ES2417879T3 - Antisense modulation of apolipoprotein B expression - Google Patents

Abstract

A 20 nucleic length antisense oligonucleotide compound having a nucleic base sequence as set forth in SEQ ID NO: 247 and comprising 5-methylcytidine at nucleic bases 2, 3, 5, 9, 12, 15, 17 , 19 and 20, in which each internucleoside bond is a phosphorothioate bond, nucleic bases 1-5 and 16-20 comprise a modification.

Description

Antisense modulation of apolipoprotein B expression

Field of the Invention

The present invention provides compositions and methods for modulating the expression of apolipoprotein B. This invention relates to oligonucleotides that can specifically hybridize to nucleic acids encoding apolipoprotein B. Such compounds have been shown to modulate expression of apolipoprotein B.

Background of the Invention

Lipoproteins are micellar globular particles consisting of a non-polar nucleus of acylglycerols and cholesteryl esters surrounded by an amphiphilic coating of protein, phospholipids, and cholesterol. Lipoproteins

10 have been classified into 5 broad categories based on their functional and physical properties: chylomicrons, which transport lipids from the diet of the intestine to the tissues; very low density lipoproteins (VLDL); intermediate density lipoproteins (IDL); low-density lipoprotein (LDL); all of them transport triacylglycerols and cholesterol from the liver to the tissues; and high-density lipoproteins (HDL), which transport endogenous cholesterol from the tissues to the liver.

Lipoprotein particles undergo continuous metabolic processing and have variable properties and compositions. Lipoprotein densities increase without decreasing particle diameter because the density of the outer coatings is less than that of the inner core. The protein components of lipoproteins are known as apolipoproteins. At least 9 apolipoproteins are distributed in significant amounts among the different human lipoproteins.

20 Apolipoprotein B (also known as ApoB, apolipoprotein B-100; ApoB-100, apolipoprotein B-48; ApoB48 and Ag (x) antigen), is a large glycoprotein that has an indispensable function in the assembly and secretion of lipids and in receptor-mediated transport and uptake, and delivery of different classes of lipoproteins. The importance of apolipoprotein B extends to a variety of functions, from the absorption and processing of lipids from the diet to the regulation of circulating lipoprotein levels (Davidson and

25 Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). This latter property is at the basis of its importance in terms of susceptibility to atherosclerosis, which is highly correlated with the ambient concentration of lipoproteins containing apolipoprotein B (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169- 193).

In mammals there are two forms of apolipoprotein B. ApoB-100 represents the full-length protein containing 4536 amino acid residues, synthesized exclusively in the human liver (Davidson and Shelness,

30 Annu. Rev. Nutr., 2000, 20, 169-193). A truncated form, known as apoB-48, is collinear with the 2,152 terminal amino acid residues and is synthesized in the small intestine of all mammals (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193) .

ApoB-100 is the main protein component of LDL and contains the domain necessary for the interaction of this lipoprotein species with the LDL receptor. Furthermore, apoB-100 contains an unpaired cysteine residue.

35 that mediates the interaction with apolipoprotein (a) and generates a different atherogenic lipoprotein called Lp (a) lipoprotein (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193).

In humans, apoB-48 circulates in association with chylomicrons and chylomicron residues and these particles are removed by a distinct receptor known as the LDL receptor-related protein (Davidson and Shelness, Annu. Rev. Nutr., 2000 , 20, 169-193). ApoB-48 can be considered as an adaptation

40 crucial by which dietary lipid is supplied from the small intestine to the liver, while apoB100 participates in the transport and supply of endogenous plasma cholesterol (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193).

The basis by which the common structural gene for apolipoprotein B produces two distinct protein isoforms is a process known as RNA editing. A specific site of cytosine editing reaction in uracil produces

A UAA stop codon and translation termination of apolipoprotein B to produce ApoB-48 (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193).

Apolipoprotein B was cloned in 1985 (Law et al., Proc. Natl. Acad. Sci. USA, 1985, 82, 8340-8344) and mapped to chromosome 2p23-2p24 in 1986 (Deeb et al., Proc. Natl. Acad. Sci. USA, 1986, 83, 419-422).

In U.S. Patent No. 5,786,206 discloses and claims methods and compositions for determining the level of

50 low-density lipoprotein (LDL) in plasma including isolated DNA sequences encoding regions of the apolipoprotein B-100 epitope (Smith et al., 1998).

It was found that transgenic mice expressing human apolipoprotein B and fed a high fat diet, developed high levels of cholesterol in plasma and had an 11-fold increase in atherosclerotic lesions compared to offspring of the same non-transgenic litter ( Kim and Young, J. Lipid Res.,

1998, 39, 703-723; Nishina et al., J. Lipid Res., 1990, 31, 859-869).

Furthermore, transgenic mice expressing truncated forms of apolipoprotein B have been used to identify the carboxyl terminal structural features of ApoB-100 that are necessary for interactions with apolipoprotein (a) to generate the lipoprotein particle Lp (a). and investigate structural features of the ApoB-100 LDL receptor binding region (Kim and Young, J. Lipid Res., 1998, 39, 703723; McCormick et al., J. Biol. Chem., 1997, 272 , 23616-23622).

Mice have been generated with the apolipoprotein B gene turned off (which carry alterations in both ApoB100 and ApoB-48) that are protected against the development of hypercholesterolemia when fed with a high fat diet (Farese et al., Proc Natl. Acad. Sci. USA, 1995, 92, 1774-1778; Kim and Young, J. Lipid Res., 1998, 39, 703-723). The incidence of atherosclerosis has been investigated in mice that express exclusively ApoB-100 or ApoB-48 and it was found that susceptibility to atherosclerosis depended on total cholesterol levels. The fact that mice synthesized ApoB-100 or ApoB-48 did not affect the extent of atherosclerosis, indicating that there is probably no significant difference in the intrinsic atherogenicity of ApoB-100 versus ApoB-48 (Kim and Young, J Lipid Res., 1998, 39, 703-723; Veniant et al., J. Clin. Invest., 1997, 100, 180-188).

Elevated plasma levels of Lp (a) lipoprotein containing apoB-100 are associated with an increased risk of atherosclerosis and its manifestations, which may include hypercholesterolemia (Seed et al., N. Engl. J. Med., 1990, 322 , 1494-1499), myocardial infarction (Sandkamp et al., Clin. Chem., 1990, 36, 20-23) and thrombosis (Nowak-Gottl et al., Pediatrics, 1997, 99, E11).

Plasma Lp (a) concentration is highly influenced by hereditary factors and is refractory to most drugs and diet manipulation (Katan and Beynen, Am. J. Epidemiol., 1987, 125, 387-399; Vessby et al., Atherosclerosis, 1982, 44, 61-71). Pharmacological therapy of elevated Lp (a) levels has been only moderately successful, and apheresis remains the most effective therapeutic modality (Hajjar and Nachman, Annu. Rev. Med., 1996, 47, 423-442).

In U.S. Patent No. 6,156,315 and corresponding PCT publication WO 99/18986 describe and claim a method of inhibiting LDL binding to the matrix of blood vessels in a subject, comprising administering to the subject an effective amount of an antibody or a fragment of the itself, which is capable of binding to the amino terminal region of apolipoprotein B, thereby inhibiting the binding of low-density lipoprotein to the matrix of blood vessels (Goldberg and Pillarisetti, 2000; Goldberg and Pillarisetti, 1999).

In U.S. Patent No. 6,096,516 vectors are described and claimed to contain murine recombinant antibodies encoding cDNA that binds to human ApoB-100 for the purpose of diagnosis and treatment of cardiovascular disease (Kwak et al., 2000).

In European patent application EP 911344 published on April 28, 1999 (and corresponding to US patent 6,309,844) a monoclonal antibody is specifically described and claimed that specifically binds to ApoB-48 and does not bind specifically ApoB-100, which is useful for the diagnosis and therapy of hyperlipidemia and arterial sclerosis (Uchida and Kurano, 1998).

Methods of treating a patient with a cardiovascular disorder are described and claimed in PCT publication WO 01/30354, comprising administering a therapeutically effective amount of a compound to said patient, wherein said compound acts for a period of time to reduce plasma concentrations of apolipoprotein B or lipoproteins containing apolipoprotein B stimulating a pathway of degradation of apolipoprotein B (Fisher and Williams, 2001).

In U.S. Patent No. 5,220,006 a cloned cis-acting DNA sequence that mediates suppression of atherogenic apolipoprotein B is described and claimed (Ross et al., 1993).

PCT publication WO 01/12789 describes and claims a ribozyme that cleaves ApoB-100 mRNA specifically at position 6679 (Chan et al., 2001).

Tang et al., Chinese Journal of Arteriosclerosis, 1999, 7 (4) describe experiments using antisense oligodeoxynucleotides targeting apolipoprotein B in rat liver cells.

Eggerman et al., Federal Register, 2000, 65 (110) discuss experiments using antisense oligodeoxynucleotides targeting apolipoprotein B in human liver cells.

To date, strategies aimed at inhibiting apolipoprotein B function have been limited to apheresis for Lp (a), antibodies, antibody fragments, and ribozymes. However, with the exception of Lp (a) apheresis, these research strategies have not been tested as therapeutic protocols. Accordingly, a long-standing need remains for additional agents capable of effectively inhibiting the function of apolipoprotein B.

Antisense technology is emerging as an effective means of reducing the expression of specific gene products and therefore may prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications involving modulation of apolipoprotein B expression. .

The present invention provides compositions and methods for modulating expression of apolipoprotein B, including inhibition of the alternative apolipoprotein B isoform, ApoB-48.

5 Compendium of the invention

The invention provides a 20 nucleic base long antisense oligonucleotide compound having a nucleic base sequence as set forth in SEQ ID NO: 247 and comprising 5-methylcytidine at nucleic bases 2, 3, 5, 9, 12, 15, 17, 19 and 20, where each internucleoside bond is a phosphorothioate bond, nucleic bases 1-5 and 16-20 comprise a 2'-methoxyethoxy modification, and nucleic bases 6-15 are

10 deoxynucleotides.

The invention also provides a composition comprising the antisense oligonucleotide compound of the invention and a pharmaceutically acceptable carrier or diluent.

The invention also provides the antisense oligonucleotide compound of the invention or the composition of the invention, for use in the therapy or prophylaxis of a disease.

The invention also provides the antisense oligonucleotide compound of the invention or the composition of the invention, for use in the treatment of hypercholesterolemia in a human.

The invention also provides the antisense oligonucleotide compound of the invention or the composition of the invention, for use in the treatment of cardiovascular disease, such as atherosclerosis, in a human.

The invention also provides the antisense oligonucleotide compound of the invention or the composition of the invention, for use in treating hyperlipidemia in a human.

The invention also provides the antisense oligonucleotide compound of the invention or the composition of the invention, for use in the treatment of diabetes in a human.

The invention also provides the antisense oligonucleotide compound of the invention or the composition of the invention, for use in the treatment of obesity in a human.

The invention also provides the use of the antisense oligonucleotide compound of the invention in the preparation of a medicament for treating hypercholesterolemia in a human.

The invention also provides the use of the antisense oligonucleotide compound of the invention in the preparation of a medicament for treating cardiovascular disease, such as atherosclerosis, in a human.

The invention also provides the use of the antisense oligonucleotide compound of the invention in the preparation of a medicament for treating hyperlipidemia in a human.

The invention also provides the use of the antisense oligonucleotide compound of the invention in the preparation of a medicament for treating diabetes in a human.

The invention also provides the use of the antisense oligonucleotide compound of the invention in the preparation of a medicament for treating obesity in a human.

Summary of the description

The present disclosure relates to compounds, in particular antisense oligonucleotides, that are directed to a nucleic acid encoding apolipoprotein B, and that modulate expression of apolipoprotein B. Pharmaceutical compositions and other compositions comprising the compounds of the description. In addition, methods are described for modulating the expression of apolipoprotein B in cells or tissues, which comprise contacting said cells or tissues with one or more antisense compounds or compositions of the description. In addition, methods of treating an animal, particularly a human, suspected of having or prone to having a disease or condition associated with apolipoprotein B expression, by administration of a therapeutically or prophylactically effective amount of one, are described. or more

Antisense compounds or compositions of the description.

In particular, herein is described a compound 8 to 50 nucleic bases in length targeting a nucleic acid molecule encoding apolipoprotein B, wherein said compound specifically hybridizes with and inhibits the expression of a nucleic acid molecule encoding apolipoprotein B, said compound comprising at least 8 contiguous nucleic bases of any of SEQ ID NO: 127-134, 136, 138-174, 176-317,

50 319-321, 323-333, 335-339, 341-374, 376-416, 418-500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830 , 831, 833-835, 837-839, 842, 843, and 845-854.

Also disclosed herein is a compound 8 to 50 nucleic bases in length, specifically hybridizing to at least an 8 nucleic base portion of an active site in a nucleic acid molecule encoding apolipoprotein B, said compound comprising minus 8 contiguous nuclei bases of any of SEQ ID NO: 127-134, 136, 138-174, 176-317, 319-321, 323-333, 335-339, 341-374, 376-416, 418500, 502 -510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839, 842, 843 and 845-854, said active site being a region in said nucleic acid, wherein the binding of said compound to said site significantly inhibits apolipoprotein B expression compared to a control.

Also disclosed herein is a compound 8 to 50 nucleic bases in length targeting a nucleic acid molecule encoding apolipoprotein B, wherein said compound specifically hybridizes to said nucleic acid and inhibits expression of apolipoprotein B, wherein apolipoprotein B is encoded by a polynucleotide selected from the group consisting of: (a) SEQ ID NO: 3 and (b) and a natural variant of the polynucleotide encoding apolipoprotein B that hybridizes to polynucleotide complement (a ) under stringent conditions, said compound comprising at least 8 contiguous nucleic bases of any one of SEQ ID NO: 127-134, 136, 138-174, 176-317, 319-321, 323-333, 335-339, 341 -374, 376-416, 418-500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839, 842, 843 and 845-854.

Also disclosed herein is a compound 8 to 50 nucleic bases in length targeting a nucleic acid molecule encoding apolipoprotein B, wherein said compound specifically hybridizes to said nucleic acid and inhibits expression of apolipoprotein B, wherein apolipoprotein B is encoded by a polynucleotide selected from the group consisting of SEQ ID NO: 3 and SEQ ID NO: 17, said compound comprising at least 8 contiguous nucleic bases of any one of SEQ ID NO: 127- 134, 136, 138174, 176-317, 319-321, 323-333, 335-339, 341-374, 376-416, 418-500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839 842, 843, and 845-854.

Also disclosed herein is a compound 8 to 50 nucleic bases in length targeting a nucleic acid molecule encoding apolipoprotein B, wherein said compound specifically hybridizes to an active site on said nucleic acid and inhibits the expression of apolipoprotein B, said compound comprising at least 8 contiguous nucleic bases of any of SEQ ID NO: 127-134, 136, 138-174, 176-317, 319-321, 323-333, 335-339, 341-374 , 376-416, 418-500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839, 842, 843 and 845 -854, said active site being a region in said nucleic acid, in which the binding of said compound to said site significantly inhibits the expression of apolipoprotein B compared to a control.

Also disclosed herein is an 8 to 50 nucleic base length oligonucleotide mimetic compound targeting a nucleic acid molecule encoding apolipoprotein B, wherein said compound specifically hybridizes to said nucleic acid and inhibits apolipoprotein expression. B, said compound comprising at least 8 contiguous nucleic bases of any of SEQ ID NO: 127-134, 136, 138-174, 176-317, 319-321, 323-333, 335-339, 341-374, 376 -416, 418-500, 502-510, 512-804, 815, 816, 819-821, 824, 825, 827, 828, 830, 831, 833-835, 837-839, 842, 843, and 845-854 .

Also described herein is an antisense compound 8 to 50 nucleic bases in length, wherein said compound specifically hybridizes to nucleotides 2920-3420 set forth in SEQ ID NO: 3, and inhibits the expression of the mRNA encoding the human apolipoprotein B after 16 to 24 h in at least 30%, in HepG2 cells at 80% confluence in a culture at a concentration of 150 nM. In some respects, the 8 to 50 nucleic base antisense compound in length hybridizes to nucleotides 3230-3288 set forth in SEQ ID NO: 3 and inhibits expression of the mRNA encoding human apolipoprotein B after 16 to 24 h in al minus 30%, in HepG2 cells at 80% confluence in a culture at a concentration of 150 nM. In another aspect, the compounds inhibit apolipoprotein B encoding mRNA expression by at least 50%, after 16-24 in HepG2 cells at 80% confluence at a concentration of 150 nM.

In one aspect, the compounds of the description are directed to a nucleic acid molecule encoding apolipoprotein B, wherein said compound specifically hybridizes with and inhibits the expression of the long form of apolipoprotein B, ApoB-100. In another aspect, the compounds specifically hybridize with said nucleic acid and inhibit the expression of apolipoprotein B encoding mRNA by at least 5%, in HepG2 cells at 80% confluence in culture at an optimal concentration. In yet another aspect, the compounds inhibit apolipoprotein B encoding mRNA expression by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, or at least 50%.

In another aspect, the compounds are antisense oligonucleotides, and in one aspect, the compound has a sequence comprising SEQ ID NO: 224, the antisense oligonucleotide hybridizes to a region complementary to SEQ ID NO: 224, the compound comprises SEQ ID NO: 224, the compound consists essentially of SEQ ID NO: 224 or the compound consists of SEQ ID NO: 224.

In another aspect, the compound has a sequence comprising SEQ ID NO: 247, the antisense oligonucleotide hybridizes with a complementary region to SEQ ID NO: 247, the compound comprises SEQ ID NO: 247, the compound consists essentially of SEQ ID NO: 247 or the compound consists of SEQ ID NO: 247.

In another aspect, the compound has a sequence comprising SEQ ID NO: 319, the antisense oligonucleotide hybridizes with a complementary region to SEQ ID NO: 319, the compound comprises SEQ ID NO: 319, the compound consists essentially of SEQ ID NO: 319 or the compound consists of SEQ ID NO: 319.

In one aspect, the compounds comprise at least one modified internucleoside bond, and in another aspect, the internucleoside bond is a phosphorothioate linkage.

