTGCAG 73 274 3'UTR 3 13974 TGGTGCCAGCTTTGGTGCAG 73 274
- 301040 301040
- 3'UTR 3 13978 GCCCTGGTGCCAGCTTTGGT 74 275 3'UTR 3 13978 GCCCTGGTGCCAGCTTTGGT 74 275
- 301041 301041
- 3'UTR 3 13997 GAGTTCAGAGACCTTCCGAG 85 276 3'UTR 3 13997 GAGTTCAGAGACCTTCCGAG 85 276
- 301042 301042
- 3'UTR 3 14012 AAATGCCATCCTTCTGAGTT 81 277 3'UTR 3 14012 AAATGCCATCCTTCTGAGTT 81 277
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 301043 301043
- 3'UTR 3 14014 AAAAATGCCATCCTTCTGAG 81 278 3'UTR 3 14014 AAAAATGCCATCCTTCTGAG 81 278
- 301044 301044
- 3'UTR 3 14049 AAAATAACTCAGATCCTGAT 76 279 3'UTR 3 14049 AAAATAACTCAGATCCTGAT 76 279
- 301045 301045
- 3'UTR 3 14052 AGCAAAATAACTCAGATCCT 90 280 3'UTR 3 14052 AGCAAAATAACTCAGATCCT 90 280
- 301046 301046
- 3'UTR 3 14057 AGTTTAGCAAAATAACTCAG 80 281 3'UTR 3 14057 AGTTTAGCAAAATAACTCAG 80 281
- 301047 301047
- 3'UTR 3 14064 TCCCCCAAGTTTAGCAAAAT 56 282 3'UTR 3 14064 TCCCCCAAGTTTAGCAAAAT 56 282
- 301048 301048
- 3'UTR 3 14071 TTCCTCCTCCCCCAAGTTTA 67 283 3'UTR 3 14071 TTCCTCCTCCCCCAAGTTTA 67 283
- 301217 301217
- 3'UTR 3 14087 AGACTCCATTTATTTGTTCC 81 284 3'UTR 3 14087 AGACTCCATTTATTTGTTCC 81 284
Ejemplo 30 Example 30
Inhibición antisentido de la apolipoproteína B - Desplazamiento sobre gen Antisense inhibition of apolipoprotein B - Displacement over gene
Se llevó a cabo un "desplazamiento sobre gen" en el que se diseñó otra serie de oligonucleótidos para dirigir a las A "gene shift" was performed in which another series of oligonucleotides were designed to target the
5 regiones del ARN de la apolipoproteína B humana (número de acceso en GenBank NM_000384.1, incorporada en el presente documento como SEQ ID NO: 3) que están cerca del sitio diana de las SEQ ID No 224 o 247. Los oligonucleótidos se muestran en la Tabla 11. El "sitio diana" indica el número del primer nucleótido (más 5') en la secuencia diana particular, al que se une el oligonucleótido. Todos los compuestos en la tabla 11 son oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud, compuestos de una región de "hueco" 5 regions of human apolipoprotein B RNA (GenBank accession number NM_000384.1, incorporated herein as SEQ ID NO: 3) that are close to the target site of SEQ ID No. 224 or 247. Oligonucleotides are shown in Table 11. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 11 are 20 nucleotide long chimeric oligonucleotides ("gammers"), composed of a "gap" region
10 central que consiste en 10 2'-desoxinucleótidos, que está flanqueada en ambos lados (direcciones 5' y 3') por "alas" de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE) nucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todos los residuos de citidina son 5-metilcitidinas. Se analizó el efecto de los compuestos en los niveles de ARNm de la apolipoproteína B humana en células HepG2 por PCR en tiempo real cuantitativa, como se describe en otros ejemplos en la presente memoria. Central 10 consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5 'and 3' directions) by 5 'nucleotide' wings'. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels in HepG2 cells was analyzed by quantitative real-time PCR, as described in other examples herein.
15 Las dosis de tratamiento eran 50 nM y 150 nM y están indicadas en la tabla 11. Los datos son medias de dos experimentos. Si está presente, "N.D." indica "no hay datos". The treatment doses were 50 nM and 150 nM and are indicated in Table 11. Data are means from two experiments. If present, "N.D." indicates "no data".
Tabla 11 Table 11
Inhibición de los niveles de ARNm de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi - Desplazamiento sobre gen Inhibition of human apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap - Displacement over gene
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. 150 nM % de INHIB. 50 nM SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. 150 nM % of INHIB. 50 nM SEQ ID NO
- 308589308589
- unión exón: exón 3 3230 CTTCTGCTTGAGTTACAAAC 94 20 285 exon junction: exon 3 3230 CTTCTGCTTGAGTTACAAAC 94 twenty 285
- 308590308590
- unión exón: exón 3 3232 ACCTTCTGCTTGAGTTACAA 98 26 286 exon junction: exon 3 3232 ACCTTCTGCTTGAGTTACAA 98 26 286
- 308591308591
- unión exón: exón 3 3234 GCACCTTCTGCTTGAGTTAC 92 76 287 exon junction: exon 3 3234 GCACCTTCTGCTTGAGTTAC 92 76 287
- 308592308592
- unión exón: exón 3 3236 TCGCACCTTCTGCTTGAGTT 96 49 288 exon junction: exon 3 3236 TCGCACCTTCTGCTTGAGTT 96 49 288
- 308593308593
- unión exón: exón 3 3238 CTTCGCACCTTCTGCTTGAG 80 41 289 exon junction: exon 3 3238 CTTCGCACCTTCTGCTTGAG 80 41 289
- 308594308594
- unión exón: exón 3 3240 TGCTTCGCACCTTCTGCTTG 88 57 290 exon junction: exon 3 3240 TGCTTCGCACCTTCTGCTTG 88 57 290
- 308595308595
- unión exón: exón 3 3242 TCTGCTTCGCACCTTCTGCT 82 60 291 exon junction: exon 3 3242 TCTGCTTCGCACCTTCTGCT 82 60 291
- 308596308596
- unión exón: exón 3 3244 AGTCTGCTTCGCACCTTCTG 94 81 292 exon junction: exon 3 3244 AGTCTGCTTCGCACCTTCTG 94 81 292
- 308597308597
- unión exón: exón 3 3246 TCAGTCTGCTTCGCACCTTC 91 66 293 exon junction: exon 3 3246 TCAGTCTGCTTCGCACCTTC 91 66 293
- 308598308598
- unión exón: exón 3 3248 CCTCAGTCTGCTTCGCACCT 85 59 294 exon junction: exon 3 3248 CCTCAGTCTGCTTCGCACCT 85 59 294
- 308599308599
- unión exón: exón 3 3250 AGCCTCAGTCTGCTTCGCAC 94 79 295 exon junction: exon 3 3250 AGCCTCAGTCTGCTTCGCAC 94 79 295
- 308600 308600
- codificante 3 3252 GTAGCCTCAGTCTGCTTCGC 89 72 296 coding 3 3252 GTAGCCTCAGTCTGCTTCGC 89 72 296
- 308601 308601
- codificante 3 3254 TGGTAGCCTCAGTCTGCTTC 91 63 297 coding 3 3254 TGGTAGCCTCAGTCTGCTTC 91 63 297
- 308602 308602
- codificante 3 3256 ICATGGTAGCCTCAGTCTGCT 92 83 298 coding 3 3256 ICATGGTAGCCTCAGTCTGCT 92 83 298
- 308603 308603
- codificante 3 3258 GTCATGGTAGCCTCAGTCTG 97 56 299 coding 3 3258 GTCATGGTAGCCTCAGTCTG 97 56 299
- 308604 308604
- codificante 3 3260 ATGTCATGGTAGCCTCAGTC 90 73 300 coding 3 3260 ATGTCATGGTAGCCTCAGTC 90 73 300
- 308605 308605
- codificante 3 3262 GAATGTCATGGTAGCCTCAG 81 50 301 coding 3 3262 GAATGTCATGGTAGCCTCAG 81 fifty 301
- 308606 308606
- codificante 3 3264 TTGAATGTCATGGTAGCCTC 97 54 302 coding 3 3264 TTGAATGTCATGGTAGCCTC 97 54 302
- 308607 308607
- codificante 3 3266 ATTTGAATGTCATGGTAGCC 77 9 303 coding 3 3266 ATTTGAATGTCATGGTAGCC 77 9 303
- 308608 308608
- codificante 3 3268 ATATTTGAATGTCATGGTAG 85 70 304 coding 3 3268 ATATTTGAATGTCATGGTAG 85 70 304
- 308609 308609
- codificante 3 5582 CAGCCACATGCAGCTTCAGG 96 78 305 coding 3 5582 CAGCCACATGCAGCTTCAGG 96 78 305
- 308610 308610
- codificante 3 5584 ACCAGCCACATGCAGCTTCA 90 40 306 coding 3 5584 ACCAGCCACATGCAGCTTCA 90 40 306
- 308611 308611
- codificante 3 5586 TTACCAGCCACATGCAGCTT 95 59 307 coding 3 5586 TTACCAGCCACATGCAGCTT 95 59 307
- 308612 308612
- codificante 3 5588 GGTTACCAGCCACATGCAGC 90 75 308 coding 3 5588 GGTTACCAGCCACATGCAGC 90 75 308
- 308613 308613
- codificante 3 5590 TAGGTTACCAGCCACATGCA 87 43 309 coding 3 5590 TAGGTTACCAGCCACATGCA 87 43 309
- 308614 308614
- codificante 3 5592 TTTAGGTTACCAGCCACATG 92 74 310 coding 3 5592 TTTAGGTTACCAGCCACATG 92 74 310
- 308615 308615
- codificante 3 5594 CTTTTAGGTTACCAGCCACA 85 45 311 coding 3 5594 CTTTTAGGTTACCAGCCACA 85 Four. Five 311
- 308616 308616
- codificante 3 5596 TCCTTTTAGGTTACCAGCCA 81 39 312 coding 3 5596 TCCTTTTAGGTTACCAGCCA 81 39 312
- 308617 308617
- codificante 3 5598 GCTCCTTTTAGGTTACCAGC 87 77 313 coding 3 5598 GCTCCTTTTAGGTTACCAGC 87 77 313
- 308618 308618
- codificante 3 5600 AGGCTCCTTTTAGGTTACCA 77 61 314 coding 3 5600 AGGCTCCTTTTAGGTTACCA 77 61 314
- 308619 308619
- codificante 3 5602 GTAGGCTCCTTTTAGGTTAC 74 69 315 coding 3 5602 GTAGGCTCCTTTTAGGTTAC 74 69 315
- 308620 308620
- codificante 3 5604 TGGTAGGCTCCTTTTAGGTT 88 69 316 coding 3 5604 TGGTAGGCTCCTTTTAGGTT 88 69 316
- 308621 308621
- codificante 3 5606 TTTGGTAGGCTCCTTTTAGG 91 56 317 coding 3 5606 TTTGGTAGGCTCCTTTTAGG 91 56 317
Como se muestra en las tablas 10 y 11, las SEQ ID No 124, 128, 129, 132, 133, 134, 138, 140, 141, 142, 144, 145, 147, 148, 149, 150, 152, 153, 155, 156, 158, 159, 160, 161, 163, 165, 166, 167, 169, 170, 172, 176, 177, 178, 181, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, As shown in Tables 10 and 11, SEQ ID No. 124, 128, 129, 132, 133, 134, 138, 140, 141, 142, 144, 145, 147, 148, 149, 150, 152, 153, 155, 156, 158, 159, 160, 161, 163, 165, 166, 167, 169, 170, 172, 176, 177, 178, 181, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228,
229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, y 317 demostraron al menos 5 30% de inhibición de la expresión de la apolipoproteína B humana en este ensayo y por lo tanto son preferidas. Son más preferidas las SEQ ID No 224, 247 y 262. Las regiones diana de los que estas secuencias preferidas son complementarias se denominan en el presente documento "segmentos diana preferidos" y por lo tanto son sitios preferidos para dirigir los compuestos de la presente descripción. Estos segmentos diana preferidos se muestran en la tabla 18. Las secuencias representan el complemento inverso de los compuestos antisentido preferidos mostrados 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, and 317 demonstrated at least 5 30% inhibition of human apolipoprotein B expression in this assay and are therefore preferred. SEQ ID Nos. 224, 247 and 262 are more preferred. Target regions of which these preferred sequences are complementary are referred to herein as "preferred target segments" and are therefore preferred sites for targeting the compounds of the present disclosure . These preferred target segments are shown in Table 18. The sequences represent the reverse complement of the preferred antisense compounds shown.
10 en las tablas 10 y 11. El "sitio diana" indica el número del primer nucleótido (más 5') en el ácido nucleico diana particular, al que se une el oligonucleótido. También se muestran en la tabla 18 las especies en las que se encontraron cada uno de los segmentos diana preferidos. 10 in Tables 10 and 11. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target nucleic acid, to which the oligonucleotide binds. The species in which each of the preferred target segments were found are also shown in Table 18.
Ejemplo 31 Example 31
Inhibición antisentido de la expresión de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos 15 que tienen alas 2'-MOE y un hueco desoxi:Dirigido al número de acceso en GenBank M14162.1 Antisense inhibition of human apolipoprotein B expression by chimeric phosphorothioate oligonucleotides 15 having 2'-MOE wings and a deoxy gap: Targeted at accession number in GenBank M14162.1
Se diseñó otra serie de oligonucleótidos para dirigir a diferentes regiones del ARN de la apolipoproteína B humana, usando la secuencia publicada (número de acceso en GenBank M14162.1, incorporada en el presente documento como SEQ ID NO: 318). Los oligonucleótidos se muestran en la Tabla 12. El "sitio diana" indica el número del primer nucleótido (más 5') en la secuencia diana particular, al que se une el oligonucleótido. Todos los compuestos en la 20 tabla 12 son oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud, compuestos de una región de "hueco" central que consiste en 10 2'-desoxinucleótidos, que está flanqueada en ambos lados (direcciones 5' y 3') por "alas" de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE) nucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todos los residuos de citidina son 5-metilcitidinas. Se analizó el efecto de los compuestos en los niveles de ARNm de la Another series of oligonucleotides were designed to target different regions of human apolipoprotein B RNA, using the published sequence (GenBank accession number M14162.1, incorporated herein as SEQ ID NO: 318). The oligonucleotides are shown in Table 12. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 12 are chimeric oligonucleotides ("gammers") 20 nucleotides in length, composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which are flanked on both sides (5 'directions and 3 ') by 5 nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on the mRNA levels of the
25 apolipoproteína B humana en células HepG2 por PCR en tiempo real cuantitativa, como se describe en otros ejemplos en la presente memoria. Los datos son medias de dos experimentos en los que las células HepG2 se trataron con los compuestos de la tabla 12 en concentración 150 nM. Si está presente, "N.D." indica "no hay datos". Human apolipoprotein B in HepG2 cells by quantitative real-time PCR, as described in other examples herein. Data are means from two experiments in which HepG2 cells were treated with the compounds in Table 12 in 150 nM concentration. If present, "N.D." indicates "no data".
Tabla 12 Table 12
Inhibición de los niveles de ARNm de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que 30 tienen alas 2'-MOE y un hueco desoxi Inhibition of human apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 271009 271009
- codificante 318 3121 GCCTCAGTCTGCTTCGCGCC 75 319 coding 318 3121 GCCTCAGTCTGCTTCGCGCC 75 319
- 271024 271024
- codificante 318 8031 GCTCACTGTTCAGCATCTGG 27 320 coding 318 8031 GCTCACTGTTCAGCATCTGG 27 320
- 271029 271029
- codificante 318 8792 TGAGAATCTGGGCGAGGCCC N.D. 321 coding 318 8792 TGAGAATCTGGGCGAGGCCC N.D. 321
- 271040 271040
- codificante 318 11880 GTCCTTCATATTTGCCATCT 0 322 coding 318 11880 GTCCTTCATATTTGCCATCT 0 322
- 271047 271047
- codificante 318 12651 CCTCCCTCATGAACATAGTG 32 323 coding 318 12651 CCTCCCTCATGAACATAGTG 32 323
- 281639 281639
- codificante 318 9851 GACGTCAGAACCTATGATGG 38 324 coding 318 9851 GACGTCAGAACCTATGATGG 38 324
- 281647 281647
- codificante 318 12561 TGAGTGAGTCAATCAGCTTC 73 325 coding 318 12561 TGAGTGAGTCAATCAGCTTC 73 325
Ejemplo 32 Example 32
Inhibición antisentido de la apolipoproteína B humana - Desplazamiento sobre gen dirigido al número de acceso en GenBank M14162.1 Antisense inhibition of human apolipoprotein B - Displacement over gene directed to accession number in GenBank M14162.1
35 Se llevó a cabo un "desplazamiento sobre gen" en el que se diseñó otra serie de oligonucleótidos para dirigir a las regiones del ARN de la apolipoproteína B humana (número de acceso en GenBank M14162.1, incorporada en el presente documento como SEQ ID NO: 318) que están cerca del sitio diana de la SEQ ID NO: 319. Los oligonucleótidos se muestran en la Tabla 13. El "sitio diana" indica el número del primer nucleótido (más 5') en la secuencia diana particular, al que se une el oligonucleótido. Todos los compuestos en la tabla 13 son A "gene shift" was performed in which another series of oligonucleotides were designed to target the human apolipoprotein B RNA regions (GenBank accession number M14162.1, incorporated herein as SEQ ID NO: 318) that are close to the target site of SEQ ID NO: 319. The oligonucleotides are shown in Table 13. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, at that binds the oligonucleotide. All compounds in table 13 are
40 oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud, compuestos de una región de "hueco" central que consiste en 10 2'-desoxinucleótidos, que está flanqueada en ambos lados (direcciones 5' y 3') por "alas" de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE) nucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todos los residuos de citidina son 5-metilcitidinas. Se analizó el efecto de los compuestos en los niveles de ARNm de la apolipoproteína B humana 40 chimeric oligonucleotides ("gammers") 20 nucleotides long, composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5 'and 3' directions) by "wings" of 5 nucleotides. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels was analyzed.
45 en células HepG2 por PCR en tiempo real cuantitativa, como se describe en otros ejemplos en la presente memoria. Las dosis de tratamiento eran 50 nM y 150 nM y están indicadas en la tabla 13. Los datos son medias de dos experimentos. Si está presente, "N.D." indica "no hay datos". In HepG2 cells by quantitative real-time PCR, as described in other examples herein. The treatment doses were 50 nM and 150 nM and are indicated in Table 13. Data are means from two experiments. If present, "N.D." indicates "no data".
Tabla 13 Table 13
Inhibición de los niveles de ARNm de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi Inhibition of mRNA levels of human apolipoprotein B by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. 150 nM % de INHIB. 50 nM SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. 150 nM % of INHIB. 50 nM SEQ ID NO
- 308622 308622
- codificante 318 3104 GCCTTCTGCTTGAGTTACAA 87 25 326 coding 318 3104 GCCTTCTGCTTGAGTTACAA 87 25 326
- 308623 308623
- codificante 318 3106 GCGCCTTCTGCTTGAGTTAC 71 62 327 coding 318 3106 GCGCCTTCTGCTTGAGTTAC 71 62 327
- 308624 308624
- codificante 318 3108 TCGCGCCTTCTGCTTGAGTT 89 69 328 coding 318 3108 TCGCGCCTTCTGCTTGAGTT 89 69 328
- 308625 308625
- codificante 318 3110 CTTCGCGCCTTCTGCTTGAG 83 64 329 coding 318 3110 CTTCGCGCCTTCTGCTTGAG 83 64 329
- 308626 308626
- codificante 318 3116 AGTCTGCTTCGCGCCTTCTG 94 38 330 coding 318 3116 AGTCTGCTTCGCGCCTTCTG 94 38 330
- 308627 308627
- codificante 318 3118 TCAGTCTGCTTCGCGCCTTC 89 67 331 coding 318 3118 TCAGTCTGCTTCGCGCCTTC 89 67 331
- 308628 308628
- codificante 318 3120 CCTCAGTCTGCTTCGCGCCT 92 61 332 coding 318 3120 CCTCAGTCTGCTTCGCGCCT 92 61 332
- 308629 308629
- codificante 318 3122 AGCCTCAGTCTGCTTCGCGC 95 77 333 coding 318 3122 AGCCTCAGTCTGCTTCGCGC 95 77 333
5 Como se muestra en las tablas 12 y 13, las SEQ ID No 319, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, y 333 demostraron al menos 30% de inhibición de la expresión de la apolipoproteína B humana en este ensayo y por lo tanto son preferidas. Es más preferida la SEQ ID NO: 319. Las regiones diana de los que estas secuencias preferidas son complementarias se denominan en el presente documento "segmentos diana preferidos" y por lo tanto son sitios preferidos para dirigir los compuestos de la presente descripción. Estos segmentos diana preferidos 5 As shown in Tables 12 and 13, SEQ ID No. 319, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, and 333 demonstrated at least 30% inhibition of the expression of human apolipoprotein B in this assay and are therefore preferred. SEQ ID NO: 319 is more preferred. The target regions of which these preferred sequences are complementary are referred to herein as "preferred target segments" and are therefore preferred sites for targeting the compounds of the present disclosure. These preferred target segments
10 se muestran en la tabla 18. Las secuencias representan el complemento inverso de los compuestos antisentido preferidos mostrados en las tablas 12 y 13. El "sitio diana" indica el número del primer nucleótido (más 5') en el ácido nucleico diana particular, al que se une el oligonucleótido. También se muestran en la tabla 18 las especies en las que se encontraron cada uno de los segmentos diana preferidos. 10 are shown in Table 18. The sequences represent the reverse complement of the preferred antisense compounds shown in Tables 12 and 13. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target nucleic acid, to which the oligonucleotide is attached. The species in which each of the preferred target segments were found are also shown in Table 18.
Ejemplo 33 Example 33
15 Inhibición antisentido de la expresión de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi - Dirigido a la secuencia genómica 15 Antisense Inhibition of Human Apolipoprotein B Expression by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap - Targeted at Genomic Sequence
Se diseñó otra serie de oligonucleótidos para dirigir a diferentes regiones del ARN de la apolipoproteína B humana, usando la secuencia publicada (el complemento de los nucleótidos 39835 a 83279 de la secuencia con número de acceso a GenBank NT_022227.9, que representa una secuencia genómica, incorporada en la presente memoria 20 como SEQ ID NO: 334). Los oligonucleótidos se muestran en la Tabla 14. El "sitio diana" indica el número del primer nucleótido (más 5') en la secuencia diana particular, al que se une el oligonucleótido. Todos los compuestos en la tabla 14 son oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud, compuestos de una región de "hueco" central que consiste en 10 2'-desoxinucleótidos, que está flanqueada en ambos lados (direcciones 5' y 3') por "alas" de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE) nucleótidos. Los enlaces Another series of oligonucleotides were designed to target different regions of human apolipoprotein B RNA, using the published sequence (complement of nucleotides 39835 to 83279 of the sequence with GenBank accession number NT_022227.9, representing a genomic sequence , incorporated herein as SEQ ID NO: 334). The oligonucleotides are shown in Table 14. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 14 are chimeric oligonucleotides ("gammers") 20 nucleotides in length, composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which are flanked on both sides (5 'directions and 3 ') by "wings" of 5 nucleotides. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. The links
25 internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todos los residuos de citidina son 5-metilcitidinas. Se analizó el efecto de los compuestos en los niveles de ARNm de la apolipoproteína B humana en células HepG2 por PCR en tiempo real cuantitativa, como se describe en otros ejemplos en la presente memoria. Los datos son medias de dos experimentos en los que las células HepG2 se trataron con los oligonucleótidos 150 nM de la tabla 14. Si está presente, "N.D." indica "no hay datos". Internucleoside (main chain) are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels in HepG2 cells was analyzed by quantitative real-time PCR, as described in other examples herein. Data are means from two experiments in which HepG2 cells were treated with 150 nM oligonucleotides from Table 14. If present, "N.D." indicates "no data".
30 Tabla 14 30 Table 14
Inhibición de los niveles de ARNm de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi Inhibition of mRNA levels of human apolipoprotein B by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 301049 301049
- unión intrón:exón 334 904 TCTGTAAGACAGGAGAAAGA 41 335 intron junction: exon 334 904 TCTGTAAGACAGGAGAAAGA 41 335
- 301050 301050
- unión intrón:exón 334 913 ATTTCCTCTTCTGTAAGACA 22 336 intron junction: exon 334 913 ATTTCCTCTTCTGTAAGACA 22 336
- 301051 301051
- unión exón:intrón 334 952 GATGCCTTACTTGGACAGAC 27 337 exon junction: intron 334 952 GATGCCTTACTTGGACAGAC 27 337
- 301052 301052
- intrón 334 1945 AGAAATAGCTCTCCCAAGGA 13 338 intron 334 1945 AGAAATAGCTCTCCCAAGGA 13 338
- 301053 301053
- unión intron:exón 334 1988 GTCGCATCTTCTAACGTGGG 45 339 intron: exon junction 334 1988 GTCGCATCTTCTAACGTGGG Four. Five 339
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 301054 301054
- unión exón:intrón 334 2104 TCCTCCATACCTTGCAGTTG 0 340 exon junction: intron 334 2104 TCCTCCATACCTTGCAGTTG 0 340
- 301055 301055
- intrón 334 2722 TGGCTCATGTCTACCATATT 49 341 intron 334 2722 TGGCTCATGTCTACCATATT 49 341
- 301056 301056
- intrón 334 2791 CAGTTGAAATGCAGCTAATG 35 342 intron 334 2791 CAGTTGAAATGCAGCTAATG 35 342
- 301057 301057
- intrón 334 3045 TGCAGACTAGGAGTGAAAGT 30 343 intron 334 3045 TGCAGACTAGGAGTGAAAGT 30 343
- 301058 301058
- intrón 334 3117 AGGAGGATGTCCTTTTATTG 27 344 intron 334 3117 AGGAGGATGTCCTTTTATTG 27 344
- 301059 301059
- intrón 334 3290 ATCAGAGCACCAAAGGGAAT 12 345 intron 334 3290 ATCAGAGCACCAAAGGGAAT 12 3. 4. 5
- 301060 301060
- unión intrón:exón 334 3381 CCAGCTCAACCTGAGAATTC 17 346 intron junction: exon 334 3381 CCAGCTCAACCTGAGAATTC 17 346
- 301061 301061
- unión exón:intrón 334 3527 CATGACTTACCTGGACATGG 52 347 exon junction: intron 334 3527 CATGACTTACCTGGACATGG 52 347
- 301062 301062
- intrón 334 3566 CCTCAGCGGACACACACACA 21 348 intron 334 3566 CCTCAGCGGACACACACACA twenty-one 348
- 301063 301063
- intrón 334 3603 GTCACATCCGTGCCTGGTGC 41 349 intron 334 3603 GTCACATCCGTGCCTGGTGC 41 349
- 301064 301064
- intrón 334 3864 CAGTGCCTCTGGGACCCCAC 60 350 intron 334 3864 CAGTGCCTCTGGGACCCCAC 60 350
- 301065 301065
- intrón 334 3990 AGCTGCAGTGGCCGATCAGC 50 351 intron 334 3990 AGCTGCAGTGGCCGATCAGC fifty 351
- 301066 301066
- intrón 334 4251 GACCTCCCCAGCCACGTGGA 61 352 intron 334 4251 GACCTCCCCAGCCACGTGGA 61 352
- 301067 301067
- intrón 334 4853 TCTGATCACCATACATTACA 45 353 intron 334 4853 TCTGATCACCATACATTACA Four. Five 353
- 301068 301068
- intrón 334 5023 ATTTCCCACTGGGTACTCTC 44 354 intron 334 5023 ATTTCCCACTGGGTACTCTC 44 354
- 301069 301069
- intrón 334 5055 GGCTGAAGCCCATGCTGACT 44 355 intron 334 5055 GGCTGAAGCCCATGCTGACT 44 355
- 301070 301070
- intrón 334 5091 GTTGGACAGTCATTCTTTTG 38 356 intron 334 5091 GTTGGACAGTCATTCTTTTG 38 356
- 301071 301071
- intrón 334 5096 CACTTGTTGGACAGTCATTC 48 357 intron 334 5096 CACTTGTTGGACAGTCATTC 48 357
- 301072 301072
- intrón 334 5301 ATTTTAAATTACAGTAGATA 43 358 intron 334 5301 ATTTTAAATTACAGTAGATA 43 358
- 301073 301073
- intrón 334 5780 CTGTTCTCCACCCATATCAG 37 359 intron 334 5780 CTGTTCTCCACCCATATCAG 37 359
- 301074 301074
- unión intrón:exón 334 6353 GAGCTCATACCTGTCCCAGA 75 360 intron junction: exon 334 6353 GAGCTCATACCTGTCCCAGA 75 360
- 301075 301075
- intrón 334 6534 TTCAAGGGCCACTGCTATCA 52 361 intron 334 6534 TTCAAGGGCCACTGCTATCA 52 361
- 301076 301076
- intrón 334 6641 CCAGTATTTCACGCCAATCC 36 362 intron 334 6641 CCAGTATTTCACGCCAATCC 36 362
- 301077 301077
- intrón 334 6661 GGCAGGAGGAACCTCGGGCA 55 363 intron 334 6661 GGCAGGAGGAACCTCGGGCA 55 363
- 301078 301078
- intrón 334 6721 TTTTAAAATTAGACCCAACC 22 364 intron 334 6721 TTTTAAAATTAGACCCAACC 22 364
- 301079 301079
- intrón 334 6727 TGACTGTTTTAAAATTAGAC 20 365 intron 334 6727 TGACTGTTTTAAAATTAGAC twenty 365
- 301080 301080
- intrón 334 6788 CCCAGCAAACACAGGTGAAG 25 366 intron 334 6788 CCCAGCAAACACAGGTGAAG 25 366
- 301081 301081
- intrón 334 7059 GAGTGTGGTCTTGCTAGTGC 46 367 intron 334 7059 GAGTGTGGTCTTGCTAGTGC 46 367
- 301082 301082
- intrón 334 7066 CTATGCAGAGTGTGGTCTTG 41 368 intron 334 7066 CTATGCAGAGTGTGGTCTTG 41 368
- 301083 301083
- intrón 334 7189 AGAAGATGCAACCACATGTA 29 369 intron 334 7189 AGAAGATGCAACCACATGTA 29 369
- 301084 301084
- unión intrón:exón 334 7209 ACACGGTATCCTATGGAGGA 49 370 intron junction: exon 334 7209 ACACGGTATCCTATGGAGGA 49 370
- 301085 301085
- unión exón:intrón 334 7365 TGGGACTTACCATGCCTTTG 11 371 exon junction: intron 334 7365 TGGGACTTACCATGCCTTTG eleven 371
- 301086 301086
- intrón 334 7702 GGTTTTGCTGCCCTACATCC 30 372 intron 334 7702 GGTTTTGCTGCCCTACATCC 30 372
- 301087 301087
- intrón 334 7736 ACAAGGAGTCCTTGTGCAGA 40 373 intron 334 7736 ACAAGGAGTCCTTGTGCAGA 40 373
- 301088 301088
- intrón 334 8006 ATGTTCACTGAGACAGGCTG 41 374 intron 334 8006 ATGTTCACTGAGACAGGCTG 41 374
- 301089 301089
- intrón 334 8215 GAAGGTCCATGGTTCATCTG 0 375 intron 334 8215 GAAGGTCCATGGTTCATCTG 0 375
- 301090 301090
- intrón 334 8239 ATTAGACTGGAAGCATCCTG 39 376 intron 334 8239 ATTAGACTGGAAGCATCCTG 39 376
- 301091 301091
- intrón 334 8738 GAGATTGGAGACGAGCATTT 35 377 intron 334 8738 GAGATTGGAGACGAGCATTT 35 377
- 301092 301092
- unión exón:intrón 334 8881 CATGACCTACTTGTAGGAGA 22 378 exon junction: intron 334 8881 CATGACCTACTTGTAGGAGA 22 378
- 301093 301093
- intrón 334 9208 TGGATTTGGATACACAAGTT 42 379 intron 334 9208 TGGATTTGGATACACAAGTT 42 379
- 301094 301094
- intrón 334 9244 ACTCAATATATATTCATTGA 22 380 intron 334 9244 ACTCAATATATATTCATTGA 22 380
- 301095 301095
- intrón 334 9545 CAAGGAAGCACACCATGTCA 38 381 intron 334 9545 CAAGGAAGCACACCATGTCA 38 381
- 301096 301096
- unión intrón:exón 334 9563 ATACTTATTCCTGGTAACCA 24 382 intron junction: exon 334 9563 ATACTTATTCCTGGTAACCA 24 382
- 301097 301097
- intrón 334 9770 GGTAGCCAGAACACCAGTGT 50 383 intron 334 9770 GGTAGCCAGAACACCAGTGT fifty 383
- 301098 301098
- intrón 334 9776 ACTAGAGGTAGCCAGAACAC 34 384 intron 334 9776 ACTAGAGGTAGCCAGAACAC 3. 4 384
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 301099 301099
- intrón 334 10149 ACCACCTGACATCACAGGTT 24 385 intron 334 10149 ACCACCTGACATCACAGGTT 24 385
- 301100 301100
- intrón 334 10341 TACTGTGACCTATGCCAGGA 55 386 intron 334 10341 TACTGTGACCTATGCCAGGA 55 386
- 301101 301101
- intrón 334 10467 GGAGGTGCTACTGTTGACAT 42 387 intron 334 10467 GGAGGTGCTACTGTTGACAT 42 387
- 301102 301102
- intrón 334 10522 TCCAGACTTGTCTGAGTCTA 47 388 intron 334 10522 TCCAGACTTGTCTGAGTCTA 47 388
- 301103 301103
- intrón 334 10547 TCTAAGAGGTAGAGCTAAAG 7 389 intron 334 10547 TCTAAGAGGTAGAGCTAAAG 7 389
- 301104 301104
- intrón 334 10587 CCAGAGATGAGCAACTTAGG 38 390 intron 334 10587 CCAGAGATGAGCAACTTAGG 38 390
- 301105 301105
- intrón 334 10675 GGCCATGTAAATTGCTCATC 7 391 intron 334 10675 GGCCATGTAAATTGCTCATC 7 391
- 301106 301106
- intrón 334 10831 AAAGAAACTATCCTGTATTC 12 392 intron 334 10831 AAAGAAACTATCCTGTATTC 12 392
- 301107 301107
- unión intrón:exón 334 10946 TTCTTAGTACCTGGAAGATG 23 393 intron junction: exon 334 10946 TTCTTAGTACCTGGAAGATG 2. 3 393
- 301108 301108
- unión exón:intrón 334 11166 CATTAGATACCTGGACACCT 29 394 exon junction: intron 334 11166 CATTAGATACCTGGACACCT 29 394
- 301109 301109
- intrón 334 11337 GTTTCATGGAACTCAGCGCA 44 395 intron 334 11337 GTTTCATGGAACTCAGCGCA 44 395
- 301110 301110
- intrón 334 11457 CTGGAGAGCACCTGCAATAG 35 396 intron 334 11457 CTGGAGAGCACCTGCAATAG 35 396
- 301111 301111
- intrón 334 11521 TGAAGGGTAGAGAAATCATA 9 397 intron 334 11521 TGAAGGGTAGAGAAATCATA 9 397
- 301112 301112
- unión exón:intrón 334 12111 GGAAACTCACTTGTTGACCG 25 398 exon junction: intron 334 12111 GGAAACTCACTTGTTGACCG 25 398
- 301113 301113
- intrón 334 12155 AGGTGCAAGATGTTCCTCTG 46 399 intron 334 12155 AGGTGCAAGATGTTCCTCTG 46 399
- 301114 301114
- intrón 334 12162 TGCACAGAGGTGCAAGATGT 16 400 intron 334 12162 TGCACAGAGGTGCAAGATGT 16 400
- 301115 301115
- intrón 334 12221 CACAAGAGTAAGGAGCAGAG 39 401 intron 334 12221 CACAAGAGTAAGGAGCAGAG 39 401
- 301116 301116
- intrón 334 12987 GATGGATGGTGAGAAATTAC 33 402 intron 334 12987 GATGGATGGTGAGAAATTAC 33 402
- 301117 301117
- intrón 334 13025 TAGACAATTGAGACTCAGAA 39 403 intron 334 13025 TAGACAATTGAGACTCAGAA 39 403
- 301118 301118
- intrón 334 13057 ATGTGCACACAAGGACATAG 33 404 intron 334 13057 ATGTGCACACAAGGACATAG 33 404
- 301119 301119
- intrón 334 13634 ACATACAAATGGCAATAGGC 33 405 intron 334 13634 ACATACAAATGGCAATAGGC 33 405
- 301120 301120
- intrón 334 13673 TAGGCAAAGGACATGAATAG 30 406 intron 334 13673 TAGGCAAAGGACATGAATAG 30 406
- 301121 301121
- codificante 334 14448 TTATGATAGCTACAGAATAA 29 407 coding 334 14448 TTATGATAGCTACAGAATAA 29 407
- 301122 301122
- unión exón:intrón 334 14567 CTGAGATTACCCGCAGAATC 32 408 exon junction: intron 334 14567 CTGAGATTACCCGCAGAATC 32 408
- 301123 301123
- intrón 334 14587 GATGTATGTCATATAAAAGA 26 409 intron 334 14587 GATGTATGTCATATAAAAGA 26 409
- 301124 301124
- unión intrón:exón 334 14680 TTTCCAATGACCTGCATTGA 48 410 intron junction: exon 334 14680 TTTCCAATGACCTGCATTGA 48 410
- 301125 301125
- intrón 334 15444 AGGGATGGTCAATCTGGTAG 57 411 intron 334 15444 AGGGATGGTCAATCTGGTAG 57 411
- 301126 301126
- intrón 334 15562 GGCTAATAAATAGGGTAGTT 22 412 intron 334 15562 GGCTAATAAATAGGGTAGTT 22 412
- 301127 301127
- intrón 334 15757 TCCTAGAGCACTATCAAGTA 41 413 intron 334 15757 TCCTAGAGCACTATCAAGTA 41 413
- 301128 301128
- unión intrón:exón 334 15926 CCTCCTGGTCCTGCAGTCAA 56 414 intron junction: exon 334 15926 CCTCCTGGTCCTGCAGTCAA 56 414
- 301129 301129
- intrón 334 16245 CATTTGCACAAGTGTTTGTT 35 415 intron 334 16245 CATTTGCACAAGTGTTTGTT 35 415
- 301130 301130
- intrón 334 16363 CTGACACACCATGTTATTAT 10 416 intron 334 16363 CTGACACACCATGTTATTAT 10 416
- 301131 301131
- unión intrón:exón 334 16399 CTTTTTCAGACTAGATAAGA 0 417 intron junction: exon 334 16399 CTTTTTCAGACTAGATAAGA 0 417
- 301132 301132
- unión exón:intrón 334 16637 TCACACTTACCTCGATGAGG 29 418 exon junction: intron 334 16637 TCACACTTACCTCGATGAGG 29 418
- 301133 301133
- intrón 334 17471 AAGAAAATGGCATCAGGTTT 13 419 intron 334 17471 AAGAAAATGGCATCAGGTTT 13 419
- 301134 301134
- unión intrón:exón 334 17500 CCAAGCCAATCTGAGAAAGA 25 420 intron junction: exon 334 17500 CCAAGCCAATCTGAGAAAGA 25 420
- 301135 301135
- unión exón:intrón 334 17677 AAATACACACCTGCTCATGT 20 421 exon junction: intron 334 17677 AAATACACACCTGCTCATGT twenty 421
- 301136 301136
- unión exón:intrón 334 17683 CTTCACAAATACACACCTGC 20 422 exon junction: intron 334 17683 CTTCACAAATACACACCTGC twenty 422
- 301137 301137
- intrón 334 18519 AGTGGAAGTTTGGTCTCATT 41 423 intron 334 18519 AGTGGAAGTTTGGTCTCATT 41 423
- 301138 301138
- intrón 334 18532 TTGCTAGCTTCAAAGTGGAA 44 424 intron 334 18532 TTGCTAGCTTCAAAGTGGAA 44 424
- 301139 301139
- intrón 334 18586 TCAAGAATAAGCTCCAGATC 41 425 intron 334 18586 TCAAGAATAAGCTCCAGATC 41 425
- 301140 301140
- intrón 334 18697 GCATACAAGTCACATGAGGT 34 426 intron 334 18697 GCATACAAGTCACATGAGGT 3. 4 426
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 301141 301141
- intrón 334 18969 TACAAGGTGTTTCTTAAGAA 38 427 intron 334 18969 TACAAGGTGTTTCTTAAGAA 38 427
- 301142 301142
- intrón 334 19250 ATGCAGCCAGGATGGGCCTA 54 428 intron 334 19250 ATGCAGCCAGGATGGGCCTA 54 428
- 301143 301143
- unión intrón:exón 334 19340 TTACCATATCCTGAGAGTTT 55 429 intron junction: exon 334 19340 TTACCATATCCTGAGAGTTT 55 429
- 301144 301144
- intrón 334 19802 GCAAAGGTAGAGGAAGGTAT 32 430 intron 334 19802 GCAAAGGTAGAGGAAGGTAT 32 430
- 301145 301145
- intrón 334 19813 AAGGACCTTCAGCAAAGGTA 36 431 intron 334 19813 AAGGACCTTCAGCAAAGGTA 36 431
- 301146 301146
- intrón 334 20253 CATAGGAGTACATTTATATA 23 432 intron 334 20253 CATAGGAGTACATTTATATA 2. 3 432
- 301147 301147
- intrón 334 20398 ATTATGATAAAATCAATTTT 19 433 intron 334 20398 ATTATGATAAAATCAATTTT 19 433
- 301148 301148
- intrón 334 20567 AGAAATTTCACTAGATAGAT 31 434 intron 334 20567 AGAAATTTCACTAGATAGAT 31 434
- 301149 301149
- intrón 334 20647 AGCATATTTTGATGAGCTGA 44 435 intron 334 20647 AGCATATTTTGATGAGCTGA 44 435
- 301150 301150
- intrón 334 20660 GAAAGGAAGGACTAGCATAT 39 436 intron 334 20660 GAAAGGAAGGACTAGCATAT 39 436
- 301151 301151
- unión intrón:exón 334 20772 CCTCTCCAATCTGTAGACCC 28 437 intron junction: exon 334 20772 CCTCTCCAATCTGTAGACCC 28 437
- 301152 301152
- intrón 334 21316 CTGGATAACTCAGACCTTTG 40 438 intron 334 21316 CTGGATAACTCAGACCTTTG 40 438
- 301153 301153
- intrón 334 21407 AGTCAGAAAACAACCTATTC 11 439 intron 334 21407 AGTCAGAAAACAACCTATTC eleven 439
- 301154 301154
- unión intrón:exón 334 21422 CAGCCTGCATCTATAAGTCA 31 440 intron junction: exon 334 21422 CAGCCTGCATCTATAAGTCA 31 440
- 301155 301155
- unión exón:intrón 334 21634 AAAGAATTACCCTCCACTGA 33 441 exon junction: intron 334 21634 AAAGAATTACCCTCCACTGA 33 441
- 301156 301156
- intrón 334 21664 TCTTTCAAACTGGCTAGGCA 39 442 intron 334 21664 TCTTTCAAACTGGCTAGGCA 39 442
- 301157 301157
- intrón 334 21700 GCCTGGCAAAATTCTGCAGG 37 443 intron 334 21700 GCCTGGCAAAATTCTGCAGG 37 443
- 301158 301158
- intrón 334 22032 CTACCTCAAATCAATATGTT 28 444 intron 334 22032 CTACCTCAAATCAATATGTT 28 444
- 301159 301159
- intrón 334 22048 TGCTTTACCTACCTAGCTAC 36 445 intron 334 22048 TGCTTTACCTACCTAGCTAC 36 445
- 301160 301160
- intrón 334 22551 ACCTTGTGTGTCTCACTCAA 49 446 intron 334 22551 ACCTTGTGTGTCTCACTCAA 49 446
- 301161 301161
- intrón 334 22694 ATGCATTCCCTGACTAGCAC 34 447 intron 334 22694 ATGCATTCCCTGACTAGCAC 3. 4 447
- 301162 301162
- intrón 334 22866 CATCTCTGAGCCCCTTACCA 24 448 intron 334 22866 CATCTCTGAGCCCCTTACCA 24 448
- 301163 301163
- intrón 334 22903 GCTGGGCATGCTCTCTCCCC 51 449 intron 334 22903 GCTGGGCATGCTCTCTCCCC 51 449
- 301164 301164
- intrón 334 22912 GCTTTCGCAGCTGGGCATGC 55 450 intron 334 22912 GCTTTCGCAGCTGGGCATGC 55 450
- 301165 301165
- intrón 334 23137 ACTCCTTTCTATACCTGGCT 47 451 intron 334 23137 ACTCCTTTCTATACCTGGCT 47 451
- 301166 301166
- intrón 334 23170 ATTCTGCCTCTTAGAAAGTT 38 452 intron 334 23170 ATTCTGCCTCTTAGAAAGTT 38 452
- 301167 301167
- intrón 334 23402 CCAAGCCTCTTTACTGGGCT 29 453 intron 334 23402 CCAAGCCTCTTTACTGGGCT 29 453
- 301168 301168
- intrón 334 23882 CACTCATGACCAGACTAAGA 35 454 intron 334 23882 CACTCATGACCAGACTAAGA 35 454
- 301169 301169
- intrón 334 23911 ACCTCCCAGAAGCCTTCCAT 22 455 intron 334 23911 ACCTCCCAGAAGCCTTCCAT 22 455
- 301170 301170
- intrón 334 24184 TTCATATGAAATCTCCTACT 40 456 intron 334 24184 TTCATATGAAATCTCCTACT 40 456
- 301171 301171
- intrón 334 24425 TATTTAATTTACTGAGAAAC 7 457 intron 334 24425 TATTTAATTTACTGAGAAAC 7 457
- 301172 301172
- unión intrón:exón 334 24559 TAATGTGTTGCTGGTGAAGA 35 458 intron junction: exon 334 24559 TAATGTGTTGCTGGTGAAGA 35 458
- 301173 301173
- unión exón:intrón 334 24742 CATCTCTAACCTGGTGTCCC 21 459 exon junction: intron 334 24742 CATCTCTAACCTGGTGTCCC twenty-one 459
- 301174 301174
- intrón 334 24800 GTGCCATGCTAGGTGGCCAT 37 460 intron 334 24800 GTGCCATGCTAGGTGGCCAT 37 460
- 301175 301175
- intrón 334 24957 AGCAAATTGGGATCTGTGCT 29 461 intron 334 24957 AGCAAATTGGGATCTGTGCT 29 461
- 301176 301176
- intrón 334 24991 TCTGGAGGCTCAGAAACATG 57 462 intron 334 24991 TCTGGAGGCTCAGAAACATG 57 462
- 301177 301177
- intrón 334 25067 TCAAGACAGGAGCCACCTA 40 463 intron 334 25067 TCAAGACAGGAGCCACCTA 40 463
- 301178 301178
- intrón 334 25152 AGGATTCCCAAGACTTTGGA 38 464 intron 334 25152 AGGATTCCCAAGACTTTGGA 38 464
- 301179 301179
- unión intrón:exón 334 25351 CAGCTCTAATCTAAAGACAT 22 465 intron junction: exon 334 25351 CAGCTCTAATCTAAAGACAT 22 465
- 301180 301180
- unión exón:intrón 334 25473 GAATACTCACCTTCTGCTTG 6 466 exon junction: intron 334 25473 GAATACTCACCTTCTGCTTG 6 466
- 301181 301181
- intrón 334 26047 ATCTCTCTGTCCTCATCTTC 28 467 intron 334 26047 ATCTCTCTGTCCTCATCTTC 28 467
- 301182 301182
- intrón 334 26749 CCAACTCCCCCTTTCTTTGT 37 468 intron 334 26749 CCAACTCCCCCTTTCTTTGT 37 468
- 301183 301183
- intrón 334 26841 TCTGGGCCAGGAAGACACGA 68 469 intron 334 26841 TCTGGGCCAGGAAGACACGA 68 469
- 301184 301184
- intrón 334 27210 TATTGTGTGCTGGGCACTGC 52 470 intron 334 27210 TATTGTGTGCTGGGCACTGC 52 470
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 301185 301185
- unión intrón:exón 334 27815 TGCTTCGCACCTGGACGAGT 51 471 intron junction: exon 334 27815 TGCTTCGCACCTGGACGAGT 51 471
- 301186 301186
- unión exón:intrón 334 28026 CCTTCTTTACCTTAGGTGGC 37 472 exon junction: intron 334 28026 CCTTCTTTACCTTAGGTGGC 37 472
- 301187 301187
- intrón 334 28145 GCTCTCTCTGCCACTCTGAT 47 473 intron 334 28145 GCTCTCTCTGCCACTCTGAT 47 473
- 301188 301188
- intrón 334 28769 AACTTCTAAAGCCAACATTC 27 474 intron 334 28769 AACTTCTAAAGCCAACATTC 27 474
- 301189 301189
- unión intrón:exón 334 28919 TGTGTCACAACTATGGTAAA 63 475 intron junction: exon 334 28919 TGTGTCACAACTATGGTAAA 63 475
- 301190 301190
- unión exón:intrón 334 29095 AGACACATACCATAATGCCA 22 476 exon junction: intron 334 29095 AGACACATACCATAATGCCA 22 476
- 301191 301191
- unión intrón:exón 334 29204 TTCTCTTCATCTGAAAATAC 21 477 intron junction: exon 334 29204 TTCTCTTCATCTGAAAATAC twenty-one 477
- 301192 301192
- intrón 334 29440 TGAGGATGTAATTAGCACTT 27 478 intron 334 29440 TGAGGATGTAATTAGCACTT 27 478
- 301193 301193
- unión intrón:exón 334 29871 AGCTCATTGCCTACAAAATG 31 479 intron junction: exon 334 29871 AGCTCATTGCCTACAAAATG 31 479
- 301194 301194
- intrón 334 30181 GTTCTCATGTTTACTAATGC 40 480 intron 334 30181 GTTCTCATGTTTACTAATGC 40 480
- 301195 301195
- intrón 334 30465 GAATTGAGACAACTTGATTT 26 481 intron 334 30465 GAATTGAGACAACTTGATTT 26 481
- 301196 301196
- unión intrón:exón 334 30931 CCGGCCATCGCTGAAATGAA 54 482 intron junction: exon 334 30931 CCGGCCATCGCTGAAATGAA 54 482
- 301197 301197
- unión exón:intrón 334 31305 CATAGCTCACCTTGCACATT 28 483 exon junction: intron 334 31305 CATAGCTCACCTTGCACATT 28 483
- 301198 301198
- intrón 334 31325 CGGTGCACCCTTTACCTGAG 28 484 intron 334 31325 CGGTGCACCCTTTACCTGAG 28 484
- 301199 301199
- unión intrón:exón 334 31813 TCTCCAGATCCTAACATAAA 19 485 intron junction: exon 334 31813 TCTCCAGATCCTAACATAAA 19 485
- 301200 301200
- intrón 334 39562 TTGAATGACACTAGATTTTC 37 486 intron 334 39562 TTGAATGACACTAGATTTTC 37 486
- 301201 301201
- intrón 334 39591 AAAATCCATTTTCTTTAAAG 12 487 intron 334 39591 AAAATCCATTTTCTTTAAAG 12 487
- 301202 301202
- intrón 334 39654 CAGCTCACACTTATTTTAAA 7 488 intron 334 39654 CAGCTCACACTTATTTTAAA 7 488
- 301203 301203
- unión intrón:exón 334 39789 GTTCCCAAAACTGTATAGGA 36 489 intron junction: exon 334 39789 GTTCCCAAAACTGTATAGGA 36 489
- 301204 301204
- unión exón:intrón 334 39904 AGCTCCATACTGAAGTCCTT 37 490 exon junction: intron 334 39904 AGCTCCATACTGAAGTCCTT 37 490
- 301205 301205
- intrón 334 39916 CAATTCAATAAAAGCTCCAT 31 491 intron 334 39916 CAATTCAATAAAAGCTCCAT 31 491
- 301206 301206
- intrón 334 39938 GTTTTCAAAAGGTATAAGGT 28 492 intron 334 39938 GTTTTCAAAAGGTATAAGGT 28 492
- 301207 301207
- unión intrón:exón 334 40012 TTCCCATTCCCTGAAAGCAG 13 493 intron junction: exon 334 40012 TTCCCATTCCCTGAAAGCAG 13 493
- 301208 301208
- unión exón:intrón 334 40196 TGGTATTTACCTGAGGGCTG 21 494 exon junction: intron 334 40196 TGGTATTTACCTGAGGGCTG twenty-one 494
- 301209 301209
- intrón 334 40412 ATAAATAATAGTGCTGATGG 39 495 intron 334 40412 ATAAATAATAGTGCTGATGG 39 495
- 301210 301210
- intrón 334 40483 CTATGGCTGAGCTTGCCTAT 33 496 intron 334 40483 CTATGGCTGAGCTTGCCTAT 33 496
- 301211 301211
- intrón 334 40505 CTCTCTGAAAAATATACCCT 17 497 intron 334 40505 CTCTCTGAAAAATATACCCT 17 497
- 301212 301212
- intrón 334 40576 TTGATGTATCTCATCTAGCA 41 498 intron 334 40576 TTGATGTATCTCATCTAGCA 41 498
- 301213 301213
- intrón 334 40658 TAGAACCATGTTTGGTCTTC 35 499 intron 334 40658 TAGAACCATGTTTGGTCTTC 35 499
- 301214 301214
- intrón 334 40935 TTTCTCTTTATCACATGCCC 29 500 intron 334 40935 TTTCTCTTTATCACATGCCC 29 500
- 301215 301215
- intrón 41066 TATAGTACATAAAACTTCA 1 501 intron 41066 TATAGTACATAAAACTTCA one 501
- 301216 301216
- unión intrón:exón 334 41130 CTGGAGAGGACTAAACAGAG 49 502 intron junction: exon 334 41130 CTGGAGAGGACTAAACAGAG 49 502
Como se muestra en la tabla 14, las SEQ ID No 335, 339, 341, 342, 343, 347, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 367, 368, 370, 372, 373, 374, 376, 377, 379, 381, 383, 384, 386, 387, 388, 390, 395, 396, 399, 401, 402, 403, 404, 405, 406, 408, 410, 411, 413, 414, 415, 423, 424, 425, 426, 427, 428, 429, 430, 431, 434, 435, 436, 438, 440, 441, 442, 443, 445, 446, 447, 449, 450, 451, 452, 454, 456, 458, 460, 462, 463, 464, 468, 469, 470, 471, 472, 473, 475, 479, 480, 482, 486, 489, 490, 491, 495, 496, 498, 499, y 502 demostraron al menos 30% de inhibición de la expresión de la apolipoproteína B humana en este ensayo, y por lo tanto son preferidas. Las regiones diana de los que estas secuencias preferidas son complementarias se denominan en el presente documento "segmentos diana preferidos" y por lo tanto son preferidos para dirigir los compuestos de la presente descripción. Estos segmentos diana preferidos se muestran en la tabla 18. Las secuencias representan el complemento inverso de los compuestos antisentido preferidos mostrados en la tabla 14. El "sitio diana" indica el número del primer nucleótido (más 5') en el ácido nucleico diana particular, al que se une el oligonucleótido. As shown in Table 14, SEQ ID No.s 335, 339, 341, 342, 343, 347, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 367, 368, 370, 372, 373, 374, 376, 377, 379, 381, 383, 384, 386, 387, 388, 390, 395, 396, 399, 401, 402, 403, 404, 405, 406, 408, 410, 411, 413, 414, 415, 423, 424, 425, 426, 427, 428, 429, 430, 431, 434, 435, 436, 438, 440, 441, 442, 443, 445, 446, 447, 449, 450, 451, 452, 454, 456, 458, 460, 462, 463, 464, 468, 469, 470, 471, 472, 473, 475, 479, 480, 482, 486, 489, 490, 491, 495, 496, 498, 499, and 502 demonstrated at least 30% inhibition of human apolipoprotein B expression in this assay, and are therefore preferred. Target regions of which these preferred sequences are complementary are referred to herein as "preferred target segments" and are therefore preferred for targeting the compounds of the present disclosure. These preferred target segments are shown in Table 18. The sequences represent the reverse complement of the preferred antisense compounds shown in Table 14. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target nucleic acid. , to which the oligonucleotide is attached.
5 También se muestran en la tabla 18 las especies en las que se encontraron cada uno de los segmentos diana preferidos. 5 The species in which each of the preferred target segments were found are also shown in Table 18.
Ejemplo 34 Example 34
Inhibición antisentido de la expresión de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi - Dirigido al número de acceso en GenBank AI249040.1 Antisense Inhibition of Human Apolipoprotein B Expression by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap - Targeted at GenBank Accession Number AI249040.1
10 Se diseñó otra serie de oligonucleótidos para dirigir a diferentes regiones diana del ARN de la apolipoproteína B humana, usando la secuencia publicada (el complemento de la secuencia con número de acceso en GenBank AI249040.1, incorporada en la presente memoria como SEQ ID NO: 503). Los oligonucleótidos se muestran en la Tabla 15. El "sitio diana" indica el número del primer nucleótido (más 5') en la secuencia diana particular, al que se une el oligonucleótido. Todos los compuestos en la tabla 15 son oligonucleótidos quiméricos ("gápmeros") de 20 Another series of oligonucleotides were designed to target different target regions of human apolipoprotein B RNA, using the published sequence (the complement of the sequence with accession number in GenBank AI249040.1, incorporated herein as SEQ ID NO. : 503). The oligonucleotides are shown in Table 15. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 15 are chimeric oligonucleotides ("gammers") of 20
15 nucleótidos de longitud, compuestos de una región de "hueco" central que consiste en 10 2'-desoxinucleótidos, que está flanqueada en ambos lados (direcciones 5' y 3') por "alas" de 5 nucleótidos. Las alas están compuestas por 2'metoxietil (2'-MOE) nucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todos los residuos de citidina son 5-metilcitidinas. Se analizó el efecto de los compuestos en los niveles de ARNm de la apolipoproteína B humana en células HepG2 por PCR en tiempo real 15 nucleotides in length, composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5 'and 3' directions) by 5 nucleotide "wings". The wings are made up of 2'methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels in HepG2 cells was analyzed by real-time PCR
20 cuantitativa, como se describe en otros ejemplos en la presente memoria. Los datos son medias de dos experimentos en los que las células HepG2 se trataron con los oligonucleótidos 150 nM de la tabla 15. Si está presente, "N.D." indica "no hay datos". 20 quantitative, as described in other examples herein. Data are means from two experiments in which HepG2 cells were treated with 150 nM oligonucleotides from Table 15. If present, "N.D." indicates "no data".
Tabla 15 Table 15
Inhibición de los niveles de ARNm de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que 25 tienen alas 2'-MOE y un hueco desoxi Inhibition of human apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
- nº de ISIS ISIS number
- REGIÓN SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 301218 301218
- 3'UTR 503 484 ACATTTTATCAATGCCCTCG 23 504 3'UTR 503 484 ACATTTTATCAATGCCCTCG 2. 3 504
- 301219 301219
- 3'UTR 503 490 GCCAGAACATTTTATCAATG 35 505 3'UTR 503 490 GCCAGAACATTTTATCAATG 35 505
- 301220 301220
- 3'UTR 503 504 AGAGGTTTTGCTGTGCCAGA 51 506 3'UTR 503 504 AGAGGTTTTGCTGTGCCAGA 51 506
- 301221 301221
- 3'UTR 503 506 CTAGAGGTTTTGCTGTGCCA 61 507 3'UTR 503 506 CTAGAGGTTTTGCTGTGCCA 61 507
- 301222 301222
- 3'UTR 503 507 TCTAGAGGTTTTGCTGTGCC 14 508 3'UTR 503 507 TCTAGAGGTTTTGCTGTGCC 14 508
- 301223 301223
- 3'UTR 503 522 AATCACACTATGTGTTCTAG 26 509 3'UTR 503 522 AATCACACTATGTGTTCTAG 26 509
- 301224 301224
- 3'UTR 503 523 AAATCACACTATGTGTTCTA 33 510 3'UTR 503 523 AAATCACACTATGTGTTCTA 33 510
- 301225 301225
- 3'UTR 503 524 TAAATCACACTATGTGTTCT 3 511 3'UTR 503 524 TAAATCACACTATGTGTTCT 3 511
- 301226 301226
- 3'UTR 503 526 CTTAAATCACACTATGTGTT 39 512 3'UTR 503 526 CTTAAATCACACTATGTGTT 39 512
- 301227 301227
- 3'UTR 503 536 TATTCTGTTACTTAAATCAC 23 513 3'UTR 503 536 TATTCTGTTACTTAAATCAC 2. 3 513
Como se muestra en la tabla 15, las SEQ ID No 505, 506, 507, 510, y 512 demostraron al menos 30% de inhibición de la expresión de la apolipoproteína B humana en este ensayo y por lo tanto son preferidas. Las regiones diana de los que estas secuencias preferidas son complementarias se denominan en el presente documento "segmentos As shown in Table 15, SEQ ID No.s 505, 506, 507, 510, and 512 demonstrated at least 30% inhibition of human apolipoprotein B expression in this assay and are therefore preferred. Target regions of which these preferred sequences are complementary are referred to herein as "segments
30 diana preferidos" y por lo tanto son sitios preferidos para dirigir los compuestos de la presente descripción. Estos segmentos diana preferidos se muestran en la tabla 18. Las secuencias representan el complemento inverso de los compuestos antisentido preferidos mostrados en la tabla 15. El "sitio diana" indica el número del primer nucleótido (más 5') en el ácido nucleico diana particular, al que se une el oligonucleótido. También se muestran en la tabla 18 las especies en las que se encontraron cada uno de los segmentos diana preferidos. Preferred targets "and therefore are preferred sites for targeting the compounds of the present disclosure. These preferred target segments are shown in Table 18. The sequences represent the reverse complement of the preferred antisense compounds shown in Table 15. The" "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target nucleic acid to which the oligonucleotide binds. Table 18 also shows the species in which each of the preferred target segments was found.
35 Ejemplo 35 35 Example 35
Inhibición antisentido de la expresión de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi - Variación en la posición del hueco Antisense inhibition of human apolipoprotein B expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap - Variation in gap position
Se diseñó una serie de compuestos antisentido para dirigir a diferentes regiones del ARN de la apolipoproteína B humana, usando secuencias publicadas (número de acceso en GenBank NM_000384.1, incorporada en el presente 40 documento como SEQ ID NO: 3). Los compuestos se muestran en la Tabla 16. El "sitio diana" indica el número del primer nucleótido (más 5') en la secuencia diana particular, al que se une el compuesto. Todos los compuestos de la tabla 16 son oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud. La región de "hueco" consiste en 2'-desoxinucleótidos, que está flanqueada por ambos lados (direcciones 5' y 3') por "alas" compuestas de 2'metoxietil (2'-MOE)nucleótidos. El número de 2'-MOE-nucleótidos en cada lado del hueco varía de modo que el número total de 2'-MOE-nucleótidos es siempre igual a 10 y la longitud total del oligonucleótido quimérico es 20 nucleótidos. La estructura exacta de cada oligonucleótido se designa en la tabla 16 como "estructura del hueco" y los 2'-desoxinucleótidos están en negrilla. Una designación de 8-10-2, por ejemplo, indica que los primeros (los más 5') 5 8 nucleótidos y los últimos (los más 3') 2 nucleótidos son 2'-MOE-nucleótidos y los 10 nucleótidos en el hueco son 2'desoxinucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todos los residuos de citidina son 5-metilcitidinas. Se analizó el efecto de los compuestos en los niveles de ARNm de la apolipoproteína B humana por PCR en tiempo real cuantitativa, como se describe en otros ejemplos en la presente memoria. Los datos mostrados en la tabla 16 son medias de tres experimentos en los A series of antisense compounds were designed to target different regions of human apolipoprotein B RNA, using published sequences (GenBank accession number NM_000384.1, incorporated herein as SEQ ID NO: 3). The compounds are shown in Table 16. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the compound binds. All of the compounds in Table 16 are chimeric oligonucleotides ("gammers") 20 nucleotides in length. The "gap" region consists of 2'-deoxynucleotides, which are flanked on both sides (5 'and 3' directions) by "wings" composed of 2'methoxyethyl (2'-MOE) nucleotides. The number of 2'-MOE-nucleotides on each side of the gap varies so that the total number of 2'-MOE-nucleotides is always equal to 10 and the total length of the chimeric oligonucleotide is 20 nucleotides. The exact structure of each oligonucleotide is designated in Table 16 as "gap structure" and the 2'-deoxynucleotides are in bold. An 8-10-2 designation, for example, indicates that the first (most 5 ') 5 8 nucleotides and the last (most 3') 2 nucleotides are 2'-MOE-nucleotides and the 10 nucleotides in the gap they are 2'deoxynucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels was analyzed by quantitative real-time PCR, as described in other examples herein. The data shown in Table 16 are means from three experiments in the
10 que se trataron células HepG2 con oligonucleótidos antisentido de la presente descripción con dosis de 50 nM y 150 nM. Si está presente, "N.D." indica "no hay datos". 10 that HepG2 cells were treated with antisense oligonucleotides of the present disclosure with doses of 50 nM and 150 nM. If present, "N.D." indicates "no data".
Tabla 16 Table 16
Inhibición de los niveles de ARNm de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi variable Inhibition of Human Apolipoprotein B mRNA Levels by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Variable Deoxy Gap
- nº de ISIS ISIS number
- SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. 150 nM % de INHIB. 50 nM estructura del hueco SEQ ID NO SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. 150 nM % of INHIB. 50 nM hollow structure SEQ ID NO
- 308631 308631
- 3 5589 AGGTTACCAGCCACATGCAG. 94 74 0∼10∼10 224 3 5589 AGGTTACCAGCCACATGCAG. 94 74 0∼10∼10 224
- 308632 308632
- 3 3249 GCCTCAGTCTGCTTCGCACC 97 41 0∼10∼10 247 3 3249 GCCTCAGTCTGCTTCGCACC 97 41 0∼10∼10 247
- 308634 308634
- 3 5589 AGGTTACCAGCCACATGCAG 67 45 10~10~0 224 3 5589 AGGTTACCAGCCACATGCAG 67 Four. Five 10 ~ 10 ~ 0 224
- 308635 308635
- 3 3249 GCCTCAGTCTGCTTCGCACC 93 69 10~10~0 247 3 3249 GCCTCAGTCTGCTTCGCACC 93 69 10 ~ 10 ~ 0 247
- 308637 308637
- 3 5589 AGGTTACCAGCCACATGCAG 95 79 1∼10∼9 224 3 5589 AGGTTACCAGCCACATGCAG 95 79 1∼10∼9 224
- 308638 308638
- 3 3249 GCCTCAGTCTGCTTCGCACC 94 91 1~10~9 247 3 3249 GCCTCAGTCTGCTTCGCACC 94 91 1 ~ 10 ~ 9 247
- 308640 308640
- 3 5589 AGGTTACCAGCCACATGCAG 96 76 2~10~8 224 3 5589 AGGTTACCAGCCACATGCAG 96 76 2 ~ 10 ~ 8 224
- 308641 308641
- 3 3249 GCCTCAGTCTGCTTCGCACC 89 77 2∼10∼8 247 3 3249 GCCTCAGTCTGCTTCGCACC 89 77 2∼10∼8 247
- 308643 308643
- 3 5589 AGGTTACCAGCCACATGCAG. 96 56 3~10~7 224 3 5589 AGGTTACCAGCCACATGCAG. 96 56 3 ~ 10 ~ 7 224
- 308644 308644
- 3 3249 GCCTCAGTCTCCTTCGCACC: 93 71 3∼10∼7 247 3 3249 GCCTCAGTCTCCTTCGCACC: 93 71 3∼10∼7 247
- 308646 308646
- 3 5589 AGGTTACCAGCCACATGCAG 76 50 4∼10∼6 224 3 5589 AGGTTACCAGCCACATGCAG 76 fifty 4∼10∼6 224
- 308647 308647
- 3 3249 GCCTCAGTCTGCTTCGCACC 86 53 4~10~6 247 3 3249 GCCTCAGTCTGCTTCGCACC 86 53 4 ~ 10 ~ 6 247
- 308649 308649
- 3 5589 AGGTTACCAGCCACATGCAG 91 68 6∼10∼4 224 3 5589 AGGTTACCAGCCACATGCAG 91 68 6∼10∼4 224
- 308650 308650
- 3 3249 GCCTCAGTCTGCTTCGCACC 94 74 6~10~4 247 3 3249 GCCTCAGTCTGCTTCGCACC 94 74 6 ~ 10 ~ 4 247
- 308652 308652
- 3 5589 AGGTTACCAGCCACATGCAG 95 73 7∼10∼3 224 3 5589 AGGTTACCAGCCACATGCAG 95 73 7∼10∼3 224
- 308653 308653
- 3 3249 GCCTCAGTCTGCTTCGCACC 89 73 7∼10∼3 247 3 3249 GCCTCAGTCTGCTTCGCACC 89 73 7∼10∼3 247
- 308655 308655
- 3 5589 AGGTTACCAGCCACATGCAG 83 84 8∼10∼2 224 3 5589 AGGTTACCAGCCACATGCAG 83 84 8∼10∼2 224
- 308656 308656
- 3 3249 GCCTCAGTCTGCTTCGCACC 97 37 8~10~2 247 3 3249 GCCTCAGTCTGCTTCGCACC 97 37 8 ~ 10 ~ 2 247
- 308658 308658
- 3 5589 AGGTTACCAGCCACATGCAG 78 86 9∼10∼1 224 3 5589 AGGTTACCAGCCACATGCAG 78 86 9∼10∼1 224
- 308659 308659
- 3 3249 GCCTCAGTCTGCTTCGCACC 93 70 9∼10∼1 247 3 3249 GCCTCAGTCTGCTTCGCACC 93 70 9∼10∼1 247
- 308660 308660
- 3 3254 TGGTAGCCTCAGTCTGCTTC 92 72 2~10~8 514 3 3254 TGGTAGCCTCAGTCTGCTTC 92 72 2 ~ 10 ~ 8 514
- 308662 308662
- 3 3254 TGGTAGCCTCAGTCTGCTTC 83 76 8~10~2 514 3 3254 TGGTAGCCTCAGTCTGCTTC 83 76 8 ~ 10 ~ 2 514
Como se muestra en la tabla 16, las SEQ ID No 224, 247 y 514 demostraron al menos 30% de inhibición de la expresión de la apolipoproteína B humana en este ensayo con ambas dosis. Estos datos sugieren que los oligonucleótidos son eficaces con una serie de variaciones en la situación del hueco. Las regiones diana de los que 5 estas secuencias preferidas son complementarias se denominan en el presente documento "segmentos diana preferidos" y por lo tanto son sitios preferidos para dirigir los compuestos de la presente descripción. Estos segmentos diana preferidos se muestran en la tabla 18. Las secuencias representan el complemento inverso de los compuestos antisentido preferidos mostrados en la tabla 16. El "sitio diana" indica el número del primer nucleótido (más 5') en el ácido nucleico diana particular, al que se une el oligonucleótido. También se muestran en la tabla 18 As shown in Table 16, SEQ ID No.s 224, 247 and 514 demonstrated at least 30% inhibition of human apolipoprotein B expression in this assay at both doses. These data suggest that oligonucleotides are effective with a number of variations in the gap situation. The target regions from which these preferred sequences are complementary are referred to herein as "preferred target segments" and are therefore preferred sites for targeting the compounds of the present disclosure. These preferred target segments are shown in Table 18. The sequences represent the reverse complement of the preferred antisense compounds shown in Table 16. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target nucleic acid , to which the oligonucleotide is attached. They are also shown in table 18
10 las especies en las que se encontraron cada uno de los segmentos diana preferidos. 10 species in which each of the preferred target segments were found.
Ejemplo 36 Example 36
Inhibición antisentido de la expresión de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi - Variación en la posición del hueco de las SEQ ID No: 319 y 515 Antisense inhibition of human apolipoprotein B expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap - Variation in gap position of SEQ ID No: 319 and 515
Se diseñaron una serie de compuestos antisentido basados en las SEQ ID No 319 y 515, con variaciones en la A series of antisense compounds based on SEQ ID No. 319 and 515 were designed, with variations in
15 estructura del hueco. Los compuestos se muestran en la Tabla 17. El "sitio diana" indica el número del primer nucleótido (más 5') en la secuencia diana particular, al que se une el compuesto. Todos los compuestos de la tabla 17 son oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud. La región de "hueco" consiste en 2'desoxinucleótidos, que está flanqueada por ambos lados (direcciones 5' y 3') por "alas" compuestas de 2'-metoxietil (2'-MOE)nucleótidos. El número de 2'-MOE-nucleótidos en cada lado del hueco varía de modo que el número total 15 structure of the hole. The compounds are shown in Table 17. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the compound binds. All of the compounds in Table 17 are chimeric oligonucleotides ("gammers") 20 nucleotides in length. The "gap" region consists of 2'-deoxynucleotides, which are flanked on both sides (5 'and 3' directions) by "wings" composed of 2'-methoxyethyl (2'-MOE) nucleotides. The number of 2'-MOE-nucleotides on each side of the gap varies so that the total number
20 de 2'-MOE-nucleótidos es siempre igual a 10 y la longitud total del oligonucleótido quimérico es 20 nucleótidos. La estructura exacta de cada oligonucleótido se designa en la tabla 17 como "estructura del hueco" y los 2'desoxinucleótidos están en negrilla. Una designación de 8-10-2, por ejemplo, indica que los primeros (los más 5') 8 nucleótidos y los últimos (los más 3') 2 nucleótidos son 2'-MOE-nucleótidos y los 10 nucleótidos en el hueco son 2'desoxinucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todos los residuos de citidina son 5-metilcitidinas. Se analizó el efecto de los compuestos en los niveles de ARNm de la apolipoproteína B humana por PCR en tiempo real cuantitativa, como se describe en otros ejemplos en la presente memoria. Los datos mostrados en la tabla 17 son medias de tres experimentos en los que se trataron células HepG2 con oligonucleótidos antisentido de la presente descripción con dosis de 50 nM y 150 nM. Si está presente, "N.D." indica "no hay datos". 20 of 2'-MOE-nucleotides is always equal to 10 and the total length of the chimeric oligonucleotide is 20 nucleotides. The exact structure of each oligonucleotide is designated in Table 17 as "gap structure" and the 2'-deoxynucleotides are in bold. An 8-10-2 designation, for example, indicates that the first (most 5 ') 8 nucleotides and the last (most 3') 2 nucleotides are 2'-MOE-nucleotides and the 10 nucleotides in the gap are 2'deoxynucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels was analyzed by quantitative real-time PCR, as described in other examples herein. The data shown in Table 17 are means from three experiments in which HepG2 cells were treated with antisense oligonucleotides of the present disclosure at doses of 50 nM and 150 nM. If present, "N.D." indicates "no data".