In another aspect, the compounds comprise at least one modified sugar residue, and in one aspect, the modified sugar residue is a 2'-O-methoxyethyl sugar residue.

In another aspect, the compounds comprise at least one modified nucleic base, and in one aspect the modified nucleic base is 5-methylcytosine.

In yet another aspect, the compounds are chimeric oligonucleotides. Preferred chimeric compounds include those that have one or more phosphorothioate linkages and that further comprise 2'-methoxyethoxynucleotide wings and a 2'-deoxynucleotide 10 nucleic base gap.

In another aspect, the compounds specifically hybridize to and inhibit the expression of a nucleic acid molecule encoding an alternately spliced form of apolipoprotein B.

Compositions comprising a compound of the disclosure and a pharmaceutically acceptable carrier or diluent are also described herein. In one aspect, the composition further comprises a colloidal dispersion system, and in another aspect, the compound in the composition is an antisense oligonucleotide. In some aspects, the composition comprises an antisense compound of the disclosure hybridized to a complementary strand. Hybridization of the antisense strand can form one or more blunt ends or one or more protruding ends. In some respects, the protruding end comprises a modified base.

Also disclosed herein are methods of inhibiting the expression of apolipoprotein B in cells or tissues, which comprises contacting said cells or tissues with a compound of the disclosure such that expression of apolipoprotein B is inhibited. disclose methods of treating an animal having an apolipoprotein B-associated disease or condition, comprising administering to said animal a therapeutically or prophylactically effective amount of a compound of the disclosure, so that expression of apolipoprotein B is inhibited. different aspects, the condition is associated with abnormal lipid metabolism, the condition is associated with abnormal cholesterol metabolism, the condition is atherosclerosis, the condition is a common metabolic condition, the abnormal metabolic condition is hyperlipidemia, the disease is diabetes, diabetes is type 2 diabetes, the condition is obesity and / or the disease is a disease cardiovascular age.

Also disclosed herein are methods of modulating glucose levels in an animal comprising administering to said animal a compound of the disclosure, and in one aspect, the animal is a human. In different aspects, glucose levels are plasma glucose levels, glucose levels are serum glucose levels, and / or the animal is a diabetic animal.

Also disclosed herein are methods of preventing or delaying the onset of a disease or condition associated with apolipoprotein B in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of a compound of the disclosure. In one aspect, the animal is a human being. In other respects, the condition is an abnormal metabolic condition, the abnormal metabolic condition is hyperlipidemia, the disease is diabetes, diabetes is type 2 diabetes, the condition is obesity, the condition is atherosclerosis, the condition involves abnormal lipid metabolism, and / or the condition involves abnormal cholesterol metabolism.

Also disclosed herein are methods of preventing or delaying the onset of increased glucose levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of a compound of the disclosure. In one aspect, the animal is a human being. In other aspects, glucose levels are serum glucose levels and / or glucose levels are plasma glucose levels.

Also disclosed herein are methods of modulating serum cholesterol levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of a compound of the disclosure. In one aspect, the animal is a human being.

Also described herein are methods of modulating lipoprotein levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of a compound of the disclosure. In one aspect, the animal is a human being. In other aspects, the lipoprotein is VLDL, the lipoprotein is HDL, and / or the lipoprotein is LDL.

Also described herein are methods of modulating serum triglyceride levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of a

compound of the description. In one aspect, the animal is a human being.

Also disclosed herein is the use of a compound of the disclosure for making a medicament for the treatment of a disease or condition associated with the expression of apolipoprotein B, a medicament for the treatment of a condition associated with abnormal metabolism of lipids, a medicine to treat a condition associated with abnormal cholesterol metabolism, a medicine to treat atherosclerosis, a medicine to treat hyperlipidemia, a medicine to treat diabetes, a medicine to treat type 2 diabetes, a medicine to treat obesity, a medicine to treat cardiovascular disease, a medicine to prevent or delay the onset of increased glucose levels, a medicine to prevent or delay the onset of levels serum glucose levels, a medicine to prevent or delay the onset of leveling s increased plasma glucose, a drug to modulate serum cholesterol levels, a drug to modulate serum lipoprotein levels, a drug to modulate serum VLDL levels, a drug to modulate HDL levels in serum and / or a medicine to modulate serum LDL levels, a medicine to modulate serum triglyceride levels.

In another aspect, methods for reducing circulating lipoprotein levels are described herein, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce expression of apolipoprotein B. In another aspect, Methods for reducing lipoprotein transport are described herein, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Methods for reducing the expression of apolipoprotein B are also described herein. absorption / adsorption of lipoproteins, comprising the step of administering to an individual an amount of a compound of the description sufficient to reduce the expression of apolipoprotein B.

In another aspect, methods for reducing circulating triglyceride levels are described herein, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce expression of apolipoprotein B. Methods are also described. for reducing triglyceride transport, which comprises the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Methods for reducing the absorption / adsorption of triglycerides are also described herein. , which comprise the step of administering to an individual an amount of a compound of the description sufficient to reduce the expression of apolipoprotein B.

In another aspect, methods for reducing circulating cholesterol levels, including cholesteryl esters and / or non-esterified cholesterol, are described herein, comprising the steps of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression Methods for reducing cholesterol transport, including cholesterol esters and / or non-esterified cholesterol, are also contemplated, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Methods for reducing cholesterol absorption / adsorption, including cholesterol esters and / or non-esterified cholesterol, are also described herein, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B.

Also described herein are methods of reducing circulating lipid levels, which comprise the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Also described herein, Methods for reducing plasma lipid transport, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Also described herein are methods of reducing absorption. / lipid adsorption, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B.

Also described herein are methods of reducing dietary lipid levels, which comprise the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Also described are methods of reducing dietary lipid transport, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression, as well as methods of reducing the absorption / adsorption of dietary lipids comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression

Also described herein are methods of reducing circulating fatty acid levels, which comprise the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. They are also described herein. methods of reducing fatty acid transport, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce expression of apolipoprotein B. Methods of reducing fatty acid absorption are also contemplated, comprising the stage of administering to an individual an amount of a

compound of the description sufficient to reduce the expression of apolipoprotein B.

Also described herein are methods of reducing circulating acute phase reactants, which comprise the steps of administering to an individual an amount of a compound of the disclosure sufficient to reduce expression of apolipoprotein B. In another aspect, they are described in The present specification methods to reduce the transport of acute phase reactants, comprising the steps of administering to an individual an amount of a compound of the description sufficient to reduce the expression of apolipoprotein B, as well as methods to reduce the absorption of reactants from acute phase comprising the steps of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression

Also disclosed herein are methods of reducing circulating chylomicrons comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression, methods of reducing chylomicron transport comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression, and methods of reducing the absorption of chylomicrons comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein expression

B.

Also disclosed herein are methods of reducing circulating chylomicron remanufactured particles comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression, methods of reducing the transport of remnants of chylomicrons comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression, and methods of reducing the absorption of chylomicron remnants comprising the step of administering to an individual an amount of a compound of the description sufficient to reduce the expression of apolipoprotein B.

Also disclosed herein are methods of reducing circulating VLDL, LDL, LDL, and / or HDL, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B. Similarly, methods for reducing VLDL, LDL, LDL and / or HDL transport are described herein, comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce apolipoprotein B expression, in addition to methods to reduce the absorption of VLDL, IDL, LDL and / or HDL comprising the step of administering to an individual an amount of a compound of the description sufficient to reduce the expression of apolipoprotein B.

In yet another aspect, methods of treating a condition associated with apolipoprotein B expression are described herein which comprise the step of administering to an individual an amount of a compound of the disclosure sufficient to reduce the expression of apolipoprotein B, selected said condition of hyperlipoproteinemia, type 3 familial hyperlipoproteinemia (familial dysbetalipoproteinemia), and familial hyperalfalipoproteinemia; hyperlipidemia, mixed hyperlipidemias, multiple lipoprotein-type hyperlipidemia, and familial combined hyperlipidemia; hypertriglyceridemia, familial hypertriglyceridemia, and familial lipoprotein lipase; hypercholesterolemia, familial hypercholesterolemia, polygenic hypercholesterolemia, and familial defective apolipoprotein B; cardiovascular disorders including atherosclerosis and coronary artery disease; peripheral vascular disease; von Gierke's disease (glycogen storage disease, type I); lipodystrophies (congenital and acquired forms); Cushing's syndrome; sexual ateliotic dwarfism (isolated growth hormone deficiency); Mellitus diabetes; hyperthyroidism; hypertension; anorexia nervosa; Werner's syndrome; acute intermittent porphyria; primary biliary cirrhosis; extrahepatic biliary obstruction; acute hepatitis; hepatoma; systemic lupus erythematosus; monoclonal gammopathies (including myeloma, multiple myeloma, macroglobulinemia, and lymphoma); endocrinopathies; obesity; nephrotic syndrome; metabolic syndrome; inflammation; hypothyroidism; uremia (hyperuricemia); impotence; obstructive liver disease; idiopathic hypercalcemia; dysglobulinemia; elevated insulin levels; syndrome X; Dupuytren's contracture; and Alzheimer's disease and dementia.

Also disclosed herein are methods of reducing the risk of a condition comprising the steps of administering to an individual an amount of a compound of the disclosure sufficient to inhibit apolipoprotein B expression, selected from said pregnancy condition; intermittent claudication; gout; and mercury toxicity disease and amalgam.

Also disclosed herein are methods of inhibiting the binding of cholesterol particles to the vascular endothelium comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to inhibit apolipoprotein B expression, and as a result also describe herein methods to reduce the risk of: (i) oxidation of cholesterol particles; (ii) binding of monocytes to the vascular endothelium; (iii) differentiation of monocytes into macrophages; (iv) macrophage ingestion of oxidized lipid particles and cytokine release (including, but not limited to, IL-1, TNF-alpha, TGF-beta); (v) platelet formation of fibrous fibrous fat lesions and inflammation; (vi) endothelial lesions that lead to clots; and (vii) clots leading to myocardial infarction or stroke, which also comprise the steps of administering to an individual an amount of a compound of the disclosure sufficient to inhibit the expression of apolipoprotein B.

Also described herein are methods of reducing hyperlipidemia associated with alcoholism, tobacco, use of oral contraceptives, use of glucocorticoids, use of beta-adrenergic blocking agents, or use of isotretinoin (13-cis-retinoic acid) comprising the step of administering to an individual an amount of a compound of the disclosure sufficient to inhibit apolipoprotein B expression

Also described herein is an antisense oligonucleotide compound 8 to 50 nucleic bases in length comprising at least 8 contiguous nucleotides of SEQ ID NO: 247 and having a length of at least 12 or at least 14 to 30 bases nucleic.

The invention provides a 20 nucleic base long antisense oligonucleotide compound having a nucleic base sequence as set forth in SEQ ID NO: 247 and comprising 5-methylcytidine at nucleic bases 2, 3, 5, 9, 12, 15, 17, 19 and 20, where each internucleoside bond is a phosphorothioate bond, nucleic bases 1-5 and 16-20 comprise a 2'-methoxyethoxy modification, and nucleic bases 6-15 are deoxynucleotides.

Also described herein is a compound comprising a first strand of nucleic bases, 8 to 50 nucleic bases in length and comprising a sequence of at least 8 contiguous nucleic bases from the sequence set forth in SEQ ID NO: 3, hybridized with a second nucleic base chain, 8 to 50 nucleic bases in length, and comprising a sequence sufficiently complementary to the first one each to allow stable hybridization, said compound inhibiting the expression of the mRNA encoding apolipoprotein B after 16 to 24 h, at least 30% or at least 50%, in HepG2 cells at 80% confluence in cultures at a concentration of 100 nM.

Further disclosed is a vesicle, such as a liposome, comprising a compound or composition of the disclosure.

Preferred methods of administering the compounds or compositions of the disclosure to an animal are intravenous, subcutaneous, or oral. Administration can be repeated.

Also disclosed herein is a method of reducing hepatocyte secretion of lipoprotein (a), comprising (a) contacting hepatocytes with an amount of a composition comprising a non-catalytic compound of 8 to 50 nucleic bases in length that specifically hybridizes to the mRNA encoding human apolipoprotein B and inhibits mRNA expression after 16 to 24 h, at least 30% or at least 50%, in HepG2 cells at 80% confluence in cultures in a 150 nM concentration, in which at least said amount is effective to inhibit the expression of apolipoprotein B in hepatocytes; and (b) measure the secretion of lipoprotein (a) by hepatocytes.

Also disclosed herein is a method of treating a condition associated with the expression of apolipoprotein B in a primate, such as a human, which comprises administering to the primate a therapeutically or prophylactically effective amount of a non-catalytic compound of 8 to 50 nucleic bases in length that hybridizes specifically to the mRNA encoding human apolipoprotein B and inhibits mRNA expression after 16 to 24 h, at least 30% or at least 50%, in HepG2 cells at 80% confluence in cultures at a concentration of 150 nM.

Also described herein is a method of reducing the expression of apolipoprotein B in the liver of an animal, which comprises administering to the animal between 2 mg / kg and 20 mg / kg of a non-catalytic compound from 8 to 50 nucleic bases. in length that hybridizes specifically to the mRNA encoding human apolipoprotein B by at least 30% or at least 50%, in HepG2 cells at 80% confluence in cultures at a concentration of 150 nM.

Also disclosed is a method of making a compound of the disclosure comprising specifically hybridizing a first nucleic base chain in vitro comprising a sequence of at least 8 contiguous nucleic bases of the sequence set forth in SEQ ID NO: 3 with a second chain nucleic base comprising a sequence sufficiently complementary to said first strand so as to allow stable hybridization.

Also described herein is the use of a compound of the disclosure in the manufacture of a medicament for the treatment of each and every condition described herein.

Detailed description of the invention

The present invention uses oligomeric compounds, specifically antisense oligonucleotides, for use in modulating the function of nucleic acid molecules encoding apolipoprotein B, ultimately modulating the amount of apolipoprotein B produced. This is accomplished by providing antisense compounds that specifically hybridize to one or more nucleic acids encoding apolipoprotein B. As used herein, the terms "target nucleic acid" and "nucleic acid encoding apolipoprotein B" encompass DNA encoding apolipoprotein B, RNA (including pre-mRNA and mRNA) transcribed from said DNA, and also cDNA derived from said RNA. The specific hybridization of an oligomeric compound with a target nucleic acid interferes with the normal function of the nucleic acid. This modulation of the function of a target nucleic acid by compounds with which it specifically hybridizes is called "antisense." The DNA functions to be interfered with include replication and transcription. The functions of the RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the protein translation site,

5 translation of proteins from RNA, splicing of RNA to give one or more species of mRNA, and catalytic activity in which RNA may be involved or facilitated. The overall effect of such interference with target nucleic acid function is modulation of apolipoprotein B expression. In the context of the present invention, "modulation" means an increase (stimulation) or decrease (inhibition) of expression of a gene. In the context of the present invention, inhibition is the preferred form of modulation of gene expression and mRNA is a preferred target.

Targeting specific nucleic acids is preferred for the antisense procedure. "Targeting" an antisense compound to a particular nucleic acid, in the context of this invention, is a multi-step procedure. The procedure normally begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule of an infectious agent. In the present invention, the target is a nucleic acid molecule that encodes apolipoprotein B. The targeting process also includes determining a site or sites in this gene for antisense interaction to occur so that the desired effect results, e.g. eg, detection or modulation of protein expression. In the context of the present description, a preferred intragenic site is the region spanning the translation start or stop codon of the gene's open reading frame (ORF). Since the translation start codon is typically known in the art as 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation start codon is also called "AUG codon", the "start codon" or the "AUG start codon". A minority of genes have a translation start codon that has the 5'-GUG, 5'-UUG or 5'-CUG RNA sequence, and it has been shown that 5'-AUA, 5'-ACG and 5 ' -CUG works in vivo. Therefore, the terms "translation start codon" and "start codon" can encompass many codon sequences, even though the initiator amino acid in each case is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes can have two or more alternative start codons, either of which can preferably be used for translation initiation in a particular cell or tissue type, or in a particular set of conditions. In the context of the invention, "start codon" and "translation start codon" refers to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding the apolipoprotein B, regardless of the

or the sequences of said codons.

It is also known in the art, that a translation stop codon (or "stop codon") of a gene can have one of three sequences, ie 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences

35 are 5'-TAA, 5'-TAG and 5'-TGA, respectively). The terms "start codon region" and "translation start codon region" refer to a part of said mRNA or gene spanning from about 25 to about 50 contiguous nucleotides in either direction (ie 5 ' or 3 ') from a translation start codon. Similarly, the terms "stop codon region" and "translation stop codon region" refer to a part of said mRNA or gene that spans from about 25 to about 50 contiguous nucleotides in either direction (is say 5 'or 3') from a translation stop codon.

The open reading frame (ORF) or "coding region", which is known in the art to refer to the region between the translation start codon and the translation stop codon, is also a region that can be a target region efficiently. Other target regions include the 5 'untranslated region (5'UTR), which is known in the

A technique that refers to the part of an mRNA in the 5 'direction from the translation start codon, and therefore includes the nucleotides between the 5' cap site and the translation start codon of a MRNA or the corresponding nucleotides in the gene, and the 3 'untranslated region (3'UTR) known in the art that refers to the part of an mRNA in the 3' direction from the translational stop codon, and therefore includes nucleotides between the translation termination codon and the 3 'end of an mRNA or the corresponding nucleotides in the gene. The 5 'cap of an mRNA comprises an N7-methylated guanosine residue linked to the 5' most extreme residue of the mRNA via a 5'-5'-triphosphate bond The 5 'cap region of an mRNA is considered to include the structure itself of the 5 'cap as well as the first 50 nucleotides adjacent to the cap. The 5 'cap region may also be a preferred target region.

Although some eukaryotic mRNAs are translated directly, many contain one or more regions, known

55 as "introns" that are cleaved from a transcript before being translated. The rest of the regions (and therefore translated) are known as "exons" and are spliced together to form a continuous mRNA sequence. MRNA splice sites, i.e., intron-exon junctions, may also be preferred target regions, and are particularly useful in situations where aberrant splicing is involved in disease, or when excess disease is involved in disease of production of a particular mRNA splicing product. Aberrant fusion junctions due to rearrangements or deletions are also preferred targets. It has also been found that introns can also be effective, and therefore preferred, target regions for antisense compounds targeting, for example, DNA or pre-mRNA.

One or more target sites have been identified, and oligonucleotides that are sufficiently complementary to the target, that is, hybridize well enough and with sufficient specificity, are chosen to give the desired effect.

In the context of this invention, "hybridization" means hydrogen bond, which may be Watson-Crick, Hoogsteen or reverse Hoogsteen hydrogen bond. For example, adenine and thymine are complementary nucleic bases that mate by forming hydrogen bonds. "Complementary," as used herein, refers to the ability for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of forming a hydrogen bond with a nucleotide at the same position of a DNA or RNA molecule, then the nucleotide and DNA are considered

or RNAs are complementary to each other in that position. The oligonucleotide and DNA or RNA are complementary between

10 yes when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can form hydrogen bonds with each other. Therefore, "specifically capable of hybridizing" and "complementary" are terms used to indicate a sufficient degree of complementarity or precise pairing so that a specific and stable binding occurs between the oligonucleotides and the target DNA or RNA. It is understood in the art that the sequence of an antisense compound need not be 100%.

15 complementary to that of its target nucleic acid so that it can specifically hybridize. An antisense compound can specifically hybridize when the compound's binding to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause loss of utility, and there is a sufficient degree of complementarity to prevent nonspecific binding of the antisense compound to non-target sequences under conditions where specific binding is desired, i.e. under physiological conditions in the case of

20 in vivo tests or therapeutic treatment, and in the case of in vitro tests, under conditions in which the tests are carried out.

Antisense compounds and other compounds of the invention that hybridize to the target and inhibit expression of the target, are identified by experimentation, and the sequences of these compounds are hereinafter identified as preferred embodiments of the invention. The target sites from which these preferred sequences are

Complementary sites are hereinafter referred to as "active sites" and are therefore preferred sites for use as targets. Therefore, another embodiment of the invention encompasses compounds that hybridize to these active sites.

Antisense compounds are normally used as research and diagnostic reagents. For example, antisense oligonucleotides that are capable of inhibiting gene expression with exquisite specificity are often used by those skilled in the art to elucidate the function of particular genes. Antisense compounds

30 are also used, for example, to distinguish between functions of different members of a biological pathway. Therefore, antisense modulation has been exploited for research use.

For use in kits and in diagnostics, the antisense compounds of the present invention, alone or in combination with other antisense compounds or therapeutic compounds, can be used as tools in differential and / or combinatorial analysis to elucidate expression patterns of a part or the integer complement of expressed genes

35 in cells and tissues.

Expression patterns in cells or tissues treated with one or more antisense compounds are compared with control cells or tissues not treated with antisense compounds and the different levels of gene expression in the patterns produced are analyzed for, for example, to the association with the disease, signaling route, cellular location, level of expression, size, structure or function of the examined genes. The

Analysis can be carried out on stimulated or non-stimulated cells and in the presence or absence of other compounds that affect expression patterns.

Examples of gene expression analysis methods known in the art include DNA matrices and microarrays (Brazma and Vilo, FEBS Lett., 2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480 , 2-16), SAGE (serial analysis of gene expression) (Madden, et al., Drug Discov. Today, 2000, 5, 415-425), READS (amplification with 45 digested cDNA restriction enzymes) ( Prashar and Weissman, Methods Enzymol., 1999, 303, 258-72), TOGA (analysis of total gene expression) (Sutcliffe, et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 1976-81) , protein matrices and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16; Jungblut, et al., Electrophoresis, 1999, 20, 210010), expressed sequence marker sequencing (EST) ( Celis, et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57), subtractive RNA fingerprint (SuRF) (Fuchs, et al., Anal. Biochem.,

50 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41, 203-208), subtractive cloning, differential presentation (DD) (Jurecic and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative genomic hybridization ( Carulli, et al., J. Cell Biochem. Suppl., 1998, 31, 286-96), FISH techniques (fluorescent in situ hybridization) (Going and Gusterson, Eur. J. Cancer, 1999, 35, 1895-904 ) and mass spectrometry methods (reviewed in To, Comb. Chem. High Throughput Screen, 2000, 3, 235-41).

55 The specificity and sensitivity of the antisense compound is also exploited by those skilled in the art for therapeutic uses. Antisense oligonucleotides have been used as therapeutic residues in the treatment of disease states in animals and man. Antisense oligonucleotide drugs, including ribozymes, have been safely and effectively administered to humans and numerous clinical trials are currently underway. Therefore, it is established that oligonucleotides may be useful therapeutic modalities that are

60 can be configured to be useful in treatment regimens for the treatment of cells, tissues and animals, especially humans.

In the context of this invention, the term "oligonucleotide" refers to an oligomer or a polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. Therefore, this term includes oligonucleotides composed of naturally occurring nucleic bases, sugars, and internucleoside linkages.

5 covalent (main chain) (RNA and DNA), as well as oligonucleotides that have similarly acting, non-naturally occurring portions (oligonucleotide mimetics). Oligonucleotide mimetics are often preferred over natural forms because of desirable properties such as, for example, increased cell uptake, increased affinity for target nucleic acid, and increased stability in the presence of nucleases.

Although antisense oligonucleotides are a preferred form of antisense compound, the present description

10 includes other antisense oligomeric compounds, including, but not limited to, oligonucleotide mimetics as described below. Antisense compounds according to this disclosure comprise from about 8 to about 50 nucleic bases (ie, from about 8 to about 50 bound nucleosides). Particularly preferred antisense compounds are antisense oligonucleotides, even more preferably those comprising from about 12, about 14, about

15 20 to about 30 nucleic bases. Antisense compounds include ribozymes, external guide sequence oligonucleotides (EGS) (oligozymes), and other short catalytic RNAs or catalytic oligonucleotides that hybridize to the target nucleic acid and modulate its expression. In preferred embodiments, the antisense compound is a non-catalytic oligonucleotide, that is, it does not depend on a catalytic property of the oligonucleotide for its modulating activity. The antisense compounds of the invention can include double-stranded molecules in which a

The first chain is stably hybridized with a second chain.

As known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are purines and pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently attached to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group may be attached to the 2 ', 3' or 5 'hydroxyl moiety of the sugar. In oligonucleotide formation, phosphate groups covalently link nucleosides together, to form a linear polymeric compound. In turn, the respective ends of this linear polymeric structure can further be joined to form a circular structure, however open linear structures are generally preferred. Within the structure of the oligonucleotide, phosphate groups are commonly known as those that form the main chain

30 of oligonucleotide internucleosides. The normal link or backbone of RNA and DNA is a 3 'to 5' phosphodiester bond.

Specific examples of antisense compounds useful in this invention include oligonucleotides containing modified backbones or unnatural internucleoside linkages. As defined in this specification, oligonucleotides that have modified backbones include those that retain a

35 phosphorus atom in the main chain and those without a phosphorus atom in the main chain. For the purposes of this specification, and sometimes for reference in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone, can also be considered oligonucleosides.

Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl phosphonates and other 40 alkyls including 3'-alkylene phosphonates, 5'-alkylene phosphonates, and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino-phosphoramidate and aminoalkyl phosphoramidates, thionophosphoramidates, thionoalkyl phosphonates, thionoalkyl phosphotristers, selenophosphates and boranophosphates that have normal 3'-5 'linkages, and those in reverse polarity that one or more internucleotide linkages is a 3 'to 3', 5 'to 5' or 2 'to 2' link. Preferred oligonucleotides having reverse polarity comprise a

Single 3 'to 3' bond at the most 3 'internucleotide bond, ie a single reverse nucleoside residue that may be baseless (the nucleic base is absent or has a hydroxyl group in place). Also included are different salts, mixed salts, or forms of free acid.

Representative United States patents teaching the preparation of the above phosphorous-containing bonds include, without limitation, US Patents: 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196;

50 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050.

Modified oligonucleotide backbones that do not include a phosphorous atom therein have backbones that consist of internucleoside linkages of short-chain alkyl or cycloalkyl, 55 internucleoside linkages of mixed or cycloalkyl heteroatoms, or one or more heteroatomic internucleoside linkages of short chain or heterocyclic. These include those that have morpholino linkages (formed in part of the sugar part of a nucleoside); siloxane backbones; main chains of sulfide, sulfoxide and sulfone; formacetyl and thioformacetyl backbones; methyleneformacetyl and thioformacetyl backbones; riboacetyl backbones; alkene-containing backbones; sulfamate backbones; 60 methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; chains

amide principals; and others that have parts with mixed N, O, S, and CH2 components.

Representative United States patents that teach the preparation of the above oligonucleosides include, without limitation, US Patents: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;

5 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439.

In other preferred oligonucleotide mimetics, both the sugar and the internucleoside link, ie, the backbone, of the nucleotide units are replaced by new groups. Base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomer compound, an oligonucleotide mimetic which has been shown to have excellent hybridization properties, is called a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an oligonucleotide is replaced with an amide-containing backbone, in particular an aminoethylglycine backbone. Nucleic bases are conserved and attached directly or indirectly to nitrogen atoms in the amide part of the main chain. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, US Patents: 5,539,082; 5,714,331; and

5,719,262. Additional teachings of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.

The most preferred embodiments of the invention are phosphorothioate backbone oligonucleotides and heteroatom backbone oligonucleosides, and in particular -CH2-NH-O-CH2-, -CH2-N (CH3) -O-CH2

20 [known as methylene (methylimino) backbone or MMI], -CH2-ON (CH3) -CH2-, -CH2-N (CH3) -N (CH3) -CH2- and ON (CH3) -CH2-CH2 - [in which the natural phosphodiester backbone is represented as -OPO-CH2-] in US Pat. cited above 5,489,677, and the amide backbones of US Pat. previously cited 5,602,240. Oligonucleotides having morpholino backbone structures of US Pat. cited above 5,034,506.

The modified oligonucleotides can also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2 'position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, where the alkyl, alkenyl and alkynyl can be C1 to C10 alkyl or substituted or unsubstituted C2 to C10 alkenyl and alkynyl. O [(CH2) nO] mCH3, O (CH2) nOCH3, O (CH2) nNH2, O (CH2) nCH3, O (CH2) nONH2, and O (CH2) nON [(CH2) nCH3)] are particularly preferred. 2, in which n and m are

About 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2 'position: C1-C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or Oaralkyl, SH, SCH3, OCN , Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an indicator group, an intercalant, a group to improve the pharmacokinetic properties of an oligonucleotide, or a group

35 to improve the pharmacodynamic properties of an oligonucleotide, and other substituents that have similar properties. A preferred modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O- (2methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486 -504) ie, an alkoxyalkoxy group. A further preferred modification includes 2'-dimethylaminooxyethoxy, i.e. an O (CH2) 2ON (CH3) 2 group, also known as 2'-DMAOE, as described in the examples below, and 2'-dimethylaminoethoxyethoxy (also

Known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e. 2'-O-CH2-O-CH2-N (CH2) 2, also described in the examples below.

A further preferred modification includes blocked nucleic acids (LNA) in which the 2'-hydroxyl group is attached to the 3 'or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene (-CH2-) n group that bridges the 2 'oxygen atom and the

The 4 'carbon where n is 1 or 2. LNAs and their preparation are described in WO 98/39352 and WO 99/14226.

Other preferred modifications include 2'-methoxy (2'-O-CH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), 2'-allyl (2'-CH2-CH = CH2), 2'-O-allyl ( 2'-O-CH2-CH = CH2) and 2'-fluoro (2'-F). The 2 'modification may be in the arabino (top) position or the ribo (bottom) position. A preferred 2'-arabino modification is 2'-F. Similar modifications can also be made at other positions on the oligonucleotide, particularly at the 3 'position of the sugar at the 3' terminal nucleotide or at the 2'-5 'linked oligonucleotides and the 5' position of the 5 'terminal nucleotide. Oligonucleotides can also have sugar mimetics such as cyclobutyl residues instead of pentafuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, US Patents: 4,981,957; 5,118,800; 5,319,080;

55 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920.

Oligonucleotides can also include nucleic base modifications or substitutions (often referred to in the art simply as "bases"). As used herein, "unmodified" or "natural" nucleic bases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleic bases include other natural or synthetic nucleic bases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl-cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, derivatives 2 -propyl and other alkyls of adenine and guanine, 2-thiouracil, 2-thiothimine and 2-thiocytosine, 5-halogenouracil and cytosine, 5-propynyl (-C≡C-CH3) derivatives of uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo-uracil, cytosine, and thymine, 55 uracil (pseudouracil), 4-thiouracil, 8-halogen, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines , 5-halogen in particular 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7- desazaguanine and 7desazaadenine and 3-deaazaguanine and 3-deazaadenine. Additional modified nucleic bases include tricyclic pyrimidines such as phenoxazine-cytidine (1H-pyrimido [5.4-b] [1,4] benzoxazin-2 (3H) -one), phenothiazinacytidine (1H-pyrimido [5.4-b ] [1,4] benzothiazin-2 (3H) -one), G forceps such as a substituted phenoxazine-cytidine (eg 9- (2-aminoethoxy) -H-pyrimido [5,4-b] [1 , 4] benzoxazin-2 (3H) -one), carbazol-cytidine (2H-pyrimido [4,5-b] indole-2-one), pyridoindol-cytidine (H-pyrido [3 ', 2': 4, 5] pyrrolo [2,3-d] pyrimidin-2-one). Modified nucleic bases can also include those in which the puric or pyrimidine base is replaced by other heterocycles, for example, 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Additional nucleic acids include those described in US Pat. No. 3,687,808, those described in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those described by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those described by Sanghvi, YS, Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., ed., CRC Press, 1993. Some of these nucleic bases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase duplex nucleic acid stability by 0.6-1.2 ° C (Sanghvi, YS, Crooke, ST and Lebleu, B., eds., Antisense Research and Applications, CRC Press , Boca Raton, 1993, pp. 276-278) and are currently the preferred base substitutions, even more particularly when combined with 2'-O modifications

25 methoxyethyl in sugar.

Representative United States patents that teach the preparation of the nucleic bases indicated above, as well as other modified nucleic bases include, but are not limited to, US Pat. 3,687,808 indicated above, as well as US Patents: 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121. 5,596,091. 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, and U.S. Patent 5,750,692.

Another modification of the oligonucleotides of the invention involves chemical binding to the oligonucleotide of one or more residues or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. The compounds of the invention can include conjugated groups covalently linked to functional groups such as primary or secondary hydroxyl groups. The conjugated groups of the invention include intercalating, 35 reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of the oligomers, and groups that enhance the pharmacokinetic properties of the oligomers. Typical conjugated groups include cholesterol, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance pharmacodynamic properties, in the context of this invention, include groups that enhance oligomer uptake, enhance resistance of oligomers to degradation, and / or enhance sequence-specific hybridization to RNA. Groups that enhance pharmacokinetic properties, in the context of this invention, include groups that enhance oligomer uptake, distribution, metabolism, or excretion. Representative conjugated groups are described in international patent application PCT / US92 / 09196, filed October 23, 1992. Conjugated residues include, but are not limited to, lipid residues such as a cholesterol residue (Letsinger et 45 al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, p. eg, hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765- 2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g. eg, dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie , 1993, 75, 49-54), a phospholipid, e.g. eg, di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycerol-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane-acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl residue (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylaminocarbonyl- residue. oxycholesterol (Crooke

55 et al., J. Pharmacol. Exp. Ther. , 1996, 277, 923-937). The oligonucleotides of the invention can also be conjugated with substances that are active drugs, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S) - (+) - pranoprofen, carprofen, dansylsarcosine, acid 2, 3,5-triiodobenzoic, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicine, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in US patent application 09 / 334,130 (filed June 15, 1999).

Representative United States patents that teach the preparation of such oligonucleotide conjugates include, without limitation, US Patents: 4,828,979; 4,948,882; 5,218,105; 5,525,465;

5,541,313; 5,545,730; 5,552,538; 5,578,717. 5,580,731. 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241. 5,391,723.

5,416,203. 5,451,463. 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.

It is not necessary that all positions in a given compound be uniformly modified, and more than one of the aforementioned modifications can be incorporated into a single compound or even a single nucleoside in an oligonucleotide. The present invention also includes antisense compounds that are chimeric compounds. In the context of this invention, "chimeric" or "chimera" antisense compounds are antisense compounds, in particular oligonucleotides, that contain two or more chemically distinct regions, each consisting of at least one monomer unit, that is, a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region in which the oligonucleotide is modified so that it gives the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity for nucleic acid. Diana. An additional region of the oligonucleotide can serve as a substrate for enzymes capable of cleaving RNA: DNA or RNA: RNA hybrids. As an example, RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA: DNA duplex. Therefore, activation of RNase H results in cleavage of the target RNA, thereby greatly enhancing the efficacy of inhibition of gene expression by the oligonucleotide. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to deoxyoligonucleotide phosphorothioates that hybridize to the same target region. Cleavage of the target RNA can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

The chimeric antisense compounds of the invention can be formed as structures consisting of two or more oligonucleotides, modified oligonucleotides, oligonucleosides, and / or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gammers. Representative United States patent documents that describe the preparation of such hybrid structures include, but are not limited to: 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922.

Antisense compounds used in accordance with this invention can be conveniently and routinely prepared by the well-known technique of solid phase synthesis. Equipment for such synthesis can be obtained from various vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may be used additionally or alternatively. The use of similar techniques to prepare oligonucleotides such as phosphorothioates and alkylated derivatives is well known.

The antisense compounds of the invention are synthesized in vitro and do not include compositions of biologically derived antisense compounds, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.

The compounds of the invention may also be mixed, encapsulated, conjugated, or otherwise associated with other molecules, molecule structures, or mixtures of compounds, such as, for example, liposomes, receptor-directed molecules, oral, rectal, and topical formulations. or others, to help the capture, distribution and / or absorption. Representative United States patents that teach the preparation of such uptake, distribution and / or absorption aids include, but are not limited to, US Patents: 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756.