Tabla 17 Table 17
Inhibición de los niveles de ARNm de la apolipoproteína B humana por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi variable Inhibition of Human Apolipoprotein B mRNA Levels by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Variable Deoxy Gap
- nº de ISIS ISIS number
- SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. 150 nM % de INHIB. 50 nM estructura del hueco SEQ ID NO SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. 150 nM % of INHIB. 50 nM hollow structure SEQ ID NO
- 308630 308630
- 318 3121 GCCTCAGTCTGCTTCGCGCC 89 69 0~10~10 319 318 3121 GCCTCAGTCTGCTTCGCGCC 89 69 0 ~ 10 ~ 10 319
- 30863 30863
- 318 3121 GCCTCAGTCTGCTTCGCGCC 83 66 10∼10~0 319 318 3121 GCCTCAGTCTGCTTCGCGCC 83 66 10∼10 ~ 0 319
- 308636 308636
- 318 3121 GCCTCAGTCTGCTTCGCGCC 91 81 1~10~9 319 318 3121 GCCTCAGTCTGCTTCGCGCC 91 81 1 ~ 10 ~ 9 319
- 308639 308639
- 318 3121 GCCTCAGTCTGCTTCGCGCC 94 86 2~10~8 319 318 3121 GCCTCAGTCTGCTTCGCGCC 94 86 2 ~ 10 ~ 8 319
- 308642 308642
- 318 3121 GCCTCAGTCTGCTTCGCGCC 95 85 3~10∼7 319 318 3121 GCCTCAGTCTGCTTCGCGCC 95 85 3 ~ 10∼7 319
- 308645 308645
- 318 3121 GCCTCAGTCTGCTTCGCGCC 98 57 4~20~6 319 318 3121 GCCTCAGTCTGCTTCGCGCC 98 57 4 ~ 20 ~ 6 319
- 308648 308648
- 318 3121 GCCTCAGTCTGCTTCGCGCC 89 78 6~10~4 319 318 3121 GCCTCAGTCTGCTTCGCGCC 89 78 6 ~ 10 ~ 4 319
- 308651 308651
- 318 3121 GCCTCAGTCTGCTTCGCGCC 88 87 7~10~3 319 318 3121 GCCTCAGTCTGCTTCGCGCC 88 87 7 ~ 10 ~ 3 319
- 308654 308654
- 318 3121 GCCTCAGTCTGCTTCGCGCC 90 81 8~10~2 319 318 3121 GCCTCAGTCTGCTTCGCGCC 90 81 8 ~ 10 ~ 2 319
- 308657 308657
- 318 3121 GCCTCAGTCTGCTTCGCGCC 78 61 9~10~1 319 318 3121 GCCTCAGTCTGCTTCGCGCC 78 61 9 ~ 10 ~ 1 319
- 308661 308661
- 318 3116 AGTCTGCTTCGCGCCTTCTG 91 70 2~10~8 515 318 3116 AGTCTGCTTCGCGCCTTCTG 91 70 2 ~ 10 ~ 8 515
- 308663 308663
- 318 3116 AGTCTGCTTCGCGCCTTCTG 84 44 8~10∼2 515 318 3116 AGTCTGCTTCGCGCCTTCTG 84 44 8 ~ 10∼2 515
10 Como se muestra en la tabla 17, las SEQ ID No , 319 y 515 demostraron al menos 44% de inhibición de la expresión de la apolipoproteína B humana en este ensayo para cualquiera de las dosis. Estos datos sugieren que los compuestos son eficaces con una serie de variaciones en la situación del hueco. Las regiones diana de los que estas secuencias preferidas son complementarias se denominan en el presente documento "segmentos diana preferidos" y por lo tanto son sitios preferidos para dirigir los compuestos de la presente descripción. Estos 10 As shown in Table 17, SEQ ID No.s, 319 and 515 demonstrated at least 44% inhibition of human apolipoprotein B expression in this assay for either dose. These data suggest that the compounds are effective with a number of variations in the gap situation. Target regions of which these preferred sequences are complementary are referred to herein as "preferred target segments" and are therefore preferred sites for targeting the compounds of the present disclosure. These
15 segmentos diana preferidos se muestran en la tabla 18. Las secuencias representan el complemento inverso de los compuestos antisentido preferidos mostrados en la tabla 17. El "sitio diana" indica el número del primer nucleótido (más 5') en el ácido nucleico diana particular, al que se une el oligonucleótido. También se muestran en la tabla 18 las especies en las que se encontraron cada uno de los segmentos diana preferidos. 15 preferred target segments are shown in Table 18. The sequences represent the reverse complement of the preferred antisense compounds shown in Table 17. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target nucleic acid , to which the oligonucleotide is attached. The species in which each of the preferred target segments were found are also shown in Table 18.
Tabla 18 Table 18
20 Secuencia y posición de los segmentos diana preferidos identificados en la apolipoproteína B. 20 Sequence and position of the preferred target segments identified in apolipoprotein B.
- ID DE SITIO SITE ID
- SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA COMP. INV DE SEQ ID NO ACTIVO EN SEQ ID NO SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO
- 187342 187342
- 3 199 GCGCCAGGGCCGAAGAGGAA 124 H. sapiens 516 3 199 GCGCCAGGGCCGAAGAGGAA 124 H. sapiens 516
- 187346 187346
- 3 509 CAGGTATGAGCTCAAGCTGG 128 H. sapiens 517 3 509 CAGGTATGAGCTCAAGCTGG 128 H. sapiens 517
- 187347 187347
- 3 584 CATCCTGAACATCAAGAGGG 129 H. sapiens 518 3 584 CATCCTGAACATCAAGAGGG 129 H. sapiens 518
- 187350 187350
- 3 756 GGGCAGTGTGATCGCTTCAA 132 H. sapiens 519 3 756 GGGCAGTGTGATCGCTTCAA 132 H. sapiens 519
- 187351 187351
- 3 799 CACTTGCTCTCATCAAAGGC 133 H. sapiens 520 3 799 CACTTGCTCTCATCAAAGGC 133 H. sapiens 520
- ID DE SITIO SITE ID
- SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA COMP. INV DE SEQ ID NO ACTIVO EN SEQ ID NO SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO
- 187352 187352
- 3 869 CACACTGGACGCTAAGAGGA 134 H. sapiens 521 3 869 CACACTGGACGCTAAGAGGA 134 H. sapiens 521
- 187356 187356
- 3 1459 CGCTGAGCCACGCGGTCAAC 138 H. sapiens 522 3 1459 CGCTGAGCCACGCGGTCAAC 138 H. sapiens 522
- 187358 187358
- 3 1859 TGTCCAAATTCTACCATGGG 140 H. sapiens 523 3 1859 TGTCCAAATTCTACCATGGG 140 H. sapiens 523
- 187359 187359
- 3 2179 CAGCTGACCTCATCGAGATT 141 H. sapiens 524 3 2179 CAGCTGACCTCATCGAGATT 141 H. sapiens 524
- 187360 187360
- 3 2299 GTCAAGTTCCTGATGGTGTC 142 H. sapiens 525 3 2299 GTCAAGTTCCTGATGGTGTC 142 H. sapiens 525
- 187362 187362
- 3 2518 AGCTGCTTCTGATGGGTGCC 144 H. sapiens 526 3 2518 AGCTGCTTCTGATGGGTGCC 144 H. sapiens 526
- 187363 187363
- 3 2789 GGGCATCATCATTCCGGACT 145 H. sapiens 527 3 2789 GGGCATCATCATTCCGGACT 145 H. sapiens 527
- 187365 187365
- 3 3100 CCTACTATCCGCTGACCGGG 147 H. sapiens 528 3 3100 CCTACTATCCGCTGACCGGG 147 H. sapiens 528
- 187367 187367
- 3 3449 GGGCCACCTAAGTTGTGACA 148 H. sapiens 529 3 3449 GGGCCACCTAAGTTGTGACA 148 H. sapiens 529
- 187368 187368
- 3 3919 AGAACATGGGATTGCCAGAC 149 H. sapiens 530 3 3919 AGAACATGGGATTGCCAGAC 149 H. sapiens 530
- 187369 187369
- 3 4089 CTCCACTTCAAGTCTGTGGG 150 H. sapiens 531 3 4089 CTCCACTTCAAGTCTGTGGG 150 H. sapiens 531
- 187371 187371
- 3 5146 CAGAGCTTGGCCTCTCTGGG 152 H. sapiens 532 3 5146 CAGAGCTTGGCCTCTCTGGG 152 H. sapiens 532
- 187372 187372
- 3 5189 TGGCCGCTTCAGGGAACACA 153 H. sapiens 533 3 5189 TGGCCGCTTCAGGGAACACA 153 H. sapiens 533
- 187374 187374
- 3 6049 CAGCTGAGCAGACAGGCACC 155 H. sapiens 534 3 6049 CAGCTGAGCAGACAGGCACC 155 H. sapiens 534
- 187375 187375
- 3 6520 GGGAGAGACAAGTTTCACAT 156 H. sapiens 535 3 6520 GGGAGAGACAAGTTTCACAT 156 H. sapiens 535
- 187377 187377
- 3 6859 GTACTGCATCCTGGATTCAA 158 H. sapiens 536 3 6859 GTACTGCATCCTGGATTCAA 158 H. sapiens 536
- 187378 187378
- 3 7459 GTGAGGTGACTCAGAGACTC 159 H. sapiens 537 3 7459 GTGAGGTGACTCAGAGACTC 159 H. sapiens 537
- 187379 187379
- 3 7819 TTGCAGAGCAATATTCTATC 160 H. sapiens 538 3 7819 TTGCAGAGCAATATTCTATC 160 H. sapiens 538
- 187380 187380
- 3 7861 AAGCATTGGTAGAGCAAGGG 161 H. sapiens 539 3 7861 AAGCATTGGTAGAGCAAGGG 161 H. sapiens 539
- 187383 187383
- 3 8589 CCGCTGGCTCTGAAGGAGTC 163 H. sapiens 540 3 8589 CCGCTGGCTCTGAAGGAGTC 163 H. sapiens 540
- 187385 187385
- 3 8829 TCTAGTCAGGCTGACCTGCG 165 H. sapiens 541 3 8829 TCTAGTCAGGCTGACCTGCG 165 H. sapiens 541
- 187387 187387
- 3 9119 GGGCCACAGTGTTCTAACTG 166 H. sapiens 542 3 9119 GGGCCACAGTGTTCTAACTG 166 H. sapiens 542
- 187388 187388
- 3 10159 AATCAAGTGTCATCACACTG 167 H. sapiens 543 3 10159 AATCAAGTGTCATCACACTG 167 H. sapiens 543
- 187390 187390
- 3 10349 GGGTAGTCATAACAGTACTG 169 H. sapiens 544 3 10349 GGGTAGTCATAACAGTACTG 169 H. sapiens 544
- 187391 187391
- 3 10699 AGAGCACACGGTCTTCAGTG 170 H. sapiens 545 3 10699 AGAGCACACGGTCTTCAGTG 170 H. sapiens 545
- 187393 187393
- 3 10839 TTACAGCTAGAGGGCCTCTT 172 H. sapiens 546 3 10839 TTACAGCTAGAGGGCCTCTT 172 H. sapiens 546
- 187398 187398
- 3 12149 CACCGTGGGCATGGATATGG 176 H. sapiens 547 3 12149 CACCGTGGGCATGGATATGG 176 H. sapiens 547
- 187399 187399
- 3 12265 GGGAATCTGATGAGGAAACT 177 H. sapiens 548 3 12265 GGGAATCTGATGAGGAAACT 177 H. sapiens 548
- 187400 187400
- 3 12380 TGTCAACAAGTACCACTGGG 178 H. sapiens 549 3 12380 TGTCAACAAGTACCACTGGG 178 H. sapiens 549
- 187403 187403
- 3 12749 ACCTGGGATATACACTAGGG 181 H. sapiens 550 3 12749 ACCTGGGATATACACTAGGG 181 H. sapiens 550
- 187406 187406
- 3 13299 CCAAGTATAGTTGGCTGGAC 183 H. sapiens 551 3 13299 CCAAGTATAGTTGGCTGGAC 183 H. sapiens 551
- 187407 187407
- 3 13779 TACATGAAGCTTGCTCCAGG 184 H. sapiens 552 3 13779 TACATGAAGCTTGCTCCAGG 184 H. sapiens 552
- 197724 197724
- 3 229 ATGTCAGCCTGGTCTGTCCA 185 H. sapiens 553 3 229 ATGTCAGCCTGGTCTGTCCA 185 H. sapiens 553
- 197725 197725
- 3 269 GCACCTCCGGAAGTACACAT 186 H. sapiens 554 3 269 GCACCTCCGGAAGTACACAT 186 H. sapiens 554
- 197726 197726
- 3 389 CTGCAGCTTCATCCTGAAGA 187 H. sapiens 555 3 389 CTGCAGCTTCATCCTGAAGA 187 H. sapiens 555
- 197727 197727
- 3 449 TGAGGGCAAAGCCTTGCTGA 188 H. sapiens 556 3 449 TGAGGGCAAAGCCTTGCTGA 188 H. sapiens 556
- 197728 197728
- 3 529 CCATTCCAGAAGGGAAGCAG 189 H. sapiens 557 3 529 CCATTCCAGAAGGGAAGCAG 189 H. sapiens 557
- 197729 197729
- 3 709 CGAGGAAGGGCAATGTGGCA 190 H. sapiens 558 3 709 CGAGGAAGGGCAATGTGGCA 190 H. sapiens 558
- 197730 197730
- 3 829 CCTTGTCAACTCTGATCAGC 191 H. sapiens 559 3 829 CCTTGTCAACTCTGATCAGC 191 H. sapiens 559
- 197731 197731
- 3 849 AGCAGCCAGTCCTGTCAGTA 192 H. sapiens 560 3 849 AGCAGCCAGTCCTGTCAGTA 192 H. sapiens 560
- 197732 197732
- 3 889 AGCATGTGGCAGAAGCCATC 193 H. sapiens 561 3 889 AGCATGTGGCAGAAGCCATC 193 H. sapiens 561
- 197733 197733
- 3 1059 GAGAGCACCAAATCCACATC 194 H. sapiens 562 3 1059 GAGAGCACCAAATCCACATC 194 H. sapiens 562
- 197734 197734
- 3 1199 CCTCAGTGATGAAGCAGTCA 195 H. sapiens 563 3 1199 CCTCAGTGATGAAGCAGTCA 195 H. sapiens 563
- 197735 197735
- 3 1349 GATAGATGTGGTCACCTACC 196 H. sapiens 564 3 1349 GATAGATGTGGTCACCTACC 196 H. sapiens 564
- 197736 197736
- 3 1390 CCTCAGCACAGCAGCTGCGA 197 H. sapiens 565 3 1390 CCTCAGCACAGCAGCTGCGA 197 H. sapiens 565
- 197737 197737
- 3 1589 GATTCTGCGGGTCATTGGAA 198 H. sapiens 566 3 1589 GATTCTGCGGGTCATTGGAA 198 H. sapiens 566
- 197738 197738
- 3 1678 CAAAGCCATCACTGATGATC 199 H. sapiens 567 3 1678 CAAAGCCATCACTGATGATC 199 H. sapiens 567
- 197739 197739
- 3 1699 AGAAAGCTGCCATCCAGGCT 200 H. sapiens 568 3 1699 AGAAAGCTGCCATCCAGGCT 200 H. sapiens 568
- 197740 197740
- 3 1749 CAGGAGGTTCTTCTTCAGAC 201 H. sapiens 569 3 1749 CAGGAGGTTCTTCTTCAGAC 201 H. sapiens 569
- 197741 197741
- 3 1829 GAGTCCTTCACAGGCAGATA 202 H. sapiens 570 3 1829 GAGTCCTTCACAGGCAGATA 202 H. sapiens 570
- 197742 197742
- 3 1919 TGCCAATATCTTGAACTCAG 203 H. sapiens 571 3 1919 TGCCAATATCTTGAACTCAG 203 H. sapiens 571
- 197743 197743
- 3 2189 CATCGAGATTGGCTTGGAAG 204 H. sapiens 572 3 2189 CATCGAGATTGGCTTGGAAG 204 H. sapiens 572
- 197744 197744
- 3 2649 GGAGCTGGATTACAGTTGCA 205 H. sapiens 573 3 2649 GGAGCTGGATTACAGTTGCA 205 H. sapiens 573
- ID DE SITIO SITE ID
- SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA COMP. INV DE SEQ ID NO ACTIVO EN SEQ ID NO SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO
- 197745 197745
- 3 2729 CAACATGCAGGCTGAACTGG 206 H. sapiens 574 3 2729 CAACATGCAGGCTGAACTGG 206 H. sapiens 574
- 197746 197746
- 3 2949 ACATTACATTTGGTCTCTAC 207 H. sapiens 575 3 2949 ACATTACATTTGGTCTCTAC 207 H. sapiens 575
- 197747 197747
- 3 3059 CTCAGGCGCTTACTCCAACG 208 H. sapiens 576 3 3059 CTCAGGCGCTTACTCCAACG 208 H. sapiens 576
- 197748 197748
- 3 3118 GGGACACCAGATTAGAGCTG 209 H. sapiens 577 3 3118 GGGACACCAGATTAGAGCTG 209 H. sapiens 577
- 197749 197749
- 3 3189 GAGCTCCAGAGAGAGGACAG 210 H. sapiens 578 3 3189 GAGCTCCAGAGAGAGGACAG 210 H. sapiens 578
- 197750 197750
- 3 3289 ATCGGCAGAGTATGACCTTG 211 H. sapiens 579 3 3289 ATCGGCAGAGTATGACCTTG 211 H. sapiens 579
- 197751 197751
- 3 3488 CAAGGGTGTTATTTCCATAC 212 H. sapiens 580 3 3488 CAAGGGTGTTATTTCCATAC 212 H. sapiens 580
- 197752 197752
- 3 3579 GACTCATCTGCTACAGCTTA 213 H. sapiens 581 3 3579 GACTCATCTGCTACAGCTTA 213 H. sapiens 581
- 197753 197753
- 3 4039 GCAAATCCTCCAGAGATCTA 214 H. sapiens 582 3 4039 GCAAATCCTCCAGAGATCTA 214 H. sapiens 582
- 197754 197754
- 3 4180 CTCTCCTGGGTGTTCTAGAC 215 H. sapiens 583 3 4180 CTCTCCTGGGTGTTCTAGAC 215 H. sapiens 583
- 197755 197755
- 3 4299 ATGAAGGCTGACTCTGTGGT 216 H. sapiens 584 3 4299 ATGAAGGCTGACTCTGTGGT 216 H. sapiens 584
- 197756 197756
- 3 4511 GGGACCACAGATGTCTGCTT 217 H. sapiens 585 3 4511 GGGACCACAGATGTCTGCTT 217 H. sapiens 585
- 197757 197757
- 3 4660 CTGGCCGGCTCAATGGAGAG 218 H. sapiens 586 3 4660 CTGGCCGGCTCAATGGAGAG 218 H. sapiens 586
- 197758 197758
- 3 4919 GCTGCGTTCTGAATATCAGG 219 H. sapiens 587 3 4919 GCTGCGTTCTGAATATCAGG 219 H. sapiens 587
- 197759 197759
- 3 5009 TGCTGACATCTTAGGCACTG 220 H. sapiens 588 3 5009 TGCTGACATCTTAGGCACTG 220 H. sapiens 588
- 197760 197760
- 3 5109 AAGTGTAGTCTCCTGGTGCT 221 H. sapiens 589 3 5109 AAGTGTAGTCTCCTGGTGCT 221 H. sapiens 589
- 197761 197761
- 3 5212 CAAAATTCAGTCTGGATGGG 222 H. sapiens 590 3 5212 CAAAATTCAGTCTGGATGGG 222 H. sapiens 590
- 197762 197762
- 3 5562 GGGAAACTACGGCTAGAACC 223 H. sapiens 591 3 5562 GGGAAACTACGGCTAGAACC 223 H. sapiens 591
- 197763 197763
- 3 5589 CTGCATGTGGCTGGTAACCT 224 H. sapiens 592 3 5589 CTGCATGTGGCTGGTAACCT 224 H. sapiens 592
- 197764 197764
- 3 5839 CCATGACCATCGATGCACAT 225 H. sapiens 593 3 5839 CCATGACCATCGATGCACAT 225 H. sapiens 593
- 197765 197765
- 3 5869 ATGGGAAACTCGCTCTCTGG 226 H. sapiens 594 3 5869 ATGGGAAACTCGCTCTCTGG 226 H. sapiens 594
- 197766 197766
- 3 5979 AGTCATCATCTCGTGTCTAG 227 H. sapiens 595 3 5979 AGTCATCATCTCGTGTCTAG 227 H. sapiens 595
- 197767 197767
- 3 6099 GAATACAGCCAGGACTTGGA 228 H. sapiens 596 3 6099 GAATACAGCCAGGACTTGGA 228 H. sapiens 596
- 197768 197768
- 3 6144 GGCGTGGAGCTTACTGGACG 229 H. sapiens 597 3 6144 GGCGTGGAGCTTACTGGACG 229 H. sapiens 597
- 197769 197769
- 3 6249 GAGATGAGAGATGCCGTTGA 230 H. sapiens 598 3 6249 GAGATGAGAGATGCCGTTGA 230 H. sapiens 598
- 197770 197770
- 3 6759 AGTCTTGATGAGCACTATCA 231 H. sapiens 599 3 6759 AGTCTTGATGAGCACTATCA 231 H. sapiens 599
- 197771 197771
- 3 6889 CTAAGTACCAAATCAGAATC 232 H. sapiens 600 3 6889 CTAAGTACCAAATCAGAATC 232 H. sapiens 600
- 197772 197772
- 3 7149 GTCCATGAGTTAATCGAGAG 233 H. sapiens 601 3 7149 GTCCATGAGTTAATCGAGAG 233 H. sapiens 601
- 197773 197773
- 3 7549 AGGCCACAGTTGCAGTGTAT 234 H. sapiens 602 3 7549 AGGCCACAGTTGCAGTGTAT 2. 3. 4 H. sapiens 602
- 197774 197774
- 3 7779 TCTGATTGGTGGACTCTTGC 235 H. sapiens 603 3 7779 TCTGATTGGTGGACTCTTGC 235 H. sapiens 603
- 197775 197775
- 3 7929 GAAGTCAGTCTTCAGGCTCT 236 H. sapiens 604 3 7929 GAAGTCAGTCTTCAGGCTCT 236 H. sapiens 604
- 197776 197776
- 3 8929 CCAGATTCTCAGATGAGGGA 237 H. sapiens 605 3 8929 CCAGATTCTCAGATGAGGGA 237 H. sapiens 605
- 197778 197778
- 3 10240 CATCTGTCATTGATGCACTG 238 H. sapiens 606 3 10240 CATCTGTCATTGATGCACTG 238 H. sapiens 606
- 197779 197779
- 3 10619 AGGAGATGTCAAGGGTTCGG 239 H. sapiens 607 3 10619 AGGAGATGTCAAGGGTTCGG 239 H. sapiens 607
- 197780 197780
- 3 10659 GGAACTATTGCTAGTGAGGC 240 H. sapiens 608 3 10659 GGAACTATTGCTAGTGAGGC 240 H. sapiens 608
- 197781 197781
- 3 10899 CTCTCTCCATGGCAAATGTC 241 H. sapiens 609 3 10899 CTCTCTCCATGGCAAATGTC 241 H. sapiens 609
- 197783 197783
- 3 11979 CACCGTGACTTCAGTGCAGA 243 H. sapiens 610 3 11979 CACCGTGACTTCAGTGCAGA 243 H. sapiens 610
- 197784 197784
- 3 12249 ACTGAGTTGAGGGTCCGGGA 244 H. sapiens 611 3 12249 ACTGAGTTGAGGGTCCGGGA 244 H. sapiens 611
- 197786 197786
- 3 13958 CACATATGAACTGGACCTGC 245 H. sapiens 612 3 13958 CACATATGAACTGGACCTGC 245 H. sapiens 612
- 197787 197787
- 3 14008 TCTGAACTCAGAAGGATGGC 246 H. sapiens 613 3 14008 TCTGAACTCAGAAGGATGGC 246 H. sapiens 613
- 216825 216825
- 3 3249 GGTGCGAAGCAGACTGAGGC 247 H. sapiens 614 3 3249 GGTGCGAAGCAGACTGAGGC 247 H. sapiens 614
- 216826 216826
- 3 3 TCCCACCGGGACCTGCGGGG 248 H. sapiens 615 3 3 TCCCACCGGGACCTGCGGGG 248 H. sapiens 615
- 216827 216827
- 3 6 CACCGGGACCTGCGGGGCTG 249 H. sapiens 616 3 6 CACCGGGACCTGCGGGGCTG 249 H. sapiens 616
- 216828 216828
- 3 23 CTGAGTGCCCTTCTCGGTTG 250 H. sapiens 617 3 2. 3 CTGAGTGCCCTTCTCGGTTG 250 H. sapiens 617
- 216829 216829
- 3 35 CTCGGTTGCTGCCGCTGAGG 251 H. sapiens 618 3 35 CTCGGTTGCTGCCGCTGAGG 251 H. sapiens 618
- 216830 216830
- 3 36 TCGGTTGCTGCCGCTGAGGA 252 H. sapiens 619 3 36 TCGGTTGCTGCCGCTGAGGA 252 H. sapiens 619
- 216831 216831
- 3 37 CGGTTGCTGCCGCTGAGGAG 253 H. sapiens 620 3 37 CGGTTGCTGCCGCTGAGGAG 253 H. sapiens 620
- 216832 216832
- 3 39 GTTGCTGCCGCTGAGGAGCC 254 H. sapiens 621 3 39 GTTGCTGCCGCTGAGGAGCC 254 H. sapiens 621
- 216833 216833
- 3 43 CTGCCGCTGAGGAGCCCGCC 255 H. sapiens 622 3 43 CTGCCGCTGAGGAGCCCGCC 255 H. sapiens 622
- 216834 216834
- 3 116 ACCGCAGCTGGCGATGGACC 256 H. sapiens 623 3 116 ACCGCAGCTGGCGATGGACC 256 H. sapiens 623
- 216835 216835
- 3 120 CAGCTGGCGATGGACCCGCC 257 H. sapiens 624 3 120 CAGCTGGCGATGGACCCGCC 257 H. sapiens 624
- 216836 216836
- 3 13800 GAACTTACTATCATCCTCTA 258 H. sapiens 625 3 13800 GAACTTACTATCATCCTCTA 258 H. sapiens 625
- 216838 216838
- 3 13854 TCCAATTGAACTTTCACATA 260 H. sapiens 626 3 13854 TCCAATTGAACTTTCACATA 260 H. sapiens 626
- ID DE SITIO SITE ID
- SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA COMP. INV DE SEQ ID NO ACTIVO EN SEQ ID NO SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO
- 216839 216839
- 3 13882 AAAATTCAAACTGCCTATAT 261 H. sapiens 627 3 13882 AAAATTCAAACTGCCTATAT 261 H. sapiens 627
- 216840 216840
- 3 13903 GATAAAACCATACAGTGAGC 262 H. sapiens 628 3 13903 GATAAAACCATACAGTGAGC 262 H. sapiens 628
- 216841 216841
- 3 13904 ATAAAACCATACAGTGAGCC 263 H. sapiens 629 3 13904 ATAAAACCATACAGTGAGCC 263 H. sapiens 629
- 216842 216842
- 3 13908 AACCATACAGTGAGCCAGCC 264 H. sapiens 630 3 13908 AACCATACAGTGAGCCAGCC 264 H. sapiens 630
- 216843 216843
- 3 13909 ACCATACAGTGAGCCAGCCT 265 H. sapiens 631 3 13909 ACCATACAGTGAGCCAGCCT 265 H. sapiens 631
- 216844 216844
- 3 13910 CCATACAGTGAGCCAGCCTT 266 H. sapiens 632 3 13910 CCATACAGTGAGCCAGCCTT 266 H. sapiens 632
- 216845 216845
- 3 13917 GTGAGCCAGCCTTGCAGTAG 267 H. sapiens 633 3 13917 GTGAGCCAGCCTTGCAGTAG 267 H. sapiens 633
- 216846 216846
- 3 13922 CCAGCCTTGCAGTAGGCAGT 268 H. sapiens 634 3 13922 CCAGCCTTGCAGTAGGCAGT 268 H. sapiens 634
- 216847 216847
- 3 13934 TAGGCAGTAGACTATAAGCA 269 H. sapiens 635 3 13934 TAGGCAGTAGACTATAAGCA 269 H. sapiens 635
- 216848 216848
- 3 13937 GCAGTAGACTATAAGCAGAA 270 H. sapiens 636 3 13937 GCAGTAGACTATAAGCAGAA 270 H. sapiens 636
- 216849 216849
- 3 13964 TGAACTGGACCTGCACCAAA 271 H. sapiens 637 3 13964 TGAACTGGACCTGCACCAAA 271 H. sapiens 637
- 216850 216850
- 3 13968 CTGGACCTGCACCAAAGCTG 272 H. sapiens 638 3 13968 CTGGACCTGCACCAAAGCTG 272 H. sapiens 638
- 216851 216851
- 3 13970 GGACCTGCACCAAAGCTGGC 273 H. sapiens 639 3 13970 GGACCTGCACCAAAGCTGGC 273 H. sapiens 639
- 216852 216852
- 3 13974 CTGCACCAAAGCTGGCACCA 274 H. sapiens 640 3 13974 CTGCACCAAAGCTGGCACCA 274 H. sapiens 640
- 216853 216853
- 3 13978 ACCAAAGCTGGCACCAGGGC 275 H. sapiens 641 3 13978 ACCAAAGCTGGCACCAGGGC 275 H. sapiens 641
- 216854 216854
- 3 13997 CTCGGAAGGTCTCTGAACTC 276 H. sapiens 642 3 13997 CTCGGAAGGTCTCTGAACTC 276 H. sapiens 642
- 216855 216855
- 3 14012 AACTCAGAAGGATGGCATTT 277 H. sapiens 643 3 14012 AACTCAGAAGGATGGCATTT 277 H. sapiens 643
- 216856 216856
- 3 14014 CTCAGAAGGATGGCATTTTT 278 H. sapiens 644 3 14014 CTCAGAAGGATGGCATTTTT 278 H. sapiens 644
- 216857 216857
- 3 14049 ATCAGGATCTGAGTTATTTT 279 H. sapiens 645 3 14049 ATCAGGATCTGAGTTATTTT 279 H. sapiens 645
- 216858 216858
- 3 14052 AGGATCTGAGTTATTTTGCT 280 H. sapiens 646 3 14052 AGGATCTGAGTTATTTTGCT 280 H. sapiens 646
- 216859 216859
- 3 14057 CTGAGTTATTTTGCTAAACT 281 H. sapiens 647 3 14057 CTGAGTTATTTTGCTAAACT 281 H. sapiens 647
- 216860 216860
- 3 14064 ATTTTGCTAAACTTGGGGGA 282 H. sapiens 648 3 14064 ATTTTGCTAAACTTGGGGGA 282 H. sapiens 648
- 216861 216861
- 3 14071 TAAACTTGGGGGAGGAGGAA 283 H. sapiens 649 3 14071 TAAACTTGGGGGAGGAGGAA 283 H. sapiens 649
- 217030 217030
- 3 14087 GGAACAAATAAATGGAGTCT 284 H. sapiens 650 3 14087 GGAACAAATAAATGGAGTCT 284 H. sapiens 650
- 224316 224316
- 3 3230 GTTTGTAACTCAAGCAGAAG 285 H. sapiens 651 3 3230 GTTTGTAACTCAAGCAGAAG 285 H. sapiens 651
- 224317 224317
- 3 3232 TTGTAACTCAAGCAGAAGGT 286 H. sapiens 652 3 3232 TTGTAACTCAAGCAGAAGGT 286 H. sapiens 652
- 224318 224318
- 3 3234 GTAACTCAAGCAGAAGGTGC 287 H. sapiens 653 3 3234 GTAACTCAAGCAGAAGGTGC 287 H. sapiens 653
- 224319 224319
- 3 3236 AACTCAAGCAGAAGGTGCGA 288 H. sapiens 654 3 3236 AACTCAAGCAGAAGGTGCGA 288 H. sapiens 654
- 224320 224320
- 3 3238 CTCAAGCAGAAGGTGCGAAG 289 H. sapiens 655 3 3238 CTCAAGCAGAAGGTGCGAAG 289 H. sapiens 655
- 224321 224321
- 3 3240 CAAGCAGAAGGTGCGAAGCA 290 H. sapiens 656 3 3240 CAAGCAGAAGGTGCGAAGCA 290 H. sapiens 656
- 224322 224322
- 3 3242 AGCAGAAGGTGCGAAGCAGA 291 H. sapiens 657 3 3242 AGCAGAAGGTGCGAAGCAGA 291 H. sapiens 657
- 224323 224323
- 3 3244 CAGAAGGTGCGAAGCAGACT 292 H. sapiens 658 3 3244 CAGAAGGTGCGAAGCAGACT 292 H. sapiens 658
- 224324 224324
- 3 3246 GAAGGTGCGAAGCAGACTGA 293 H. sapiens 659 3 3246 GAAGGTGCGAAGCAGACTGA 293 H. sapiens 659
- 224325 224325
- 3 3248 AGGTGCGAAGCAGACTGAGG 294 H. sapiens 660 3 3248 AGGTGCGAAGCAGACTGAGG 294 H. sapiens 660
- 224326 224326
- 3 3250 GTGCGAAGCAGACTGAGGCT 295 H. sapiens 661 3 3250 GTGCGAAGCAGACTGAGGCT 295 H. sapiens 661
- 224327 224327
- 3 3252 GCGAAGCAGACTGAGGCTAC 296 H. sapiens 662 3 3252 GCGAAGCAGACTGAGGCTAC 296 H. sapiens 662
- 224328 224328
- 3 3254 GAAGCAGACTGAGGCTACCA 297 H. sapiens 663 3 3254 GAAGCAGACTGAGGCTACCA 297 H. sapiens 663
- 224329 224329
- 3 3256 AGCAGACTGAGGCTACCATG 298 H. sapiens 664 3 3256 AGCAGACTGAGGCTACCATG 298 H. sapiens 664
- 224330 224330
- 3 3258 CAGACTGAGGCTACCATGAC 299 H. sapiens 665 3 3258 CAGACTGAGGCTACCATGAC 299 H. sapiens 665
- 224331 224331
- 3 3260 GACTGAGGCTACCATGACAT 300 H. sapiens 666 3 3260 GACTGAGGCTACCATGACAT 300 H. sapiens 666
- 224332 224332
- 3 3262 CTGAGGCTACCATGACATTC 301 H. sapiens 667 3 3262 CTGAGGCTACCATGACATTC 301 H. sapiens 667
- 224333 224333
- 3 3264 GAGGCTACCATGACATTCAA 302 H. sapiens 668 3 3264 GAGGCTACCATGACATTCAA 302 H. sapiens 668
- 224334 224334
- 3 3266 GGCTACCATGACATTCAAAT 303 H. sapiens 669 3 3266 GGCTACCATGACATTCAAAT 303 H. sapiens 669
- 224335 224335
- 3 3268 CTACCATGACATTCAAATAT 304 H. sapiens 670 3 3268 CTACCATGACATTCAAATAT 304 H. sapiens 670
- 224336 224336
- 3 5582 CCTGAAGCTGCATGTGGCTG 305 H. sapiens 671 3 5582 CCTGAAGCTGCATGTGGCTG 305 H. sapiens 671
- 224337 224337
- 3 5584 TGAAGCTGCATGTGGCTGGT 306 H. sapiens 672 3 5584 TGAAGCTGCATGTGGCTGGT 306 H. sapiens 672
- 224338 224338
- 3 5586 AAGCTGCATGTGGCTGGTAA 307 H. sapiens 673 3 5586 AAGCTGCATGTGGCTGGTAA 307 H. sapiens 673
- 224339 224339
- 3 5588 GCTGCATGTGGCTGGTAACC 308 H. sapiens 674 3 5588 GCTGCATGTGGCTGGTAACC 308 H. sapiens 674
- 224340 224340
- 3 5590 TGCATGTGGCTGGTAACCTA 309 H. sapiens 675 3 5590 TGCATGTGGCTGGTAACCTA 309 H. sapiens 675
- 224341 224341
- 3 5592 CATGTGGCTGGTAACCTAAA 310 H. sapiens 676 3 5592 CATGTGGCTGGTAACCTAAA 310 H. sapiens 676
- 224342 224342
- 3 5594 TGTGGCTGGTAACCTAAAAG 311 H. sapiens 677 3 5594 TGTGGCTGGTAACCTAAAAG 311 H. sapiens 677
- 224343 224343
- 3 5596 TGGCTGGTAACCTAAAAGGA 312 H. sapiens 678 3 5596 TGGCTGGTAACCTAAAAGGA 312 H. sapiens 678
- 224344 224344
- 3 5598 GCTGGTAACCTAAAAGGAGC 313 H. sapiens 679 3 5598 GCTGGTAACCTAAAAGGAGC 313 H. sapiens 679
- ID DE SITIO SITE ID
- SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA COMP. INV DE SEQ ID NO ACTIVO EN SEQ ID NO SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO
- 224345 224345
- 3 5600 TGGTAACCTAAAAGGAGCCT 314 H. sapiens 680 3 5600 TGGTAACCTAAAAGGAGCCT 314 H. sapiens 680
- 224346 224346
- 3 5602 GTAACCTAAAAGGAGCCTAC 315 H. sapiens 681 3 5602 GTAACCTAAAAGGAGCCTAC 315 H. sapiens 681
- 224347 224347
- 3 5604 AACCTAAAAGGAGCCTACCA 316 H. sapiens 682 3 5604 AACCTAAAAGGAGCCTACCA 316 H. sapiens 682
- 224348 224348
- 3 5606 CCTAAAAGGAGCCTACCAAA 317 H. sapiens 683 3 5606 CCTAAAAGGAGCCTACCAAA 317 H. sapiens 683
- 187366 187366
- 318 3121 GGCGCGAAGCAGACTGAGGC 319 H. sapiens 684 318 3121 GGCGCGAAGCAGACTGAGGC 319 H. sapiens 684
- 187404 187404
- 318 12651 CACTATGTTCATGAGGGAGG 323 H. sapiens 685 318 12651 CACTATGTTCATGAGGGAGG 323 H. sapiens 685
- 197777 197777
- 318 9851 CCATCATAGGTTCTGACGTC 324 H. sapiens 686 318 9851 CCATCATAGGTTCTGACGTC 324 H. sapiens 686
- 197785 197785
- 318 12561 GAAGCTGATTGACTCACTCA 325 H. sapiens 687 318 12561 GAAGCTGATTGACTCACTCA 325 H. sapiens 687
- 224349 224349
- 318 3104 TTGTAACTCAAGCAGAAGGC 326 H. sapiens 688 318 3104 TTGTAACTCAAGCAGAAGGC 326 H. sapiens 688
- 224350 224350
- 318 3106 GTAACTCAAGCAGAAGGCGC 327 H. sapiens 689 318 3106 GTAACTCAAGCAGAAGGCGC 327 H. sapiens 689
- 224351 224351
- 318 3108 AACTCAAGCAGAAGGCGCGA 328 H. sapiens 690 318 3108 AACTCAAGCAGAAGGCGCGA 328 H. sapiens 690
- 224352 224352
- 318 3110 CTCAAGCAGAAGGCGCGAAG 329 H. sapiens 691 318 3110 CTCAAGCAGAAGGCGCGAAG 329 H. sapiens 691
- 224353 224353
- 318 3116 CAGAAGGCGCGAAGCAGACT 330 H. sapiens 692 318 3116 CAGAAGGCGCGAAGCAGACT 330 H. sapiens 692
- 224354 224354
- 318 3118 GAAGGCGCGAAGCAGACTGA 331 H. sapiens 693 318 3118 GAAGGCGCGAAGCAGACTGA 331 H. sapiens 693
- 224355 224355
- 318 3120 AGGCGCGAAGCAGACTGAGG 332 H. sapiens 694 318 3120 AGGCGCGAAGCAGACTGAGG 332 H. sapiens 694
- 224356 224356
- 318 3122 GCGCGAAGCAGACTGAGGCT 333 H. sapiens 695 318 3122 GCGCGAAGCAGACTGAGGCT 333 H. sapiens 695
- 224328 224328
- 3 3254 GAAGCAGACTGAGGCTACCA 514 H. sapiens 696 3 3254 GAAGCAGACTGAGGCTACCA 514 H. sapiens 696
- 224353 224353
- 318 3116 CAGAAGGCGCGAAGCAGACT 515 H. sapiens 697 318 3116 CAGAAGGCGCGAAGCAGACT 515 H. sapiens 697
- 216862 216862
- 334 904 TCTTTCTCCTGTCTTACAGA 335 H. sapiens 698 334 904 TCTTTCTCCTGTCTTACAGA 335 H. sapiens 698
- 216866 216866
- 334 1988 CCCACGTTAGAAGATGCGAC 339 H. sapiens 699 334 1988 CCCACGTTAGAAGATGCGAC 339 H. sapiens 699
- 216868 216868
- 334 2722 AATATGGTAGACATGAGCCA 341 H. sapiens 700 334 2722 AATATGGTAGACATGAGCCA 341 H. sapiens 700
- 216869 216869
- 334 2791 CATTAGCTGCATTTCAACTG 342 H. sapiens 701 334 2791 CATTAGCTGCATTTCAACTG 342 H. sapiens 701
- 216870 216870
- 334 3045 ACTTTCACTCCTAGTCTGCA 343 H. sapiens 702 334 3045 ACTTTCACTCCTAGTCTGCA 343 H. sapiens 702
- 216874 216874
- 334 3527 CCATGTCCAGGTAAGTCATG 347 H. sapiens 703 334 3527 CCATGTCCAGGTAAGTCATG 347 H. sapiens 703
- 216876 216876
- 334 3603 GCACCAGGCACGGATGTGAC 349 H. sapiens 704 334 3603 GCACCAGGCACGGATGTGAC 349 H. sapiens 704
- 216877 216877
- 334 3864 GTGGGGTCCCAGAGGCACTG 350 H. sapiens 705 334 3864 GTGGGGTCCCAGAGGCACTG 350 H. sapiens 705
- 216878 216878
- 334 3990 GCTGATCGGCCACTGCAGCT 351 H. sapiens 706 334 3990 GCTGATCGGCCACTGCAGCT 351 H. sapiens 706
- 216879 216879
- 334 4251 TCCACGTGGCTGGGGAGGTC 352 H. sapiens 707 334 4251 TCCACGTGGCTGGGGAGGTC 352 H. sapiens 707
- 216880 216880
- 334 4853 TGTAATGTATGGTGATCAGA 353 H. sapiens 708 334 4853 TGTAATGTATGGTGATCAGA 353 H. sapiens 708
- 216881 216881
- 334 5023 GAGAGTACCCAGTGGGAAAT 354 H. sapiens 709 334 5023 GAGAGTACCCAGTGGGAAAT 354 H. sapiens 709
- 216882 216882
- 334 5055 AGTCAGCATGGGCTTCAGCC 355 H. sapiens 710 334 5055 AGTCAGCATGGGCTTCAGCC 355 H. sapiens 710
- 216883 216883
- 334 5091 CAAAAGAATGACTGTCCAAC 356 H. sapiens 711 334 5091 CAAAAGAATGACTGTCCAAC 356 H. sapiens 711
- 216884 216884
- 334 5096 GAATGACTGTCCAACAAGTG 357 H. sapiens 712 334 5096 GAATGACTGTCCAACAAGTG 357 H. sapiens 712
- 216885 216885
- 334 5301 TATCTACTGTAATTTAAAAT 358 H. sapiens 713 334 5301 TATCTACTGTAATTTAAAAT 358 H. sapiens 713
- 216886 216886
- 334 5780 CTGATATGGGTGGAGAACAG 359 H. sapiens 714 334 5780 CTGATATGGGTGGAGAACAG 359 H. sapiens 714
- 216887 216887
- 334 6353 TCTGGGACAGGTATGAGCTC 360 H. sapiens 715 334 6353 TCTGGGACAGGTATGAGCTC 360 H. sapiens 715
- 216888 216888
- 334 6534 TGATAGCAGTGGCCCTTGAA 361 H. sapiens 716 334 6534 TGATAGCAGTGGCCCTTGAA 361 H. sapiens 716
- 216889 216889
- 334 6641 GGATTGGCGTGAAATACTGG 362 H. sapiens 717 334 6641 GGATTGGCGTGAAATACTGG 362 H. sapiens 717
- 216890 216890
- 334 6661 TGCCCGAGGTTCCTCCTGCC 363 H. sapiens 718 334 6661 TGCCCGAGGTTCCTCCTGCC 363 H. sapiens 718
- 216894 216894
- 334 7059 GCACTAGCAAGACCACACTC 367 H. sapiens 719 334 7059 GCACTAGCAAGACCACACTC 367 H. sapiens 719
- 216895 216895
- 334 7066 CAAGACCACACTCTGCATAG 368 H. sapiens 720 334 7066 CAAGACCACACTCTGCATAG 368 H. sapiens 720
- 216897 216897
- 334 7209 TCCTCCATAGGATACCGTGT 370 H. sapiens 721 334 7209 TCCTCCATAGGATACCGTGT 370 H. sapiens 721
- 216899 216899
- 334 7702 GGATGTAGGGCAGCAAAACC 372 H. sapiens 722 334 7702 GGATGTAGGGCAGCAAAACC 372 H. sapiens 722
- 216900 216900
- 334 7736 TCTGCACAAGGACTCCTTGT 373 H. sapiens 723 334 7736 TCTGCACAAGGACTCCTTGT 373 H. sapiens 723
- 216901 216901
- 334 8006 CAGCCTGTCTCAGTGAACAT 374 H. sapiens 724 334 8006 CAGCCTGTCTCAGTGAACAT 374 H. sapiens 724
- 216903 216903
- 334 8239 CAGGATGCTTCCAGTCTAAT 376 H. sapiens 725 334 8239 CAGGATGCTTCCAGTCTAAT 376 H. sapiens 725
- 216904 216904
- 334 8738 AAATGCTCGTCTCCAATCTC 377 H. sapiens 726 334 8738 AAATGCTCGTCTCCAATCTC 377 H. sapiens 726
- 216906 216906
- 334 9208 AACTTGTGTATCCAAATCCA 379 H. sapiens 727 334 9208 AACTTGTGTATCCAAATCCA 379 H. sapiens 727
- 216908 216908
- 334 9545 TGACATGGTGTGCTTCCTTG 381 H. sapiens 728 334 9545 TGACATGGTGTGCTTCCTTG 381 H. sapiens 728
- 216910 216910
- 334 9770 ACACTGGTGTTCTGGCTACC 383 H. sapiens 729 334 9770 ACACTGGTGTTCTGGCTACC 383 H. sapiens 729
- 216911 216911
- 334 9776 GTGTTCTGGCTACCTCTAGT 384 H. sapiens 730 334 9776 GTGTTCTGGCTACCTCTAGT 384 H. sapiens 730
- 216913 216913
- 334 10341 TCCTGGCATAGGTCACAGTA 386 H. sapiens 731 334 10341 TCCTGGCATAGGTCACAGTA 386 H. sapiens 731
- 216914 216914
- 334 10467 ATGTCAACAGTAGCACCTCC 387 H. sapiens 732 334 10467 ATGTCAACAGTAGCACCTCC 387 H. sapiens 732
- ID DE SITIO SITE ID
- SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA COMP. INV DE SEQ ID NO ACTIVO EN SEQ ID NO SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO
- 216915 216915
- 334 10522 TAGACTCAGACAAGTCTGGA 388 H. sapiens 733 334 10522 TAGACTCAGACAAGTCTGGA 388 H. sapiens 733
- 216917 216917
- 334 10587 CCTAAGTTGCTCATCTCTGG 390 H. sapiens 734 334 10587 CCTAAGTTGCTCATCTCTGG 390 H. sapiens 734
- 216922 216922
- 334 11337 TGCGCTGAGTTCCATGAAAC 395 H. sapiens 735 334 11337 TGCGCTGAGTTCCATGAAAC 395 H. sapiens 735
- 216923 216923
- 334 11457 CTATTGCAGGTGCTCTCCAG 396 H. sapiens 736 334 11457 CTATTGCAGGTGCTCTCCAG 396 H. sapiens 736
- 216926 216926
- 334 12155 CAGAGGAACATCTTGCACCT 399 H. sapiens 737 334 12155 CAGAGGAACATCTTGCACCT 399 H. sapiens 737
- 216928 216928
- 334 12221 CTCTGCTCCTTACTCTTGTG 401 H. sapiens 738 334 12221 CTCTGCTCCTTACTCTTGTG 401 H. sapiens 738
- 216929 216929
- 334 12987 GTAATTTCTCACCATCCATC 402 H. sapiens 739 334 12987 GTAATTTCTCACCATCCATC 402 H. sapiens 739
- 216930 216930
- 334 13025 TTCTGAGTCTCAATTGTCTA 403 H. sapiens 740 334 13025 TTCTGAGTCTCAATTGTCTA 403 H. sapiens 740
- 216931 216931
- 334 13057 CTATGTCCTTGTGTGCACAT 404 H. sapiens 741 334 13057 CTATGTCCTTGTGTGCACAT 404 H. sapiens 741
- 216932 216932
- 334 13634 GCCTATTGCCATTTGTATGT 405 H. sapiens 742 334 13634 GCCTATTGCCATTTGTATGT 405 H. sapiens 742
- 216933 216933
- 334 13673 CTATTCATGTCCTTTGCCTA 406 H. sapiens 743 334 13673 CTATTCATGTCCTTTGCCTA 406 H. sapiens 743
- 216935 216935
- 334 14567 GATTCTGCGGGTAATCTCAG 408 H. sapiens 744 334 14567 GATTCTGCGGGTAATCTCAG 408 H. sapiens 744
- 216937 216937
- 334 14680 TCAATGCAGGTCATTGGAAA 410 H. sapiens 745 334 14680 TCAATGCAGGTCATTGGAAA 410 H. sapiens 745
- 216938 216938
- 334 15444 CTACCAGATTGACCATCCCT 411 H. sapiens 746 334 15444 CTACCAGATTGACCATCCCT 411 H. sapiens 746
- 216940 216940
- 334 15757 TACTTGATAGTGCTCTAGGA 413 H. sapiens 747 334 15757 TACTTGATAGTGCTCTAGGA 413 H. sapiens 747
- 216941 216941
- 334 15926 TTGACTGCAGGACCAGGAGG 414 H. sapiens 748 334 15926 TTGACTGCAGGACCAGGAGG 414 H. sapiens 748
- 216942 216942
- 334 16245 AACAAACACTTGTGCAAATG 415 H. sapiens 749 334 16245 AACAAACACTTGTGCAAATG 415 H. sapiens 749
- 216950 216950
- 334 18519 AATGAGACCAAACTTCCACT 423 H. sapiens 750 334 18519 AATGAGACCAAACTTCCACT 423 H. sapiens 750
- 216951 216951
- 334 18532 TTCCACTTTGAAGCTAGCAA 424 H. sapiens 751 334 18532 TTCCACTTTGAAGCTAGCAA 424 H. sapiens 751
- 216952 216952
- 334 18586 GATCTGGAGCTTATTCTTGA 425 H. sapiens 752 334 18586 GATCTGGAGCTTATTCTTGA 425 H. sapiens 752
- 216953 216953
- 334 18697 ACCTCATGTGACTTGTATGC 426 H. sapiens 753 334 18697 ACCTCATGTGACTTGTATGC 426 H. sapiens 753
- 216954 216954
- 334 18969 TTCTTAAGAAACACCTTGTA 427 H. sapiens 754 334 18969 TTCTTAAGAAACACCTTGTA 427 H. sapiens 754
- 216955 216955
- 334 19250 TAGGCCCATCCTGGCTGCAT 428 H. sapiens 755 334 19250 TAGGCCCATCCTGGCTGCAT 428 H. sapiens 755
- 216956 216956
- 334 19340 AAACTCTCAGGATATGGTAA 429 H. sapiens 756 334 19340 AAACTCTCAGGATATGGTAA 429 H. sapiens 756
- 216957 216957
- 334 19802 ATACCTTCCTCTACCTTTGC 430 H. sapiens 757 334 19802 ATACCTTCCTCTACCTTTGC 430 H. sapiens 757
- 216958 216958
- 334 19813 TACCTTTGCTGAAGGTCCTT 431 H. sapiens 758 334 19813 TACCTTTGCTGAAGGTCCTT 431 H. sapiens 758
- 216961 216961
- 334 20567 ATCTATCTAGTGAAATTTCT 434 H. sapiens 759 334 20567 ATCTATCTAGTGAAATTTCT 434 H. sapiens 759
- 216962 216962
- 334 20647 TCAGCTCATCAAAATATGCT 435 H. sapiens 760 334 20647 TCAGCTCATCAAAATATGCT 435 H. sapiens 760
- 216963 216963
- 334 20660 ATATGCTAGTCCTTCCTTTC 436 H. sapiens 761 334 20660 ATATGCTAGTCCTTCCTTTC 436 H. sapiens 761
- 216965 216965
- 334 21316 CAAAGGTCTGAGTTATCCAG 438 H. sapiens 762 334 21316 CAAAGGTCTGAGTTATCCAG 438 H. sapiens 762
- 216967 216967
- 334 21422 TGACTTATAGATGCAGGCTG 440 H. sapiens 763 334 21422 TGACTTATAGATGCAGGCTG 440 H. sapiens 763
- 216968 216968
- 334 21634 TCAGTGGAGGGTAATTCTTT 441 H. sapiens 764 334 21634 TCAGTGGAGGGTAATTCTTT 441 H. sapiens 764
- 216969 216969
- 334 21664 TGCCTAGCCAGTTTGAAAGA 442 H. sapiens 765 334 21664 TGCCTAGCCAGTTTGAAAGA 442 H. sapiens 765
- 216970 216970
- 334 21700 CCTGCAGAATTTTGCCAGGC 443 H. sapiens 766 334 21700 CCTGCAGAATTTTGCCAGGC 443 H. sapiens 766
- 216972 216972
- 334 22048 GTAGCTAGGTAGGTAAAGCA 445 H. sapiens 767 334 22048 GTAGCTAGGTAGGTAAAGCA 445 H. sapiens 767
- 216973 216973
- 334 22551 TTGAGTGAGACACACAAGGT 446 H. sapiens 768 334 22551 TTGAGTGAGACACACAAGGT 446 H. sapiens 768
- 216974 216974
- 334 22694 GTGCTAGTCAGGGAATGCAT 447 H. sapiens 769 334 22694 GTGCTAGTCAGGGAATGCAT 447 H. sapiens 769
- 216976 216976
- 334 22903 GGGGAGAGAGCATGCCCAGC 449 H. sapiens 770 334 22903 GGGGAGAGAGCATGCCCAGC 449 H. sapiens 770
- 216977 216977
- 334 22912 GCATGCCCAGCTGCGAAAGC 450 H. sapiens 771 334 22912 GCATGCCCAGCTGCGAAAGC 450 H. sapiens 771
- 216978 216978
- 334 23137 AGCCAGGTATAGAAAGGAGT 451 H. sapiens 772 334 23137 AGCCAGGTATAGAAAGGAGT 451 H. sapiens 772
- 216979 216979
- 334 23170 AACTTTCTAAGAGGCAGAAT 452 H. sapiens 773 334 23170 AACTTTCTAAGAGGCAGAAT 452 H. sapiens 773
- 216981 216981
- 334 23882 TCTTAGTCTGGTCATGAGTG 454 H. sapiens 774 334 23882 TCTTAGTCTGGTCATGAGTG 454 H. sapiens 774
- 216983 216983
- 334 24184 AGTAGGAGATTTCATATGAA 456 H. sapiens 775 334 24184 AGTAGGAGATTTCATATGAA 456 H. sapiens 775
- 216985 216985
- 334 24559 TCTTCACCAGCAACACATTA 458 H. sapiens 776 334 24559 TCTTCACCAGCAACACATTA 458 H. sapiens 776
- 216987 216987
- 334 24800 ATGGCCACCTAGCATGGCAC 460 H. sapiens 777 334 24800 ATGGCCACCTAGCATGGCAC 460 H. sapiens 777
- 216989 216989
- 334 24991 CATGTTTCTGAGCCTCCAGA 462 H. sapiens 778 334 24991 CATGTTTCTGAGCCTCCAGA 462 H. sapiens 778
- 216990 216990
- 334 25067 TAGGTGGCTCCCTGTCTTCA 463 H. sapiens 779 334 25067 TAGGTGGCTCCCTGTCTTCA 463 H. sapiens 779
- 216991 216991
- 334 25152 TCCAAAGTCTTGGGAATCCT 464 H. sapiens 780 334 25152 TCCAAAGTCTTGGGAATCCT 464 H. sapiens 780
- 216995 216995
- 334 26749 ACAAAGAAAGGGGGAGTTGG 468 H. sapiens 781 334 26749 ACAAAGAAAGGGGGAGTTGG 468 H. sapiens 781
- 216996 216996
- 334 26841 TCGTGTCTTCCTGGCCCAGA 469 H. sapiens 782 334 26841 TCGTGTCTTCCTGGCCCAGA 469 H. sapiens 782
- 216997 216997
- 334 27210 GCAGTGCCCAGCACACAATA 470 H. sapiens 783 334 27210 GCAGTGCCCAGCACACAATA 470 H. sapiens 783
- 216998 216998
- 334 27815 ACTCGTCCAGGTGCGAAGCA 471 H. sapiens 784 334 27815 ACTCGTCCAGGTGCGAAGCA 471 H. sapiens 784
- 216999 216999
- 334 28026 GCCACCTAAGGTAAAGAAGG 472 H. sapiens 785 334 28026 GCCACCTAAGGTAAAGAAGG 472 H. sapiens 785
- ID DE SITIO SITE ID
- SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA COMP. INV DE SEQ ID NO ACTIVO EN SEQ ID NO SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO
- 217000 217000
- 334 28145 ATCAGAGTGGCAGAGAGAGC 473 H. sapiens 786 334 28145 ATCAGAGTGGCAGAGAGAGC 473 H. sapiens 786
- 217002 217002
- 334 28919 TTTACCATAGTTGTGACACA 475 H. sapiens 787 334 28919 TTTACCATAGTTGTGACACA 475 H. sapiens 787
- 217006 217006
- 334 29871 CATTTTGTAGGCAATG4GCT 479 H. sapiens 788 334 29871 CATTTTGTAGGCAATG4GCT 479 H. sapiens 788
- 217007 217007
- 334 30181 GCATTAGTAAACATGAGAAC 480 H. sapiens 789 334 30181 GCATTAGTAAACATGAGAAC 480 H. sapiens 789
- 217009 217009
- 334 30931 TTCATTTCAGCGATGGCCGG 482 H. sapiens 790 334 30931 TTCATTTCAGCGATGGCCGG 482 H. sapiens 790
- 217013 217013
- 334 39562 GAAAATCTAGTGTCATTCAA 486 H. sapiens 791 334 39562 GAAAATCTAGTGTCATTCAA 486 H. sapiens 791
- 217016 217016
- 334 39789 TCCTATACAGTTTTGGGAAC 489 H. sapiens 792 334 39789 TCCTATACAGTTTTGGGAAC 489 H. sapiens 792
- 217017 217017
- 334 39904 AAGGACTTCAGTATGGAGCT 490 H. sapiens 793 334 39904 AAGGACTTCAGTATGGAGCT 490 H. sapiens 793
- 217018 217018
- 334 39916 ATGGAGCTTTTATTGAATTG 491 H. sapiens 794 334 39916 ATGGAGCTTTTATTGAATTG 491 H. sapiens 794
- 217022 217022
- 334 40412 CCATCAGCACTATTATTTAT 495 H. sapiens 795 334 40412 CCATCAGCACTATTATTTAT 495 H. sapiens 795
- 217023 217023
- 334 40483 ATAGGCAAGCTCAGCCATAG1 496 H. sapiens 796 334 40483 ATAGGCAAGCTCAGCCATAG1 496 H. sapiens 796
- 217025 217025
- 334 40576 TGCTAGATGAGATACATCAA 498 H. sapiens 797 334 40576 TGCTAGATGAGATACATCAA 498 H. sapiens 797
- 217026 217026
- 334 40658 GAAGACCAAACATGGTTCTA 499 H. sapiens 798 334 40658 GAAGACCAAACATGGTTCTA 499 H. sapiens 798
- 217029 217029
- 334 41130 CTCTGTTTAGTCCTCTCCAG 502 H. sapiens 799 334 41130 CTCTGTTTAGTCCTCTCCAG 502 H. sapiens 799
- 1217032 1217032
- 503 490 CATTGATAAAATGTTCTGGC 505 H. sapiens 800 503 490 CATTGATAAAATGTTCTGGC 505 H. sapiens 800
- 217033 217033
- 503 504 TCTGGCACAGCAAAACCTCT 506 H. sapiens 801 503 504 TCTGGCACAGCAAAACCTCT 506 H. sapiens 801
- 217034 217034
- 503 506 TGGCACAGCAAAACCTCTAG 507 H. sapiens 802 503 506 TGGCACAGCAAAACCTCTAG 507 H. sapiens 802
- 217037 217037
- 503 523 TAGAACACATAGTGTGATTT 510 H. sapiens 803 503 523 TAGAACACATAGTGTGATTT 510 H. sapiens 803
- 217039 217039
- 503 526 AACACATAGTGTGATTTAAG 512 H. sapiens 804 503 526 AACACATAGTGTGATTTAAG 512 H. sapiens 804
Puesto que se ha encontrado por experimentación que estos "segmentos diana preferidos" están abiertos a, y por lo tanto son accesibles para, la hibridación con compuestos antisentido de la presente descripción, un experto en la materia reconocerá o podrá determinar, usando solo experimentación rutinaria, otros aspectos de la descripción que Since these "preferred target segments" have been found by experimentation to be open to, and therefore accessible to, hybridization with antisense compounds of the present disclosure, one of skill in the art will recognize, or be able to determine, using only routine experimentation. , other aspects of the description that
5 abarcan otros compuestos que hibridan específicamente con estos segmentos diana preferidos y por consiguiente inhiben la expresión de la apolipoproteína B. 5 encompass other compounds that specifically hybridize to these preferred target segments and therefore inhibit apolipoprotein B expression.
Según la presente descripción, los compuestos antisentido incluyen compuestos oligómeros antisentido, oligonucleótidos antisentido, ribozimas, oligonucleótidos de secuencia guía externa (EGS), empalmes alternativos, cebadores, sondas y otros compuestos oligómeros cortos que hibridan con al menos una parte del ácido nucleico According to the present description, antisense compounds include antisense oligomer compounds, antisense oligonucleotides, ribozymes, external guide sequence oligonucleotides (EGS), alternative splices, primers, probes, and other short oligomeric compounds that hybridize to at least part of the nucleic acid.
10 diana. 10 target.
Ejemplo 37 Example 37
Inhibición antisentido de la expresión de la apolipoproteína B humana - dosis-respuesta de los oligonucleótidos Antisense inhibition of human apolipoprotein B expression - dose-response of oligonucleotides
Los 12 oligonucleótidos descritos en los ejemplos 29 y 31 se investigaron más en un estudio de dosis-respuesta. Los oligonucleótidos de control usados en este estudio eran ISIS 18076 (SEQ ID NO: 805) y ISIS 13650 (SEQ ID NO: The 12 oligonucleotides described in Examples 29 and 31 were further investigated in a dose-response study. The control oligonucleotides used in this study were ISIS 18076 (SEQ ID NO: 805) and ISIS 13650 (SEQ ID NO:
15 806). 15 806).
Todos los compuestos en este estudio, incluyendo los controles eran oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud, compuestos de una región de "hueco" central que consiste en 10 2'-desoxinucleótidos, que está flanqueada por ambos lados (direcciones 5' y 3') por "alas" de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE) nucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato All compounds in this study, including controls, were 20 nucleotide long chimeric oligonucleotides ("gammers"), composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which are flanked on both sides (directions 5 'and 3') by 5 nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) bonds are phosphorothioate bonds
20 (P=S) a lo largo de los oligonucleótidos. Todos los residuos de citidina son 5-metilcitidinas. 20 (P = S) throughout the oligonucleotides. All cytidine residues are 5-methylcytidines.
En el experimento de dosis-respuesta, con los niveles de ARNm como criterio de valoración, se trataron células HepG2 con los oligonucleótidos antisentido o los oligonucleótidos de control con dosis de 37, 75, 150, y 300 nM del oligonucleótido. Los datos se obtuvieron por PCR cuantitativa en tiempo real como se describe en otros ejemplos en la presente memoria, y son la media de dos experimentos con los niveles de ARNm en los grupos de tratamiento In the dose-response experiment, with mRNA levels as the end point, HepG2 cells were treated with the antisense oligonucleotides or the control oligonucleotides with doses of 37, 75, 150, and 300 nM of the oligonucleotide. Data were obtained by quantitative real-time PCR as described in other examples herein, and are the average of two experiments with mRNA levels in treatment groups.
25 normalizados con respecto a un grupo de control no tratado. Los datos se muestran en la Tabla 19. 25 normalized with respect to an untreated control group. The data is shown in Table 19.
Tabla 19 Table 19
Inhibición de los niveles de ARNm de la apolipoproteína B por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi - Dosis-respuesta Inhibition of apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap - Dose-response
- Dosis Dose
- 37 nM 37 nM
- 75 nM 150 nM 300 nM 75 nM 150 nM 300 nM
- nº de ISIS ISIS number
- % inhibición SEQ ID NO % inhibition SEQ ID NO
- 271009 271009
- 82 91 94 96 319 82 91 94 96 319
- 281625 281625
- 62 76 84 94 224 62 76 84 94 224
- 301014 301014
- 75 90 96 98 249 75 90 96 98 249
- 301027 301027
- 80 90 95 96 262 80 90 95 96 262
- 301028 301028
- 70 79 85 92 263 70 79 85 92 263
- 301029 301029
- 54 67 79 85 264 54 67 79 85 264
- 301030 301030
- 64 75 87 92 265 64 75 87 92 265
- 301031 301031
- 61 82 92 96 266 61 82 92 96 266
- 301034 301034
- 73 87 93 97 269 73 87 93 97 269
- 301036 301036
- 67 83 92 95 271 67 83 92 95 271
- 301037 301037
- 73 85 89 96 272 73 85 89 96 272
- 301045 301045
- 77 86 94 98 280 77 86 94 98 280
5 Ejemplo 38 5 Example 38
Inhibición antisentido de la expresión de la apolipoproteína B humana - dosis-respuesta - Intervalo de dosis inferior Antisense inhibition of human apolipoprotein B expression - dose-response - Lower dose range
Los 7 oligonucleótidos descritos en los ejemplos 29, 31, 35 y 36 se investigaron más en un estudio de dosisrespuesta. Los oligonucleótidos de control usados en este estudio eran ISIS 18076 (SEQ ID NO: 805), ISIS 13650 (SEQ ID NO: 806), y ISIS 129695 (SEQ ID NO: 807). The 7 oligonucleotides described in Examples 29, 31, 35, and 36 were further investigated in a dose-response study. The control oligonucleotides used in this study were ISIS 18076 (SEQ ID NO: 805), ISIS 13650 (SEQ ID NO: 806), and ISIS 129695 (SEQ ID NO: 807).
10 Todos los compuestos en este estudio, incluyendo los controles eran oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud, compuestos de una región de "hueco" central que consiste en 10 2'-desoxinucleótidos, que está flanqueada por ambos lados (direcciones 5' y 3') por "alas" de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE) nucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de los oligonucleótidos. Todos los residuos de citidina son 5-metilcitidinas. 10 All of the compounds in this study, including controls, were chimeric oligonucleotides ("gammers") 20 nucleotides in length, composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which are flanked on both sides ( directions 5 'and 3') by 5 nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages along oligonucleotides. All cytidine residues are 5-methylcytidines.
15 En el experimento de dosis-respuesta, con los niveles de ARNm como criterio de valoración, se trataron células HepG2 con los oligonucleótidos antisentido o los oligonucleótidos de control con dosis de 12,5, 37, 75, 150 y 300 nM del oligonucleótido. Los datos se obtuvieron por PCR cuantitativa en tiempo real como se describe en otros ejemplos en la presente memoria, y son la media de dos experimentos con los niveles de ARNm en los grupos de tratamiento normalizados con respecto a un grupo de control no tratado. Los datos se muestran en la Tabla 20. In the dose-response experiment, with mRNA levels as the end point, HepG2 cells were treated with the antisense oligonucleotides or the control oligonucleotides with doses of 12.5, 37, 75, 150 and 300 nM of the oligonucleotide. Data were obtained by quantitative real-time PCR as described in other examples herein, and are the average of two experiments with mRNA levels in standardized treatment groups relative to an untreated control group. The data is shown in Table 20.
20 Tabla 20 20 Table 20
Inhibición de los niveles de ARNm de la apolipoproteína B por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi - Dosis-respuesta Inhibition of apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap - Dose-response
- Dosis Dose
- 12,5 nM 12.5 nM
- 37 nM 75 nM 150 nM 300 nM 37 nM 75 nM 150 nM 300 nM
- nº de ISIS ISIS number
- % inhibición SEQ ID No % inhibition SEQ ID No
- 271009 271009
- 67 86 92 94 95 319 67 86 92 94 95 319
- 281625 281625
- 44 66 83 85 94 224 44 66 83 85 94 224
- 301012 301012
- 63 79 90 92 95 247 63 79 90 92 95 247
- 308638 308638
- 42 73 91 96 97 247 42 73 91 96 97 247
- 308642 308642
- 59 84 91 97 98 319 59 84 91 97 98 319
- 308651 308651
- 57 76 84 90 88 319 57 76 84 90 88 319
- 308658 308658
- 29 61 73 78 90 224 29 61 73 78 90 224
Ejemplo 39 Example 39
Síntesis de ARN RNA synthesis
En general, la química de la síntesis de ARN se basa en la incorporación selectiva de diferentes grupos protectores en reacciones intermedias estratégicas. Aunque el experto en la técnica entenderá el uso de grupos protectores en síntesis orgánica, una clase útil de grupos protectores incluye los éteres de sililo. En particular, se usan éteres de sililo voluminosos para proteger el 5'-hidroxilo en combinación con un grupo protector ortoéster lábil frente a ácidos en el 2'-hidroxilo. Este conjunto de grupos protectores se usa después en la tecnología de síntesis en fase sólida convencional. Es importante eliminar en último lugar el grupo protector ortoéster lábil frente a ácidos, después de todas las demás etapas sintéticas. Además, el uso pronto de los grupos protectores sililo durante la síntesis facilita la eliminación cuando se desea, sin la desprotección indeseada del 2'-hidroxilo. In general, the chemistry of RNA synthesis is based on the selective incorporation of different protecting groups in strategic intermediate reactions. Although the person skilled in the art will understand the use of protecting groups in organic synthesis, a useful class of protecting groups includes silyl ethers. In particular, bulky silyl ethers are used to protect the 5'-hydroxyl in combination with an acid-labile orthoester protecting group on the 2'-hydroxyl. This set of protecting groups is then used in conventional solid phase synthesis technology. It is important to remove the acid labile orthoester protecting group last, after all other synthetic steps. Furthermore, the prompt use of silyl protecting groups during synthesis facilitates removal when desired, without unwanted deprotection of the 2'-hydroxyl.
Siguiendo este procedimiento para la protección secuencial del 5'-hidroxilo en combinación con la protección del 2'hidroxilo mediante grupos protectores que se eliminan de forma diferente y son químicamente lábiles de forma diferente, se sintetizaron los oligonucleótidos de ARN. Following this procedure for sequential protection of 5'-hydroxyl in combination with protection of 2'-hydroxyl by protecting groups that are removed differently and are chemically labile differently, RNA oligonucleotides were synthesized.
Los oligonucleótidos de ARN se sintetizan por pasos. Cada nucleótido se añade de forma secuencial (dirección de 3'- a 5'-) a un oligonucleótido unido a un soporte sólido. El primer nucleósido en el extremo 3' de la cadena está covalentemente unido a un soporte sólido. Se añaden el nucleótido precursor, un ribonucleósido fosforamidita y activador, acoplando la segunda base al extremo 5' del primer nucleósido. El soporte se lava y se remata cualquier grupo 5'-hidroxilo sin reaccionar con anhídrido acético para dar restos 5'-acetilo. Después el enlace se oxida al enlace más estable y finalmente deseado de P(V). Al final del ciclo de adición de nucleótidos, el grupo 5'-sililo se escinde con fluoruro. El ciclo se repite para cada nucleótido que sigue. RNA oligonucleotides are synthesized in steps. Each nucleotide is added sequentially (3'- to 5'- direction) to an oligonucleotide attached to a solid support. The first nucleoside at the 3 'end of the chain is covalently attached to a solid support. The precursor nucleotide, a phosphoramidite and activator ribonucleoside are added, coupling the second base to the 5 'end of the first nucleoside. The support is washed and any unreacted 5'-hydroxyl group is capped with acetic anhydride to give 5'-acetyl residues. The bond is then oxidized to the more stable and ultimately desired bond of P (V). At the end of the nucleotide addition cycle, the 5'-silyl group is cleaved with fluoride. The cycle is repeated for each nucleotide that follows.
Siguiendo la síntesis, los grupos protectores metilo en los fosfatos se escinden en 30 min usando 2-carbamoil-2cianoetileno-1,1-ditiolato de disodio trihidrato (S2Na2) 1 M en DMF. La disolución de desprotección se lava del oligonucleótido unido al soporte sólido usando agua. Después, el soporte se trata con metilenamina al 40% en agua durante 10 min a 55ºC. Esto libera los oligonucleótidos de ARN a la disolución, desprotege las aminas exocíclicas y modifica los grupos 2'. Los oligonucleótidos se pueden analizar por HPLC de intercambio aniónico en esta etapa. Following the synthesis, the methyl protecting groups on the phosphates are cleaved in 30 min using 1M disodium 2-carbamoyl-2-cyanoethylene-1,1-dithiolate trihydrate (S2Na2) in DMF. The deprotection solution is washed from the oligonucleotide bound to the solid support using water. The support is then treated with 40% methylenamine in water for 10 min at 55 ° C. This releases the RNA oligonucleotides into solution, deprotects the exocyclic amines and modifies the 2 'groups. Oligonucleotides can be analyzed by anion exchange HPLC at this stage.
Los grupos 2'-ortoéster son los últimos grupos protectores que se eliminan. El grupo protector ortoéster de monoacetato de etilenglicol desarrollado por Dharmacon Research, Inc. (Lafayette, CO), es un ejemplo de un grupo protector ortoéster útil que tiene las siguientes propiedades importantes. Es estable en las condiciones de síntesis del nucleósido fosforamidita y la síntesis del oligonucleótido. Sin embargo, después de la síntesis del oligonucleótido, el oligonucleótido se trata con metilamina que no solo escinde el oligonucleótido del soporte sólido sino que también elimina los grupos acetilo de los ortoésteres. Los sustituyentes 2-etil-hidroxilo resultantes en el ortoéster son menos atractores de electrones que el precursor acetilado. Como resultado, el ortoéster modificado se hace más lábil a la hidrólisis catalizada por ácido. Específicamente, la tasa de escisión es aproximadamente 10 veces más rápida después de eliminar los grupos acetilo. Por lo tanto, el ortoéster tiene suficiente estabilidad con el fin de ser compatible con la síntesis de oligonucleótidos y además, cuando es posteriormente modificado, permite llevar a cabo la desprotección en condiciones acuosas relativamente suaves compatibles con el producto oligonucleótido de ARN final. 2'-Orthoester groups are the last protecting groups to be removed. The ethylene glycol monoacetate orthoester protecting group developed by Dharmacon Research, Inc. (Lafayette, CO), is an example of a useful orthoester protecting group having the following important properties. It is stable under the conditions of synthesis of the nucleoside phosphoramidite and the synthesis of the oligonucleotide. However, after synthesis of the oligonucleotide, the oligonucleotide is treated with methylamine which not only cleaves the oligonucleotide from the solid support but also removes the acetyl groups from the orthoesters. The resulting 2-ethyl-hydroxyl substituents on the orthoester are less electron-attracting than the acetylated precursor. As a result, the modified orthoester becomes more labile to acid catalyzed hydrolysis. Specifically, the cleavage rate is approximately 10 times faster after removing acetyl groups. Therefore, the orthoester has sufficient stability in order to be compatible with the synthesis of oligonucleotides and furthermore, when it is subsequently modified, it allows the deprotection to be carried out under relatively mild aqueous conditions compatible with the final RNA oligonucleotide product.
Además, los métodos de síntesis de ARN son bien conocidos en la técnica (Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996; Scaringe, S. A., et al., J. Am. Chem. Soc., 1998, 120, 11820-11821; Matteucci, M. D. and Caruthers, M. H. J. Am. Chem. Soc., 1981, 103, 3185-3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett., 1981, 22, 1859-1862; Dahl, B. J., et al., Acta Chem. Scand,. 1990, 44, 639-641; Reddy, M. P., et al., Tetrahedron Lett., 1994, 25, 4311-4314; Wincott, F. et al., Nucleic Acids Res., 1995, 23, 2677-2684; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2301-2313; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2315-2331). Furthermore, RNA synthesis methods are well known in the art (Scaringe, SA Ph.D. Thesis, University of Colorado, 1996; Scaringe, SA, et al., J. Am. Chem. Soc., 1998, 120 , 11820-11821; Matteucci, MD and Caruthers, MHJ Am. Chem. Soc., 1981, 103, 3185-3191; Beaucage, SL and Caruthers, MH Tetrahedron Lett., 1981, 22, 1859-1862; Dahl, BJ, et al., Acta Chem. Scand ,. 1990, 44, 639-641; Reddy, MP, et al., Tetrahedron Lett., 1994, 25, 4311-4314; Wincott, F. et al., Nucleic Acids Res. , 1995, 23, 2677-2684; Griffin, BE, et al., Tetrahedron, 1967, 23, 2301-2313; Griffin, BE, et al., Tetrahedron, 1967, 23, 2315-2331).
Los compuestos de ARN antisentido (oligonucleótidos de ARN) de la presente invención se pueden sintetizar por métodos de la presente memoria o adquirir en Dharmacon Research, Inc (Lafayette, CO). Una vez sintetizados, los compuestos de ARN antisentido complementario se pueden entonces reasociar de forma estable por métodos conocidos en la técnica para formar compuestos antisentido bicatenarios (dúplex)Por ejemplo, se pueden formar dúplex combinando 30 μl de cada una de las cadenas complementarias de los oligonucleótidos de ARN (disolución de oligonucleótido de ARN 50 !M) y 15 μl de 5X tampón de reasociación (acetato de potasio 100 mM, HEPES-KOH 30 mM a pH 7,4, acetato de magnesio 2 mM) seguido de calentamiento durante 1 min a 90°C, después 1 h a 37°C. Los compuestos antisentido en forma de dúplex resultantes se pueden usar en kits, ensayos, cribados, u otros métodos para investigar la función de un ácido nucleico diana. The antisense RNA compounds (RNA oligonucleotides) of the present invention can be synthesized by methods herein or purchased from Dharmacon Research, Inc (Lafayette, CO). Once synthesized, complementary antisense RNA compounds can then be stably reassociated by methods known in the art to form double-stranded antisense compounds (duplexes). For example, duplexes can be formed by combining 30 µl of each of the complementary strands of the RNA oligonucleotides (50 µM RNA oligonucleotide solution) and 15 µl of 5X annealing buffer (100mM potassium acetate, 30mM HEPES-KOH pH 7.4, 2mM magnesium acetate) followed by heating for 1 min at 90 ° C, then 1 h at 37 ° C. The resulting duplex antisense compounds can be used in kits, assays, screens, or other methods to investigate the function of a target nucleic acid.
Ejemplo 40 Example 40
Diseño y cribado de compuestos antisentido en forma de dúplex dirigidos a la apolipoproteína B Design and screening of duplex antisense compounds targeting apolipoprotein B
Se diseñan una serie de dúplex de ácido nucleico que comprenden los compuestos antisentido de la presente invención y sus complementarios para dirigirlos a la apolipoproteína B. La secuencia de bases nucleicas de la cadena antisentido del dúplex comprende al menos una parte de un oligonucleótido descrito en la presente memoria. A series of nucleic acid duplexes comprising the antisense compounds of the present invention and their complements are designed to target them to apolipoprotein B. The nucleic base sequence of the duplex antisense chain comprises at least a part of an oligonucleotide described in present memory.
Los extremos de las cadenas se pueden modificar por la adición de una o más bases nucleicas naturales o modificadas para formar un extremo saliente. Después se diseña la cadena del mismo sentido del ARN de doble cadena y se sintetiza como el complemento de la cadena antisentido y también puede contener modificaciones o adiciones en los extremos. Por ejemplo, en una realización, ambas cadenas del dúplex del ARNdc serían The ends of the chains can be modified by the addition of one or more natural or modified nucleic bases to form a protruding end. The same-way strand of double-stranded RNA is then engineered and synthesized as the complement of the antisense strand and may also contain modifications or additions at the ends. For example, in one embodiment, both strands of the dsRNA duplex would be
5 complementarias alrededor de las bases nucleicas centrales, cada una con extremos salientes en uno o ambos extremos. Las cadenas antisentido y del mismo sentido del dúplex comprenden de aproximadamente 17 a 25 nucleótidos, o de aproximadamente 19 a 23 nucleótidos. Alternativamente, las cadenas antisentido y del mismo sentido comprenden 20, 21 ó 22 nucleótidos. 5 complementary around the central nucleic bases, each with projecting ends at one or both ends. The duplex antisense and same-sense strands comprise from about 17 to 25 nucleotides, or from about 19 to 23 nucleotides. Alternatively, the antisense and sense chains comprise 20, 21, or 22 nucleotides.
Por ejemplo, un dúplex que comprende una cadena antisentido que tiene la secuencia For example, a duplex comprising an antisense strand that has the sequence
Cadena antisentido Antisense chain
Complemento Complement
En otra realización, un dúplex que comprende una cadena antisentido que tiene la misma secuencia CGAGAGGCGGACGGGACCG se puede preparar con extremos romos (sin extremo saliente en ninguna cadena) In another embodiment, a duplex comprising an antisense strand having the same CGAGAGGCGGACGGGACCG sequence can be prepared with blunt ends (with no protruding end on any strand)
15 como se muestra: 15 as shown:
Cadena antisentido Antisense chain
Complemento Complement
Las cadenas de ARN de los dúplex se pueden sintetizar por métodos descritos en la presente memoria o se pueden adquirir en Dharmacon Research Inc., (Lafayette, CO). Una vez sintetizadas, las cadenas complementarias se reasocian de forma estable. Se toman partes alícuotas de las cadenas individuales y se diluyen hasta una 20 concentración 50 !M. Una vez diluidas, se combinan 30 !l de cada cadena con 15 !l de una disolución 5X de tampón de reasociación. La concentración final de dicho tampón es acetato de potasio 100 mM, HEPES-KOH 30 mM a pH 7,4, y acetato de magnesio 2 mM. El volumen final es 75 !l. Esta disolución se incuba durante 1 min a 90ºC y después se centrifuga durante 15 s. El tubo se deja asentar durante 1 h a 37ºC momento en el que se usan los dúplex de ARNdc en la experimentación. La concentración final de los dúplex de ARNdc es 20 !M. La disolución Duplex RNA strands can be synthesized by methods described herein or purchased from Dharmacon Research Inc., (Lafayette, CO). Once synthesized, the complementary strands are stably reassociated. Aliquots of the individual chains are taken and diluted to a concentration of 50 µM. Once diluted, 30 µl of each chain is combined with 15 µl of a 5X annealing buffer solution. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, and 2 mM magnesium acetate. The final volume is 75 µl. This solution is incubated for 1 min at 90 ° C and then centrifuged for 15 s. The tube is left to settle for 1 hr at 37 ° C at which time dsRNA duplexes are used in experimentation. The final concentration of the dsRNA duplexes is 20 µM. The dissolution
25 se puede almacenar congelada (-20ºC) y congelar-descongelar hasta 5 veces. 25 can be stored frozen (-20ºC) and freeze-thaw up to 5 times.
Una vez preparados, se evalúa la capacidad de los compuestos antisentido en dúplex de modular la expresión de la apolipoproteína B. Once prepared, the ability of duplex antisense compounds to modulate apolipoprotein B expression is evaluated.
Cuando las células alcanzan 80% de confluencia, se tratan con los compuestos antisentido en dúplex de la invención. Para células cultivadas en placas de 96 pocillos, los pocillos se lavan una vez con 200 μl de medio OPTIWhen the cells reach 80% confluence, they are treated with the duplex antisense compounds of the invention. For cells grown in 96-well plates, the wells are washed once with 200 µl of OPTI medium
30 MEM-1 reducido en suero (Gibco BRL) y después se tratan con 130 μl de OPTI-MEM-1 que contiene 12 μg/ml de LIPOFECTIN (Gibco BRL) y el compuesto antisentido dúplex deseado en una concentración final de 200 nM. Después de 5 h de tratamiento, el medio se sustituye por medio de nueva aportación. Las células se recogen 16 h después del tratamiento, momento en el que el ARN se aísla y se mide la reducción de la diana por RT-PCR. Serum reduced MEM-1 (Gibco BRL) and then treated with 130 µl OPTI-MEM-1 containing 12 µg / ml LIPOFECTIN (Gibco BRL) and the desired duplex antisense compound at a final concentration of 200 nM. After 5 h of treatment, the medium is replaced by fresh addition. Cells are harvested 16 h after treatment, at which time RNA is isolated and target reduction is measured by RT-PCR.
Ejemplo 41 Example 41
35 Diseño de ensayos fenotípicos y estudios in vivo para usar los inhibidores de la apolipoproteína B 35 Design of phenotypic assays and in vivo studies to use apolipoprotein B inhibitors
Ensayos fenotípicos Phenotypic assays
Una vez que se han identificado los inhibidores de la apolipoproteína B por los métodos descritos en la presente memoria, los compuestos se investigan más en uno o más ensayos fenotípicos, cada uno con criterios de valoración medibles que predicen la eficacia en el tratamiento de un estado patológico o afección particular. Los ensayos 40 fenotípicos, kits y reactivos para usar son bien conocidos por los expertos en la materia y se usan en la presente memoria para investigar la función y/o la asociación de la apolipoproteína B con la salud y la enfermedad. Los ensayos fenotípicos representativos, que se pueden adquirir en uno o varios proveedores comerciales, incluyen aquellos para determinar la viabilidad celular, citotoxicidad, proliferación o supervivencia celular (Molecular Probes, Eugene, OR; PerkinElmer, Boston, MA), ensayos basados en proteína, incluyendo ensayos enzimáticos (Panvera, Once apolipoprotein B inhibitors have been identified by the methods described herein, the compounds are further investigated in one or more phenotypic assays, each with measurable endpoints that predict efficacy in treating a condition. pathological or particular condition. Phenotypic assays, kits, and reagents for use are well known to those of skill in the art and are used herein to investigate the function and / or association of apolipoprotein B with health and disease. Representative phenotypic assays, which may be purchased from one or more commercial suppliers, include those to determine cell viability, cytotoxicity, proliferation, or cell survival (Molecular Probes, Eugene, OR; PerkinElmer, Boston, MA), protein-based assays, including enzymatic assays (Panvera,
45 LLC, Madison, WI; BD Biosciences, Franklin Lakes, NJ; Oncogene Research Products, San Diego, CA), regulación celular, transducción de señales, inflamación, procesos oxidativos y apoptosis (Assay Designs Inc., Ann Arbor, MI), acumulación de triglicéridos (Sigma-Aldrich, St. Louis, MO), ensayos de angiogénesis, ensayos de formación de tubos, ensayos de citoquinas y hormonas y ensayos metabólicos (Chemicon International Inc., Temecula, CA; Amersham Biosciences, Piscataway, NJ). 45 LLC, Madison, WI; BD Biosciences, Franklin Lakes, NJ; Oncogene Research Products, San Diego, CA), cell regulation, signal transduction, inflammation, oxidative processes, and apoptosis (Assay Designs Inc., Ann Arbor, MI), triglyceride accumulation (Sigma-Aldrich, St. Louis, MO), angiogenesis assays, tube formation assays, cytokine and hormone assays, and metabolic assays (Chemicon International Inc., Temecula, CA; Amersham Biosciences, Piscataway, NJ).
50 En un ejemplo no limitante, las células que se determina que son adecuadas para un ensayo fenotípico particular (es decir, células MCF-7 seleccionadas para estudios de cáncer de mama; adipocitos para estudios de obesidad) se tratan con inhibidores de apolipoproteína B identificados en los estudios in vitro, así como compuestos de control, en las concentraciones óptimas que son determinadas por los métodos descritos antes. Al final del periodo de tratamiento, las células tratadas y no tratadas se analizar por uno o más métodos específicos para el ensayo para determinar los resultados fenotípicos y criterios de valoración. In a non-limiting example, cells determined to be suitable for a particular phenotypic assay (ie, MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies) are treated with identified apolipoprotein B inhibitors in in vitro studies, as well as control compounds, at optimal concentrations that are determined by the methods described above. At the end of the treatment period, treated and untreated cells will be analyzed by one or more specific assay methods to determine phenotypic results and endpoints.
Los criterios de valoración fenotípicos incluyen cambios en la morfología celular a lo largo del tiempo o dosis de tratamiento así como cambios en los niveles de componentes celulares tales como proteínas, lípidos, ácidos nucleicos, hormonas, sacáridos o metales. Las mediciones del estado celular que incluyen pH, estadio del ciclo celular, absorción o excreción de indicadores biológicos por la célula, son también criterios de valoración de interés. Phenotypic endpoints include changes in cell morphology over time or dose of treatment as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides, or metals. Measurements of cell status including pH, cell cycle stage, absorption or excretion of biological indicators by the cell, are also endpoints of interest.
El análisis del genotipo de la célula (medición de la expresión de uno o más genes de la célula) después de tratamiento, también se usa como un indicador de la eficacia o potencia de los inhibidores de la apolipoproteína B. Los genes distintivos, o aquellos genes que se sospecha que están asociados con un estado patológico, afección o genotipo específicos, se miden tanto en las células tratadas como en las no tratadas. Analysis of the cell genotype (measurement of the expression of one or more cell genes) after treatment is also used as an indicator of the efficacy or potency of apolipoprotein B inhibitors. The distinctive genes, or those Genes suspected to be associated with a specific disease state, condition, or genotype are measured in both treated and untreated cells.
Estudios In Vivo In Vivo Studies
Los sujetos individuales de los estudios in vivo descritos en el presente documento son animales vertebrados de sangre caliente, que incluyen seres humanos. The individual subjects of the in vivo studies described herein are warm blooded vertebrate animals, including humans.
El ensayo clínico se somete a controles rigurosos que aseguran que los individuos no se ponen en riesgo de forma innecesaria y que están completamente informados de su función en el estudio. The clinical trial undergoes rigorous controls that ensure that individuals are not unnecessarily put at risk and that they are fully informed of their role in the study.
Para tener en cuenta los efectos psicológicos de recibir los tratamientos, se les da a los voluntarios aleatoriamente placebo o inhibidor de apolipoproteína B. Además, para prevenir que los médicos no sean imparciales, no se les informa de si la medicación que están administrando es un inhibidor de apolipoproteína B o un placebo. Usando este procedimiento de aleatorización, cada voluntario tiene la misma probabilidad de que le den el nuevo tratamiento o el placebo. To account for the psychological effects of receiving the treatments, volunteers are randomly given placebo or apolipoprotein B inhibitor. Also, to prevent doctors from being impartial, they are not informed if the medication they are administering is a apolipoprotein B inhibitor or a placebo. Using this randomization procedure, each volunteer is equally likely to be given the new treatment or the placebo.
Los voluntarios recibieron el inhibidor de apolipoproteína B o el placebo durante un periodo de 8 semanas, midiéndose los parámetros biológicos asociados con el estado patológico o la afección indicada al principio (medición de los valores iniciales antes de cualquier tratamiento), al final (después del tratamiento final), y a intervalos regulares durante el periodo de estudio. Dichas mediciones incluyen los niveles de moléculas de ácido nucleico que codifican la apolipoproteína B o niveles de proteína apolipoproteína B en fluidos corporales, tejidos u órganos comprados con los niveles antes de tratamiento. Otras mediciones incluyen, pero sin limitar, índices del estado patológico o afección que se va a tratar, peso corporal, presión sanguínea, título del suero de indicadores farmacológicos de la enfermedad o toxicidad así como mediciones ADME (absorción, distribución, metabolismo y excreción). The volunteers received the apolipoprotein B inhibitor or the placebo for a period of 8 weeks, measuring the biological parameters associated with the pathological state or the condition indicated at the beginning (measurement of the initial values before any treatment), at the end (after the final treatment), and at regular intervals during the study period. Such measurements include levels of nucleic acid molecules encoding apolipoprotein B or levels of apolipoprotein B protein in body fluids, tissues, or organs purchased at levels prior to treatment. Other measurements include, but are not limited to, indices of the disease state or condition to be treated, body weight, blood pressure, serum titer of pharmacological indicators of disease or toxicity as well as ADME measurements (absorption, distribution, metabolism, and excretion) .
La información registrada para cada paciente incluye la edad (años), género, altura (cm), historia familiar del estado patológico o afección (si/no), valoración de la motivación (algo/moderada/grande) y número y tipo de regímenes de tratamiento previos para la enfermedad o afección indicadas. The information recorded for each patient includes age (years), gender, height (cm), family history of disease state or condition (yes / no), motivation assessment (somewhat / moderate / large), and number and type of regimens of previous treatment for the indicated disease or condition.
Los voluntarios que toman parte en este estudio son adultos sanos (edad de 18 a 65 años) y participan aproximadamente el mismo número de hombres y mujeres en este estudio. Los voluntarios con determinadas características se distribuyen de forma igualitaria en el tratamiento con placebo y con inhibidor de apolipoproteína B. En general, los voluntarios tratados con placebo tienen poca o no tienen respuesta al tratamiento, mientras que los voluntarios tratados con el inhibidor de la apolipoproteína B presentan tendencias positivas en su índice del estado patológico o afección al final del estudio. The volunteers taking part in this study are healthy adults (ages 18 to 65) and approximately the same number of men and women participate in this study. Volunteers with certain characteristics are equally distributed on placebo and apolipoprotein B inhibitor treatment. In general, placebo-treated volunteers have little or no response to treatment, whereas volunteers treated with apolipoprotein inhibitor B show positive trends in their index of disease state or condition at the end of the study.
Ejemplo 42 Example 42
Inhibición antisentido de la expresión de la apolipoproteína B de conejo por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi Antisense inhibition of rabbit apolipoprotein B expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
Se diseñó una serie de oligonucleótidos para dirigir a diferentes regiones del ARN de la apolipoproteína B de conejo, usando las secuencias publicadas (número de acceso en GenBank X07480.1, incorporada en la presente memoria como SEQ ID NO: 808, número de acceso en GenBank M17780.1, incorporada en la presente memoria como SEQ ID NO: 809, y se obtuvo una secuencia usando los cebadores descritos previamente (Tanaka, Journ. Biol. Chem., 1993, 268, 12713-12718) que representan el ARNm de la apolipoproteína B de conejo, incorporada en la presente memoria como SEQ ID NO: 810). Los oligonucleótidos se muestran en la Tabla 21. El "sitio diana" indica el número del primer nucleótido (más 5') en la secuencia diana particular, al que se une el oligonucleótido. Todos los compuestos en la tabla 21 son oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud, compuestos de una región de "hueco" central que consiste en 10 2'-desoxinucleótidos, que está flanqueada en ambos lados (direcciones 5' y 3') por "alas" de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE) nucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todos los residuos de citidina son 5-metilcitidinas. Se analizó el efecto de los compuestos en los niveles de ARNm de la apolipoproteína B de conejo en hepatocitos primarios de conejo por PCR en tiempo real cuantitativa, como se describe en otros ejemplos en la presente memoria. Los hepatocitos primarios de conejo se trataron con los compuestos 150 mM de la tabla 21. Para la apolipoproteína B de conejo los cebadores de la PCR eran: A series of oligonucleotides were designed to target different regions of rabbit apolipoprotein B RNA, using the sequences published (GenBank accession number X07480.1, incorporated herein as SEQ ID NO: 808, accession number in GenBank M17780.1, incorporated herein as SEQ ID NO: 809, and a sequence was obtained using the primers previously described (Tanaka, Journ. Biol. Chem., 1993, 268, 12713-12718) representing the mRNA of rabbit apolipoprotein B, incorporated herein as SEQ ID NO: 810). The oligonucleotides are shown in Table 21. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 21 are 20 nucleotide long chimeric oligonucleotides ("gammers"), composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5 'directions and 3 ') by "wings" of 5 nucleotides. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of compounds on rabbit apolipoprotein B mRNA levels in primary rabbit hepatocytes was analyzed by quantitative real-time PCR, as described in other examples herein. The primary rabbit hepatocytes were treated with the 150 mM compounds in Table 21. For the rabbit apolipoprotein B the PCR primers were:
5 cebador directo: AAGCACCCCCAATGTCACC (SEQ ID NO: 811) cebador inverso: GGGATGGCAGAGCCAATGTA (SEQ ID NO: 812) y la sonda para PCR era: FAM- TCCTGGATTCAAGCTTCTATGTGCCTTCA -TAMRA (SEQ ID NO: 813) donde FAM (PE-Applied Biosystems, Foster City, CA) es el colorante indicador fluorescente) y TAMRA (PE-Applied Biosystems, Foster City, CA) es el colorante atenuador. Los datos son medias de dos experimentos. Si está presente, "N.D." indica "no hay datos". 5 forward primer: AAGCACCCCCAATGTCACC (SEQ ID NO: 811) reverse primer: GGGATGGCAGAGCCAATGTA (SEQ ID NO: 812) and the PCR probe was: FAM-TCCTGGATTCAAGCTTCTATGTGCCTTCA -TAMRA (SEQ ID NO: 813) where F Foster City, CA) is the fluorescent indicator dye) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quenching dye. Data are means from two experiments. If present, "N.D." indicates "no data".
10 Tabla 21 10 Table 21
Inhibición de los niveles de ARNm de la apolipoproteína B de conejo por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi Inhibition of rabbit apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
- nº de ISIS ISIS number
- SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA % de INHIB. SEQ ID NO SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO
- 233149 233149
- 808 1 TGCTTGGAGAAGGTAAGATC 0 814 808 one TGCTTGGAGAAGGTAAGATC 0 814
- 233150 233150
- 810 1 GCGTTGTCTCCGATGTTCTG 20 815 810 one GCGTTGTCTCCGATGTTCTG twenty 815
- 233151 233151
- 809 13 TAATCATTAACTTGCTGTGG 20 816 809 13 TAATCATTAACTTGCTGTGG twenty 816
- 233152 233152
- 808 22 TCAGCACGTAGCAATGCATT 0 817 808 22 TCAGCACGTAGCAATGCATT 0 817
- 233153 233153
- 808 31 GCCTGATACTCAGCACGTAG 0 818 808 31 GCCTGATACTCAGCACGTAG 0 818
- 233154 233154
- 809 31 CAATTGAATGTACTCAGATA 18 819 809 31 CAATTGAATGTACTCAGATA 18 819
- 233155 233155
- 808 51 ACCTCAGTGACTTGTAATCA 47 820 808 51 ACCTCAGTGACTTGTAATCA 47 820
- 233156 233156
- 809 51 CACTGGAAACTTGTCTCTCC 23 821 809 51 CACTGGAAACTTGTCTCTCC 2. 3 821
- 233157 233157
- 809 71 AGTAGTTAGTTTCTCCTTGG 0 822 809 71 AGTAGTTAGTTTCTCCTTGG 0 822
- 233159 233159
- 808 121 TCAGTGCCCAAGATGTCAGC 0 823 808 121 TCAGTGCCCAAGATGTCAGC 0 823
- 233160 233160
- 810 121 ATTGGAATAATGTATCCAGG 81 824 810 121 ATTGGAATAATGTATCCAGG 81 824
- 233161 233161
- 809 130 TTGGCATTATCCAATGCAGT 28 825 809 130 TTGGCATTATCCAATGCAGT 28 825
- 233162 233162
- 808 151 GTTGCCTTGTGAGCAGCAGT 0 826 808 151 GTTGCCTTGTGAGCAGCAGT 0 826
- 233163 233163
- 810 151 ATTGTGAGTGGAGATACTTC 80 827 810 151 ATTGTGAGTGGAGATACTTC 80 827
- 233164 233164
- 809 171 CATATGTCTGAAGTTGAGAC 8 828 809 171 CATATGTCTGAAGTTGAGAC 8 828
- 233165 233165
- 808 181 GTAGATACTCCATTTTGGCC 0 829 808 181 GTAGATACTCCATTTTGGCC 0 829
- 233166 233166
- 810 181 GGATCACATGACTGAATGCT 82 830 810 181 GGATCACATGACTGAATGCT 82 830
- 233167 233167
- 808 201 TCAAGCTGGTTGTTGCACTG 28 831 808 201 TCAAGCTGGTTGTTGCACTG 28 831
- 233168 233168
- 808 211 GGACTGTACCTCAAGCTGGT 0 832 808 211 GGACTGTACCTCAAGCTGGT 0 832
- 233169 233169
- 808 231 GCTCATTCTCCAGCATCAGG 14 833 808 231 GCTCATTCTCCAGCATCAGG 14 833
- 233170 233170
- 809 251 TTGATCTATAATACTAGCTA 23 834 809 251 TTGATCTATAATACTAGCTA 2. 3 834
- 233172 233172
- 810 282 ATGGAAGACTGGCAGCTCTA 86 835 810 282 ATGGAAGACTGGCAGCTCTA 86 835
- 233173 233173
- 808 301 TTGTGTTCCTTGAAGCGGCC 3 836 808 301 TTGTGTTCCTTGAAGCGGCC 3 836
- 233174 233174
- 809 301 TGTGCACGGATATGATAACG 21 837 809 301 TGTGCACGGATATGATAACG twenty-one 837
- 233175 233175
- 810 306 GACCTTGAGTAGATTCCTGG 90 838 810 306 GACCTTGAGTAGATTCCTGG 90 838
- 233176 233176
- 810 321 GAAATCTGGAAGAGAGACCT 62 839 810 321 GAAATCTGGAAGAGAGACCT 62 839
- 233177 233177
- 808 331 GTAGCTTTCCCATCTAGGCT 0 840 808 331 GTAGCTTTCCCATCTAGGCT 0 840
- 233178 233178
- 808 346 GATAACTCTGTGAGGGTAGC 0 841 808 346 GATAACTCTGTGAGGGTAGC 0 841
- 233179 233179
- 810 371 ATGTTGCCCATGGCTGGAAT 65 842 810 371 ATGTTGCCCATGGCTGGAAT 65 842
- 233180 233180
- 809 381 AAGATGCAGTACTACTTCCA 13 843 809 381 AAGATGCAGTACTACTTCCA 13 843
- 233181 233181
- 808 382 GCACCCAGAATCATGGCCTG 0 844 808 382 GCACCCAGAATCATGGCCTG 0 844
- 233182 233182
- 809 411 CTTGATACTTGGTATCCACA 59 845 809 411 CTTGATACTTGGTATCCACA 59 845
- 233183 233183
- 810 411 CAGTGTAATGATCGTTGATT 88 846 810 411 CAGTGTAATGATCGTTGATT 88 846
- 233184 233184
- 810 431 TAAAGTCCAGCATTGGTATT 69 847 810 431 TAAAGTCCAGCATTGGTATT 69 847
- 233185 233185
- 810 451 CAACAATGTCTGATTGGTTA 73 848 810 451 CAACAATGTCTGATTGGTTA 73 848
- 233186 233186
- 810 473 GAAGAGGAAGAAAGGATATG 60 849 810 473 GAAGAGGAAGAAAGGATATG 60 849
- 233187 233187
- 810 481 TGACAGATGAAGAGGAAGAA 66 850 810 481 TGACAGATGAAGAGGAAGAA 66 850
- 233188 233188
- 810 500 TTGTACTGTAGTGCATCAAT 74 851 810 500 TTGTACTGTAGTGCATCAAT 74 851
- 233189 233189
- 809 511 GCCTCAATCTGTTGTTTCAG 46 852 809 511 GCCTCAATCTGTTGTTTCAG 46 852
- 233190 233190
- 810 520 ACTTGAGCGTGCCCTCTAAT 69 853 810 520 ACTTGAGCGTGCCCTCTAAT 69 853
- 233191 233191
- 809 561 GAAATGGAATTGTAGTTCTC 31 854 809 561 GAAATGGAATTGTAGTTCTC 31 854
Ejemplo 43 Example 43
Inhibición antisentido de la expresión de la apolipoproteína B de conejo por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi - Estudio de dosis y respuesta Antisense Inhibition of Rabbit Apolipoprotein B Expression by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap - Dose and Response Study
Un subconjunto de oligonucleótidos antisentido del ejemplo 42 se investigó más en estudios de dosis y respuesta. A subset of antisense oligonucleotides from Example 42 was further investigated in dose-response studies.
5 Las dosis de tratamiento eran 10, 50, 150 y 300 nM. ISIS 233160 (SEQ ID NO: 824), ISIS 233166 (SEQ ID NO: 830), ISIS 233172 (SEQ ID NO: 835), ISIS 233175 (SEQ ID NO: 838), y ISIS 233183 (SEQ ID NO: 846) se analizaron según su efecto en los niveles de ARNm de la apolipoproteína B de conejo en hepatocitos primarios de conejo por PCR en tiempo real cuantitativa, como se describe en otros ejemplos en la presente memoria. Los datos son medias de dos experimentos y se muestran en la tabla 22. 5 The treatment doses were 10, 50, 150 and 300 nM. ISIS 233160 (SEQ ID NO: 824), ISIS 233166 (SEQ ID NO: 830), ISIS 233172 (SEQ ID NO: 835), ISIS 233175 (SEQ ID NO: 838), and ISIS 233183 (SEQ ID NO: 846) were analyzed for their effect on rabbit apolipoprotein B mRNA levels in primary rabbit hepatocytes by quantitative real-time PCR, as described in other examples herein. Data are means from two experiments and are shown in Table 22.
10 Tabla 22 10 Table 22
Inhibición de los niveles de ARNm de la apolipoproteína B de conejo por oligonucleótidos fosforotioato quiméricos que tienen alas 2'-MOE y un hueco desoxi Inhibition of rabbit apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
- Porcentaje de inhibición Inhibition percentage
- nº de ISIS ISIS number
- 300 nM 150 nM 50 nM 10 nM 300 nM 150 nM 50 nM 10 nM
- 233160 233160
- 80 74 67 33 80 74 67 33
- 233166 233166
- 73 79 81 66 73 79 81 66
- 233172 233172
- 84 81 76 60 84 81 76 60
- 233175 233175
- 93 90 85 67 93 90 85 67
- 233183 233183
- 80 81 71 30 80 81 71 30
Ejemplo 44 Example 44
15 Efectos de la inhibición antisentido de la apolipoproteína B en ratones LDLr-/-- Dosis-Respuesta 15 Effects of Antisense Inhibition of Apolipoprotein B in LDLr - / - Dose-Response Mice
Los ratones deficientes en el receptor de LDL (ratones LDLr(-/-)), una cepa que no puede modificar el ARNm de la apolipoproteína B y por lo tanto sintetiza exclusivamente apolipoproteína B-100, tienen niveles de colesterol LDL y apolipoproteína B-100 notablemente elevados y desarrollan aterosclerosis extensa. Mice deficient in the LDL receptor (LDLr (- / -) mice), a strain that cannot modify apolipoprotein B mRNA and therefore exclusively synthesizes apolipoprotein B-100, have levels of LDL cholesterol and apolipoprotein B- 100 markedly elevated and develop extensive atherosclerosis.
Se usaron ratones LDLr(-/-) adquiridos en Taconic (Germantown, NY) para evaluar el potencial de los LDLr (- / -) mice purchased from Taconic (Germantown, NY) were used to assess the potential of the
20 oligonucleótidos antisentido para disminuir los niveles de ARNm o proteína de apolipoproteína B, así como criterios de valoración fenotípicos asociados con la apolipoproteína B. Los ratones LDLr(-/-) se separaron en grupos de machos y hembras. Se administró a los ratones LDLr(-/-) por vía intraperitoneal, dos veces a la semana durante 6 semanas, 10, 25 ó 50 mg/kg de ISIS 147764 (SEQ ID NO: 109) o ISIS 270906 (SEQ ID NO: 856) que es ISIS 147764 con 4 apareamientos de bases erróneos, o disolución salina o 20 mg/kg de atorvastatina. Al terminar el Antisense oligonucleotides to decrease apolipoprotein B mRNA or protein levels, as well as phenotypic endpoints associated with apolipoprotein B. LDLr (- / -) mice were separated into groups of males and females. Mice were administered LDLr (- / -) intraperitoneally, twice weekly for 6 weeks, 10, 25, or 50 mg / kg of ISIS 147764 (SEQ ID NO: 109) or ISIS 270906 (SEQ ID NO: 856) which is ISIS 147764 with 4 wrong base pairings, or saline or 20 mg / kg atorvastatin. At the end of
25 estudio, los animales se sacrificaron y se evaluaron varios marcadores fenotípicos. In the study, animals were euthanized and various phenotypic markers were evaluated.
ISIS 147764 era capaz de reducir los niveles de colesterol, triglicéridos y ARNm de una forma dependiente de la dosis tanto en los ratones macho como hembra, mientras que ISIS 270906 con 4 apareamientos de bases erróneos no era capaz de hacer esto. Los resultados del estudio se resumen en la tabla 23. ISIS 147764 was able to reduce cholesterol, triglyceride and mRNA levels in a dose-dependent manner in both male and female mice, while ISIS 270906 with 4 base mismatches was unable to do this. The results of the study are summarized in Table 23.
Tabla 23 Table 23
Efectos del tratamiento con ISIS 147764 en ratones LDLr-/- macho y hembra en los niveles de ARNm de la apolipoproteína B, enzimas hepáticas, colesterol y triglicéridos Effects of ISIS 147764 treatment in male and female LDLr - / - mice on levels of apolipoprotein B mRNA, liver enzymes, cholesterol and triglycerides
- Dosis Dose
- Enzimas hepáticas IU/l Lipoproteínas mg/dl % de ARNm control Hepatic enzymes IU / l Lipoproteins mg / dl % of control mRNA
- Nº de ISIS ISIS No.
- mg/kg AST ALT COL. HDL LDL TRIG. mg / kg AST ALT CABBAGE. HDL LDL TRIG.
- Machos Males
- Disolución Salina Saline Dissolution
- 68,4 26,6 279,2 125,4 134,7 170,6 100,0 68.4 26.6 279.2 125.4 134.7 170.6 100.0
- 147764 147764
- 10 57.6 29,8 314,2 150,0 134,7 198,6 61,7 10 57.6 29.8 314.2 150.0 134.7 198.6 61.7
- 25 25
- 112,6 78,8 185,0 110,6 66,2 104,2 30,7 112.6 78.8 185.0 110.6 66.2 104.2 30.7
- 50 fifty
- 163,6 156,8 165,6 107,8 51,2 113,4 16,6 163.6 156.8 165.6 107.8 51.2 113.4 16.6
- 270906 270906
- 50 167,4 348,0 941,0 244,2 541,9 844,8 N.D. fifty 167.4 348.0 941.0 244.2 541.9 844.8 N.D.
- Atorvastatina Atorvastatin
- 20 N.D. N.D. N.D. N.D. N.D. N.D. 110,9 twenty N.D. N.D. N.D. N.D. N.D. N.D. 110.9
- Hembras Females
- Disolución Salina Saline Dissolution
- 65,0 23,4 265,8 105,8 154,9 121,4 100,0 65.0 23.4 265.8 105.8 154.9 121.4 100.0
- 147764 147764
- 1,0 82,0 27,2 269,6 121,0 127,8 140,8 64,2 1.0 82.0 27.2 269.6 121.0 127.8 140.8 64.2
- 25 25
- 61,4 32,2 175,8 99,5 68,9 100,4 41,3 61.4 32.2 175.8 99.5 68.9 100.4 41.3
- 50 fifty
- 134,6 120,4 138,2 92,2 45,9 98,0 18,5 134.6 120.4 138.2 92.2 45.9 98.0 18.5
- 270906 270906
- 50 96,0 88,6 564,6 200,0 310,0 240,4 N.D. fifty 96.0 88.6 564.6 200.0 310.0 240.4 N.D.
- Atorvastatina Atorvastatin
- 20 N.D. N.D. N.D. N.D. N.D. N.D. 109,0 twenty N.D. N.D. N.D. N.D. N.D. N.D. 109.0
5 Ejemplo 45 5 Example 45
Efectos de la inhibición antisentido de la apolipoproteína B en macacos cangrejeros Effects of antisense inhibition of apolipoprotein B in crab-eating macaques
Los macacos cangrejeros alimentados con una dieta aterogénica desarrollan aterosclerosis con muchas similitudes con la aterosclerosis de seres humanos. Los macacos cangrejeros hembra comparten varias similitudes en las lipoproteínas y el sistema cardiovascular con seres humanos. Además de estas características, hay similitudes en la Crabeater macaques fed an atherogenic diet develop atherosclerosis with many similarities to atherosclerosis in humans. Female crab-eating macaques share several similarities in lipoproteins and the cardiovascular system with humans. In addition to these characteristics, there are similarities in
10 biología reproductiva. Las hembras cangrejeras tienen un ciclo menstrual de 28 días como el de las mujeres. Se han medido las concentraciones de hormonas a lo largo del ciclo menstrual de macacos cangrejeros, y la duración de las fases folicular y lútea, así como las concentraciones de estradiol y progesterona en el plasma a lo largo del ciclo, también son notablemente similares a los de las mujeres. 10 reproductive biology. Female crabsmen have a 28-day menstrual cycle like that of women. Hormone concentrations throughout the menstrual cycle of crab-eating macaques have been measured, and the duration of the follicular and luteal phases, as well as plasma estradiol and progesterone concentrations throughout the cycle, are also remarkably similar to those Women's.
Los macacos cangrejeros (machos o hembras) se pueden usar para evaluar el potencial de los oligonucleótidos Crab-eating macaques (male or female) can be used to assess the potential of oligonucleotides
15 antisentido para reducir los niveles de proteína o ARNm de la apolipoproteína B, así como criterios de valoración fenotípicos asociados con la apolipoproteína B incluyendo, pero sin limitar, indicadores cardiovasculares, aterosclerosis, enfermedades lipídicas, obesidad, y formación de placa. Un estudio podía incluir monos hipercolesterolémicos inducidos y normales alimentados con dietas que son normales o con alto contenido en lípidos y colesterol. La administración a los macacos cangrejeros puede ser en una variedad de regímenes, siendo uno por Antisense to reduce apolipoprotein B protein or mRNA levels, as well as phenotypic endpoints associated with apolipoprotein B including, but not limited to, cardiovascular indicators, atherosclerosis, lipid diseases, obesity, and plaque formation. One study could include normal and induced hypercholesterolemic monkeys fed diets that are normal or high in lipids and cholesterol. Administration to crab macaques can be in a variety of regimes, one per
20 vía subcutánea de 10-20 mg/kg de compuesto oligomérico durante 1-2 meses. Los parámetros que se pueden observar durante el periodo de ensayo podrían incluir: colesterol total en el plasma, colesterol LDL, colesterol HDL, triglicéridos, contenido de colesterol en la pared arterial y engrosamiento de la íntima coronaria. 20 subcutaneous route of 10-20 mg / kg of oligomeric compound for 1-2 months. The parameters that can be observed during the test period could include: total plasma cholesterol, LDL cholesterol, HDL cholesterol, triglycerides, cholesterol content in the arterial wall and thickening of the coronary intima.
Ejemplo 46 Example 46
Secuenciación del segmento diana preferido de la apolipoproteína B de macacos cangrejeros (Macaca fascicularis) Sequencing of the preferred target segment of apolipoprotein B from crab-eating macaques (Macaca fascicularis)
25 Se amplificó una parte del ARNm de la apolipoproteína B de macaco cangrejero que no está disponible en la técnica. Las posiciones de 2920 a 3420 de la secuencia de ARNm de la apolipoproteína B humana (número de acceso en GenBank NM_000384.1, incorporada en la presente memoria como SEQ ID NO: 3) contienen el segmento diana preferido con el cual hibrida ISIS 301012 y se amplificó y secuenció el correspondiente segmentos del ARNm de la apolipoproteína B del macaco cangrejero. El sitio con el que hibrida ISIS 301012 en la A portion of the crab-eating macaque apolipoprotein B mRNA that is not available in the art was amplified. Positions 2920 to 3420 of the human apolipoprotein B mRNA sequence (GenBank accession number NM_000384.1, incorporated herein as SEQ ID NO: 3) contain the preferred target segment with which it hybridizes ISIS 301012 and the corresponding segments of the crab-eating macaque apolipoprotein B mRNA were amplified and sequenced. The site with which ISIS 301012 hybridizes in the
30 apolipoproteína B humana se amplificó poniendo los cebadores 5' en la posición 2920 y 3' en la posición 3420. Se adquirieron hepatocitos de macaco cangrejero en In Vitro Technologies (Gaithersburg, MD). Se produjeron fragmentos de 500 pb usando ADNc de hepatocitos 1º humanos y de macaco cangrejero y se produjeron por transcripción inversa del ARN total seguido de 40 ciclos de amplificación por PCR. Después de la purificación en gel de los amplicones humano y de macaco cangrejero, se realizaron las reacciones de secuenciación directa e inversa Human apolipoprotein B was amplified by setting the 5 'primers at position 2920 and 3' at position 3420. Crab macaque hepatocytes were purchased from In Vitro Technologies (Gaithersburg, MD). Fragments of 500 bp were produced using cDNAs from human 1st hepatocytes and crab-eating macaque and were produced by reverse transcription of total RNA followed by 40 cycles of PCR amplification. After gel purification of the human and crab-eating macaque amplicons, forward and reverse sequencing reactions were performed
35 de cada producto mediante Retrogen (se usó el kit de Invitrogen para crear el ADN, monocatenario y proporcionar los reactivos para la reacción de PCR con Amplitaq). La secuencia del macaco cangrejero se incorpora en la presente memoria como SEQ ID NO: 855 y es idéntica en el 96% a las posiciones de 2920 a 3420 del ARNm de la apolipoproteína B humana. 35 of each product by Retrogen (the Invitrogen kit was used to create the DNA, single-stranded and to provide the reagents for the PCR reaction with Amplitaq). The crab-eating macaque sequence is incorporated herein as SEQ ID NO: 855 and is 96% identical to the 2920 to 3420 positions of human apolipoprotein B mRNA.
Ejemplo 47 Example 47
Efectos de la inhibición antisentido del gen de la apolipoproteína B (ISIS 281625 y 301012) en ratones transgénicos C57BL/6NTac-TgN(APOB100) Effects of antisense inhibition of the apolipoprotein B gene (ISIS 281625 and 301012) in C57BL / 6NTac-TgN transgenic mice (APOB100)
Los ratones transgénicos C57BL/6NTac-TgN(APOB100) tienen el gen de la apolipoproteína B humana "introducido de sustitución". Estos ratones expresan niveles altos de la apolipoproteína B100 humana que da como resultado ratones con niveles elevados en el suero de colesterol LDL. Estos ratones son útiles para identificar y evaluar compuestos para reducir los niveles elevados de colesterol LDL y el riesgo de aterosclerosis. Cuando se alimentaron con una dieta alta en grasa y colesterol, estos ratones desarrollan una acumulación lipídica significativa debajo del endotelio y en la media, y tienen lesiones ateroscleróticas significativamente más complejas que los animales de control. Transgenic C57BL / 6NTac-TgN mice (APOB100) have the human apolipoprotein B gene "introduced by replacement." These mice express high levels of human apolipoprotein B100 resulting in mice with elevated serum LDL cholesterol levels. These mice are useful for identifying and evaluating compounds to reduce elevated LDL cholesterol levels and the risk of atherosclerosis. When fed a diet high in fat and cholesterol, these mice develop significant lipid accumulation below the endothelium and in the median, and have significantly more complex atherosclerotic lesions than control animals.
Los ratones C57BL/6NTac-TgN(APOB100) se dividieron en dos grupos, un grupo que recibía el tratamiento con oligonucleótido y los animales de control que recibían tratamiento con disolución salina. Después de ayunar durante la noche, se administró a los ratones por vía intraperitoneal dos veces por semana, disolución salina o 25 mg/kg de ISIS 281625 (SEQ ID No: 224) o ISIS 301012 (SEQ ID No: 247) durante 8 semanas. Al terminar el estudio y 48 h después de las inyecciones finales, los animales se sacrificaron y se evaluaron los niveles de ARNm diana en el hígado, niveles de colesterol y triglicéridos y niveles de enzimas hepáticas. Además, se midieron los niveles de apolipoproteína B endógena de ratón en el hígado para evaluar cualquier efecto de los oligonucleótidos antisentido dirigidos a la apolipoproteína B humana. The C57BL / 6NTac-TgN (APOB100) mice were divided into two groups, one group receiving the oligonucleotide treatment and the control animals receiving the saline treatment. After fasting overnight, mice were intraperitoneally administered twice weekly with saline or 25 mg / kg ISIS 281625 (SEQ ID No: 224) or ISIS 301012 (SEQ ID No: 247) for 8 weeks. . At the end of the study and 48 h after the final injections, the animals were sacrificed and the target mRNA levels in the liver, cholesterol and triglyceride levels and liver enzyme levels were evaluated. In addition, liver endogenous mouse apolipoprotein B levels were measured to assess any effects of antisense oligonucleotides targeting human apolipoprotein B.
Tras el tratamiento con ISIS 281625 o ISIS 301012, los niveles de AST y ALT eran mayores, aunque todavía no superaban los valores normales (∀300 IU/l). Los niveles de colesterol eran ligeramente mayores con respecto al tratamiento con disolución salina, mientras que los niveles de triglicéridos eran ligeramente menores. El tratamiento con cualquiera de esos oligonucleótidos dirigidos a la apolipoproteína B humana que es expresada en estos ratones, disminuyó notablemente los niveles de ARNm de la apolipoproteína humana, mientras que los niveles de la apolipoproteína B endógena de ratón no se afectaron, indicando que estos oligonucleótidos presentan especificidad por la apolipoproteína B humana. Los resultados de los estudios comparativos se muestran en la tabla 24. After treatment with ISIS 281625 or ISIS 301012, AST and ALT levels were higher, although they still did not exceed normal values (∀300 IU / l). Cholesterol levels were slightly higher compared to saline treatment, while triglyceride levels were slightly lower. Treatment with any of those oligonucleotides targeting human apolipoprotein B that is expressed in these mice markedly decreased levels of human apolipoprotein mRNA, whereas levels of endogenous mouse apolipoprotein B were unaffected, indicating that these oligonucleotides they have specificity for human apolipoprotein B. The results of the comparative studies are shown in Table 24.
Tabla 24 Table 24
Efectos del tratamiento con ISIS 281625 y 301012 en ratones en los niveles de ARNm de la apolipoproteína B, enzimas hepáticas, colesterol y triglicéridos. Effects of treatment with ISIS 281625 and 301012 in mice on apolipoprotein B mRNA levels, liver enzymes, cholesterol and triglycerides.
- Nº de ISIS ISIS No.
- Disolución salina Saline dissolution
- 281625 301012 281625 301012
- Enzimas hepáticas IU/l Hepatic enzymes IU / l
- AST AST
- 70,3 265,8 208,4 70.3 265.8 208.4
- ALT ALT
- 32,8 363,8 137,4 32.8 363.8 137.4
- Lipoproteínas mg/dl Lipoproteins mg / dl
- COL. CABBAGE.
- 109,5 152,0 145,1 109.5 152.0 145.1
- HDL HDL
- 67,3 84.6 98,6 67.3 84.6 98.6
- LDL LDL
- 30,2 49,8 36,6 30.2 49.8 36.6
- TRIG. TRIG.
- 194,5 171,1 157,8 194.5 171.1 157.8
- % de ARNm control % of control mRNA
- ARNm humano Human mRNA
- 100,0 45,2 23,7 100.0 45.2 23.7
- ARNm de ratón Mouse mRNA
- 100,0 111,0 94,6 100.0 111.0 94.6
Después de 2 y 4 semanas de tratamiento con ISIS 301012, los niveles de colesterol LDL se redujeron significativamente a 22 mg/dl y 17 mg/dl, respectivamente. After 2 and 4 weeks of treatment with ISIS 301012, LDL cholesterol levels were significantly reduced to 22 mg / dl and 17 mg / dl, respectively.
Los niveles de la proteína apolipoproteína B en el hígado también se evaluaron al final del periodo de tratamiento de 8 semanas. Se aisló la proteína hepática y se sometió a análisis de inmunotransferencia usando anticuerpos específicos para la proteína apolipoproteína B humana o de ratón (US Biologicals, Swampscott, MA y Santa Cruz Biotechnology, Inc., Santa Cruz, CA, respectivamente). El análisis de inmunotransferencia de las muestras de proteínas hepáticas puso de manifiesto una reducción de la expresión de ambas formas de apolipoproteína B humana, la apolipoproteína B-100 y la apolipoproteína B-48. Los niveles de apolipoproteína B de ratón en el hígado no habían cambiado significativamente, de acuerdo con el análisis de inmunotransferencia. Apolipoprotein B protein levels in the liver were also assessed at the end of the 8-week treatment period. Liver protein was isolated and subjected to immunoblot analysis using antibodies specific for mouse or human apolipoprotein B protein (US Biologicals, Swampscott, MA and Santa Cruz Biotechnology, Inc., Santa Cruz, CA, respectively). Immunoblot analysis of liver protein samples revealed reduced expression of both forms of human apolipoprotein B, apolipoprotein B-100 and apolipoprotein B-48. The levels of mouse apolipoprotein B in the liver had not changed significantly, according to the immunoblot analysis.
También se recogieron muestras de suero a las 2, 4, 6 y 8 semanas y se evaluó la expresión de la apolipoproteína B usando un kit de ELISA específico para la apolipoproteína B humana (ALerCHEK Inc., Portland, ME). La cuantificación de la proteína apolipoproteína B humana en el suero por ELISA puso de manifiesto que el tratamiento con ISIS 281625 reducía la proteína apolipoproteína B humana en el suero en 31, 26, 11 y 26% a las 2, 4, 6 y 8 Serum samples were also collected at 2, 4, 6, and 8 weeks and apolipoprotein B expression was assessed using an ELISA kit specific for human apolipoprotein B (ALerCHEK Inc., Portland, ME). ELISA quantification of human apolipoprotein B protein in serum revealed that treatment with ISIS 281625 reduced human apolipoprotein B protein in serum by 31, 26, 11, and 26% at 2, 4, 6, and 8
semanas, respectivamente, con respecto a los animales tratados con disolución salina. El tratamiento con ISIS 301012 redujo la proteína apolipoproteína B humana en el suero en 70, 87, 81 y 41% a las 2, 4, 6 y 8 semanas, respectivamente, con respecto a los animales de control tratados con disolución salina. El suero de los ratones transgénicos también se sometió a análisis de inmunotransferencia usando anticuerpos específicos contra 5 apolipoproteína B tanto humana como de ratón (US Biologicals, Swampscott, MA y Santa Cruz Biotechnology, Inc., Santa Cruz, CA, respectivamente). El análisis de inmunotransferencia de las muestras de suero tomadas de los animales, muestra un patrón similar de expresión de la apolipoproteína B humana, con una reducción significativa en el suero de la proteína apolipoproteína B después de 2, 4 y 6 semanas de tratamiento y una ligera reducción a las 8 semanas. La apolipoproteína B de ratón en el suero no cambió significativamente, de acuerdo con el análisis de weeks, respectively, with respect to the animals treated with saline solution. Treatment with ISIS 301012 reduced human apolipoprotein B protein in serum by 70, 87, 81, and 41% at 2, 4, 6, and 8 weeks, respectively, relative to control animals treated with saline. The serum from the transgenic mice was also subjected to immunoblot analysis using specific antibodies against both human and mouse apolipoprotein B (US Biologicals, Swampscott, MA and Santa Cruz Biotechnology, Inc., Santa Cruz, CA, respectively). Immunoblot analysis of serum samples taken from animals shows a similar pattern of expression of human apolipoprotein B, with a significant reduction in serum of apolipoprotein B protein after 2, 4, and 6 weeks of treatment and a slight reduction at 8 weeks. Mouse apolipoprotein B in serum did not change significantly, according to the analysis of
10 inmunotransferencia. 10 immunoblot.
Ejemplo 48 Example 48
Efectos de la inhibición antisentido de la apolipoproteína B (ISIS 233172, 233175, 281625, 301012, y 301027) en ratones C57BL/6 Effects of antisense inhibition of apolipoprotein B (ISIS 233172, 233175, 281625, 301012, and 301027) in C57BL / 6 mice
Los ratones C57BL/6, una cepa presentada como susceptible a la formación de placa aterosclerótica inducida por C57BL / 6 mice, a strain presented as susceptible to atherosclerotic plaque formation induced by
15 hiperlipidemia, se usaron en los siguientes estudios para evaluar la toxicidad en ratones de varios oligonucleótidos antisentido dirigidos a la apolipoproteína B humana o de ratón. Hyperlipidemia was used in the following studies to assess the toxicity in mice of various antisense oligonucleotides targeting mouse or human apolipoprotein B.
Los ratones C57BL/6 se dividieron en dos grupos, uno que recibía tratamiento con oligonucleótido y animales de control que recibían tratamiento con disolución salina. Después de ayunar durante la noche, se administró a los ratones por vía intraperitoneal dos veces por semana, disolución salina o 25 mg/kg de uno de varios oligonucleótidos C57BL / 6 mice were divided into two groups, one receiving oligonucleotide treatment and control animals receiving saline treatment. After fasting overnight, mice were intraperitoneally administered twice weekly with saline or 25 mg / kg of one of several oligonucleotides.
20 durante 2 semanas. Los oligonucleótidos antisentido usados en el presente estudio eran ISIS 233172 (SEQ ID NO: 835) y ISIS 233175 (SEQ ID NO: 838), ambos dirigidos a la apolipoproteína B de conejo, y ISIS 281625 (SEQ ID NO: 224), ISIS 301012 (SEQ ID NO: 247), y ISIS 301027 (SEQ ID NO: 262), dirigidos a la apolipoproteína B humana. Al terminar el estudio y 48 h después de las inyecciones finales, los animales se sacrificaron y se evaluaron los niveles de enzimas hepáticas, peso corporal, peso del hígado, y peso del bazo. 20 for 2 weeks. The antisense oligonucleotides used in the present study were ISIS 233172 (SEQ ID NO: 835) and ISIS 233175 (SEQ ID NO: 838), both targeting rabbit apolipoprotein B, and ISIS 281625 (SEQ ID NO: 224), ISIS 301012 (SEQ ID NO: 247), and ISIS 301027 (SEQ ID NO: 262), targeting human apolipoprotein B. At the end of the study and 48 h after the final injections, the animals were euthanized and liver enzyme levels, body weight, liver weight, and spleen weight were evaluated.
25 Los niveles de las enzimas hepáticas en ratones eran menores con respecto al tratamiento con disolución salina para tres de los oligonucleótidos antisentido. Sin embargo, el oligonucleótido para conejo ISIS 233175 y el oligonucleótido para ser humano ISIS 301027 produjeron ambos niveles drásticamente mayores de las enzimas hepáticas, indicando toxicidad. Para todos los oligonucleótidos ensayados, el cambio en el peso corporal, del hígado y bazo era pequeño. Los resultados de los estudios comparativos se muestran en la tabla 25. 25 Liver enzyme levels in mice were lower with respect to saline treatment for three of the antisense oligonucleotides. However, rabbit oligonucleotide ISIS 233175 and human oligonucleotide ISIS 301027 both produced dramatically higher levels of liver enzymes, indicating toxicity. For all oligonucleotides tested, the change in body, liver and spleen weight was small. The results of the comparative studies are shown in Table 25.
30 Tabla 25 30 Table 25
Efectos de los oligonucleótidos antisentido dirigidos a la apolipoproteína B humana o de ratón en los niveles de ARNm de la apolipoproteína B, enzimas hepáticas, colesterol y triglicéridos. Effects of mouse or human apolipoprotein B antisense oligonucleotides on levels of apolipoprotein B mRNA, liver enzymes, cholesterol and triglycerides.
- Nº de ISIS ISIS No.
- Disolución salina Saline dissolution
- 233172 233175 281625 301012 301027 233172 233175 281625 301012 301027
- Enzimas hepáticas Hepatic enzymes
- AST IU/l AST IU / l
- 104,5 94,3 346,7 89,5 50,6 455,3 104.5 94.3 346.7 89.5 50.6 455.3
- ALT IU/l ALT IU / l
- 39,5 43,3 230.2 36,2 21,2 221,3 39.5 43.3 230.2 36.2 21.2 221.3
- Peso corporal Body weight
- 21,2 21,3 21,5 20,9 21,3 21,2 21.2 21.3 21.5 20.9 21.3 21.2
- Hígado Liver
- 1,1 1,3 1,4 1,2 1,1 1,3 1.1 1.3 1.4 1.2 1.1 1.3
- Bazo Spleen
- 0,1 0,1 0,1 0,1 0,1 0,1 0.1 0.1 0.1 0.1 0.1 0.1
Ejemplo 49 Example 49
35 Evaluación de la evolución del oligonucleótido con dos dosis diferentes 35 Evaluation of the evolution of the oligonucleotide with two different doses
Los ratones C57BL/6, una cepa presentada como susceptible a la formación de placa aterosclerótica inducida por hiperlipidemia, se usaron en los siguientes estudios para evaluar la toxicidad en ratones de varios oligonucleótidos antisentido dirigidos a la apolipoproteína B humana. C57BL / 6 mice, a strain presented as susceptible to hyperlipidemia-induced atherosclerotic plaque formation, were used in the following studies to assess the toxicity in mice of various antisense oligonucleotides targeting human apolipoprotein B.
Los ratones hembra C57BL/6 se dividieron en dos grupos, uno que recibía tratamiento con oligonucleótido y Female C57BL / 6 mice were divided into two groups, one receiving oligonucleotide treatment and
40 animales de control que recibían tratamiento con disolución salina. Después de ayunar durante la noche, se administró a los ratones por vía intraperitoneal dos veces por semana, disolución salina o 25 mg/kg o 50 mg/kg de ISIS 281625 (SEQ ID No: 224), ISIS 301012 (SEQ ID NO: 247), o ISIS 301027 (SEQ ID NO: 262). Después de 2 semanas, se tomó una muestra de sangre de la cola de los ratones y se evaluaron las enzimas hepáticas. Después de 4 semanas y al terminar el estudio, los animales se sacrificaron y se evaluaron los niveles de enzimas hepáticas. 40 control animals receiving saline treatment. After fasting overnight, mice were intraperitoneally administered twice weekly with saline or 25 mg / kg or 50 mg / kg ISIS 281625 (SEQ ID No: 224), ISIS 301012 (SEQ ID NO: 247), or ISIS 301027 (SEQ ID NO: 262). After 2 weeks, a blood sample was taken from the tail of the mice and liver enzymes were evaluated. After 4 weeks and at the end of the study, the animals were euthanized and liver enzyme levels were assessed.
45 Para ISIS 281625 y ISIS 301012, los niveles de AST y ALT permanecieron cercanos a los de la disolución salina, con cualquiera de las dosis después de 2 semanas. Después 4 semanas, los niveles de AST y ALT mostraron un aumento moderado frente a los animales tratados con disolución salina para la dosis más baja, pero un aumento grande para la dosis más alta. ISIS 301027, administrado con cualquiera de las dosis, mostró un pequeño aumento de los niveles de AST y ALT después de 2 semanas y un gran aumento de los niveles de AST y ALT después de 4 semanas. Los resultados de los estudios se resumen en la tabla 26. 45 For ISIS 281625 and ISIS 301012, AST and ALT levels remained close to those of the saline solution, with either dose after 2 weeks. After 4 weeks, AST and ALT levels showed a moderate increase compared to animals treated with saline for the lowest dose, but a large increase for the highest dose. ISIS 301027, administered with either dose, showed a small increase in AST and ALT levels after 2 weeks and a large increase in AST and ALT levels after 4 weeks. The results of the studies are summarized in Table 26.
Tabla 26 Table 26
Niveles de AST y ALT en ratones tratados con ISIS 281625, 301012 ó 301027 después de 2 y 4 semanas AST and ALT levels in mice treated with ISIS 281625, 301012 or 301027 after 2 and 4 weeks
- AST (IU/l) AST (IU / l)
- ALT (IU/l) ALT (IU / l)
- 2 semanas 2 weeks
- 4 semanas 2 semanas 4 semanas 4 weeks 2 weeks 4 weeks
- Disolución salina Saline dissolution
- 49,6 63,2 22,4 25,2 49.6 63.2 22.4 25.2
- Nº de ISIS ISIS No.
- Dosis (mg/kg) Dose (mg / kg)
- 281625 281625
- 25 40,8 75 21,2 31,8 25 40.8 75 21.2 31.8
- 50 fifty
- 44,4 152,4 30,8 210,4 44.4 152.4 30.8 210.4
- 301012 301012
- 25 37,2 89,8 22,4 24,8 25 37.2 89.8 22.4 24.8
- 50 fifty
- 38,4 107.4 23,2 29,2 38.4 107.4 23.2 29.2
- 301027 301027
- 25 55,4 537,6 27,2 311,2 25 55.4 537.6 27.2 311.2
- 50 fifty
- 64 1884 34,8 1194 64 1884 34.8 1194
Ejemplo 50 Example 50
Efectos de la inhibición antisentido de la apolipoproteína B (ISIS 147483 y 147764) en ratones ob/ob Effects of antisense inhibition of apolipoprotein B (ISIS 147483 and 147764) in ob / ob mice
10 La leptina es una hormona producida por la grasa que regula el apetito. Las deficiencias en esta hormona tanto en seres humanos como en animales no humanos, conduce a la obesidad. Los ratones ob/ob tienen una mutación en el gen de la leptina que da como resultado leptina e hiperglucemia. Como tal, estos ratones son un modelo útil para la investigación de la obesidad y la diabetes, y los tratamientos diseñados para tratar estas afecciones. 10 Leptin is a hormone produced by fat that regulates appetite. Deficiencies in this hormone in both humans and non-human animals leads to obesity. The ob / ob mice have a mutation in the leptin gene that results in leptin and hyperglycemia. As such, these mice are a useful model for obesity and diabetes research, and treatments designed to treat these conditions.
Ratones ob/ob que recibía una dieta alta en grasa, alta en colesterol (60% de kcal de grasa complementada con Ob / ob mice receiving a high-fat, high-cholesterol diet (60% kcal of fat supplemented with
15 0,15% de colesterol) se trataron con uno de los varios oligonucleótidos para evaluar su efecto en los criterios de valoración fenotípicos relacionados con la apolipoproteína B en ratones ob/ob. Después de ayunar durante la noche, se administró a los ratones de cada grupo por vía intraperitoneal, dos veces por semana, 50 mg/kg de ISIS 147483 (SEQ ID No: 79) o 147764 (SEQ ID NO: 109) o los controles ISIS 116847 (SEQ ID NO: 857) o 141923 (SEQ ID NO: 858) o disolución salina, durante 6 semanas. Al terminar el estudio y 48 h después de las inyecciones finales, los 0.15% cholesterol) were treated with one of several oligonucleotides to assess their effect on apolipoprotein B-related phenotypic endpoints in ob / ob mice. After fasting overnight, mice in each group were administered intraperitoneally, twice weekly, 50 mg / kg of ISIS 147483 (SEQ ID No: 79) or 147764 (SEQ ID NO: 109) or controls ISIS 116847 (SEQ ID NO: 857) or 141923 (SEQ ID NO: 858) or saline, for 6 weeks. At the end of the study and 48 h after the final injections, the
20 animales se sacrificaron y se evaluaron los niveles de ARNm diana en el hígado, niveles de colesterol y triglicéridos, niveles de enzimas hepáticas, niveles de glucosa en el suero y niveles de PTEN. 20 animals were euthanized and target mRNA levels in the liver, cholesterol and triglyceride levels, liver enzyme levels, serum glucose levels and PTEN levels were evaluated.
ISIS 147483 y 147764 ambos eran capaces de disminuir los niveles de ARNm de la apolipoproteína B, así como los niveles de glucosa, colesterol y triglicéridos. Los resultados de los estudios comparativos se muestran en la tabla 27. ISIS 147483 and 147764 both were able to decrease apolipoprotein B mRNA levels, as well as glucose, cholesterol and triglyceride levels. The results of the comparative studies are shown in Table 27.
Tabla 27 Table 27
25 Efectos del tratamiento con ISIS 147483 y 147764 en ratones ob/ob en los niveles de ARNm de apolipoproteína B, colesterol, lípidos, triglicéridos, enzimas hepáticas, glucosa y PTEN. 25 Effects of treatment with ISIS 147483 and 147764 in ob / ob mice on apolipoprotein B mRNA levels, cholesterol, lipids, triglycerides, liver enzymes, glucose and PTEN.
- Nº de ISIS ISIS No.
- Disolución salina Saline dissolution
- 116847 141923 147483 147764 116847 141923 147483 147764
- Glucosa mg/dl Glucose mg / dl
- 269,6 135,5 328,5 213,2 209,2 269.6 135.5 328.5 213.2 209.2
- Enzimas hepáticas Hepatic enzymes
- IU/l IU / l
- AST 422,3 343,2 329,3 790,2 406,5 AST 422.3 343.2 329.3 790.2 406.5
- ALT ALT
- 884,3 607,5 701,7 941,7 835,0 884.3 607.5 701.7 941.7 835.0
- Lipoproteínas Lipoproteins
- mg/dl mg / dl
- COL. 431,9 287,5 646,3 250,0 286,3 CABBAGE. 431.9 287.5 646.3 250.0 286.3
- TRIG. TRIG.
- 128,6 196,5 196,5 99,8 101,2 128.6 196.5 196.5 99.8 101.2
- ARNm MRNA
- % del control % of control
- ApoB ApoB
- 100,0 77,0 100,0 25,2 43,1 100.0 77.0 100.0 25.2 43.1
- PTEN PTEN
- 100,0 20,0 113,6 143,2 115.3 100.0 20.0 113.6 143.2 115.3
Ejemplo 51 Example 51
Inhibición antisentido de la apolipoproteína B en ratones alimentados con dieta alta en grasa: efectos dependientes del tiempo Antisense inhibition of apolipoprotein B in mice fed a high-fat diet: time-dependent effects
En una realización adicional de la invención, se comparó la inhibición del ARNm de la apolipoproteína B en ratones In a further embodiment of the invention, inhibition of apolipoprotein B mRNA in mice was compared
5 con la concentración de oligonucleótido en el hígado, colesterol total, colesterol LDL y colesterol HDL. Se evaluaron ratones macho C57B1/6 que recibían una dieta con alto contenido en grasa (60% de grasa) a lo largo del curso de 6 semanas, con inyecciones por vía intraperitoneal dos veces por semana, de 50 mg/kg de ISIS 147764 (SEQ ID NO: 109) o 50 mg/kg del oligonucleótido de control ISIS 141923 (SEQ ID NO: 858). Los animales de control recibieron tratamiento con disolución salina. Los animales se sacrificaron después de 2 días, 1, 2, 4 y 6 semanas de 5 with the concentration of oligonucleotide in the liver, total cholesterol, LDL cholesterol and HDL cholesterol. Male C57B1 / 6 mice receiving a high fat (60% fat) diet were evaluated throughout the course of 6 weeks, with intraperitoneal injections twice a week of 50 mg / kg of ISIS 147764 ( SEQ ID NO: 109) or 50 mg / kg of the control oligonucleotide ISIS 141923 (SEQ ID NO: 858). Control animals received saline treatment. Animals were sacrificed after 2 days, 1, 2, 4 and 6 weeks of
10 tratamiento. Cada grupo de tratamiento en cada tiempo de medición consistía en 8 ratones. 10 treatment. Each treatment group at each measurement time consisted of 8 mice.
La expresión de la diana en el hígado se midió por la PCR en tiempo real como se ha descrito por otros ejemplos en la presente memoria y se expresa como porcentaje de inhibición con respecto a los ratones tratados con disolución salina. Los niveles de colesterol total, LDL y HDL se midieron por análisis clínico rutinario usando un analizador clínico Olympus (Olympus America Inc., Melville, NY) y se presentan en mg/dl. Los resultados de los animales Target expression in the liver was measured by real-time PCR as described by other examples herein and is expressed as percent inhibition relative to mice treated with saline. Total, LDL and HDL cholesterol levels were measured by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY) and are reported in mg / dl. Animal results
15 tratados con disolución salina se muestran para la comparación. El oligonucleótido intacto en el tejido hepático se midió por electroforesis en gel capilar y se presenta como microgramos de oligonucleótidos por gramo de tejido. Todos los resultados son la media de 8 animales y se muestran en la tabla 28. 15 treated with saline are shown for comparison. The intact oligonucleotide in liver tissue was measured by capillary gel electrophoresis and is presented as micrograms of oligonucleotides per gram of tissue. All results are the mean of 8 animals and are shown in Table 28.
Tabla 28 Table 28
Correlación entre la concentración de fármaco en el hígado, la expresión de ARNm de la apolipoproteína B y los 20 lípidos en el suero durante el tratamiento con ISIS 147764 Correlation between drug concentration in the liver, apolipoprotein B mRNA expression and 20 lipids in serum during treatment with ISIS 147764
- Periodo de tratamiento Treatment period
- nº de ISIS ISIS number
- 2 días 1 semana 2 semanas 4 semanas 6 semanas 2 days 1 week 2 weeks 4 weeks 6 weeks
- % de inhibición del ARNm de la apolipoproteína B % inhibition of apolipoprotein B mRNA
- 141923 9 4 7 0 0 141923 9 4 7 0 0
- 147764 147764
- 50 57 73 82 88 fifty 57 73 82 88
- Oligonucleótido intacto !g/g Intact oligonucleotide! G / g
- 141923 58 61 152 261 631 141923 58 61 152 261 631
- 147764 147764
- 85 121 194 340 586 85 121 194 340 586
- Colesterol total mg/dl Total cholesterol mg / dl
- disolución salina 105 152 144 180 191 saline solution 105 152 144 180 191
- 141923 141923
- 99 146 152 169 225 99 146 152 169 225
- 147764 147764
- 101 128 121 75 73 101 128 121 75 73
- Colesterol LDL LDL cholesterol
- disolución salina 8 32 28 50 46 saline solution 8 32 28 fifty 46
- mg/dl mg / dl
- 141923 8 27 27 38 56 141923 8 27 27 38 56
- 147764 147764
- 7 19 14 7 7 7 19 14 7 7
- Colesterol HDL mg/dl HDL cholesterol mg / dl
- disolución salina 74 117 114 127 141 saline solution 74 117 114 127 141
- 141923 141923
- 70 116 122 128 166 70 116 122 128 166
- 147764 147764
- 76 107 105 66 64 76 107 105 66 64
Estos resultados ilustran que la inhibición del ARNm de la apolipoproteína B por ISIS 147764 ocurría en el espacio de 2 días de tratamiento, aumentaba con los tratamientos sucesivos y persistía durante 6 semanas de tratamiento. La cuantificación de los niveles de oligonucleótido en el hígado pone de manifiesto una fuerte correlación entre la 25 extensión de la inhibición de la diana y la concentración de fármaco en el hígado. Además, a las 1, 2, 3 y 4 semanas de tratamiento, se observa una correlación inversa entre la inhibición del ARNm diana y los niveles de colesterol (total, HDL y LDL), disminuyendo los niveles de colesterol al hacerse mayores el porcentaje de inhibición del ARNm de la apolipoproteína B. Las muestras de suero se sometieron a análisis de inmunotransferencia usando un anticuerpo para detectar la proteína apolipoproteína B de ratón (Gladstone Institute, San Francisco, CA). La These results illustrate that the inhibition of apolipoprotein B mRNA by ISIS 147764 occurred within 2 days of treatment, increased with successive treatments, and persisted for 6 weeks of treatment. Quantification of oligonucleotide levels in the liver reveals a strong correlation between the extent of target inhibition and the concentration of drug in the liver. In addition, at 1, 2, 3 and 4 weeks of treatment, an inverse correlation is observed between inhibition of the target mRNA and cholesterol levels (total, HDL and LDL), decreasing cholesterol levels as the percentage of inhibition of apolipoprotein B mRNA. Serum samples were subjected to immunoblot analysis using an antibody to detect mouse apolipoprotein B protein (Gladstone Institute, San Francisco, CA). The
30 expresión de la proteína sigue el mismo patrón que el del ARNm, con la proteína apolipoproteína B notablemente reducida en el espacio de 48 h y disminuida a lo largo del periodo de tratamiento de 6 semanas. The expression of the protein follows the same pattern as that of the mRNA, with the protein apolipoprotein B markedly reduced in the space of 48 h and decreased throughout the 6-week treatment period.
Los tratamientos con oligonucleótido descritos en este ejemplo se hicieron por duplicado para investigar la extensión con la que persisten los efectos de ISIS 147764 después de cesar el tratamiento. Los ratones se trataron como se ha descrito, y se sacrificaron 1, 2, 4, 6 y 8 semanas después de cesar el tratamiento con oligonucleótido. Se The oligonucleotide treatments described in this example were done in duplicate to investigate the extent to which the effects of ISIS 147764 persist after cessation of treatment. Mice were treated as described, and were sacrificed 1, 2, 4, 6, and 8 weeks after cessation of oligonucleotide treatment. I know
35 analizaron los mismos parámetros y los resultados se muestran en la tabla 29. 35 analyzed the same parameters and the results are shown in Table 29.
Tabla 29 Table 29
Correlación entre la concentración de fármaco en el hígado, expresión de ARNm de la apolipoproteína B y lípidos en el suero después de cesar la dosificación Correlation between drug concentration in the liver, expression of apolipoprotein B mRNA and lipids in serum after dosing ceased
- Periodo de tratamiento Treatment period
- nº de ISIS ISIS number
- 1 semana 2 semanas 4 semanas 6 semanas 8 semanas 1 week 2 weeks 4 weeks 6 weeks 8 weeks
- % de inhibición del ARNm de la apolipoproteína B % inhibition of apolipoprotein B mRNA
- 141923 15 2 7 11 7 141923 fifteen 2 7 eleven 7
- 147764 147764
- 82 78 49 37 19 82 78 49 37 19
- Oligonucleótido intacto ug/g Intact oligonucleotide ug / g
- 141923 297 250 207 212 128 141923 297 250 207 212 128
- 147764 147764
- 215 168 124 70 43 215 168 124 70 43
- Colesterol total mg/dl Total cholesterol mg / dl
- disolución salina 114 144 195 221 160 saline solution 114 144 195 221 160
- 141923 141923
- 158 139 185 186 151 158 139 185 186 151
- 147764 147764
- 69 67 111 138 135 69 67 111 138 135
- Colesterol LDL mg/dl LDL cholesterol mg / dl
- disolución salina 21 24 34 37 22 saline solution twenty-one 24 3. 4 37 22
- 141923 141923
- 24 24 32 32 24 24 24 32 32 24
- 147764 147764
- 14 14 18 24 21 14 14 18 24 twenty-one
- Colesterol HDL mg/dl HDL cholesterol mg / dl
- disolución salina 86 109 134 158 117 saline solution 86 109 134 158 117
- 141923 141923
- 121 105 135 136 108 121 105 135 136 108
- 147764 147764
- 51 49 79 100 94 51 49 79 100 94
Estos datos demuestran que tras terminar el tratamiento con el oligonucleótido, los efectos de ISIS 147764, incluyendo la inhibición del ARNm de la apolipoproteína B, y disminución del colesterol, persisten durante hasta 8 semanas. Los análisis de inmunotransferencia demuestran que la proteína apolipoproteína B sigue un patrón similar al observado para los niveles de expresión del ARNm. These data demonstrate that upon termination of the oligonucleotide treatment, the effects of ISIS 147764, including inhibition of apolipoprotein B mRNA, and decreased cholesterol, persist for up to 8 weeks. Immunoblot analyzes demonstrate that the apolipoprotein B protein follows a similar pattern to that observed for mRNA expression levels.
Ejemplo 52 Example 52
Efectos de la inhibición antisentido del gen de la apolipoproteína B humana por 301012 en ratones transgénicos C57BL/6NTac-TgN(APOB100): estudio de la dosificación Effects of antisense inhibition of the human apolipoprotein B gene by 301012 in C57BL / 6NTac-TgN transgenic mice (APOB100): study of dosage
Los ratones transgénicos C57BL/6NTac-TgN(APOB100) tienen el gen de la apolipoproteína B humana "introducido de sustitución". Estos ratones expresan niveles altos de la apolipoproteína B humana que da como resultado ratones con niveles elevados en el suero de colesterol LDL. Estos ratones son útiles para identificar y evaluar compuestos para reducir los niveles elevados de colesterol LDL y el riesgo de aterosclerosis. Cuando se alimentaron con una dieta alta en grasa y colesterol, estos ratones desarrollan una acumulación lipídica significativa debajo del endotelio y en la media, y tienen lesiones de placa aterosclerótica significativamente más complejas que los animales de control. Transgenic C57BL / 6NTac-TgN mice (APOB100) have the human apolipoprotein B gene "introduced by replacement." These mice express high levels of human apolipoprotein B resulting in mice with elevated serum LDL cholesterol levels. These mice are useful for identifying and evaluating compounds to reduce elevated LDL cholesterol levels and the risk of atherosclerosis. When fed a diet high in fat and cholesterol, these mice develop significant lipid accumulation below the endothelium and in the median, and have significantly more complex atherosclerotic plaque lesions than control animals.