The antisense compounds of the invention encompass any salt, ester or salt of said ester or any other pharmaceutically acceptable compound, which upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or rest of it. Accordingly, for example, the description also discloses prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of said prodrugs, and other bioequivalents.

The term "prodrug" indicates a therapeutic agent that is prepared in an inactive form and that is converted to an active form (ie, drug) within the body, or its cells, by the action of endogenous enzymes or other chemicals, and / or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods described in WO 93/24510 of Gosselin et al., published December 9, 1993 or in WO 94/26764 and US 5,770,713 to Imbach et al.

The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: that is, salts that retain the desired biological activity of the original compound and do not confer undesired toxicological effects thereto.

Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium, and the like. Examples of suitable amines are N, N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, eg, Berge et 5 al., "Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19). The base addition salts of such acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional way. The free acid form can be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional way. The free acid forms differ somewhat from their respective salt forms in some physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acids for the purposes of the present invention. As used herein, a "pharmaceutically added salt" includes a pharmaceutically acceptable salt of an acidic form of one of the components of the compositions of the invention. These include organic and inorganic acid salts of the amines. Preferred acid salts are hydrochlorides, acetates, salicylates, nitrates, and phosphates. Other pharmaceutically acceptable salts are well known to those skilled in the art, and include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as, for example, hydrochloric acid, hydrobromic acid, acid sulfuric or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids, or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, acid lactic, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, enbonic acid, nicotinic acid

or isonicotinic acid; with amino acids, such as the 20 alpha-amino acids involved in the synthesis of proteins in nature, for example glutamic acid or aspartic acid, and also phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, ethane-1,2 acid -disulfonic, benzenesulfonic acid, acid 4

25 methylbenzenesulfonic, naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or 3-phosphoroglycerate, glucose6-phosphate, N-cyclohexylsulfamic acid (with the formation of cyclamates), or with other acidic organic compounds, such as ascorbic acid. The pharmaceutically acceptable salts of the compounds can also be prepared with a pharmaceutically acceptable cation. Pharmaceutically acceptable cations are well known to those skilled in the art, and include alkali, alkaline earth, ammonium, and quaternary ammonium cations. Carbonates and hydrogencarbonates are also possible.

For oligonucleotides, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, calcium, magnesium, polyamines such as spermine and spermidine, etc .; (b) acid addition salts formed with inorganic acids, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like; (c) salts formed with

Organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid , polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, ptoluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine.

The antisense compounds of the present invention can be used for diagnosis, therapeutic, prophylactic treatment and as reagents and research kits. For therapeutic treatments, an animal, preferably a human who is suspected of having a disease or disorder that can be treated by modulation of apolipoprotein B expression, is treated by administration of antisense compounds in accordance with this invention. The compounds of the invention can be used in pharmaceutical compositions by adding an amount

Effectiveness of an antisense compound to a suitable pharmaceutically acceptable diluent or vehicle. The use of antisense compounds and the methods of the invention may also be useful prophylactically, e.g. eg, to prevent or delay infection, inflammation, or tumor formation, for example.

The antisense compounds of the invention are useful for research and diagnosis, because these compounds hybridize to nucleic acids encoding apolipoprotein B, making it possible to easily construct sandwich-type assays and other assays to exploit this fact. Hybridization of the antisense oligonucleotides of this invention with a nucleic acid encoding apolipoprotein B can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide, or any other suitable detection means. Kits can also be prepared using such detection means to detect the level of apolipoprotein B in a sample.

The present invention also includes pharmaceutical compositions and formulations including antisense compounds of the invention. The pharmaceutical compositions of the present invention can be administered in a number of ways depending on whether local or systemic treatment is desired and the area to be treated. Administration can be topical (including ophthalmic and on mucous membranes including vaginal and rectal delivery), pulmonary, e.g. eg, by inhalation or insufflation of powders or aerosols, including with nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraaerterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; or intracranial administration, e.g. eg, intrathecal

or intraventricular. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration.

Pharmaceutical compositions and formulations for topical administration may include intradermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powdered or oily bases, thickeners, and the like may be necessary or convenient. Coated condoms, gloves, and the like may also be useful. Typical 5 preferred formulations include those in which the oligonucleotides of the invention are mixed with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Preferred lipids and liposomes include neutrals (eg, dioleoylphosphatidylethanolamine DOPE, dimethystoylphosphatidylcholine DMPC, distearoylphosphatidylcholine), negative (eg, dimethylaphosphatidyl-dimethylaphylotropyl-diolethyl-ethoyl-ylothioyl-diolyl-diolethylatropyloyl-diolethylpyrolyl)), and cationic (eg. . The oligonucleotides of the invention can be encapsulated in liposomes or complexed therewith, in particular with cationic liposomes. Alternatively, the oligonucleotides can complex with lipids, in particular with cationic lipids. Preferred fatty acids and esters include, but are not limited to, arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein , dilaurin, glyceryl-1

Monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C1-10 alkyl ester (eg isopropyl myristate IPM), monoglyceride, diglycerol or its pharmaceutically acceptable salts. Topical formulations are described in detail in US Patent Application 09 / 315,298 filed on May 20, 1999.

Compositions and formulations for oral administration include powders or granules, microparticles, nanoparticles, suspensions or solutions in water or non-aqueous medium, capsules, gel capsules, sachets, tablets or mini-tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids, or binders may be convenient. Preferred oral formulations are those in which the oligonucleotides of the invention are administered in conjunction with one or more penetration enhancing or chelating surfactants. Preferred surfactants include fatty acids and / or esters or their salts, bile acids 25 and / or their salts. Preferred bile acids / salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocolic acid, deoxycholic acid, glycolic acid, glycolic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, tauro-24,25-dihydro -sodium fusidate, sodium glycidihydrofusidate. Preferred fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capic acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, 1-monocaprate of glyceryl, 1-dodecylazacycloheptan-2one, an acylcarnitine, an acylcholine, or a pharmaceutically acceptable monoglyceride, diglyceride, or one of its salts (eg, sodium). Combinations of penetration enhancers are also preferred, eg, fatty acids / salts in combination with bile acids / salts. A particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA. Other penetration enhancers include polyoxyethylene-9 ether.

Lauryl, polyoxyethylene-20-cetyl ether. The oligonucleotides of the invention can be delivered orally in granular form including spray-dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents include:

polyamino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxetanes, polyalkylcyanoacrylates; cationised jellies, albumins, starches, acrylates, polyethylene glycols (PEG) and starches; polyalkylcyanoacrylates; polyimines derivatized with DEAE, pullulans, cellulose and starches. Particularly preferred complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P (TDAE), polyaminostyrene (eg p-amino), poly (cyanoacrylate) poly (ethyl cyanoacrylate), poly (butyl cyanoacrylate), poly (isobutyl cyanoacrylate), poly (isohexyl cyanoacrylate), DEAE methacrylate, DEAE hexy acrylamide, DEAE-albumin and DEAE-DEAE

Polymethylacrylate, polyhexylacrylate, poly (D, L-lactic acid), poly (DL-lactic-co-glycolic acid) (PLGA), alginate, and polyethylene glycol (PEG). Other oral formulations for oligonucleotides and their preparation are described in detail in U.S. Applications 08 / 886,829 (filed July 1, 1997), 09 / 108,673 (filed July 1, 1998), 09 / 256,515 (filed February 23, 1999), 09 / 082,624 (filed May 21, 1998) and 09 / 315,298 (filed May 20, 1999).

Compositions and formulations for parenteral, intrathecal, or intraventricular administration may include sterile aqueous solutions, which may also contain buffers, diluents, and other suitable additives such as, but not limited to, penetration enhancers, vehicle compounds, and other pharmaceutically acceptable carriers or excipients. .

The pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and

55 formulations containing liposomes. These compositions can be generated from a variety of components including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids.

The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of associating the active ingredients with the pharmaceutical vehicle (s) or excipient (s). In general, the formulations are prepared by uniformly and intimately associating the active ingredients with liquid vehicles or finely divided solid vehicles, or both, and then, if necessary, molding the product.

The compositions of the present invention can be formulated in any of many possible dosage forms, such as, but not limited to, tablets, capsules, gel caps, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention can also be formulated as suspensions

5 in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethyl cellulose, sorbitol and / or dextran. The suspension may also contain stabilizers.

In one embodiment of the present invention, the pharmaceutical compositions can be formulated and used in the form of foams. Dosage forms include formulations such as, but not limited to, emulsions,

10 microemulsions, creams, gelatins and liposomes. Although basically similar in nature, these formulations vary in the components and consistency of the final product. The preparation of such compositions and formulations in general is known to the person skilled in the pharmaceutical and formulation art, and can be applied to the formulation of the compositions of the present invention.

Emulsions

The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems from one liquid dispersed to another in the form of droplets that normally exceed 0.1 µm in diameter (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc. , New York, NY, volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, Volume 1, p. 245; Block in Pharmaceutical Dosage Forms,

20 Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., In Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions can be in the form of water in oil (ag / ac) or oil in water (ac / ag). When an aqueous phase is finely divided and dispersed as tiny droplets into a bulky oil phase,

The resulting composition is called a water-in-oil (ag / ac) emulsion. Alternatively, when an oil phase is finely divided and dispersed as tiny droplets into a bulky aqueous phase, the resulting composition is called an oil-in-water (ac / ag) emulsion. The emulsions may contain additional components in addition to the dispersed phases and the active drug, which may be present as a solution in the aqueous phase, the oil phase, or itself as a separate phase. Excipients may also be present

Pharmaceuticals such as emulsifiers, stabilizers, colorants, and antioxidants, in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are composed of more than two phases such as, for example, in the case of oil-in-oil-in-oil (ac / ag / ac) and water-in-oil-in-water (ag / ac / ag). Such complex formulations often provide certain benefits that simple binary emulsions do not. Multiple emulsions in which small drops of oil

Individuals of an ac / ag emulsion enclose small water droplets make up an ag / ac / ag emulsion. In the same way, a system of small oil droplets enclosed in globules of sterilized water in a continuous oil phase provides an ac / ag / ac emulsion.

Emulsions are characterized by having little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed in the external or continuous phase and is maintained in this form by 40 emulsifiers or by the viscosity of the formulation. Either phase of the emulsion can be a semi-solid

or a solid, as is the case of ointment bases and emulsion-type creams. Other means of stabilizing emulsions involve the use of emulsifiers that can be incorporated into any of the phases of the emulsion. Emulsifiers can be broadly classified into 4 categories: synthetic surfactants, natural emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman,

45 Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

Synthetic surfactants, also known as surfactants, have found a wide field of application in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, NY, 1988, 50 volume 1 , p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic part. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophilic / lipophilic balance (HLB) and is a valuable tool for classifying and selecting surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),

55 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).

Natural emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin, and gum arabic. Absorption bases have hydrophilic properties so that they can be soaked in water to form ag / ac emulsions that still retain semisolid consistency, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers, especially 60 in combination with surfactants in viscous preparations. These include polar inorganic solids, such as

heavy metal hydroxides, non-swelling clays such as bentonite, attapulguite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments, and non-polar solids such as carbon or glyceryl triestearate.

A wide variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of the emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc. , New York, NY, volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199) .

Hydrophilic or hydrocolloid colloids include natural gums and synthetic polymers such as polysaccharides (for example, gum arabic, agar, alginic acid, carrageenan, guar gum, karaya gum and tragacanth), cellulose derivatives (for example, carboxymethyl cellulose and carboxypropyl cellulose) and synthetic polymers (eg, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize the emulsions by forming strong interfacial films around the small droplets of the dispersed phase and increasing the viscosity of the external phase.

Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols, and phosphatides, which can easily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also routinely added to emulsion formulations to prevent deterioration of the formulation. The antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene or reducing agents such as ascorbic acid and sodium metabisulfite, and synergistic compounds of antioxidants such as citric acid, tartaric acid and lecithin.

The application of the dermatological, oral and parenteral emulsion formulations and the methods for their manufacture have been reviewed in the literature (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc ., New York, NY, volume 1, p. 199). Emulsion formulations for oral delivery have been used very widely because of the ease of use of the formulation, and the efficacy from the point of view of absorption and bioavailability. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199). Mineral oil-based laxatives, oil-soluble vitamins and high-fat nutritional preparations are among the materials that have been routinely administered orally in the form of ac / ag emulsions.

In an embodiment of the present invention, the oligonucleotide and nucleic acid compositions are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and amphiphilic compound, which is a single thermodynamically stable and optically isotropic liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245). Typically, microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain length alcohol, to form a clear system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically transparent dispersions of two immiscible liquids that are stabilized by interfacial films of surfactant molecules (Leung and Shah, in: Controlled Release of Drugs: polymers and Aggregate Systems, Rosoff, M ., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions are normally prepared by a combination of three to five components including oil, water, surfactant, co-surfactant, and electrolyte. Whether the microemulsion is of the water-in-oil (ag / ac) or oil-in-water (ac / ag) type depends on the properties of the oil and surfactant used and the structure and geometric packing of the polar heads and tails hydrocarbons of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 271).

The phenomenological procedure using phase diagrams has been extensively studied and the expert in the art has been given comprehensive knowledge of how to formulate microemulsions (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker , Inc., New York, NY, volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335). Compared to normal emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable small droplets that spontaneously form.

Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, nonionic surfactants, Brij 96, polyoxyethylene and oleyl ethers, fatty acid and polyglycerol esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310) , hexaglycerol monooleate (PO310),

hexaglycerol (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sesquioleate (SO750), decaglycerol decaoleate (DA0750), alone or in combination with co-surfactants. The co-surfactant, typically a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase interfacial fluidity by penetrating the surfactant film and thereby creating a disordered film due to the void space generated between the surfactant molecules. . However, microemulsions can be prepared without using co-surfactants, and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase typically can be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and ethylene glycol derivatives. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, esters of fatty acids, mono, di, and medium chain triglycerides (C8-C12), fatty acid esters, and polyoxyethylated glyceryl, fatty alcohols, polyglycolized glycerides, polyglycolylated C8-C10 glycerides, vegetable oils and silicone oil.

Microemulsions are particularly interesting from the point of view of drug solubilization and enhanced drug absorption. Lipid-based microemulsions (both ac / ag and ag / ac) have been proposed to enhance oral bioavailability of drugs, including peptides (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions provide advantages of better drug solubilization, protection of the drug against enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration vs. solid dosage forms, better clinical potency, and less toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Microemulsions can often form spontaneously when their components are put together at room temperature. This can be particularly advantageous when formulating heat labile drugs, peptides, or oligonucleotides. Microemulsions have also been effective in transdermal delivery of active components in both cosmetic and pharmaceutical applications. The microemulsion compositions and formulations of the present invention are expected to facilitate increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve local cellular uptake of oligonucleotides and nucleic acids in the gastrointestinal tract, vagina, oral cavity. and other administration areas.

The microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the formulation properties and enhance the absorption of the oligonucleotides and nucleic acids herein. invention. The penetration enhancers used in the microemulsions of the present invention can be classified as belonging to one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed before.

Liposomes

There are many organized surfactant structures in addition to microemulsions that have been studied and used for drug formulation. These include monolayers, micelles, bilayers, and vesicles. Vesicles, such as liposomes, have attracted great interest due to their specificity and the duration of action they offer, from the point of view of drug delivery. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.

Liposomes are unilamellar or multilamellar vesicles that have a membrane made of a lipophilic material and an aqueous interior. The aqueous part contains the composition to be released. Cationic liposomes have the advantage of being able to fuse with the cell wall. Although non-cationic liposomes cannot fuse as effectively with the cell wall, they are trapped by macrophages in vivo.

In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each less than 50 nm in diameter, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome that is highly deformable and can pass through such fine pores.

Other advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide variety of lipid and water soluble drugs; liposomes can protect drugs encapsulated in their internal compartments against metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1 , p. 245). In preparing liposome formulations considerations on lipid surface charge, gallbladder size, and aqueous volume of liposomes are important.

Liposomes are useful for the transfer and supply of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes begin to fuse with the cell membranes. As the fusion of the liposome and the cell progresses, the content of the liposome empties into the cell where the active agent can act.

Liposomal formulations have been the focus of extensive research as a mode of release for many drugs. There is increasing evidence that for topical administration, liposomes have several advantages over other formulations. Such advantages include fewer side effects related to the high systemic absorption of the administered drug, greater accumulation of the administered drug in the desired target, and

5 the ability to deliver a wide variety of drugs, both hydrophilic and hydrophobic, to the skin.

Several publications have detailed the ability of liposomes to deliver agents to the skin, including high molecular weight DNA. Compounds including pain relievers, antibodies, hormones and high molecular weight DNA have been administered to the skin. Most applications were directed at the upper epidermis.

Liposomes are in two broad classes. Cationic liposomes are positively charged liposomes that

10 interact with negatively charged DNA molecules to form a stable complex. The positively charged DNA / liposome complex binds to the negatively charged cell surface and is internalized into an endosome. Due to the acidic pH within the endosome, the liposomes rupture releasing their contents into the cellular cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

Liposomes that are pH sensitive or negatively charged trap DNA rather than complex with it.

Since both DNA and lipid are similarly charged, repulsion occurs rather than complex formation. However, some DNA is trapped within the aqueous interior of these liposomes. PH sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cultured cell monolayers. Expression of the endogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

One of the main types of liposome compositions includes phospholipids other than natural phosphatidylcholine. For example, neutral liposome compositions can be formed from dimyristoyl-phosphatidylcholine (DMPC) or dipalmitoyl-phosphatidylcholine (DPPC). Anionic liposome compositions are generally formed from dimyristoyl-phosphatidylglycerol, while anionic fusogenic liposomes are primarily formed from dioleoyl-phosphatidylethanolamine (DOPE). Another type of liposome composition is formed by

Phosphatidylcholine (PC), such as for example soy PC and egg PC. Another type is formed by mixtures of phospholipids and / or phosphatidylcholine and / or cholesterol.