Se llevó a cabo un estudio a largo plazo de inhibición de la apolipoproteína B humana por ISIS 301012 en ratones C57BL/6NTac-TgN(APOB100) (Taconic, Germantown, NY) durante un periodo de 3 meses. Se administró a los ratones por vía intraperitoneal dos veces por semana, 10 ó 25 mg/kg de ISIS 301012 (SEQ ID No: 247) durante 12 semanas. Los animales a los que se inyectó disolución salina sirvieron como controles. Cada grupo de tratamiento comprendía 4 animales. A long-term study of human apolipoprotein B inhibition by ISIS 301012 was conducted in C57BL / 6NTac-TgN (APOB100) mice (Taconic, Germantown, NY) over a period of 3 months. Mice were administered intraperitoneally twice weekly, 10 or 25 mg / kg ISIS 301012 (SEQ ID No: 247) for 12 weeks. Animals injected with saline served as controls. Each treatment group comprised 4 animals.
Después de 2, 4, 6, 8 y 12 semanas de tratamiento, se recogieron muestras de suero con el propósito de medir la proteína apolipoproteína B humana. La proteína en el suero se cuantificó usando un kit de ELISA específico para la apolipoproteína B humana (ALerCHEK Inc., Portland, ME). Los datos se muestran en la tabla 30 y cada resultado representa la media de 4 animales. Los datos están normalizados respecto a los animales de control tratados con disolución salina. After 2, 4, 6, 8 and 12 weeks of treatment, serum samples were collected for the purpose of measuring human apolipoprotein B protein. Protein in serum was quantified using an ELISA kit specific for human apolipoprotein B (ALerCHEK Inc., Portland, ME). The data is shown in Table 30 and each result represents the mean of 4 animals. The data is normalized with respect to the control animals treated with saline solution.
Tabla 30 Table 30
Reducción de la apolipoproteína B humana en el suero de ratones transgénicos después del tratamiento con ISIS 301012 Reduction of human apolipoprotein B in the serum of transgenic mice after treatment with ISIS 301012
- % de reducción en la proteína apolipoproteína B en el suero % reduction in serum apolipoprotein B protein
- Dosis de oligonucleótido mg/kg Oligonucleotide dose mg / kg
- 2 semanas 4 semanas 6 semanas 8 semanas 12 semanas 2 weeks 4 weeks 6 weeks 8 weeks 12 weeks
- 10 10
- 76 78 73 42 85 76 78 73 42 85
- 25 25
- 80 87 86 47 79 80 87 86 47 79
Estos datos ilustran que después de 2, 4, 6 ó 12 semanas de tratamiento con ISIS 301012, el nivel de proteína apolipoproteína B humana en el suero de ratones transgénicos ha disminuido en aproximadamente 80%, demostrando que además de inhibir la expresión del ARNm, ISIS 301012 inhibe eficazmente la expresión de la proteína apolipoproteína B humana en ratones que llevan el transgén de la apolipoproteína B humana. La proteína 5 apolipoproteína B en el suero también se evaluó por análisis de inmunotransferencia, usando un anticuerpo dirigido contra la proteína apolipoproteína B humana (US Biologicals, Swampscott, MA). Este análisis muestra que los niveles de proteína apolipoproteína B humana, tanto de la forma apolipoproteína B-100 como apolipoproteína B-48, disminuyen a las 2, 4, 6 y 12 semanas de tratamiento. El análisis de inmunotransferencia usando una anticuerpo específico para la apolipoproteína B de ratón (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) pone de manifiesto These data illustrate that after 2, 4, 6 or 12 weeks of treatment with ISIS 301012, the level of human apolipoprotein B protein in the serum of transgenic mice has decreased by approximately 80%, demonstrating that in addition to inhibiting mRNA expression, ISIS 301012 effectively inhibits the expression of human apolipoprotein B protein in mice bearing the human apolipoprotein B transgene. Protein 5 apolipoprotein B in serum was also evaluated by immunoblot analysis, using an antibody directed against human apolipoprotein B protein (US Biologicals, Swampscott, MA). This analysis shows that levels of human apolipoprotein B protein, both apolipoprotein B-100 and apolipoprotein B-48, decrease at 2, 4, 6 and 12 weeks of treatment. Immunoblot analysis using an antibody specific for mouse apolipoprotein B (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) reveals
10 que no hay un cambio significativo en la expresión de la proteína de ratón en el suero. 10 that there is no significant change in the expression of mouse protein in serum.
Al principio del tratamiento (inicio) y después de 2, 4, 6 y 8 semanas de tratamiento, se recogieron muestras de suero y se midieron los niveles de colesterol total, HDL y LDL por análisis clínico rutinario usando un analizador clínico Olympus (Olympus America Inc., Melville, NY), y estos datos se presentan en la tabla 31. Los resultados se presentan como mg/dl y representan la media de 4 animales. También se muestran los animales de control de At the start of treatment (start) and after 2, 4, 6 and 8 weeks of treatment, serum samples were collected and total cholesterol, HDL and LDL levels were measured by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY), and these data are presented in Table 31. Results are presented as mg / dl and represent the mean of 4 animals. Control animals are also shown.
15 disolución salina. 15 saline solution.
Tabla 31 Table 31
Efectos de ISIS 301012 en los lípidos del suero en ratones transgénicos con apolipoproteína B humana Effects of ISIS 301012 on serum lipids in transgenic mice with human apolipoprotein B
- Periodo de tratamiento Treatment period
- Tratamiento Treatment
- Inicio 2 semanas 4 semanas 6 semanas 8 semanas Start 2 weeks 4 weeks 6 weeks 8 weeks
- Colesterol total mg/dl Total cholesterol mg / dl
- Disolución salina 120 110 129 121 126 Saline dissolution 120 110 129 121 126
- 10 10
- 115 97 111 120 122 115 97 111 120 122
- 25 25
- 107 101 107 124 147 107 101 107 124 147
- Colesterol HDL mg/dl HDL cholesterol mg / dl
- Disolución salina 67 61 69 62 64 Saline dissolution 67 61 69 62 64
- 10 10
- 70 69 78 72 79 70 69 78 72 79
- 25 25
- 64 73 76 80 91 64 73 76 80 91
- Colesterol LDL mg/dl LDL cholesterol mg / dl
- Disolución salina 39 41 50 45 47 Saline dissolution 39 41 fifty Four. Five 47
- 10 10
- 35 20 23 37 33 35 twenty 2. 3 37 33
- 25 25
- 33 19 19 37 44 33 19 19 37 44
Estos datos demuestran que el colesterol LDL disminuye por el tratamiento con 10 ó 25 mg/kg de ISIS 147764 20 durante las primeras 4 semanas de tratamiento. These data demonstrate that LDL cholesterol decreases by treatment with 10 or 25 mg / kg of ISIS 147764 20 during the first 4 weeks of treatment.
El estudio se terminó 48 h después de las inyecciones finales en las 8 semanas de tratamiento, cuando los animales se sacrificaron y se evaluaron los niveles de ARNm diana en el hígado, niveles de proteína apolipoproteína B en el hígado y colesterol en el suero y niveles de enzimas hepáticas. Además, se midió la expresión de los niveles de apolipoproteína B de ratón endógenos en el suero para evaluar cualquier efecto de ISIS 301012 en la expresión del The study was completed 48 h after the final injections in the 8 weeks of treatment, when the animals were sacrificed and the levels of target mRNA in the liver, levels of apolipoprotein B protein in the liver and serum cholesterol and levels were evaluated. of liver enzymes. In addition, expression of endogenous mouse apolipoprotein B levels in serum was measured to assess any effect of ISIS 301012 on expression of the
25 ARNm de la apolipoproteína B. 25 apolipoprotein B mRNA.
Se midieron los niveles de ARNm de la apolipoproteína B humana y de ratón en los hígados de los animales tratados durante 12 semanas de tratamiento, por PCR en tiempo real como se describe en la presente memoria. Cada resultado representa la media de los datos de 4 animales. Los datos se normalizaron respecto a los controles con disolución salina y se muestran en la tabla 32. Mouse and human apolipoprotein B mRNA levels in the livers of treated animals were measured during 12 weeks of treatment, by real-time PCR as described herein. Each result represents the mean of the data from 4 animals. The data were normalized with respect to the saline controls and are shown in Table 32.
30 Tabla 32 30 Table 32
Efectos de ISIS 301012 en los niveles de ARNm de la apolipoproteína B humana y de ratón en ratones transgénicos Effects of ISIS 301012 on mouse and human apolipoprotein B mRNA levels in transgenic mice
- % inhibición % inhibition
- Dosis de ISIS 301012 ISIS Dose 301012
- especies de ARNm medidas measured mRNA species
- 10 mg/kg 25 mg/kg 10 mg / kg 25 mg / kg
- apolipoproteína B humana human apolipoprotein B
- 65 75 65 75
- apolipoproteína B de ratón mouse apolipoprotein B
- 6 6 6 6
Estos datos demuestran que después de 12 semanas de tratamiento con ISIS 301012, el ARNm de la apolipoproteína B humana se reduce tanto como el 75% en los hígados de ratones transgénicos, mientras que el 35 ARNm de la apolipoproteína B del hígado de ratón no era afectada. Además, el análisis por ELISA de la proteína apolipoproteína B en hígados de ratones transgénicos puso de manifiesto una reducción de 80% y 82% en la proteína humana después de 10 y 20 mg/kg de ISIS 301012, respectivamente. El análisis de inmunotransferencia usando un anticuerpo dirigido contra la apolipoproteína B humana también demuestra una reducción de la expresión These data demonstrate that after 12 weeks of treatment with ISIS 301012, human apolipoprotein B mRNA is reduced by as much as 75% in the livers of transgenic mice, whereas apolipoprotein B mRNA from mouse liver was not affected. Furthermore, ELISA analysis of the apolipoprotein B protein in livers of transgenic mice revealed an 80% and 82% reduction in human protein after 10 and 20 mg / kg of ISIS 301012, respectively. Immunoblot analysis using an antibody directed against human apolipoprotein B also demonstrates reduced expression.
de la apolipoproteína B humana, tanto de la forma apolipoproteína B-100 como de la apolipoproteína B-48, en los hígados de ratones transgénicos. El análisis de inmunotransferencia usando un anticuerpo dirigido contra la proteína apolipoproteína B de ratón (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) pone de manifiesto que la expresión de la proteína de ratón en el hígado no cambia significativamente. of human apolipoprotein B, both apolipoprotein B-100 and apolipoprotein B-48, in the livers of transgenic mice. Immunoblot analysis using an antibody directed against mouse apolipoprotein B protein (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) shows that the expression of mouse protein in the liver does not change significantly.
También se midieron los niveles de ALT y AST en el suero usando el analizador clínico Olympus (Olympus America Inc., Melville, NY) y mostraron que después del tratamiento con ISIS 301012, los niveles de AST y ALT aumentaron, aunque no superaron los niveles normales (-300 IU/l), indicando falta de toxicidad debido al tratamiento con ISIS 301012. ALT and AST levels in serum were also measured using the Olympus clinical analyzer (Olympus America Inc., Melville, NY) and showed that after treatment with ISIS 301012, AST and ALT levels increased, but did not exceed levels. normal (-300 IU / l), indicating lack of toxicity due to treatment with ISIS 301012.
Ejemplo 53 Example 53
Evaluación de los efectos inmunoestimuladores in vitro de ISIS 301012 Evaluation of the in vitro immunostimulatory effects of ISIS 301012
La actividad inmunoestimuladora se define por la producción de citoquinas tras exposición a un agente proinflamatorio. En una realización adicional de la invención, se ensayaron la actividad inmunoestimuladora o proinflamatoria de ISIS 301012. Estos estudios los realizaron en MDS Pharma Services (Saint Germain sur l'Arbresle, Francia). Se recogió sangre entera de ratones B6C3F1 sin tratamiento previo, que no habían sido expuestos conscientemente a tratamiento vírico, químico o de radiación. Las células de la sangre cultivadas se expusieron a ISIS 301012 0,5, 5 ó 50 μM durante un periodo de 14 a 16 h. Oligonucleótidos antisentido que se sabe que tienen actividad proinflamatoria sirvieron como controles positivos. Cada tratamiento se realizó por triplicado. Al final del periodo de tratamiento, se recogieron los líquidos sobrenadantes y se llevó a cabo el análisis de citoquinas usando un método de citometría de flujo con el kit CBA de inflamación de ratón (Becton Dickinson, Franklin Lakes, NJ). Los resultados pusieron de manifiesto que ISIS 301012 no estimula la liberación de ninguna de las citoquinas ensayadas, que eran la interleuquina 12p70 (IL-12p70), factor de necrosis tumoral alfa (TNF-alfa), interferón gamma (IFN-gamma), interleuquina 6 (IL-6), proteína quimioatractora de macrófagos 1 (MCP-1) e interleuquina 10 (IL-10). Por lo tanto, ISIS 301012 no tiene actividad inmunoestimuladora, según se determinó por el ensayo inmunoestimulador in vitro. Immunostimulatory activity is defined by the production of cytokines after exposure to a proinflammatory agent. In a further embodiment of the invention, the immunostimulatory or proinflammatory activity of ISIS 301012 was assayed. These studies were performed at MDS Pharma Services (Saint Germain sur l'Arbresle, France). Whole blood was collected from B6C3F1 mice without prior treatment, which had not been consciously exposed to viral, chemical, or radiation treatment. The cultured blood cells were exposed to 0.5, 5 or 50 µM ISIS 301012 for a period of 14 to 16 h. Antisense oligonucleotides known to have proinflammatory activity served as positive controls. Each treatment was performed in triplicate. At the end of the treatment period, the supernatant fluids were collected and cytokine analysis was performed using a flow cytometric method with the CBA Mouse Inflammation Kit (Becton Dickinson, Franklin Lakes, NJ). The results showed that ISIS 301012 does not stimulate the release of any of the cytokines tested, which were interleukin 12p70 (IL-12p70), tumor necrosis factor alpha (TNF-alpha), interferon gamma (IFN-gamma), interleukin. 6 (IL-6), macrophage chemoattractor protein 1 (MCP-1) and interleukin 10 (IL-10). Therefore, ISIS 301012 has no immunostimulatory activity, as determined by the in vitro immunostimulatory assay.
Ejemplo 54 Example 54
Análisis comparativo genómico de la apolipoproteína B Comparative genomic analysis of apolipoprotein B
Se llevó a cabo un análisis genómico comparativo de las secuencias de la apolipoproteína B de ser humano, ratón y mono e ilustró que las secuencias de apolipoproteína B son conservadas entre especies. La organización de los genes de la apolipoproteína B humana y de ratón también se conservan. Los genes humano y de ratón están compuestos por 29 y 26 exones, respectivamente. El ARNm de ratón tiene una homología de aproximadamente 81% con la secuencia humana. La secuencia completa y la estructura génica del gen de la apolipoproteína B en primates no humanos no se ha identificado. Sin embargo, como se ilustra en el ejemplo 46, un fragmento de 500 pares de bases que contiene la secuencia diana de ISIS 301012 presenta una identidad de aproximadamente 96% con la secuencia humana. A comparative genomic analysis of human, mouse and monkey apolipoprotein B sequences was performed and illustrated that apolipoprotein B sequences are conserved across species. The organization of the human and mouse apolipoprotein B genes is also conserved. The human and mouse genes are made up of 29 and 26 exons, respectively. Mouse mRNA has approximately 81% homology to the human sequence. The complete sequence and gene structure of the apolipoprotein B gene in non-human primates has not been identified. However, as illustrated in Example 46, a 500 base pair fragment containing the ISIS 301012 target sequence has approximately 96% identity to the human sequence.
El sitio de unión para ISIS 301012 está dentro de la región codificante, en el exón 22 del ARNm de la apolipoproteína B humana. Cuando se compararon los sitios de unión de ISIS 301012 de ser humano, ratón y mono, se observó una diversidad de secuencia significativa. Aunque la conservación total de la secuencia entre la de ser humano y la de mono a lo largo de la región de 500 nucleótidos era aproximadamente de 96%, el sitio de unión de ISIS 301012 de la secuencia de mono contiene 2 apareamientos erróneos con respecto a la secuencia humana. Igualmente, aunque la secuencia de ARNm de la apolipoproteína B de ratón tiene una homología de aproximadamente 81% con la humana, en el sitio de unión de ISIS 301012, hay 5 nucleótidos divergentes. Las comparaciones de secuencias para el sitio de unión de ISIS 301012 para las secuencias de la apolipoproteína B humana, de ratón y de mono se muestran en la tabla 33. Los nucleótidos mal apareados con respecto a la secuencia diana de ISIS 301012 están subrayados. The binding site for ISIS 301012 is within the coding region, in exon 22 of the human apolipoprotein B mRNA. When human, mouse and monkey ISIS 301012 binding sites were compared, significant sequence diversity was observed. Although the total conservation of the sequence between human and monkey throughout the 500 nucleotide region was approximately 96%, the ISIS 301012 binding site of the monkey sequence contains 2 mismatches with respect to the human sequence. Similarly, although the mouse apolipoprotein B mRNA sequence has approximately 81% homology to human, at the ISIS 301012 binding site, there are 5 divergent nucleotides. Sequence comparisons for the ISIS 301012 binding site for human, mouse and monkey apolipoprotein B sequences are shown in Table 33. Nucleotides mismatched with respect to the target sequence for ISIS 301012 are underlined.
Tabla 33 Table 33
Comparación del sitio de unión de ISIS 301012 entre las secuencias de apolipoproteína B humana, de mono y de ratón Comparison of the ISIS 301012 binding site between human, monkey and mouse apolipoprotein B sequences
- Especies Species
- nº de apareamientos erróneos secuencia diana de ISIS 301012 no. of mismatches ISIS target sequence 301012
- Ser humano Human being
- 0 aggtgcgaagcagactgagg 0 aggtgcgaagcagactgagg
- Mono Monkey
- 2 aggtgtaaagcagactgagg 2 aggtgtaaagcagactgagg
- Ratón Mouse
- 5 aggagtgcagcagtctgaag 5 aggagtgcagcagtctgaag
La secuencia diana con la que el oligonucleótido antisentido de ratón ISIS 147764 hibrida está en el exón 24 del gen de la apolipoproteína B de ratón. Las comparaciones de secuencias para el sitio de unión de ISIS 147764 en las secuencias de la apolipoproteína B de ratón y humana, se muestran en la tabla 34. Los nucleótidos mal apareados The target sequence with which the mouse antisense oligonucleotide ISIS 147764 hybridizes is in exon 24 of the mouse apolipoprotein B gene. Sequence comparisons for the ISIS 147764 binding site on mouse and human apolipoprotein B sequences are shown in Table 34. Mismatched nucleotides
con respecto a la secuencia diana de ISIS 147764 están subrayados. Tabla 34 Comparación del sitio de unión de ISIS 147764 entre las secuencias de apolipoproteína B de ratón y humana with respect to the target sequence of ISIS 147764 they are underlined. Table 34 Comparison of the ISIS 147764 binding site between mouse and human apolipoprotein B sequences
- Especies Species
- nº de apareamientos erróneos sitio de unión de ISIS 147764 no. of mismatches ISIS binding site 147764
- Ser humano Human being
- 5 gcattgacatdttcagggac 5 gcattgacatdttcagggac
- Ratón Mouse
- 0 gcatggacttcttctggaaa 0 gcatggacttcttctggaaa
5 Ejemplo 55 5 Example 55
Análisis BLAST de ISIS 301012 BLAST Analysis of ISIS 301012
Se determinó el número de regiones en el genoma humano con las que hibridará ISIS 301012 con complementariedad perfecta. El porcentaje de complementariedad de un compuesto antisentido con una región de un ácido nucleico diana se determinó usando los programas BLAST (herramientas de búsqueda de alineamientos The number of regions in the human genome with which ISIS 301012 will hybridize with perfect complementarity was determined. The percentage of complementarity of an antisense compound with a region of a target nucleic acid was determined using BLAST programs (alignment search tools
10 locales básica) y programas PowerBLAST conocidos en la técnica (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Este análisis evaluaba la complementariedad de secuencia en regiones genómicas o pre-ARNm y en secuencias codificantes. 10 basic premises) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). This analysis evaluated sequence complementarity in genomic or pre-mRNA regions and in coding sequences.
En regiones genómicas, ISIS 301012 muestra una complementariedad de secuencia perfecta con el gen de la apolipoproteína B solo. No se encontraron secuencias dianas con un apareamiento erróneo con respecto a ISIS In genomic regions, ISIS 301012 shows perfect sequence complementarity with the apolipoprotein B gene alone. No target sequences were found with a mismatch with respect to ISIS
15 301012. Se encuentran dos apareamientos erróneos entre la secuencia diana de ISIS 301012 y el gen de heparanasa, y se encuentran 3 apareamientos erróneos entre la secuencia diana de ISIS 301012 y 28 sitios genómicos únicos. 301012. Two mismatches are found between the ISIS 301012 target sequence and the heparanase gene, and 3 mismatches are found between the ISIS 301012 target sequence and 28 unique genomic sites.
En las secuencias de ARN, se encuentra una complementariedad de secuencia perfecta entre ISIS 301012 y el ARNm de la apolipoproteína B y 3 marcadores de secuencia expresados que llevan una similitud moderada con el In RNA sequences, perfect sequence complementarity is found between ISIS 301012 and apolipoprotein B mRNA and 3 expressed sequence markers that bear moderate similarity to
20 precursor de la apolipoproteína B humana. Se encuentra un solo apareamiento erróneo entre ISIS 301012 y un marcador de secuencia expresado similar a la forma de la cadena ligera de miosina del músculo liso. 20 precursor of human apolipoprotein B. A single mismatch is found between ISIS 301012 and an expressed sequence marker similar to the smooth muscle myosin light chain form.
Ejemplo 56 Example 56
Inhibición antisentido de la apolipoproteína B en hepatocitos humanos primarios: estudios de dosis-respuesta Antisense inhibition of apolipoprotein B in primary human hepatocytes: dose-response studies
Los oligonucleótidos antisentido dirigidos a la apolipoproteína B humana se ensayaron en estudios de dosisAntisense oligonucleotides targeting human apolipoprotein B were tested in dose studies
25 respuesta en hepatocitos humanos primarios. Los hepatocitos humanos primarios precultivados en placa se adquirieron en InVitro Technologies (Baltimore, MD). Las células se cultivaron en DMEM con alto contenido de glucosa (Invitrogen Corporation, Carlsbad, CA) complementado con suero bovino fetal al 10% (Invitrogen Corporation, Carlsbad, CA), 100 unidades/ml y 100 μg/ml de estreptomicina (Invitrogen Corporation, Carlsbad, CA). 25 response in primary human hepatocytes. Plaque precultured primary human hepatocytes were purchased from InVitro Technologies (Baltimore, MD). Cells were grown in high glucose DMEM (Invitrogen Corporation, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitrogen Corporation, Carlsbad, CA), 100 units / ml and 100 µg / ml streptomycin (Invitrogen Corporation , Carlsbad, CA).
Los hepatocitos primarios humanos se trataron con ISIS 301012 (SEQ ID NO: 247) 10, 50, 150 ó 300 nM. Las Human primary hepatocytes were treated with ISIS 301012 (SEQ ID NO: 247) 10, 50, 150, or 300 nM. The
30 células no tratadas y las células tratadas con el oligonucleótido de control desordenado ISIS 113529 (CTCTTACTGTGCTGTGGACA, SEQ ID NO: 859) sirvieron como dos grupos de células de control. ISIS 113529 es un oligonucleótidos quimérico ("gápmero") de 20 nucleótidos de longitud, compuesto por una región de "hueco" que consta de diez 2'-desoxinucleótidos, que está flanqueada a ambos lados (direcciones 5' y 3') por “alas” de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE) nucleótidos. Los enlaces internucleosídicos 30 untreated cells and cells treated with ISIS 113529 messy control oligonucleotide (CTCTTACTGTGCTGTGGACA, SEQ ID NO: 859) served as two groups of control cells. ISIS 113529 is a chimeric oligonucleotide ("gapmer") 20 nucleotides in length, consisting of a "gap" region consisting of ten 2'-deoxynucleotides, which is flanked on both sides (5 'and 3' directions) by " wings ”of 5 nucleotides. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside linkages
35 (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todas las citidinas son 5metilcitidinas. 35 (main chain) are phosphorothioate (P = S) linkages throughout the entire oligonucleotide. All cytidines are 5-methylcytidines.
Los oligonucleótidos se introdujeron en las células mediante transfección mediada por LIPOFECTIN como se describe en otros ejemplos de la presente memoria. Las células se recogieron tanto 24 como 48 h después del tratamiento con oligonucleótido, y se aislaron tanto el ARN como la proteína. Además, se recogió el medio de cultivo Oligonucleotides were introduced into cells by LIPOFECTIN mediated transfection as described in other examples herein. Cells were harvested both 24 and 48 h after oligonucleotide treatment, and both RNA and protein were isolated. In addition, the culture medium was collected
40 de las células tratadas para el análisis por ELISA de la secreción de la proteína apolipoproteína B. 40 of the cells treated for ELISA analysis of apolipoprotein B protein secretion.
La expresión del ARNm de la apolipoproteína B se determinó por PCR en tiempo real de las muestras de ARN como se describe en otros ejemplos en la presente memoria. Cada resultado representa 6 experimentos. Los datos se normalizan respecto a las células de control no tratadas y se muestran en la tabla 35. Apolipoprotein B mRNA expression was determined by real-time PCR of the RNA samples as described in other examples herein. Each result represents 6 experiments. The data is normalized with respect to the untreated control cells and is shown in Table 35.
Tabla 35 Inhibición del ARNm de la apolipoproteína B por oligonucleótidos antisentido en hepatocitos primarios humanos
Table 35 Inhibition of apolipoprotein B mRNA by antisense oligonucleotides in human primary hepatocytes
- % de inhibición del ARNm de la apolipoproteína B % inhibition of apolipoprotein B mRNA
- nº de ISIS ISIS number
- Dosis de oligonucleótido Oligonucleotide dose
- Tratamiento (horas) 301012 113529 Treatment (hours) 301012 113529
- 10 nM 10 nM
- 24 65 N.D. 24 65 N.D.
- 48 48
- 33 N.D. 33 N.D.
- 50 nM 50 nM
- 24 75 N.D. 24 75 N.D.
- 48 48
- 48 48
- N.D. N.D.
- 150 nM 150 nM
- 24 90 16 24 90 16
- 48 48
- 78 5 78 5
- 300 nM 300 nM
- 24 89 10 24 89 10
- 48 48
- 72 18 72 18
Estos datos demuestran que ISIS 301012 inhibe la expresión de la apolipoproteína B de una forma dependiente de 5 la dosis en hepatocitos humanos primarios. These data demonstrate that ISIS 301012 inhibits apolipoprotein B expression in a dose dependent manner in primary human hepatocytes.
Se midió la proteína apolipoproteína B secretada al medio celular cultivado en las muestras tratadas con el oligonucleótido 50 y 150 nM, usando un kit de ELISA específico de la proteína diana (ALerCHEK Inc., Portland, ME). Cada resultado representa 3 experimentos. Los datos se normalizan respecto a las células de control no tratadas y se muestran en la tabla 36. The apolipoprotein B protein secreted to the cultured cell medium was measured in the samples treated with the 50 and 150 nM oligonucleotide, using an ELISA kit specific for the target protein (ALerCHEK Inc., Portland, ME). Each result represents 3 experiments. The data is normalized with respect to the untreated control cells and is shown in Table 36.
10 Tabla 36 10 Table 36
Inhibición de la secreción de la proteína apolipoproteína B de hepatocitos humanos primarios por ISIS 301012 Inhibition of Apolipoprotein B Protein Secretion from Primary Human Hepatocytes by ISIS 301012
- % de cambio en la secreción de la proteína apolipoproteína B % change in apolipoprotein B protein secretion
- nº de ISIS ISIS number
- Dosis Dose
- Tratamiento (horas) 301012 113529 Treatment (hours) 301012 113529
- 150 nM 150 nM
- 24 -57 +6 24 -57 +6
- 48 48
- -75 +4 -75 +4
- 300 nM 300 nM
- 24 -41 -2 24 -41 -2
- 48 48
- -48 -5 -48 -5
Las muestras de proteínas de las dosis de 50, 150 and 300 nM después de 24 h y las dosis de 150 y 300 nM después de 48 h, se sometieron a análisis de inmunotransferencia como se describe en otros ejemplos en la Protein samples from the 50, 150 and 300 nM doses after 24 h and the 150 and 300 nM doses after 48 h were subjected to immunoblot analysis as described in other examples in
15 presente memoria, usando el anticuerpo específico de la proteína apolipoproteína B humana adquirido en US Biological (Swampscott, MA). El análisis de inmunotransferencia demuestra que la proteína apolipoproteína B en hepatocitos humanos disminuye de una forma dependiente de la dosis después del tratamiento con oligonucleótido antisentido con ISIS 301012. This specification uses the human apolipoprotein B protein specific antibody purchased from US Biological (Swampscott, MA). Immunoblot analysis demonstrates that apolipoprotein B protein in human hepatocytes decreases in a dose dependent manner after treatment with antisense oligonucleotide with ISIS 301012.
Se llevó a cabo un experimento adicional para ensayar los efectos de ISIS 271009 (SEQ ID NO: 319), ISIS 281625 A further experiment was carried out to test the effects of ISIS 271009 (SEQ ID NO: 319), ISIS 281625
20 (SEQ ID NO: 224) y ISIS 301027 (SEQ ID NO: 262) en el ARNm de la apolipoproteína B humana en hepatocitos humanos primarios. Las células se cultivaron como se describe en la presente memoria, y se trataron con ISIS 271009, ISIS 281625 o ISIS 301027, 5, 10, 50 ó 150 nM durante un periodo de 24 h. Los oligonucleótidos de control ISIS 13650 (SEQ ID NO: 806) y ISIS 113529 (SEQ ID NO: 859) se usaron en concentración 50 o 150 nM. Se evaluó la expresión del ARNm de la apolipoproteína B humana por PCR en tiempo real como se describe en otros ejemplos 20 (SEQ ID NO: 224) and ISIS 301027 (SEQ ID NO: 262) on human apolipoprotein B mRNA in primary human hepatocytes. Cells were grown as described herein, and treated with ISIS 271009, ISIS 281625, or ISIS 301027, 5, 10, 50, or 150 nM over a 24 h period. Control oligonucleotides ISIS 13650 (SEQ ID NO: 806) and ISIS 113529 (SEQ ID NO: 859) were used in 50 or 150 nM concentration. Human apolipoprotein B mRNA expression was evaluated by real-time PCR as described in other examples
25 en la presente memoria. Se midió la proteína apolipoproteína B secretada al medio celular cultivado en las muestras tratadas con el oligonucleótido 50 y 150 nM, usando un kit de ELISA específico de la proteína diana (ALerCHEK Inc., Portland, ME). 25 herein. The apolipoprotein B protein secreted to the cultured cell medium was measured in the samples treated with the 50 and 150 nM oligonucleotide, using an ELISA kit specific for the target protein (ALerCHEK Inc., Portland, ME).
Los datos mostrados en la tabla 37, representan la media de 2 experimentos y están normalizados con respecto a las células de control. Cuando está presente, un "+" indica que la expresión génica era mayor. The data shown in Table 37 represent the average of 2 experiments and are normalized with respect to the control cells. When present, a "+" indicates that gene expression was higher.
Tabla 37 Inhibición antisentido del ARNm de la apolipoproteína B humana por ISIS 271009, ISIS 281625 y ISIS 301027
Table 37 Antisense inhibition of human apolipoprotein B mRNA by ISIS 271009, ISIS 281625 and ISIS 301027
- Dosis de oligonucleótido Oligonucleotide dose
- ISIS 271009 ISIS 281625 ISIS 301027 ISIS 13650 ISIS 113529 ISIS 271009 ISIS 281625 ISIS 301027 ISIS 13650 ISIS 113529
- % de inhibición de la expresión del % inhibition of the expression of
- 5 nM +4 8 11 N.D. N.D. 5 nM +4 8 eleven N.D. N.D.
- ARNm de la apolipoproteína B Apolipoprotein B mRNA
- 10 nM 5 22 37 N.D. N.D. 10 nM 5 22 37 N.D. N.D.
- 50 nM 50 nM
- 52 49 50 38 0 52 49 fifty 38 0
- 150 nM 150 nM
- 81 52 70 26 14 81 52 70 26 14
- % de inhibición de la secreción de % inhibition of the secretion of
- 50 nM 17 18 21 N.D. N.D. 50 nM 17 18 twenty-one N.D. N.D.
- la proteína apolipoproteína B apolipoprotein B protein
- 150 nM 32 18 32 +18 +1 150 nM 32 18 32 +18 +1
Estos datos demuestran que ISIS 271009, ISIS 281625 y ISIS 301027 inhiben la expresión del ARNm de la 5 apolipoproteína B de una forma dependiente de la dosis en hepatocitos humanos primarios. ISIS 271009 y ISIS 301027 inhiben la secreción de proteína apolipoproteína B de las células de una forma dependiente de la dosis. These data demonstrate that ISIS 271009, ISIS 281625 and ISIS 301027 inhibit apolipoprotein B mRNA expression in a dose-dependent manner in primary human hepatocytes. ISIS 271009 and ISIS 301027 inhibit apolipoprotein B protein secretion from cells in a dose-dependent manner.
Ejemplo 57 Example 57
Efectos de los oligonucleótidos antisentido de la apolipoproteína B-100 en la expresión de la apolipoproteína(a) Effects of apolipoprotein B-100 antisense oligonucleotides on apolipoprotein expression (a)
La lipoproteína (a) [Lp(a)] contiene dos proteínas distintas unidas por disulfuro, la apolipoproteína (a) y la Lipoprotein (a) [Lp (a)] contains two distinct disulfide-bound proteins, apolipoprotein (a) and
10 apolipoproteína B (Rainwater and Kammerer, J. Exp. Zool., 1998, 282, 54-61). Se ensayaron los efectos de los oligonucleótidos antisentido dirigidos a la apolipoproteína B en la expresión del componente apolipoproteína (a) de la partícula de lipoproteína (a) en hepatocitos humanos primarios. 10 apolipoprotein B (Rainwater and Kammerer, J. Exp. Zool., 1998, 282, 54-61). The effects of apolipoprotein B-directed antisense oligonucleotides on the expression of the apolipoprotein component (a) of the lipoprotein particle (a) were tested in primary human hepatocytes.
Los hepatocitos humanos primarios (Invitro Technologies, Baltimore, MD), cultivados y transfectados como se describe en la presente memoria, se trataron con concentraciones 5, 10, 50 ó 150 nM de ISIS 271009 (SEQ ID NO: Primary human hepatocytes (Invitro Technologies, Baltimore, MD), cultured and transfected as described herein, were treated with 5, 10, 50, or 150 nM concentrations of ISIS 271009 (SEQ ID NO:
15 319), 281625 (SEQ ID NO: 224), 301012 (SEQ ID NO: 247) o 301027 (SEQ ID NO: 262). Las células también se trataron con concentraciones 50 ó 150 nM de los oligonucleótidos de control ISIS 113529 (SEQ ID NO: 859) o ISIS 13650 (SEQ ID NO: 806). Las células no tratadas sirvieron de control. Después de 24 h de tratamiento con el oligonucleótido, se midió la expresión del ARNm de la apolipoproteína (a) por PCR cuantitativa en tiempo real como se describe en otros ejemplos en la presente memoria. 15 319), 281625 (SEQ ID NO: 224), 301012 (SEQ ID NO: 247) or 301027 (SEQ ID NO: 262). The cells were also treated with 50 or 150 nM concentrations of the control oligonucleotides ISIS 113529 (SEQ ID NO: 859) or ISIS 13650 (SEQ ID NO: 806). Untreated cells served as controls. After 24 hr of treatment with the oligonucleotide, apolipoprotein (a) mRNA expression was measured by quantitative real-time PCR as described in other examples herein.
20 Las sondas y cebadores para la apolipoproteína (a) humana se diseñaron para hibridar con una secuencia de apolipoproteína (a) humana, usando la información de la secuencia publicada (número de acceso en GenBank NM_005577.1, incorporada en la presente memoria como SEQ ID NO: 860). Para la apolipoproteína (a) humana los cebadores de la PCR eran: Probes and primers for human apolipoprotein (a) were designed to hybridize with a sequence of human apolipoprotein (a), using the published sequence information (GenBank accession number NM_005577.1, incorporated herein as SEQ ID NO: 860). For human apolipoprotein (a) the PCR primers were:
cebador directo: CAGCTCCTTATTGTTATACGAGGGA (SEQ ID NO: 861) forward primer: CAGCTCCTTATTGTTATACGAGGGA (SEQ ID NO: 861)
25 cebador inverso: TGCGTCTGAGCATTGCGT (SEQ ID NO: 862) y la sonda de la PCR era: FAM-CCCGGTGTCAGGTGGGAGTACTGC-TAMRA (SEQ ID NO: 863) donde FAM es el colorante fluorescentes y TAMRA es el colorante atenuador. Reverse primer: TGCGTCTGAGCATTGCGT (SEQ ID NO: 862) and the PCR probe was: FAM-CCCGGTGTCAGGTGGGAGTACTGC-TAMRA (SEQ ID NO: 863) where FAM is the fluorescent dye and TAMRA is the quencher dye.
Los datos son la media de 3 experimentos y se expresan como porcentaje de inhibición con respecto a los controles no tratados. Los resultados se muestran en la tabla 38. Un "+" o "-" que precede al número indica que la expresión Data are the average of 3 experiments and are expressed as percentage of inhibition with respect to untreated controls. The results are shown in Table 38. A "+" or "-" preceding the number indicates that the expression
30 de la apolipoproteína(a) había aumentado o disminuido, respectivamente, después de tratamiento con los oligonucleótidos antisentido. 30 of the apolipoprotein (a) had increased or decreased, respectively, after treatment with the antisense oligonucleotides.
Tabla 38 Table 38
Efectos de los oligonucleótidos antisentido de la apolipoproteína B en la expresión de la apolipoproteína (a) Estos resultados ilustran que ISIS 301012 no inhibía la expresión de la apolipoproteína (a) en hepatocitos humanos primarios. ISIS 271009 inhibía la expresión de la apolipoproteína (a) con la dosis más alta. ISIS 281625 y ISIS 301027 disminuían los niveles de ARNm de apolipoproteína(a). Effects of apolipoprotein B antisense oligonucleotides on apolipoprotein (a) expression These results illustrate that ISIS 301012 did not inhibit apolipoprotein (a) expression in primary human hepatocytes. ISIS 271009 inhibited apolipoprotein (a) expression at the highest dose. ISIS 281625 and ISIS 301027 decreased apolipoprotein mRNA levels (a).
- % de cambio en la expresión del ARNm de la apolipoproteína (a) después de inhibición antisentido de la apolipoproteína B % change in apolipoprotein (a) mRNA expression after antisense inhibition of apolipoprotein B
- Dosis de Dose
- nº de ISIS ISIS number
- oligonucleótido oligonucleotide
- 271009 281625 301012 301027 13650 113529 271009 281625 301012 301027 13650 113529
- 5 nM 5 nM
- +70 -9 +34 -16 N.D. N.D. +70 -9 +34 -16 N.D. N.D.
- 10 nM 10 nM
- +31 -23 +86 -45 N.D. N.D. +31 -2. 3 +86 -Four. Five N.D. N.D.
- 50 nM 50 nM
- +25 -34 +30 -39 -68 +14 +25 -3. 4 +30 -39 -68 +14
- 150 nM 150 nM
- -47 +32 +38 -43 -37 -9 -47 +32 +38 -43 -37 -9
Ejemplo 58 Example 58
5 Inhibición de la secreción de partículas de lipoproteína (a) con oligonucleótidos antisentido dirigidos a la apolipoproteína B-100 5 Inhibition of the secretion of lipoprotein (a) particles with antisense oligonucleotides directed at apolipoprotein B-100
Se evaluó la secreción de partículas de lipoproteína (a), que están compuestas de una molécula de apolipoproteína Secretion of lipoprotein particles (a), which are composed of an apolipoprotein molecule, was evaluated.
(a) unida covalentemente a una molécula de apolipoproteína B, en hepatocitos humanos primarios tratados con oligonucleótidos antisentido dirigidos al componente apolipoproteína B de la lipoproteína (a). (a) covalently bound to an apolipoprotein B molecule, in primary human hepatocytes treated with antisense oligonucleotides targeting the apolipoprotein B component of lipoprotein (a).
10 Hepatocitos humanos primarios (InVitro Technologies, Baltimore, MD), cultivados y transfectados como se describe en la presente memoria, se trataron durante 24 h con 50 ó 150 nM de ISIS 271009 (SEQ ID NO: 319), 281625 (SEQ ID NO: 224), 301012 (SEQ ID NO: 247) o 301027 (SEQ ID NO: 262). Las células también se trataron con concentración 150 nM de los oligonucleótidos de control ISIS 113529 (SEQ ID NO: 859) o ISIS 13650 (SEQ ID NO: 806). Las células no tratadas sirvieron de control. Después de 24 h de tratamiento con el oligonucleótido, se midió la 10 Primary human hepatocytes (InVitro Technologies, Baltimore, MD), cultured and transfected as described herein, were treated for 24 h with 50 or 150 nM of ISIS 271009 (SEQ ID NO: 319), 281625 (SEQ ID NO : 224), 301012 (SEQ ID NO: 247) or 301027 (SEQ ID NO: 262). Cells were also treated with 150 nM concentration of control oligonucleotides ISIS 113529 (SEQ ID NO: 859) or ISIS 13650 (SEQ ID NO: 806). Untreated cells served as controls. After 24 h of treatment with the oligonucleotide, the
15 cantidad de lipoproteína (a) en el medio de cultivo recogido de las células tratadas, usando un kit de ELISA disponible en el comercio (ALerCHEK Inc., Portland, ME). Los resultados son la media de 3 experimentos y se expresan como el porcentaje de cambio en la secreción de lipoproteína (a) con respecto a los controles no tratados. Los datos se muestran en la Tabla 39. Un "+" o "-" que preceden al número indica que la secreción de partículas de lipoproteína (a) aumentó o disminuyó, respectivamente, después del tratamiento con oligonucleótidos antisentido Amount of lipoprotein (a) in the culture medium collected from the treated cells, using a commercially available ELISA kit (ALerCHEK Inc., Portland, ME). Results are the average of 3 experiments and are expressed as the percentage change in lipoprotein secretion (a) with respect to untreated controls. Data are shown in Table 39. A "+" or "-" preceding the number indicates that the secretion of lipoprotein (a) particles increased or decreased, respectively, after treatment with antisense oligonucleotides
20 dirigidos a la apolipoproteína B. 20 targeting apolipoprotein B.
Tabla 39 Table 39
Inhibición de la secreción de partículas de lipoproteína (a) con oligonucleótidos antisentido dirigidos a la apolipoproteína B Inhibition of the secretion of lipoprotein (a) particles with antisense oligonucleotides targeting apolipoprotein B
- % de cambio en la secreción de lipoproteína (a) % change in lipoprotein secretion (a)
- Dosis de oligonucleótido Oligonucleotide dose
- nº de ISIS ISIS number
- 271009 271009
- 281625 301012 301027 13650 113529 281625 301012 301027 13650 113529
- 50 nM 50 nM
- -25 -26 -27 -33 N.D. N.D. -25 -26 -27 -33 N.D. N.D.
- 150 nM 150 nM
- -42 -24 -37 -44 +14 +14 -42 -24 -37 -44 +14 +14
25 Estos datos demuestran que la inhibición antisentido de la apolipoproteína B, un componente de la partícula de lipoproteína (a), puede reducir la secreción de lipoproteína (a) de hepatocitos humanos primarios. Además, esta reducción en la secreción de lipoproteína (a) no es necesariamente simultánea con una disminución de la expresión de ARNm de apolipoproteína (a), como se muestra en el ejemplo 57. These data demonstrate that antisense inhibition of apolipoprotein B, a component of the lipoprotein particle (a), can reduce lipoprotein (a) secretion from primary human hepatocytes. Furthermore, this reduction in lipoprotein (a) secretion is not necessarily simultaneous with a decrease in apolipoprotein (a) mRNA expression, as shown in Example 57.
Ejemplo 59 Example 59
30 Derivados con apareamientos erróneos y truncados de ISIS 301012 30 Derivatives with Erroneous and Truncated Matches of ISIS 301012
Como se demuestra en la presente memoria, ISIS 301012 (SEQ ID NO: 247) reduce los niveles de ARNm de la apolipoproteína B en líneas celulares humanas cultivadas igual que en los hepatocitos humanos primarios. En una realización adicional de la invención, se llevó a cabo un estudio usando derivados de la secuencia de nucleótidos de ISIS 301012. Se diseñó una serie de oligonucleótidos que contenían de 1 a 7 apareamientos erróneos de bases, 35 empezando en el centro de la secuencia de ISIS 301012. Esta serie se diseñó para introducir la pérdida consecutiva de emparejamientos de bases de Watson-Crick entre ISIS 301012 y su secuencia diana de ARNm. Estos compuestos se muestran en la Tabla 40. Los compuestos antisentido con nucleótidos mal apareados con respecto a ISIS 301012 son oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud, compuestos de una región de "hueco" central que contiene diez 2'-desoxinucleótidos, que está flanqueada por ambos lados (direcciones 5' y 3') As demonstrated herein, ISIS 301012 (SEQ ID NO: 247) reduces apolipoprotein B mRNA levels in cultured human cell lines as well as in primary human hepatocytes. In a further embodiment of the invention, a study was conducted using derivatives of the ISIS 301012 nucleotide sequence. A series of oligonucleotides containing 1 to 7 base mismatches were designed, 35 starting in the middle of the sequence of ISIS 301012. This series was designed to introduce the consecutive loss of Watson-Crick base pairings between ISIS 301012 and its target mRNA sequence. These compounds are shown in Table 40. Antisense compounds with mismatched nucleotides relative to ISIS 301012 are chimeric oligonucleotides ("gammers") 20 nucleotides in length, composed of a central "gap" region containing ten 2'- deoxynucleotides, which are flanked on both sides (5 'and 3' directions)
40 por "alas" de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE)-nucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. 40 for 5 nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) -nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide.
Se diseñó un derivado adicional de ISIS 301012 que comprendía la secuencia de ISIS 301012 con 2'MOEnucleótidos a lo largo del oligonucleótido (2'-MOE uniforme). Este compuesto tiene 20 nucleótidos de longitud, con enlaces fosforotioato a lo largo del oligonucleótido. Este compuesto también se muestra en la tabla 40. An additional derivative of ISIS 301012 was designed that comprised the sequence of ISIS 301012 with 2'MOEnucleotides along the oligonucleotide (uniform 2'-MOE). This compound is 20 nucleotides in length, with phosphorothioate linkages along the oligonucleotide. This compound is also shown in Table 40.
45 Se trataron células HepG2 con los compuestos de la tabla 40 con 50 ó 150 nM, durante un periodo de 24 h, después de lo cual se aisló el ARN y se midió la expresión diana por PCR en tiempo real como se describe en la presente memoria. Células no tratadas sirvieron de control. Los resultados se muestran en la tabla 40 y están normalizados con respecto a las muestras de control. HepG2 cells were treated with the compounds in Table 40 with 50 or 150 nM, over a 24 h period, after which RNA was isolated and target expression was measured by real-time PCR as described herein. memory. Untreated cells served as controls. The results are shown in Table 40 and are normalized with respect to the control samples.
Tabla 40 Table 40
Efectos de los oligonucleótidos con apareamientos erróneos ISIS 301012 y un 2'MOE-oligonucleótido uniforme en la expresión de la apolipoproteína B en células HepG2 Effects of oligonucleotides with ISIS 301012 mismatches and a uniform 2'MOE-oligonucleotide on apolipoprotein B expression in HepG2 cells
- % de cambio en la expresión del ARNm de la apolipoproteína B % change in apolipoprotein B mRNA expression
- nº de ISIS ISIS number
- SECUENCIA nº de apareamientos erróneos Dosis de oligonucleótido SEQ ID NO SEQUENCE no. of mismatches Oligonucleotide dose SEQ ID NO
- 50 fifty
- 150 150
- 301012 301012
- GCCTCAGTCTGCTTCGCACC 0 -44 -75 247 GCCTCAGTCTGCTTCGCACC 0 -44 -75 247
- Serie con apareamientos erróneos, oligonucleótidos quiméricos Series with mismatches, chimeric oligonucleotides
- 332770 332770
- GCCTCAGTCTTCTTCGCACC 1 +7 -22 864 GCCTCAGTCTTCTTCGCACC one +7 -22 864
- 332771 332771
- GCCTCAGTCTTATTCGCACC 2 +37 +37 865 GCCTCAGTCTTATTCGCACC 2 +37 +37 865
- 332772 332772
- GCCTCAGTATTATTCGCACC 3 +99 +84 866 GCCTCAGTATTATTCGCACC 3 +99 +84 866
- 332773 332773
- GCCTCATTATTATTCGCACC 4 +75 +80 867 GCCTCATTATTATTCGCACC 4 +75 +80 867
- 332774 332774
- GCCTCATTATTATTAGCACC 5 +62 +66 868 GCCTCATTATTATTAGCACC 5 +62 +66 868
- 332775 332775
- GCCTCATTATTATTATCACC 6 -1 +10 869 GCCTCATTATTATTATCACC 6 -one +10 869
- 332776 332776
- GCCTAATTATTATTATCACC 7 +10 +20 870 GCCTAATTATTATTATCACC 7 +10 +20 870
- 2'-MOE-oligonucleótido uniforme 2'-MOE-uniform oligonucleotide
- 332769 332769
- GCCTCAGTCTGCTTCGCACC 0 -11 -14 247 GCCTCAGTCTGCTTCGCACC 0 -eleven -14 247
5 Los resultados del tratamiento de células HepG2 con los compuestos de la tabla 40 ponen de manifiesto que ninguno de los compuestos presenta la inhibición dependiente de la dosis observada después de tratamiento con la secuencia de ISIS 301012 original. ISIS 332770, que tiene solo una sustitución de timidina a citosina en el centro del oligonucleótido, era 3 veces menos potente que ISIS 301012. Sustituciones de nucleótidos adicionales anulan la inhibición antisentido de la expresión de la apolipoproteína B. 5 The results of treatment of HepG2 cells with the compounds in Table 40 show that none of the compounds exhibits the dose dependent inhibition observed after treatment with the original ISIS 301012 sequence. ISIS 332770, which has only one thymidine to cytosine substitution at the center of the oligonucleotide, was 3 times less potent than ISIS 301012. Additional nucleotide substitutions nullify antisense inhibition of apolipoprotein B expression.
10 Los oligonucleótidos fosforotioato quiméricos son metabolizados in vivo predominantemente por escisión endonucleolítica. Se diseñó una serie de oligonucleótidos por truncado de la secuencia de ISIS 301012 en incrementos de 1 ó 2 bases desde el extremo 5' y/o 3'. Los oligonucleótidos truncados representan los posibles productos que resultan de la escisión endonucleolítica. Estos compuestos se muestran en la Tabla 41. Los compuestos en la tabla 41 son oligonucleótidos quiméricos ("gápmeros") de diferentes longitudes, compuestos de Chimeric phosphorothioate oligonucleotides are metabolized in vivo predominantly by endonucleolytic cleavage. A series of oligonucleotides were designed by truncating the sequence of ISIS 301012 in 1 or 2 base increments from the 5 'and / or 3' end. Truncated oligonucleotides represent possible products that result from endonucleolytic cleavage. These compounds are shown in Table 41. The compounds in Table 41 are chimeric oligonucleotides ("gammers") of different lengths, composed of
15 una región de "hueco" central que consiste en 2'-desoxinucleótidos, que está flanqueada en ambos extremos por 2'metoxietil (2'-MOE)nucleótidos. La estructura exacta de cada oligonucleótido quimérico se designa en la tabla 41 como "estructura quimérica". Por ejemplo, una designación 4~10~4 indica que los primeros 4 (los más 5') y los últimos 4 (los más 3' ) son 2'-MOE-nucleótidos, y los 10 nucleótidos en el hueco son 2'-desoxinucleótidos. Los 2'MOE-nucleótidos se indican en negrilla. Los enlaces internucleósidos (cadena principal) son fosfodiéster (P=O) entre 15 a central "gap" region consisting of 2'-deoxynucleotides, which is flanked at both ends by 2'methoxyethyl (2'-MOE) nucleotides. The exact structure of each chimeric oligonucleotide is designated in Table 41 as "chimeric structure". For example, a 4 ~ 10 ~ 4 designation indicates that the first 4 (most 5 ') and last 4 (most 3') are 2'-MOE-nucleotides, and the 10 nucleotides in the gap are 2'- deoxynucleotides. The 2'MOE-nucleotides are indicated in bold. Internucleoside (backbone) bonds are phosphodiester (P = O) between
20 nucleótidos resaltados; todos los demás enlaces internucleósidos son fosforotioato (P=S). 20 highlighted nucleotides; all other internucleoside linkages are phosphorothioate (P = S).
Se ensayó en estos compuestos su capacidad para reducir la expresión del ARNm de la apolipoproteína B. Se trataron células HepG2 con cada uno de los compuestos antisentido de la tabla 41, en concentración 10, 50 ó 150 nM, durante un periodo de 24 h, después de lo cual se aisló el ARN y se midió la expresión diana por PCR en tiempo real como se describe en la presente memoria. Células no tratadas sirvieron de control. Los resultados se muestran These compounds were tested for their ability to reduce apolipoprotein B mRNA expression. HepG2 cells were treated with each of the antisense compounds in Table 41, in 10, 50, or 150 nM concentration, over a period of 24 h, after which RNA was isolated and target expression was measured by real-time PCR as described herein. Untreated cells served as controls. The results are shown
25 en la tabla 41 y están normalizados con respecto a las muestras de control no tratadas. 25 in Table 41 and are normalized with respect to untreated control samples.
Tabla 41 Efecto de los mutantes truncados de ISIS 301012 en la expresión de la apolipoproteína B en células HepG2
Table 41 Effect of truncated ISIS 301012 mutants on apolipoprotein B expression in HepG2 cells
- % de cambio en la expresión del ARNm de la apolipoproteína B % change in apolipoprotein B mRNA expression
- nº de ISIS ISIS number
- SEQ ID NO DE LA DIANA SITIO DIANA SECUENCIA Estructura quimérica Dosis de oligonucleótido SEQ ID NO SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE Chimeric structure Oligonucleotide dose SEQ ID NO
- 10 10
- 50 150 fifty 150
- 301012 301012
- 3 3249 GCCTCAGTCTGCTTCGCACC 5~10~5 -51 -72 -92 247 3 3249 GCCTCAGTCTGCTTCGCACC 5 ~ 10 ~ 5 -51 -72 -92 247
- 331022 331022
- 3 3249 GCCTCAGTCTGCTTCGCAC 5~10~4 -33 -49 -87 871 3 3249 GCCTCAGTCTGCTTCGCAC 5 ~ 10 ~ 4 -33 -49 -87 871
- 332777 332777
- 3 3249 GCCTCAGTCTGCTTCGCA 5~10~3 -27 -53 -80 872 3 3249 GCCTCAGTCTGCTTCGCA 5 ~ 10 ~ 3 -27 -53 -80 872
- 332778 332778
- 3 3249 GCCTCAGTCTGCTTC 5~10~0 -11 -20 -58 873 3 3249 GCCTCAGTCTGCTTC 5 ~ 10 ~ 0 -eleven -twenty -58 873
- 332780 332780
- 3 3248 CCTCAGTCTGCTTCGCAC 4~10~4 -3 -43 -74 874 3 3248 CCTCAGTCTGCTTCGCAC 4 ~ 10 ~ 4 -3 -43 -74 874
- 332781 332781
- 3 3247 CTCAGTCTGCTTCGCA 3~10~3 -9 -35 -60 875 3 3247 CTCAGTCTGCTTCGCA 3 ~ 10 ~ 3 -9 -35 -60 875
- 332782 332782
- 3 3246 TCAGTCTGCTTCGC 2~10~2 -16 -16 -69 876 3 3246 TCAGTCTGCTTCGC 2 ~ 10 ~ 2 -16 -16 -69 876
- 332784 332784
- 3 3249 GCCTCAGTCT 5~5~0 +12 -1 +7 877 3 3249 GCCTCAGTCT 5 ~ 5 ~ 0 +12 -one +7 877
- 332785 332785
- 3 3238 GCTTCGCACC 0~5~5 +5 -2 - 4 878 3 3238 GCTTCGCACC 0 ~ 5 ~ 5 +5 -2 - 4 878
Los resultados en la tabla 41 ilustran que la inhibición de la apolipoproteína B depende de la longitud de secuencia, 5 así como de la complementariedad de secuencia y la dosis, como se demuestra en la tabla 41, pero las versiones truncadas de ISIS 301012 son capaces en cierta medida de inhibir la expresión del ARNm de la apolipoproteína B. The results in Table 41 illustrate that apolipoprotein B inhibition depends on sequence length, 5 as well as sequence and dose complementarity, as demonstrated in Table 41, but truncated versions of ISIS 301012 are capable to some extent inhibit apolipoprotein B mRNA expression.
Ejemplo 60 Example 60
Diseño y cribado de los ARNdc que se dirigen a la apolipoproteína B humana Design and screening of dsRNAs targeting human apolipoprotein B
Se diseñó una serie de dúplex de ácido nucleico que comprendían los compuestos antisentido de la presente A series of nucleic acid duplexes were designed comprising the antisense compounds herein
10 descripción, y sus complementos para dirigirse a la apolipoproteína B y se muestran en la tabla 42. Todos los compuestos de la tabla 42 son oligorribonucleótidos de 20 nucleótidos de longitud con enlaces internucleósidos fosfodiéster (cadena principal) a lo largo del compuesto. Los compuestos se prepararon con extremos romos. La tabla 41 muestra la cadena antisentido de los ARNdc, y la cadena del mismo sentido se sintetiza como complemento de la cadena antisentido. Se muestra que estas secuencias contienen uracilo (U) pero un experto en la técnica 10 description, and its complements to target apolipoprotein B and are shown in Table 42. All compounds in Table 42 are 20 nucleotide long oligoribonucleotides with phosphodiester internucleoside linkages throughout the compound. Compounds were prepared with blunt ends. Table 41 shows the antisense strand of the dsRNA, and the same strand is synthesized as a complement to the antisense strand. These sequences are shown to contain uracil (U) but one skilled in the art
15 apreciará que el uracilo (U) generalmente es sustituido por timina (T) en las secuencias de ADN. El "sitio diana" indica el número del primer nucleótido (más 5') en la secuencia diana particular, al que se une el compuesto. Un subconjunto de los compuestos en la tabla 42 son los equivalentes de ARN de los oligonucleótidos antisentido descritos en la presente memoria, y cuando se aplique, esto se indica por el nº de ISIS del oligonucleótido de ADN en la columna de "ARN equivalente a nº de ISIS" 15 will appreciate that uracil (U) is generally replaced by thymine (T) in DNA sequences. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the compound binds. A subset of the compounds in Table 42 are the RNA equivalents of the antisense oligonucleotides described herein, and when applied, this is indicated by the ISIS # of the DNA oligonucleotide in the "RNA equivalent to # from ISIS "
Tabla 42 ARNdc dirigidos a la apolipoproteína B humana
Table 42 dsRNAs Targeting Human Apolipoprotein B
- nº de ISIS ISIS number
- Región SEQ ID NO DE LA DIANA SITIO DIANA Secuencia SEQ ID NO ARN equivalente a nº de ISIS Region SEQ ID NO OF THE DAILY DIANA SITE Sequence SEQ ID NO RNA equivalent to ISIS number
- 342855 342855
- codificante 3 3249 GCCUCAGUCUGCUUCGCACC 247 301012 coding 3 3249 GCCUCAGUCUGCUUCGCACC 247 301012
- 342856 342856
- 3' UTR 3 13903 GCUCACUGUAUGGUUUUAUC 262 301027 3 'UTR 3 13903 GCUCACUGUAUGGUUUUAUC 262 301027
- 342857 342857
- codificante 3 5589 AGGUUACCAGCCACAUGCAG 224 308361 coding 3 5589 AGGUUACCAGCCACAUGCAG 224 308361
- 342858 342858
- codificante 3 669 GAGCAGUUUCCAUACACGGU 130 270991 coding 3 669 GAGCAGUUUCCAUACACGGU 130 270991
- 342859 342859
- codificante 3 1179 CCUCUCAGCUCAGUAACCAG 135 270996 coding 3 1179 CCUCUCAGCUCAGUAACCAG 135 270996
- 342860 342860
- codificante 3 2331 GUAUAGCCAAAGUGGUCCAC 34 147797 coding 3 2331 GUAUAGCCAAAGUGGUCCAC 3. 4 147797
- 342861 342861
- codificante 3 3579 UAAGCUGUAGCAGAUGAGUC 213 281614 coding 3 3579 UAAGCUGUAGCAGAUGAGUC 213 281614
- 342862 342862
- 5' UTR 3 6 CAGCCCCGCAGGUCCCGGUG 249 301014 5 'UTR 3 6 CAGCCCCGCAGGUCCCGGUG 249 301014
- 342863 342863
- 5' UTR 3 116 GGUCCAUCGCCAGCUGCGGU 256 301021 5 'UTR 3 116 GGUCCAUCGCCAGCUGCGGU 256 301021
- 342864 342864
- 3' UTR 3 13910 AAGGCUGGCUCACUGUAUGG 266 301031 3 'UTR 3 13910 AAGGCUGGCUCACUGUAUGG 266 301031
- 342865 342865
- 3' UTR 3 13970 GCCAGCUUUGGUGCAGGUCC 273 301038 3 'UTR 3 13970 GCCAGCUUUGGUGCAGGUCC 273 301038
- 342866 342866
- codificante 3 426 UUGAAGCCAUACACCUCUUU 879 Ninguno coding 3 426 UUGAAGCCAUACACCUCUUU 879 None
- 342867 342867
- codificante 3 3001 UGACCAGGACUGCCUGUUCU 880 Ninguno coding 3 3001 UGACCAGGACUGCCUGUUCU 880 None
- 342868 342868
- codificante 3 5484 GAAUAGGGCUGUAGCUGUAA 881 Ninguno coding 3 5484 GAAUAGGGCUGUAGCUGUAA 881 None
- 342869 342869
- codificante 3 6662 UAUACUGAUCAAAUUGUAUC 882 Ninguno coding 3 6662 UAUACUGAUCAAAUUGUAUC 882 None
- 342870 342870
- codificante 3 8334 UGGAAUUCUGGUAUGUGAAG 883 Ninguno coding 3 8334 UGGAAUUCUGGUAUGUGAAG 883 None
- 342871 342871
- codificante 3 9621 AAAUCAAAUGAUUGCUUUGU 883 Ninguno coding 3 9621 AAAUCAAAUGAUUGCUUUGU 883 None
- 342872 342872
- codificante 3 10155 GUGAUGACACUUGAUUUAAA 885 Ninguno coding 3 10155 GUGAUGACACUUGAUUUAAA 885 None
- 342873 342873
- codificante 3 12300 GAAGCUGCCUCUUCUUCCCA 886 Ninguno coding 3 12300 GAAGCUGCCUCUUCUUCCCA 886 None
- 342874 342874
- codificante 3 113629 GAGAGUUGGUCUGAAAAAUC 887 Ninguno coding 3 113629 GAGAGUUGGUCUGAAAAAUC 887 None
Se ensayaron los efectos de los ARNdc de la tabla 42 en el ARNm de la apolipoproteína humana en células HepG2. The effects of the dsRNAs from Table 42 on the human apolipoprotein mRNA were tested in HepG2 cells.
5 Las células HepG2 se trataron con compuestos de ARNdc 100 nM mezclados con LIPOFECTIN 5 μg/ml (Invitrogen Corporation, Carlsbad, CA) durante un periodo de 16 h. En el mismo experimento, las células HepG2 también se trataron con un subconjunto de oligonucleótidos antisentido 150 nM descritos en la presente memoria mezclados con LIPOFECTIN 3,75 μg/ml; estos compuestos se indican en la Tabla 43. Los oligonucleótidos de control incluían ISIS 18078 (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 888). ISIS 18078 es un oligonucleótido quimérico HepG2 cells were treated with 100 nM dsRNA compounds mixed with 5 µg / ml LIPOFECTIN (Invitrogen Corporation, Carlsbad, CA) for a period of 16 h. In the same experiment, HepG2 cells were also treated with a subset of 150 nM antisense oligonucleotides described herein mixed with 3.75 µg / ml LIPOFECTIN; these compounds are listed in Table 43. Control oligonucleotides included ISIS 18078 (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 888). ISIS 18078 is a chimeric oligonucleotide
10 ("gápmero") de 20 nucleótidos de longitud, compuesto de una región de "hueco" central que consiste en 9 2'desoxinucleótidos, que está flanqueada en los extremos 5' y 3' por un "ala" de 5 nucleótidos y un "ala" de 6 nucleótidos, respectivamente. Las alas están compuestas por 2'-metoxietil (2'-MOE)-nucleótidos. Los enlaces internucleosídicos (cadena principal) son enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todas las citidinas son 5-metilcitidinas. El dúplex de ISIS 263188 (CUUCUGGCAUCCGGUUUAGTT, SEQ ID NO: 889) y su 20 nucleotide "gammer" 10, composed of a central "gap" region consisting of 9 2'-deoxynucleotides, which is flanked at the 5 'and 3' ends by a 5-nucleotide "wing" and a 6 nucleotide "wing", respectively. The wings are made up of 2'-methoxyethyl (2'-MOE) -nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidines are 5-methylcytidines. ISIS Duplex 263188 (CUUCUGGCAUCCGGUUUAGTT, SEQ ID NO: 889) and its
15 complementario también se usan como control. ISIS 263188 es un oligoribonucleótido de 21 nucleótidos de longitud siendo los 2 nucleótidos del extremo 3'-oligodesoxirribonucleótidos (TT) y con enlaces internucleósido fosfodiéster (cadena principal) a lo largo del compuesto. Supplementary 15 are also used as a control. ISIS 263188 is a 21 nucleotide long oligoribonucleotide with the 2 nucleotides being the 3'-oligodeoxyribonucleotide (TT) end and with internucleoside phosphodiester linkages (backbone) throughout the compound.
Las células se trataron durante 4 h, después de lo cual se midió la expresión del ARNm de la apolipoproteína B humana como se describe en los ejemplos en la presente memoria. Los resultados se normalizaron con respecto a Cells were treated for 4 hr, after which expression of human apolipoprotein B mRNA was measured as described in the examples herein. The results were normalized with respect to
20 las células de control no tratadas, las cuales no se trataron con LIPOFECTIN u oligonucleótido. Los datos son la media de 4 experimentos y se presentan en la tabla 43. The untreated control cells, which were not treated with LIPOFECTIN or oligonucleotide. Data are the average of 4 experiments and are presented in Table 43.
Tabla 43 Inhibición del ARNm de la apolipoproteína B por los ARNdc en células HepG2
Table 43 Inhibition of apolipoprotein B mRNA by dsRNA in HepG2 Cells
- nº de ISIS ISIS number
- Dosis % inhibición SEQ ID No Dose % inhibition SEQ ID No
- 342855 342855
- 100 nM 53 247 100 nM 53 247
- 342856 342856
- 100 nM 34 262 100 nM 3. 4 262
- 342857 342857
- 100 nM 55 224 100 nM 55 224
- 342858 342858
- 100 nM 44 130 100 nM 44 130
- 342859 342859
- 100 nM 23 135 100 nM 2. 3 135
- 342860 342860
- 100 nM 34 34 100 nM 3. 4 3. 4
- 342861 342861
- 100 nM 42 213 100 nM 42 213
- 342862 342862
- 100 nM 16 249 100 nM 16 249
- 342863 342863
- 100 nM 34 256 100 nM 3. 4 256
- 342864 342864
- 100 nM 53 266 100 nM 53 266
- 342865 342865
- 100 nM 50 273 100 nM fifty 273
- 342866 342866
- 100 nM 12 879 100 nM 12 879
- 342867 342867
- 100 nM 26 880 100 nM 26 880
- 342868 342868
- 100 nM 36 881 100 nM 36 881
- 342869 342869
- 100 nM 78 882 100 nM 78 882
- 342870 342870
- 100 nM 71 883 100 nM 71 883
- 342871 342871
- 100 nM 9 883 100 nM 9 883
- 342872 342872
- 100 nM 2 885 100 nM 2 885
- 342873 342873
- 100 nM 53 886 100 nM 53 886
- 342874 342874
- 100 nM 73 887 100 nM 73 887
- 281625 281625
- 150 nM 79 224 150 nM 79 224
- 301012 301012
- 150 nM 77 247 150 nM 77 247
- 301014 301014
- 150 nM 88 249 150 nM 88 249
- 301021 301021
- 150 nM 67 256 150 nM 67 256
- 301027 301027
- 150 nM 79 262 150 nM 79 262
- 301028 301028
- 150 nM 85 263 150 nM 85 263
- 301029 301029
- 150 nM 77 264 150 nM 77 264
- 301030 301030
- 150 nM 70 265 150 nM 70 265
- 301031 301031
- 150 nM 73 266 150 nM 73 266
- 301037 301037
- 150 nM 80 272 150 nM 80 272
- 301038 301038
- 150 nM 84 273 150 nM 84 273
- 301045 301045
- 150 nM 77 280 150 nM 77 280
- 263188 263188
- 150 nM 26 888 150 nM 26 888
- 18078 18078
- 150 nM 13 889 150 nM 13 889
Ejemplo 61 Example 61
5 Inhibición antisentido de la apolipoproteína B en hepatocitos primarios de macaco cangrejero 5 Antisense inhibition of apolipoprotein B in primary hepatocytes of crab-eating macaque
Como se demostró en el ejemplo 46, la región que contiene el sitio diana con el que hibrida ISIS 301012 comparte una identidad de 96% con la correspondiente región de la secuencia de ARNm de la apolipoproteína B del macaco cangrejero. ISIS 301012 contiene dos nucleótidos mal apareados con respecto a la secuencia de ARNm de la apolipoproteína B del macaco cangrejero con la que hibrida. En un aspecto adicional de la descripción, se diseñaron 10 oligonucleótidos para dirigirse al ARNm de la apolipoproteína B de mono, usando la secuencia parcial de la apolipoproteína B del macaco cangrejero descrita en la presente memoria (SEQ ID NO: 855) y una parte adicional de la secuencia de ARN de la apolipoproteína B de macaco cangrejero, incorporada en la presente memoria como SEQ ID NO: 890. El sitio diana indica el número del primer nucleótido (más 5') en la secuencia diana particular a la que se une el oligonucleótido. Para ISIS 326358 (GCCTCAGTCTGCTTTACACC, SEQ ID NO: 891) el sitio diana es 15 el nucleótido 168 de la SEQ ID NO: 855 y para ISIS 315089 (AGATTACCAGCCATATGCAG, SEQ ID NO: 892) el sitio diana es el nucleótido 19 de la SEQ ID NO: 890. ISIS 326358 e ISIS 315089 son oligonucleótidos quiméricos ("gápmeros") de 20 nucleótidos de longitud, compuestos de una región de "hueco" central que consiste en 10 2'desoxinucleótidos, que está flanqueada en ambos lados (direcciones 5' y 3') por "alas" de 5 nucleótidos. Las alas están compuestas por 2'-metoxietil (2'-MOE)-nucleótidos. Los enlaces internucleosídicos (cadena principal) son 20 enlaces fosforotioato (P=S) a lo largo de todo el oligonucleótido. Todos los residuos de citidina son 5-metilcitidinas. As demonstrated in Example 46, the region containing the target site to which ISIS 301012 hybridizes shares a 96% identity with the corresponding region of the crab-eating macaque apolipoprotein B mRNA sequence. ISIS 301012 contains two nucleotides mismatched with respect to the crab-eating macaque apolipoprotein B mRNA sequence with which it hybridizes. In a further aspect of the description, 10 oligonucleotides were designed to target the monkey apolipoprotein B mRNA, using the crab-eating macaque apolipoprotein B partial sequence described herein (SEQ ID NO: 855) and an additional part of the crab-eating macaque apolipoprotein B RNA sequence, incorporated herein as SEQ ID NO: 890. The target site indicates the number of the first nucleotide (plus 5 ') in the particular target sequence to which the oligonucleotide. For ISIS 326358 (GCCTCAGTCTGCTTTACACC, SEQ ID NO: 891) the target site is nucleotide 168 of SEQ ID NO: 855 and for ISIS 315089 (AGATTACCAGCCATATGCAG, SEQ ID NO: 892) the target site is nucleotide 19 of SEQ ID NO: 890. ISIS 326358 and ISIS 315089 are 20 nucleotide long chimeric oligonucleotides ("gammers"), composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (directions 5 'and 3') by 5 nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) -nucleotides. The internucleoside bonds (main chain) are 20 phosphorothioate bonds (P = S) throughout the entire oligonucleotide. All cytidine residues are 5-methylcytidines.
ISIS 326358 e ISIS 315089 son los equivalentes del macaco cangrejero de los oligonucleótidos antisentido para la apolipoproteína B humana ISIS 301012 (SEQ ID NO: 247) e ISIS 281625 (SEQ ID NO: 224), respectivamente. ISIS 326358 and ISIS 315089 are the crab macaque equivalents of the antisense oligonucleotides for human apolipoprotein B ISIS 301012 (SEQ ID NO: 247) and ISIS 281625 (SEQ ID NO: 224), respectively.
Se comparó la inhibición antisentido de ISIS 301012 con la de ISIS 326358, que tiene una correspondencia perfecta con la secuencia de la apolipoproteína B del macaco cangrejero con la que hibrida ISIS 301012. Se analizó el efecto 5 de los compuestos en los niveles de ARNm de la apolipoproteína B del macaco cangrejero en hepatocitos primarios de macaco cangrejero adquiridos en Vitro Technologies (Gaithersburg, MD). Los hepatocitos primarios de macaco cangrejero precultivados en placa se adquirieron en InVitro Technologies (Baltimore, MD). Las células se cultivaron en DMEM con alto contenido de glucosa (Invitrogen Corporation, Carlsbad, CA) complementado con suero bovino fetal al 10% (Invitrogen Corporation, Carlsbad, CA), 100 unidades/ml y 100 μg/ml de estreptomicina (Invitrogen The antisense inhibition of ISIS 301012 was compared with that of ISIS 326358, which has a perfect correspondence with the sequence of the crab-eating macaque apolipoprotein B with which hybridizes ISIS 301012. The effect 5 of the compounds on mRNA levels of Apolipoprotein B from crab macaque in primary hepatocytes of crab macaque purchased from Vitro Technologies (Gaithersburg, MD). Pre-cultured plaque macaque primary hepatocytes were purchased from InVitro Technologies (Baltimore, MD). Cells were grown in high glucose DMEM (Invitrogen Corporation, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitrogen Corporation, Carlsbad, CA), 100 units / ml and 100 µg / ml streptomycin (Invitrogen
10 Corporation, Carlsbad, CA). 10 Corporation, Carlsbad, CA).
Los hepatocitos primarios de macaco cangrejero se trataron con oligonucleótidos antisentido 10, 50, 150 ó 300 nM durante 48 h. ISIS 113529 (SEQ ID NO: 859) se usó como un oligonucleótido de control. Las células no tratadas también sirvieron de control. Los niveles de ARNm de la apolipoproteína B de macaco cangrejero se cuantificaron por PCR en tiempo real usando los cebadores de la apolipoproteína B humana y GAPDH y las sondas descritas en Primary crab macaque hepatocytes were treated with 10, 50, 150, or 300 nM antisense oligonucleotides for 48 h. ISIS 113529 (SEQ ID NO: 859) was used as a control oligonucleotide. Untreated cells also served as controls. Crab macaque apolipoprotein B mRNA levels were quantified by real-time PCR using the human apolipoprotein B and GAPDH primers and probes described in
15 los ejemplos en la presente memoria. Los resultados, mostrados en la tabla 44, son la media de 6 experimentos y se expresan como porcentaje de inhibición del ARNm de la apolipoproteína B normalizados con respecto a las células de control no tratadas. 15 the examples herein. The results, shown in Table 44, are the average of 6 experiments and are expressed as percent inhibition of apolipoprotein B mRNA normalized with respect to untreated control cells.
Tabla 44 Table 44
Inhibición del ARNm de la apolipoproteína B del macaco cangrejero por ISIS 301012 e ISIS 326358 Inhibition of crab-eating macaque apolipoprotein B mRNA by ISIS 301012 and ISIS 326358
- % de inhibición del ARNm de la apolipoproteína B % inhibition of apolipoprotein B mRNA
- nº de ISIS ISIS number
- Dosis de oligonucleótido Oligonucleotide dose
- Tiempo de tratamiento 326358 301012 113529 Treatment time 326358 301012 113529
- (horas) (hours)
- 10 nM 10 nM
- 24 35 24 N.D. 24 35 24 N.D.
- 48 48
- 85 76 N.D. 85 76 N.D.
- 50 nM 50 nM
- 24 66 60 N.D. 24 66 60 N.D.
- 48 48
- 88 77 N.D. 88 77 N.D.
- 150 nM 150 nM
- 24 61 56 5 24 61 56 5
- 48 48
- 82 88 42 82 88 42
- 300 nM 300 nM
- 24 64 61 19 24 64 61 19
- 48 48
- 87 86 13 87 86 13
Estos datos demuestran que tanto ISIS 326359 como ISIS 301012 (a pesar de dos apareamientos erróneos con la secuencia de la apolipoproteína B del macaco cangrejero) pueden inhibir la expresión del ARNm de la apolipoproteína B en hepatocitos primarios de macaco cangrejero, de una forma dependiente de la dosis y del tiempo. These data demonstrate that both ISIS 326359 and ISIS 301012 (despite two mismatches with the crab-eating macaque apolipoprotein B sequence) can inhibit apolipoprotein B mRNA expression in crab-eating macaque primary hepatocytes in a manner dependent on the dose and time.
25 Se midió la proteína apolipoproteína B secretada por hepatocitos primarios de macaco cangrejero tratados con oligonucleótido 150 y 300 nM por ELISA, usando un kit específico de proteína apolipoproteína B (ALerCHEK Inc., Portland, ME). Cada resultado representa la media de 3 experimentos. Los datos se normalizan respecto a las células de control no tratadas y se muestran en la tabla 45. The apolipoprotein B protein secreted by crab macaque primary hepatocytes treated with 150 and 300 nM oligonucleotide was measured by ELISA, using a specific apolipoprotein B protein kit (ALerCHEK Inc., Portland, ME). Each result represents the average of 3 experiments. The data is normalized with respect to the untreated control cells and is shown in Table 45.
Tabla 45 Table 45
30 Reducción de la proteína apolipoproteína B secretada por hepatocitos de macaco cangrejero después de tratamiento con oligonucleótido antisentido 30 Reduction of Apolipoprotein B Protein Secreted by Crab Macaque Hepatocytes After Treatment with Antisense Oligonucleotide
- % de reducción de la proteína apolipoproteína B secretada % reduction of secreted apolipoprotein B protein
- nº de ISIS ISIS number
- Dosis de oligonucleótido Oligonucleotide dose
- Tiempo de tratamiento (horas) 326358 301012 113529 Treatment time (hours) 326358 301012 113529
- 150 nM 150 nM
- 24 21 31 11 24 twenty-one 31 eleven
- 48 48
- 29 25 18 29 25 18
- 300 nM 300 nM
- 24 17 10 12 24 17 10 12
- 48 48
- 35 17 8 35 17 8
Estos resultados demuestran que la inhibición antisentido por ISIS 301012 e ISIS 326358 conduce a una disminución de la secreción de la proteína apolipoproteína B de hepatocitos de macaco cangrejero primarios cultivados. These results demonstrate that antisense inhibition by ISIS 301012 and ISIS 326358 leads to decreased secretion of apolipoprotein B protein from cultured primary crab-eating macaque hepatocytes.
Además, la proteína se aisló de los hepatocitos de macaco cangrejero primarios tratados con oligonucleótido y se sometieron a análisis de inmunotransferencia para evaluar mejor la expresión de la proteína apolipoproteína B. La inmunotransferencia se realizó como se describe en la presente memoria, usando un anticuerpo contra la proteína apolipoproteína B humana (US Biologicals, Swampscott, MA). El análisis de inmunotransferencia de la expresión de la apolipoproteína B después del tratamiento con oligonucleótido antisentido con ISIS 326358 e ISIS 301012 pone de manifiesto una reducción sustancial de la expresión de la apolipoproteína B. In addition, the protein was isolated from oligonucleotide-treated primary crab macaque hepatocytes and subjected to immunoblot analysis to better assess apolipoprotein B protein expression. Immunoblotting was performed as described herein using an anti-antibody the human apolipoprotein B protein (US Biologicals, Swampscott, MA). Immunoblot analysis of apolipoprotein B expression after treatment with antisense oligonucleotide with ISIS 326358 and ISIS 301012 reveals a substantial reduction in apolipoprotein B expression.
En un aspecto adicional de la descripción, se comparó la inhibición antisentido por ISIS 281625 con la de ISIS 315089, que es una correspondencia perfecta con la secuencia de la apolipoproteína B del macaco cangrejero con la que hibrida ISIS 281625. Hepatocitos primarios de macaco cangrejero, cultivados como se describe en la presente memoria, se trataron con ISIS 315089 o ISIS 281625, 10, 50, 150 ó 300 nM durante 24 h. Las células se trataron con el oligonucleótido de control ISIS 13650 (SEQ ID NO: 806) 150 y 300 nM o con ISIS 113529 (SEQ ID NO: 859) 300 nM. Las células no tratadas también sirvieron de control. Se cuantificaron los niveles de ARNm de la apolipoproteína B en los hepatocitos primarios de macaco cangrejero usando la PCR en tiempo real con cebadores y sonda humanos como se describe en otros ejemplos en la presente memoria. Los resultados, mostrados en la tabla 46, son la media de 3 experimentos y se expresan como porcentaje de inhibición del ARNm de la apolipoproteína B normalizados con respecto a las células de control no tratadas. Cuando está presente, un "+" que precede al valor indica que aumentó la expresión de ARNm. In a further aspect of the description, the antisense inhibition by ISIS 281625 was compared with that of ISIS 315089, which is a perfect correspondence with the sequence of apolipoprotein B of the crab-eating macaque with that hybridizing ISIS 281625. Crab macaque primary hepatocytes, grown as described herein, treated with ISIS 315089 or ISIS 281625, 10, 50, 150, or 300 nM for 24 h. Cells were treated with the 150 and 300 nM ISIS 13650 control oligonucleotide (SEQ ID NO: 806) or with 300 nM ISIS 113529 (SEQ ID NO: 859). Untreated cells also served as controls. Apolipoprotein B mRNA levels in crab-eating macaque primary hepatocytes were quantified using real-time PCR with human primers and probe as described in other examples herein. The results, shown in Table 46, are the average of 3 experiments and are expressed as percent inhibition of apolipoprotein B mRNA normalized with respect to untreated control cells. When present, a "+" preceding the value indicates increased mRNA expression.
Tabla 46 Table 46
Inhibición antisentido de la expresión del ARNm de la apolipoproteína B en hepatocitos de macaco cangrejero Antisense inhibition of apolipoprotein B mRNA expression in crab-eating macaque hepatocytes
- % de inhibición del ARNm de la apolipoproteína B % inhibition of apolipoprotein B mRNA
- nº de ISIS ISIS number
- Dosis de oligonucleótido Oligonucleotide dose
- 315089 281625 13650 113529 315089 281625 13650 113529
- 10 nM 10 nM
- 70 +5 N.D. N.D. 70 +5 N.D. N.D.
- 50 nM 50 nM
- 83 41 N.D. N.D. 83 41 N.D. N.D.
- 150 nM 150 nM
- 81 35 +50 N.D. 81 35 +50 N.D.
- 300 nM 300 nM
- 82 69 33 28 82 69 33 28
Estos datos demuestran que tanto ISIS 315089 como ISIS 281625 pueden inhibir la expresión del ARNm de la apolipoproteína B en hepatocitos primarios de macaco cangrejero, de una forma dependiente de la dosis. These data demonstrate that both ISIS 315089 and ISIS 281625 can inhibit apolipoprotein B mRNA expression in primary crab macaque hepatocytes in a dose-dependent manner.
Se midió la proteína apolipoproteína B secretada por hepatocitos primarios de macaco cangrejero tratados con ISIS 315089 e ISIS 281625, 50 y 150 nM, por ELISA usando un kit específico de la proteína apolipoproteína B (ALerCHEK Inc., Portland, ME). Cada resultados representa la media de 3 experimentos. Los datos se normalizan respecto a las células de control no tratadas y se muestran en la tabla 47. The apolipoprotein B protein secreted by crab macaque primary hepatocytes treated with ISIS 315089 and ISIS 281625, 50 and 150 nM, was measured by ELISA using a specific kit for apolipoprotein B protein (ALerCHEK Inc., Portland, ME). Each results represents the average of 3 experiments. The data is normalized with respect to the untreated control cells and is shown in Table 47.
Tabla 47 Table 47
Reducción de la proteína apolipoproteína B secretada por hepatocitos de macaco cangrejero después de tratamiento con oligonucleótido antisentido Reduction of Apolipoprotein B Protein Secreted by Crab Macaque Hepatocytes After Treatment with Antisense Oligonucleotide
- % de reducción de la secreción de proteína apolipoproteína B de mono % reduction in monkey apolipoprotein B protein secretion
- nº de ISIS ISIS number
- Dosis de oligonucleótido Oligonucleotide dose
- 315089 281625 13650 113529 315089 281625 13650 113529
- 50 nM 50 nM
- 11 6 16 N.D. eleven 6 16 N.D.
- 150 nM 150 nM
- 25 13 13 12 25 13 13 12
Estos resultados demuestran que la inhibición antisentido por ISIS 315089 150 mM conduce a una disminución de la secreción de la proteína apolipoproteína B de hepatocitos de macaco cangrejero primarios cultivados. These results demonstrate that 150 mM ISIS 315089 antisense inhibition leads to decreased secretion of apolipoprotein B protein from cultured primary crab-eating macaque hepatocytes.
También se ensayaron los efectos de ISIS 271009 (SEQ ID NO: 319) e ISIS 301027 (SEQ ID NO: 262) en el ARNm de la apolipoproteína B y expresión de proteína en hepatocitos primarios de macaco cangrejero. Las células cultivadas como se describe en la presente memoria, se trataron con ISIS 271009 o ISIS 301027, 10, 50 y 150 nM durante 24 h. Las células se trataron con el oligonucleótido de control ISIS 113529 (SEQ ID NO: 859) 150 nM. Las células no tratadas también sirvieron de control. Se cuantificaron los niveles de ARNm de la apolipoproteína B en los hepatocitos primarios de macaco cangrejero usando la PCR en tiempo real con cebadores y sonda humanos como se describe en otros ejemplos en la presente memoria. Los resultados, mostrados en la tabla 48, son la media de 2 The effects of ISIS 271009 (SEQ ID NO: 319) and ISIS 301027 (SEQ ID NO: 262) on apolipoprotein B mRNA and protein expression in primary hepatocytes of crab macaque were also tested. Cells grown as described herein were treated with ISIS 271009 or ISIS 301027, 10, 50, and 150 nM for 24 hr. The cells were treated with the 150 nM ISIS 113529 control oligonucleotide (SEQ ID NO: 859). Untreated cells also served as controls. Apolipoprotein B mRNA levels in crab-eating macaque primary hepatocytes were quantified using real-time PCR with human primers and probe as described in other examples herein. The results, shown in Table 48, are the mean of 2
experimentos y se expresan como porcentaje de inhibición del ARNm de la apolipoproteína B normalizados con respecto a las células de control no tratadas. Tabla 48 Inhibición antisentido de la expresión del ARNm de la apolipoproteína B en hepatocitos de macaco cangrejero experiments and are expressed as percent inhibition of apolipoprotein B mRNA normalized with respect to untreated control cells. Table 48 Antisense inhibition of apolipoprotein B mRNA expression in crab-eating macaque hepatocytes
- % de inhibición del ARNm de la apolipoproteína B % inhibition of apolipoprotein B mRNA
- nº de ISIS ISIS number
- Dosis de oligonucleótido Oligonucleotide dose
- 271009 301027 113529 271009 301027 113529
- 10 nM 10 nM
- 42 40 N.D. 42 40 N.D.
- 50 nM 50 nM
- 66 54 N.D. 66 54 N.D.
- 150 nM 150 nM
- 69 67 11 69 67 eleven
Estos datos demuestran que tanto ISIS 271009 como ISIS 301027 pueden inhibir la expresión del ARNm de la apolipoproteína B en hepatocitos primarios de macaco cangrejero, de una forma dependiente de la dosis. These data demonstrate that both ISIS 271009 and ISIS 301027 can inhibit apolipoprotein B mRNA expression in primary crab macaque hepatocytes in a dose-dependent manner.
Se midió la proteína apolipoproteína B secretada por hepatocitos primarios de macaco cangrejero tratados con ISIS 271009 e ISIS 301027, 50 y 150 nM, por ELISA usando un kit específico de la proteína apolipoproteína B (ALerCHEK Inc., Portland, ME). Cada resultados representa la media de 3 experimentos. Los datos se muestran como porcentaje de reducción de la proteína secretada, normalizados con respecto a las células de control no tratadas y se muestran en la tabla 49. Cuando está presente, un "+" indica que la secreción de proteína era mayor. The apolipoprotein B protein secreted by crawler macaque primary hepatocytes treated with ISIS 271009 and ISIS 301027, 50 and 150 nM, was measured by ELISA using a specific kit for apolipoprotein B protein (ALerCHEK Inc., Portland, ME). Each results represents the average of 3 experiments. Data are shown as percent reduction of secreted protein, normalized relative to untreated control cells, and are shown in Table 49. When present, a "+" indicates that protein secretion was higher.
Tabla 49 Table 49
Reducción de la proteína apolipoproteína B secretada por hepatocitos de macaco cangrejero después de tratamiento con oligonucleótido antisentido Reduction of Apolipoprotein B Protein Secreted by Crab Macaque Hepatocytes After Treatment with Antisense Oligonucleotide
- % de reducción de la secreción de proteína apolipoproteína B de mono % reduction in monkey apolipoprotein B protein secretion
- nº de ISIS ISIS number
- Dosis de oligonucleótido Oligonucleotide dose
- 271009 301027 13650 113529 271009 301027 13650 113529
- 50 nM 50 nM
- +30 25 N.D. N.D. +30 25 N.D. N.D.
- 150 nM 150 nM
- 26 31 +1 15 26 31 +1 fifteen
Estos resultados demuestran que la inhibición antisentido por ISIS 315089 e ISIS 281625 conduce a una disminución de la secreción de la proteína apolipoproteína B de hepatocitos de macaco cangrejero primarios cultivados. These results demonstrate that antisense inhibition by ISIS 315089 and ISIS 281625 leads to decreased secretion of apolipoprotein B protein from cultured primary crab macaque hepatocytes.
Ejemplo 62 Example 62
Métodos para evaluar la esteatosis hepática Methods for evaluating liver steatosis
La esteatosis hepática se refiere a la acumulación de lípidos en el hígado o "hígado graso", que es producida con frecuencia por el consumo de alcohol, diabetes e hiperlipidemia. Se evaluó en los hígados de animales tratados con oligonucleótidos antisentido dirigidos a la apolipoproteína B la presencia de esteatosis. La esteatosis se evalúa por análisis histológico de tejido hepático y medida de los niveles de triglicéridos en el hígado. Hepatic steatosis refers to the accumulation of lipids in the liver, or "fatty liver," which is frequently caused by alcohol consumption, diabetes, and hyperlipidemia. The presence of steatosis was evaluated in the livers of animals treated with antisense oligonucleotides directed at apolipoprotein B. Steatosis is evaluated by histological analysis of liver tissue and measurement of triglyceride levels in the liver.
El tejido reseccionado del hígado se sumerge inmediatamente en compuesto de inmersión Tissue Tek OCT (Ted Pella, Inc., Redding, CA) y se congela en una suspensión de hielo seco de 2-metil-butano. Las secciones de tejido se cortan con un grosor de 4-5 μm y después se fijan en formalina tamponada neutra al 5%. Las secciones de tejido se tiñen con hematoxilina y eosina siguiendo procedimientos histológicos estándar para visualizar los núcleos y citoplasma, respectivamente, y rojo oleoso O de acuerdo con las instrucciones del fabricante (Newcomers Supply, Middleton, WI) para visualizar los lípidos. The resected liver tissue is immediately dipped in Tissue Tek OCT dipping compound (Ted Pella, Inc., Redding, CA) and frozen in a 2-methyl-butane dry ice suspension. The tissue sections are cut 4-5 µm thick and then fixed in 5% neutral buffered formalin. The tissue sections are stained with hematoxylin and eosin following standard histological procedures to visualize the nuclei and cytoplasm, respectively, and oily red O according to the manufacturer's instructions (Newcomers Supply, Middleton, WI) to visualize lipids.
Alternativamente, los tejidos se fijan en formalina tamponada neutra al 10%, se sumergen en parafina, se cortan en secciones de 4-5 μm de grosor, se desparafinan y se tiñen con hematoxilina y eosina, todo de acuerdo con procedimientos histológicos estándar. Alternatively, the tissues are fixed in 10% neutral buffered formalin, dipped in paraffin, cut into sections 4-5 µm thick, deparaffinized, and stained with hematoxylin and eosin, all according to standard histological procedures.
También se usa la cuantificación del contenido de triglicéridos para evaluar la estatosis. Los niveles de triglicéridos en los tejidos se miden usando un ensayo GPO de triglicéridos (Sigma-Aldrich, St. Louis, MO). Triglyceride content quantification is also used to assess statosis. Tissue triglyceride levels are measured using a GPO triglyceride assay (Sigma-Aldrich, St. Louis, MO).
Ejemplo 63 Example 63
Efectos de la inhibición antisentido por ISIS 301012 en ratones magros: estudio a largo plazo Effects of antisense inhibition by ISIS 301012 in lean mice: long-term study
La toxicidad de ISIS 301012 (SEQ ID NO: 247) se investiga en un estudio de 3 meses, a largo plazo, en ratones. Se administra a ratones CD-1 macho y hembra, de 2 meses de edad (Charles River Laboratories, Wilmington, MA) 2, 5, 12,5, 25 ó 50 mg/kg de ISIS 301012 dos veces por semana durante la primera semana, y después cada 4 días. Los ratones se mantienen con una dieta de roedores estándar. Los animales con disolución salina u oligonucleótido de control sirven como controles y las inyecciones siguen el mismo esquema. Cada grupo de tratamiento contiene de 6 a 10 ratones de cada sexo, y cada grupo de tratamiento está por duplicado, un grupo para terminar el estudio en 1 mes, el otro para terminar el estudio en 3 meses. Después de los periodos de tratamiento de 1 ó 3 meses, los ratones son sacrificados y se evalúa la expresión de la diana en el hígado, los niveles de lípidos en el suero y los indicadores de toxicidad. Se obtienen muestras de hígado, se aísla el ARN y se mide la expresión del ARNm de la apolipoproteína B por la PCR en tiempo real como se describe en otros ejemplos en la presente memoria. Los lípidos en el suero, incluyendo el colesterol total, colesterol LDL, colesterol HDL y triglicéridos se evaluaron mediante análisis clínicos rutinarios usando un analizador clínico Olympus (Olympus America Inc., Melville, NY). También se calcularon las relaciones de colesterol LDL a colesterol HDL y de colesterol total a colesterol HDL. El análisis de ALT y AST en el suero, infiltrados inflamatorios en el tejido y gránulos basófilos en el tejido proporcionan una evaluación de las toxicidades relacionadas con el tratamiento. La esteatosis hepática, o acumulación de lípidos en el hígado, se evalúa mediante análisis histológicos de rutina con tinción con rojo oleoso O y la medición de triglicéridos en el tejido hepático, usando un ensayo GPO de triglicéridos (Sigma-Aldrich, St. Louis, MO). The toxicity of ISIS 301012 (SEQ ID NO: 247) is investigated in a 3-month, long-term study in mice. 2-month-old male and female CD-1 mice (Charles River Laboratories, Wilmington, MA) are administered 2, 5, 12.5, 25 or 50 mg / kg ISIS 301012 twice weekly for the first week , and then every 4 days. Mice are kept on a standard rodent diet. Animals with saline or control oligonucleotide serve as controls and injections follow the same schedule. Each treatment group contains 6 to 10 mice of each sex, and each treatment group is in duplicate, one group to complete the study in 1 month, the other to complete the study in 3 months. After the treatment periods of 1 or 3 months, the mice are sacrificed and the expression of the target in the liver, the lipid levels in the serum and the indicators of toxicity are evaluated. Liver samples are obtained, RNA is isolated, and apolipoprotein B mRNA expression is measured by real-time PCR as described in other examples herein. Serum lipids including total cholesterol, LDL cholesterol, HDL cholesterol, and triglycerides were evaluated by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY). The ratios of LDL cholesterol to HDL cholesterol and total cholesterol to HDL cholesterol were also calculated. Analysis of ALT and AST in serum, inflammatory tissue infiltrates, and basophilic granules in tissue provide an assessment of treatment-related toxicities. Hepatic steatosis, or lipid accumulation in the liver, is assessed by routine histological analysis with oil-red O staining and measurement of triglycerides in liver tissue, using a GPO triglyceride assay (Sigma-Aldrich, St. Louis, MO).
El estudio de toxicidad también incluye grupos de animales que se dejan recuperar tras cesar el tratamiento con oligonucleótido. Se tratan ratones CD-1 tanto machos como hembras (Charles River Laboratories, Wilmington, MA) con 5, 10, 50 mg/kg de ISIS 301012 dos veces por semana durante la primera semana y después cada 4 días. Los animales a los que se inyectó disolución salina y oligonucleótido de control sirven como controles. Cada grupo de tratamiento incluye 6 animales por sexo. Después de 3 meses de tratamiento, los animales permanecen sin tratamiento durante 3 meses adicionales, después de los cuales se sacrifican. Se evalúan los mismos parámetros que en los ratones sacrificados inmediatamente después de 3 meses de tratamiento. The toxicity study also includes groups of animals that are allowed to recover after cessation of oligonucleotide treatment. Both male and female CD-1 mice (Charles River Laboratories, Wilmington, MA) are treated with 5, 10, 50 mg / kg ISIS 301012 twice weekly for the first week and every 4 days thereafter. Animals injected with saline and control oligonucleotide serve as controls. Each treatment group includes 6 animals per sex. After 3 months of treatment, the animals remain untreated for an additional 3 months, after which they are euthanized. The same parameters are evaluated as in the sacrificed mice immediately after 3 months of treatment.
Después de 1 mes de tratamiento, la cuantificación por PCR en tiempo real pone de manifiesto que los niveles de ARNm de la apolipoproteína B en el hígado se reducen en 53%. Además, se observaron las toxicidades de dosisrespuesta esperadas. Los niveles de ALT y AST, medidos por procedimientos clínicos rutinarios en un analizador clínico Olympus (Olympus America Inc., Melville, NY), son mayores en ratones tratados con 25 ó 50 mg/kg de ISIS 301012. Los tejidos se prepararon para el análisis por procedimientos histológicos rutinarios. Se observaron gránulos basófilos en el hígado y tejido de riñón con dosis de ISIS 301012 superiores a 12,5 mg/kg. Se observaron infiltrados linfohistocitarios en diferentes tejidos con dosis mayores de 12,5 mg/kg de ISIS 301012. La tinción de las secciones de tejido con rojo oleoso O pone de manifiesto que no hay estatosis después de los tratamientos con oligonucleótido. After 1 month of treatment, real-time PCR quantification shows that apolipoprotein B mRNA levels in the liver are reduced by 53%. In addition, the expected dose response toxicities were observed. ALT and AST levels, measured by routine clinical procedures on an Olympus clinical analyzer (Olympus America Inc., Melville, NY), are highest in mice treated with 25 or 50 mg / kg ISIS 301012. The tissues were prepared for the analysis by routine histological procedures. Basophilic granules were observed in the liver and kidney tissue with doses of ISIS 301012 greater than 12.5 mg / kg. Lymphohistocytic infiltrates were observed in different tissues with doses greater than 12.5 mg / kg of ISIS 301012. Staining of the tissue sections with oil red O shows that there is no statosis after the oligonucleotide treatments.
Ejemplo 64 Example 64
Efectos de la inhibición antisentido por ISIS 301012 en macacos cangrejeros magros: estudio a largo plazo Effects of antisense inhibition by ISIS 301012 in lean crabeater macaques: long-term study
Como se describe en el ejemplo 45, se usan macacos cangrejeros (machos o hembras) para evaluar el potencial de los oligonucleótidos antisentido para reducir los niveles de proteína o ARNm de la apolipoproteína B, así como criterios de valoración fenotípicos asociados con la apolipoproteína B incluyendo, pero sin limitar, indicadores cardiovasculares, aterosclerosis, enfermedades lipídicas, obesidad y formación de placa. Por consiguiente, en una realización adicional de la invención, se investigan los efectos de ISIS 301012 (SEQ ID NO: 247) en un estudio a largo plazo en la expresión de la apolipoproteína B y los lípidos en el suero en macacos cangrejeros. Dicho estudio a largo plazo también se usa para evaluar la toxicidad de los compuestos antisentido. As described in Example 45, crab-eating macaques (male or female) are used to assess the potential of antisense oligonucleotides to reduce apolipoprotein B protein or mRNA levels, as well as phenotypic endpoints associated with apolipoprotein B including , but without limitation, cardiovascular indicators, atherosclerosis, lipid diseases, obesity and plaque formation. Accordingly, in a further embodiment of the invention, the effects of ISIS 301012 (SEQ ID NO: 247) are investigated in a long-term study on the expression of apolipoprotein B and serum lipids in crab-eating macaques. Such a long-term study is also used to assess the toxicity of antisense compounds.
Se tratan macacos cangrejeros machos y hembra con 2, 4 ó 12 mg/kg de ISIS 301012 por vía intravenosa, o con 2 ó 20 mg/kg por vía subcutánea con una frecuencia de cada dos días la primera semana, y después cada 4 días, durante periodos de 1 y 3 meses de tratamiento. Los animales tratados con disolución salina sirven como controles. Cada grupo de tratamiento incluye de 2 a 3 animales de cada sexo. Male and female crab macaques are treated with 2, 4 or 12 mg / kg of ISIS 301012 intravenously, or with 2 or 20 mg / kg subcutaneously every two days the first week, and then every 4 days thereafter. , during periods of 1 and 3 months of treatment. Animals treated with saline solution serve as controls. Each treatment group includes 2 to 3 animals of each sex.
Con un intervalo de un mes y a los 3 meses de la terminación del estudio, se sacrifican los animales y se evalúa la expresión de la diana en el hígado, los niveles de lípidos en suero y los indicadores de toxicidad. Se obtienen muestras de hígado, se aísla el ARN y se mide la expresión del ARNm de la apolipoproteína B por la PCR en tiempo real como se describe en otros ejemplos en la presente memoria. Los lípidos en el suero, incluyendo el colesterol total, colesterol LDL, colesterol HDL y triglicéridos se evaluaron mediante análisis clínicos rutinarios usando un analizador clínico Olympus (Olympus America Inc., Melville, NY). También se calcularon las relaciones de colesterol LDL a colesterol HDL y de colesterol total a colesterol HDL. El análisis de ALT y AST en el suero, infiltrados inflamatorios en el tejido y gránulos basófilos en el tejido proporcionan una evaluación de las toxicidades relacionadas con el tratamiento. La esteatosis hepática, o acumulación de lípidos en el hígado, se evalúa mediante análisis histológicos de rutina con tinción con Oil Red O y la medición de triglicéridos en el tejido hepático, usando un At one month interval and 3 months after the end of the study, the animals are sacrificed and the expression of the target in the liver, serum lipid levels and toxicity indicators are evaluated. Liver samples are obtained, RNA is isolated, and apolipoprotein B mRNA expression is measured by real-time PCR as described in other examples herein. Serum lipids including total cholesterol, LDL cholesterol, HDL cholesterol, and triglycerides were evaluated by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY). The ratios of LDL cholesterol to HDL cholesterol and total cholesterol to HDL cholesterol were also calculated. Analysis of ALT and AST in serum, inflammatory tissue infiltrates, and basophilic granules in tissue provide an assessment of treatment-related toxicities. Hepatic steatosis, or lipid accumulation in the liver, is assessed by routine histological analysis with Oil Red O staining and measurement of triglycerides in liver tissue, using a
ensayo GPO de triglicéridos (Sigma-Aldrich, St. Louis, MO). GPO triglyceride assay (Sigma-Aldrich, St. Louis, MO).
Los grupos de tratamiento adicionales, consistían en 2 animales por sexo, que se tratan con disolución salina (0 mg/kg), 12 ó 20 mg/kg de ISIS 301012 con una frecuencia de cada dos días durante la primera semana, y después cada 4 días, durante un periodo de 3 meses. Después del periodo de tratamiento, los animales no reciben tratamiento durante 3 meses adicionales. Estos grupos de tratamiento están dirigidos al estudio de los efectos de la inhibición de la apolipoproteína B 3 meses después de cesar el tratamiento. Al final del periodo de recuperación de 3 meses, los animales se sacrifican y se evalúan los mismos parámetros que en los animales sacrificados inmediatamente después de 1 y 3 meses de tratamiento. Additional treatment groups consisted of 2 animals per sex, treated with saline (0 mg / kg), 12 or 20 mg / kg ISIS 301012 every other day for the first week, and then every 4 days, over a period of 3 months. After the treatment period, animals are not treated for an additional 3 months. These treatment groups are aimed at studying the effects of apolipoprotein B inhibition 3 months after stopping treatment. At the end of the 3-month recovery period, animals are euthanized and the same parameters as for animals euthanized immediately after 1 and 3 months of treatment are evaluated.
Los resultados procedentes del intervalo de un mes del tratamiento a largo plazo, se muestran en la Tabla 50 y están normalizados con respecto a animales tratados con disolución salina, para el ARNm y respecto a los valores de referencia no tratados, para los niveles de lípidos. Los niveles en suero de colesterol total, colesterol LDL, colesterol HDL, concentración de partículas de LDL y triglicéridos se midieron por espectroscopia de resonancia magnética nuclear mediante Liposcience (Raleigh, NC). Además, la concentración de oligonucleótido intacto en el hígado se midió mediante electroforesis en gel capilar y se presenta como microgramos de oligonucleótido por gramo de tejido hepático. Cada resultado representa el promedio de los datos de 4 animales (2 machos y 2 hembras). The results from the one-month interval of long-term treatment are shown in Table 50 and are normalized with respect to saline-treated animals, for mRNA and with respect to untreated reference values, for lipid levels . Serum levels of total cholesterol, LDL cholesterol, HDL cholesterol, LDL particle concentration, and triglycerides were measured by nuclear magnetic resonance spectroscopy using Liposcience (Raleigh, NC). Furthermore, the concentration of intact oligonucleotide in the liver was measured by capillary gel electrophoresis and is presented as micrograms of oligonucleotide per gram of liver tissue. Each result represents the average of the data from 4 animals (2 males and 2 females).
Tabla 50 Table 50
Efectos de la inhibición antisentido por ISIS 301012 en macacos cangrejeros magros: Effects of antisense inhibition by ISIS 301012 in lean crabeater macaques:
- Administración intravenosa Intravenous administration
- Inyección subcutánea Subcutaneous injection
- 2 mg/kg 2 mg / kg
- 4 mg/kg 12 mg/kg 3,5 mg/kg 20 mg/kg 4 mg / kg 12 mg / kg 3.5 mg / kg 20 mg / kg
- % de cambio de la expresión de la apolipoproteína B normalizado respecto a la disolución salina % change in expression of apolipoprotein B normalized with respect to saline
- -45 -76 -96 N.D. -94 -Four. Five -76 -96 N.D. -94
- Concentración del oligonucleótido antisentido μg/g Concentration of the antisense oligonucleotide μg / g
- 92 179 550 N.D. 855 92 179 550 N.D. 855
- Parámetros lipídicos, % de cambio normalizado frente al valor de referencia no tratado Lipid parameters,% change normalized against the untreated reference value
- Disolución salina 2 mg/kg 4 mg/kg 12 mg/kg 3,5 mg/kg 20 mg/kg Saline dissolution 2 mg / kg 4 mg / kg 12 mg / kg 3.5 mg / kg 20 mg / kg
- Colesterol total Total cholesterol
- +1 -6 -2 -2 +5 -5 +1 -6 -2 -2 +5 -5
- Colesterol LDL LDL cholesterol
- +17 +15 +9 +3 -4 -16 +17 +15 +9 +3 -4 -16
- Colesterol HDL HDL cholesterol
- -11 -23 -15 -8 +13 +5 -eleven -2. 3 -fifteen -8 +13 +5
- LDL/HDL LDL / HDL
- +62 +94 +38 +44 -15 -19 +62 +94 +38 +44 -fifteen -19
- Colesterol total/HDL Total / HDL cholesterol
- +30 +44 +22 +21 -7 -10 +30 +44 +22 +21 -7 -10
- Triglicérido Triglyceride
- +37 +26 +32 +15 +1 -3 +37 +26 +32 +15 +1 -3
- Concentración de partículas de LDL LDL particle concentration
- +15 +8 +8 -11 -14 -21 +15 +8 +8 -eleven -14 -twenty-one
Estos datos muestran que ISIS 301012 inhibe la expresión de la apolipoproteína B de una manera dependiente de la dosis en una especie de primates y de forma concomitante disminuye los niveles de lípidos con dosis más altas de ISIS 301012. Además, estos resultados demuestran que el oligonucleótido antisentido se acumula en el hígado de una forma dependiente de la dosis. These data show that ISIS 301012 inhibits apolipoprotein B expression in a dose-dependent manner in a primate species and concomitantly lowers lipid levels with higher doses of ISIS 301012. Furthermore, these results demonstrate that the oligonucleotide Antisense accumulates in the liver in a dose-dependent manner.
No se observó esteatosis hepática, o acumulación de lípidos en el hígado, después de 4 semanas de tratamiento con las dosis indicadas. Se observó una toxicidad esperada relacionada con la dosis, con las dosis más altas de 12 y 20 mg/kg, incluyendo un incremento transitorio de 1,2-1,3 veces en el tiempo de la tromboplastina parcial activada (APTT), durante las primeras 4 horas y gránulos basófilos en el hígado y el riñón (tal y como se determinó con un examen histológico de rutina con muestras de tejidos). No se observaron cambios funcionales en el riñón. No hepatic steatosis, or lipid accumulation in the liver, was observed after 4 weeks of treatment with the indicated doses. Expected dose-related toxicity, with the highest doses of 12 and 20 mg / kg, including a 1.2-1.3 fold transient increase in time of activated partial thromboplastin (APTT), was observed during the first 4 hours and basophilic granules in the liver and kidney (as determined by routine histological examination with tissue samples). No functional changes were observed in the kidney.
En un experimento similar, monos cangrejeros machos y hembras recibieron una dosis intravenosa de ISIS 301012 de 4 mg/kg, cada dos días durante la primera semana y después cada 4 días. Los grupos de animales se sacrificaron después de la primera dosis y la cuarta dosis, así como los días 11, 15 y 23 después de la cuarta dosis y la dosis final. Se aisló el ARN del hígado y se evaluaron los niveles de ARNm de la apolipoproteína B por PCR en tiempo real como se describe en la presente memoria. Los resultados de este experimento demuestran una reducción del 40% en la expresión del ARNm de la apolipoproteína B después de una dosis intravenosa única de 4 mg/kg de ISIS 301012. Además, después de 4 dosis de ISIS 301012 de 4 mg/kg, el ARNm diana se redujo en aproximadamente 85% y se mantuvo una reducción del 50% en el ARNm diana hasta 16 días después del cese del tratamiento con el oligonucleótido antisentido. In a similar experiment, male and female crab-eating monkeys received an intravenous dose of ISIS 301012 of 4 mg / kg, every other day for the first week and every 4 days thereafter. The groups of animals were sacrificed after the first dose and the fourth dose, as well as on days 11, 15 and 23 after the fourth dose and the final dose. RNA was isolated from the liver and apolipoprotein B mRNA levels were assessed by real-time PCR as described herein. The results of this experiment demonstrate a 40% reduction in apolipoprotein B mRNA expression after a single 4 mg / kg intravenous dose of ISIS 301012. In addition, after 4 doses of 4 mg / kg ISIS 301012, target mRNA was reduced by approximately 85% and a 50% reduction in target mRNA was maintained for up to 16 days after cessation of treatment with the antisense oligonucleotide.
Ejemplo 65 Example 65
Análisis de micromatrices: patrones de expresión génica en ratones magros frente a ratones alimentados con alto contenido de grasa Microarray analysis: gene expression patterns in lean mice vs. high-fat fed mice
Ratones C57B1/6 se dividieron en los siguientes grupos, que consistían en 5 animales cada uno: (1) ratones con dieta magra, a los que se inyecta disolución salina (control magros); (2) ratones con una dieta con alto contenido en grasa; (3) ratones con una dieta con alto contenido en grasa a los que se inyectan 50 mg/kg del oligonucleótido de control 141923 (SEQ ID NO: 858); (4) ratones con una dieta con alto contenido en grasa a los que se les dan 20 mg/kg de atorvastatina de calcio (Lipitor®, Pfizer Inc.); (5) ratones con una dieta con alto contenido en grasa a los que se inyectan 10, 25 ó 50 mg/kg de ISIS 147764 (SEQ ID NO: 109). Los tratamientos con disolución salina y oligonucleótido se administraron por vía intraperitoneal dos veces por semana durante 6 semanas. La atorvastatina se administró diariamente durante 6 semanas. Al terminar el estudio, se aislaron muestras de hígado de cada animal y se aisló el ARN para la evaluación cualitativa por transferencia Northern, micromatriz de ADN y PCR en tiempo real cuantitativa. La evaluación por transferencia Northern y la PCR en tiempo real cuantitativa se realizaron como se describe en otros ejemplos en la presente memoria. C57B1 / 6 mice were divided into the following groups, consisting of 5 animals each: (1) mice on a lean diet, injected with saline (lean control); (2) mice on a high fat diet; (3) mice on a high fat diet injected with 50 mg / kg of control oligonucleotide 141923 (SEQ ID NO: 858); (4) mice on a high fat diet given 20 mg / kg atorvastatin calcium (Lipitor®, Pfizer Inc.); (5) high-fat diet mice injected with 10, 25, or 50 mg / kg ISIS 147764 (SEQ ID NO: 109). The saline and oligonucleotide treatments were administered intraperitoneally twice a week for 6 weeks. Atorvastatin was administered daily for 6 weeks. At the end of the study, liver samples were isolated from each animal and RNA was isolated for qualitative evaluation by Northern blotting, DNA microarray and quantitative real-time PCR. Northern blot evaluation and quantitative real-time PCR were performed as described in other examples herein.
Para el análisis de micromatrices de ADN, se prepararon muestras de hibridación a partir de 10 μg de ARN total aislado de cada hígado de ratón de acuerdo con el manual técnico de análisis de expresión de Affymetrix (Affymetrix, Inc., Santa Clara, CA). Las muestras se hibridaron con un chip de genes de ratón que contenía aproximadamente 22.000 genes, que posteriormente se lavó, se tiñó doblemente usando Fluidics Station 400 (Affymetrix, Inc., Santa Clara, CA) como define el protocolo del fabricante. Se hizo un barrido de los chips teñidos de la intensidad celular de la sonda con el escáner GeneArray (Affymetrix, Inc., Santa Clara, CA). Se calcularon los valores de las señales de cada conjunto de sondas usando el software de Affymetrix Microarray Suite v5.0 (Affymetrix, Inc., Santa Clara, CA). Se hizo el perfil de cada condición a partir de 5 muestras biológicas por grupo, un chip por muestra. El número de cambios de la expresión se computó usando la media geométrica de los valores de la señal Microarray Suite v5.0. El análisis estadístico usaba ANOVA de una vía seguido de 9 comparaciones por parejas. Todos los grupos se compararon con el grupo de alto contenido de grasa para determinar los cambios en la expresión génica que resultan del tratamiento con ISIS 147764. Los datos de las micromatrices se interpretaron usando una agrupación jerárquica para visualizar los patrones de expresión génica globales. For DNA microarray analysis, hybridization samples were prepared from 10 µg of total RNA isolated from each mouse liver according to the Affymetrix Expression Analysis Technical Manual (Affymetrix, Inc., Santa Clara, CA) . Samples were hybridized to a mouse gene chip containing approximately 22,000 genes, which was subsequently washed, double stained using Fluidics Station 400 (Affymetrix, Inc., Santa Clara, CA) as defined by the manufacturer's protocol. The cell intensity stained chips of the probe were scanned with the GeneArray scanner (Affymetrix, Inc., Santa Clara, CA). The signal values of each probe set were calculated using the Affymetrix Microarray Suite v5.0 software (Affymetrix, Inc., Santa Clara, CA). Each condition was profiled from 5 biological samples per group, one chip per sample. The number of changes in the expression was computed using the geometric mean of the Microarray Suite v5.0 signal values. Statistical analysis used one-way ANOVA followed by 9 pairwise comparisons. All groups were compared to the high fat group to determine changes in gene expression resulting from treatment with ISIS 147764. Microarray data was interpreted using a hierarchical grouping to visualize global gene expression patterns.
Los resultados de los análisis de micromatrices pusieron de manifiesto que el tratamiento con ISIS 147764 lleva el perfil de expresión génica en los ratones alimentados con alto contenido en grasa al perfil observado en los ratones magros. El análisis por PCR en tiempo real confirmó la reducción de la expresión del ARNm para los siguientes genes implicados en el metabolismo de lípidos: lipasa hepática, casete de unión a ATP sintasa de ácidos grasos, miembro 2 de la subfamilia D (ALD), proteína de unión a ácidos grasos intestinales 2, estearoil-CoA desaturasa-1 y HMG CoA reductasa. The results of microarray analyzes revealed that treatment with ISIS 147764 brings the gene expression profile in high-fat fed mice to the profile observed in lean mice. Real-time PCR analysis confirmed the reduction of mRNA expression for the following genes involved in lipid metabolism: hepatic lipase, fatty acid ATP synthase binding cassette, member 2 of subfamily D (ALD), protein of binding to intestinal fatty acids 2, stearoyl-CoA desaturase-1 and HMG CoA reductase.
Se evaluaron los niveles de ARNm de la apolipoproteína B de ratón y de colesterol en el suero como se describe en la presente memoria, para confirmar la inhibición antisentido por ISIS 147764 e ISIS 147483. Tanto los niveles de ARNm como los de colesterol disminuyeron de una forma dependiente de la dosis después de tratamiento con ISIS 147764 o ISIS 147483, como se demuestra en otros ejemplos en la presente memoria. La dosis de 50 mg/kg de ISIS 147483 aumentó los niveles de ALT y AST. Las dosis de 10, 25 y 50 mg/kg de ISIS 147764 y las dosis de 10 y 25 mg/kg de ISIS 147483 no elevaron significativamente los niveles de ALT o AST. Serum cholesterol and mouse apolipoprotein B mRNA levels were evaluated as described herein to confirm antisense inhibition by ISIS 147764 and ISIS 147483. Both mRNA and cholesterol levels decreased by one dose dependent form after treatment with ISIS 147764 or ISIS 147483, as demonstrated in other examples herein. The 50 mg / kg dose of ISIS 147483 increased ALT and AST levels. The 10, 25, and 50 mg / kg doses of ISIS 147764 and the 10 and 25 mg / kg doses of ISIS 147483 did not significantly elevate ALT or AST levels.
Ejemplo 66 Example 66
Evaluación de la esteatosis hepática en animales tratados con oligonucleótidos antisentido de la apolipoproteína B Evaluation of hepatic steatosis in animals treated with apolipoprotein B antisense oligonucleotides
Se evaluó en los hígados de animales tratados con oligonucleótidos antisentido dirigidos a la apolipoproteína B la presencia de esteatosis. La esteatosis se evalúa por análisis histológico de tejido hepático y medida de los niveles de triglicéridos en el hígado. The presence of steatosis was evaluated in the livers of animals treated with antisense oligonucleotides directed at apolipoprotein B. Steatosis is evaluated by histological analysis of liver tissue and measurement of triglyceride levels in the liver.
Evaluación de la esteatosis en animales alimentados con alto contenido en grasa, tratados con ISIS 147764 durante 6 semanas Evaluation of steatosis in animals fed with high fat content, treated with ISIS 147764 for 6 weeks
Se evaluó en el tejido hepático de animales tratados con ISIS 147764 (SEQ ID NO: 109) y de control descritos en el ejemplo 21, la esteatosis al terminar el estudio después de 6 semanas de tratamiento. Se tiñeron secciones de tejido con rojo oleoso O y hematoxilina para visualizar los lípidos y núcleos respectivamente. También se tiñeron secciones de tejidos con hematoxilina y eosina para visualizar los núcleos y el citoplasma, respectivamente. El análisis histológico de secciones de tejidos teñidas por cualquiera de los métodos puso de manifiesto que no había diferencia en la esteatosis entre los animales tratados con disolución salina y los tratados con ISIS 147764, demostrando que un tratamiento de 6 semanas con ISIS 147764 no conduce a la acumulación de lípidos en el hígado. Steatosis at the end of the study after 6 weeks of treatment was evaluated in the liver tissue of animals treated with ISIS 147764 (SEQ ID NO: 109) and control described in Example 21. Tissue sections were stained with oily red O and hematoxylin to visualize the lipids and nuclei respectively. Tissue sections were also stained with hematoxylin and eosin to visualize the nuclei and cytoplasm, respectively. Histological analysis of tissue sections stained by either method revealed that there was no difference in steatosis between animals treated with saline and those treated with ISIS 147764, demonstrating that a 6-week treatment with ISIS 147764 does not lead to lipid accumulation in the liver.
Evaluación de la esteatosis después de tratamiento a largo plazo con inhibidor de la apolipoproteína B en animales alimentados con alto contenido en grasa Evaluation of steatosis after long-term treatment with apolipoprotein B inhibitor in animals fed with high fat content
Se trataron ratones macho C57B1/6 dos veces por semana con inyecciones intraperitoneales de 25 mg/kg de ISIS 147764 (SEQ ID NO: 109) o 25 mg/kg de ISIS 141923 (SEQ ID NO: 858) durante 6, 12 y 20 semanas. Los animales tratados con disolución salina sirvieron como controles. Cada grupo de tratamiento contenía 4 animales. Los animales se sacrificaron a las 6, 12 y 20 semanas y se obtuvo tejido hepático para el análisis histológico y la 5 medición del contenido de triglicéridos en el tejido. Los resultados pusieron de manifiesto que no había diferencias significativas en el contenido de triglicéridos del tejido hepático cuando se comparan los animales tratados con ISIS 147764 con los animales tratados con disolución salina. Además, los análisis histológicos de la sección de tejido hepático demuestran que la esteatosis se reduce a las 12 y 20 semanas después de tratamiento de los ratones alimentados con alto contenido en grasa, con ISIS 147764, en comparación con los animales de control de Male C57B1 / 6 mice were treated twice weekly with intraperitoneal injections of 25 mg / kg ISIS 147764 (SEQ ID NO: 109) or 25 mg / kg ISIS 141923 (SEQ ID NO: 858) for 6, 12, and 20 weeks. Animals treated with saline solution served as controls. Each treatment group contained 4 animals. Animals were sacrificed at 6, 12 and 20 weeks and liver tissue was obtained for histological analysis and measurement of the triglyceride content in the tissue. The results showed that there were no significant differences in the triglyceride content of liver tissue when comparing animals treated with ISIS 147764 with animals treated with saline. Furthermore, histological analyzes of the liver tissue section demonstrate that steatosis is reduced at 12 and 20 weeks after treatment of high-fat-fed mice with ISIS 147764, compared to control animals.
10 disolución salina que recibieron una dieta con alto contenido en grasa. 10 saline that received a high fat diet.
Evaluación de la estatosis en ratones magros Assessment of statosis in lean mice
También se evaluó la acumulación de lípidos en el tejido hepático en ratones magros. Ratones macho C67B1/6 (Charles River Laboratories (Wilmington, MA) de 6 a 7 semanas de edad, se mantuvieron con una dieta de roedor estándar y se trataron dos veces por semana con inyecciones intraperitoneales de 25 ó 50 mg/kg de 147764 (SEQ Lipid accumulation in liver tissue was also evaluated in lean mice. Male C67B1 / 6 mice (Charles River Laboratories (Wilmington, MA) 6 to 7 weeks old, maintained on a standard rodent diet and treated twice weekly with 25 or 50 mg / kg intraperitoneal injections of 147764 ( I KNOW THAT
15 ID NO: 109) o 147483 (SEQ ID NO: 79) durante 6 semanas. Los animales tratados con disolución salina sirvieron como controles. Cada grupo de tratamiento estaba compuesto de 4 animales. Los animales se sacrificaron después del periodo de tratamiento de 6 semanas, momento en el que se recogieron el tejido hepático y el suero. 15 ID NO: 109) or 147483 (SEQ ID NO: 79) for 6 weeks. Animals treated with saline solution served as controls. Each treatment group was composed of 4 animals. Animals were sacrificed after the 6 week treatment period, at which time liver tissue and serum were collected.
Se midieron los niveles de ARNm de la apolipoproteína B por PCR en tiempo real, como se describe en otros ejemplos en la presente memoria. Los datos mostrados en la tabla 51, representan la media de 4 animales y se Apolipoprotein B mRNA levels were measured by real-time PCR, as described in other examples herein. The data shown in Table 51 represent the mean of 4 animals and are
20 presentan como la inhibición con respecto a los controles tratados con disolución salina. Los resultados demuestran que tanto ISIS 147483 como ISIS 147764 inhiben la expresión del ARNm de la apolipoproteína B en ratones magros, de una forma dependiente de la dosis. 20 present as the inhibition with respect to the controls treated with saline solution. The results demonstrate that both ISIS 147483 and ISIS 147764 inhibit apolipoprotein B mRNA expression in lean mice in a dose-dependent manner.
Tabla 51 Table 51
Inhibición antisentido de ARNm de la apolipoproteína B en ratones magros Antisense inhibition of apolipoprotein B mRNA in lean mice
- Tratamiento y dosis Treatment and dosage
- ISIS ISIS
- ISIS ISIS
- 147483 147483
- 147764 147764
- 25 mg/kg 25 mg / kg
- 50 mg/kg 25 mg/kg 50 mg/kg 50 mg / kg 25 mg / kg 50 mg / kg
- % de inhibición del ARNm de la apolipoproteína B % inhibition of apolipoprotein B mRNA
- 79 91 48 77 79 91 48 77
El colesterol total, colesterol LDL, colesterol HDL y triglicéridos en el suero se midieron por análisis clínico rutinario usando un analizador clínico Olympus (Olympus America Inc., Melville, NY). Las enzimas hepáticas ALT y ALT en el suero también se midieron usando el analizador clínico Olympus. Estos resultados demuestran que ISIS 147764 disminuye los lípidos en el suero con respecto a los animales de control tratados con disolución salina. Los niveles Total cholesterol, LDL cholesterol, HDL cholesterol, and serum triglycerides were measured by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY). ALT and ALT liver enzymes in serum were also measured using the Olympus clinical analyzer. These results demonstrate that ISIS 147764 lowers serum lipids relative to control animals treated with saline. The levels
30 de ALT y AST no superan el intervalo normal para ratones (300 IU/l), indicando falta de toxicidad asociada al tratamiento. Los resultados son la media de los datos de 4 animales y se muestran en la tabla 52. 30 of ALT and AST do not exceed the normal range for mice (300 IU / l), indicating lack of toxicity associated with treatment. The results are the mean of the data from 4 animals and are shown in Table 52.
Tabla 52 Table 52
Niveles de lípidos y enzimas hepáticas en el suero en ratones magros tratados con ISIS 147764 e ISIS 147483 Serum lipid and liver enzyme levels in lean mice treated with ISIS 147764 and ISIS 147483
- Tratamiento y dosis Treatment and dosage
- Disolución salina Saline dissolution
- ISIS 147483 ISIS 147764 ISIS 147483 ISIS 147764
- 25 25
- 50 25 50 fifty 25 fifty
- mg/kg mg / kg
- mg/kg mg / kg
- mg/kg mg / kg
- mg/kg mg / kg
- Lípidos en el suero Lipids in serum
- Colesterol total mg/dl Total cholesterol mg / dl
- 164 153 183 114 57 164 153 183 114 57
- Colesterol LDL mg/dl LDL cholesterol mg / dl
- 25 26 39 29 18 25 26 39 29 18
- Colesterol HDL mg/dl HDL cholesterol mg / dl
- 127 117 131 79 38 127 117 131 79 38
- Triglicéridos mg/dl Triglycerides mg / dl
- 121 138 127 80 30 121 138 127 80 30
- Enzimas hepáticas Hepatic enzymes
- ALT IU/l ALT IU / l
- 105 73 57 47 48 105 73 57 47 48
- AST IU/l AST IU / l
- 109 78 72 81 101 109 78 72 81 101
35 Se preparó tejido hepático por métodos histológicos rutinarios para evaluar la estatosis, como se describe en la presente memoria. El examen de muestras de tejido teñidas con rojo oleoso O o hematoxilina y eosina, pone de manifiesto que el tratamiento de ratones magros con oligonucleótidos antisentido para apolipoproteína B no produce estatosis. Liver tissue was prepared by routine histological methods to assess statosis, as described herein. Examination of tissue samples stained with oily red O or hematoxylin and eosin shows that treatment of lean mice with antisense oligonucleotides for apolipoprotein B does not produce statosis.
Estudio de 6 meses para evaluar mejor la estatosis en ratones tratados con oligonucleótidos antisentido para la apolipoproteína B 6-month study to better assess statosis in mice treated with apolipoprotein B antisense oligonucleotide
Se usa un tratamiento a largo plazo de ratones con oligonucleótidos antisentido dirigidos a la apolipoproteína B para evaluar los efectos tóxicos y farmacológicos del tratamiento prolongado con compuestos antisentido. Se tratan ratones C57B1/6 tanto machos como hembras a los 2 meses de edad con 2, 5, 25 ó 50 mg/kg de oligonucleótido antisentido de la apolipoproteína B. Los tratamientos se administran por vía intraperitoneal cada 2 días durante la primera semana y después cada 4 días. Los ratones con disolución salina solo u oligonucleótido de control sirven como grupos de control. Cada grupo de tratamiento contiene de 25 a 30 ratones. Después de 6 meses de tratamiento, se sacrifica un subconjunto de ratones en cada grupo de tratamiento. Al resto de los ratones se les deja un periodo de recuperación de 3 meses sin tratamiento, después de lo cual se sacrifican. Se mide la expresión del ARNm de la apolipoproteína B por PCR en tiempo real como se describe para otros métodos en la presente memoria. También se prepara tejido hepático para medir el contenido de triglicéridos usando el ensayo GPO de triglicéridos (Sigma-Aldrich, St. Louis, MO). Se recoge suero y se evalúa el contenido de lípidos, incluyendo el colesterol total, colesterol LDL, colesterol HDL y triglicéridos, usando un analizador clínico Olympus (Olympus America Inc., Melville, NY). También se miden las enzimas hepáticas ALT y AST en el suero, usando también el analizador clínico. Las muestras de suero se someten a análisis de inmunotransferencia usando un anticuerpo dirigido a la apolipoproteína B (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Los tejidos hepático, de riñón y otros se preparan por procedimientos rutinarios para los análisis histológicos. Se evalúa en los tejidos la presencia de gránulos basófilos e infiltrado inflamatorios. La esteatosis se evalúa por tinción con rojo oleoso O de las secciones de tejido hepático. Long-term treatment of mice with apolipoprotein B-directed antisense oligonucleotides is used to assess the toxic and pharmacological effects of prolonged treatment with antisense compounds. Male and female C57B1 / 6 mice at 2 months of age are treated with 2, 5, 25, or 50 mg / kg apolipoprotein B antisense oligonucleotide. Treatments are administered intraperitoneally every 2 days for the first week and then every 4 days. Mice with saline alone or control oligonucleotide serve as control groups. Each treatment group contains 25 to 30 mice. After 6 months of treatment, a subset of mice is sacrificed in each treatment group. The rest of the mice are left a recovery period of 3 months without treatment, after which they are sacrificed. Apolipoprotein B mRNA expression is measured by real-time PCR as described for other methods herein. Liver tissue is also prepared to measure triglyceride content using the GPO Triglyceride Assay (Sigma-Aldrich, St. Louis, MO). Serum is collected and lipid content, including total cholesterol, LDL cholesterol, HDL cholesterol, and triglycerides, is evaluated using an Olympus clinical analyzer (Olympus America Inc., Melville, NY). ALT and AST liver enzymes in serum are also measured, also using the clinical analyzer. Serum samples are subjected to immunoblot analysis using an antibody directed to apolipoprotein B (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Liver, kidney and other tissues are prepared by routine procedures for histological analysis. Tissues are evaluated for the presence of inflammatory basophilic granules and infiltrates. Steatosis is assessed by staining with oil red O of liver tissue sections.
Ejemplo 67 Example 67
Un modelo de ratón para la formación de placa aterosclerótica: ratones transgénicos para la apolipoproteína B que carecen del gen del receptor de LDL A mouse model for atherosclerotic plaque formation: apolipoprotein B transgenic mice lacking the LDL receptor gene
El receptor de LDL es responsable de eliminar las partículas de LDL que contienen apolipoproteína B. Sin el receptor de LDL, los animales no pueden eliminar eficazmente las partículas de LDL que contienen apolipoproteína B del plasma. Por lo tanto los niveles en el plasma de apolipoproteína B y colesterol LDL son notablemente elevados. Se usan tanto ratones que expresan el transgén de la apolipoproteína B humana (TgN-hApoB +/+) como ratones deficientes para el receptor de LDL (LDLr -/-) como modelos animales de desarrollo de placa aterosclerótica. Cuando el genotipo de deficiencia de receptor de LDL se combina con el genotipo transgénico de apolipoproteína B humana (TgN-hApoB +/+; LDLr -/-), se desarrollan rápidamente placas ateroscleróticas. Los ratones con este contexto genético se usan para investigar la capacidad de los compuestos para prevenir la aterosclerosis y la formación de placa. The LDL receptor is responsible for removing apolipoprotein B-containing LDL particles. Without the LDL receptor, animals cannot effectively remove apolipoprotein B-containing LDL particles from plasma. Therefore, plasma levels of apolipoprotein B and LDL cholesterol are remarkably high. Both mice expressing the human apolipoprotein B transgene (TgN-hApoB + / +) and LDL receptor deficient (LDLr - / -) mice are used as animal models of development of atherosclerotic plaque. When the LDL receptor deficiency genotype is combined with the human apolipoprotein B transgenic genotype (TgN-hApoB + / +; LDLr - / -), atherosclerotic plaques develop rapidly. Mice with this genetic background are used to investigate the ability of the compounds to prevent atherosclerosis and plaque formation.
Ratones macho TgN-hApoB +/+;LDLr -/-se tratan dos veces por semana con 10 ó 20 mg/kg de oligonucleótidos antisentido para la apolipoproteína B durante 12 semanas. Los grupos de control se tratan con disolución salina o con oligonucleótido de control. El colesterol total en el suero, colesterol HDL, colesterol LDL y triglicéridos se miden a las 2, 4, 6, 8 y 12 semanas mediante análisis clínico rutinario usando un analizador clínico Olympus (Olympus America Inc., Melville, NY). Se mide la proteína apolipoproteína B humana en el suero a las 2, 4, 6, 8 y 12 semanas usando un kit de ELISA (ALerCHEK Inc., Portland, ME). El ARNm de la apolipoproteína humana y de ratón en el hígado se mide a las 12 semanas. Los resultados del estudio de 12 semanas sirven para evaluar el comportamiento farmacológico de ISIS 301012 en un modelo doblemente transgénico. Male TgN-hApoB + / +; LDLr - / - mice are treated twice weekly with 10 or 20 mg / kg antisense oligonucleotide for apolipoprotein B for 12 weeks. Control groups are treated with either saline or control oligonucleotide. Total serum cholesterol, HDL cholesterol, LDL cholesterol, and triglycerides are measured at 2, 4, 6, 8, and 12 weeks by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY). Human apolipoprotein B protein is measured in serum at 2, 4, 6, 8, and 12 weeks using an ELISA kit (ALerCHEK Inc., Portland, ME). The human and mouse apolipoprotein mRNA in the liver is measured at 12 weeks. The results of the 12-week study serve to evaluate the pharmacological behavior of ISIS 301012 in a double transgenic model.
Además, se lleva a cabo un estudio de 4 meses en ratones TgN-hApoB +/+;LDLr -/-, con las condiciones de tratamiento usadas en el estudio de 12 semanas. Los ratones se tratan durante 4 meses con oligonucleótidos antisentido dirigidos contra la apolipoproteína B humana para evaluar la capacidad de dichos compuestos para prevenir la formación de placa aterosclerótica. Al final del periodo de tratamiento de 4 meses, los ratones se anestesian y se perfunden con formalina al 10%. Se aísla el árbol arterial perfundido y se examina la presencia de placas ateroscleróticas. Se sumergen en parafina secciones del árbol arterial y se preparan para el análisis histológico usando modelos rutinarios. El colesterol total en el suero, colesterol HDL, colesterol LDL y triglicéridos se miden a las 2, 4, 6, 8, 12 y 16 semanas mediante análisis clínico rutinario usando un analizador clínico Olympus (Olympus America Inc., Melville, NY). Se mide la proteína apolipoproteína B humana en el suero a las 2, 4, 6, 8, 12 y 16 semanas usando un kit de ELISA (ALerCHEK Inc., Portland, ME). Se mide el ARNm de apolipoproteína humana y de ratón en el hígado a las 16 semanas por PCR en tiempo real. In addition, a 4-month study was conducted in TgN-hApoB + / +; LDLr - / - mice, with the treatment conditions used in the 12-week study. Mice are treated for 4 months with antisense oligonucleotides directed against human apolipoprotein B to assess the ability of such compounds to prevent atherosclerotic plaque formation. At the end of the 4 month treatment period, the mice are anesthetized and perfused with 10% formalin. The perfused arterial tree is isolated and the presence of atherosclerotic plaques is examined. Sections of the arterial tree are paraffinized and prepared for histological analysis using routine models. Total serum cholesterol, HDL cholesterol, LDL cholesterol, and triglycerides are measured at 2, 4, 6, 8, 12, and 16 weeks by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY). Human apolipoprotein B protein is measured in serum at 2, 4, 6, 8, 12, and 16 weeks using an ELISA kit (ALerCHEK Inc., Portland, ME). Mouse and human apolipoprotein mRNA in the liver is measured at 16 weeks by real-time PCR.
Ejemplo 68 Example 68
Modelos de conejo para estudiar la formación de placa aterosclerótica Rabbit models to study atherosclerotic plaque formation
Se usa la variedad de conejo Watanabe con hiperlipidemia heredable (WHHL) como modelo para la formación de placa aterosclerótica. También se usaron conejos blancos de Nueva Zelanda con una dieta con alto contenido en grasa como modelo de la formación de placa aterosclerótica. El tratamiento de los conejos WHHL o los conejos blancos de Nueva Zelanda alimentados con alto contenido en grasa, con compuestos antisentido para la apolipoproteína B, se usa para ensayar su potencial como tratamientos terapéuticos o profilácticos para la enfermedad de placa aterosclerótica. Se inyecta a los conejos 5, 10, 25 ó 50 mg/kg de oligonucleótidos antisentido dirigidos a la apolipoproteína B. Los animales tratados con disolución salina sola o un oligonucleótido de control sirven como controles. A lo largo del tratamiento se recogen muestras de suero y se evalúan los niveles de proteína apolipoproteína B por ELISA (kit de ALerCHEK Inc., Portland, ME) y los lípidos en el suero (colesterol, colesterol LDL, colesterol VLDL, colesterol HDL, triglicéridos) por análisis clínico rutinario. El contenido de triglicéridos del tejido hepático se mide usando un ensayo GPO de triglicéridos (Sigma-Aldrich, St. Louis, MO). Se obtienen tejidos de hígado, riñón, corazón, aorta y otros tejidos y se procesan para el análisis histológico usando procedimientos rutinarios. Se examina en los tejidos de hígado y riñón las pruebas de gránulos basófilos e infiltrados inflamatorios. Se evalúa en el tejido hepático la esteatosis usando teñido con rojo oleoso O. Además, se examinan secciones aórticas teñidas con rojo oleoso O y hematoxilina para evaluar la formación de lesiones ateroscleróticas. The Watanabe rabbit variety with inheritable hyperlipidemia (WHHL) is used as a model for atherosclerotic plaque formation. New Zealand white rabbits on a high-fat diet were also used as a model of atherosclerotic plaque formation. Treatment of WHHL rabbits or New Zealand white rabbits fed high fat content with antisense compounds for apolipoprotein B is used to test their potential as therapeutic or prophylactic treatments for atherosclerotic plaque disease. Rabbits are injected with 5, 10, 25, or 50 mg / kg apolipoprotein B-targeted antisense oligonucleotides. Animals treated with saline alone or a control oligonucleotide serve as controls. Throughout the treatment serum samples are collected and the levels of apolipoprotein B protein are evaluated by ELISA (kit from ALerCHEK Inc., Portland, ME) and the lipids in the serum (cholesterol, LDL cholesterol, VLDL cholesterol, HDL cholesterol, triglycerides) by routine clinical analysis. Liver tissue triglyceride content is measured using a GPO triglyceride assay (Sigma-Aldrich, St. Louis, MO). Tissues from liver, kidney, heart, aorta, and other tissues are obtained and processed for histological analysis using routine procedures. Tests for basophil granules and inflammatory infiltrates are examined in liver and kidney tissues. Steatosis is evaluated in liver tissue using O-red staining. In addition, aortic sections stained with O-red O and hematoxylin are examined to assess the formation of atherosclerotic lesions.
Ejemplo 69 Example 69
Suministro oral de inhibidores de la apolipoproteína B Oral supply of apolipoprotein B inhibitors
Los oligonucleótidos se pueden formular para el suministro in vivo en una forma farmacéutica aceptable, p. ej., como formulaciones parenterales o no parenterales. Las formulaciones parenterales incluyen formulaciones intravenosa (IV), subcutánea (SC), intraperitoneal (IP), intravítrea e intramuscular (IM), así como formulaciones para el suministro por inhalación pulmonar, administración intranasal, administración tópica, etc. Las formulaciones no parenterales incluyen formulaciones para el suministro por el canal alimentario, p. ej., administración oral, administración rectal, instilación intrayeyunal etc. La administración rectal incluye administración como un enema o un supositorio. La administración oral incluye la administración de una cápsula, una cápsula de gel, una píldora, un elixir, etc. Oligonucleotides can be formulated for in vivo delivery in an acceptable dosage form, e.g. eg, as parenteral or non-parenteral formulations. Parenteral formulations include intravenous (IV), subcutaneous (SC), intraperitoneal (IP), intravitreal and intramuscular (IM) formulations, as well as formulations for delivery by pulmonary inhalation, intranasal administration, topical administration, etc. Non-parenteral formulations include formulations for delivery via the alimentary canal, e.g. eg, oral administration, rectal administration, intrajejunal instillation etc. Rectal administration includes administration such as an enema or a suppository. Oral administration includes the administration of a capsule, a gel capsule, a pill, an elixir, etc.
En algunas realizaciones, se puede administrar un oligonucleótido a un sujeto por una vía de administración oral. El sujeto puede ser un animal o un ser humano (hombre). Un sujeto animal puede ser un mamífero, tal como un ratón, rata, ratón, una rata, un perro, un cobaya, un mono, un primate no humano, un gato o un cerdo. Los primates no humanos incluyen monos y chimpancés. Un sujeto animal adecuado puede ser un animal experimental, tal como un ratón, rata, ratón, una rata, un perro, un mono, un primate no humano, un gato o un cerdo. In some embodiments, an oligonucleotide can be administered to a subject by an oral route of administration. The subject can be an animal or a human being (man). An animal subject may be a mammal, such as a mouse, rat, mouse, rat, dog, guinea pig, monkey, non-human primate, cat, or pig. Non-human primates include monkeys and chimpanzees. A suitable animal subject can be an experimental animal, such as a mouse, rat, mouse, rat, dog, monkey, non-human primate, cat, or pig.
En algunas realizaciones, el sujeto puede ser un ser humano. En algunas realizaciones, el sujeto puede ser un paciente humano que necesita tratamiento terapéutico como se discute con más detalle en la presente memoria. En algunas realizaciones, el sujeto puede necesitar la modulación de la expresión de uno o más genes como se discute con más detalle en la presente memoria. En algunas realizaciones particulares, el sujeto puede necesitar la inhibición de la expresión de uno o más genes como se discute con más detalle en la presente memoria. En particular, el sujeto puede necesitar la modulación, es decir, inhibición o potenciación, de la apolipoproteína B con el fin de obtener las indicaciones terapéuticas discutidas con más detalle en la presente memoria. In some embodiments, the subject may be a human. In some embodiments, the subject may be a human patient in need of therapeutic treatment as discussed in more detail herein. In some embodiments, the subject may require modulation of the expression of one or more genes as discussed in more detail herein. In some particular embodiments, the subject may require inhibition of the expression of one or more genes as discussed in more detail herein. In particular, the subject may need modulation, i.e., inhibition or potentiation, of apolipoprotein B in order to obtain the therapeutic indications discussed in more detail herein.
En algunas realizaciones, las formulaciones de oligonucleótidos no parenterales (p. ej., orales) según la presente invención, producen una biodisponibilidad potenciada del oligonucleótido. En este contexto, el término "biodisponibilidad" se refiere a una medición de la porción de un fármaco administrado que llega al sistema circulatorio (por ejemplo, la sangre, especialmente el plasma sanguíneo) cuando se emplea un modo particular de administración para suministrar el fármaco. La biodisponibilidad potenciada se refiere a la capacidad de un modo de administración particular de suministrar el oligonucleótido al plasma de la sangre periférica de un sujeto, con respecto a otro modo de administración. Por ejemplo, cuando se usa un modo de administración no parenteral (p. ej., un modo oral) para introducir el fármaco en un sujeto, la biodisponibilidad para ese modo de administración se puede comparar con un modo diferente de administración, p. ej., un modo de administración IV. En algunas realizaciones, el área bajo la curva de la concentración del compuesto en el plasma sanguíneo (AUC0) después de la administración no parenteral (p. ej. oral, rectal, intrayeyunal) se puede dividir entre el área bajo la curva de la concentración de fármaco en el plasma después de administración intravenosa (i.v.) (AUCiv) para proporcionar un cociente adimensional (biodisponibilidad relativa, RB) que representa la fracción de compuesto absorbida por una ruta no parenteral comparado con la ruta IV. Se dice que la biodisponibilidad de una composición está potenciada en comparación con la biodisponibilidad de otra composición, cuando la biodisponibilidad relativa de la primera composición (RB1) es mayor que la biodisponibilidad relativa de la segunda composición (RB2). In some embodiments, the non-parenteral (eg, oral) oligonucleotide formulations according to the present invention produce enhanced bioavailability of the oligonucleotide. In this context, the term "bioavailability" refers to a measurement of the portion of an administered drug that reaches the circulatory system (eg, blood, especially blood plasma) when a particular mode of administration is employed to deliver the drug. . Enhanced bioavailability refers to the ability of a particular mode of administration to deliver the oligonucleotide to a subject's peripheral blood plasma, relative to another mode of administration. For example, when a non-parenteral mode of administration (eg, an oral mode) is used to introduce the drug into a subject, the bioavailability for that mode of administration can be compared to a different mode of administration, eg. eg, an IV mode of administration. In some embodiments, the area under the curve of the concentration of the compound in blood plasma (AUC0) after non-parenteral administration (eg oral, rectal, intrajejunal) can be divided by the area under the concentration curve of drug in plasma after intravenous (iv) administration (AUCiv) to provide a dimensionless ratio (relative bioavailability, RB) representing the fraction of compound absorbed by a non-parenteral route compared to route IV. The bioavailability of one composition is said to be enhanced compared to the bioavailability of another composition, when the relative bioavailability of the first composition (RB1) is greater than the relative bioavailability of the second composition (RB2).
En general, la biodisponibilidad se correlaciona con la eficacia terapéutica cuando la eficacia terapéutica de un compuesto está relacionada con la concentración sanguínea obtenida, incluso si el sitio de acción final del fármaco es intracelular (van Berge-Henegouwen et al., Gastroenterol., 1977, 73, 300). Se han usado estudios de biodisponibilidad para determinar el grado de absorción intestinal de un fármaco, midiendo el cambio en los niveles del fármaco en la sangre periférica después de una dosis oral (DiSanto, Chapter 76 In: Remington=s Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, pages 1451-1458). In general, bioavailability correlates with therapeutic efficacy when the therapeutic efficacy of a compound is related to the blood concentration obtained, even if the final site of action of the drug is intracellular (van Berge-Henegouwen et al., Gastroenterol., 1977 , 73, 300). Bioavailability studies have been used to determine the degree of intestinal absorption of a drug, measuring the change in drug levels in the peripheral blood after an oral dose (DiSanto, Chapter 76 In: Remington = s Pharmaceutical Sciences, 18th Ed. , Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, pages 1451-1458).
En general, se dice que la biodisponibilidad de una composición oral está "potenciada" cuando su biodisponibilidad relativa es mayor que la biodisponibilidad de una composición que consiste sustancialmente en el oligonucleótido puro, es decir, el oligonucleótido en ausencia de un potenciador de la penetración. In general, the bioavailability of an oral composition is said to be "enhanced" when its relative bioavailability is greater than the bioavailability of a composition consisting substantially of the pure oligonucleotide, ie, the oligonucleotide in the absence of a penetration enhancer.
La biodisponibilidad en el órgano se refiere a la concentración de un compuesto en un órgano. La biodisponibilidad en un órgano se puede medir en sujetos de ensayo por una variedad de medios, tales como mediante radiografía de todo el cuerpo. La biodisponibilidad en un órgano se puede modificar, por ejemplo, potenciar, con una o más modificaciones de un oligonucleótido, mediante el uso de uno o varios compuestos vehículos o excipientes, etc., tal y como se describe con más detalle en esta memoria. En general, un aumento de la biodisponibilidad se traducirá en un aumento de la biodisponibilidad de un órgano. Organ bioavailability refers to the concentration of a compound in an organ. Organ bioavailability can be measured in test subjects by a variety of means, such as by whole body radiography. Bioavailability in an organ can be modified, eg, enhanced, with one or more modifications of an oligonucleotide, through the use of one or more vehicle or excipient compounds, etc., as described in more detail herein. In general, an increase in bioavailability will result in an increase in the bioavailability of an organ.
Las composiciones de oligonucleótidos orales según la presente invención, pueden comprender uno o más "potenciadores de la penetración en la mucosa" conocidos también como "potenciadores de la absorción" o simplemente como "potenciadores de la penetración". Por consiguiente, algunas realizaciones de la invención comprenden al menos un oligonucleótido en combinación con al menos un potenciador de la penetración. En general, un potenciador de la penetración es una sustancia que facilita el transporte de un fármaco a través de la o las membranas mucosas asociadas con el modo de administración deseado, p. ej., membranas del epitelio intestinal. Por consiguiente, es deseable seleccionar uno o más potenciadores de la penetración que faciliten la absorción de un oligonucleótido, sin interferir con la actividad del oligonucleótido, y de modo que el oligonucleótido se pueda introducir en el cuerpo de un animal sin efectos secundarios inaceptables tales como toxicidad, irritación o respuestas alérgicas. Oral oligonucleotide compositions according to the present invention may comprise one or more "mucosal penetration enhancers" also known as "absorption enhancers" or simply as "penetration enhancers". Accordingly, some embodiments of the invention comprise at least one oligonucleotide in combination with at least one penetration enhancer. In general, a penetration enhancer is a substance that facilitates the transport of a drug through the mucous membrane (s) associated with the desired mode of administration, e.g. eg, intestinal epithelial membranes. Accordingly, it is desirable to select one or more penetration enhancers that facilitate the absorption of an oligonucleotide, without interfering with the activity of the oligonucleotide, and so that the oligonucleotide can be introduced into the body of an animal without unacceptable side effects such as toxicity, irritation or allergic responses.