Several studies have evaluated the topical delivery of liposomal drug formulations to the skin. The application of liposomes containing interferon to the skin of guinea pigs resulted in a reduction of blisters of herpes cutaneous, while the supply of interferon by another route (eg, as a solution or an emulsion) did not

30 was effective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Furthermore, a further study tested the efficacy of interferon administered as part of a liposomal formulation versus administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265).

Nonionic liposomal systems have also been examined to determine their utility in supplying

35 drugs to the skin, in particular systems comprise non-ionic surfactant and cholesterol. Nonionic liposomal formulations comprising Novasome ™ I (glyceryl dilaurate / cholesterol / stearyl ether and polyoxyethylene-10) and Novasome ™ II (glyceryl distearate / cholesterol / stearyl ether and polyoxyethylene-10) were used to supply cyclosporin A in the dermis of mouse skin. The results indicated that these nonionic liposomal systems were effective in facilitating the deposition of cyclosporin A in different layers of the skin.

40 (Hu et al. S.T.P. Pharma. Sci., 1994, 4, 6, 466).

Liposomes also include "sterically stabilized" liposomes, a term that as used herein, refers to liposomes that comprise one or more specialized lipids that, when incorporated into liposomes, result in shelf life in circulation. enhanced with respect to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the lipid that forms the liposome vesicle (A) comprises one or more glycolipids, such as monosialoganglioside GM1, or (B) is derivatized with one or more hydrophilic polymers, such as a residue of polyethylene glycol (PEG). Without wishing to be bound by any particular theory, it is believed in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes is derived from a lower

Uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

Different liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) described the ability of monosialoganglioside GM1, galactocerebroside sulfate, and phosphatidylinositol to improve the blood half-lives of liposomes. These findings 55 were exposed by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). US patent no.

4,837,028 and International Publication WO 88/04924, both by Allen et al., Describe liposomes comprising

(1) sphingomyelin and (2) GM1 ganglioside or a galactocerebroside sulfate ester. US patent no.

5,543,152 (Webb et al.) Describe liposomes comprising sphingomyelin. Liposomes comprising 1,2-syndysyristoylphosphatidylcholine are described in International Publication WO 97/13499 (Lim et al.).

Many liposomes comprising lipids derivatized with one or more hydrophilic polymers and methods for their preparation are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C1215G, containing a PEG residue. Illum et al. (FEBS Lett., 1984, 167, 79) observed that the hydrophilic coating of polystyrene particles with polymeric glycols 5 resulted in enhanced blood half-lives. They describe synthetic phospholipids modified by binding of carboxylic groups of polyalkylene glycols (eg, PEG) Sears (US Patent Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments showing that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate had significant increases in half-lives in the bloodstream. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended these observations to other PEG-derivatized phospholipids, e.g. eg, DSPE-PEG, formed by the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having PEG moieties covalently attached to their outer surface are described in European Patent No. EP 0 445 131 B1 and Fisher International Publication WO 90/04384. Liposome compositions containing 1-20 mole percent PE derivatized with PEG, and methods for their use, are described by Woodle et al. (U.S. Patent Nos. 5,013,556 and 5,356,633) and

15 Martin et al. (US Patent No. 5,213,804 and European Patent No. EP 0496813 B1). Liposomes comprising a series of lipid-polymer conjugates are described in International Publication WO 91/05545 and US Pat. No. 5,225,212 (both by Martin et al.) and in international publication WO 94/20073 (Zalipsky et al.). Liposomes comprising PEG-modified ceramide lipids are described in International Publication WO 96/10391 (Choi et al.). US patents Nos. 5,540,935 (Miyazaki et al.) and 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that may also be derivatized with functional residues on their surfaces.

A limited number of liposomes comprising nucleic acids are known in the art. International publication WO 96/40062 by Thierry et al. describes methods for encapsulating high molecular weight nucleic acids in liposomes. US patent No. 5,264,221 to Tagawa et al. describes protein-bound liposomes and states that the content of such liposomes may include antisense RNA. US patent No. 5,665,710

25 of Rahman et al. describes certain methods for encapsulating oligodeoxynucleotides in liposomes. International publication WO 97/04787 of Love et al. describes liposomes comprising antisense oligonucleotides targeting the raf gene.

Transferosomes are yet another type of liposome, and are highly deformable lipid aggregates that are attractive candidates for drug delivery vehicles. Transferosomes can be described as tiny lipid droplets that are so deformable that they can easily penetrate through pores that are smaller than tiny droplets. Transferosomes can be adapted to the environment in which they are used, e.g. For example, they are self-optimizing (adapt to the shape of pores in the skin), self-repairing, often reach their targets without fragmentation, and often self-loading. To make transferosomes, surface edge activators, usually surfactants, can be added to a conventional liposome composition. Transferosomes

35 have been used to deliver serum albumin to the skin. Transferosome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

Surfactants have wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way to classify and order the properties of many different types of surfactants, both natural and synthetic, is through the use of the hydrophilic / lipophilic balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means of classifying the different types of surfactants used in the formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988 , p. 285).

If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Surfactants do not

Ionic 45 have a wide application in pharmaceutical and cosmetic products and can be used in a wide range of pH values. In general, its HLB values are in the range of 2 to about 18 depending on its structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as ethoxylated fatty alcohols, propoxylated alcohols, and ethoxylated / propoxylated block polymers are also included in this class. Polyoxyethylene surfactants are the most popular members of the class of nonionic surfactants.

If the surfactant molecule carries a negative charge when dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, amino acid acylamides, esters of sulfuric acid such as alkyl sulfates, and ethoxylated alkyl sulfates,

Sulfonates such as alkyl benzenesulfonates, acyl isethionates, acyl taurates, and sulfosuccinates and phosphates. The most important members of the class of anionic surfactants are alkyl sulfates and soaps.

If the surfactant molecule carries a positive charge when dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most widely used members of this class.

If the surfactant molecule has the ability to carry a positive or negative charge, the surfactant is classified

as an amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, Nalkyl betaines and phosphatides.

The use of surfactants in drugs, formulations, and emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).

Penetration enhancers

In one embodiment, the present invention uses different penetration enhancers to produce the effective delivery of nucleic acids, in particular oligonucleotides, into the skin of animals. Most drugs are present in solution in both ionized and non-ionized forms. However, typically only lipid-soluble or lipophilic drugs readily cross cell membranes. It has been found that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to adding the diffusion of non-lipophilic drugs through cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.

Penetration enhancers can be classified as belonging to one of five broad categories, that is, surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991 , p.92). Each of the classes mentioned before of penetration enhancers are described in more detail below.

Surfactants: In relation to the present invention, surfactants (or "surfactants") are chemical entities that, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that the absorption of the oligonucleotides through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, lauryl ether, and polyoxyethylene-9 and cetyl ether and polyoxyethylene-20) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and FC-43 perfluorinated chemical emulsions. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

Fatty acids: Different fatty acids and their derivatives that act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, acid linolenic, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurine, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C1-alkyl esters the same (eg, methyl, isopropyl, and t-butyl), and mono and diglycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al. , Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

Bile Salts: The physiological role of bile includes facilitating the dispersion and absorption of fat-soluble lipids and vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Different natural bile salts and their synthetic derivatives act as penetration enhancers. Therefore the expression "bile salts" includes any of the natural components of bile as well as any of its synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocolic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glycolic acid (sodium glucolate) , glycolic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), , Sodium 25-dihydrofusidate (STDHF), Sodium Lauryl Ether Glycol Dihydrofusidate and Polyoxyethylene-9 (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 in: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al. , J. Pharm. Exp. The r., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

Chelating Agents: Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metal ions from the solution by forming complexes therewith, with the result that the absorption of the oligonucleotides is enhanced through the mucosa. In relation to their use as penetration enhancers in the present invention, chelating agents have the added advantage that they also serve as DNase inhibitors, since most characterized DNA nucleases require a divalent metal ion for catalysis and for therefore they are inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Chelating agents of the invention include, but are not limited to, sodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (eg, salicylate, 5-methoxysalicylate, and sodium homovanilate), derivatives of collagen Nacyl, derivatives of laureth- 9 and N-aminoacyl of beta-diketones (enamines) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

Non-chelating Non-Surfactants: As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate negligible activity as chelating agents or as surfactants but, nevertheless, enhance the absorption of oligonucleotides to through the digestive mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas,

5 derivatives of 1-alkyl- and 1-alkenylazacyclocycloalkanone (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin, and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

Agents that enhance oligonucleotide uptake at the cellular level may also be added to the pharmaceutical compositions and other compositions of the present invention. For example, lipids are known to

Cationics, such as lipofectin (Junichi et al, US Patent No. 5,705,188), cationic glycerol derivatives and polycationic molecules such as polylysine (Lollo et al., PCT application WO 97/30731), also enhance cellular uptake of oligonucleotides.

Other agents can be used to enhance the penetration of administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrroles such as 2-pyrrole, azones, and terpenes such as limonene and

15 chin.

Vehicles

Some compositions of the present invention also incorporate vehicle compounds into the formulation. As used herein, "vehicle compound" or "vehicle" can refer to a nucleic acid or analog thereof, which is inert (ie, does not have biological activity by itself) but is recognized as a nucleic acid 20 by in vivo processes that reduce the bioavailability of nucleic acid having biological activity, for example by degrading biologically active nucleic acid or promoting its elimination from circulation. Co-administration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction in the amount of nucleic acid recovered in the liver, kidney or other extracirculatory deposits, presumably due to competition between the compound

25 vehicle and nucleic acid by a common receptor. For example, the recovery of a partially phosphorothioate oligonucleotide in liver tissue can be reduced when co-administered with polyinosinic acid, dextran sulfate, polycytidylic acid or 4-acetamido-4'-isothiocyanyl-2,2'-disulfonic acid (Miyao et al., Antisense Res. Dev., 1995, 5; 115-121; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).

Excipients

30 Unlike a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert carrier to deliver one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned administration form in mind, to provide volume, consistency, etc. desired, when combined with a nucleic acid and the other components of a given pharmaceutical composition. The

Typical pharmaceutical carriers include, but are not limited to, binding agents (eg, pregelatinized corn starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (eg, lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (eg, magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate,

40 etc.); disintegrants (eg, starch, sodium starch glycolate, etc.); and wetting agents (eg, sodium lauryl sulfate, etc.).

Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration that do not react deleteriously with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not

Limit, water, saline solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinylpyrrolidone and the like.

Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of nucleic acids in solid liquid or oily bases. The solutions can contain buffers, diluents and others

50 suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration that do not react adversely with nucleic acids can be used.

Pharmaceutically acceptable excipients include, but are not limited to, water, saline solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinylpyrrolidone, and the like.

55 Supply in pulses

The compounds of the present invention can also be administered by pulse delivery. "Pulse delivery" refers to a pharmaceutical formulation that delivers a first pulse of drug combined with a

penetration enhancer and a second pulse of penetration enhancer to promote absorption of drug that has not been absorbed after the release of penetration enhancer with the first pulse.

An embodiment of the present invention is a delayed-release oral formulation for enhanced intestinal drug absorption, comprising:

(to)

 a first population of carrier particles comprising said drug and a penetration enhancer, wherein said drug and said penetration enhancer are released at a first site in the intestine; and

(b)

 a second population of carrier particles comprising a penetration enhancer and a delayed release coating or matrix, in which the penetration enhancer is released at a second site in the intestine, below the first site, so that drug absorption is enhanced when the drug reaches the second site.

Alternatively, the penetration enhancer in (a) and (b) is different.

This enhancement is obtained by encapsulating at least two populations of vehicle particles. The first population of vehicle particles comprises a biologically active substance and a penetration enhancer, and the second (and optionally additional) population of vehicle particles comprises a penetration enhancer and a coating or matrix for delayed release.

A "first-pass effect" that is applied to orally administered drugs is degradation due to the action of gastric acid and different digestive enzymes. One means of enhancing the first-pass elimination effects is to increase the dose of the drug administered, thereby compensating for the proportion of drug lost in the first-pass elimination. Although this can be easily accomplished with IV administration, for example, simply by providing more drug to an animal, other factors influence the bioavailability of drugs administered by non-parenteral means. For example, a drug can be enzymatically or chemically degraded in the alimentary canal or bloodstream and / or it can be impermeable or permeable against different mucous membranes.

These pharmaceutical compositions are also contemplated to be capable of enhancing the absorption of biologically active substances when administered rectally, vaginally, nasally or pulmonary. It is also contemplated that the release of the biologically active substance can be accomplished anywhere in the gastrointestinal tract.

Liquid pharmaceutical oligonucleotide compositions can be prepared by combining the oligonucleotide with a suitable vehicle, eg sterile pyrogen-free water or saline. Other therapeutic compounds may optionally be included.

The present invention also contemplates the use of solid particulate compositions. Such compositions preferably comprise oligonucleotide particles that are respirable in size. Such particles can be prepared, for example, by grinding the dried oligonucleotide by conventional means, for example with a mortar and pestle, and then passing the resulting powder composition through a # 400 mesh screen to separate large particles and the agglomerates. A solid particulate composition composed of an active oligonucleotide may optionally contain a dispersant that serves to facilitate the formation of an aerosol, for example lactose.

In accordance with the present invention, the oligonucleotide compositions can be aerosolized. Liquid particle aerosolization can occur by any suitable means, such as a nebulizer. See, for example, US Pat. No. 4,501,729. Nebulizers are commercially available devices that transform solutions or suspensions into a therapeutic mist-type aerosol by acceleration of a compressed gas, typically air and oxygen, through a narrow Venturi orifice or by ultrasonic agitation. Suitable nebulizers include those sold by Blairex® under the names PARI LC PLUS, PARI DURA-NEB 2000, PARI-BABY Size, PARI PRONEB compressor with LC PLUS, PARI WALKHALER compressor / nebulizer system, PARI LC PLUS reusable nebulizer and PARI LC Jet + ®Nebulizer.

Example formulations for use in nebulizers consist of an oligonucleotide in a liquid, such as sterile pyrogen-free water, or saline, in which the oligonucleotide comprises up to about 40% w / w of the formulation. Preferably, the oligonucleotide comprises less than 20% w / w. If desired, additional additives such as preservatives (eg, methyl hydroxybenzoate), antioxidants, and flavoring agents can be added to the composition.

Solid particles comprising an oligonucleotide can also be aerosolized using any solid particle drug aerosol generator known in the art. Such aerosol generators produce respirable particles, as described above, and also produce reproducible measured doses per unit volume of the aerosol. Suitable solid particle aerosol generators include insufflators and metered dose inhalers. Metered dose inhalers are used in the art and are useful in the present invention.

Preferably, liquid or solid aerosols are produced at a rate of from about 10 to 150 liters per minute, more preferably from about 30 to 150 liters per minute, and most preferably about 60 liters per minute.

Enhanced bioavailability of biologically active substances is also achieved by oral administration of the compositions and methods of the present invention. The term "bioavailability" refers to a measurement of how much of an administered drug reaches the circulatory system when a non-parenteral mode of administration is used to introduce the drug into an animal.

Penetration enhancers include, but are not limited to, members of molecular classes such as surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactant molecules. (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Carriers are inert molecules that can be included in the compositions of the present invention to interfere with the processes leading to the reduction of levels of the bioavailable drug.

Other components

The compositions of the present invention may additionally contain other auxiliary components conventionally found in pharmaceutical compositions, at their use levels established in the art. Thus, for example, the compositions may contain additional, compatible, pharmaceutically active materials such as, for example, antipruritic, astringent, local anesthetic or anti-inflammatory agents, or they may contain additional materials useful in the physical formulation of various pharmaceutical forms of the compositions of the present invention, such as colorants, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents, and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, for example, lubricating agents, preservatives, stabilizers, humectants, emulsifiers, salts to influence osmotic pressure, buffers, colorants, flavoring agents and / or aromatic substances and similar, which do not harmfully interact with the nucleic acid (s) of the formulation.

Aqueous suspensions may contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethyl cellulose, sorbitol and / or dextran. The suspension may also contain stabilizers.

Some embodiments of the invention provide pharmaceutical compositions containing (a) one or more antisense compounds, and (b) one or more other chemotherapeutic agents that function by a non-antisense mechanism. Examples of such chemotherapeutic agents include, but are not limited to, daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, maphosphamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosourea, bis-chloroethylnitrosourea, busin prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentametilmelamina, mitoxantrone, amsacrine, chlorambucil, metilciclohexilnitrosourea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4hidroxiperoxiciclofosforamida , 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). See generally The Merck Manual of Diagnosis and Therapy, 15th Ed. 1987, pp. 1206-1228, Berkow et al., Eds., Rahway, N.J. When used with the compounds of the invention, such chemotherapeutic agents can be used individually (eg, 5-FU and oligonucleotide), sequentially (eg, 5-FU and oligonucleotide for a period of time followed MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (eg, 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including, but not limited to, non-steroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including, but not limited to, ribivirine, vidarabine, acyclovir, and ganciclovir, can also be combined in compositions of the invention. See generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., Eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively). Other chemotherapeutic agents that are not of the antisense type are also within the scope of this invention. Two or more compounds can be used combined together or sequentially.

In another related embodiment, the compositions of the invention may contain one or more antisense compounds, in particular oligonucleotides, directed to a first nucleic acid and one or more additional antisense compounds directed to a second target nucleic acid. Numerous examples of antisense compounds are known in the art. Two or more compounds can be used combined together or sequentially.

The formulation of the therapeutic compositions and their subsequent administration is believed to be based on the experience of those skilled in the art. The dosage depends on the severity and sensitivity of the disease state to be treated, lasting the course of treatment from several days to several months, or until the cure is performed or a decrease in the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the patient's body. Those of skill in the art can easily determine optimal dosages, dosing methodologies, and repetition rates. The

Optimal dosages can vary depending on the relative potency of the individual oligonucleotides, and can generally be calculated based on the EC50 found effective in in vitro and in vivo animal models. In general, the dosage is 0.01 ug to 100 g per kg of body weight, and can be given one or more times a day, weekly, monthly or annually, or even once every 2 to 20 years. Those of skill in the art can easily calculate the repeat rate for dosing based on the measured residence times and drug concentrations in body fluids or tissues. After successful treatment, it may be desirable for the patient to follow maintenance therapy to prevent recurrence of the disease state, in which the oligonucleotide is administered in maintenance doses, in the range of 0.01 ug to 100 g per kg of body weight, one or more times a day, up to once every 20 years.