Las realizaciones de la presente invención proporcionan composiciones que comprenden uno o más potenciadores de la penetración farmacéuticamente aceptables y métodos de uso de dichas composiciones, que producen la biodisponibilidad mejorada de los oligonucleótidos administrados por modos de administración no parenterales. Hasta ahora, se han usado algunos potenciadores de la penetración para mejorar la biodisponibilidad de determinados fármacos. Véase Muranishi, Crit. Rev. Ther. Drug Carrier Systems, 1990, 7, 1 y Lee et al., Crit. Rev. Ther. Drug Carrier Systems, 1991, 8, 91. Se ha encontrado que la absorción y el suministro de oligonucleótidos, moléculas relativamente complejas que se sabe que son difíciles de administrar a animales y el hombre, se pueden mejorar mucho incluso cuando se administran por medios no parenterales por el uso de una serie de diferentes clases de potenciadores de la penetración. Embodiments of the present invention provide compositions comprising one or more pharmaceutically acceptable penetration enhancers and methods of using such compositions, which result in improved bioavailability of oligonucleotides administered by non-parenteral modes of administration. Until now, some penetration enhancers have been used to improve the bioavailability of certain drugs. See Muranishi, Crit. Rev. Ther. Drug Carrier Systems, 1990, 7, 1 and Lee et al., Crit. Rev. Ther. Drug Carrier Systems, 1991, 8, 91. The uptake and delivery of oligonucleotides, relatively complex molecules known to be difficult to administer to animals and humans, have been found to be greatly improved even when administered by unsuitable means. parenterals by using a number of different classes of penetration enhancers.
En algunas realizaciones, las composiciones para la administración no parenteral incluyen una o más modificaciones de oligonucleótidos naturales (es decir, desoxirribosil-oligonucleótidos completamente fosfodiéster y ribosiloligonucleótidos completamente fosfodiéster). Dichas modificaciones pueden aumentar la afinidad de unión, estabilidad de nucleasa, permeabilidad celular o tisular, distribución tisular, u otra propiedad biológica o farmacocinética. Se pueden hacer modificaciones en la base, el conector o el azúcar, como se discute en general como más detalle en la presente memoria, en relación con la química de los oligonucleótidos. En algunas realizaciones de la invención, las composiciones para administrar a un sujeto, y en particular las composiciones orales para administrar a un sujeto animal o humano, comprenderán oligonucleótidos modificados que tienen una o más modificaciones para potenciar la afinidad, estabilidad, distribución tisular u otras propiedades biológicas. In some embodiments, compositions for non-parenteral administration include one or more modifications of naturally occurring oligonucleotides (ie, fully phosphodiester deoxyribosyl-oligonucleotides and fully phosphodiester ribosyloligonucleotides). Such modifications can increase binding affinity, nuclease stability, cellular or tissue permeability, tissue distribution, or other biological or pharmacokinetic property. Modifications to the base, linker, or sugar can be made, as generally discussed in more detail herein, in connection with oligonucleotide chemistry. In some embodiments of the invention, compositions for administration to a subject, and in particular oral compositions for administration to an animal or human subject, will comprise modified oligonucleotides having one or more modifications to enhance affinity, stability, tissue distribution, or otherwise. biological properties.
Los conectores modificados adecuados incluyen conectores fosforotioato. En algunas realizaciones de acuerdo con la invención, el oligonucleótido tiene al menos un conector fosforotioato. Los enlaces fosforotioato proporcionan estabilidad frente a nucleasas, así como características de unión de proteínas plasmáticas al oligonucleótido. La estabilidad frente a nucleasas es útil para aumentar la vida útil in vivo de los oligonucleótidos, mientras que la unión a proteínas plasmáticas disminuye la tasa de aclaramiento de primer paso del oligonucleótido a través de la excreción renal. En algunas realizaciones según la presente invención, el oligonucleótido tiene al menos dos conectores fosforotioato. En algunas realizaciones en las que el oligonucleótido tiene exactamente n nucleósidos, el oligonucleótidos tiene de 1 a n-1 enlaces fosforotioato. En algunas realizaciones en las que el oligonucleótido tiene exactamente n nucleósidos, el oligonucleótidos tiene n-1 enlaces fosforotioato. En otras realizaciones en las que el oligonucleótido tiene exactamente n nucleósidos, y n es par, el oligonucleótidos tiene de 1 a n/2 enlaces fosforotioato, o cuando n es impar, de 1 a (n-1)/2 enlaces fosforotioato. En algunas realizaciones, el oligonucleótido tiene enlaces fosfodiéster (PO) y fosforotioato (PS) que alternan. En otras realizaciones, el oligonucleótido tiene un tramo de dos o más enlaces PO consecutivos y al menos un tramo de dos o más enlaces PS. En otra realizaciones, el oligonucleótido tiene al menos dos tramos de enlaces PO interrumpidos por al menos un enlace PS. Suitable modified connectors include phosphorothioate connectors. In some embodiments according to the invention, the oligonucleotide has at least one phosphorothioate linker. Phosphorothioate linkages provide stability against nucleases, as well as binding characteristics of plasma proteins to the oligonucleotide. Nuclease stability is useful for increasing the in vivo life of oligonucleotides, while binding to plasma proteins decreases the first pass clearance rate of the oligonucleotide through renal excretion. In some embodiments according to the present invention, the oligonucleotide has at least two phosphorothioate linkers. In some embodiments where the oligonucleotide has exactly n nucleosides, the oligonucleotide has 1 to n-1 phosphorothioate linkages. In some embodiments where the oligonucleotide has exactly n nucleosides, the oligonucleotide has n-1 phosphorothioate linkages. In other embodiments where the oligonucleotide has exactly n nucleosides, and n is even, the oligonucleotide has 1 to n / 2 phosphorothioate bonds, or when n is odd, 1 to (n-1) / 2 phosphorothioate bonds. In some embodiments, the oligonucleotide has alternating phosphodiester (PO) and phosphorothioate (PS) bonds. In other embodiments, the oligonucleotide has a stretch of two or more consecutive PO bonds and at least a stretch of two or more PS bonds. In other embodiments, the oligonucleotide has at least two stretches of PO bonds interrupted by at least one PS bond.
En algunas realizaciones, al menos uno de los nucleósidos está modificado en la unidad de azúcar de ribosilo por una modificación que imparte estabilidad a la nucleasa, afinidad de unión o alguna otra propiedad biológica beneficiosa. En algunos casos, la modificación del azúcar incluye una modificación 2', p. ej. el 2'-OH del azúcar ribosilo se reemplaza o sustituye. Los reemplazos adecuados para el 2'-OH incluyen 2'-F y 2'-arabino-F. Las sustituciones adecuadas para el OH incluyen 2'-O-alquilo, p. ej. 2-O-metilo y 2'-O-alquilo sustituido, p. ej. 2'-Ometoxietilo, 2'-O-aminopropilo, etc. En algunas realizaciones, el oligonucleótido contiene al menos una modificación 2'. En algunas realizaciones, el oligonucleótido contiene al menos 2 modificaciones 2'. En algunas realizaciones, el oligonucleótido tiene al menos una modificación 2' en cada uno de los extremos (es decir, los nucleósidos 3' y 5' terminales tienen cada uno las mismas o diferentes modificaciones 2'). En algunas realizaciones, el oligonucleótido tiene al menos dos modificaciones 2' secuenciales en cada extremo del oligonucleótido. En algunas realizaciones, los oligonucleótidos comprenden además al menos un desoxinucleósido. En realizaciones particulares, los oligonucleótidos comprenden un tramo de desoxinucleósidos de modo que el tramo es capaz de activar la escisión por la RNasa (p. ej., RNasa H) de un ARN con el que es capaz de hibridar el oligonucleótido. En algunas realizaciones, un tramo de desoxinucleósidos capaz de activar la escisión mediada por la RNasa del ARN comprende de aproximadamente 6 a aproximadamente 16, p. ej. de aproximadamente 8 a aproximadamente 16 desoxinucleósidos consecutivos. In some embodiments, at least one of the nucleosides is modified in the ribosyl sugar unit by a modification that imparts nuclease stability, binding affinity, or some other beneficial biological property. In some cases, the sugar modification includes a 2 'modification, e.g. ex. the 2'-OH of ribosyl sugar is replaced or substituted. Suitable replacements for 2'-OH include 2'-F and 2'-arabino-F. Suitable substitutions for OH include 2'-O-alkyl, e. ex. 2-O-methyl and 2'-O-substituted alkyl, e.g. ex. 2'-Omethoxyethyl, 2'-O-aminopropyl, etc. In some embodiments, the oligonucleotide contains at least one 2 'modification. In some embodiments, the oligonucleotide contains at least 2 2 'modifications. In some embodiments, the oligonucleotide has at least one 2 'modification at each end (ie, the 3' and 5 'terminal nucleosides each have the same or different 2' modifications). In some embodiments, the oligonucleotide has at least two 2 'sequential modifications at each end of the oligonucleotide. In some embodiments, the oligonucleotides further comprise at least one deoxynucleoside. In particular embodiments, the oligonucleotides comprise a stretch of deoxynucleosides such that the stretch is capable of triggering cleavage by RNase (eg, RNase H) of an RNA with which it is capable of hybridizing the oligonucleotide. In some embodiments, a stretch of deoxynucleosides capable of activating RNase-mediated cleavage of the RNA comprises from about 6 to about 16, e.g. ex. from about 8 to about 16 consecutive deoxynucleosides.
Las composiciones orales para la administración de composiciones de oligonucleótidos no parenterales de la presente invención, se pueden formular en diferentes formas de dosificación tales como, pero sin limitar, comprimidos, cápsulas, jarabes líquidos, geles blandos, supositorios y enemas. La expresión "suministro alimentario" abarca, p. ej., la administración oral, rectal, endoscópica y sublingual/bucal. Un requisito común para estos modos de administración es la absorción en alguna parte o en todo el tracto digestivo y la necesidad de la penetración eficaz en la mucosa del ácido o ácidos nucleicos así administrados. Oral compositions for administration of non-parenteral oligonucleotide compositions of the present invention can be formulated in different dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The term "food supply" encompasses, eg. eg, oral, rectal, endoscopic, and sublingual / buccal administration. A common requirement for these modes of administration is the absorption in some or all of the digestive tract and the need for effective penetration into the mucosa of the acid or nucleic acids thus administered.
El suministro de un fármaco por la mucosa oral, como es el caso de la administración bucal y sublingual, tiene varias características deseables, incluyendo, en muchos casos, una elevación más rápida de la concentración plasmática del fármaco que por el suministro oral (Harvey, capítulo 35 en: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, page 711). The delivery of a drug by the oral mucosa, as is the case with buccal and sublingual administration, has several desirable characteristics, including, in many cases, a faster rise in the plasma concentration of the drug than by oral delivery (Harvey, Chapter 35 in: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, page 711).
Se puede usar la endoscopia para el suministro de fármaco directamente en una parte interior del tracto alimentario. Por ejemplo, la colangiopancreatografía retrógrada endoscópica (CPRE) aprovecha la gastroscopia extendida y permite el acceso selectivo al tracto biliar y al conducto pancreático (Hirahata et al., Gan To Kagaku Ryoho, 1992, 19(10 Suppl.), 1591). Las composiciones farmacéuticas, incluyendo las formulaciones de liposomas, se pueden suministrar directamente en porciones del canal digestivo, tales como, p. ej., el duodeno (Somogyi et al., Pharm. Res., 1995, 12, 149) o la submucosa gástrica (Akamo et al., Japanese J. Cancer Res., 1994, 85, 652) por medios endoscópicos. También se pueden usar dispositivos de lavado gástrico (Inoue et al., Artif. organs, 1997, 21, 28) y dispositivos de alimentación endoscópica percutánea (Pennington et al., Ailment. Pharmacol. Ther., 1995, 9, 471) para el suministro alimentario directo de las composiciones farmacéuticas. Endoscopy can be used to deliver the drug directly to an inner part of the alimentary tract. For example, endoscopic retrograde cholangiopancreatography (ERCP) takes advantage of extended gastroscopy and allows selective access to the biliary tract and pancreatic duct (Hirahata et al., Gan To Kagaku Ryoho, 1992, 19 (10 Suppl.), 1591). Pharmaceutical compositions, including liposome formulations, can be delivered directly into portions of the digestive canal, such as, e.g. eg, the duodenum (Somogyi et al., Pharm. Res., 1995, 12, 149) or the gastric submucosa (Akamo et al., Japanese J. Cancer Res., 1994, 85, 652) by endoscopic means. Gastric lavage devices (Inoue et al., Artif. Organs, 1997, 21, 28) and percutaneous endoscopic feeding devices (Pennington et al., Ailment. Pharmacol. Ther., 1995, 9, 471) can also be used to direct food supply of pharmaceutical compositions.
En algunas realizaciones, las formulaciones de oligonucleótidos se pueden administrar por el ano en el recto o el intestino inferior. Se pueden usar supositorios rectales, enemas de retención o catéteres rectales para este propósito y pueden ser preferidos cuando de lo contrario puede ser difícil conseguir la observancia del paciente (p. ej., en aplicaciones pediátricas y geriátrica, o cuando el paciente está vomitando o está inconsciente). La administración oral puede producir niveles en la sangre más rápidos y más altos que la ruta oral. (Harvey, capítulo 35 en: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, page 711). Debido a que aproximadamente el 50% del fármaco que es absorbido del recto no pasará el hígado, la administración por esta vía reduce significativamente el potencial del metabolismo de primer paso (Benet et al., capítulo 1 en: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill, New York, NY, 1996). In some embodiments, the oligonucleotide formulations can be administered through the anus into the rectum or lower intestine. Rectal suppositories, retention enemas, or rectal catheters may be used for this purpose and may be preferred when patient compliance may otherwise be difficult to achieve (eg, in pediatric and geriatric applications, or when the patient is vomiting or is unconscious). Oral administration can produce faster and higher blood levels than the oral route. (Harvey, Chapter 35 in: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, page 711). Because approximately 50% of the drug that is absorbed from the rectum will not pass through the liver, administration by this route significantly reduces the potential for first-pass metabolism (Benet et al., Chapter 1 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., Eds., McGraw-Hill, New York, NY, 1996).
Un método ventajoso de las composiciones de oligonucleótidos de administración no parenteral es el suministro oral. Algunas realizaciones usan diferentes potenciadores de la penetración con el fin de realizar el transporte de oligonucleótidos y otros ácido nucleicos a través de las membranas mucosa y epitelial. Los potenciadores de la penetración se pueden clasificar como pertenecientes a una de cinco amplias categorías: tensioactivos, ácidos grasos, sales biliares, agentes quelantes y no tensioactivos no quelantes (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Por consiguiente, algunas realizaciones comprenden composiciones de oligonucleótidos orales que comprenden al menos un miembro que consiste en tensioactivos, ácidos grasos, sales biliares, agentes quelantes y no tensioactivos no quelantes. Otras realizaciones comprenden el oligonucleótido oral que comprende al menos un ácido graso, p. ej., ácido cáprico o láurico, o combinaciones o sales de los mismos. Otras realizaciones comprenden métodos para potenciar la biodisponibilidad oral de un oligonucleótido, comprendiendo el método la coadministración del oligonucleótido y al menos un potenciador de la penetración. An advantageous method of non-parenterally administered oligonucleotide compositions is oral delivery. Some embodiments use different penetration enhancers in order to carry out the transport of oligonucleotides and other nucleic acids through the mucous and epithelial membranes. Penetration enhancers can be classified as belonging to one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Accordingly, some embodiments comprise oral oligonucleotide compositions comprising at least one member consisting of surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Other embodiments comprise the oral oligonucleotide comprising at least one fatty acid, e.g. eg, capric or lauric acid, or combinations or salts thereof. Other embodiments comprise methods of enhancing the oral bioavailability of an oligonucleotide, the method comprising co-administration of the oligonucleotide and at least one penetration enhancer.
Otros excipientes que se pueden añadir a las composiciones de oligonucleótidos orales incluyen tensioactivos (o "agentes tensioactivos"), que son entidades químicas que, cuando se disuelven en una disolución acuosa reducen la tensión superficial de la disolución o la tensión interfases entre la disolución acuosa y otro líquido, con el resultado de que se potencia la absorción de oligonucleótidos a través de la mucosa digestiva y otras membranas epiteliales. Además de las sales biliares y los ácidos grasos, los tensioactivos incluyen, por ejemplo, laurilsulfato sódico, éter de laurilo y polioxietileno-9 y éter de cetilo y polioxietileno-20 (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); y emulsiones perfluoroquímicas, tales como FC-43 (Takahashi et al., J. Pharm. Phamacol., 1988, 40, 252). Other excipients that can be added to oral oligonucleotide compositions include surfactants (or "surfactants"), which are chemical entities that, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interface tension between the aqueous solution. and another liquid, with the result that the absorption of oligonucleotides through the digestive mucosa and other epithelial membranes is enhanced. In addition to bile salts and fatty acids, surfactants include, for example, sodium lauryl sulfate, lauryl ether, and polyoxyethylene-9 and cetyl ether and polyoxyethylene-20 (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991 , p.92); and perfluorochemical emulsions, such as FC-43 (Takahashi et al., J. Pharm. Phamacol., 1988, 40, 252).
Los ácidos grasos y sus derivados que actúan como potenciadores de la penetración y se pueden usar en composiciones de la presente invención incluyen, por ejemplo, ácido oleico, ácido láurico, ácido cáprico (ácido ndecanoico), ácido mirístico, ácido palmítico, ácido esteárico, ácido linoleico, ácido linolénico, dicaprato, tricaprato, monooleína (1-monooleoil-rac-glicerol), dilaurina, ácido caprílico, ácido araquidónico, 1-monocaprato de glicerilo, 1dodecilazacicloheptan-2-ona, acilcarnitinas, acilcolinas y sus mono y di-glicéridos y/o sus sales fisiológicamente aceptables (es decir, oleato, laurato, caprato, miristato, palmitato, estearato, linoleato, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; El-Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651). Fatty acids and their derivatives that act as penetration enhancers and can be used in compositions of the present invention include, for example, oleic acid, lauric acid, capric acid (ndecanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurine, caprylic acid, arachidonic acid, glyceryl 1-monocaprate, 1-docylazacycloheptan-2-one, acylcarnitines, acylcholine and its glycerides and / or their physiologically acceptable salts (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; El-Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651).
En algunas realizaciones, las composiciones de oligonucleótidos para el suministro oral comprenden al menos dos fases discretas, cuyas fases pueden comprender partículas, cápsulas, cápsulas de gel, microesferas, etc. Cada fase puede contener uno o más oligonucleótidos, potenciadores de la penetración, tensioactivos, bioadhesivos, agentes efervescentes, u otros adyuvantes, excipientes o diluyentes. En algunas realizaciones, una fase comprende al menos un oligonucleótidos y al menos un potenciador de la penetración. En algunas realizaciones, una primera fase comprende al menos un oligonucleótido y al menos un potenciador de la penetración, mientras que una segunda fase comprende al menos un potenciador de la penetración. En algunas realizaciones, una primera fase comprende al menos un oligonucleótido y al menos un potenciador de la penetración, mientras que una segunda fase comprende al menos un potenciador de la penetración y sustancialmente no comprende oligonucleótido. En algunas realizaciones, al menos una fase se mezcla con al menos un retardante de la degradación, tal como un recubrimiento o una matriz, que retrasa la liberación del contenido de esta fase. En algunas realizaciones, al menos una fase, en algunas realizaciones, una primera fase comprende al menos un oligonucleótido, al menos un potenciador de la penetración, mientras que una segunda fase comprende al menos un potenciador de la penetración y un retardante de la liberación. En realizaciones particulares, un oligonucleótido oral comprende una primera fase que comprende partículas que contienen un oligonucleótido y un potenciador de la penetración, y una segunda fase que comprende partículas recubiertas con un agente retardante de la liberación y contienen potenciador de la penetración. In some embodiments, the oligonucleotide compositions for oral delivery comprise at least two discrete phases, the phases of which may comprise particles, capsules, gel caps, microspheres, etc. Each phase may contain one or more oligonucleotides, penetration enhancers, surfactants, bioadhesives, effervescent agents, or other adjuvants, excipients, or diluents. In some embodiments, a phase comprises at least one oligonucleotide and at least one penetration enhancer. In some embodiments, a first phase comprises at least one oligonucleotide and at least one penetration enhancer, while a second phase comprises at least one penetration enhancer. In some embodiments, a first phase comprises at least one oligonucleotide and at least one penetration enhancer, while a second phase comprises at least one penetration enhancer and substantially does not comprise oligonucleotide. In some embodiments, at least one phase is mixed with at least one degradation retardant, such as a coating or matrix, that delays the release of the content of this phase. In some embodiments, at least one phase, in some embodiments, a first phase comprises at least one oligonucleotide, at least one penetration enhancer, while a second phase comprises at least one penetration enhancer and one release retardant. In particular embodiments, an oral oligonucleotide comprises a first phase comprising particles containing an oligonucleotide and a penetration enhancer, and a second phase comprising particles coated with a release retarding agent and containing penetration enhancer.
Una variedad de sales biliares también funcionan como potenciadores de la penetración para facilitar la absorción y la biodisponibilidad de los fármacos. Las funciones fisiológicas de la bilis incluyen el facilitar la dispersión y absorción de lípidos y vitaminas solubles en grasa (Brunton, capítulo 38 en: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill, New York, NY, 1996, pages 934-935). Diferentes sales biliares naturales y sus derivados sintéticos actúan como potenciadores de la penetración. Por lo tanto la expresión "sal biliar" incluye cualquiera de los componentes naturales de la bilis así como cualquiera de sus derivados sintéticos. Las sales biliares de la invención incluyen, por ejemplo, ácido cólico (o sus sal de sodio farmacéuticamente aceptable, colato de sodio), ácido deshidrocólico (deshidrocolato de sodio), ácido desoxicólico (desoxicolato de sodio), ácido glucólico (glucolato de sodio), ácido glicólico (glicocolato de sodio), ácido glicodesoxicólico (glicodesoxicolato de sodio), ácido taurocólico (taurocolato de sodio), ácido taurodesoxicólico (taurodesoxicolato de sodio), ácido quenodesoxicólico (CDCA, quenodesoxicolato de sodio), ácido ursodesoxicólico (UDCA), tauro-24,25-dihidrofusidato de sodio (STDHF), glicodihidrofusidato de sodio y éter de laurilo y polioxietileno9 (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, capítulo 39 en: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, pages 782783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579). A variety of bile salts also function as penetration enhancers to facilitate drug absorption and bioavailability. The physiological functions of bile include facilitating the dispersion and absorption of fat-soluble lipids and vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., Eds., McGraw- Hill, New York, NY, 1996, pages 934-935). Different natural bile salts and their synthetic derivatives act as penetration enhancers. Therefore the term "bile salt" includes any of the natural components of bile as well as any of its synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocolic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glycolic acid (sodium glucolate) , Glycolic Acid (Sodium Glycocholate), Glycodeoxycholic Acid (Sodium Glycodeoxycholate), Taurocholic Acid (Sodium Taurocholate), Taurodeoxycholic Acid (Sodium Taurodeoxycholate), CDCA, Sodium Chenodeoxycholate), Ursodeoxycholic Acid (UD) -24,25-sodium dihydrofusidate (STDHF), sodium lauryl ether polyoxyethylene glycol dihydrofusidate9 (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, chapter 39 in: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, pages 782783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; Yamamoto et al., J. Pharm Exp. Th er., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579).
En algunas realizaciones, los potenciadores de la penetración útiles en algunas realizaciones de la presente invención, son mezclas de compuestos potenciadores de la penetración. Uno de dichos potenciadores de la penetración es una mezcla de UDCA (y/o CDCA) con ácidos cáprico y/o láurico o sales de los mismos, p. ej., de sodio. Dichas mezclas son útiles para potenciar el suministro de sustancias biológicamente activas a través de las membranas mucosas, en particular de la mucosa intestinal. Otras mezclas de potenciadores de la penetración comprenden aproximadamente 5-95% de ácidos biliares o sal(es) de UDCA y/o CDCA con 5-95% de ácido cáprico y/o láurico. Los potenciadores de la penetración particulares son mezclas de las sales sódicas de UDCA, ácido cáprico y ácido láurico, en una relación de aproximadamente 1:2:2, respectivamente. Otro de dichos potenciadores de la penetración es una mezcla de ácido cáprico y láurico (o sales de los mismos) en una relación de 0,01:1 a 1:0,01 (base en moles). En realizaciones particulares, el ácido cáprico y el ácido láurico están presentes en relaciones molares de aproximadamente 0,1:1 a aproximadamente 1:0,1, en particular de aproximadamente 0,5:1 a aproximadamente 1:0,5. In some embodiments, the penetration enhancers useful in some embodiments of the present invention are mixtures of penetration enhancing compounds. One such penetration enhancer is a mixture of UDCA (and / or CDCA) with capric and / or lauric acids or salts thereof, eg. eg, sodium. Such mixtures are useful to enhance the supply of biologically active substances through the mucous membranes, in particular the intestinal mucosa. Other mixtures of penetration enhancers comprise approximately 5-95% bile acids or UDCA and / or CDCA salt (s) with 5-95% capric and / or lauric acid. Particular penetration enhancers are mixtures of the sodium salts of UDCA, capric acid, and lauric acid, in a ratio of approximately 1: 2: 2, respectively. Another such penetration enhancers is a mixture of capric and lauric acid (or salts thereof) in a ratio of 0.01: 1 to 1: 0.01 (basis in moles). In particular embodiments, capric acid and lauric acid are present in molar ratios of from about 0.1: 1 to about 1: 0.1, in particular from about 0.5: 1 to about 1: 0.5.
Otros excipientes incluyen agentes quelantes, es decir, compuestos que eliminan iones metálicos de la disolución formando complejos con los mismos, con el resultado de que se potencia la absorción de los oligonucleótidos a través de la mucosa digestiva y otras mucosas. En relación con su uso como potenciadores de la penetración en la presente invención, los agentes quelantes tienen la ventaja añadida de que también sirven como inhibidores de DNasa, ya que la mayoría de las ADN nucleasas caracterizadas requieren un ion metálico divalente para la catálisis y por lo tanto son inhibidas por los agentes quelantes (Jarrett, J. Chromatogr., 1993, 618, 315). Los agentes quelantes de la invención incluyen, pero sin limitar, etilendiaminatetraacetato de sodio (EDTA), ácido cítrico, salicilatos (p. ej., salicilato, 5-metoxisalicilato y homovanilato de sodio), derivados de N-acilo del colágeno, derivados de laureth-9 y N-aminoacilo de beta-dicetonas (enaminas) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; Buur et al., J. Control Rel., 1990, 14, 43). Other excipients include chelating agents, that is, compounds that remove metal ions from the solution by complexing with them, with the result that the absorption of the oligonucleotides through the digestive mucosa and other mucosa is enhanced. In relation to their use as penetration enhancers in the present invention, chelating agents have the added advantage that they also serve as DNase inhibitors, since most characterized DNA nucleases require a divalent metal ion for catalysis and for therefore they are inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315). Chelating agents of the invention include, but are not limited to, sodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (eg, salicylate, sodium 5-methoxysalicylate), N-acyl derivatives of collagen, derivatives of laureth-9 and N-aminoacyl of beta-diketones (enamines) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; Buur et al., J. Control Rel., 1990, 14, 43).
Como se usa en la presente memoria, los potenciadores de la penetración no tensioactivos no quelantes se pueden definir como compuestos que demuestran actividad insignificante como agentes quelantes o como tensioactivos pero que, no obstante, potencian la absorción de oligonucleótidos a través de la mucosa digestiva y otras membranas mucosas (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1). Esta clase de potenciadores de la penetración incluye, pero sin limitar, ureas cíclicas insaturadas, derivados de 1-alquil-y 1alquenilazaciclo-alcanona (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); y agentes antiinflamatorios no esteroideos tales como diclofenaco de sodio, indometacina y fenilbutazona (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621). As used herein, non-chelating non-surfactant penetration enhancers can be defined as compounds that demonstrate negligible activity as chelating agents or as surfactants but, nevertheless, enhance the absorption of oligonucleotides through the digestive mucosa and other mucous membranes (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1). This class of penetration enhancers includes, but is not limited to, unsaturated cyclic ureas, 1-alkyl-and 1-alkenylzacyclocycloalkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin, and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621).
También se pueden añadir agentes que potencian la captación de oligonucleótidos a nivel celular a las composiciones farmacéuticas y otras composiciones de la presente invención. Por ejemplo, se pueden usar lípidos catiónicos tales como la lipofectina (Junichi et al., patente de EE.UU. nº 5.705.188), derivados de glicerol catiónicos y moléculas policatiónicas, tales como polilisina (Lollo et al., solicitud PCT WO 97/30731). Agents that enhance oligonucleotide uptake at the cellular level may also be added to the pharmaceutical compositions and other compositions of the present invention. For example, cationic lipids such as lipofectin (Junichi et al., US Patent No. 5,705,188), cationic glycerol derivatives and polycationic molecules, such as polylysine (Lollo et al., PCT application WO) can be used 97/30731).
Algunas composiciones de oligonucleótidos orales también incorporan compuesto vehículo en la formulación. Como se usa en la presente memoria, el "compuesto vehículo" o "vehículo" se puede referir a un ácido nucleico o análogo del mismo, que puede ser inerte (es decir, no tiene actividad biológica por sí mismo) o puede ser necesario para el transporte, reconocimiento o ruta de activación o mediación, o es reconocido como un ácido nucleico por procesos in vivo que reducen la biodisponibilidad del ácido nucleico que tiene actividad biológica, por ejemplo, degradando el ácido nucleico biológicamente activo o promoviendo su eliminación de la circulación. La coadministración de un ácido nucleico y un compuesto vehículo, típicamente con un exceso de esta última sustancia, puede dar como resultado una reducción sustancial de la cantidad de ácido nucleico recuperado en el hígado, riñón u otros depósitos extracirculatorios, supuestamente debido a la competición entre el compuesto vehículo y el ácido nucleico por un receptor común. Por ejemplo, la recuperación de un oligonucleótido parcialmente fosforotioato en tejido hepático se puede reducir cuando se coadministra con ácido poliinosínico, sulfato de dextrano, ácido policitídico o ácido 4acetamido-4'-isotiociano-estilbeno-2,2'-disulfónico (Miyao et al., Antisense Res. Dev., 1995, 5, 5; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177). Some oral oligonucleotide compositions also incorporate vehicle compound in the formulation. As used herein, the "vehicle compound" or "vehicle" may refer to a nucleic acid or analog thereof, which may be inert (ie, has no biological activity by itself) or may be necessary for the transport, recognition, or activation or mediation pathway, or is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of nucleic acid that has biological activity, for example, by degrading biologically active nucleic acid or promoting its elimination from circulation . Co-administration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction in the amount of nucleic acid recovered in the liver, kidney or other extracirculatory deposits, presumably due to competition between the vehicle compound and nucleic acid by a common receptor. For example, the recovery of a partially phosphorothioate oligonucleotide in liver tissue can be reduced when co-administered with polyinosinic acid, dextran sulfate, polycytidic acid or 4acetamido-4'-isothiocyanyl-stilbene-2,2'-disulfonic acid (Miyao et al ., Antisense Res. Dev., 1995, 5, 5; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177).
Un "vehículo farmacéutico" o un "excipiente" puede ser un disolvente farmacéuticamente aceptable, un agente de suspensión o cualquier otro vehículo farmacológicamente inerte para suministrar uno o varios ácidos nucleicos a un animal. El excipiente puede ser líquido o sólido y se selecciona, con la forma de administración planeada en mente, de modo que proporcione el volumen, consistencia, etc. deseados, cuando se combina con un ácido nucleico y los otros componentes de una composición farmacéutica dada. Los vehículos farmacéuticos típicos incluyen, pero sin limitar, agentes aglutinantes (p. ej., almidón de maíz pregelatinizado, polivinilpirrolidona o hidroxipropilmetilcelulosa, etc.); cargas (p. ej., lactosa y otros azúcares, celulosa microcristalina, pectina, gelatina, sulfato de calcio, etilcelulosa, poliacrilatos o hidrogenofosfato de calcio, etc.); lubricantes (p. ej., estearato de magnesio, talco, sílice, dióxido de silicio coloidal, ácido esteárico, estearatos metálicos, aceites vegetales hidrogenados, almidón de maíz, polietilenglicoles, benzoato sódico, acetato sódico, etc.); disgregantes (p. ej., almidón, glicolato sódico de almidón, EXPLOTAB); y agentes humectantes (p. ej., laurilsulfato sódico, etc.). A "pharmaceutical vehicle" or an "excipient" can be a pharmaceutically acceptable solvent, a suspending agent, or any other pharmacologically inert vehicle for supplying one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned administration form in mind, to provide volume, consistency, etc. desired, when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (eg, pregelatinized corn starch, polyvinylpyrrolidone or hydroxypropylmethylcellulose, etc.); fillers (eg, lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (eg, magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (eg, starch, sodium starch glycolate, EXPLOTAB); and wetting agents (eg, sodium lauryl sulfate, etc.).
Las composiciones orales de oligonucleótidos pueden contener adicionalmente otros componentes auxiliares encontrados convencionalmente en composiciones farmacéuticas, en sus niveles de uso establecidos en la técnica. Así, por ejemplo, las composiciones pueden contener materiales adicionales, compatibles, farmacéuticamente activos tales como, por ejemplo, agentes antipruríticos, astringentes, anestésicos locales o antiinflamatorios, o pueden contener materiales adicionales útiles en la formulación física de diversas formas farmacéuticas de la composición de la presente invención, tales como colorantes, agentes de sabor, conservantes, antioxidantes, opacificantes, agentes espesantes y estabilizantes. Sin embargo, dichos materiales, cuando se añaden, no deberían interferir indebidamente con las actividades biológicas de los componentes de las composiciones de la presente invención. A continuación se describen realizaciones adicionales de la invención: Oral oligonucleotide compositions may additionally contain other auxiliary components conventionally found in pharmaceutical compositions, at their use levels established in the art. Thus, for example, the compositions may contain additional, compatible, pharmaceutically active materials such as, for example, antipruritic, astringent, local anesthetic or anti-inflammatory agents, or they may contain additional materials useful in the physical formulation of various pharmaceutical forms of the composition of the present invention, such as colorants, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents, and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. Further embodiments of the invention are described below:
- 1. one.
- Un compuesto antisentido de 8 a 50 bases nucleicas de longitud, en el que dicho compuesto específicamente hibrida con los nucleótidos 2920-3420 expuestos en la SEQ ID NO: 3 e inhibe la expresión del ARNm que codifica la apolipoproteína B humana después de 16 a 24 h en al menos 30%, en células HepG2 al 80% de confluencia en un cultivo en una concentración 150 nM. An antisense compound 8 to 50 nucleic bases in length, in which said compound specifically hybridizes with nucleotides 2920-3420 exposed in SEQ ID NO: 3 and inhibits the expression of mRNA encoding human apolipoprotein B after 16 to 24 h at least 30%, in HepG2 cells at 80% confluence in a culture at a concentration of 150 nM.
- 2.2.
- El compuesto antisentido de la realización 1, en el que dicho compuesto específicamente hibrida con los nucleótidos 3230-3288 expuestos en la SEQ ID NO: 3 e inhibe la expresión del ARNm que codifica la apolipoproteína B humana después de 16 a 24 h en al menos 30%, en células HepG2 al 80% de confluencia en un cultivo en una concentración 150 nM. The antisense compound of embodiment 1, wherein said compound specifically hybridizes to nucleotides 3230-3288 set forth in SEQ ID NO: 3 and inhibits expression of the mRNA encoding human apolipoprotein B after 16 to 24 h in at least 30%, in HepG2 cells at 80% confluence in a culture at a concentration of 150 nM.
- 3.3.
- El compuesto antisentido de la realización 2, que es un oligonucleótido antisentido. The antisense compound of embodiment 2, which is an antisense oligonucleotide.
- 4. Four.
- El compuesto antisentido de la realización 3, en el que el oligonucleótido antisentido es un compuesto mimético de oligonucleótido. The antisense compound of embodiment 3, wherein the antisense oligonucleotide is an oligonucleotide mimetic compound.
- 5.5.
- El compuesto antisentido de la realización 2, de 12 a 30 bases nucleicas de longitud. The antisense compound of embodiment 2, 12 to 30 nucleic bases in length.
- 6.6.
- El compuesto antisentido de la realización 5, de 14 a 20 bases nucleicas de longitud. The antisense compound of embodiment 5, 14 to 20 nucleic bases in length.
- 7. 7.
- El compuesto antisentido de la realización 4, en el que el compuesto mimético de oligonucleótido comprende al menos un enlace fosforotioato. The antisense compound of embodiment 4, wherein the oligonucleotide mimetic compound comprises at least one phosphorothioate bond.
- 8. 8.
- El compuesto antisentido de la realización 4, en el que el compuesto mimético de oligonucleótido comprende al menos un resto de 2'-O-metoxietil-azúcar. The antisense compound of embodiment 4, wherein the oligonucleotide mimetic compound comprises at least one 2'-O-methoxyethyl sugar moiety.
- 9. 9.
- El compuesto antisentido de la realización 4, en el que el compuesto mimético de oligonucleótido comprende al menos una 5-metilcitosina. The antisense compound of embodiment 4, wherein the oligonucleotide mimetic compound comprises at least one 5-methylcytosine.
- 10.10.
- El compuesto antisentido de la realización 2, en el que el compuesto antisentido es un compuesto antisentido quimérico. The antisense compound of embodiment 2, wherein the antisense compound is a chimeric antisense compound.
- 11.eleven.
- El compuesto antisentido de la realización 10, en el que el compuesto antisentido quimérico es un compuesto antisentido fosforotioato quimérico. The antisense compound of embodiment 10, wherein the chimeric antisense compound is a chimeric phosphorothioate antisense compound.
- 12.12.
- El compuesto antisentido de la realización 11, en el que el compuesto antisentido fosforotioato quimérico comprende alas de 2'-metoxietoxil-nucleótido y un hueco de 2'-desoxinucleótidos. The antisense compound of embodiment 11, wherein the chimeric phosphorothioate antisense compound comprises 2'-methoxyethoxy-nucleotide wings and a 2'-deoxynucleotide gap.
- 13.13.
- El compuesto antisentido de la realización 12, en el que el compuesto antisentido fosforotioato quimérico comprende 10 2'-desoxinucleótidos. The antisense compound of embodiment 12, wherein the chimeric phosphorothioate antisense compound comprises 10 2'-deoxynucleotides.
- 14.14.
- El compuesto antisentido de una cualquiera de las realizaciones 1-13, en el que dicho compuesto antisentido inhibe la expresión del ARNm que codifica la apolipoproteína B humana después de 16 a 24 h en al menos 50%, en células HepG2 al 80% de confluencia en cultivo en una concentración 150 nM. The antisense compound of any one of embodiments 1-13, wherein said antisense compound inhibits expression of the human apolipoprotein B encoding mRNA after 16 to 24 h by at least 50%, in HepG2 cells at 80% confluence. in culture at a concentration of 150 nM.
- 15.fifteen.
- El compuesto antisentido de una cualquiera de las realizaciones 1-13, en el que al menos una base nucleica está covalentemente unida a un conjugado. The antisense compound of any one of embodiments 1-13, wherein the at least one nucleic base is covalently linked to a conjugate.
- 16.16.
- Una composición que comprende el compuesto antisentido de una cualquiera de las realizaciones 1-13, y un vehículo o diluyente farmacéuticamente aceptable. A composition comprising the antisense compound of any one of embodiments 1-13, and a pharmaceutically acceptable carrier or diluent.
- 17.17.
- La composición de la realización 16, que además comprende un sistema de dispersión coloidal. The composition of embodiment 16, further comprising a colloidal dispersion system.
- 18.18.
- Una composición que comprende un compuesto antisentido de cualquiera de las realizaciones 1-13, hibridado con una cadena complementaria. A composition comprising an antisense compound of any one of embodiments 1-13, hybridized to a complementary strand.
- 19.19.
- La composición de la realización 18, en la que la hibridación del compuesto antisentido con la cadena complementaria forma al menos un extremo romo. The composition of embodiment 18, wherein the hybridization of the antisense compound to the complementary strand forms at least one blunt end.
- 20.twenty.
- La composición de la realización 19, en la que la hibridación del compuesto antisentido con la cadena complementaria forma al menos dos extremos romos. The composition of embodiment 19, wherein the hybridization of the antisense compound to the complementary strand forms at least two blunt ends.
- 21.twenty-one.
- Un compuesto oligonucleótido antisentido de 8 a 50 base nucleicas de longitud, que comprende al menos 8 nucleótidos contiguos de la SEQ ID NO: 247. An antisense oligonucleotide compound 8 to 50 nucleic bases in length, comprising at least 8 contiguous nucleotides of SEQ ID NO: 247.
- 22.22.
- El compuesto oligonucleótido antisentido de la realización 21, en el que el compuesto oligonucleótido antisentido tiene una secuencia que comprende la SEQ ID NO: 247. The antisense oligonucleotide compound of embodiment 21, wherein the antisense oligonucleotide compound has a sequence comprising SEQ ID NO: 247.
- 23.2. 3.
- El compuesto oligonucleótido antisentido de la realización 22, de 12 a 30 bases nucleicas de longitud. The antisense oligonucleotide compound of embodiment 22, 12 to 30 nucleic bases in length.
- 24.24.
- El compuesto oligonucleótido antisentido de la realización 23, de 14 a 20 bases nucleicas de longitud. The antisense oligonucleotide compound of embodiment 23, 14-20 nucleic bases in length.
- 25.25.
- El compuesto oligonucleótido antisentido de la realización 24, en el que el compuesto oligonucleótido antisentido tiene una secuencia que consiste en la SEQ ID NO: 247. The antisense oligonucleotide compound of embodiment 24, wherein the antisense oligonucleotide compound has a sequence consisting of SEQ ID NO: 247.
- 26.26.
- El compuesto oligonucleótido antisentido de la realización 25, en el que el compuesto oligonucleótido antisentido es un compuesto mimético de oligonucleótido. The antisense oligonucleotide compound of embodiment 25, wherein the antisense oligonucleotide compound is an oligonucleotide mimetic compound.
- 27.27.
- El compuesto oligonucleótido antisentido de la realización 26, en el que el compuesto mimético de oligonucleótido es un compuesto oligonucleótido fosforotioato quimérico. The antisense oligonucleotide compound of embodiment 26, wherein the oligonucleotide mimetic compound is a chimeric phosphorothioate oligonucleotide compound.
- 28.28.
- El compuesto oligonucleótido antisentido de la realización 27, en el que el compuesto oligonucleótido fosforotioato quimérico comprende alas de 2'-metoxietoxil-nucleótido y un hueco de 2'-desoxinucleótidos. The antisense oligonucleotide compound of embodiment 27, wherein the chimeric phosphorothioate oligonucleotide compound comprises 2'-methoxyethoxyl-nucleotide wings and a 2'-deoxynucleotide gap.
- 29.29.
- El compuesto oligonucleótido antisentido de la realización 28, en el que el compuesto oligonucleótido fosforotioato quimérico comprende 10 2'-desoxinucleótidos. The antisense oligonucleotide compound of embodiment 28, wherein the chimeric phosphorothioate oligonucleotide compound comprises 10 2'-deoxynucleotides.
- 30.30.
- El compuesto oligonucleótido antisentido de una cualquiera de las realizaciones 21-29, en el que al menos un oligonucleótido está covalentemente unido a un conjugado. The antisense oligonucleotide compound of any one of embodiments 21-29, wherein the at least one oligonucleotide is covalently linked to a conjugate.
- 31. 31.
- Una composición que comprende el compuesto oligonucleótido antisentido de una cualquiera de las realizaciones 21-29, y un vehículo o diluyente farmacéuticamente aceptable. A composition comprising the antisense oligonucleotide compound of any one of embodiments 21-29, and a pharmaceutically acceptable carrier or diluent.
- 32.32.
- La composición de la realización 31, que además comprende un sistema de dispersión coloidal. The composition of embodiment 31, further comprising a colloidal dispersion system.
- 33.33.
- Una composición que comprende un compuesto oligonucleótido de cualquiera de las realizaciones 22-29, hibridado con una cadena complementaria. A composition comprising an oligonucleotide compound of any one of embodiments 22-29, hybridized to a complementary strand.
- 34.3. 4.
- La composición de la realización 33, en la que la hibridación del compuesto oligonucleótido con la cadena The composition of embodiment 33, wherein the hybridization of the oligonucleotide compound with the chain
complementaria forma al menos un extremo romo. complementary forms at least one blunt end.
- 35.35.
- La composición de la realización 34, en la que la hibridación del compuesto oligonucleótido con la cadena complementaria forma al menos dos extremos romos. The composition of embodiment 34, wherein hybridization of the oligonucleotide compound with the complementary strand forms at least two blunt ends.
- 36.36.
- Un método para inhibir la expresión de la apolipoproteína B en células o tejidos, que comprende poner en contacto dichas células o tejidos con un compuesto de la realización 2, en condiciones tales que se inhiba la expresión de la apolipoproteína B. A method of inhibiting the expression of apolipoprotein B in cells or tissues, comprising contacting said cells or tissues with a compound of embodiment 2, under conditions such that the expression of apolipoprotein B is inhibited.
- 37.37.
- Un método para inhibir la expresión de la apolipoproteína B en células o tejidos, que comprende poner en contacto dichas células o tejidos con un compuesto de la realización 21, en condiciones tales que se inhiba la expresión de la apolipoproteína B. A method of inhibiting the expression of apolipoprotein B in cells or tissues, comprising contacting said cells or tissues with a compound of embodiment 21, under conditions such that the expression of apolipoprotein B is inhibited.
- 38.38.
- El método de la realización 36 o realización 37, en el que las células o tejidos se ponen en contacto in vivo. The method of embodiment 36 or embodiment 37, wherein the cells or tissues are contacted in vivo.
- 39.39.
- El método de la realización 38, en el que dicho contacto comprende la etapa de administrar el compuesto a un animal. The method of embodiment 38, wherein said contacting comprises the step of administering the compound to an animal.
- 40.40.
- El método de la realización 39, en el que el animal es un ser humano. The method of embodiment 39, wherein the animal is a human.
- 41.41.
- El método de la realización 40, en el que el ser humano tiene una enfermedad o afección asociada con la expresión de la apolipoproteína B, y se administra una cantidad terapéutica o profilácticamente eficaz del compuesto. The method of embodiment 40, wherein the human has a disease or condition associated with apolipoprotein B expression, and a therapeutically or prophylactically effective amount of the compound is administered.
- 42.42.
- El método de la realización 41, en el que el ser humano tiene una afección asociada con el metabolismo anómalo de lípidos. The method of embodiment 41, wherein the human has a condition associated with abnormal lipid metabolism.
- 43.43.
- El método de la realización 41, en el que el ser humano tiene una afección asociada con el metabolismo anómalo del colesterol. The method of embodiment 41, wherein the human has a condition associated with abnormal cholesterol metabolism.
- 44.44.
- El método de la realización 41, en el que el ser humano tiene una enfermedad cardiovascular. The method of embodiment 41, wherein the human being has cardiovascular disease.
- 45.Four. Five.
- El método de la realización 44, en el que la enfermedad cardiovascular es la aterosclerosis. The method of embodiment 44, wherein the cardiovascular disease is atherosclerosis.
- 46.46.
- El método de la realización 41, en el que el ser humano tiene una afección metabólica anómala asociada con la expresión de la apolipoproteína B. The method of embodiment 41, wherein the human being has an abnormal metabolic condition associated with apolipoprotein B expression.
- 47.47.
- El método de la realización 46, en el que la afección metabólica anómala es la hiperlipidemia. The method of embodiment 46, wherein the abnormal metabolic condition is hyperlipidemia.
- 48.48.
- El método de la realización 41, en el que el ser humano tiene diabetes. The method of embodiment 41, wherein the human being has diabetes.
- 49.49.
- El método de la realización 41, en el que el ser humano es obeso. The method of embodiment 41, wherein the human is obese.
- 50.fifty.
- El método de la realización 40, en el que se administra una cantidad eficaz del compuesto para prevenir una enfermedad o afección asociada con la expresión de la apolipoproteína B. The method of embodiment 40, wherein an effective amount of the compound is administered to prevent a disease or condition associated with apolipoprotein B expression.
- 51.51.
- El método de la realización 40, en el que se administra una cantidad eficaz del compuesto para retrasar una enfermedad o afección asociada con la expresión de la apolipoproteína B. The method of embodiment 40, wherein an effective amount of the compound is administered to delay a disease or condition associated with apolipoprotein B expression.
- 52.52.
- Un método para prevenir o retrasar el inicio de un aumento de los niveles de glucosa en un animal, que comprende administrar a dicho animal una cantidad terapéutica o profilácticamente eficaz del compuesto de la realización 1. A method of preventing or delaying the onset of an increase in glucose levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of the compound of embodiment 1.
- 53.53.
- Un método para prevenir o retrasar el inicio de un aumento de los niveles de glucosa en un animal, que comprende administrar a dicho animal una cantidad terapéutica o profilácticamente eficaz del compuesto de la realización 22. A method of preventing or delaying the onset of an increase in glucose levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of the compound of embodiment 22.
- 54.54.
- El método de la realización 52 o realización 53, en el que el animal es un ser humano. The method of embodiment 52 or embodiment 53, wherein the animal is a human.
- 55.55.
- El método de la realización 54, en el que los niveles de glucosa son niveles de glucosa en el suero o el plasma. The method of embodiment 54, wherein the glucose levels are serum or plasma glucose levels.
- 56.56.
- Un método para modular los niveles de colesterol en el suero en un animal, que comprende administrar a dicho animal una cantidad terapéutica o profilácticamente eficaz del compuesto de la realización 1 ó 21. A method of modulating serum cholesterol levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of the compound of embodiment 1 or 21.
- 57.57.
- El método de la realización 56, en el que el animal es un ser humano. The method of embodiment 56, wherein the animal is a human.
- 58.58.
- Un método para modular los niveles de lipoproteína en un animal, que comprende administrar a dicho animal una cantidad terapéutica o profilácticamente eficaz del compuesto de la realización 1. A method of modulating lipoprotein levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of the compound of embodiment 1.
- 59.59.
- Un método para modular los niveles de lipoproteína en un animal, que comprende administrar a dicho animal A method of modulating lipoprotein levels in an animal, which comprises administering to said animal
una cantidad terapéutica o profilácticamente eficaz del compuesto de la realización 22. a therapeutically or prophylactically effective amount of the compound of embodiment 22.
- 60.60.
- El método de la realización 58 o realización 59, en el que el animal es un ser humano. The method of embodiment 58 or embodiment 59, wherein the animal is a human.
- 61.61.
- El método de la realización 60, en el que la lipoproteína es VLDL. The method of embodiment 60, wherein the lipoprotein is VLDL.
- 62.62.
- El método de la realización 60, en el que la lipoproteína es HDL. The method of embodiment 60, wherein the lipoprotein is HDL.
- 63.63.
- El método de la realización 60, en el que la lipoproteína es LDL. The method of embodiment 60, wherein the lipoprotein is LDL.
- 64.64.
- El método de una cualquiera de las realizaciones 39, 52, 53, 56, 58 y 59, en el que el compuesto se administra por vía intravenosa. The method of any one of embodiments 39, 52, 53, 56, 58 and 59, wherein the compound is administered intravenously.
65.El método de una cualquiera de las realizaciones 39, 52, 53, 56, 58 y 59, en el que el compuesto se administra por vía subcutánea. 65. The method of any one of embodiments 39, 52, 53, 56, 58 and 59, wherein the compound is administered subcutaneously.
- 66.66.
- Un compuesto oligonucleótido antisentido de 20 bases nucleicas de longitud que tiene una secuencia de bases nucleicas como se expone en la SEQ ID NO: 247 y que comprende 5-metilcitidina en las bases nucleicas 2, 3, 5, 9, 12, 15, 17, 19 y 20, en el que cada enlace internucleósido es un enlace fosforotioato, las bases nucleicas 1-5 y 16-20 comprenden una modificación 2'-metoxietoxilo, y las bases nucleicas 6-15 son desoxinucleótidos. A 20 nucleic length antisense oligonucleotide compound having a nucleic base sequence as set forth in SEQ ID NO: 247 and comprising 5-methylcytidine at nucleic bases 2, 3, 5, 9, 12, 15, 17 , 19 and 20, in which each internucleoside bond is a phosphorothioate bond, nucleic bases 1-5 and 16-20 comprise a 2'-methoxyethoxy modification, and nucleic bases 6-15 are deoxynucleotides.
- 67.67.
- El compuesto oligonucleótido antisentido de la realización 66, en el que un oligonucleótido está covalentemente unido a un conjugado. The antisense oligonucleotide compound of embodiment 66, wherein an oligonucleotide is covalently linked to a conjugate.
- 68. 68.
- Una composición que comprende el compuesto oligonucleótido antisentido de la realización 66, y un vehículo o diluyente farmacéuticamente aceptable. A composition comprising the antisense oligonucleotide compound of embodiment 66, and a pharmaceutically acceptable carrier or diluent.
- 69.69.
- La composición de la realización 68, que además comprende un sistema de dispersión coloidal. The composition of embodiment 68, further comprising a colloidal dispersion system.
- 70.70.
- Una composición que comprende el compuesto oligonucleótido antisentido de la realización 66, hibridado con una cadena complementaria. A composition comprising the antisense oligonucleotide compound of embodiment 66, hybridized to a complementary strand.
- 71.71.
- Un método para inhibir la expresión de la apolipoproteína B en células o tejidos, que comprende poner en contacto dichas células o tejidos con un compuesto de la realización 66, de modo que se inhiba la expresión de la apolipoproteína B. A method of inhibiting the expression of apolipoprotein B in cells or tissues, which comprises contacting said cells or tissues with a compound of embodiment 66, so that the expression of apolipoprotein B is inhibited.
- 72.72.
- El método de la realización 72 o realización 71, en el que las células o tejidos se ponen en contacto in vivo. The method of embodiment 72 or embodiment 71, wherein the cells or tissues are contacted in vivo.
- 73.73.
- El método de la realización 72, en el que dicho contacto comprende la etapa de administrar el compuesto a un animal. The method of embodiment 72, wherein said contacting comprises the step of administering the compound to an animal.
- 74.74.
- El método de la realización 73, en el que el animal es un ser humano. The method of embodiment 73, wherein the animal is a human.
- 75.75.
- El método de la realización 74, en el que el ser humano tiene una enfermedad o afección asociada con la expresión de la apolipoproteína B, y se administra una cantidad terapéutica o profilácticamente eficaz del compuesto. The method of embodiment 74, wherein the human has a disease or condition associated with apolipoprotein B expression, and a therapeutically or prophylactically effective amount of the compound is administered.
- 76.76.
- El método de la realización 75, en el que el ser humano tiene una afección asociada con el metabolismo anómalo de lípidos. The method of embodiment 75, wherein the human has a condition associated with abnormal lipid metabolism.
- 77.77.
- El método de la realización 75, en el que el ser humano tiene una afección asociada con el metabolismo anómalo del colesterol. The method of embodiment 75, wherein the human has a condition associated with abnormal cholesterol metabolism.
- 78.78.
- El método de la realización 75, en el que el ser humano tiene una enfermedad cardiovascular. The method of embodiment 75, wherein the human being has cardiovascular disease.
- 79.79.
- El método de la realización 78, en el que la enfermedad cardiovascular es la aterosclerosis. The method of embodiment 78, wherein the cardiovascular disease is atherosclerosis.
- 80.80.
- El método de la realización 75, en el que el ser humano tiene una afección metabólica anómala asociada con la expresión de la apolipoproteína B. The method of embodiment 75, wherein the human has an abnormal metabolic condition associated with apolipoprotein B expression.
- 81.81.
- El método de la realización 80, en el que la afección metabólica anómala es la hiperlipidemia. The method of embodiment 80, wherein the abnormal metabolic condition is hyperlipidemia.
- 82.82.
- El método de la realización 75, en el que el ser humano tiene diabetes. The method of embodiment 75, wherein the human being has diabetes.
- 83.83.
- El método de la realización 75, en el que el ser humano es obeso. The method of embodiment 75, wherein the human is obese.
- 84.84.
- El método de la realización 74, en el que se administra una cantidad eficaz del compuesto para prevenir una enfermedad o afección asociada con la expresión de la apolipoproteína B. The method of embodiment 74, wherein an effective amount of the compound is administered to prevent a disease or condition associated with apolipoprotein B expression.
- 85.85.
- El método de la realización 74, en el que se administra una cantidad eficaz del compuesto para retrasar una enfermedad o afección asociada con la expresión de la apolipoproteína B. The method of embodiment 74, wherein an effective amount of the compound is administered to delay a disease or condition associated with apolipoprotein B expression.
- 86.86.
- Un método para prevenir o retrasar el inicio de un aumento de los niveles de glucosa en un ser humano, que comprende administrar a dicho ser humano una cantidad terapéutica o profilácticamente eficaz del compuesto de la realización 66. A method of preventing or delaying the onset of an increase in glucose levels in a human, comprising administering to said human a therapeutically or prophylactically effective amount of the compound of embodiment 66.
- 87.87.
- El método de la realización 86, en el que los niveles de glucosa son niveles de glucosa en el suero. The method of embodiment 86, wherein the glucose levels are serum glucose levels.
- 88.88.
- El método de la realización 86, en el que los niveles de glucosa son niveles de glucosa en el plasma. The method of embodiment 86, wherein the glucose levels are plasma glucose levels.
- 89. 89.
- Un método para modular los niveles de colesterol en el suero en un ser humano, que comprende administrar a dicho ser humano una cantidad terapéutica o profilácticamente eficaz del compuesto de la realización 66. A method of modulating serum cholesterol levels in a human, comprising administering to said human a therapeutically or prophylactically effective amount of the compound of embodiment 66.
- 90. 90.
- Un método para modular los niveles de lipoproteína en un ser humano, que comprende administrar a dicho ser humano una cantidad terapéutica o profilácticamente eficaz del compuesto de la realización 66. A method of modulating lipoprotein levels in a human, comprising administering to said human a therapeutically or prophylactically effective amount of the compound of embodiment 66.
- 91.91.
- El método de la realización 90, en el que la lipoproteína es VLDL. The method of embodiment 90, wherein the lipoprotein is VLDL.
- 92.92.
- El método de la realización 90, en el que la lipoproteína es HDL. The method of embodiment 90, wherein the lipoprotein is HDL.
- 93.93.
- El método de la realización 90, en el que la lipoproteína es LDL. The method of embodiment 90, wherein the lipoprotein is LDL.
- 94.94.
- El método de una cualquiera de las realizaciones 73-93, en el que el compuesto se administra por vía intravenosa. The method of any one of embodiments 73-93, wherein the compound is administered intravenously.
- 95.95.
- El método de una cualquiera de las realizaciones 73-93, en el que el compuesto se administra por vía subcutánea. The method of any one of embodiments 73-93, wherein the compound is administered subcutaneously.
- 96.96.
- El método de una cualquiera de las realizaciones 73-93, en el que el compuesto se administra por vía oral. The method of any one of embodiments 73-93, wherein the compound is administered orally.
- 97.97.
- Un kit que comprende un compuesto de una cualquiera de las realizaciones 1-15, 21-30 y 66-67. A kit comprising a compound of any one of Embodiments 1-15, 21-30 and 66-67.
- 98.98.
- Un compuesto que comprende una primera cadena de bases nucleicas hibridada con una segunda cadena de bases nucleicas, cada cadena de 8 a 50 bases nucleicas de longitud, comprendiendo dicha primera cadena de bases nucleicas una secuencia de al menos 8 bases nucleicas contiguas de la secuencia expuesta en la SEQ ID NO: 3, comprendiendo dicha segunda cadena de bases nucleicas una secuencia suficientemente complementaria de dicha primera cadena para permitir la hibridación estable, inhibiendo dicho compuesto la expresión del ARNm de la apolipoproteína B humana después de 16 a 24 h en al menos 30%, en células HepG2 al 80% de confluencia en cultivo en una concentración 100 nM. A compound comprising a first nucleic base chain hybridized to a second nucleic base chain, each chain 8 to 50 nucleic bases in length, said first nucleic base chain comprising a sequence of at least 8 contiguous nucleic bases of the exposed sequence in SEQ ID NO: 3, said second nucleic base chain comprising a sequence sufficiently complementary to said first chain to allow stable hybridization, said compound inhibiting the expression of human apolipoprotein B mRNA after 16 to 24 h in at least 30%, in HepG2 cells at 80% confluence in culture at a concentration of 100 nM.
- 99.99.
- El compuesto de la realización 98, en el que la primera cadena comprende una secuencia de 12 a 30 bases nucleicas contiguas de la secuencia expuesta en la SEQ ID NO: 3. The compound of embodiment 98, wherein the first strand comprises a sequence of 12 to 30 contiguous nucleic bases of the sequence set forth in SEQ ID NO: 3.
- 100.100.
- El compuesto de la realización 98, en el que la primera cadena comprende una secuencia de 20 bases nucleicas contiguas de la secuencia expuesta en la SEQ ID NO: 3. The compound of embodiment 98, wherein the first strand comprises a sequence of 20 contiguous nucleic bases of the sequence set forth in SEQ ID NO: 3.
- 101.101.
- El compuesto de las realizaciones 98, 99 ó 100, en el que la segunda cadena comprende una secuencia perfectamente complementaria de al menos 8 bases nucleicas contiguas de la secuencia expuesta en la SEQ ID NO: 3. The compound of embodiments 98, 99 or 100, wherein the second strand comprises a perfectly complementary sequence of at least 8 contiguous nucleic bases of the sequence set forth in SEQ ID NO: 3.
- 102.102.
- El compuesto de la realización 101, en el que la segunda cadena comprende una secuencia perfectamente complementaria de 12 a 30 bases nucleicas de la secuencia expuesta en la SEQ ID NO: 3. The compound of embodiment 101, wherein the second strand comprises a perfectly complementary sequence of 12 to 30 nucleic bases from the sequence set forth in SEQ ID NO: 3.
- 103.103.
- El compuesto de la realización 101, en el que la segunda cadena comprende una secuencia perfectamente complementaria de 20 bases nucleicas de la secuencia expuesta en la SEQ ID NO: 3. The compound of embodiment 101, wherein the second strand comprises a perfectly complementary sequence of 20 nucleic bases from the sequence set forth in SEQ ID NO: 3.
- 104.104.
- El compuesto de cualquiera de las realizaciones 98-103, en el que al menos una cadena comprende ARN. The compound of any of embodiments 98-103, wherein the at least one chain comprises RNA.
- 105.105.
- El compuesto de cualquiera de las realizaciones 98-104, en el que al menos una cadena comprende uno o más desoxinucleósidos. The compound of any one of embodiments 98-104, wherein the at least one chain comprises one or more deoxynucleosides.
- 106.106.
- El compuesto de cualquiera de las realizaciones 98-105, en el que las cadenas hibridadas forman al menos un extremo saliente. The compound of any one of embodiments 98-105, wherein the hybridized chains form at least one protruding end.
- 107.107.
- El compuesto de la realización 106, en el que el extremo saliente comprende al menos una base modificada. The compound of embodiment 106, wherein the projecting end comprises at least one modified base.
- 108.108.
- El compuesto de cualquiera de las realizaciones 98-107, en el que dicho compuesto inhibe la expresión del ARNm que codifica la apolipoproteína B humana después de 16 a 24 h en al menos 50%, en células HepG2 al 80% de confluencia en cultivo en una concentración 100 nM. The compound of any of embodiments 98-107, wherein said compound inhibits expression of the human apolipoprotein B encoding mRNA after 16 to 24 h by at least 50%, in HepG2 cells at 80% confluence in culture in a 100 nM concentration.
- 109.109.
- Una vesícula que comprende un compuesto de cualquiera de las realizaciones 98-108. A vesicle comprising a compound of any one of embodiments 98-108.
- 110.110.
- La vesícula de la realización 109, en la que la vesícula es un liposoma. The vesicle of embodiment 109, wherein the vesicle is a liposome.
- 111.111.
- Una composición que comprende el compuesto de una cualquiera de las realizaciones 98-108, y un vehículo o diluyente farmacéuticamente aceptable. A composition comprising the compound of any one of embodiments 98-108, and a pharmaceutically acceptable carrier or diluent.
- 112.112.
- La composición de la realización 111, que además comprende un sistema de dispersión coloidal. The composition of embodiment 111, further comprising a colloidal dispersion system.
- 113.113.
- Un método para inhibir la expresión de la apolipoproteína B en células o tejidos, que comprende poner en contacto dichas células o tejidos con el compuesto de una cualquiera de las realizaciones 98-108, en condiciones tales que se inhiba la expresión de la apolipoproteína B. A method of inhibiting the expression of apolipoprotein B in cells or tissues, comprising contacting said cells or tissues with the compound of any one of embodiments 98-108, under conditions such that the expression of apolipoprotein B is inhibited.
- 114.114.
- El método de la realización 113, en el que las células o tejidos se ponen en contacto in vivo. The method of embodiment 113, wherein the cells or tissues are contacted in vivo.
- 115.115.
- El método de la realización 114, en el que dicho contacto comprende la etapa de administrar el compuesto a un animal. The method of embodiment 114, wherein said contacting comprises the step of administering the compound to an animal.
- 116.116.
- El método de la realización 115, en el que el animal es un ser humano. The method of embodiment 115, wherein the animal is a human.
- 117.117.
- El método de la realización 116, en el que el ser humano tiene una afección asociada con la expresión de la apolipoproteína B, y se administra una cantidad terapéutica o profilácticamente eficaz del compuesto. The method of embodiment 116, wherein the human has a condition associated with apolipoprotein B expression, and a therapeutically or prophylactically effective amount of the compound is administered.
- 118.118.
- El método de la realización 117, en el que dicha afección está asociada con el metabolismo anómalo de lípidos. The method of embodiment 117, wherein said condition is associated with abnormal lipid metabolism.
- 119.119.
- El método de la realización 117, en el que dicha afección está asociada con el metabolismo anómalo del colesterol. The method of embodiment 117, wherein said condition is associated with abnormal cholesterol metabolism.
- 120.120.
- El método de la realización 117, en el que dicha afección es una la enfermedad cardiovascular. The method of embodiment 117, wherein said condition is cardiovascular disease.
- 121.121.
- El método de la realización 120, en el que la enfermedad cardiovascular es la aterosclerosis. The method of embodiment 120, wherein the cardiovascular disease is atherosclerosis.
- 122.122.
- El método de la realización 117, en el que dicha afección es una afección metabólica anómala asociada con la expresión de la apolipoproteína B. The method of embodiment 117, wherein said condition is an abnormal metabolic condition associated with apolipoprotein B expression.
- 123. 123.
- El método de la realización 122, en el que la afección metabólica anómala asociada con la expresión de la apolipoproteína B es la hiperlipidemia. The method of embodiment 122, wherein the abnormal metabolic condition associated with apolipoprotein B expression is hyperlipidemia.
- 124.124.
- El método de la realización 117, en el que la afección es la diabetes. The method of embodiment 117, wherein the condition is diabetes.
- 125.125.
- El método de la realización 117, en el que la afección es la obesidad. The method of embodiment 117, wherein the condition is obesity.
- 126.126.
- El método de la realización 116, en el que se administra una cantidad eficaz del compuesto para prevenir una afección asociada con la expresión de la apolipoproteína B. The method of embodiment 116, wherein an effective amount of the compound is administered to prevent a condition associated with apolipoprotein B expression.
- 127.127.
- El método de la realización 126, en el que se administra una cantidad eficaz del compuesto para retrasar una afección asociada con la expresión de la apolipoproteína B. The method of embodiment 126, wherein an effective amount of the compound is administered to delay a condition associated with apolipoprotein B expression.
- 128.128.
- Un método para reducir la secreción de lipoproteína (a) por hepatocitos, que comprende: A method of reducing lipoprotein (a) secretion by hepatocytes, comprising:
- (a)(to)
- poner en contacto hepatocitos con una cantidad de una composición que comprende un compuesto no catalítico de 8 a 50 bases nucleicas de longitud, que hibrida específicamente con el ARNm que codifica la apolipoproteína B humana e inhibe la expresión del ARNm después de 16 a 24 h en al menos 30%, en células HepG2 al 80% de confluencia en cultivo en una concentración 150 nM, en el que dicha cantidad es eficaz para inhibir la expresión de la apolipoproteína B en los hepatocitos; y contacting hepatocytes with an amount of a composition comprising a non-catalytic compound 8 to 50 nucleic bases in length, which specifically hybridizes with the mRNA encoding human apolipoprotein B and inhibits mRNA expression after 16 to 24 h in at least 30%, in HepG2 cells at 80% confluence in culture at a concentration of 150 nM, in which said amount is effective to inhibit the expression of apolipoprotein B in hepatocytes; and
- (b)(b)
- medir la secreción de la lipoproteína (a) por los hepatocitos. measure the secretion of lipoprotein (a) by hepatocytes.
- 129.129.
- El método de la realización 128, en el que el compuesto no catalítico hibrida específicamente con los nucleótidos 3230-3288 expuestos en la SEQ ID NO: 3. The method of embodiment 128, wherein the non-catalytic compound specifically hybridizes to nucleotides 3230-3288 set forth in SEQ ID NO: 3.
- 130. 130.
- El método de la realización 129, en el que el compuesto no catalítico comprende una secuencia de bases nucleicas como se expone en la SEQ ID NO: 247. The method of embodiment 129, wherein the non-catalytic compound comprises a nucleic base sequence as set forth in SEQ ID NO: 247.
- 131.131.
- El método de cualquiera de las realizaciones 128-130, en el que el compuesto no catalítico es un mimético de oligonucleótido antisentido. The method of any of embodiments 128-130, wherein the non-catalytic compound is an antisense oligonucleotide mimetic.
- 132.132.
- Un método para tratar una afección asociada con la expresión de la apolipoproteína B humana en un primate, que comprende administrar al primate una cantidad terapéutica o profilácticamente eficaz de un compuesto no catalítico de 8 a 50 bases nucleicas de longitud que hibrida específicamente con ARNm que codifica la apolipoproteína B humana e inhibe la expresión del ARNm después de 16 a 24 h en al menos 30%, en células HepG2 al 80% de confluencia en cultivo en una concentración 150 nM. A method of treating a condition associated with the expression of human apolipoprotein B in a primate, comprising administering to the primate a therapeutically or prophylactically effective amount of a non-catalytic compound of 8 to 50 nucleic bases in length that specifically hybridizes with mRNA encoding human apolipoprotein B and inhibits mRNA expression after 16 to 24 h by at least 30%, in HepG2 cells at 80% confluence in culture at a concentration of 150 nM.
- 133.133.
- El método de la realización 132, en el que el primate es un ser humano. The method of embodiment 132, wherein the primate is a human.
- 134.134.
- El método de la realización 133, en el que la afección se selecciona del grupo que consiste en metabolismo anómalo de lípidos, metabolismo anómalo del colesterol, enfermedad cardiovascular, hiperlipidemia, diabetes y obesidad. The method of embodiment 133, wherein the condition is selected from the group consisting of abnormal lipid metabolism, abnormal cholesterol metabolism, cardiovascular disease, hyperlipidemia, diabetes and obesity.
- 135.135.
- Un método para reducir la expresión de la apolipoproteína B en el hígado de un animal, que comprende administrar al animal entre 2 mg/kg y 20 mg/kg de un compuesto no catalítico de 8 a 50 bases nucleicas de longitud que hibrida específicamente con el ARNm que codifica la apolipoproteína B humana en al menos 30%, en células HepG2 al 80% de confluencia en cultivos en una concentración 150 nM. A method of reducing the expression of apolipoprotein B in the liver of an animal, which comprises administering to the animal between 2 mg / kg and 20 mg / kg of a non-catalytic compound 8 to 50 nucleic bases in length that specifically hybridizes with the MRNA encoding human apolipoprotein B at least 30%, in HepG2 cells at 80% confluence in cultures at a concentration of 150 nM.
- 136.136.
- El método de la realización 135, en el que el compuesto se administra por vía subcutánea. The method of embodiment 135, wherein the compound is administered subcutaneously.
- 137.137.
- El método de la realización 135, en el que el compuesto se administra por vía intravenosa. The method of embodiment 135, wherein the compound is administered intravenously.
- 138.138.
- El método de la realización 135, en el que el compuesto se administra por vía oral. The method of embodiment 135, wherein the compound is administered orally.
- 139.139.
- El método de una cualquiera de las realizaciones 135-138, en el que la administración al animal se repite. The method of any one of embodiments 135-138, wherein administration to the animal is repeated.
- 140.140.
- El método de una cualquiera de las reivindicaciones 135-139, en el que el animal es un ser humano. The method of any one of claims 135-139, wherein the animal is a human.
- 141.141.
- Uso de un compuesto de una cualquiera de las reivindicaciones 1-15, 21-30, 66-67 y 98-108, en la producción de un medicamento. Use of a compound of any one of claims 1-15, 21-30, 66-67 and 98-108, in the production of a medicament.
- 142.142.
- Uso de un compuesto de una cualquiera de las reivindicaciones 1-15, 21-30, 66-67 y 98-108, en un medicamento para alterar el metabolismo de lípidos. Use of a compound of any one of claims 1-15, 21-30, 66-67 and 98-108, in a medicament for altering lipid metabolism.
- 143.143.
- Uso de un compuesto de una cualquiera de las reivindicaciones 1-15, 21-30, 66-67 y 98-108, en un medicamento para una enfermedad o afección asociada con la expresión de la apolipoproteína B. Use of a compound of any one of claims 1-15, 21-30, 66-67 and 98-108, in a medicament for a disease or condition associated with apolipoprotein B expression.
- 144.144.
- Un método para fabricar un compuesto de una cualquiera de las realizaciones 98-108, que comprende hibridar específicamente in vitro una primera cadena de bases nucleicas que comprende una secuencia de al menos 8 bases nucleicas contiguas de la secuencia expuesta en la SEQ ID NO: 3 con una segunda cadena de bases nucleicas que comprende una secuencia suficientemente complementaria de dicha primera cadena de forma que permite la hibridación estable. A method of manufacturing a compound of any one of embodiments 98-108, which specifically hybridizes in vitro to a first nucleic base chain comprising a sequence of at least 8 contiguous nucleic bases of the sequence set forth in SEQ ID NO: 3 with a second nucleic base chain comprising a sequence sufficiently complementary to said first chain so as to allow stable hybridization.
LISTA DE SECUENCIAS SEQUENCE LIST
<110> Genzyme Corporation <110> Genzyme Corporation
<120> MODULACION ANTISENTIDO DE LA EXPRESIÓN DE LA APOLIPOPROTEÍNA B <120> ANTI-SENSE MODULATION OF THE EXPRESSION OF APOLIPOPROTEIN B
<130> P055617EP <130> P055617EP
<150> US 60/426,234 <150> US 60 / 426,234
<151> <151>
<150> PCT/US03/015493 <150> PCT / US03 / 015493
<151> <151>
<150> PCT/US03/036411 <150> PCT / US03 / 036411
<151> <151>
<150> EP 03789763.4 <150> EP 03789763.4
<151> <151>
<160> 892 <160> 892
<210> 1 <210> 1
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 1 <400> 1
tccgtcatcg ctcctcaggg 20 tccgtcatcg ctcctcaggg 20
<210> 2 <210> 2
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 2 <400> 2
atgcattctg cccccaagga 20 atgcattctg cccccaagga 20
<210> 3 <210> 3
<211> 14121 <211> 14121
<212> ADN <212> DNA
<213> Homo sapiens <213> Homo sapiens
<220> <220>
<221> CDS <221> CDS
<222> (129)..(13820) <222> (129) .. (13820)
<400> 3 <400> 3
- <210> 4 <211> 21 <212> ADN <213> Secuencia Artificial <210> 4 <211> 21 <212> DNA <213> Artificial Sequence
- <220> <223> Cebador PCR <220> <223> PCR primer
- <400> 4 <400> 4
- tgctaaaggc acatatggcc t tgctaaaggc acatatggcc t
- 21 twenty-one
- <210> 5 <211> 23 <212> ADN <213> Secuencia Artificial <210> 5 <211> 23 <212> DNA <213> Artificial Sequence
- <220> <223> Cebador PCR <220> <223> PCR primer
- <400> 5 <400> 5
- ctcaggttgg actctccatt gag ctcaggttgg actctccatt gag
- 23 2. 3
- <210> 6 <211> 28 <212> ADN <213> Secuencia Artificial <210> 6 <211> 28 <212> DNA <213> Artificial Sequence
- <220> <223> Sonda PCR <220> <223> PCR probe
- <400> 6 <400> 6
- cttgtcagag ggatcctaac actggccg cttgtcagag ggatcctaac actggccg
- 28 28
- <210> 7 <211> 19 <212> ADN <213> Secuencia Artificial <210> 7 <211> 19 <212> DNA <213> Artificial Sequence
- <220> <223> Cebador PCR <220> <223> PCR primer
- <400> 7 <400> 7
- gaaggtgaag gtcggagtc gaaggtgaag gtcggagtc
- 19 19
- <210> 8 <211> 20 <212> ADN <213> Secuencia Artificial <210> 8 <211> 20 <212> DNA <213> Artificial Sequence
- <220> <223> Cebador PCR <220> <223> PCR primer
- <400> 8 <400> 8
- gaagatggtg atgggatttc gaagatggtg atgggatttc
- 20 twenty
- <210> 9 <211> 20 <212> ADN <213> Secuencia Artificial <210> 9 <211> 20 <212> DNA <213> Artificial Sequence
- <220> <223> Sonda PCR <220> <223> PCR probe
- <400> 9 <400> 9
- caagcttccc gttctcagcc caagcttccc gttctcagcc
- 20 twenty
- <210> 10 <211> 2354 <212> ADN <213> Mus musculus <210> 10 <211> 2354 <212> DNA <213> Mus musculus
- <400> 10 <400> 10
<210> 11 <210> 11
<211> 19 <211> 19
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Cebador PCR <223> PCR primer
<400> 11 <400> 11
cgtgggctcc agcattcta cgtgggctcc agcattcta
<210> 12 <210> 12
<211> 21 <211> 21
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Cebador PCR <223> PCR primer
<400> 12 <400> 12
agtcatttct gcctttgcgt c agtcatttct gcctttgcgt c
<210> 13 <210> 13
<211> 22 <211> 22
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Sonda PCR <223> PCR probe
<400> 13 <400> 13
ccaatggtcg ggcactgctc aa ccaatggtcg ggcactgctc aa
<210> 14 <210> 14
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Cebador PCR <223> PCR primer
<400> 14 <400> 14
ggcaaattca acggcacagt ggcaaattca acggcacagt
<210> 15 <210> 15
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Cebador PCR <223> PCR primer
<400> 15 <400> 15
gggtctcgct cctggaagat gggtctcgct cctggaagat
<210> 16 <210> 16
<211> 27 <211> 27
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Sonda PCR <223> PCR probe
<400> 16 aaggccgaga atgggaagct tgtcatc 27 <400> 16 aaggccgaga atgggaagct tgtcatc 27
<210> 17 <210> 17
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 17 ccgcaggtcc cggtgggaat 20 <400> 17 ccgcaggtcc cggtgggaat 20
<210> 18 <210> 18
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 18 accgagaagg gcactcagcc 20 <400> 18 accgagaagg gcactcagcc 20
<210> 19 <210> 19
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 19 gcctcggcct cgcggccctg 20 <400> 19 gcctcggcct cgcggccctg 20
<210> 20 <210> 20
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 20 tccatcgcca gctgcggtgg 20 <400> 20 tccatcgcca gctgcggtgg 20
<210> 21 <210> 21
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 21 cagcgccagc agcgccagca 20 <400> 21 cagcgccagc agcgccagca 20
<210> 22 <210> 22
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 22 <400> 22
gcccgccagc agcagcagca gcccgccagc agcagcagca
<210> 23 <210> 23
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 23 <400> 23
cttgaatcag cagtcccagg cttgaatcag cagtcccagg
<210> 24 <210> 24
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 24 <400> 24
cttcagcaag gctttgccct cttcagcaag gctttgccct
<210> 25 <210> 25
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 25 <400> 25
tttctgttgc cacattgccc tttctgttgc cacattgccc
<210> 26 <210> 26
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 26 <400> 26
ggaagaggtg ttgctccttg ggaagaggtg ttgctccttg
<210> 27 <210> 27
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 27 tgtgctacca tcccatactt <400> 27 tgtgctacca tcccatactt
<210> 28 <210> 28
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 28 tcaaatgcga ggcccatctt <400> 28 tcaaatgcga ggcccatctt
<210> 29 <210> 29
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 29 ggacacctca atcagctgtg <400> 29 ggacacctca atcagctgtg
<210> 30 <210> 30
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 30 tcagggccac caggtaggtg <400> 30 tcagggccac caggtaggtg
<210> 31 <210> 31
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 31 gtaatcttca tccccagtgc <400> 31 gtaatcttca tccccagtgc
<210> 32 <210> 32
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 32 tgctccatgg tttggcccat <400> 32 tgctccatgg tttggcccat
<210> 33 <210> 33
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 33 <400> 33
gcagccagtc gcttatctcc gcagccagtc gcttatctcc
<210> 34 <210> 34
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 34 <400> 34
gtatagccaa agtggtccac gtatagccaa agtggtccac
<210> 35 <210> 35
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 35 <400> 35
cccaggagct ggaggtcatg cccaggagct ggaggtcatg
<210> 36 <210> 36
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 36 <400> 36
ttgagccctt cctgatgacc ttgagccctt cctgatgacc
<210> 37 <210> 37
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 37 <400> 37
atctggaccc cactcctagc atctggaccc cactcctagc
<210> 38 <210> 38
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 38 cagacccgac tcgtggaaga <400> 38 cagacccgac tcgtggaaga
<210> 39 <210> 39
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 39 gccctcagta gattcatcat <400> 39 gccctcagta gattcatcat
<210> 40 <210> 40
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 40 gccatgccac cctcttggaa <400> 40 gccatgccac cctcttggaa
<210> 41 <210> 41
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 41 aacccacgtg ccggaaagtc <400> 41 aacccacgtg ccggaaagtc
<210> 42 <210> 42
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 42 actcccagat gccttctgaa <400> 42 actcccagat gccttctgaa
<210> 43 <210> 43
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 43 atgtggtaac gagcccgaag <400> 43 atgtggtaac gagcccgaag
<210> 44 <210> 44
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 44 <400> 44
ggcgtagaga cccatcacat ggcgtagaga cccatcacat
<210> 45 <210> 45
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 45 <400> 45
gtgttaggat ccctctgaca gtgttaggat ccctctgaca
<210> 46 <210> 46
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 46 <400> 46
cccagtgata gctctgtgag cccagtgata gctctgtgag
<210> 47 <210> 47
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 47 <400> 47
atttcagcat atgagcccat atttcagcat atgagcccat
<210> 48 <210> 48
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 48 <400> 48
ccctgaacct tagcaacagt ccctgaacct tagcaacagt
<210> 49 <210> 49
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 49 gctgaagcca gcccagcgat <400> 49 gctgaagcca gcccagcgat
<210> 50 <210> 50
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 50 acagctgccc agtatgttct <400> 50 acagctgccc agtatgttct
<210> 51 <210> 51
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 51 cccaataaga tttataacaa <400> 51 cccaataaga tttataacaa
<210> 52 <210> 52
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 52 tggcctacca gagacaggta <400> 52 tggcctacca gagacaggta
<210> 53 <210> 53
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 53 tcatacgttt agcccaatct <400> 53 tcatacgttt agcccaatct
<210> 54 <210> 54
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 54 gcatggtccc aaggatggtc <400> 54 gcatggtccc aaggatggtc
<210> 55 <210> 55
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 55 <400> 55
agtgatggaa gctgcgatac agtgatggaa gctgcgatac
<210> 56 <210> 56
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 56 <400> 56
atgagcatca tgcctcccag atgagcatca tgcctcccag
<210> 57 <210> 57
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 57 <400> 57
gaacacatag ccgaatgccg gaacacatag ccgaatgccg
<210> 58 <210> 58
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 58 <400> 58
gtggtgccct ctaatttgta gtggtgccct ctaatttgta
<210> 59 <210> 59
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 59 <400> 59
cccgagaaag aaccgaaccc cccgagaaag aaccgaaccc
<210> 60 <210> 60
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 60 tgccctgcag cttcactgaa <400> 60 tgccctgcag cttcactgaa
<210> 61 <210> 61
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 61 gaaatcccat aagctcttgt <400> 61 gaaatcccat aagctcttgt
<210> 62 <210> 62
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 62 agaagctgcc tcttcttccc <400> 62 agaagctgcc tcttcttccc
<210> 63 <210> 63
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 63 tcagggtgag ccctgtgtgt <400> 63 tcagggtgag ccctgtgtgt
<210> 64 <210> 64
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 64 ctaatggccc cttgataaac <400> 64 ctaatggccc cttgataaac
<210> 65 <210> 65
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 65 acgttatcct tgagtccctg <400> 65 acgttatcct tgagtccctg
<210> 66 <210> 66
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 66 <400> 66
tatatcccag gtttccccgg tatatcccag gtttccccgg
<210> 67 <210> 67
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 67 <400> 67
acctgggaca gtaccgtccc acctgggaca gtaccgtccc
<210> 68 <210> 68
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 68 <400> 68
ctgcctactg caaggctggc ctgcctactg caaggctggc
<210> 69 <210> 69
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 69 <400> 69
agagaccttc cgagccctgg agagaccttc cgagccctgg
<210> 70 <210> 70
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 70 <400> 70
atgatacaca ataaagactc atgatacaca ataaagactc
<210> 71 <210> 71
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 71 attgtatgtg agaggtgagg <400> 71 attgtatgtg agaggtgagg
<210> 72 <210> 72
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 72 gaggagattg gatcttaagg <400> 72 gaggagattg gatcttaagg
<210> 73 <210> 73
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 73 cttcaaattg ggactctcct <400> 73 cttcaaattg ggactctcct
<210> 74 <210> 74
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 74 tccaggaatt gagcttgtgc <400> 74 tccaggaatt gagcttgtgc
<210> 75 <210> 75
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 75 ttcaggactg gaggatgagg <400> 75 ttcaggactg gaggatgagg
<210> 76 <210> 76
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 76 tctcaccctc atgctccatt <400> 76 tctcaccctc atgctccatt
<210> 77 <210> 77
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 77 <400> 77
tgactgtcaa gggtgagctg tgactgtcaa gggtgagctg
<210> 78 <210> 78
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 78 <400> 78
gtccagccta ggaacactca gtccagccta ggaacactca
<210> 79 <210> 79
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 79 <400> 79
atgtcaatgc cacatgtcca atgtcaatgc cacatgtcca
<210> 80 <210> 80
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 80 <400> 80
ttcatccgag aagttgggac ttcatccgag aagttgggac
<210> 81 <210> 81
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 81 <400> 81
atttgggacg aatgtatgcc atttgggacg aatgtatgcc
<210> 82 <210> 82
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 82 20 agttgaggaa gccagattca <400> 82 20 agttgaggaa gccagattca
<210> 83 <210> 83
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 83 ttcccagtca gctttagtgg <400> 83 ttcccagtca gctttagtgg
<210> 84 <210> 84
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 84 agcttgcttg ttgggcacgg <400> 84 agcttgcttg ttgggcacgg
<210> 85 <210> 85
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 85 cctatactgg cttctatgtt <400> 85 cctatactgg cttctatgtt
<210> 86 <210> 86
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 86 tgaactccgt gtaaggcaag <400> 86 tgaactccgt gtaaggcaag
<210> 87 <210> 87
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 87 <400> 87
gagaaatcct tcagtaaggg gagaaatcct tcagtaaggg
<210> 88 <210> 88
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 88 <400> 88
caatggaatg cttgtcactg caatggaatg cttgtcactg
<210> 89 <210> 89
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 89 <400> 89
gcttcattat aggaggtggt gcttcattat aggaggtggt
<210> 90 <210> 90
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 90 <400> 90
acaactggga tagtgtagcc acaactggga tagtgtagcc
<210> 91 <210> 91
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 91 <400> 91
gttaggacca gggattgtga gttaggacca gggattgtga
<210> 92 <210> 92
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 92 <400> 92
accatggaaa actggcaact accatggaaa actggcaact
<210> 93 <210> 93
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 93 tgggaggaaa aacttgaata <400> 93 tgggaggaaa aacttgaata
<210> 94 <210> 94
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 94 tgggcaacga tatctgattg <400> 94 tgggcaacga tatctgattg
<210> 95 <210> 95
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 95 ctgcagggcg tcagtgacaa <400> 95 ctgcagggcg tcagtgacaa
<210> 96 <210> 96
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 96 gcatcagacg tgatgttccc <400> 96 gcatcagacg tgatgttccc
<210> 97 <210> 97
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 97 cttggttaaa ctaatggtgc <400> 97 cttggttaaa ctaatggtgc
<210> 98 <210> 98
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 98 <400> 98
atgggagcat ggaggttggc atgggagcat ggaggttggc
<210> 99 <210> 99
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 99 <400> 99
aatggatgat gaaacagtgg aatggatgat gaaacagtgg
<210> 100 <210> 100
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 100 <400> 100
atcaatgcct cctgttgcag atcaatgcct cctgttgcag
<210> 101 <210> 101
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 101 <400> 101
ggaagtgaga ctttctaagc ggaagtgaga ctttctaagc
<210> 102 <210> 102
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 102 <400> 102
aggaaggaac tcttgatatt aggaaggaac tcttgatatt
<210> 103 <210> 103
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 103 <400> 103
attggcttca ttggcaacac attggcttca ttggcaacac
<210> 104 <210> 104
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 104 aggtgaggaa gttggaattc <400> 104 aggtgaggaa gttggaattc
<210> 105 <210> 105
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 105 ttgttccctg aagttgttac <400> 105 ttgttccctg aagttgttac
<210> 106 <210> 106
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 106 gttcatggat tccttcagga <400> 106 gttcatggat tccttcagga
<210> 107 <210> 107
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 107 atgctccatt ctcacatgct <400> 107 atgctccatt ctcacatgct
<210> 108 <210> 108
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 108 tgcgactgtg tctgatttcc <400> 108 tgcgactgtg tctgatttcc
<210> 109 <210> 109
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 109 <400> 109
gtccctgaag atgtcaatgc gtccctgaag atgtcaatgc
<210> 110 <210> 110
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 110 <400> 110
aggcccagtt ccatgaccct aggcccagtt ccatgaccct
<210> 111 <210> 111
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 111 <400> 111
ggagcccacg tgctgagatt ggagcccacg tgctgagatt
<210> 112 <210> 112
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 112 <400> 112
cgtccttgag cagtgcccga cgtccttgag cagtgcccga
<210> 113 <210> 113
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 113 <400> 113
cccatatgga gaaatccttc cccatatgga gaaatccttc
<210> 114 <210> 114
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 114 <400> 114
catgcctgga agccagtgtc catgcctgga agccagtgtc
<210> 115 <210> 115
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 115 gtgttgaatc ccttgaaatc <400> 115 gtgttgaatc ccttgaaatc
<210> 116 <210> 116
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 116 ggtaaagttg cccatggctg <400> 116 ggtaaagttg cccatggctg
<210> 117 <210> 117
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 117 gttataaagt ccagcattgg <400> 117 gttataaagt ccagcattgg
<210> 118 <210> 118
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 118 catcagacgt gatgttccct <400> 118 catcagacgt gatgttccct
<210> 119 <210> 119
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 119 tggctagttt caatcccctt <400> 119 tggctagttt caatcccctt
<210> 120 <210> 120
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 120 <400> 120
ctgtcatgac tgccctttac ctgtcatgac tgccctttac
<210> 121 <210> 121
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 121 <400> 121
gcttgaagtt cattgagaat gcttgaagtt cattgagaat
<210> 122 <210> 122
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 122 <400> 122
ttcctgagaa aggaaggaac ttcctgagaa aggaaggaac
<210> 123 <210> 123
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 123 <400> 123
tcagatatac attggcttca tcagatatac attggcttca
<210> 124 <210> 124
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 124 <400> 124
ttcctcttcg gccctggcgc ttcctcttcg gccctggcgc
<210> 125 <210> 125
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 125 <400> 125
ctccactgga actctcagcc ctccactgga actctcagcc
<210> 126 <210> 126
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 126 cctccagctc aaccttgcag <400> 126 cctccagctc aaccttgcag
<210> 127 <210> 127
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 127 gggttgaagc catacacctc <400> 127 gggttgaagc catacacctc
<210> 128 <210> 128
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 128 ccagcttgag ctcatacctg <400> 128 ccagcttgag ctcatacctg
<210> 129 <210> 129
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 129 ccctcttgat gttcaggatg <400> 129 ccctcttgat gttcaggatg
<210> 130 <210> 130
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 130 gagcagtttc catacacggt <400> 130 gagcagtttc catacacggt
<210> 131 <210> 131
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 131 <400> 131
cccttcctcg tcttgacggt cccttcctcg tcttgacggt
<210> 132 <210> 132
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 132 <400> 132
ttgaagcgat cacactgccc ttgaagcgat cacactgccc
<210> 133 <210> 133
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 133 <400> 133
gcctttgatg agagcaagtg gcctttgatg agagcaagtg
<210> 134 <210> 134
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 134 <400> 134
tcctcttagc gtccagtgtg tcctcttagc gtccagtgtg
<210> 135 <210> 135
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 135 <400> 135
cctctcagct cagtaaccag cctctcagct cagtaaccag
<210> 136 <210> 136
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 136 <400> 136
gcactgaggc tgtccacact gcactgaggc tgtccacact
<210> 137 <210> 137
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 137 cgctgatccc tcgccatgtt <400> 137 cgctgatccc tcgccatgtt
<210> 138 <210> 138
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 138 gttgaccgcg tggctcagcg <400> 138 gttgaccgcg tggctcagcg
<210> 139 <210> 139
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 139 gcagctcctg ggtccctgta <400> 139 gcagctcctg ggtccctgta
<210> 140 <210> 140
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 140 cccatggtag aatttggaca <400> 140 cccatggtag aatttggaca
<210> 141 <210> 141
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 141 aatctcgatg aggtcagctg <400> 141 aatctcgatg aggtcagctg
<210> 142 <210> 142
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 142 <400> 142
gacaccatca ggaacttgac gacaccatca ggaacttgac
<210> 143 <210> 143
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 143 <400> 143
gctcctctcc caagatgcgg gctcctctcc caagatgcgg
<210> 144 <210> 144
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 144 <400> 144
ggcacccatc agaagcagct ggcacccatc agaagcagct
<210> 145 <210> 145
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 145 <400> 145
agtccggaat gatgatgccc agtccggaat gatgatgccc
<210> 146 <210> 146
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 146 <400> 146
ctgagcagct tgactggtct ctgagcagct tgactggtct
<210> 147 <210> 147
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 147 <400> 147
cccggtcagc ggatagtagg cccggtcagc ggatagtagg
<210> 148 <210> 148
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 148 tgtcacaact taggtggccc <400> 148 tgtcacaact taggtggccc
<210> 149 <210> 149
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 149 gtctggcaat cccatgttct <400> 149 gtctggcaat cccatgttct
<210> 150 <210> 150
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 150 cccacagact tgaagtggag <400> 150 cccacagact tgaagtggag
<210> 151 <210> 151
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 151 gaactgccca tcaatcttga <400> 151 gaactgccca tcaatcttga
<210> 152 <210> 152
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 152 20 cccagagagg ccaagctctg <400> 152 20 cccagagagg ccaagctctg
<210> 153 <210> 153
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 153 <400> 153
tgtgttccct gaagcggcca tgtgttccct gaagcggcca
<210> 154 <210> 154
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 154 acccagaatc atggcctgat <400> 154 acccagaatc atggcctgat
<210> 155 <210> 155
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 155 ggtgcctgtc tgctcagctg <400> 155 ggtgcctgtc tgctcagctg
<210> 156 <210> 156
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 156 atgtgaaact tgtctctccc <400> 156 atgtgaaact tgtctctccc
<210> 157 <210> 157
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 157 tatgtctgca gttgagatag <400> 157 tatgtctgca gttgagatag
<210> 158 <210> 158
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 158 ttgaatccag gatgcagtac <400> 158 ttgaatccag gatgcagtac
<210> 159 <210> 159
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 159 gagtctctga gtcacctcac <400> 159 gagtctctga gtcacctcac
<210> 160 <210> 160
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 160 gatagaatat tgctctgcaa <400> 160 gatagaatat tgctctgcaa
<210> 161 <210> 161
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 161 cccttgctct accaatgctt <400> 161 cccttgctct accaatgctt
<210> 162 <210> 162
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 162 tccattccct atgtcagcat <400> 162 tccattccct atgtcagcat
<210> 163 <210> 163
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 163 gactccttca gagccagcgg <400> 163 gactccttca gagccagcgg
<210> 164 <210> 164
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 164 <400> 164
cccatgctcc gttctcaggt cccatgctcc gttctcaggt
<210> 165 <210> 165
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 165 <400> 165
cgcaggtcag cctgactaga cgcaggtcag cctgactaga
<210> 166 <210> 166
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 166 <400> 166
cagttagaac actgtggccc cagttagaac actgtggccc
<210> 167 <210> 167
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 167 <400> 167
cagtgtgatg acacttgatt cagtgtgatg acacttgatt
<210> 168 <210> 168
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 168 <400> 168
ctgtggctaa cttcaatccc ctgtggctaa cttcaatccc
<210> 169 <210> 169
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 169 <400> 169
cagtactgtt atgactaccc cagtactgtt atgactaccc
<210> 170 <210> 170
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 170 cactgaagac cgtgtgctct <400> 170 cactgaagac cgtgtgctct
<210> 171 <210> 171
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 171 tcgtactgtg ctcccagagg <400> 171 tcgtactgtg ctcccagagg
<210> 172 <210> 172
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 172 aagaggccct ctagctgtaa <400> 172 aagaggccct ctagctgtaa
<210> 173 <210> 173
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 173 aagacccaga atgaatccgg <400> 173 aagacccaga atgaatccgg
<210> 174 <210> 174
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 174 gtctacctca aagcgtgcag <400> 174 gtctacctca aagcgtgcag
<210> 175 <210> 175
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 175 <400> 175
tagaggctaa cgtaccatct tagaggctaa cgtaccatct
<210> 176 <210> 176
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 176 <400> 176
ccatatccat gcccacggtg ccatatccat gcccacggtg
<210> 177 <210> 177
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 177 <400> 177
agtttcctca tcagattccc agtttcctca tcagattccc
<210> 178 <210> 178
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 178 <400> 178
cccagtggta cttgttgaca cccagtggta cttgttgaca
<210> 179 <210> 179
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 179 <400> 179
cccagtggtg ccactggctg cccagtggtg ccactggctg
<210> 180 <210> 180
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 180 <400> 180
gtcaacagtt cctggtacag gtcaacagtt cctggtacag
<210> 181 <210> 181
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 181 ccctagtgta tatcccaggt <400> 181 ccctagtgta tatcccaggt
<210> 182 <210> 182
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 182 ctgaagatta cgtagcacct <400> 182 ctgaagatta cgtagcacct
<210> 183 <210> 183
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 183 gtccagccaa ctatacttgg <400> 183 gtccagccaa ctatacttgg
<210> 184 <210> 184
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 184 cctggagcaa gcttcatgta <400> 184 cctggagcaa gcttcatgta
<210> 185 <210> 185
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 185 tggacagacc aggctgacat <400> 185 tggacagacc aggctgacat
<210> 186 <210> 186
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 186 <400> 186
atgtgtactt ccggaggtgc atgtgtactt ccggaggtgc
<210> 187 <210> 187
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 187 <400> 187
tcttcaggat gaagctgcag tcttcaggat gaagctgcag
<210> 188 <210> 188
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 188 tcagcaaggc tttgccctca <400> 188 tcagcaaggc tttgccctca
<210> 189 <210> 189
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 189 <400> 189
ctgcttccct tctggaatgg ctgcttccct tctggaatgg
<210> 190 <210> 190
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 190 <400> 190
tgccacattg cccttcctcg tgccacattg cccttcctcg
<210> 191 <210> 191
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 191 <400> 191
gctgatcaga gttgacaagg gctgatcaga gttgacaagg
<210> 192 <210> 192
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 192 tactgacagg actggctgct <400> 192 tactgacagg actggctgct
<210> 193 <210> 193
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 193 gatggcttct gccacatgct <400> 193 gatggcttct gccacatgct
<210> 194 <210> 194
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 194 gatgtggatt tggtgctctc <400> 194 gatgtggatt tggtgctctc
<210> 195 <210> 195
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 195 tgactgcttc atcactgagg <400> 195 tgactgcttc atcactgagg
<210> 196 <210> 196
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 196 ggtaggtgac cacatctatc <400> 196 ggtaggtgac cacatctatc
<210> 197 <210> 197
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 197 <400> 197
tcgcagctgc tgtgctgagg tcgcagctgc tgtgctgagg
<210> 198 <210> 198
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 198 <400> 198
ttccaatgac ccgcagaatc ttccaatgac ccgcagaatc
<210> 199 <210> 199
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 199 <400> 199
gatcatcagt gatggctttg gatcatcagt gatggctttg
<210> 200 <210> 200
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 200 <400> 200
agcctggatg gcagctttct agcctggatg gcagctttct
<210> 201 <210> 201
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 201 <400> 201
gtctgaagaa gaacctcctg gtctgaagaa gaacctcctg
<210> 202 <210> 202
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 202 <400> 202
tatctgcctg tgaaggactc tatctgcctg tgaaggactc
<210> 203 <210> 203
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 203 ctgagttcaa gatattggca <400> 203 ctgagttcaa gatattggca
<210> 204 <210> 204
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 204 cttccaagcc aatctcgatg <400> 204 cttccaagcc aatctcgatg
<210> 205 <210> 205
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 205 tgcaactgta atccagctcc <400> 205 tgcaactgta atccagctcc
<210> 206 <210> 206
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 206 ccagttcagc ctgcatgttg <400> 206 ccagttcagc ctgcatgttg
<210> 207 <210> 207
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 207 gtagagacca aatgtaatgt <400> 207 gtagagacca aatgtaatgt
<210> 208 <210> 208
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 208 <400> 208
cgttggagta agcgcctgag cgttggagta agcgcctgag
<210> 209 <210> 209
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 209 <400> 209
cagctctaat ctggtgtccc cagctctaat ctggtgtccc
<210> 210 <210> 210
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 210 <400> 210
ctgtcctctc tctggagctc ctgtcctctc tctggagctc
<210> 211 <210> 211
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 211 <400> 211
caaggtcata ctctgccgat caaggtcata ctctgccgat
<210> 212 <210> 212
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 212 <400> 212
gtatggaaat aacacccttg gtatggaaat aacacccttg
<210> 213 <210> 213
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 213 <400> 213
taagctgtag cagatgagtc taagctgtag cagatgagtc
<210> 214 <210> 214
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 214 tagatctctg gaggatttgc <400> 214 tagatctctg gaggatttgc
<210> 215 <210> 215
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 215 gtctagaaca cccaggagag <400> 215 gtctagaaca cccaggagag
<210> 216 <210> 216
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 216 accacagagt cagccttcat <400> 216 accacagagt cagccttcat
<210> 217 <210> 217
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 217 aagcagacat ctgtggtccc <400> 217 aagcagacat ctgtggtccc
<210> 218 <210> 218
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 218 ctctccattg agccggccag <400> 218 ctctccattg agccggccag
<210> 219 <210> 219
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 219 <400> 219
cctgatattc agaacgcagc cctgatattc agaacgcagc
<210> 220 <210> 220
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 220 <400> 220
cagtgcctaa gatgtcagca cagtgcctaa gatgtcagca
<210> 221 <210> 221
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 221 <400> 221
agcaccagga gactacactt agcaccagga gactacactt
<210> 222 <210> 222
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 222 <400> 222
cccatccaga ctgaattttg cccatccaga ctgaattttg
<210> 223 <210> 223
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 223 <400> 223
ggttctagcc gtagtttccc ggttctagcc gtagtttccc
<210> 224 <210> 224
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 224 <400> 224
aggttaccag ccacatgcag aggttaccag ccacatgcag
<210> 225 <210> 225
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 225 atgtgcatcg atggtcatgg <400> 225 atgtgcatcg atggtcatgg
<210> 226 <210> 226
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 226 ccagagagcg agtttcccat <400> 226 ccagagagcg agtttcccat
<210> 227 <210> 227
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 227 ctagacacga gatgatgact <400> 227 ctagacacga gatgatgact
<210> 228 <210> 228
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 228 tccaagtcct ggctgtattc <400> 228 tccaagtcct ggctgtattc
<210> 229 <210> 229
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 229 cgtccagtaa gctccacgcc <400> 229 cgtccagtaa gctccacgcc
<210> 230 <210> 230
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 230 <400> 230
tcaacggcat ctctcatctc tcaacggcat ctctcatctc
<210> 231 <210> 231
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 231 <400> 231
tgatagtgct catcaagact tgatagtgct catcaagact
<210> 232 <210> 232
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 232 <400> 232
gattctgatt tggtacttag gattctgatt tggtacttag
<210> 233 <210> 233
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 233 <400> 233
ctctcgatta actcatggac ctctcgatta actcatggac
<210> 234 <210> 234
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 234 <400> 234
atacactgca actgtggcct atacactgca actgtggcct
<210> 235 <210> 235
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 235 <400> 235
gcaagagtcc accaatcaga gcaagagtcc accaatcaga
<210> 236 <210> 236
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 236 agagcctgaa gactgacttc <400> 236 agagcctgaa gactgacttc
<210> 237 <210> 237
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 237 tccctcatct gagaatctgg <400> 237 tccctcatct gagaatctgg
<210> 238 <210> 238
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 238 cagtgcatca atgacagatg <400> 238 cagtgcatca atgacagatg
<210> 239 <210> 239
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 239 ccgaaccctt gacatctcct <400> 239 ccgaaccctt gacatctcct
<210> 240 <210> 240
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 240 gcctcactag caatagttcc <400> 240 gcctcactag caatagttcc
<210> 241 <210> 241
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 241 <400> 241
gacatttgcc atggagagag gacatttgcc atggagagag
<210> 242 <210> 242
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 242 <400> 242
ctgtctccta ccaatgctgg ctgtctccta ccaatgctgg
<210> 243 <210> 243
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 243 <400> 243
tctgcactga agtcacggtg tctgcactga agtcacggtg
<210> 244 <210> 244
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 244 <400> 244
tcccggaccc tcaactcagt tcccggaccc tcaactcagt
<210> 245 <210> 245
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 245 <400> 245
gcaggtccag ttcatatgtg gcaggtccag ttcatatgtg
<210> 246 <210> 246
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 246 <400> 246
gccatccttc tgagttcaga gccatccttc tgagttcaga
<210> 247 <210> 247
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 247 gcctcagtct gcttcgcacc <400> 247 gcctcagtct gcttcgcacc
<210> 248 <210> 248
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 248 ccccgcaggt cccggtggga <400> 248 ccccgcaggt cccggtggga
<210> 249 <210> 249
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 249 cagccccgca ggtcccggtg <400> 249 cagccccgca ggtcccggtg
<210> 250 <210> 250
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 250 caaccgagaa gggcactcag <400> 250 caaccgagaa gggcactcag
<210> 251 <210> 251
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 251 cctcagcggc agcaaccgag <400> 251 cctcagcggc agcaaccgag
<210> 252 <210> 252
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 252 <400> 252
tcctcagcgg cagcaaccga tcctcagcgg cagcaaccga
<210> 253 <210> 253
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 253 <400> 253
ctcctcagcg gcagcaaccg ctcctcagcg gcagcaaccg
<210> 254 <210> 254
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 254 <400> 254
ggctcctcag cggcagcaac ggctcctcag cggcagcaac
<210> 255 <210> 255
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 255 <400> 255
ggcgggctcc tcagcggcag ggcgggctcc tcagcggcag
<210> 256 <210> 256
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 256 <400> 256
ggtccatcgc cagctgcggt ggtccatcgc cagctgcggt
<210> 257 <210> 257
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 257 <400> 257
ggcgggtcca tcgccagctg ggcgggtcca tcgccagctg
<210> 258 <210> 258
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 258 tagaggatga tagtaagttc <400> 258 tagaggatga tagtaagttc
<210> 259 <210> 259
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 259 aaatgaagat ttcttttaaa <400> 259 aaatgaagat ttcttttaaa
<210> 260 <210> 260
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 260 tatgtgaaag ttcaattgga <400> 260 tatgtgaaag ttcaattgga
<210> 261 <210> 261
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 261 atataggcag tttgaatttt <400> 261 atataggcag tttgaatttt
<210> 262 <210> 262
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 262 gctcactgta tggttttatc <400> 262 gctcactgta tggttttatc
<210> 263 <210> 263
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 263 <400> 263
ggctcactgt atggttttat ggctcactgt atggttttat
<210> 264 <210> 264
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 264 <400> 264
ggctggctca ctgtatggtt ggctggctca ctgtatggtt
<210> 265 <210> 265
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 265 <400> 265
aggctggctc actgtatggt aggctggctc actgtatggt
<210> 266 <210> 266
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 266 <400> 266
aaggctggct cactgtatgg aaggctggct cactgtatgg
<210> 267 <210> 267
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 267 <400> 267
ctactgcaag gctggctcac ctactgcaag gctggctcac
<210> 268 <210> 268
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 268 <400> 268
actgcctact gcaaggctgg actgcctact gcaaggctgg
<210> 269 <210> 269
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 269 tgcttatagt ctactgccta <400> 269 tgcttatagt ctactgccta
<210> 270 <210> 270
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 270 ttctgcttat agtctactgc <400> 270 ttctgcttat agtctactgc
<210> 271 <210> 271
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 271 tttggtgcag gtccagttca <400> 271 tttggtgcag gtccagttca
<210> 272 <210> 272
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 272 cagctttggt gcaggtccag <400> 272 cagctttggt gcaggtccag
<210> 273 <210> 273
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 273 gccagctttg gtgcaggtcc <400> 273 gccagctttg gtgcaggtcc
<210> 274 <210> 274
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 274 <400> 274
tggtgccagc tttggtgcag tggtgccagc tttggtgcag
<210> 275 <210> 275
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 275 <400> 275
gccctggtgc cagctttggt gccctggtgc cagctttggt
<210> 276 <210> 276
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 276 <400> 276
gagttcagag accttccgag gagttcagag accttccgag
<210> 277 <210> 277
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 277 <400> 277
aaatgccatc cttctgagtt aaatgccatc cttctgagtt
<210> 278 <210> 278
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 278 <400> 278
aaaaatgcca tccttctgag aaaaatgcca tccttctgag
<210> 279 <210> 279
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 279 <400> 279
aaaataactc agatcctgat aaaataactc agatcctgat
<210> 280 <210> 280
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 280 agcaaaataa ctcagatcct <400> 280 agcaaaataa ctcagatcct
<210> 281 <210> 281
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 281 agtttagcaa aataactcag <400> 281 agtttagcaa aataactcag
<210> 282 <210> 282
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 282 tcccccaagt ttagcaaaat <400> 282 tcccccaagt ttagcaaaat
<210> 283 <210> 283
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 283 ttcctcctcc cccaagttta <400> 283 ttcctcctcc cccaagttta
<210> 284 <210> 284
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 284 agactccatt tatttgttcc <400> 284 agactccatt tatttgttcc
<210> 285 <210> 285
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 285 <400> 285
cttctgcttg agttacaaac cttctgcttg agttacaaac
<210> 286 <210> 286
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 286 20 <400> 286 20
accttctgct tgagttacaa accttctgct tgagttacaa
<210> 287 <210> 287
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 287 20 <400> 287 20
gcaccttctg cttgagttac gcaccttctg cttgagttac
<210> 288 <210> 288
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 288 20 <400> 288 20
tcgcaccttc tgcttgagtt tcgcaccttc tgcttgagtt
<210> 289 <210> 289
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 289 20 <400> 289 20
cttcgcacct tctgcttgag cttcgcacct tctgcttgag
<210> 290 <210> 290
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 290 <400> 290
tgcttcgcac cttctgcttg tgcttcgcac cttctgcttg
<210> 291 <210> 291
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 291 tctgcttcgc accttctgct <400> 291 tctgcttcgc accttctgct
<210> 292 <210> 292
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 292 agtctgcttc gcaccttctg <400> 292 agtctgcttc gcaccttctg
<210> 293 <210> 293
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 293 tcagtctgct tcgcaccttc <400> 293 tcagtctgct tcgcaccttc
<210> 294 <210> 294
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 294 cctcagtctg cttcgcacct <400> 294 cctcagtctg cttcgcacct
<210> 295 <210> 295
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 295 agcctcagtc tgcttcgcac <400> 295 agcctcagtc tgcttcgcac
<210> 296 <210> 296
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 296 <400> 296
gtagcctcag tctgcttcgc gtagcctcag tctgcttcgc
<210> 297 <210> 297
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 297 <400> 297
tggtagcctc agtctgcttc tggtagcctc agtctgcttc
<210> 298 <210> 298
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 298 <400> 298
catggtagcc tcagtctgct catggtagcc tcagtctgct
<210> 299 <210> 299
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 299 <400> 299
gtcatggtag cctcagtctg gtcatggtag cctcagtctg
<210> 300 <210> 300
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 300 <400> 300
atgtcatggt agcctcagtc atgtcatggt agcctcagtc
<210> 301 <210> 301
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 301 <400> 301
gaatgtcatg gtagcctcag gaatgtcatg gtagcctcag
<210> 302 <210> 302
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 302 ttgaatgtca tggtagcctc <400> 302 ttgaatgtca tggtagcctc
<210> 303 <210> 303
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 303 atttgaatgt catggtagcc <400> 303 atttgaatgt catggtagcc
<210> 304 <210> 304
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 304 atatttgaat gtcatggtag <400> 304 atatttgaat gtcatggtag
<210> 305 <210> 305
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 305 cagccacatg cagcttcagg <400> 305 cagccacatg cagcttcagg
<210> 306 <210> 306
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 306 accagccaca tgcagcttca <400> 306 accagccaca tgcagcttca
<210> 307 <210> 307
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 307 <400> 307
ttaccagcca catgcagctt ttaccagcca catgcagctt
<210> 308 <210> 308
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 308 <400> 308
ggttaccagc cacatgcagc ggttaccagc cacatgcagc
<210> 309 <210> 309
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 309 <400> 309
taggttacca gccacatgca taggttacca gccacatgca
<210> 310 <210> 310
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 310 <400> 310
tttaggttac cagccacatg tttaggttac cagccacatg
<210> 311 <210> 311
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 311 <400> 311
cttttaggtt accagccaca cttttaggtt accagccaca
<210> 312 <210> 312
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 312 <400> 312
tccttttagg ttaccagcca tccttttagg ttaccagcca
<210> 313 <210> 313
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 313 <400> 313
gctcctttta ggttaccagc gctcctttta ggttaccagc
<210> 314 <210> 314
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 314 <400> 314
aggctccttt taggttacca aggctccttt taggttacca
<210> 315 <210> 315
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 315 <400> 315
gtaggctcct tttaggttac gtaggctcct tttaggttac
<210> 316 <210> 316
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 316 <400> 316
tggtaggctc cttttaggtt tggtaggctc cttttaggtt
<210> 317 <210> 317
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 317 <400> 317
tttggtaggc tccttttagg tttggtaggc tccttttagg
<210> 318 <210> 318
<211> 13993 <211> 13993
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<220> <220>
<221> CDS <221> CDS
<222> (1).. (13692) <222> (1) .. (13692)
<400> 318 <400> 318
- 5 5
- <210> 319 <211> 20 <212> ADN <213> Secuencia Artificial <210> 319 <211> 20 <212> DNA <213> Artificial Sequence
- 10 10
- <220> <223> Oligonucleótido Antisentido <400> 319 <220> <223> Antisense Oligonucleotide <400> 319
- gcctcagtct gcttcgcgcc gcctcagtct gcttcgcgcc
- 20 twenty
- 15 fifteen
- <210> 320 <211> 20 <212> ADN <210> 320 <211> 20 <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 320 gctcactgtt cagcatctgg <400> 320 gctcactgtt cagcatctgg
<210> 321 <210> 321
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 321 tgagaatctg ggcgaggccc <400> 321 tgagaatctg ggcgaggccc
<210> 322 <210> 322
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 322 gtccttcata tttgccatct <400> 322 gtccttcata tttgccatct
<210> 323 <210> 323
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 323 cctccctcat gaacatagtg <400> 323 cctccctcat gaacatagtg
<210> 324 <210> 324
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 324 gacgtcagaa cctatgatgg <400> 324 gacgtcagaa cctatgatgg
<210> 325 <210> 325
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 325 <400> 325
tgagtgagtc aatcagcttc tgagtgagtc aatcagcttc
<210> 326 <210> 326
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 326 <400> 326
gccttctgct tgagttacaa gccttctgct tgagttacaa
<210> 327 <210> 327
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 327 <400> 327
gcgccttctg cttgagttac gcgccttctg cttgagttac
<210> 328 <210> 328
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 328 <400> 328
tcgcgccttc tgcttgagtt tcgcgccttc tgcttgagtt
<210> 329 <210> 329
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 329 <400> 329
cttcgcgcct tctgcttgag cttcgcgcct tctgcttgag
<210> 330 <210> 330
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 330 <400> 330
agtctgcttc gcgccttctg agtctgcttc gcgccttctg
<210> 331 <210> 331
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 331 tcagtctgct tcgcgccttc 20 <400> 331 tcagtctgct tcgcgccttc 20
<210> 332 <210> 332
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 332 cctcagtctg cttcgcgcct 20 <400> 332 cctcagtctg cttcgcgcct 20
<210> 333 <210> 333
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 333 agcctcagtc tgcttcgcgc 20 <400> 333 agcctcagtc tgcttcgcgc 20
<210> 334 <210> 334
<211> 43445 <211> 43445
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 334 <400> 334
<210> 335 <210> 335
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 335 <400> 335
tctgtaagac aggagaaaga 20 tctgtaagac aggagaaaga 20
<210> 336 <210> 336
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 336 <400> 336
atttcctctt ctgtaagaca 20 atttcctctt ctgtaagaca 20
<210> 337 <210> 337
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 337 <400> 337
gatgccttac ttggacagac gatgccttac ttggacagac
<210> 338 <210> 338
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 338 <400> 338
agaaatagct ctcccaagga agaaatagct ctcccaagga
<210> 339 <210> 339
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 339 <400> 339
gtcgcatctt ctaacgtggg gtcgcatctt ctaacgtggg
<210> 340 <210> 340
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 340 <400> 340
tcctccatac cttgcagttg tcctccatac cttgcagttg
<210> 341 <210> 341
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
*<400> 341 * <400> 341
tggctcatgt ctaccatatt tggctcatgt ctaccatatt
<210> 342 <210> 342
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 342 cagttgaaat gcagctaatg <400> 342 cagttgaaat gcagctaatg
<210> 343 <210> 343
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 343 tgcagactag gagtgaaagt <400> 343 tgcagactag gagtgaaagt
<210> 344 <210> 344
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 344 aggaggatgt ccttttattg <400> 344 aggaggatgt ccttttattg
<210> 345 <210> 345
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 345 atcagagcac caaagggaat <400> 345 atcagagcac caaagggaat
<210> 346 <210> 346
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 346 ccagctcaac ctgagaattc <400> 346 ccagctcaac ctgagaattc
<210> 347 <210> 347
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 347 catgacttac ctggacatgg <400> 347 catgacttac ctggacatgg
<210> 348 <210> 348
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 348 <400> 348
cctcagcgga cacacacaca cctcagcgga cacacacaca
<210> 349 <210> 349
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 349 <400> 349
gtcacatccg tgcctggtgc gtcacatccg tgcctggtgc
<210> 350 <210> 350
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 350 <400> 350
cagtgcctct gggaccccac cagtgcctct gggaccccac
<210> 351 <210> 351
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 351 <400> 351
agctgcagtg gccgatcagc agctgcagtg gccgatcagc
<210> 352 <210> 352
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 352 <400> 352
gacctcccca gccacgtgga gacctcccca gccacgtgga
<210> 353 <210> 353
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 353 tctgatcacc atacattaca <400> 353 tctgatcacc atacattaca
<210> 354 <210> 354
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 354 atttcccact gggtactctc <400> 354 atttcccact gggtactctc
<210> 355 <210> 355
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 355 20 ggctgaagcc catgctgact <400> 355 20 ggctgaagcc catgctgact
<210> 356 <210> 356
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 356 20 gttggacagt cattcttttg <400> 356 20 gttggacagt cattcttttg
<210> 357 <210> 357
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 357 20 cacttgttgg acagtcattc <400> 357 20 cacttgttgg acagtcattc
<210> 358 <210> 358
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 358 attttaaatt acagtagata <400> 358 attttaaatt acagtagata
<210> 359 <210> 359
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 359 <400> 359
ctgttctcca cccatatcag ctgttctcca cccatatcag
<210> 360 <210> 360
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 360 <400> 360
gagctcatac ctgtcccaga gagctcatac ctgtcccaga
<210> 361 <210> 361
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 361 <400> 361
ttcaagggcc actgctatca ttcaagggcc actgctatca
<210> 362 <210> 362
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 362 <400> 362
ccagtatttc acgccaatcc ccagtatttc acgccaatcc
<210> 363 <210> 363
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 363 <400> 363
ggcaggagga acctcgggca ggcaggagga acctcgggca
<210> 364 <210> 364
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 364 ttttaaaatt agacccaacc <400> 364 ttttaaaatt agacccaacc
<210> 365 <210> 365
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 365 tgactgtttt aaaattagac <400> 365 tgactgtttt aaaattagac
<210> 366 <210> 366
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 366 cccagcaaac acaggtgaag <400> 366 cccagcaaac acaggtgaag
<210> 367 <210> 367
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 367 gagtgtggtc ttgctagtgc <400> 367 gagtgtggtc ttgctagtgc
<210> 368 <210> 368
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 368 ctatgcagag tgtggtcttg <400> 368 ctatgcagag tgtggtcttg
<210> 369 <210> 369
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 369 agaagatgca accacatgta <400> 369 agaagatgca accacatgta
<210> 370 <210> 370
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 370 <400> 370
acacggtatc ctatggagga acacggtatc ctatggagga
<210> 371 <210> 371
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 371 <400> 371
tgggacttac catgcctttg tgggacttac catgcctttg
<210> 372 <210> 372
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 372 <400> 372
ggttttgctg ccctacatcc ggttttgctg ccctacatcc
<210> 373 <210> 373
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 373 <400> 373
acaaggagtc cttgtgcaga acaaggagtc cttgtgcaga
<210> 374 <210> 374
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 374 <400> 374
atgttcactg agacaggctg atgttcactg agacaggctg
<210> 375 <210> 375
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 375 gaaggtccat ggttcatctg <400> 375 gaaggtccat ggttcatctg
<210> 376 <210> 376
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 376 attagactgg aagcatcctg <400> 376 attagactgg aagcatcctg
<210> 377 <210> 377
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 377 gagattggag acgagcattt <400> 377 gagattggag acgagcattt
<210> 378 <210> 378
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 378 catgacctac ttgtaggaga <400> 378 catgacctac ttgtaggaga
<210> 379 <210> 379
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 379 tggatttgga tacacaagtt <400> 379 tggatttgga tacacaagtt
<210> 380 <210> 380
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 380 actcaatata tattcattga <400> 380 actcaatata tattcattga
<210> 381 <210> 381
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 381 <400> 381
caaggaagca caccatgtca caaggaagca caccatgtca
<210> 382 <210> 382
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 382 <400> 382
atacttattc ctggtaacca atacttattc ctggtaacca
<210> 383 <210> 383
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 383 <400> 383
ggtagccaga acaccagtgt ggtagccaga acaccagtgt
<210> 384 <210> 384
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 384 <400> 384
actagaggta gccagaacac actagaggta gccagaacac
<210> 385 <210> 385
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 385 <400> 385
accacctgac atcacaggtt accacctgac atcacaggtt
<210> 386 <210> 386
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 386 tactgtgacc tatgccagga <400> 386 tactgtgacc tatgccagga
<210> 387 <210> 387
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 387 ggaggtgcta ctgttgacat <400> 387 ggaggtgcta ctgttgacat
<210> 388 <210> 388
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 388 tccagacttg tctgagtcta <400> 388 tccagacttg tctgagtcta
<210> 389 <210> 389
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 389 tctaagaggt agagctaaag <400> 389 tctaagaggt agagctaaag
<210> 390 <210> 390
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 390 ccagagatga gcaacttagg <400> 390 ccagagatga gcaacttagg
<210> 391 <210> 391
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 391 ggccatgtaa attgctcatc <400> 391 ggccatgtaa attgctcatc
<210> 392 <210> 392
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 392 <400> 392
aaagaaacta tcctgtattc aaagaaacta tcctgtattc
<210> 393 <210> 393
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 393 <400> 393
ttcttagtac ctggaagatg ttcttagtac ctggaagatg
<210> 394 <210> 394
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 394 <400> 394
cattagatac ctggacacct cattagatac ctggacacct
<210> 395 <210> 395
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 395 <400> 395
gtttcatgga actcagcgca gtttcatgga actcagcgca
<210> 396 <210> 396
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 396 <400> 396
ctggagagca cctgcaatag ctggagagca cctgcaatag
<210> 397 <210> 397
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 397 tgaagggtag agaaatcata <400> 397 tgaagggtag agaaatcata
<210> 398 <210> 398
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 398 ggaaactcac ttgttgaccg <400> 398 ggaaactcac ttgttgaccg
<210> 399 <210> 399
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 399 aggtgcaaga tgttcctctg <400> 399 aggtgcaaga tgttcctctg
<210> 400 <210> 400
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 400 tgcacagagg tgcaagatgt <400> 400 tgcacagagg tgcaagatgt
<210> 401 <210> 401
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 401 cacaagagta aggagcagag <400> 401 cacaagagta aggagcagag
<210> 402 <210> 402
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 402 gatggatggt gagaaattac <400> 402 gatggatggt gagaaattac
<210> 403 <210> 403
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 403 <400> 403
tagacaattg agactcagaa tagacaattg agactcagaa
<210> 404 <210> 404
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 404 <400> 404
atgtgcacac aaggacatag atgtgcacac aaggacatag
<210> 405 <210> 405
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 405 <400> 405
acatacaaat ggcaataggc acatacaaat ggcaataggc
<210> 406 <210> 406
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 406 <400> 406
taggcaaagg acatgaatag taggcaaagg acatgaatag
<210> 407 <210> 407
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 407 <400> 407
ttatgatagc tacagaataa ttatgatagc tacagaataa
<210> 408 <210> 408
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 408 ctgagattac ccgcagaatc <400> 408 ctgagattac ccgcagaatc
<210> 409 <210> 409
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 409 gatgtatgtc atataaaaga <400> 409 gatgtatgtc atataaaaga
<210> 410 <210> 410
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 410 tttccaatga cctgcattga <400> 410 tttccaatga cctgcattga
<210> 411 <210> 411
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 411 agggatggtc aatctggtag <400> 411 agggatggtc aatctggtag
<210> 412 <210> 412
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 412 ggctaataaa tagggtagtt <400> 412 ggctaataaa tagggtagtt
<210> 413 <210> 413
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 413 tcctagagca ctatcaagta <400> 413 tcctagagca ctatcaagta
<210> 414 <210> 414
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 414 <400> 414
cctcctggtc ctgcagtcaa cctcctggtc ctgcagtcaa
<210> 415 <210> 415
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 415 <400> 415
catttgcaca agtgtttgtt catttgcaca agtgtttgtt
<210> 416 <210> 416
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 416 <400> 416
ctgacacacc atgttattat ctgacacacc atgttattat
<210> 417 <210> 417
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 417 <400> 417
ctttttcaga ctagataaga ctttttcaga ctagataaga
<210> 418 <210> 418
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 418 <400> 418
tcacacttac ctcgatgagg tcacacttac ctcgatgagg
<210> 419 <210> 419
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 419 aagaaaatgg catcaggttt <400> 419 aagaaaatgg catcaggttt
<210> 420 <210> 420
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 420 ccaagccaat ctgagaaaga <400> 420 ccaagccaat ctgagaaaga
<210> 421 <210> 421
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 421 aaatacacac ctgctcatgt <400> 421 aaatacacac ctgctcatgt
<210> 422 <210> 422
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 422 cttcacaaat acacacctgc <400> 422 cttcacaaat acacacctgc
<210> 423 <210> 423
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 423 agtggaagtt tggtctcatt <400> 423 agtggaagtt tggtctcatt
<210> 424 <210> 424
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 424 ttgctagctt caaagtggaa <400> 424 ttgctagctt caaagtggaa
<210> 425 <210> 425
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 425 <400> 425
tcaagaataa gctccagatc tcaagaataa gctccagatc
<210> 426 <210> 426
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 426 <400> 426
gcatacaagt cacatgaggt gcatacaagt cacatgaggt
<210> 427 <210> 427
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 427 <400> 427
tacaaggtgt ttcttaagaa tacaaggtgt ttcttaagaa
<210> 428 <210> 428
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 428 <400> 428
atgcagccag gatgggccta atgcagccag gatgggccta
<210> 429 <210> 429
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 429 <400> 429
ttaccatatc ctgagagttt ttaccatatc ctgagagttt
<210> 430 <210> 430
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 430 gcaaaggtag aggaaggtat <400> 430 gcaaaggtag aggaaggtat
<210> 431 <210> 431
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 431 aaggaccttc agcaaaggta <400> 431 aaggaccttc agcaaaggta
<210> 432 <210> 432
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 432 cataggagta catttatata <400> 432 cataggagta catttatata
<210> 433 <210> 433
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 433 attatgataa aatcaatttt <400> 433 attatgataa aatcaatttt
<210> 434 <210> 434
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 434 agaaatttca ctagatagat <400> 434 agaaatttca ctagatagat
<210> 435 <210> 435
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 435 agcatatttt gatgagctga <400> 435 agcatatttt gatgagctga
<210> 436 <210> 436
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 436 <400> 436
gaaaggaagg actagcatat gaaaggaagg actagcatat
<210> 437 <210> 437
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 437 <400> 437
cctctccaat ctgtagaccc cctctccaat ctgtagaccc
<210> 438 <210> 438
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 438 <400> 438
ctggataact cagacctttg ctggataact cagacctttg
<210> 439 <210> 439
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 439 <400> 439
agtcagaaaa caacctattc agtcagaaaa caacctattc
<210> 440 <210> 440
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 440 <400> 440
cagcctgcat ctataagtca cagcctgcat ctataagtca
<210> 441 <210> 441
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 441 aaagaattac cctccactga <400> 441 aaagaattac cctccactga
<210> 442 <210> 442
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 442 tctttcaaac tggctaggca <400> 442 tctttcaaac tggctaggca
<210> 443 <210> 443
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 443 gcctggcaaa attctgcagg <400> 443 gcctggcaaa attctgcagg
<210> 444 <210> 444
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 444 ctacctcaaa tcaatatgtt <400> 444 ctacctcaaa tcaatatgtt
<210> 445 <210> 445
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 445 tgctttacct acctagctac <400> 445 tgctttacct acctagctac
<210> 446 <210> 446
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 446 accttgtgtg tctcactcaa <400> 446 accttgtgtg tctcactcaa
<210> 447 <210> 447
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 447 <400> 447
atgcattccc tgactagcac atgcattccc tgactagcac
<210> 448 <210> 448
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 448 <400> 448
catctctgag ccccttacca catctctgag ccccttacca
<210> 449 <210> 449
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 449 <400> 449
gctgggcatg ctctctcccc gctgggcatg ctctctcccc
<210> 450 <210> 450
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 450 <400> 450
gctttcgcag ctgggcatgc gctttcgcag ctgggcatgc
<210> 451 <210> 451
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 451 <400> 451
actcctttct atacctggct actcctttct atacctggct
<210> 452 <210> 452
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 452 attctgcctc ttagaaagtt <400> 452 attctgcctc ttagaaagtt
<210> 453 <210> 453
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 453 ccaagcctct ttactgggct <400> 453 ccaagcctct ttactgggct
<210> 454 <210> 454
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 454 cactcatgac cagactaaga <400> 454 cactcatgac cagactaaga
<210> 455 <210> 455
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 455 acctcccaga agccttccat <400> 455 acctcccaga agccttccat
<210> 456 <210> 456
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 456 ttcatatgaa atctcctact <400> 456 ttcatatgaa atctcctact
<210> 457 <210> 457
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 457 <400> 457
tatttaattt actgagaaac tatttaattt actgagaaac
<210> 458 <210> 458
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 458 <400> 458
taatgtgttg ctggtgaaga taatgtgttg ctggtgaaga
<210> 459 <210> 459
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 459 <400> 459
catctctaac ctggtgtccc catctctaac ctggtgtccc
<210> 460 <210> 460
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 460 <400> 460
gtgccatgct aggtggccat gtgccatgct aggtggccat
<210> 461 <210> 461
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 461 <400> 461
agcaaattgg gatctgtgct agcaaattgg gatctgtgct
<210> 462 <210> 462
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 462 <400> 462
tctggaggct cagaaacatg tctggaggct cagaaacatg
<210> 463 <210> 463
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 463 tgaagacagg gagccaccta <400> 463 tgaagacagg gagccaccta
<210> 464 <210> 464
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 464 aggattccca agactttgga <400> 464 aggattccca agactttgga
<210> 465 <210> 465
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 465 cagctctaat ctaaagacat <400> 465 cagctctaat ctaaagacat
<210> 466 <210> 466
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 466 gaatactcac cttctgcttg <400> 466 gaatactcac cttctgcttg
<210> 467 <210> 467
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 467 atctctctgt cctcatcttc <400> 467 atctctctgt cctcatcttc
<210> 468 <210> 468
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 468 <400> 468
ccaactcccc ctttctttgt ccaactcccc ctttctttgt
<210> 469 <210> 469
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 469 <400> 469
tctgggccag gaagacacga tctgggccag gaagacacga
<210> 470 <210> 470
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 470 <400> 470
tattgtgtgc tgggcactgc tattgtgtgc tgggcactgc
<210> 471 <210> 471
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 471 <400> 471
tgcttcgcac ctggacgagt tgcttcgcac ctggacgagt
<210> 472 <210> 472
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 472 <400> 472
ccttctttac cttaggtggc ccttctttac cttaggtggc
<210> 473 <210> 473
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 473 <400> 473
gctctctctg ccactctgat gctctctctg ccactctgat
<210> 474 <210> 474
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 474 aacttctaaa gccaacattc <400> 474 aacttctaaa gccaacattc
<210> 475 <210> 475
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 475 tgtgtcacaa ctatggtaaa <400> 475 tgtgtcacaa ctatggtaaa
<210> 476 <210> 476
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 476 agacacatac cataatgcca <400> 476 agacacatac cataatgcca
<210> 477 <210> 477
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 477 ttctcttcat ctgaaaatac <400> 477 ttctcttcat ctgaaaatac
<210> 478 <210> 478
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 478 tgaggatgta attagcactt <400> 478 tgaggatgta attagcactt
<210> 479 <210> 479
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 479 <400> 479
agctcattgc ctacaaaatg agctcattgc ctacaaaatg
<210> 480 <210> 480
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 480 <400> 480
gttctcatgt ttactaatgc gttctcatgt ttactaatgc
<210> 481 <210> 481
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 481 <400> 481
gaattgagac aacttgattt gaattgagac aacttgattt
<210> 482 <210> 482
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 482 <400> 482
ccggccatcg ctgaaatgaa ccggccatcg ctgaaatgaa
<210> 483 <210> 483
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 483 <400> 483
catagctcac cttgcacatt catagctcac cttgcacatt
<210> 484 <210> 484
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 484 <400> 484
cggtgcaccc tttacctgag cggtgcaccc tttacctgag
<210> 485 <210> 485
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 485 tctccagatc ctaacataaa <400> 485 tctccagatc ctaacataaa
<210> 486 <210> 486
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 486 ttgaatgaca ctagattttc <400> 486 ttgaatgaca ctagattttc
<210> 487 <210> 487
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 487 aaaatccatt ttctttaaag <400> 487 aaaatccatt ttctttaaag
<210> 488 <210> 488
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 488 cagctcacac ttattttaaa <400> 488 cagctcacac ttattttaaa
<210> 489 <210> 489
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 489 gttcccaaaa ctgtatagga <400> 489 gttcccaaaa ctgtatagga
<210> 490 <210> 490
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 490 <400> 490
agctccatac tgaagtcctt agctccatac tgaagtcctt
<210> 491 <210> 491
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 491 caattcaata aaagctccat <400> 491 caattcaata aaagctccat
<210> 492 <210> 492
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 492 gttttcaaaa ggtataaggt <400> 492 gttttcaaaa ggtataaggt
<210> 493 <210> 493
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 493 ttcccattcc ctgaaagcag <400> 493 ttcccattcc ctgaaagcag
<210> 494 <210> 494
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 494 tggtatttac ctgagggctg <400> 494 tggtatttac ctgagggctg
<210> 495 <210> 495
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 495 ataaataata gtgctgatgg <400> 495 ataaataata gtgctgatgg
<210> 496 <210> 496
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 496 ctatggctga gcttgcctat <400> 496 ctatggctga gcttgcctat
<210> 497 <210> 497
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 497 ctctctgaaa aatataccct <400> 497 ctctctgaaa aatataccct
<210> 498 <210> 498
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 498 ttgatgtatc tcatctagca <400> 498 ttgatgtatc tcatctagca
<210> 499 <210> 499
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 499 tagaaccatg tttggtcttc <400> 499 tagaaccatg tttggtcttc
<210> 500 <210> 500
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 500 tttctcttta tcacatgccc <400> 500 tttctcttta tcacatgccc
<210> 501 <210> 501
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
- <400> 501 <400> 501
- tatagtacac taaaacttca tatagtacac taaaacttca
- 20 twenty
- 5 5
- <210> 502 <211> 20 <212> ADN <213> Secuencia Artificial <210> 502 <211> 20 <212> DNA <213> Artificial Sequence
- 10 10
- <220> <223> Oligonucleótido Antisentido <220> <223> Antisense Oligonucleotide
- <400> 502 <400> 502
- 15 fifteen
- ctggagagga ctaaacagag 20 ctggagagga ctaaacagag twenty
- 20 twenty
- <210> 503 <211> 568 <212> ADN <213> H. sapiens <210> 503 <211> 568 <212> DNA <213> H. sapiens
- 25 25
- <220> <221> característica_misc <222> 44, 99, 156, 468 <223> n = A,T,C o G <220> <221> feature_misc <222> 44, 99, 156, 468 <223> n = A, T, C or G
- <400> 503 <400> 503
- 30 35 30 35
- <210> 504 <211> 20 <212> ADN <213> Secuencia Artificial <220> <223> Oligonucleótido Antisentido <210> 504 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense Oligonucleotide
- 40 40
- <400> 504 acattttatc aatgccctcg 20 <400> 504 acattttatc aatgccctcg twenty
- 45 Four. Five
- <210> 505 <211> 20 <212> ADN <213> Secuencia Artificial <210> 505 <211> 20 <212> DNA <213> Artificial Sequence
- 50 fifty
- <220> <223> Oligonucleótido Antisentido <400> 505 <220> <223> Antisense Oligonucleotide <400> 505
gccagaacat tttatcaatg gccagaacat tttatcaatg
<210> 506 <210> 506
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 506 <400> 506
agaggttttg ctgtgccaga agaggttttg ctgtgccaga
<210> 507 <210> 507
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 507 <400> 507
ctagaggttt tgctgtgcca ctagaggttt tgctgtgcca
<210> 508 <210> 508
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 508 <400> 508
tctagaggtt ttgctgtgcc tctagaggtt ttgctgtgcc
<210> 509 <210> 509
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 509 <400> 509
aatcacacta tgtgttctag aatcacacta tgtgttctag
<210> 510 <210> 510
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 510 <400> 510
aaatcacact atgtgttcta aaatcacact atgtgttcta
<210> 511 <210> 511
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 511 taaatcacac tatgtgttct <400> 511 taaatcacac tatgtgttct
<210> 512 <210> 512
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 512 cttaaatcac actatgtgtt <400> 512 cttaaatcac actatgtgtt
<210> 513 <210> 513
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 513 tattctgtta cttaaatcac <400> 513 tattctgtta cttaaatcac
<210> 514 <210> 514
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 514 tggtagcctc agtctgcttc <400> 514 tggtagcctc agtctgcttc
<210> 515 <210> 515
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 515 agtctgcttc gcgccttctg <400> 515 agtctgcttc gcgccttctg
<210> 516 <210> 516
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 516 gcgccagggc cgaagaggaa <400> 516 gcgccagggc cgaagaggaa
<210> 517 <210> 517
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 517 <400> 517
caggtatgag ctcaagctgg caggtatgag ctcaagctgg
<210> 518 <210> 518
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 518 <400> 518
catcctgaac atcaagaggg catcctgaac atcaagaggg
<210> 519 <210> 519
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 519 <400> 519
gggcagtgtg atcgcttcaa gggcagtgtg atcgcttcaa
<210> 520 <210> 520
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 520 <400> 520
cacttgctct catcaaaggc cacttgctct catcaaaggc
<210> 521 <210> 521
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 521 <400> 521
cacactggac gctaagagga cacactggac gctaagagga
<210> 522 <210> 522
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 522 <400> 522
cgctgagcca cgcggtcaac cgctgagcca cgcggtcaac
<210> 523 <210> 523
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 523 <400> 523
tgtccaaatt ctaccatggg tgtccaaatt ctaccatggg
<210> 524 <210> 524
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 524 cagctgacct catcgagatt <400> 524 cagctgacct catcgagatt
<210> 525 <210> 525
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 525 gtcaagttcc tgatggtgtc <400> 525 gtcaagttcc tgatggtgtc
<210> 526 <210> 526
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 526 agctgcttct gatgggtgcc <400> 526 agctgcttct gatgggtgcc
<210> 527 <210> 527
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 527 gggcatcatc attccggact <400> 527 gggcatcatc attccggact
<210> 528 <210> 528
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 528 cctactatcc gctgaccggg <400> 528 cctactatcc gctgaccggg
<210> 529 <210> 529
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 529 gggccaccta agttgtgaca <400> 529 gggccaccta agttgtgaca
<210> 530 <210> 530
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 530 agaacatggg attgccagac <400> 530 agaacatggg attgccagac
<210> 531 <210> 531
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 531 <400> 531
ctccacttca agtctgtggg ctccacttca agtctgtggg
<210> 532 <210> 532
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 532 cagagcttgg cctctctggg <400> 532 cagagcttgg cctctctggg
<210> 533 <210> 533
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 533 tggccgcttc agggaacaca <400> 533 tggccgcttc agggaacaca
<210> 534 <210> 534
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 534 cagctgagca gacaggcacc <400> 534 cagctgagca gacaggcacc
<210> 535 <210> 535
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 535 gggagagaca agtttcacat <400> 535 gggagagaca agtttcacat
<210> 536 <210> 536
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 536 gtactgcatc ctggattcaa <400> 536 gtactgcatc ctggattcaa
<210> 537 <210> 537
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 537 gtgaggtgac tcagagactc <400> 537 gtgaggtgac tcagagactc
<210> 538 <210> 538
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 538 ttgcagagca atattctatc <400> 538 ttgcagagca atattctatc
<210> 539 <210> 539
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 539 <400> 539
aagcattggt agagcaaggg aagcattggt agagcaaggg
<210> 540 <210> 540
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 540 <400> 540
ccgctggctc tgaaggagtc ccgctggctc tgaaggagtc
<210> 541 <210> 541
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 541 <400> 541
tctagtcagg ctgacctgcg tctagtcagg ctgacctgcg
<210> 542 <210> 542
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 542 <400> 542
gggccacagt gttctaactg gggccacagt gttctaactg
<210> 543 <210> 543
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 543 <400> 543
aatcaagtgt catcacactg aatcaagtgt catcacactg
<210> 544 <210> 544
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 544 <400> 544
gggtagtcat aacagtactg gggtagtcat aacagtactg
<210> 545 <210> 545
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 545 <400> 545
agagcacacg gtcttcagtg agagcacacg gtcttcagtg
<210> 546 <210> 546
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 546 ttacagctag agggcctctt <400> 546 ttacagctag agggcctctt
<210> 547 <210> 547
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 547 caccgtgggc atggatatgg <400> 547 caccgtgggc atggatatgg
<210> 548 <210> 548
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 548 gggaatctga tgaggaaact <400> 548 gggaatctga tgaggaaact
<210> 549 <210> 549
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 549 tgtcaacaag taccactggg <400> 549 tgtcaacaag taccactggg
<210> 550 <210> 550
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 550 acctgggata tacactaggg <400> 550 acctgggata tacactaggg
<210> 551 <210> 551
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 551 ccaagtatag ttggctggac <400> 551 ccaagtatag ttggctggac
<210> 552 <210> 552
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 552 tacatgaagc ttgctccagg <400> 552 tacatgaagc ttgctccagg
<210> 553 <210> 553
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 553 <400> 553
atgtcagcct ggtctgtcca atgtcagcct ggtctgtcca
<210> 554 <210> 554
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 554 gcacctccgg aagtacacat <400> 554 gcacctccgg aagtacacat
<210> 555 <210> 555
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 555 ctgcagcttc atcctgaaga <400> 555 ctgcagcttc atcctgaaga
<210> 556 <210> 556
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 556 tgagggcaaa gccttgctga <400> 556 tgagggcaaa gccttgctga
<210> 557 <210> 557
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 557 ccattccaga agggaagcag <400> 557 ccattccaga agggaagcag
<210> 558 <210> 558
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 558 cgaggaaggg caatgtggca <400> 558 cgaggaaggg caatgtggca
<210> 559 <210> 559
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 559 ccttgtcaac tctgatcagc <400> 559 ccttgtcaac tctgatcagc
<210> 560 <210> 560
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 560 agcagccagt cctgtcagta <400> 560 agcagccagt cctgtcagta
<210> 561 <210> 561
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 561 <400> 561
agcatgtggc agaagccatc agcatgtggc agaagccatc
<210> 562 <210> 562
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 562 <400> 562
gagagcacca aatccacatc gagagcacca aatccacatc
<210> 563 <210> 563
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 563 <400> 563
cctcagtgat gaagcagtca cctcagtgat gaagcagtca
<210> 564 <210> 564
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 564 <400> 564
gatagatgtg gtcacctacc gatagatgtg gtcacctacc
<210> 565 <210> 565
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 565 <400> 565
cctcagcaca gcagctgcga cctcagcaca gcagctgcga
<210> 566 <210> 566
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 566 <400> 566
gattctgcgg gtcattggaa gattctgcgg gtcattggaa
<210> 567 <210> 567
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 567 <400> 567
caaagccatc actgatgatc caaagccatc actgatgatc
<210> 568 <210> 568
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 568 agaaagctgc catccaggct <400> 568 agaaagctgc catccaggct
<210> 569 <210> 569
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 569 caggaggttc ttcttcagac <400> 569 caggaggttc ttcttcagac
<210> 570 <210> 570
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 570 gagtccttca caggcagata <400> 570 gagtccttca caggcagata
<210> 571 <210> 571
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 571 tgccaatatc ttgaactcag <400> 571 tgccaatatc ttgaactcag
<210> 572 <210> 572
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 572 catcgagatt ggcttggaag <400> 572 catcgagatt ggcttggaag
<210> 573 <210> 573
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 573 ggagctggat tacagttgca <400> 573 ggagctggat tacagttgca
<210> 574 <210> 574
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 574 caacatgcag gctgaactgg <400> 574 caacatgcag gctgaactgg
<210> 575 <210> 575
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 575 <400> 575
acattacatt tggtctctac acattacatt tggtctctac
<210> 576 <210> 576
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 576 ctcaggcgct tactccaacg <400> 576 ctcaggcgct tactccaacg
<210> 577 <210> 577
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 577 gggacaccag attagagctg <400> 577 gggacaccag attagagctg
<210> 578 <210> 578
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 578 gagctccaga gagaggacag <400> 578 gagctccaga gagaggacag
<210> 579 <210> 579
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 579 atcggcagag tatgaccttg <400> 579 atcggcagag tatgaccttg
<210> 580 <210> 580
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 580 caagggtgtt atttccatac <400> 580 caagggtgtt atttccatac
<210> 581 <210> 581
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 581 gactcatctg ctacagctta <400> 581 gactcatctg ctacagctta
<210> 582 <210> 582
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 582 gcaaatcctc cagagatcta <400> 582 gcaaatcctc cagagatcta
<210> 583 <210> 583
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 583 <400> 583
ctctcctggg tgttctagac ctctcctggg tgttctagac
<210> 584 <210> 584
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 584 20 <400> 584 20
atgaaggctg actctgtggt atgaaggctg actctgtggt
<210> 585 <210> 585
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 585 <400> 585
gggaccacag atgtctgctt gggaccacag atgtctgctt
<210> 586 <210> 586
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 586 <400> 586
ctggccggct caatggagag ctggccggct caatggagag
<210> 587 <210> 587