Combination Therapy

The invention also provides combination therapy methods, in which one or more compounds of the invention and one or more therapeutic / prophylactic compounds are administered to treat a condition and / or disease state as described herein. In different aspects, the compound (s) of the invention and the therapeutic / prophylactic compound (s) are co-administered in the form of a mixture, or are administered individually. In one aspect, the route of administration is the same for the compound (s) of the invention and the therapeutic / prophylactic compound (s), while in other compounds, the compound (s) of the invention and the therapeutic / prophylactic compound (s) are administered by different routes. In one embodiment, the dosages of the compound (s) of the invention and the therapeutic / prophylactic compound (s) are amounts that are therapeutically or prophylactically effective for each compound when administered individually. Alternatively, the combined administration allows the use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if administered individually, and such methods are useful in decreasing one or more side effects of the reduced dose compound.

In one aspect, a compound of the present invention and one or more of the other therapeutic / prophylactic compounds effective in treating a condition are administered, in which both compounds act by the same or different mechanisms. The therapeutic / prophylactic compound (s) include, but are not limited to, bile salt sequestering resins (eg, cholestyramine, cholestipol, and colesevelam hydrochloride), HMGCoA-reductase inhibitors (eg, lovastatin, cerivastatin, prevastatin , atorvastatin, simvastatin, and fluvastatin), nicotinic acid, fibric acid derivatives (eg, clofibrate, gemfibrozil, fenofibrate, bezafibrate, and ciprofibrate), probucol, neomycin, dextrothyroxine, esters of plant absorption cholesterol (eg, ezetimibe), implitapide, bile acid transporter inhibitors (apical sodium-dependent bile acid transporters), regulators of liver CYP7a, estrogen replacement therapeutics (eg, tamoxigen), and anti-inflammatory drugs (eg glucocorticoids).

Accordingly, the invention further provides the use of a compound of the invention and one or more of another or other therapeutic / prophylactic compounds as described herein, in the manufacture of a medicament for the treatment and / or prevention of a disease or condition as described herein.

Directed supply

In another aspect, methods are provided for targeting a compound of the invention to a specific tissue, organ, or site in the body. Examples of targets include liver, lung, kidney, heart, and atherosclerotic plaques in a blood vessel. Methods of directing compounds are well known in the art.

In one embodiment the compound is directed by direct or local administration. For example, when targeting a blood vessel, the compound is administered directly to the relevant part of the vessel from within the lumen, e.g. eg, single balloon or double balloon, or through the adventitic robe with material that aids in the slow release of the compound, eg. eg, a pluronic gel system as described by Simons et al., Nature 359: 67-70 (1992). Other slow-release techniques for local delivery of the compound to a vessel include coating a stent with the compound. Methods of supplying antisense compounds to a blood vessel are described in US Pat. No. 6,159,946.

When targeted to a particular tissue or organ, the compound can be administered to or around that tissue or organ. For example, US Patent No. No. 6,547,787, describes methods and devices for targeting therapeutic agents to the heart. In one aspect, administration occurs by direct injection or by injection into a blood vessel associated with the tissue or organ. For example, when directed to the liver, the compound can be administered by injection or infusion through the portal vein.

In another aspect, methods of targeting a compound are provided including associating the compound with an agent that directs capture of the compound by one or more cell types. Exemplary agents include lipids and lipid-based structures such as liposomes, generally in combination with a specific organ or tissue targeting moiety such as, for example, an antibody, a cell surface receptor, a ligand for a receptor cell surface, a polysaccharide, a drug, a hormone, a hapten, a special lipid, and a nucleic acid as described in US Pat. No. 6,495,532. US patent No. 5,399,331, describes the coupling of proteins to liposomes by use of a crosslinking agent having at least one maleimido group and amine reactive function. US patents Nos. 4,885,172, 5,059,421, and 5,171,578, describe proteins that bind to liposomes by using streptavidin glycoprotein and coating of

5 directing liposomes with polysaccharides. Other lipid-based targeting agents include, for example, micelles and crystalline products as described in US Pat. No. 6,217,886.

In another aspect, directing agents include porous polymeric mycrospheres derived from copolymer polyesters and homopolymers containing hydrolyzable ester linkages that are biodegradable, as described in US Patent No. 5,200,300. No. 4,818,542. Typical polyesters include poly (glycolic acid) (PGA) and poly (lactic acid) 10 (PLA), and glycolide and L (-lactide) copolymers (PGL), which are particularly suitable for the methods and compositions herein. invention, insofar as they have low human toxicity and are biodegradable. The polyester or other particular polymer, oligomer or copolymer used as the polymeric matrix of the microsphere is not critical and a variety of polymers can be used depending on the desired porosity, consistency, shape and size distribution. Other biodegradable or bioerodible polymers or copolymers include, for example, gelatin, agar, corn starch, arabinogalactan, albumin, collagen, natural and synthetic materials, such as poly (ε-caprolactone), poly (ε-caprolactone-CO-acid lactic), poly (ε-caprolactone-CO-glycolic acid), poly (β-hydroxybutyric acid), poly (ethylene oxide), polyethylene, poly (alkyl 2-cyanoacrylate), (eg methyl, ethyl, butyl ), hydrogels such as poly (hydroxyethyl methacrylate), polyamides (eg, polyacrylamide), poly (amino acids) (i.e. L-leucine, L-aspartic acid, β-methyl L-aspartate, L-aspartate of β-benzyl, glutamic acid), poly (2-hydroxyethyl-DL

20 aspartamide), poly (ester urea), poly (L-phenylalanine / ethylene glycol / 1,6-diisocyanatohexane) and poly (methyl methacrylate). Exemplary natural and synthetic polymers suitable for targeted release are either commercially available or can be obtained by condensation polymerization reactions from suitable monomers, comonomers or oligomers.

In yet another embodiment, US Pat. No. 6,562,864 describes catechins, including epi isomers and others

Carbocationic isomers and derivatives thereof, which as major monomers, dimers, and multimers, can complex with cationic and nucleophilic bioactive agents for use as delivery agents. Catechin multimers have a strong affinity for polar proteins, such as those that reside in the vascular endothelium, and in cell membranes / organelles, and are particularly useful for the targeted delivery of bioactive agents to select sites in vivo. In the treatment of vascular diseases and disorders, such

Like atherosclerosis and coronary artery disease, the supply of agents includes substituted catechin multimers, including amidated catechin multimers that are formed by reaction between catechin and nitrogen containing moieties such as ammonia.

Other strategies for targeted delivery of the invention include ADEPT (antibody-directed prodrug enzyme therapy), GDEPT (gene-directed EPT), and VDEPT (virus-directed EPT) as described in

35 US patent No. 6,433,012.

The present invention further provides medical devices and kits for targeted delivery, wherein the device is, for example, a syringe, stent, or catheter. The kits include a device for administering a compound and a container comprising a compound of the invention. In one aspect, the compound is preloaded on the device. In other embodiments, the kit provides instructions for

40 compound administration methods and dosages. US patents Describing medical devices and kits for supplying antisense compounds include US Pat. No. 6,368,356; 6,344,035; 6,344,028; 6,287,285; 6,200,304; 5,824,049; 5,749,915; 5,674,242; 5,670,161; 5,609,629; 5,593,974; and 5,470,307.

Although the present invention has been specifically described in accordance with certain embodiments, the following examples serve only to illustrate the invention and are not intended to limit the invention.

45 Examples

Example 1

Nucleoside-phosphoramidites for the synthesis of deoxy and 2'-alkoxy-amidite oligonucleotides

The 2'-deoxy and 2'-methoxy-beta-cyanoethyldiisopropyl phosphoramidites were purchased from commercial sources (eg Chemgenes, Needham MA or Glen Research, Inc. Sterling VA). Other 2'-O-alkoxy-substituted nucleoside-amidites

50 were prepared as described in US Pat. 5,506,351. For oligonucleotides synthesized using 2'-alkoxy-amidites, the standard cycle for unmodified oligonucleotides was used, except that the waiting step after tetrazol and base pulse delivery was increased to 360 s.

Oligonucleotides containing 5-methyl-2'-deoxycytidine (5-Me-C) were synthesized according to published methods [Sanghvi, et. al., Nucleic Acids Research, 1993, 21, 3197-3203] using commercially available phosphoramidites

55 (Glen Research, Sterling VA or ChemGenes, Needham MA).

2'-Fluoro-amidites

2'-Fluorodeoxydenosine-amidites

The 2'-fluoro-oligonucleotides were synthesized as previously described [Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841] and US Patent 5,670,633. Briefly, the protected nucleoside N6-benzoyl-2'-deoxy-2'-fluoroadenosine was synthesized using commercially available 9-beta-D-arabinofuranosiladenine as a starting material and modifying the literature procedures so that the atom was introduced 2'-alphafluoro by an SN2 shift of a 2'-beta-trityl group. Therefore, N6-benzoyl-9-beta-Darabinofuranosiladenine was selectively protected with moderate yield as the intermediate 3 ', 5'-ditetrahydropyranil (THP). The deprotection of the THP and N6-benzoyl groups was carried out using standard methodologies and standard methods to obtain the intermediate 5'-dimethoxytryl- (DMT) and 5'-DMT-3'-phosphoramidite.

2'-Fluorodeoxyguanosine

Synthesis of 2'-deoxy-2'-fluoroguanosine was carried out using tetraisopropyldisiloxanyl-protected 9-beta-D-arabinofuranosylguanine (TPDS) as the starting material, and conversion to intermediate diisobutyrylarabinofuranosylguanosine. Deprotection of the TPDS group was followed by protection of the hydroxyl group with THP to give the diisobutyryl-di-THP protected arabinofuranosylguanine. Selective O-deacetylation and triflate formation was followed by treatment of the crude product with fluoride, and then deprotection of the THP groups.

Conventional methodologies were used to obtain the 5'-DMT- and 5'-DMT-3'-phosphoramidites.

2'-Fluorouridine

The synthesis of 2'-deoxy-2'-fluorouridine was carried out by modification of a procedure in the literature, in which 2,2'-anhydro-1-beta-D-arabinofuranosiluracil was treated with hydrogen fluoride -pyridine 70%. Conventional procedures were used to obtain the 5'-DMT- and 5'-DMT-3'-phosphoramidites.

2'-Fluorodeoxycytidine

2'-Deoxy-2'-fluorocytidine was synthesized by amination of 2'-deoxy-2'-fluorouridine, followed by selective protection to give N4-benzoyl-2'-deoxy-2'-fluorocytidine. Conventional procedures were used to obtain the 5'-DMT- and 5'-DMT-3'-phosphoramidites.

2'-O- (2-methoxyethyl) modified amidites

2'-O-methoxyethyl substituted nucleoside amidites are prepared as follows, or alternatively, according to the methods of Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504.

2,2'-Anhydro [1- (beta-D-arabinofuranosyl) -5-methyluridine]

5-Methyluridine (ribosiltimine, commercially available from Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenyl carbonate (90.0 g, 0.420 M), and sodium bicarbonate (2.0 g,) were added. 0.024 M) to DMF (300 ml). The mixture was heated to reflux temperature, with stirring allowing the formed carbon dioxide gas to be released in a controlled manner. After 1 h, the slightly darkened solution was concentrated under reduced pressure. The resulting syrup was poured into diethyl ether (2.5 liters), with stirring. The product formed a gum. The ether was decanted and the residue was dissolved in the smallest amount of methanol (approximately 400 ml). The solution was poured into fresh diethyl ether (2.5 liters) to give a stiff gum. The diethyl ether was decanted and the gum was dried in a vacuum oven (60 ° C at 1mm Hg for 24h) to give a solid which was ground to a light brown powder (57g, 85% crude yield) . The NMR spectrum was in agreement with the structure, contaminated with phenol in the form of its sodium salt (approximately 5%). The material was used as is for subsequent reactions (or further purified by column chromatography using a gradient of methanol in ethyl acetate (10-25%) to give a white solid, mp 222-4 ° C).

2'-O-Methoxyethyl-5-methyluridine

2,2'-Anhydro-5-methyluridine (195 g, 0.81 M), tris (2-methoxyethyl) borate (231 g, 0.98 M) and 2-methoxyethanol (1.2 liters) were added in a 2 liter stainless steel pressure vessel and placed in an oil bath previously heated to 160 ° C. After heating for 48 hr at 155-160 ° C, the container was opened and the solution was evaporated to dryness and triturated with MeOH (200 ml). The residue was suspended in hot acetone (1 liter). Insoluble salts were filtered, washed with acetone (150 ml) and the filtrate was evaporated. The residue (280 g) was dissolved in CH3CN (600 ml) and evaporated. A column of silica gel (3 kg) was packed in CH2Cl2 / acetone / MeOH (20: 5: 3) containing 0.5% Et3NH. The residue was dissolved in CH2Cl2 (250 ml) and adsorbed on silica (150 g) before loading on the column. The product was eluted with the packaging solvent to give 160 g (63%) of product. Additional material was obtained by re-treating the impure fractions.

2'-O-Methoxyethyl-5'-O-dimethoxytryl-5-methyluridine

2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was coevaporated with pyridine (250 ml) and the dry residue was dissolved in pyridine (1.3 liters). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the mixture was stirred at room temperature for 1 hour. A second aliquot of dimethoxytrityl chloride 5 (94.3g, 0.278M) was added and the reaction stirred for an additional hour. Then methanol (170 ml) was added to stop the reaction. HPLC showed the presence of approximately 70% product. Solvent was evaporated and triturated with CH3CN (200 ml). The residue was dissolved in CHCl3 (1.5 liters) and extracted with 2x500 ml of saturated NaHCO3 solution and 2x500 ml of saturated NaCl solution. The organic phase was dried over Na2SO4, filtered and evaporated. 275 g of residue were obtained. The residue was purified on a 3.5 kg silica gel column

Packaged and eluted with EtOAc / hexane / acetone (5: 5: 1) containing 0.5% Et3NH. The pure fractions were evaporated to give 164 g of product. Approximately 20 additional g of the impure fractions were obtained to give a total yield of 183 g (57%).

3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine

2'-O-methoxyethyl-5'-O-dimethoxytryl-5-methyluridine (106 g, 0.167 M), DMF / pyridine (750 ml of a

3: 1 mixture prepared from 562 ml of DMF and 188 ml of pyridine) and acetic anhydride (24.38 ml, 0.258 M) and stirred at room temperature for 24 h. The reaction was followed by TLC by first quenching the TLC sample by addition of MeOH. After completion of the reaction, which is judged by TLC, MeOH (50 ml) was added and the mixture was evaporated at 35 ° C. The residue was dissolved in CHCl3 (800 ml) and extracted with 2x200 ml of saturated sodium bicarbonate solution and 2x200 ml of saturated NaCl solution. The aqueous layers were re-extracted with 200 ml

CHCl3. The combined organic layers were dried with sodium sulfate and evaporated to give 122 g of the residue (approximately 90% product). The residue was purified on a 3.5 kg silica gel column and eluted using EtOAc / hexane (4: 1). The pure product fractions were evaporated to give 96 g (84%). An additional 1.5 g of the last fractions was recovered.

3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triazoluridine

A first solution was prepared by dissolving 3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytryl-5-methyluridine (96g, 0.144M) in CH3CN (700ml) and set aside. Triethylamine (189 ml, 1.44 M) was added to a solution of triazole (90 g, 1.3 M) in CH3CN (1 liter), cooled to -5 ° C and stirred for 0.5 h using a rod stirrer. POCl3 was added dropwise over a period of 30 min, to the stirred solution maintained at 0-10 ° C, and the resulting mixture was stirred for an additional 2 h. The first solution was added dropwise, over a period of 45 min, to this

30 last dissolution. The resulting reaction mixture was stored overnight in a cold room. The salts were filtered from the reaction mixture and the solution was evaporated. The residue was dissolved in EtOAc (1 liter) and the insoluble solids were separated by filtration. The filtrate was washed with 1x300 ml of NaHCO3 and 2x300 ml of saturated NaCl solution, dried over magnesium sulfate and evaporated. The residue was triturated with EtOAc to give the title compound.

2'-O-Methoxyethyl-5'-O-dimethoxytryl-5-methylcytidine

A solution of 3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triazoluridine (103g, 0.141M) in dioxane (500ml) and NH4OH (30ml) stirred for 2 h. The dioxane solution was evaporated and the residue was azeotropically distilled with MeOH (2x200 ml). The residue was dissolved in MeOH (300 ml) and transferred to a 2 liter stainless steel pressure vessel. MeOH (400 ml) saturated with NH3 gas was added and the vessel was

40 heated at 100 ° C for 2 h (TLC showed complete conversion). The contents of the container were evaporated to dryness and the residue was dissolved in EtOAc (500 ml) and washed once with saturated NaCl solution (200 ml). The organic layers were dried over sodium sulfate, and the solvent was evaporated to give 85 g (95%) of the title compound.

N4-benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-cytidine

2'-O-methoxyethyl-5'-O-dimethoxytryl-5-methylcytidine (85g, 0.134M) was dissolved in DMF (800ml) and benzoic anhydride (37.2g, 0.165M) was added with stirring. After stirring for 3 hr, TLC showed that the reaction was approximately 95% complete. The solvent was evaporated and the residue was azeotropically distilled with MeOH (200 ml). The residue was dissolved in CHCl3 (700 ml) and extracted with saturated NaHCO3 solution (2x300 ml) and saturated NaCl solution (2x300 ml), dried over MgSO4 and evaporated to give the residue (96 g). The residue is

Chromatographed on a 1.5 kg silica column using EtOAc / hexane (1: 1) containing 0.5% Et3NH as the elution solvent. The pure product fractions were evaporated to give 90 g (90%) of the title compound.

N4-benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-cytidine-3'-amidite

N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (74 g, 0.10 M) was dissolved in CH2Cl2 (1 liter). Diisopropylamine tetrazole (7.1 g) and 2-cyanoethoxy-tetra- (isopropyl) phosphite (40.5 ml, 0.123 M) were added with stirring under nitrogen atmosphere. The resulting mixture was stirred for 20 h at room temperature (TLC showed that the reaction was 95% complete). The reaction mixture was extracted with saturated NaHCO3 solution (1x300 ml) and saturated NaCl solution (3x300 ml). The aqueous washes were re-extracted with CH2Cl2 (300

ml), and the extracts were combined, dried over MgSO4 and concentrated. The obtained residue was chromatographed on a 1.5 kg silica column using EtOAc / hexane (3: 1) as the elution solvent. The pure product fractions were combined to give 90.6 g (87%) of the title compound.

2'-O- (Aminooxyethyl) -nucleoside-amidites and 2'-O- (dimethylaminooxyethyl) -nucleoside-amidites

5 2 '- (Dimethylaminooxyethoxy) -nucleoside-amidites

The 2'- (dimethylaminooxyethoxy) -nucleoside-amidites [also known in the art as 2'-O- (dimethylaminooxyethyl) nucleoside-amidites] are prepared as described in the following paragraphs. The nucleoside-amidites of adenosine, cytidine, and guanosine are prepared similarly to thymidine (5-methyluridine) except that the exocyclic amines are protected with a benzoyl residue in the case of adenosine and cytidine and with an isobutyryl in the case of

Guanosine.

5'-O-tert-Butyldiphenylsilyl-O2-2'-anhydro-5-methyluridine

O2-2'-Anhydro-5-methyluridine (Pro. Bio. Sint., Varese, Italy, 100.0 g, 0.416 mmol), dimethylaminopyridine (0.66 g, 0.013 eq, 0.0054 mmol) were dissolved in pyridine Dry (500 ml) at room temperature under an argon atmosphere and with mechanical agitation. Tert-Butyldiphenylchlorosilane (125.8 g, 119.0 ml, 1.1 eq, 0.458 mmol) was added in one portion. The reaction was stirred for 16 hr at room temperature. TLC (Rf 0.22, ethyl acetate) indicated a complete reaction. The solution was concentrated under reduced pressure to a thick oil. This was partitioned between dichloromethane (1 liter) and saturated sodium bicarbonate solution (2x1 liter) and brine (1 liter). The organic layer was dried over sodium sulfate and concentrated under reduced pressure to a thick oil. The oil was dissolved in a mixture of ethyl acetate and diethyl ether 1: 1 (600 ml) and the solution was cooled to -10 ° C. The crystalline product

The resulting was collected by filtration, washed with diethyl ether (3x200 ml) and dried (40 ° C, 1 mm Hg, 24 h) to 149 g (74.8%) of white solid. TLC and NMR were in agreement with the pure product.

5'-O-tert-Butyldiphenylsilyl-2'-O- (2-hydroxyethyl) -5-methyluridine

Borane in tetrahydrofuran (1.0M, 2.0eq, 622ml) was added to a 2-liter stainless steel non-stirring pressure reactor. In the fume hood and with manual agitation, ethylene glycol (350 25 ml, excess) was carefully added first until the evolution of hydrogen gas decreased. 5'-O-tert-Butyldiphenylsilyl-O2-2'anhydro-5-methyluridine (149g, 0.311mol) and sodium bicarbonate (0.074g, 0.003eq) were added with manual stirring. The reactor was hermetically sealed and heated in an oil bath until an internal temperature of 160 ° C was reached and then held for 16 h (pressure <7 kg / cm2). The reaction vessel was cooled to room temperature and opened. TLC (Rf 0.67 for the desired product and Rf 0.82 for the ara-T by-product, ethyl acetate) 30 indicated a conversion to the product of approximately 70%. In order to avoid the formation of additional secondary product, the reaction was stopped, concentrated under reduced pressure (10 to 1 mm Hg) in a hot water bath (40-100 ° C) with the most extreme conditions used to separate ethylene glycol. [Alternatively, once the low-boiling solvent has been removed, the remaining solution can be partitioned between ethyl acetate and water. The product will be in the organic phase]. The residue was purified by chromatography on

35 column (2 kg silica gel, ethyl acetate-hexanes gradient from 1: 1 to 4: 1). The appropriate fractions were combined, the volatiles were separated and dried to give the product as a crisp white foam (84g, 50%), contaminated starting material (17.4g), and reusable pure starting material. g. The yield based on the recovered least pure starting material was 58%. TLC and NMR were in agreement with 99% pure product.

2'-O - ([2-phthalimidoxy) ethyl] -5'-t-butyldiphenylsilyl-5-methyluridine

5'-O-tert-Butyldiphenylsilyl-2'-O- (2-hydroxyethyl) -5-methyluridine (20g, 36.98mmol) was mixed with triphenylphosphine (11.63g, 44.36mmol) and N -hydroxyphthalimide (7.24 g, 44.36 mmol). It was then dried over P2O5 under high vacuum for two days at 40 ° C. The reaction mixture was flushed with argon and dry THF (369.8 mL, Aldrich, securely sealed bottle) was added to give a clear solution. Diethyl azodicarboxylate (6.98 ml, 45 44.36 mmol) was added dropwise to the reaction mixture. The addition rate is maintained such that the resulting dark red coloration has just dropped before adding the next drop. After the addition was complete, the reaction was stirred for 4 h. At that time, TLC showed that the reaction was complete (ethyl acetate: hexane, 60:40). Solvent was evaporated in vacuo. The residue obtained was placed on a flash column with ethyl acetate: hexane (60:40), to give 2'-O - ([2-phthalimidoxy) ethyl] -5'-t-butyldiphenylsilyl-5-methyluridine as of a white foam (21,819

50 g, 86%).

5'-O-tert-Butyldiphenylsilyl-2'-O - [(2-formedximinoxyxy) ethyl] -5-methyluridine

2'-O - ([2-Phthalimidoxy) ethyl] -5'-t-butyldiphenylsilyl-5-methyluridine (3.1g, 4.5mmol) was dissolved in dry CH2Cl2 (4.5ml) and drop was added methylhydrazine (300 ml, 4.64 mmol) dropwise from -10 ° C to 0 ° C. After 1 hr, the mixture was filtered, the filtrate was washed with ice cold CH2Cl2, and the combined organic phases were washed with water, brine, and dried over Na2SO4. The solution was concentrated to give 2'-O- (aminooxyethyl) thymidine, which was then dissolved in MeOH (67.5 ml). To this was added formaldehyde (20% aqueous solution, 1.1 eq.) And the resulting mixture was stirred for 1 h. The solvent was removed in vacuo; the residue was chromatographed to give 5'-O-tert-butyldiphenylsilyl-2'-O - [(2

Formedximinooxy) ethyl] -5-methyluridine as a white foam (1.95 g, 78%).

5'-O-tert-butyldiphenylsilyl-2'-O- [N, N-dimethylaminooxyethyl] -5-methyluridine

5'-O-tert-Butyldiphenylsilyl-2'-O - [(2-formaximinooxy) ethyl] -5-methyluridine (1.77g, 3.12mmol) was dissolved in a solution of pyridinium p-toluenesulfonate 1 M (PPTS) in dry MeOH (30.6 ml). Sodium cyanoborohydride (0.39 g, 6.13 mmol) was added to this solution at 10 ° C under an inert atmosphere. The reaction mixture was stirred for 10 minutes at 10 ° C. After this, the reaction vessel was removed from the ice bath and stirred at room temperature for 2 hr, the reaction was followed by TLC (5% MeOH in CH2Cl2). Aqueous NaHCO3 solution (5%, 10 ml) was added and extracted with ethyl acetate (2x20 ml). The ethyl acetate phase was dried over anhydrous Na2SO4, and evaporated to dryness. The residue was dissolved in a solution of 1M PPTS in MeOH (30.6 ml). Formaldehyde (20% w / w, 30 ml, 3.37 mmol) was added and the reaction mixture was stirred at room temperature for 10 min. The reaction mixture was cooled to 10 ° C in an ice bath, sodium cyanoborohydride (0.39g, 6.13mmol) was added and the reaction mixture was stirred at 10 ° C for 10 min. After 10 min, the reaction mixture was removed from the ice bath and stirred at room temperature for 2 h. 5% NaHCO3 solution (25 ml) was added to the reaction mixture and extracted with ethyl acetate (2x25 ml). The ethyl acetate layer was dried over anhydrous Na2SO4 and evaporated to dryness. The residue obtained was purified by flash column chromatography and eluted with 5% MeOH in CH2Cl2 to give 5'-O-tert-butyldiphenylsilyl-2'-O- [N, Ndimethylaminooxyethyl] -5-methyluridine in the form of a white foam (14.6 g, 80%).

2'-O- (Dimethylaminooxyethyl) -5-methyluridine

Triethylamine trihydrofluoride (3.91 ml, 24.0 mmol) was dissolved in dry THF and triethylamine (1.67 ml, 12 mmol, dry, preserved over KOH). The triethylamine-2HF mixture was then added to 5'-O-tert-butyldiphenylsilyl-2'-O- [N, N-dimethylaminooxyethyl] -5-methyluridine (1.40g, 2.4mmol) and stirred at room temperature for 24 h. The reaction was followed by TLC (5% MeOH in CH2Cl2). The solvent was removed in vacuo and the residue was placed on a flash column with 10% MeOH in CH2Cl2 to give 2'-O- (dimethylaminooxyethyl) -5-methyluridine (766 mg, 92.5%).

5'-O-DMT-2'-O- (dimethylaminooxyethyl) -5-methyluridine

2'-O- (dimethylaminooxyethyl) -5-methyluridine (750mg, 2.17mmol) was dried over P2O5 under high vacuum overnight at 40 ° C. It was then coevaporated with anhydrous pyridine (20 ml). The obtained residue was dissolved in pyridine (11 ml) under an argon atmosphere. 4-Dimethylaminopyridine (26.5mg, 2.60mmol), 4,4'-dimethoxytrityl chloride (880mg, 2.60mmol) were added to the mixture and the reaction was stirred at room temperature until all material starting it had disappeared. The pyridine was removed in vacuo and the residue was chromatographed and eluted with 10% MeOH in CH2Cl2 (containing a few drops of pyridine) to give the 5'-O-DMT-2'-O- (dimethylamino-oxyethyl) - 5-methyluridine (1.13 g, 80%).

5'-O-DMT-2'-O- (2-N, N-dimethylaminooxyethyl) -5-methyluridine-3 '- [(2-cyanoethyl) -N, N-diisopropylphosphoramidite]

5'-O-DMT-2'-O- (dimethylaminooxyethyl) -5-methyluridine (1.08g, 1.67mmol) was coevaporated with toluene (20ml). To the residue was added N, N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) and dried over P2O5 under high vacuum overnight at 40 ° C. Then the reaction mixture was dissolved in anhydrous acetonitrile (8.4 ml) and 2-cyanoethyl-N, N, N1, N1-tetraisopropylphosphoramidite (2.12 ml, 6.08 mmol) was added. The reaction mixture was stirred at room temperature for 4 h under an inert atmosphere. The evolution of the reaction was followed by TLC (1: 1 hexane: ethyl acetate). The solvent was evaporated, then the residue was dissolved in ethyl acetate (70 ml) and washed with 5% aqueous NaHCO3 solution (40 ml). The ethyl acetate layer was dried over anhydrous Na2SO4 and concentrated. The obtained residue was chromatographed (ethyl acetate as eluant) to give 5'-O-DMT-2'-O- (2-N, Ndimethylaminooxyethyl) -5-methyluridine-3 '- [(2-cyanoethyl) -N , N-diisopropylphosphoramidite] as a foam (1.04 g, 74.9%).

2 '- (Aminooxyethoxy) -nucleoside-amidites

The 2'- (aminooxyethoxy) -nucleoside-amidites [also known in the art as 2'-O- (aminooxyethyl) -nucleosidoamidites] are prepared as described in the following paragraphs. The nucleoside-amidites of adenosine, cytidine, and thymidine are prepared as follows.

N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O- (2-ethylacetyl) -5'-O- (4,4'-dimethoxytryl) guanosine-3 '- [(2-cyanoethyl) -N, Ndiisopropylphosphoramidite]

The 2'-O-aminooxyethyl-guanosine analog can be obtained by selective 2'-O-alkylation of diaminopurinariboside. Multigrams of diaminopurine riboside can be purchased from Schering AG (Berlin) to provide 2'-O- (2-ethylacetyl) -diaminopurine riboside together with a minor amount of the 3 'isomer. 2'-O- (2ethylacetyl) -diaminopurine-riboside can be resolved and converted to 2'-O- (2-ethylacetyl) guanosine by treatment with adenosine deaminase. (McGee, DPC, Cook, PD, Guinosso, CJ, International Publication WO 94/02501 A1 940203.) Conventional protection procedures would give 2'-O- (2-ethylacetyl) -5'-O- (4.4 'dimethoxytryl) guanosine and 2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O- (2-ethylacetyl) -5'-O- (4,4'-dimethoxytryl) guanosine which can be reduced to give the 2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O- (2-hydroxyethyl) -5'-O- (4,4'-dimethoxytryl) guanosine.

As before, the hydroxyl group can be displaced by N-hydroxyphthalimide by a Mitsunobu reaction, and phosphoramidite from the protected nucleoside can be formed in the usual way to give 2-N-isobutyryl-6-Odiphenylcarbamoyl-2'-O - ([2-phthamidoxy] ethyl) -5'-O- (4,4'-dimethoxytryl) guanosine-3 '- [(2-cyanoethyl) -N, Ndiisopropylphosphoramidite].

2'-dimethylaminoethoxyethoxy (2'-DMAEOE) -nucleoside-amidites

The 2'-dimethylaminoethoxyethoxy-nucleoside-amidites (also known in the art as 2'-O-dimethylaminoethoxyethyl, i.e. 2'-O-CH2-O-CH2-N- (CH2) 2, or 2'-DMAEOE- nucleoside-amidites) are prepared as follows. Other nucleosidoamidites are prepared in a similar way.

2'-O- [2 (2-N, N-dimethylaminoethoxy) ethyl] -5-methyl-uridine

2 [2- (Dimethylamino) ethoxy] ethanol (Aldrich, 6.66 g, 50 mmol) is added slowly to a solution of borane in tetrahydrofuran (1M, 10 mL, 10 mmol) with stirring in a 100 mL pump . As the solid dissolves, gaseous hydrogen evolves. O2-, 2'-anhydro-5-methyluridine (1.2g, 5mmol) and sodium bicarbonate (2.5mg) are added and the pump is sealed, placed in an oil bath and heated to 155 ° C for 26 h. The pump cools down to room temperature. The crude solution is concentrated and the residue is partitioned between water (200 ml) and hexanes (200 ml). Excess phenol is removed in the hexane layer. The aqueous layer is extracted with ethyl acetate (3x200 ml) and the combined organic layers are washed once with water, dried over anhydrous sodium sulfate and concentrated. The residue is passed through a column of silica gel using 1:20 methanol / methylene chloride (which had 2% triethylamine) as the eluent. By concentrating the column fractions, a colorless solid forms which is collected to give the title compound as a white solid.

5'-O-Dimethoxytryl-2'-O- [2 (2-N, N-dimethylaminoethoxy) -ethyl)] - 5-methyl-uridine

To 0.5 g (1.3 mmol) of 2'-O- [2 (2-N, N-dimethylamino-ethoxy) ethyl)] - 5-methyl-uridine in anhydrous pyridine (8 ml), triethylamine is added (0.36 ml) and dimethoxytrityl chloride (DMT-Cl, 0.87 g, 2 eq.) And stir for 1 h. The reaction mixture is poured into water (200 ml) and extracted with CH2Cl2 (2x200 ml). The combined CH2Cl2 layers are washed with saturated NaHCO3 solution, followed by saturated NaCl solution, and dried over anhydrous sodium sulfate. Evaporation of the solvent followed by chromatography on silica gel using MeOH: CH2Cl2: Et3N (20: 1, v / v, with 1% triethylamine) gives the title compound.

5'-O-Dimethoxytryl-2'-O- [2 (2-N, N-dimethylamioethoxy) -ethyl)] - 5-methyl-uridine-3'-O- (cyanoethyl-N, N-diisopropyl) phosphoramidite

Diisopropylaminotetrazolide (0.6 g) and 2-cyanoethoxy-N, N-diisopropyl-phosphoramidite (1.1 ml, 2 eq.) Are added to a solution of 5'-O-dimethoxytryl-2'-O- [2 ( 2-N, N-dimethylaminoethoxy) ethyl)] - 5-methyluridine (2.17 g, 3 mmol) dissolved in CH2Cl2 (20 ml) under argon atmosphere. The reaction mixture is stirred overnight and the solvent is evaporated. The resulting residue is purified by flash column chromatography on silica gel with ethyl acetate as the eluent to give the title compound.

Example 2

Oligonucleotide synthesis

The unsubstituted and phosphodiester substituted oligonucleotides (P = O) are synthesized on an automated DNA synthesizer (Applied Biosystems model 380B) using standard phosphoramidite chemistry with iodine oxidation.

Phosphorothioates (P = S) are synthesized as phosphodiester oligonucleotides except that the standard oxidation bottle was replaced by 0.2M solution of 3H-1,2-benzodithiol-3-one 1,1-dioxide in acetonitrile for staggered thiation of phosphite bonds. The waiting stage of tiation was increased to 68 s and the finishing stage followed. After cleavage of the CPG column and deblocking in concentrated ammonium hydroxide at 55 ° C (18 h), the oligonucleotides were purified by precipitation twice with 2.5 volumes of ethanol from a 0.5 M NaCl solution Oligonucleotide phosphinates are prepared as described in US Pat. No. 5,508,270.

Oligonucleotide alkyl phosphonates are prepared as described in US Patent No. No. 4,469,863.

The oligonucleotide 3'-deoxy-3'-methylene phosphonates are prepared as described in US Pat. no.

5,610,289 or 5,625,050.

Oligonucleotide phosphoramidites are prepared as described in US Pat. 5,256,775 or U.S. Patent 5,366,878.