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 587 <400> 587
gctgcgttct gaatatcagg gctgcgttct gaatatcagg
<210> 588 <210> 588
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 588 <400> 588
tgctgacatc ttaggcactg tgctgacatc ttaggcactg
<210> 589 <210> 589
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 589 20 <400> 589 20
aagtgtagtc tcctggtgct aagtgtagtc tcctggtgct
<210> 590 <210> 590
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 590 20 caaaattcag tctggatggg <400> 590 20 caaaattcag tctggatggg
<210> 591 <210> 591
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 591 gggaaactac ggctagaacc <400> 591 gggaaactac ggctagaacc
<210> 592 <210> 592
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 592 ctgcatgtgg ctggtaacct <400> 592 ctgcatgtgg ctggtaacct
<210> 593 <210> 593
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 593 ccatgaccat cgatgcacat <400> 593 ccatgaccat cgatgcacat
<210> 594 <210> 594
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 594 atgggaaact cgctctctgg <400> 594 atgggaaact cgctctctgg
<210> 595 <210> 595
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 595 agtcatcatc tcgtgtctag <400> 595 agtcatcatc tcgtgtctag
<210> 596 <210> 596
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 596 gaatacagcc aggacttgga <400> 596 gaatacagcc aggacttgga
<210> 597 <210> 597
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 597 <400> 597
ggcgtggagc ttactggacg ggcgtggagc ttactggacg
<210> 598 <210> 598
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 598 gagatgagag atgccgttga <400> 598 gagatgagag atgccgttga
<210> 599 <210> 599
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 599 agtcttgatg agcactatca <400> 599 agtcttgatg agcactatca
<210> 600 <210> 600
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 600 ctaagtacca aatcagaatc <400> 600 ctaagtacca aatcagaatc
<210> 601 <210> 601
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 601 gtccatgagt taatcgagag <400> 601 gtccatgagt taatcgagag
<210> 602 <210> 602
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 602 aggccacagt tgcagtgtat <400> 602 aggccacagt tgcagtgtat
<210> 603 <210> 603
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 603 tctgattggt ggactcttgc <400> 603 tctgattggt ggactcttgc
<210> 604 <210> 604
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 604 gaagtcagtc ttcaggctct <400> 604 gaagtcagtc ttcaggctct
<210> 605 <210> 605
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 605 <400> 605
ccagattctc agatgaggga ccagattctc agatgaggga
<210> 606 <210> 606
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 606 <400> 606
catctgtcat tgatgcactg catctgtcat tgatgcactg
<210> 607 <210> 607
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 607 <400> 607
aggagatgtc aagggttcgg aggagatgtc aagggttcgg
<210> 608 <210> 608
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 608 <400> 608
ggaactattg ctagtgaggc ggaactattg ctagtgaggc
<210> 609 <210> 609
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 609 <400> 609
ctctctccat ggcaaatgtc ctctctccat ggcaaatgtc
<210> 610 <210> 610
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 610 <400> 610
caccgtgact tcagtgcaga caccgtgact tcagtgcaga
<210> 611 <210> 611
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 611 <400> 611
actgagttga gggtccggga actgagttga gggtccggga
<210> 612 <210> 612
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 612 <400> 612
cacatatgaa ctggacctgc cacatatgaa ctggacctgc
<210> 613 <210> 613
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 613 <400> 613
tctgaactca gaaggatggc tctgaactca gaaggatggc
<210> 614 <210> 614
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 614 <400> 614
ggtgcgaagc agactgaggc ggtgcgaagc agactgaggc
<210> 615 <210> 615
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 615 <400> 615
tcccaccggg acctgcgggg tcccaccggg acctgcgggg
<210> 616 <210> 616
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 616 20 <400> 616 20
caccgggacc tgcggggctg caccgggacc tgcggggctg
<210> 617 <210> 617
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 617 <400> 617
ctgagtgccc ttctcggttg ctgagtgccc ttctcggttg
<210> 618 <210> 618
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 618 <400> 618
ctcggttgct gccgctgagg ctcggttgct gccgctgagg
<210> 619 <210> 619
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 619 tcggttgctg ccgctgagga <400> 619 tcggttgctg ccgctgagga
<210> 620 <210> 620
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 620 cggttgctgc cgctgaggag <400> 620 cggttgctgc cgctgaggag
<210> 621 <210> 621
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 621 gttgctgccg ctgaggagcc <400> 621 gttgctgccg ctgaggagcc
<210> 622 <210> 622
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 622 ctgccgctga ggagcccgcc <400> 622 ctgccgctga ggagcccgcc
<210> 623 <210> 623
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 623 accgcagctg gcgatggacc <400> 623 accgcagctg gcgatggacc
<210> 624 <210> 624
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 624 cagctggcga tggacccgcc <400> 624 cagctggcga tggacccgcc
<210> 625 <210> 625
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 625 gaacttacta tcatcctcta <400> 625 gaacttacta tcatcctcta
<210> 626 <210> 626
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 626 tccaattgaa ctttcacata <400> 626 tccaattgaa ctttcacata
<210> 627 <210> 627
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 627 <400> 627
aaaattcaaa ctgcctatat aaaattcaaa ctgcctatat
<210> 628 <210> 628
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 628 <400> 628
gataaaacca tacagtgagc gataaaacca tacagtgagc
<210> 629 <210> 629
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 629 <400> 629
ataaaaccat acagtgagcc ataaaaccat acagtgagcc
<210> 630 <210> 630
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 630 <400> 630
aaccatacag tgagccagcc aaccatacag tgagccagcc
<210> 631 <210> 631
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 631 <400> 631
accatacagt gagccagcct accatacagt gagccagcct
<210> 632 <210> 632
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 632 <400> 632
ccatacagtg agccagcctt ccatacagtg agccagcctt
<210> 633 <210> 633
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 633 <400> 633
gtgagccagc cttgcagtag gtgagccagc cttgcagtag
<210> 634 <210> 634
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 634 <400> 634
ccagccttgc agtaggcagt ccagccttgc agtaggcagt
<210> 635 <210> 635
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 635 <400> 635
taggcagtag actataagca taggcagtag actataagca
<210> 636 <210> 636
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 636 <400> 636
gcagtagact ataagcagaa gcagtagact ataagcagaa
<210> 637 <210> 637
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 637 <400> 637
tgaactggac ctgcaccaaa tgaactggac ctgcaccaaa
<210> 638 <210> 638
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 638 <400> 638
ctggacctgc accaaagctg ctggacctgc accaaagctg
<210> 639 <210> 639
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 639 <400> 639
ggacctgcac caaagctggc ggacctgcac caaagctggc
<210> 640 <210> 640
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 640 <400> 640
ctgcaccaaa gctggcacca ctgcaccaaa gctggcacca
<210> 641 <210> 641
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 641 accaaagctg gcaccagggc <400> 641 accaaagctg gcaccagggc
<210> 642 <210> 642
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 642 ctcggaaggt ctctgaactc <400> 642 ctcggaaggt ctctgaactc
<210> 643 <210> 643
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 643 aactcagaag gatggcattt <400> 643 aactcagaag gatggcattt
<210> 644 <210> 644
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 644 ctcagaagga tggcattttt <400> 644 ctcagaagga tggcattttt
<210> 645 <210> 645
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 645 atcaggatct gagttatttt <400> 645 atcaggatct gagttatttt
<210> 646 <210> 646
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 646 aggatctgag ttattttgct <400> 646 aggatctgag ttattttgct
<210> 647 <210> 647
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 647 ctgagttatt ttgctaaact <400> 647 ctgagttatt ttgctaaact
<210> 648 <210> 648
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 648 attttgctaa acttggggga <400> 648 attttgctaa acttggggga
<210> 649 <210> 649
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 649 <400> 649
taaacttggg ggaggaggaa taaacttggg ggaggaggaa
<210> 650 <210> 650
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 650 <400> 650
ggaacaaata aatggagtct ggaacaaata aatggagtct
<210> 651 <210> 651
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 651 <400> 651
gtttgtaact caagcagaag gtttgtaact caagcagaag
<210> 652 <210> 652
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 652 <400> 652
ttgtaactca agcagaaggt ttgtaactca agcagaaggt
<210> 653 <210> 653
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 653 <400> 653
gtaactcaag cagaaggtgc gtaactcaag cagaaggtgc
<210> 654 <210> 654
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 654 <400> 654
aactcaagca gaaggtgcga aactcaagca gaaggtgcga
<210> 655 <210> 655
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 655 <400> 655
ctcaagcaga aggtgcgaag ctcaagcaga aggtgcgaag
<210> 656 <210> 656
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 656 <400> 656
caagcagaag gtgcgaagca caagcagaag gtgcgaagca
<210> 657 <210> 657
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 657 <400> 657
agcagaaggt gcgaagcaga agcagaaggt gcgaagcaga
<210> 658 <210> 658
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 658 <400> 658
cagaaggtgc gaagcagact cagaaggtgc gaagcagact
<210> 659 <210> 659
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 659 <400> 659
gaaggtgcga agcagactga gaaggtgcga agcagactga
<210> 660 <210> 660
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 660 <400> 660
aggtgcgaag cagactgagg aggtgcgaag cagactgagg
<210> 661 <210> 661
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 661 <400> 661
gtgcgaagca gactgaggct gtgcgaagca gactgaggct
<210> 662 <210> 662
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 662 <400> 662
gcgaagcaga ctgaggctac gcgaagcaga ctgaggctac
<210> 663 <210> 663
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 663 gaagcagact gaggctacca <400> 663 gaagcagact gaggctacca
<210> 664 <210> 664
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 664 agcagactga ggctaccatg <400> 664 agcagactga ggctaccatg
<210> 665 <210> 665
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 665 cagactgagg ctaccatgac <400> 665 cagactgagg ctaccatgac
<210> 666 <210> 666
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 666 gactgaggct accatgacat <400> 666 gactgaggct accatgacat
<210> 667 <210> 667
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 667 ctgaggctac catgacattc <400> 667 ctgaggctac catgacattc
<210> 668 <210> 668
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 668 gaggctacca tgacattcaa <400> 668 gaggctacca tgacattcaa
<210> 669 <210> 669
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 669 ggctaccatg acattcaaat <400> 669 ggctaccatg acattcaaat
<210> 670 <210> 670
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 670 ctaccatgac attcaaatat <400> 670 ctaccatgac attcaaatat
<210> 671 <210> 671
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 671 <400> 671
cctgaagctg catgtggctg cctgaagctg catgtggctg
<210> 672 <210> 672
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 672 <400> 672
tgaagctgca tgtggctggt tgaagctgca tgtggctggt
<210> 673 <210> 673
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 673 <400> 673
aagctgcatg tggctggtaa aagctgcatg tggctggtaa
<210> 674 <210> 674
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 674 <400> 674
gctgcatgtg gctggtaacc gctgcatgtg gctggtaacc
<210> 675 <210> 675
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 675 20 <400> 675 20
tgcatgtggc tggtaaccta tgcatgtggc tggtaaccta
<210> 676 <210> 676
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 676 <400> 676
catgtggctg gtaacctaaa catgtggctg gtaacctaaa
<210> 677 <210> 677
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 677 <400> 677
tgtggctggt aacctaaaag tgtggctggt aacctaaaag
<210> 678 <210> 678
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 678 <400> 678
tggctggtaa cctaaaagga tggctggtaa cctaaaagga
<210> 679 <210> 679
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 679 <400> 679
gctggtaacc taaaaggagc gctggtaacc taaaaggagc
<210> 680 <210> 680
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 680 <400> 680
tggtaaccta aaaggagcct tggtaaccta aaaggagcct
<210> 681 <210> 681
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 681 <400> 681
gtaacctaaa aggagcctac gtaacctaaa aggagcctac
<210> 682 <210> 682
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 682 <400> 682
aacctaaaag gagcctacca aacctaaaag gagcctacca
<210> 683 <210> 683
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 683 <400> 683
cctaaaagga gcctaccaaa cctaaaagga gcctaccaaa
<210> 684 <210> 684
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 684 <400> 684
ggcgcgaagc agactgaggc ggcgcgaagc agactgaggc
<210> 685 <210> 685
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 685 cactatgttc atgagggagg <400> 685 cactatgttc atgagggagg
<210> 686 <210> 686
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 686 ccatcatagg ttctgacgtc <400> 686 ccatcatagg ttctgacgtc
<210> 687 <210> 687
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 687 gaagctgatt gactcactca <400> 687 gaagctgatt gactcactca
<210> 688 <210> 688
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 688 ttgtaactca agcagaaggc <400> 688 ttgtaactca agcagaaggc
<210> 689 <210> 689
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 689 gtaactcaag cagaaggcgc <400> 689 gtaactcaag cagaaggcgc
<210> 690 <210> 690
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 690 aactcaagca gaaggcgcga <400> 690 aactcaagca gaaggcgcga
<210> 691 <210> 691
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 691 ctcaagcaga aggcgcgaag <400> 691 ctcaagcaga aggcgcgaag
<210> 692 <210> 692
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 692 cagaaggcgc gaagcagact <400> 692 cagaaggcgc gaagcagact
<210> 693 <210> 693
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 693 <400> 693
gaaggcgcga agcagactga gaaggcgcga agcagactga
<210> 694 <210> 694
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 694 <400> 694
aggcgcgaag cagactgagg aggcgcgaag cagactgagg
<210> 695 <210> 695
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 695 <400> 695
gcgcgaagca gactgaggct gcgcgaagca gactgaggct
<210> 696 <210> 696
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 696 <400> 696
gaagcagact gaggctacca gaagcagact gaggctacca
<210> 697 <210> 697
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 697 <400> 697
cagaaggcgc gaagcagact cagaaggcgc gaagcagact
<210> 698 <210> 698
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 698 <400> 698
tctttctcct gtcttacaga tctttctcct gtcttacaga
<210> 699 <210> 699
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 699 <400> 699
cccacgttag aagatgcgac cccacgttag aagatgcgac
<210> 700 <210> 700
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 700 <400> 700
aatatggtag acatgagcca aatatggtag acatgagcca
<210> 701 <210> 701
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 701 <400> 701
cattagctgc atttcaactg cattagctgc atttcaactg
<210> 702 <210> 702
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 702 <400> 702
actttcactc ctagtctgca actttcactc ctagtctgca
<210> 703 <210> 703
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 703 <400> 703
ccatgtccag gtaagtcatg ccatgtccag gtaagtcatg
<210> 704 <210> 704
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 704 <400> 704
gcaccaggca cggatgtgac gcaccaggca cggatgtgac
<210> 705 <210> 705
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 705 <400> 705
gtggggtccc agaggcactg gtggggtccc agaggcactg
<210> 706 <210> 706
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 706 <400> 706
gctgatcggc cactgcagct gctgatcggc cactgcagct
<210> 707 <210> 707
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 707 tccacgtggc tggggaggtc <400> 707 tccacgtggc tggggaggtc
<210> 708 <210> 708
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 708 tgtaatgtat ggtgatcaga <400> 708 tgtaatgtat ggtgatcaga
<210> 709 <210> 709
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 709 gagagtaccc agtgggaaat <400> 709 gagagtaccc agtgggaaat
<210> 710 <210> 710
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 710 agtcagcatg ggcttcagcc <400> 710 agtcagcatg ggcttcagcc
<210> 711 <210> 711
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 711 caaaagaatg actgtccaac <400> 711 caaaagaatg actgtccaac
<210> 712 <210> 712
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 712 gaatgactgt ccaacaagtg <400> 712 gaatgactgt ccaacaagtg
<210> 713 <210> 713
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 713 tatctactgt aatttaaaat <400> 713 tatctactgt aatttaaaat
<210> 714 <210> 714
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 714 ctgatatggg tggagaacag <400> 714 ctgatatggg tggagaacag
<210> 715 <210> 715
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 715 <400> 715
tctgggacag gtatgagctc tctgggacag gtatgagctc
<210> 716 <210> 716
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 716 <400> 716
tgatagcagt ggcccttgaa tgatagcagt ggcccttgaa
<210> 717 <210> 717
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 717 <400> 717
ggattggcgt gaaatactgg ggattggcgt gaaatactgg
<210> 718 <210> 718
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 718 20 <400> 718 20
tgcccgaggt tcctcctgcc tgcccgaggt tcctcctgcc
<210> 719 <210> 719
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 719 <400> 719
gcactagcaa gaccacactc gcactagcaa gaccacactc
<210> 720 <210> 720
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 720 <400> 720
caagaccaca ctctgcatag caagaccaca ctctgcatag
<210> 721 <210> 721
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 721 <400> 721
tcctccatag gataccgtgt tcctccatag gataccgtgt
<210> 722 <210> 722
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 722 <400> 722
ggatgtaggg cagcaaaacc ggatgtaggg cagcaaaacc
<210> 723 <210> 723
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 723 <400> 723
tctgcacaag gactccttgt tctgcacaag gactccttgt
<210> 724 <210> 724
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 724 <400> 724
cagcctgtct cagtgaacat cagcctgtct cagtgaacat
<210> 725 <210> 725
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 725 20 <400> 725 20
caggatgctt ccagtctaat caggatgctt ccagtctaat
<210> 726 <210> 726
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 726 <400> 726
aaatgctcgt ctccaatctc aaatgctcgt ctccaatctc
<210> 727 <210> 727
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 727 <400> 727
aacttgtgta tccaaatcca aacttgtgta tccaaatcca
<210> 728 <210> 728
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 728 20 <400> 728 20
tgacatggtg tgcttccttg tgacatggtg tgcttccttg
<210> 729 <210> 729
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 729 20 acactggtgt tctggctacc <400> 729 20 acactggtgt tctggctacc
<210> 730 <210> 730
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 730 gtgttctggc tacctctagt <400> 730 gtgttctggc tacctctagt
<210> 731 <210> 731
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 731 tcctggcata ggtcacagta <400> 731 tcctggcata ggtcacagta
<210> 732 <210> 732
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 732 atgtcaacag tagcacctcc <400> 732 atgtcaacag tagcacctcc
<210> 733 <210> 733
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 733 tagactcaga caagtctgga <400> 733 tagactcaga caagtctgga
<210> 734 <210> 734
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 734 cctaagttgc tcatctctgg <400> 734 cctaagttgc tcatctctgg
<210> 735 <210> 735
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 735 tgcgctgagt tccatgaaac <400> 735 tgcgctgagt tccatgaaac
<210> 736 <210> 736
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 736 ctattgcagg tgctctccag <400> 736 ctattgcagg tgctctccag
<210> 737 <210> 737
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 737 <400> 737
cagaggaaca tcttgcacct cagaggaaca tcttgcacct
<210> 738 <210> 738
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 738 <400> 738
ctctgctcct tactcttgtg ctctgctcct tactcttgtg
<210> 739 <210> 739
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 739 <400> 739
gtaatttctc accatccatc gtaatttctc accatccatc
<210> 740 <210> 740
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 740 <400> 740
ttctgagtct caattgtcta ttctgagtct caattgtcta
<210> 741 <210> 741
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 741 <400> 741
ctatgtcctt gtgtgcacat ctatgtcctt gtgtgcacat
<210> 742 <210> 742
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 742 <400> 742
gcctattgcc atttgtatgt gcctattgcc atttgtatgt
<210> 743 <210> 743
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 743 <400> 743
ctattcatgt cctttgccta ctattcatgt cctttgccta
<210> 744 <210> 744
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 744 <400> 744
gattctgcgg gtaatctcag gattctgcgg gtaatctcag
<210> 745 <210> 745
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 745 <400> 745
tcaatgcagg tcattggaaa tcaatgcagg tcattggaaa
<210> 746 <210> 746
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 746 <400> 746
ctaccagatt gaccatccct ctaccagatt gaccatccct
<210> 747 <210> 747
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 747 <400> 747
tacttgatag tgctctagga tacttgatag tgctctagga
<210> 748 <210> 748
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 748 <400> 748
ttgactgcag gaccaggagg ttgactgcag gaccaggagg
<210> 749 <210> 749
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 749 <400> 749
aacaaacact tgtgcaaatg aacaaacact tgtgcaaatg
<210> 750 <210> 750
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 750 <400> 750
aatgagacca aacttccact aatgagacca aacttccact
<210> 751 <210> 751
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 751 ttccactttg aagctagcaa <400> 751 ttccactttg aagctagcaa
<210> 752 <210> 752
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 752 gatctggagc ttattcttga <400> 752 gatctggagc ttattcttga
<210> 753 <210> 753
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 753 acctcatgtg acttgtatgc <400> 753 acctcatgtg acttgtatgc
<210> 754 <210> 754
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 754 ttcttaagaa acaccttgta <400> 754 ttcttaagaa acaccttgta
<210> 755 <210> 755
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 755 taggcccatc ctggctgcat <400> 755 taggcccatc ctggctgcat
<210> 756 <210> 756
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 756 aaactctcag gatatggtaa <400> 756 aaactctcag gatatggtaa
<210> 757 <210> 757
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 757 ataccttcct ctacctttgc <400> 757 ataccttcct ctacctttgc
<210> 758 <210> 758
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 758 tacctttgct gaaggtcctt <400> 758 tacctttgct gaaggtcctt
<210> 759 <210> 759
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 759 <400> 759
atctatctag tgaaatttct atctatctag tgaaatttct
<210> 760 <210> 760
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 760 <400> 760
tcagctcatc aaaatatgct tcagctcatc aaaatatgct
<210> 761 <210> 761
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 761 <400> 761
atatgctagt ccttcctttc atatgctagt ccttcctttc
<210> 762 <210> 762
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 762 <400> 762
caaaggtctg agttatccag caaaggtctg agttatccag
<210> 763 <210> 763
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 763 <400> 763
tgacttatag atgcaggctg tgacttatag atgcaggctg
<210> 764 <210> 764
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 764 <400> 764
tcagtggagg gtaattcttt tcagtggagg gtaattcttt
<210> 765 <210> 765
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 765 <400> 765
tgcctagcca gtttgaaaga tgcctagcca gtttgaaaga
<210> 766 <210> 766
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 766 <400> 766
cctgcagaat tttgccaggc cctgcagaat tttgccaggc
<210> 767 <210> 767
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 767 <400> 767
gtagctaggt aggtaaagca gtagctaggt aggtaaagca
<210> 768 <210> 768
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 768 <400> 768
ttgagtgaga cacacaaggt ttgagtgaga cacacaaggt
<210> 769 <210> 769
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 769 <400> 769
gtgctagtca gggaatgcat gtgctagtca gggaatgcat
<210> 770 <210> 770
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 770 <400> 770
ggggagagag catgcccagc ggggagagag catgcccagc
<210> 771 <210> 771
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 771 <400> 771
gcatgcccag ctgcgaaagc gcatgcccag ctgcgaaagc
<210> 772 <210> 772
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 772 <400> 772
agccaggtat agaaaggagt agccaggtat agaaaggagt
<210> 773 <210> 773
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 773 aactttctaa gaggcagaat <400> 773 aactttctaa gaggcagaat
<210> 774 <210> 774
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 774 tcttagtctg gtcatgagtg <400> 774 tcttagtctg gtcatgagtg
<210> 775 <210> 775
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 775 agtaggagat ttcatatgaa <400> 775 agtaggagat ttcatatgaa
<210> 776 <210> 776
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 776 tcttcaccag caacacatta <400> 776 tcttcaccag caacacatta
<210> 777 <210> 777
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 777 atggccacct agcatggcac <400> 777 atggccacct agcatggcac
<210> 778 <210> 778
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 778 catgtttctg agcctccaga <400> 778 catgtttctg agcctccaga
<210> 779 <210> 779
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 779 taggtggctc cctgtcttca <400> 779 taggtggctc cctgtcttca
<210> 780 <210> 780
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 780 tccaaagtct tgggaatcct <400> 780 tccaaagtct tgggaatcct
<210> 781 <210> 781
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 781 <400> 781
acaaagaaag ggggagttgg acaaagaaag ggggagttgg
<210> 782 <210> 782
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 782 <400> 782
tcgtgtcttc ctggcccaga tcgtgtcttc ctggcccaga
<210> 783 <210> 783
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 783 <400> 783
gcagtgccca gcacacaata gcagtgccca gcacacaata
<210> 784 <210> 784
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 784 <400> 784
actcgtccag gtgcgaagca actcgtccag gtgcgaagca
<210> 785 <210> 785
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 785 <400> 785
gccacctaag gtaaagaagg gccacctaag gtaaagaagg
<210> 786 <210> 786
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 786 <400> 786
atcagagtgg cagagagagc atcagagtgg cagagagagc
<210> 787 <210> 787
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 787 <400> 787
tttaccatag ttgtgacaca tttaccatag ttgtgacaca
<210> 788 <210> 788
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 788 <400> 788
cattttgtag gcaatgagct cattttgtag gcaatgagct
<210> 789 <210> 789
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 789 <400> 789
gcattagtaa acatgagaac gcattagtaa acatgagaac
<210> 790 <210> 790
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 790 <400> 790
ttcatttcag cgatggccgg ttcatttcag cgatggccgg
<210> 791 <210> 791
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 791 <400> 791
gaaaatctag tgtcattcaa gaaaatctag tgtcattcaa
<210> 792 <210> 792
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 792 <400> 792
tcctatacag ttttgggaac tcctatacag ttttgggaac
<210> 793 <210> 793
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 793 <400> 793
aaggacttca gtatggagct aaggacttca gtatggagct
<210> 794 <210> 794
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 794 <400> 794
atggagcttt tattgaattg atggagcttt tattgaattg
<210> 795 <210> 795
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 795 ccatcagcac tattatttat <400> 795 ccatcagcac tattatttat
<210> 796 <210> 796
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 796 ataggcaagc tcagccatag <400> 796 ataggcaagc tcagccatag
<210> 797 <210> 797
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 797 tgctagatga gatacatcaa <400> 797 tgctagatga gatacatcaa
<210> 798 <210> 798
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 798 gaagaccaaa catggttcta <400> 798 gaagaccaaa catggttcta
<210> 799 <210> 799
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 799 ctctgtttag tcctctccag <400> 799 ctctgtttag tcctctccag
<210> 800 <210> 800
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 800 cattgataaa atgttctggc <400> 800 cattgataaa atgttctggc
<210> 801 <210> 801
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 801 tctggcacag caaaacctct <400> 801 tctggcacag caaaacctct
<210> 802 <210> 802
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 802 tggcacagca aaacctctag <400> 802 tggcacagca aaacctctag
<210> 803 <210> 803
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 803 <400> 803
tagaacacat agtgtgattt tagaacacat agtgtgattt
<210> 804 <210> 804
<211> 20 <211> 20
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 804 <400> 804
aacacatagt gtgatttaag aacacatagt gtgatttaag
<210> 805 <210> 805
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 805 <400> 805
ctttccgttg gacccctggg ctttccgttg gacccctggg
<210> 806 <210> 806
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 806 <400> 806
tcccgcctgt gacatgcatt tcccgcctgt gacatgcatt
<210> 807 <210> 807
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 807 <400> 807
ttctacctcg cgcgatttac ttctacctcg cgcgatttac
<210> 808 <210> 808
<211> 432 <211> 432
<212> ADN <212> DNA
<213> O. cuniculus <213> O. cuniculus
<400> 808 <400> 808
<210> 809 <210> 809
<211> 660 <211> 660
<212> ADN <212> DNA
<213> O. cuniculus <213> O. cuniculus
<400> 809 <400> 809
<210> 810 15 <211> 543 <210> 810 15 <211> 543
<212> ADN <212> DNA
<213> O. cuniculus <213> O. cuniculus
- <220> <220>
- 20 <221> característica_misc 20 <221> misc_feature
<222> (45) <222> (45)
<223> n = a, c, g, o t <223> n = a, c, g, or t
- <220> <220>
- 25 <221> característica_misc 25 <221> misc_feature
<222> (118) <222> (118)
<223> n = a, c, g, o t <223> n = a, c, g, or t
- <220> <220>
- 30 <221> característica_misc 30 <221> misc_feature
<222> (148) <222> (148)
<223> n = a, c, g, o t <223> n = a, c, g, or t
- <220> <220>
- 35 <221> característica_misc 35 <221> misc_feature
<222> (173) <222> (173)
<223> n = a, c, g, o t <223> n = a, c, g, or t
- <220> <220>
- 40 <221> característica_misc 40 <221> misc_feature
<222> (180) <222> (180)
<223> n = a, c, g, o t <223> n = a, c, g, or t
- <400><400>
- 810 810
- <400><400>
- 814 tgcttggaga aggtaagatc 814 tgcttggaga aggtaagatc
- 10 10
- <210> 811 <211> 19 <212> ADN <213> Secuencia Artificial <210> 811 <211> 19 <212> DNA <213> Artificial Sequence
- 15 fifteen
- <220> <223> Cebador <400> 811 <220> <223> Primer <400> 811
- aagcaccccc aatgtcacc aagcaccccc aatgtcacc
- 19 19
- 20 twenty
- <210> 812 <211> 20 <212> ADN <213> Secuencia Artificial <210> 812 <211> 20 <212> DNA <213> Artificial Sequence
- 25 25
- <220> <223> Cebador <220> <223> Primer
- <400> 812 <400> 812
- 30 30
- gggatggcag agccaatgta 20 gggatggcag agccaatgta twenty
- 35 35
- <210> 813 <211> 29 <212> ADN <213> Secuencia Artificial <210> 813 <211> 29 <212> DNA <213> Artificial Sequence
- <220> <223> Sonda <220> <223> Probe
- 40 40
- <400> 813 <400> 813
- tcctggattc aagcttctat gtgccttca tcctggattc aagcttctat gtgccttca
- 29 29
- 45 Four. Five
- <210> 814 <211> 20 <212> ADN <213> Secuencia Artificial <210> 814 <211> 20 <212> DNA <213> Artificial Sequence
- 50 fifty
- <220> <223> Oligonucleótido Antisentido <220> <223> Antisense Oligonucleotide
<210> 815 <210> 815
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 815 gcgttgtctc cgatgttctg <400> 815 gcgttgtctc cgatgttctg
<210> 816 <210> 816
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 816 taatcattaa cttgctgtgg <400> 816 taatcattaa cttgctgtgg
<210> 817 <210> 817
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 817 tcagcacgta gcaatgcatt <400> 817 tcagcacgta gcaatgcatt
<210> 818 <210> 818
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 818 gcctgatact cagcacgtag <400> 818 gcctgatact cagcacgtag
<210> 819 <210> 819
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 819 caattgaatg tactcagata <400> 819 caattgaatg tactcagata
<210> 820 <210> 820
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 820 <400> 820
acctcagtga cttgtaatca acctcagtga cttgtaatca
<210> 821 <210> 821
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 821 <400> 821
cactggaaac ttgtctctcc cactggaaac ttgtctctcc
<210> 822 <210> 822
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 822 <400> 822
agtagttagt ttctccttgg agtagttagt ttctccttgg
<210> 823 <210> 823
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 823 <400> 823
tcagtgccca agatgtcagc tcagtgccca agatgtcagc
<210> 824 <210> 824
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 824 <400> 824
attggaataa tgtatccagg attggaataa tgtatccagg
<210> 825 <210> 825
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 825 ttggcattat ccaatgcagt <400> 825 ttggcattat ccaatgcagt
<210> 826 <210> 826
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 826 gttgccttgt gagcagcagt <400> 826 gttgccttgt gagcagcagt
<210> 827 <210> 827
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 827 attgtgagtg gagatacttc <400> 827 attgtgagtg gagatacttc
<210> 828 <210> 828
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 828 catatgtctg aagttgagac <400> 828 catatgtctg aagttgagac
<210> 829 <210> 829
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 829 gtagatactc cattttggcc <400> 829 gtagatactc cattttggcc
<210> 830 <210> 830
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 830 ggatcacatg actgaatgct <400> 830 ggatcacatg actgaatgct
<210> 831 <210> 831
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 831 <400> 831
tcaagctggt tgttgcactg tcaagctggt tgttgcactg
<210> 832 <210> 832
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 832 <400> 832
ggactgtacc tcaagctggt ggactgtacc tcaagctggt
<210> 833 <210> 833
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 833 <400> 833
gctcattctc cagcatcagg gctcattctc cagcatcagg
<210> 834 <210> 834
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 834 <400> 834
ttgatctata atactagcta ttgatctata atactagcta
<210> 835 <210> 835
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 835 <400> 835
atggaagact ggcagctcta atggaagact ggcagctcta
<210> 836 <210> 836
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 836 ttgtgttcct tgaagcggcc <400> 836 ttgtgttcct tgaagcggcc
<210> 837 <210> 837
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 837 tgtgcacgga tatgataacg <400> 837 tgtgcacgga tatgataacg
<210> 838 <210> 838
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 838 gaccttgagt agattcctgg <400> 838 gaccttgagt agattcctgg
<210> 839 <210> 839
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 839 gaaatctgga agagagacct <400> 839 gaaatctgga agagagacct
<210> 840 <210> 840
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 840 gtagctttcc catctaggct <400> 840 gtagctttcc catctaggct
<210> 841 <210> 841
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 841 gataactctg tgagggtagc <400> 841 gataactctg tgagggtagc
<210> 842 <210> 842
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 842 <400> 842
atgttgccca tggctggaat atgttgccca tggctggaat
<210> 843 <210> 843
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 843 <400> 843
aagatgcagt actacttcca aagatgcagt actacttcca
<210> 844 <210> 844
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 844 <400> 844
gcacccagaa tcatggcctg gcacccagaa tcatggcctg
<210> 845 <210> 845
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 845 <400> 845
cttgatactt ggtatccaca cttgatactt ggtatccaca
<210> 846 <210> 846
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 846 <400> 846
cagtgtaatg atcgttgatt cagtgtaatg atcgttgatt
<210> 847 <210> 847
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 847 taaagtccag cattggtatt <400> 847 taaagtccag cattggtatt
<210> 848 <210> 848
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 848 caacaatgtc tgattggtta <400> 848 caacaatgtc tgattggtta
<210> 849 <210> 849
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 849 gaagaggaag aaaggatatg <400> 849 gaagaggaag aaaggatatg
<210> 850 <210> 850
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 850 tgacagatga agaggaagaa <400> 850 tgacagatga agaggaagaa
<210> 851 <210> 851
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 851 ttgtactgta gtgcatcaat <400> 851 ttgtactgta gtgcatcaat
<210> 852 <210> 852
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 852 gcctcaatct gttgtttcag <400> 852 gcctcaatct gttgtttcag
<210> 853 <210> 853
<211> 20 <211> 20
- <212> ADN <213> Secuencia Artificial <212> DNA <213> Artificial Sequence
- 5 5
- <220> <223> Oligonucleótido Antisentido <220> <223> Antisense Oligonucleotide
- <400> 853 <400> 853
- 10 15 10 15
- acttgagcgt gccctctaat <210> 854 <211> 20 <212> ADN <213> Secuencia Artificial <220> <223> Oligonucleótido Antisentido 20 acttgagcgt gccctctaat <210> 854 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense Oligonucleotide twenty
- 20 twenty
- <400> 854 gaaatggaat tgtagttctc <400> 854 gaaatggaat tgtagttctc
- 20 twenty
- 25 25
- <210> 855 <211> 479 <212> ADN <213> M. fascicularis <210> 855 <211> 479 <212> DNA <213> M. fascicularis
- 30 30
- <220> <221> característica_misc <222> (7) <223> n = A,T,C o G <220> <221> misc_characteristic <222> (7) <223> n = A, T, C or G
- 35 35
- <220> <221> característica_misc <222>(469)..(474) <223> n = A,T,C o G <220> <221> misc_characteristic <222> (469) .. (474) <223> n = A, T, C or G
- 40 40
- <220> <221> característica_misc <222> (476)..( 479) <223> n = A,T,C o G <220> <221> misc_characteristic <222> (476) .. (479) <223> n = A, T, C or G
- <400> 855 <400> 855
<210> 856 <210> 856
<211> 20 <211> 20
<212> ADN 50 <213> Secuencia Artificial <212> DNA 50 <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 856 gtccctcaac atctgaatgc <400> 856 gtccctcaac atctgaatgc
<210> 857 <210> 857
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 857 ctgctagcct ctggatttga <400> 857 ctgctagcct ctggatttga
<210> 858 <210> 858
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 858 ccttccctga aggttcctcc <400> 858 ccttccctga aggttcctcc
<210> 859 <210> 859
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 859 ctcttactgt gctgtggaca <400> 859 ctcttactgt gctgtggaca
<210> 860 <210> 860
<211> 13938 <211> 13938
<212> ADN <212> DNA
<213> H. sapiens <213> H. sapiens
<400> 860 <400> 860
<210> 861 <210> 861
<211> 25 <211> 25
- <212> ADN <213> Secuencia Artificial <212> DNA <213> Artificial Sequence
- <220> <223> Cebador PCR <220> <223> PCR primer
- <400> 861 <400> 861
- cagctcctta ttgttatacg aggga cagctcctta ttgttatacg aggga
- 25 25
- <210> 862 <211> 18 <212> ADN <213> Secuencia Artificial <210> 862 <211> 18 <212> DNA <213> Artificial Sequence
- <220> <223> Cebador PCR <220> <223> PCR primer
- <400> 862 <400> 862
- tgcgtctgag cattgcgt tgcgtctgag cattgcgt
- 18 18
- <210> 863 <211> 24 <212> ADN <213> Secuencia Artificial <210> 863 <211> 24 <212> DNA <213> Artificial Sequence
- <220> <223> Sonda PCR <220> <223> PCR probe
- <400> 863 <400> 863
- cccggtgtca ggtgggagta ctgc cccggtgtca ggtgggagta ctgc
- 24 24
- <210> 864 <211> 20 <212> ADN <213> Secuencia Artificial <210> 864 <211> 20 <212> DNA <213> Artificial Sequence
- <220> <223> Oligonucleótido Antisentido <220> <223> Antisense Oligonucleotide
- <400> 864 <400> 864
- gcctcagtct tcttcgcacc gcctcagtct tcttcgcacc
- 20 twenty
- <210> 865 <211> 20 <212> ADN <213> Secuencia Artificial <210> 865 <211> 20 <212> DNA <213> Artificial Sequence
- <220> <223> Oligonucleótido Antisentido <220> <223> Antisense Oligonucleotide
- <400> 865 <400> 865
- gcctcagtct tattcgcacc gcctcagtct tattcgcacc
- 20 twenty
- <210> 866 <211> 20 <212> ADN <213> Secuencia Artificial <210> 866 <211> 20 <212> DNA <213> Artificial Sequence
- <220> <223> Oligonucleótido Antisentido <220> <223> Antisense Oligonucleotide
<400> 866 gcctcagtat tattcgcacc <400> 866 gcctcagtat tattcgcacc
<210> 867 <210> 867
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 867 gcctcattat tattcgcacc <400> 867 gcctcattat tattcgcacc
<210> 868 <210> 868
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 868 gcctcattat tattagcacc <400> 868 gcctcattat tattagcacc
<210> 869 <210> 869
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 869 gcctcattat tattatcacc <400> 869 gcctcattat tattatcacc
<210> 870 <210> 870
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 870 gcctaattat tattatcacc <400> 870 gcctaattat tattatcacc
<210> 871 <210> 871
<211> 19 <211> 19
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 871 gcctcagtct gcttcgcac <400> 871 gcctcagtct gcttcgcac
<210> 872 <210> 872
<211> 18 <211> 18
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 872 <400> 872
gcctcagtct gcttcgca 18 gcctcagtct gcttcgca 18
<210> 873 <210> 873
<211> 15 <211> 15
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 873 <400> 873
gcctcagtct gcttc 15 gcctcagtct gcttc 15
<210> 874 <210> 874
<211> 18 <211> 18
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 874 <400> 874
cctcagtctg cttcgcac 18 cctcagtctg cttcgcac 18
<210> 875 <210> 875
<211> 16 <211> 16
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 875 16 <400> 875 16
ctcagtctgc ttcgca 16 ctcagtctgc ttcgca 16
<210> 876 <210> 876
<211> 14 <211> 14
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 876 <400> 876
tcagtctgct tcgc 14 tcagtctgct tcgc 14
<210> 877 <210> 877
<211> 10 <211> 10
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 877 gcctcagtct 10 <400> 877 gcctcagtct 10
<210> 878 <210> 878
<211> 10 <211> 10
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 878 gcttcgcacc 10 <400> 878 gcttcgcacc 10
<210> 879 <210> 879
<211> 20 <211> 20
<212> ARN <212> RNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 879 uugaagccau acaccucuuu 20 <400> 879 uugaagccau acaccucuuu 20
<210> 880 <210> 880
<211> 20 <211> 20
<212> ARN <212> RNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 880 ugaccaggac ugccuguucu 20 <400> 880 ugaccaggac ugccuguucu 20
<210> 881 <210> 881
<211> 20 <211> 20
<212> ARN <212> RNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 881 gaauagggcu guagcuguaa 20 <400> 881 gaauagggcu guagcuguaa 20
<210> 882 <210> 882
<211> 20 <211> 20
<212> ARN <212> RNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 882 uauacugauc aaauuguauc 20 <400> 882 uauacugauc aaauuguauc 20
<210> 883 <210> 883
<211> 20 <211> 20
<212> ARN <212> RNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 883 <400> 883
uggaauucug guaugugaag uggaauucug guaugugaag
<210> 884 <210> 884
<211> 20 <211> 20
<212> ARN <212> RNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 884 <400> 884
aaaucaaaug auugcuuugu aaaucaaaug auugcuuugu
<210> 885 <210> 885
<211> 20 <211> 20
<212> ARN <212> RNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 885 <400> 885
gugaugacac uugauuuaaa gugaugacac uugauuuaaa
<210> 886 <210> 886
<211> 20 <211> 20
<212> ARN <212> RNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 886 <400> 886
gaagcugccu cuucuuccca gaagcugccu cuucuuccca
<210> 887 <210> 887
<211> 20 <211> 20
<212> ARN <212> RNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
<400> 887 <400> 887
gagaguuggu cugaaaaauc gagaguuggu cugaaaaauc
<210> 888 <210> 888
<211> 20 <211> 20
<212> ADN <212> DNA
<213> Secuencia Artificial <213> Artificial Sequence
<220> <220>
<223> Oligonucleótido Antisentido <223> Antisense Oligonucleotide
- <400> 888 <400> 888
- gtgcgcgcga gcccgaaatc gtgcgcgcga gcccgaaatc
- 20 twenty
- 5 5
- <210> 889 <211> 21 <212> ADN <213> Secuencia Artificial <210> 889 <211> 21 <212> DNA <213> Artificial Sequence
- <220> <223> Oligonucleótido Antisentido <220> <223> Antisense Oligonucleotide
- <400> 889 <400> 889
- 15 fifteen
- cuucuggcau ccgguuuagt t 21 cuucuggcau ccgguuuagt t twenty-one
- <210> 890 <211> 466 <212> ADN <213> M. fascicularis <210> 890 <211> 466 <212> DNA <213> M. fascicularis
- 25 25
- <220> <221> característica_misc <222> 9 <223> n = A,T,C o G <220> <221> misc_characteristic <222> 9 <223> n = A, T, C or G
- <400> 890 <400> 890
- 35 35
- <210> 891 <211> 20 <212> ADN <213> Secuencia Artificial <220> <223> Oligonucleótido Antisentido <210> 891 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense Oligonucleotide
- <400> 891 <400> 891
- gcctcagtct gctttacacc gcctcagtct gctttacacc
- 20 twenty
- 45 Four. Five
- <210> 892 <211> 20 <212> ADN <213> Secuencia Artificial <210> 892 <211> 20 <212> DNA <213> Artificial Sequence
- <220> <223> Oligonucleótido Antisentido <220> <223> Antisense Oligonucleotide
- <400> 892 <400> 892
- agattaccag ccatatgcag agattaccag ccatatgcag
- 20 twenty
- 55 55
Claims (16)
- 1. one.
- Un compuesto oligonucleótido antisentido de 20 bases nucleicas de longitud que tiene una secuencia de bases nucleicas como se expone en la SEQ ID NO: 247 y que comprende 5-metilcitidina en las bases nucleicas 2, 3, 5, 9, 12, 15, 17, 19 y 20, en el que cada enlace internucleósido es un enlace fosforotioato, las bases nucleicas 1-5 y 16-20 comprenden una modificación 2'-metoxietoxilo, y las bases nucleicas 6-15 son desoxinucleótidos. A 20 nucleic length antisense oligonucleotide compound having a nucleic base sequence as set forth in SEQ ID NO: 247 and comprising 5-methylcytidine at nucleic bases 2, 3, 5, 9, 12, 15, 17 , 19 and 20, in which each internucleoside bond is a phosphorothioate bond, nucleic bases 1-5 and 16-20 comprise a 2'-methoxyethoxy modification, and nucleic bases 6-15 are deoxynucleotides.
- 2.2.
- El compuesto oligonucleótido antisentido de la reivindicación 1, en el que el compuesto es una sal farmacéuticamente aceptable. The antisense oligonucleotide compound of claim 1, wherein the compound is a pharmaceutically acceptable salt.
- 3. 3.
- El compuesto oligonucleótido antisentido de la reivindicación 2, en el que la sal farmacéuticamente aceptable es una sal formada con el sodio catiónico. The antisense oligonucleotide compound of claim 2, wherein the pharmaceutically acceptable salt is a salt formed with the cationic sodium.
- 4. Four.
- Una composición que comprende el compuesto oligonucleótido antisentido de cualquiera de las realizaciones 1 a 3, y un vehículo o diluyente farmacéuticamente aceptable. A composition comprising the antisense oligonucleotide compound of any one of embodiments 1 to 3, and a pharmaceutically acceptable carrier or diluent.
- 5. 5.
- El compuesto oligonucleótido antisentido de cualquiera de las reivindicaciones 1 a 3, o la composición de la reivindicación 4, para usar en la terapia o profilaxis de una enfermedad. The antisense oligonucleotide compound of any one of claims 1 to 3, or the composition of claim 4, for use in the therapy or prophylaxis of a disease.
- 6. 6.
- El compuesto oligonucleótido antisentido de cualquiera de las reivindicaciones 1 a 3, o la composición de la reivindicación 4, para usar en el tratamiento de la hipercolesterolemia en un ser humano. The antisense oligonucleotide compound of any one of claims 1 to 3, or the composition of claim 4, for use in the treatment of hypercholesterolemia in a human.
- 7.7.
- El compuesto oligonucleótido antisentido de cualquiera de las reivindicaciones 1 a 3, o la composición de la reivindicación 4, para usar en el tratamiento de una enfermedad cardiovascular, tal como la aterosclerosis, en un ser humano. The antisense oligonucleotide compound of any of claims 1 to 3, or the composition of claim 4, for use in the treatment of cardiovascular disease, such as atherosclerosis, in a human.
- 8. 8.
- El compuesto oligonucleótido antisentido de cualquiera de las reivindicaciones 1 a 3, o la composición de la reivindicación 4, para usar en el tratamiento de la hiperlipidemia en un ser humano. The antisense oligonucleotide compound of any one of claims 1 to 3, or the composition of claim 4, for use in treating hyperlipidemia in a human.
- 9.9.
- El compuesto oligonucleótido antisentido de cualquiera de las reivindicaciones 1 a 3, o la composición de la reivindicación 4, para usar en el tratamiento de la diabetes en un ser humano. The antisense oligonucleotide compound of any one of claims 1 to 3, or the composition of claim 4, for use in the treatment of diabetes in a human.
- 10. 10.
- El compuesto oligonucleótido antisentido de cualquiera de las reivindicaciones 1 a 3, o la composición de la reivindicación 4, para usar en el tratamiento de la obesidad en un ser humano. The antisense oligonucleotide compound of any one of claims 1 to 3, or the composition of claim 4, for use in the treatment of obesity in a human.
- 11. eleven.
- Uso del compuesto oligonucleótido antisentido de cualquiera de las reivindicaciones 1 a 3, para preparar un medicamento para tratar la hipercolesterolemia en un ser humano. Use of the antisense oligonucleotide compound of any of claims 1 to 3, to prepare a medicament for treating hypercholesterolemia in a human.
- 12.12.
- Uso del compuesto oligonucleótido antisentido de cualquiera de las reivindicaciones 1 a 3, para preparar un medicamento para tratar una enfermedad cardiovascular, tal como la aterosclerosis, en un ser humano. Use of the antisense oligonucleotide compound of any one of claims 1 to 3, to prepare a medicament for treating cardiovascular disease, such as atherosclerosis, in a human.
- 13. 13.
- Uso del compuesto oligonucleótido antisentido de cualquiera de las reivindicaciones 1 a 3, para preparar un medicamento para tratar la hiperlipidemia en un ser humano. Use of the antisense oligonucleotide compound of any of claims 1 to 3, to prepare a medicament for treating hyperlipidemia in a human.
- 14. 14.
- Uso del compuesto oligonucleótido antisentido de cualquiera de las reivindicaciones 1 a 3, para preparar un medicamento para tratar la diabetes en un ser humano. Use of the antisense oligonucleotide compound of any of claims 1 to 3, to prepare a medicament for treating diabetes in a human.
- 15. fifteen.
- Uso del compuesto oligonucleótido antisentido de cualquiera de las reivindicaciones 1 a 3, para preparar un medicamento para tratar la obesidad en un ser humano. Use of the antisense oligonucleotide compound of any one of claims 1 to 3, to prepare a medicament for treating obesity in a human.
- 16. 16.
- El compuesto oligonucleótido antisentido o la composición de la reivindicación 6, o el uso de la reivindicación 11, en el que la hipercolesterolemia es hipercolesterolemia familiar. The antisense oligonucleotide compound or composition of claim 6, or the use of claim 11, wherein the hypercholesterolemia is familial hypercholesterolemia.
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US42623402P | 2002-11-13 | 2002-11-13 | |
US426234P | 2002-11-13 | ||
WOPCT/US03/15493 | 2003-05-15 | ||
PCT/US2003/015493 WO2003097662A1 (en) | 2002-05-15 | 2003-05-15 | Antisense modulation of apolipoprotein b expression |
Publications (1)
Publication Number | Publication Date |
---|---|
ES2417879T3 true ES2417879T3 (en) | 2013-08-09 |
Family
ID=40635393
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
ES03789763T Expired - Lifetime ES2420914T3 (en) | 2002-11-13 | 2003-11-13 | Antisense modulation of apolipoprotein B expression |
ES10180483T Expired - Lifetime ES2417879T3 (en) | 2002-11-13 | 2003-11-13 | Antisense modulation of apolipoprotein B expression |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
ES03789763T Expired - Lifetime ES2420914T3 (en) | 2002-11-13 | 2003-11-13 | Antisense modulation of apolipoprotein B expression |
Country Status (7)
Country | Link |
---|---|
EP (1) | EP2336319A1 (en) |
JP (5) | JP5342493B2 (en) |
DK (2) | DK1569695T3 (en) |
ES (2) | ES2420914T3 (en) |
PT (2) | PT2336318E (en) |
SI (2) | SI2336318T1 (en) |
ZA (1) | ZA200503690B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2835087B1 (en) | 2013-08-09 | 2018-10-10 | Eurofilters N.V. | Vacuum cleaner filter bag with spacing element |
CN106573020A (en) * | 2014-08-08 | 2017-04-19 | 加利福尼亚大学董事会 | A liver protecting method and a liver protecting agent |
Family Cites Families (236)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
US4534899A (en) | 1981-07-20 | 1985-08-13 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
US4426330A (en) | 1981-07-20 | 1984-01-17 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
US4476301A (en) | 1982-04-29 | 1984-10-09 | Centre National De La Recherche Scientifique | Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon |
JPS5927900A (en) | 1982-08-09 | 1984-02-14 | Wakunaga Seiyaku Kk | Oligonucleotide derivative and its preparation |
US4501729A (en) | 1982-12-13 | 1985-02-26 | Research Corporation | Aerosolized amiloride treatment of retained pulmonary secretions |
FR2540122B1 (en) | 1983-01-27 | 1985-11-29 | Centre Nat Rech Scient | NOVEL COMPOUNDS COMPRISING A SEQUENCE OF OLIGONUCLEOTIDE LINKED TO AN INTERCALATION AGENT, THEIR SYNTHESIS PROCESS AND THEIR APPLICATION |
US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
US4818542A (en) | 1983-11-14 | 1989-04-04 | The University Of Kentucky Research Foundation | Porous microspheres for drug delivery and methods for making same |
US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
US5550111A (en) | 1984-07-11 | 1996-08-27 | Temple University-Of The Commonwealth System Of Higher Education | Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof |
FR2567892B1 (en) | 1984-07-19 | 1989-02-17 | Centre Nat Rech Scient | NOVEL OLIGONUCLEOTIDES, THEIR PREPARATION PROCESS AND THEIR APPLICATIONS AS MEDIATORS IN DEVELOPING THE EFFECTS OF INTERFERONS |
US5367066A (en) | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
US5430136A (en) | 1984-10-16 | 1995-07-04 | Chiron Corporation | Oligonucleotides having selectably cleavable and/or abasic sites |
US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
FR2575751B1 (en) | 1985-01-08 | 1987-04-03 | Pasteur Institut | NOVEL ADENOSINE DERIVATIVE NUCLEOSIDES, THEIR PREPARATION AND THEIR BIOLOGICAL APPLICATIONS |
US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
US5166315A (en) | 1989-12-20 | 1992-11-24 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
US5405938A (en) | 1989-12-20 | 1995-04-11 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
US4885172A (en) | 1985-06-26 | 1989-12-05 | The Liposome Company, Inc. | Composition for targeting, storing and loading of liposomes |
MX9203291A (en) | 1985-06-26 | 1992-08-01 | Liposome Co Inc | LIPOSOMAS COUPLING METHOD. |
US5171578A (en) | 1985-06-26 | 1992-12-15 | The Liposome Company, Inc. | Composition for targeting, storing and loading of liposomes |
US5059421A (en) | 1985-07-26 | 1991-10-22 | The Liposome Company, Inc. | Preparation of targeted liposome systems of a defined size distribution |
US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
JPS638396A (en) | 1986-06-30 | 1988-01-14 | Wakunaga Pharmaceut Co Ltd | Poly-labeled oligonucleotide derivative |
EP0260032B1 (en) | 1986-09-08 | 1994-01-26 | Ajinomoto Co., Inc. | Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers |
US4920016A (en) | 1986-12-24 | 1990-04-24 | Linear Technology, Inc. | Liposomes with enhanced circulation time |
US4837028A (en) | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
US5264423A (en) | 1987-03-25 | 1993-11-23 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
US5276019A (en) | 1987-03-25 | 1994-01-04 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
JP2828642B2 (en) | 1987-06-24 | 1998-11-25 | ハワード フローレイ インスティテュト オブ イクスペリメンタル フィジオロジー アンド メディシン | Nucleoside derivative |
US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
US5188897A (en) | 1987-10-22 | 1993-02-23 | Temple University Of The Commonwealth System Of Higher Education | Encapsulated 2',5'-phosphorothioate oligoadenylates |
US4924624A (en) | 1987-10-22 | 1990-05-15 | Temple University-Of The Commonwealth System Of Higher Education | 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof |
US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
DE3738460A1 (en) | 1987-11-12 | 1989-05-24 | Max Planck Gesellschaft | MODIFIED OLIGONUCLEOTIDS |
ATE151467T1 (en) | 1987-11-30 | 1997-04-15 | Univ Iowa Res Found | DNA MOLECULES STABILIZED BY MODIFICATIONS TO THE 3'-TERMINAL PHOSPHODIESTER BOND, THEIR USE AS NUCLEIC ACID PROBE AND AS THERAPEUTIC AGENTS FOR INHIBITING THE EXPRESSION OF SPECIFIC TARGET GENES |
US5403711A (en) | 1987-11-30 | 1995-04-04 | University Of Iowa Research Foundation | Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved |
US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
JPH03503894A (en) | 1988-03-25 | 1991-08-29 | ユニバーシィティ オブ バージニア アランミ パテンツ ファウンデイション | Oligonucleotide N-alkylphosphoramidate |
US5278302A (en) | 1988-05-26 | 1994-01-11 | University Patents, Inc. | Polynucleotide phosphorodithioates |
US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
US5216141A (en) | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
US5175273A (en) | 1988-07-01 | 1992-12-29 | Genentech, Inc. | Nucleic acid intercalating agents |
US5749915A (en) | 1988-08-24 | 1998-05-12 | Focal, Inc. | Polymeric endoluminal paving process |
US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
US5194599A (en) | 1988-09-23 | 1993-03-16 | Gilead Sciences, Inc. | Hydrogen phosphonodithioate compositions |
GB8824593D0 (en) | 1988-10-20 | 1988-11-23 | Royal Free Hosp School Med | Liposomes |
US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
US5599923A (en) | 1989-03-06 | 1997-02-04 | Board Of Regents, University Of Tx | Texaphyrin metal complexes having improved functionalization |
US5457183A (en) | 1989-03-06 | 1995-10-10 | Board Of Regents, The University Of Texas System | Hydroxylated texaphyrins |
US5354844A (en) | 1989-03-16 | 1994-10-11 | Boehringer Ingelheim International Gmbh | Protein-polycation conjugates |
US5108921A (en) | 1989-04-03 | 1992-04-28 | Purdue Research Foundation | Method for enhanced transmembrane transport of exogenous molecules |
US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
US5256775A (en) | 1989-06-05 | 1993-10-26 | Gilead Sciences, Inc. | Exonuclease-resistant oligonucleotides |
US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
US5227170A (en) | 1989-06-22 | 1993-07-13 | Vestar, Inc. | Encapsulation process |
US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
US5134066A (en) | 1989-08-29 | 1992-07-28 | Monsanto Company | Improved probes using nucleosides containing 3-dezauracil analogs |
US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
US5225212A (en) | 1989-10-20 | 1993-07-06 | Liposome Technology, Inc. | Microreservoir liposome composition and method |
US5356633A (en) | 1989-10-20 | 1994-10-18 | Liposome Technology, Inc. | Method of treatment of inflamed tissues |
US5527528A (en) | 1989-10-20 | 1996-06-18 | Sequus Pharmaceuticals, Inc. | Solid-tumor treatment method |
US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
US5721218A (en) | 1989-10-23 | 1998-02-24 | Gilead Sciences, Inc. | Oligonucleotides with inverted polarity |
US5399676A (en) | 1989-10-23 | 1995-03-21 | Gilead Sciences | Oligonucleotides with inverted polarity |
US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
EP0942000B1 (en) | 1989-10-24 | 2004-06-23 | Isis Pharmaceuticals, Inc. | 2'-Modified oligonucleotides |
US5264562A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences, Inc. | Oligonucleotide analogs with novel linkages |
US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
US5177198A (en) | 1989-11-30 | 1993-01-05 | University Of N.C. At Chapel Hill | Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
US5130302A (en) | 1989-12-20 | 1992-07-14 | Boron Bilogicals, Inc. | Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same |
US5469854A (en) | 1989-12-22 | 1995-11-28 | Imarx Pharmaceutical Corp. | Methods of preparing gas-filled liposomes |
US5580575A (en) | 1989-12-22 | 1996-12-03 | Imarx Pharmaceutical Corp. | Therapeutic drug delivery systems |
US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
US5681941A (en) | 1990-01-11 | 1997-10-28 | Isis Pharmaceuticals, Inc. | Substituted purines and oligonucleotide cross-linking |
US5459255A (en) | 1990-01-11 | 1995-10-17 | Isis Pharmaceuticals, Inc. | N-2 substituted purines |
US5587361A (en) | 1991-10-15 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
US5587470A (en) | 1990-01-11 | 1996-12-24 | Isis Pharmaceuticals, Inc. | 3-deazapurines |
US5506351A (en) | 1992-07-23 | 1996-04-09 | Isis Pharmaceuticals | Process for the preparation of 2'-O-alkyl guanosine and related compounds |
US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
US5623065A (en) | 1990-08-13 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Gapped 2' modified oligonucleotides |
US5149797A (en) | 1990-02-15 | 1992-09-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of rna and production of encoded polypeptides |
US5220007A (en) | 1990-02-15 | 1993-06-15 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
AU7579991A (en) | 1990-02-20 | 1991-09-18 | Gilead Sciences, Inc. | Pseudonucleosides and pseudonucleotides and their polymers |
US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
US5321131A (en) | 1990-03-08 | 1994-06-14 | Hybridon, Inc. | Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling |
US5470967A (en) | 1990-04-10 | 1995-11-28 | The Dupont Merck Pharmaceutical Company | Oligonucleotide analogs with sulfamate linkages |
US5264618A (en) | 1990-04-19 | 1993-11-23 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
US5665710A (en) | 1990-04-30 | 1997-09-09 | Georgetown University | Method of making liposomal oligodeoxynucleotide compositions |
GB9009980D0 (en) | 1990-05-03 | 1990-06-27 | Amersham Int Plc | Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
ES2116977T3 (en) | 1990-05-11 | 1998-08-01 | Microprobe Corp | SOLID SUPPORTS FOR NUCLEIC ACID HYBRIDIZATION TESTS AND METHODS TO IMMOBILIZE OLIGONUCLEOTIDES IN A COVALENT WAY. |
US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
US5223618A (en) | 1990-08-13 | 1993-06-29 | Isis Pharmaceuticals, Inc. | 4'-desmethyl nucleoside analog compounds |
US5378825A (en) | 1990-07-27 | 1995-01-03 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs |
US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
US5541307A (en) | 1990-07-27 | 1996-07-30 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs and solid phase synthesis thereof |
US5618704A (en) | 1990-07-27 | 1997-04-08 | Isis Pharmacueticals, Inc. | Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling |
BR9106702A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals Inc | ANALOG OF OLIGONUCLEOTIDEOS AND PROCESSES TO MODULATE THE PRODUCTION OF A PROTEIN BY AN ORGANISM AND TO TREAT AN ORGANISM |
US5623070A (en) | 1990-07-27 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
US5677437A (en) | 1990-07-27 | 1997-10-14 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
US5386023A (en) | 1990-07-27 | 1995-01-31 | Isis Pharmaceuticals | Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling |
US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
IL113519A (en) | 1990-08-03 | 1997-11-20 | Sterling Winthrop Inc | Oligonucleoside sequences of from about 6 to about 200 bases having a three atom internucleoside linkage, their preparation and pharmaceutical compositions for inhibiting gene expression containing said oligonucleosides |
US5177196A (en) | 1990-08-16 | 1993-01-05 | Microprobe Corporation | Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof |
US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
US5214134A (en) | 1990-09-12 | 1993-05-25 | Sterling Winthrop Inc. | Process of linking nucleosides with a siloxane bridge |
US5561225A (en) | 1990-09-19 | 1996-10-01 | Southern Research Institute | Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages |
CA2092002A1 (en) | 1990-09-20 | 1992-03-21 | Mark Matteucci | Modified internucleoside linkages |
US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
US5220006A (en) | 1990-10-23 | 1993-06-15 | The United States Of America As Represented By The Department Of Health And Human Services | Identification of a suppressor of atherogenic apolipoprotein |
ATE198598T1 (en) | 1990-11-08 | 2001-01-15 | Hybridon Inc | CONNECTION OF MULTIPLE REPORTER GROUPS ON SYNTHETIC OLIGONUCLEOTIDES |
US5672697A (en) | 1991-02-08 | 1997-09-30 | Gilead Sciences, Inc. | Nucleoside 5'-methylene phosphonates |
JP3220180B2 (en) | 1991-05-23 | 2001-10-22 | 三菱化学株式会社 | Drug-containing protein-bound liposomes |
US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
US5719262A (en) | 1993-11-22 | 1998-02-17 | Buchardt, Deceased; Ole | Peptide nucleic acids having amino acid side chains |
CA2082411A1 (en) | 1991-06-28 | 1992-12-29 | Robert D. Rosenberg | Localized oligonucleotide therapy |
US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
US5571799A (en) | 1991-08-12 | 1996-11-05 | Basco, Ltd. | (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response |
US5521291A (en) | 1991-09-30 | 1996-05-28 | Boehringer Ingelheim International, Gmbh | Conjugates for introducing nucleic acid into higher eucaryotic cells |
NZ244306A (en) | 1991-09-30 | 1995-07-26 | Boehringer Ingelheim Int | Composition for introducing nucleic acid complexes into eucaryotic cells, complex containing nucleic acid and endosomolytic agent, peptide with endosomolytic domain and nucleic acid binding domain and preparation |
US5408038A (en) | 1991-10-09 | 1995-04-18 | The Scripps Research Institute | Nonnatural apolipoprotein B-100 peptides and apolipoprotein B-100-apolipoprotein A-I fusion peptides |
DE59208572D1 (en) | 1991-10-17 | 1997-07-10 | Ciba Geigy Ag | Bicyclic nucleosides, oligonucleotides, processes for their preparation and intermediates |
US5594121A (en) | 1991-11-07 | 1997-01-14 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified purines |
JP3739785B2 (en) | 1991-11-26 | 2006-01-25 | アイシス ファーマシューティカルズ,インコーポレイティド | Enhanced triple and double helix shaping using oligomers containing modified pyrimidines |
TW393513B (en) | 1991-11-26 | 2000-06-11 | Isis Pharmaceuticals Inc | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
US5484908A (en) | 1991-11-26 | 1996-01-16 | Gilead Sciences, Inc. | Oligonucleotides containing 5-propynyl pyrimidines |
US5792608A (en) | 1991-12-12 | 1998-08-11 | Gilead Sciences, Inc. | Nuclease stable and binding competent oligomers and methods for their use |
US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
US5700922A (en) | 1991-12-24 | 1997-12-23 | Isis Pharmaceuticals, Inc. | PNA-DNA-PNA chimeric macromolecules |
US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
FR2687679B1 (en) | 1992-02-05 | 1994-10-28 | Centre Nat Rech Scient | OLIGOTHIONUCLEOTIDES. |
US5633360A (en) | 1992-04-14 | 1997-05-27 | Gilead Sciences, Inc. | Oligonucleotide analogs capable of passive cell membrane permeation |
FR2692265B1 (en) | 1992-05-25 | 1996-11-08 | Centre Nat Rech Scient | BIOLOGICALLY ACTIVE COMPOUNDS OF THE PHOSPHOTRIESTER TYPE. |
US5434257A (en) | 1992-06-01 | 1995-07-18 | Gilead Sciences, Inc. | Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages |
AU4413993A (en) | 1992-06-30 | 1994-01-24 | Velke, Willi H. | Tennis racquet having a surface structure adapted for the reduction of air resistance |
EP0577558A2 (en) | 1992-07-01 | 1994-01-05 | Ciba-Geigy Ag | Carbocyclic nucleosides having bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
DE69333842T2 (en) | 1992-07-23 | 2006-04-27 | Isis Pharmaceuticals, Inc., Carlsbad | Novel 2'-O-alkyl nucleosides and phosphoramidites, processes for their preparation and their uses |
US5652355A (en) | 1992-07-23 | 1997-07-29 | Worcester Foundation For Experimental Biology | Hybrid oligonucleotide phosphorothioates |
RU95104940A (en) | 1992-07-27 | 1997-01-10 | Хайбрайдон | Method of incorporation of alkylphosphonothioate or arylphosphonothioate internucleotide linkage in oligonucleotide, method of oligonucleotide synthesis, method of gene expression inhibition, treatment method |
US6180403B1 (en) * | 1999-10-28 | 2001-01-30 | Isis Pharmaceuticals Inc. | Antisense inhibition of tumor necrosis factor alpha converting enzyme (TACE) expression |
US5583020A (en) | 1992-11-24 | 1996-12-10 | Ribozyme Pharmaceuticals, Inc. | Permeability enhancers for negatively charged polynucleotides |
US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
KR100316205B1 (en) | 1993-01-07 | 2002-04-24 | 아브람 엠. 골드핑거 | Antisense Inhibition of c-myc to Regulate Smooth Muscle Cell Proliferation |
JP3351476B2 (en) | 1993-01-22 | 2002-11-25 | 三菱化学株式会社 | Phospholipid derivatives and liposomes containing the same |
DE69400208T2 (en) | 1993-01-25 | 1996-11-28 | Hybridon Inc | OLIONUCLEOTIDALKYLPHOSPHONATES AND PHOSPHONOTHIOATES |
US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
WO1994018987A1 (en) | 1993-02-19 | 1994-09-01 | Nippon Shinyaku Co., Ltd. | Drug composition containing nucleic acid copolymer |
US5395619A (en) | 1993-03-03 | 1995-03-07 | Liposome Technology, Inc. | Lipid-polymer conjugates and liposomes |
GB9304620D0 (en) | 1993-03-06 | 1993-04-21 | Ciba Geigy Ag | Compounds |
GB9304618D0 (en) | 1993-03-06 | 1993-04-21 | Ciba Geigy Ag | Chemical compounds |
CA2159631A1 (en) | 1993-03-30 | 1994-10-13 | Sanofi | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
WO1994022891A1 (en) | 1993-03-31 | 1994-10-13 | Sterling Winthrop Inc. | Oligonucleotides with amide linkages replacing phosphodiester linkages |
DE4311944A1 (en) | 1993-04-10 | 1994-10-13 | Degussa | Coated sodium percarbonate particles, process for their preparation and detergent, cleaning and bleaching compositions containing them |
US5462854A (en) | 1993-04-19 | 1995-10-31 | Beckman Instruments, Inc. | Inverse linkage oligonucleotides for chemical and enzymatic processes |
FR2705099B1 (en) | 1993-05-12 | 1995-08-04 | Centre Nat Rech Scient | Phosphorothioate triester oligonucleotides and process for their preparation. |
US5534259A (en) | 1993-07-08 | 1996-07-09 | Liposome Technology, Inc. | Polymer compound and coated particle composition |
US5543158A (en) | 1993-07-23 | 1996-08-06 | Massachusetts Institute Of Technology | Biodegradable injectable nanoparticles |
US5417978A (en) | 1993-07-29 | 1995-05-23 | Board Of Regents, The University Of Texas System | Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use |
US5502177A (en) | 1993-09-17 | 1996-03-26 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
CA2137297C (en) | 1993-12-06 | 2000-04-18 | Tsuyoshi Miyazaki | Reactive vesicle and functional substance-fixed vesicle |
US5457187A (en) | 1993-12-08 | 1995-10-10 | Board Of Regents University Of Nebraska | Oligonucleotides containing 5-fluorouracil |
DE69425903T2 (en) | 1993-12-09 | 2001-02-15 | Thomas Jefferson University Ph | CONNECTIONS AND METHOD FOR LOCATION-SPECIFIC MUTATION IN EUKARYOTIC CELLS |
US5446137B1 (en) | 1993-12-09 | 1998-10-06 | Behringwerke Ag | Oligonucleotides containing 4'-substituted nucleotides |
US5595756A (en) | 1993-12-22 | 1997-01-21 | Inex Pharmaceuticals Corporation | Liposomal compositions for enhanced retention of bioactive agents |
US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
US5470307A (en) | 1994-03-16 | 1995-11-28 | Lindall; Arnold W. | Catheter system for controllably releasing a therapeutic agent at a remote tissue site |
US5596091A (en) | 1994-03-18 | 1997-01-21 | The Regents Of The University Of California | Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides |
US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
US5646269A (en) | 1994-04-28 | 1997-07-08 | Gilead Sciences, Inc. | Method for oligonucleotide analog synthesis |
US5525711A (en) | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
US5543152A (en) | 1994-06-20 | 1996-08-06 | Inex Pharmaceuticals Corporation | Sphingosomes for enhanced drug delivery |
US5857998A (en) | 1994-06-30 | 1999-01-12 | Boston Scientific Corporation | Stent and therapeutic delivery system |
US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
US5820873A (en) | 1994-09-30 | 1998-10-13 | The University Of British Columbia | Polyethylene glycol modified ceramide lipids and liposome uses thereof |
US5591721A (en) | 1994-10-25 | 1997-01-07 | Hybridon, Inc. | Method of down-regulating gene expression |
US5512295A (en) | 1994-11-10 | 1996-04-30 | The Board Of Trustees Of The Leland Stanford Junior University | Synthetic liposomes for enhanced uptake and delivery |
US5792747A (en) | 1995-01-24 | 1998-08-11 | The Administrators Of The Tulane Educational Fund | Highly potent agonists of growth hormone releasing hormone |
US5674242A (en) | 1995-06-06 | 1997-10-07 | Quanam Medical Corporation | Endoprosthetic device with therapeutic compound |
US5756122A (en) | 1995-06-07 | 1998-05-26 | Georgetown University | Liposomally encapsulated nucleic acids having high entrapment efficiencies, method of manufacturer and use thereof for transfection of targeted cells |
AU716005B2 (en) | 1995-06-07 | 2000-02-17 | Cook Medical Technologies Llc | Implantable medical device |
US5609629A (en) | 1995-06-07 | 1997-03-11 | Med Institute, Inc. | Coated implantable medical device |
DE69629702T2 (en) | 1995-08-01 | 2004-06-17 | Isis Pharmaceuticals, Inc., Carlsbad | LIPOSOMAL OLIGONUCLEOTIDE COMPOSITIONS |
US5652356A (en) | 1995-08-17 | 1997-07-29 | Hybridon, Inc. | Inverted chimeric and hybrid oligonucleotides |
US5858397A (en) | 1995-10-11 | 1999-01-12 | University Of British Columbia | Liposomal formulations of mitoxantrone |
KR0185334B1 (en) | 1995-11-02 | 1999-04-01 | 김은영 | Cdna coding mouse antibody of apolipoprotein b-100 |
US5994316A (en) | 1996-02-21 | 1999-11-30 | The Immune Response Corporation | Method of preparing polynucleotide-carrier complexes for delivery to cells |
US5670161A (en) | 1996-05-28 | 1997-09-23 | Healy; Kevin E. | Biodegradable stent |
US6368356B1 (en) | 1996-07-11 | 2002-04-09 | Scimed Life Systems, Inc. | Medical devices comprising hydrogel polymers having improved mechanical properties |
JP3756313B2 (en) | 1997-03-07 | 2006-03-15 | 武 今西 | Novel bicyclonucleosides and oligonucleotide analogues |
US6547787B1 (en) | 1997-03-13 | 2003-04-15 | Biocardia, Inc. | Drug delivery catheters that attach to tissue and methods for their use |
US6495532B1 (en) | 1997-03-19 | 2002-12-17 | Sky High, Llc | Compositions containing lysophosphotidic acids which inhibit apoptosis and uses thereof |
DE19729769A1 (en) | 1997-07-11 | 1999-01-14 | Cardiogene Gentherapeutische S | Transfection system, its manufacture and use in somatic gene therapy |
US6217886B1 (en) | 1997-07-14 | 2001-04-17 | The Board Of Trustees Of The University Of Illinois | Materials and methods for making improved micelle compositions |
IL135000A0 (en) | 1997-09-12 | 2001-05-20 | Exiqon As | Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues |
US6156315A (en) | 1997-10-10 | 2000-12-05 | The Trustees Of Columbia University In The City Of New York | Method for inhibiting the binding of low density lipoprotein to blood vessel matrix |
EP0911344B1 (en) | 1997-10-15 | 2004-03-03 | Fujirebio Inc. | Anti-Apo-B-48 monoclonal antibody, hybridoma, and methods of use |
US6221425B1 (en) | 1998-01-30 | 2001-04-24 | Advanced Cardiovascular Systems, Inc. | Lubricious hydrophilic coating for an intracorporeal medical device |
US6433012B1 (en) | 1998-03-25 | 2002-08-13 | Large Scale Biology Corp. | Method for inhibiting inflammatory disease |
ATE219693T1 (en) | 1998-04-27 | 2002-07-15 | Surmodics Inc | BIOACTIVE ACTIVE COATINGS |
WO2001012789A2 (en) | 1999-08-18 | 2001-02-22 | Baylor College Of Medicine | APOLIPOPROTEIN B mRNA-SPECIFIC RIBOZYME |
US6562864B1 (en) | 1999-09-02 | 2003-05-13 | Drake Larson | Catechin multimers as therapeutic drug delivery agents |
AU1350301A (en) | 1999-10-26 | 2001-05-08 | Thomas Jefferson University | Regulation of apob for diagnosis, treatment and drug screening for cardiovascular and metabolic disorders or syndromes |
US6171860B1 (en) * | 1999-11-05 | 2001-01-09 | Isis Pharmaceuticals, Inc. | Antisense inhibition of rank expression |
US6187545B1 (en) * | 2000-01-19 | 2001-02-13 | Isis Pharmaceuticals Inc. | Antisense modulation of pepck-cytosolic expression |
AU2000240366B2 (en) * | 2000-03-28 | 2005-08-04 | Isis Pharmaceuticals, Inc. | Alteration of cellular behavior by antisense modulation of mRNA processing |
US6306655B1 (en) * | 2000-06-13 | 2001-10-23 | Isis Pharmaceuticals, Inc. | Antisense inhibition of C/EBP alpha expression |
US7407943B2 (en) * | 2001-08-01 | 2008-08-05 | Isis Pharmaceuticals, Inc. | Antisense modulation of apolipoprotein B expression |
US8025587B2 (en) | 2008-05-16 | 2011-09-27 | Taylor Made Golf Company, Inc. | Golf club |
US9209196B2 (en) | 2011-11-30 | 2015-12-08 | Sharp Kabushiki Kaisha | Memory circuit, method of driving the same, nonvolatile storage device using the same, and liquid crystal display device |
US10867398B2 (en) | 2017-11-21 | 2020-12-15 | Reliance Core Consulting LLC | Methods, systems, apparatuses and devices for facilitating motion analysis in an environment |
-
2003
- 2003-11-13 DK DK03789763.4T patent/DK1569695T3/en active
- 2003-11-13 SI SI200332272T patent/SI2336318T1/en unknown
- 2003-11-13 PT PT101804839T patent/PT2336318E/en unknown
- 2003-11-13 SI SI200332280T patent/SI1569695T1/en unknown
- 2003-11-13 ES ES03789763T patent/ES2420914T3/en not_active Expired - Lifetime
- 2003-11-13 EP EP10180454A patent/EP2336319A1/en not_active Withdrawn
- 2003-11-13 ES ES10180483T patent/ES2417879T3/en not_active Expired - Lifetime
- 2003-11-13 PT PT37897634T patent/PT1569695E/en unknown
- 2003-11-13 DK DK10180483.9T patent/DK2336318T3/en active
-
2005
- 2005-05-09 ZA ZA200503690A patent/ZA200503690B/en unknown
-
2010
- 2010-04-05 JP JP2010087393A patent/JP5342493B2/en not_active Expired - Fee Related
-
2012
- 2012-12-17 JP JP2012274377A patent/JP2013066488A/en not_active Withdrawn
-
2014
- 2014-01-23 JP JP2014010494A patent/JP5989015B2/en not_active Expired - Fee Related
-
2015
- 2015-09-28 JP JP2015189236A patent/JP2016005481A/en not_active Withdrawn
-
2017
- 2017-06-30 JP JP2017129732A patent/JP2017176193A/en active Pending
Also Published As
Publication number | Publication date |
---|---|
JP5342493B2 (en) | 2013-11-13 |
JP5989015B2 (en) | 2016-09-07 |
EP2336319A1 (en) | 2011-06-22 |
JP2014087368A (en) | 2014-05-15 |
DK2336318T3 (en) | 2013-07-15 |
JP2017176193A (en) | 2017-10-05 |
JP2013066488A (en) | 2013-04-18 |
ZA200503690B (en) | 2008-01-30 |
JP2016005481A (en) | 2016-01-14 |
PT1569695E (en) | 2013-07-16 |
SI2336318T1 (en) | 2013-07-31 |
PT2336318E (en) | 2013-06-12 |
DK1569695T3 (en) | 2013-08-05 |
SI1569695T1 (en) | 2013-08-30 |
ES2420914T3 (en) | 2013-08-27 |
JP2010193894A (en) | 2010-09-09 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP2336318B1 (en) | Antisense modulation of apolipoprotein b expression | |
USRE44760E1 (en) | Antisense modulation of apolipoprotein B-expression | |
ES2546360T3 (en) | Antisense modulation of apolipoprotein B expression | |
AU2008213712B2 (en) | Antisense modulation of apolipoprotein (A) expression | |
AU2009200252B2 (en) | Antisense modulation of C-reactive protein expression | |
US20180094260A1 (en) | Effects of apolipoprotein b inhibition on gene expression profiles in animals | |
WO2003097662A1 (en) | Antisense modulation of apolipoprotein b expression | |
KR100622275B1 (en) | 5 Antisense Modulation of Insulin-like Growth Factor Binding Protein 5 Expression | |
JP2017176193A (en) | Antisense modulation of apolipoprotein b expression | |
WO2016033424A1 (en) | Methods for the prevention and treatment of major adverse cardiovascular events using compounds that modulate apolipoprotein b | |
AU2002334895B2 (en) | Antisense modulation of insulin-like growth factor binding protein 5 expression | |
AU2011203319B2 (en) | Antisense modulation of C-reactive protein expression | |
JP2005502331A (en) | Antisense regulation of hormone-sensitive lipase expression |