Oligonucleotide alkyl phosphonothioate is prepared as described in published PCT applications PCT / US94 / 00902 and PCT / US93 / 06976 (published as WO 94/17093 and WO 94/02499, respectively).

The oligonucleotide 3'-deoxy-3'-amino-phosphoramidates are prepared as described in US Pat.

5,476,925.

Oligonucleotide phosphotriesters are prepared as described in US Pat. 5,023,243.

Oligonucleotide borane phosphates are prepared as described in US Pat. 5,130,302 and

5,177,198.

5 Example 3

Oligonucleoside synthesis

Methylenemethylimino-linked oligonucleosides, also identified as MMI-linked oligonucleosides, methylenedimethylhydrazo-linked oligonucleosides, also identified as MDH-linked oligonucleosides, and methylene-carbonylamino-linked oligonucleosides, also identified as amide-3-linked oligonucleosides, and

10 methyleneaminocarbonyl-linked oligonucleosides, also identified as amide-4-linked oligonucleosides, as well as mixed main chain compounds having, for example, alternating MMI and P = O or P = S linkages are prepared as described in US Patent Nos. USA 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289.

The formacetal and thioformacetal linked oligonucleosides are prepared as described in US Pat.

5,264,562 and 5,264,564.

Oligonucleosides bound to ethylene oxide are prepared as described in US Pat. 5,223,618.

Example 4

PNA synthesis

Peptide nucleic acids (PNA) are prepared according to any of several different procedures cited in Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 20 1996, 4, 5-23. They can also be prepared according to US Pat. 5,539,082, 5,700,922, and

5,719,262.

Example 5

Synthesis of chimeric oligonucleotides

The chimeric oligonucleotides, oligonucleosides, or mixed oligonucleotides / oligonucleosides of the invention can

25 be of various kinds. These include a first type in which the "hollow" segment of linked nucleosides is located between the 5 'and 3' wing segments of linked nucleosides and a second type of "open end" where the "huceo" segment is located at the end, either 3 'or 5' terminal of the oligomeric compound. Oligonucleotides of the first type are also known in the art as "gapmers" or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as "hemimers" or "alphas".

30 [2'-O-Me] - [2'-deoxy] - [2'-O-Me] Chimeric phosphorothioate oligonucleotides

Chimeric oligonucleotides having 2'-O-alkyl-phosphorothioate and 2'-deoxyphosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems Model 380B automated DNA synthesizer, as above. The oligonucleotides are synthesized using the automatic synthesizer and the 2'-deoxy-5'-dimethoxytryl-3'-O-phosphoramidite for the DNA part and the 5'-dimethoxytryl-2'-O-methyl-3'-O- phosphoramidite for the 5 'and 3' wings. The conventional synthesis cycle is modified by increasing the waiting step after tetrazole and base supply to 600 s, repeated four times for RNA and twice for 2'-O-methyl. The fully protected oligonucleotide is cleaved from the support and the phosphate group is deprotected in 3: 1 ammonia / ethanol at room temperature overnight and then lyophilized to dryness. The treatment is then done in methanolic ammonia for 24 h at room temperature to deprotect all the bases and the sample is lyophilized to dryness again. The

The pellet is resuspended in 1M TBAF in THF for 24 hr at room temperature to deprotect the 2 'positions. The reaction is then quenched with 1M TEAA and then the sample is reduced to 1/2 volume by Rotavac before desalting on a G25 size exclusion column. The yield and purity are then analyzed on the recovered oligomer spectrophotometrically by capillary electrophoresis and mass spectrometry.

45 [2'-O- (2-Methoxyethyl)] - [2'-deoxy] - (2'-O- (methoxyethyl)] - chimeric phosphorothioate oligonucleotides

The [2'-O- (2-methoxyethyl)] - [2'-deoxy] - [- 2'-O- (methoxyethyl)] - chimeric phosphorothioate oligonucleotides were prepared in the same way as for the 2'-O- chimeric methyl-oligonucleotide, substituting 2'-O-methyl-amidites for 2'-O- (methoxyethyl) -amidites.

[2'-O- (2-Methoxyethyl) phosphodiester] - [2'-deoxy-phosphorothioate] - [2'-O- (2-methoxyethyl) -phosphodiester] -chimeric oligonucleotides

The [2'-O- (2-methoxyethyl-phosphodiester] - [2'-deoxy phosphorothioate] - [2'-O- (methoxyethyl) -phosphodiester] -oligonucleotides

Chimeric are prepared the same as by the previous procedure for the chimeric 2'-O-methyl-oligonucleotides substituting 2'-O- (methoxyethyl) -amidites for the 2'-O-methyl-amidites, oxidation with iodine to generate the internucleotide bonds phosphodiester within the wing portions for chimeric structures and sulfidation using 3, H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the inner center region.

Other chimeric oligonucleotides, chimeric oligonucleosides, and chimeric mixed oligonucleotides / oligonucleosides are synthesized according to US Patent 5,623,065.

Example 6

Oligonucleotide isolation

After cleavage of the controlled-pore glass column (Applied Biosystems) and unblocking in concentrated ammonium hydroxide at 55 ° C for 18 h, the oligonucleotides or oligonucleosides are purified by precipitation twice in 0.5M NaCl with 2, 5 volumes of ethanol. The synthesized oligonucleotides were analyzed by polyacrylamide gel electrophoresis on denaturing gels and at least 85% were considered to be full length material. The relative amounts of phosphorothioate and phosphodiester bonds obtained were periodically checked by 31P nuclear magnetic resonance spectroscopy, and for some studies the oligonucleotides were purified by HPLC as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162- 18171. The results obtained with the HPLC-purified material were similar to those obtained with the non-HPLC-purified material.

Example 7

Oligonucleotide Synthesis - 96-well Plate Format

Oligonucleotides were synthesized by solid phase phosphoramidite P (III) chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a standard 96-well format. Phosphodiester internucleotide linkages were provided by oxidation with aqueous iodine. The phosphorothioate internucleotide linkages were generated by sulfidation using 3, H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucage Reagent) in anhydrous acetonitrile. Conventional protected base beta-cyanoethyldiisopropyl phosphoramidites were purchased from commercial suppliers (eg, PE-Applied Biosystems, Foster City, CA, or Pharmacia, Piscataway, NJ). Unconventional nucleosides are synthesized by proprietary or known literature methods. They are used as the protected base beta-cyanoethyldiisopropyl-phosphoramidites.

The oligonucleotides were excised from the support and deprotected with concentrated NH4OH at elevated temperature (55-60 ° C) for 12-16 h and then the released product was dried in vacuo. The dried product was then resuspended in sterile water to give a mother plate, from which all test and analytical plate samples are diluted using robotic pipettes.

Example 8

Oligonucleotide Analysis - 96-well Plate Format

The concentration of oligonucleotides in each well was evaluated by dilution of the samples and UV absorption spectroscopy. The integrity of the full length of the individual products was evaluated by capillary electrophoresis (CE) in the 96-well format (Beckman P / ACE ™ NDQ) or, for samples prepared individually, in a commercial CE apparatus (eg. ., Beckman P / ACE ™ 5000, ABI 270). The composition of bases and of the main chain was confirmed by mass analysis of the compounds using electrospray mass spectroscopy. All test plates were diluted from the mother plate using robotic single and multi channel pipettes. Plates were considered acceptable if at least 85% of the compounds on the plate were at least 85% of the full length.

Example 9

Cell culture and oligonucleotide treatment

The effect of antisense compounds on expression of the target nucleic acid can be tested in any of a variety of cell types, provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example PCR or Northern blot analysis. The following 7 cell types are provided for illustrative purposes only, but other cell types may be routinely used, provided that the target is expressed in the chosen cell type. This can be readily determined by routine methods in the art, eg, Northern blot analysis, ribonuclease protection assays, or RT-PCR.

T-24 cells:

The T-24 human transitional cell bladder cell carcinoma cell line was obtained from the American Type Culture Collection (ATCC) (Manassas, VA). T-24 cells were routinely cultured in basal medium

McCoy 5A Complete (Gibco / Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco / Life Technologies, Gaithersburg, MD), penicillin 100 units per ml, and streptomycin 100 micrograms per ml (Gibco / Life Technologies , Gaithersburg, MD). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded in 96-well plates (Falcon-Primary # 3872) with a density of 7000 cells / well for use in RT-PCR analysis.

For Northern blot analysis and other analyzes, cells can be seeded into 100mm or other conventional tissue tissue plates and treated in a similar manner, using volumes of medium and the appropriate oligonucleotide.

A549 cells:

The A549 human lung carcinoma cell line was obtained from the American Type Culture Collection (ATCC) (Manassas, VA). A549 cells were routinely cultured in DMEM basal medium (Gibco / Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco / Life Technologies, Gaithersburg, MD), penicillin 100 units per ml, and streptomycin 100 micrograms per ml (Gibco / Life Technologies, Gaithersburg, MD). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence.

NHDF cells:

Human neonatal dermal fibroblasts (NHDF) were obtained from the Clonetics Corporation (Walkersville MD). NHDFs were routinely maintained in fibroblast growth medium (Clonetics Corporation, Walkersville MD) supplemented as recommended by the supplier. Cells were maintained for up to 10 passages as recommended by the provider.

HEK cells:

Human embryonic keratinocytes (HEK) were obtained from the Clonetics Corporation (Walkersville MD). HEKs were routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville MD) formulated as recommended by the supplier. Cells were routinely maintained for up to 10 passages as recommended by the provider.

HepG2 cells:

The HepG2 human hepatoblastoma cell line was obtained from the American Type Culture Collection (Manassas, VA). HepG2 cells were routinely cultured in Eagle's MEM supplemented with 10% fetal calf serum, non-essential amino acids, and 1 mM sodium pyruvate (Gibco / Life Technologies, Gaithersburg, MD). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded in 96-well plates (Falcon-Primary # 3872) with a density of 7000 cells / well for use in RT-PCR analysis.

For Northern blot analysis or other analyzes, cells can be seeded into 100mm or other conventional tissue tissue plates and treated in a similar manner, using volumes of medium and the appropriate oligonucleotide.

AML12 cells:

The AML12 cell line (mouse hepatic alpha 12) was established from mouse hepatocytes (strain CD1, line MT42) transgenic for human TGF alpha. Cells are grown in a 1: 1 mixture of Dulbecco's Modified Eagle's Medium and Ham's F12 Medium with 0.005 mg / ml insulin, 0.005 mg / ml transferrin, 5 ng / ml selenium, and 40 ng / ml dexamethasone, and 90% ; 10% fetal bovine serum. For the subculture, the spent medium is removed and fresh 0.25% trypsin dissolution medium, 0.03% EDTA is added. Fresh trypsin solution (1 to 2 ml) is added and the culture is allowed to settle at room temperature until the cells are shed.

Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded in 96-well plates (Falcon-Primary # 3872) with a density of 7000 cells / well for use in RT-PCR analysis.

For Northern blot analysis or other analyzes, cells can be seeded into 100mm or other conventional tissue tissue plates and treated in a similar manner, using volumes of medium and the appropriate oligonucleotide.

Primary mouse hepatocytes:

Primary mouse hepatocytes were prepared from CD-1 mice purchased from Charles River Labs (Wilmington, MA) and routinely cultured in hepatocyte adherence medium (Gibco) supplemented with 10% fetal bovine serum (Gibco / Life Technologies, Gaithersburg, MD), 250 nM dexamethasone (Sigma), and 10 nM insulin (Sigma). Cells were plated in 96-well plates (Falcon-Primary # 3872) at a density of 10,000 cells / well for use in RT-PCR analysis.

For Northern blot analysis or other analyzes, cells are grown in 100 mm cell culture dishes or other conventional plates coated with rat tail collagen (200 ug / ml) (Becton Dickinson) and treated similarly using the volumes of suitable medium and oligonucleotide.

5 Hep3B cells:

The Hep3B human hepatocellular carcinoma cell line was obtained from the American Type Culture Collection (Manassas, VA). Hep3B cells were routinely cultured in high glucose Dulbeccos MEM supplemented with 10% fetal calf serum, L-glutamine and pyridoxine hydrochloride (Gibco / Life Technologies, Gaithersburg, MD). Cells were routinely passaged by trypsinization and dilution

10 when they reached 90% confluence. Cells were plated into 24-well plates (Falcon-Primary # 3846) with a density of 50,000 cells / well for use in RT-PCR analysis.

For Northern blot analysis or other analyzes, cells can be seeded into 100mm or other conventional tissue tissue plates and treated in a similar manner, using volumes of medium and the appropriate oligonucleotide.

15 Primary rabbit liver cells:

Rabbit primary hepatocytes were purchased from Invitro Technologies (Gaithersburg, MD) and maintained in Dulbecco's modified Eagle medium (Gibco). When purchased, cells had been seeded in 96-well plates for use in RT-PCR analysis and were confluent.

For Northern blot analysis or other analyzes, cells can be plated on tissue tissue plates

20 of 100 mm or other conventional ones and treat in a similar way, using volumes of medium and the appropriate oligonucleotide.

HeLa cells:

The HeLa epiteloid carcinoma cell line was obtained from the American Tissue Type Culture Collection (Manassas, VA). HeLa cells were routinely cultured in high glucose DMEM (Invitrogen 25 Corporation, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitrogen Corporation, Carlsbad, CA). Cells were plated into 24-well plates (Falcon-Primary # 3846) with a density of 50,000 cells / well for use in RT-PCR analysis. Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were plated in 96-well plates (Falcon-Primary # 3872) with a density of 5,000 cells / well for use in RT-PCR analysis. For the

With Northern blot analysis or other assays, cells can be seeded into 100mm or other conventional tissue tissue plates and treated in a similar manner, using volumes of suitable medium and oligonucleotide.

Human mammary epithelial cells:

Normal human mammary epithelial cells (HMEC) were obtained from the American Type Culture Collection (Manassas VA). HMECs were routinely cultured in low glucose DMEM (Gibco / Life 35 Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco / Life Technologies, Gaithersburg, MD). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were plated in 96-well plates (Falcon-Primary # 353872, BD Biosciences, Bedford, MA) at a density of 7000 cells / well for use in RT-PCR analysis. For Northern blot analysis or other analyzes, cells can be plated on 100 tissue tissue plates

40 mm or other conventional ones and treat in a similar way, using volumes of medium and the appropriate oligonucleotide.

Treatment with antisense compounds:

When the cells reached 80% confluence, they were treated with the oligonucleotide. For cells grown in 96-well plates, the wells were washed once with 200 µl serum-reduced OPTI-MEM ™ -1 medium (Gibco BRL) and treated with 130 µl OPTI-MEM ™ -1 containing 3 , 75 μg / ml LIPOFECTIN ™ (Gibco BRL) and the

45 desired concentration of the oligonucleotide. After 4-7 h of treatment, the medium was replaced with fresh medium. Cells were harvested 16-24 hr after oligonucleotide treatment.

The concentration of the oligonucleotide used varies from one cell line to another. To determine the optimal oligonucleotide concentration for a particular cell line, cells were treated with a positive control oligonucleotide over a concentration range. For human cells the positive control oligonucleotide is ISIS 50 13920, TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1, a 2'-O-methoxyethyl-gapmer (the 2'-O-methoxyethyl is shown in bold) with a phosphorothioate backbone that He is targeting human H-ras. For mouse cells

or rat the positive control oligonucleotide is ISIS 15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 2, a 2'-Omethoxyethyl-gapmer (2'-O-methoxyethyl shown in bold) with a phosphorothioate backbone that targets c -raf both mouse and rat. The concentration of the positive control oligonucleotide that gives as

Result 80% inhibition of c-Ha-ras (for ISIS 13920) or c-raf (for ISIS 15770) mRNA is then used as a screening concentration for new oligonucleotides in subsequent experiments for that cell line. If 80% inhibition is not reached, then the lowest concentration of the positive control oligonucleotide that results in 60% inhibition of the H-ras or c-raf mRNA is used as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not reached, that particular cell line is considered unsuitable for oligonucleotide transfection experiments. The antisense oligonucleotide concentrations used herein are from 5 nM to 300 nM.

Example 10

Analysis of oligonucleotide inhibition of apolipoprotein B expression

Antisense modulation of apolipoprotein B expression can be tested in a variety of ways known in the art. For example, apolipoprotein B mRNA levels can be quantified by, e.g. eg, Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Quantitative real-time PCR is currently preferred. RNA analysis can be performed on total cellular RNA or poly (A) + mRNA. RNA isolation methods are taught, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Northern analysis is routine in the art and is taught, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc., 1996. Quantitative real-time PCR can be conveniently carried out using the ABI PRISM ™ 7700 Sequence Detection System available from PE-Applied Biosystems, Foster City, CA, and use it according to the manufacturer's instructions.

Apolipoprotein B protein levels can be quantified in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblot), ELISA, or fluorescence activated cell sorting (FACS). Antibodies directed against apolipoprotein B can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared by conventional antibody generation methods. Methods for preparing polyclonal antisera are taught, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. The preparation of monoclonal antibodies is taught, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.

Immunoprecipitation methods are conventional in the art, and can be found, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley & Sons, Inc., 1998. Western blot analysis (immunoblot) is conventional in the art and can be found, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Bound enzyme immunosorbent assays (ELISA) are standard in the art, and can be found, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991.

Example 11

Isolation of poly (A) + mRNA

Poly (A) + mRNA was isolated according to Miura et al., Clin. Chem., 1996, 42, 1758-1764. Other methods of isolating poly (A) + mRNA are taught, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Briefly, to grow cells in 96-well plates, the growth medium was removed from the cells and each well was washed with 200 µl cold PBS. 60 µl of lysis buffer (10mM Tris-HCl pH 7.6, 1mM EDTA, 0.5M NaCl, 0.5% NP-40, 20mM vanadyl-ribonucleoside complex) were added to each well , the plate was gently shaken and then incubated at room temperature for 5 min. 55 µl of lysate were transferred to Oligo d (T) coated 96-well plates (AGCT Inc., Irvine CA). Plates were incubated for 60 min at room temperature, washed 3 times with 200 µl of wash buffer (10mM Tris-HCl pH 7.6, 1mM EDTA, 0.3M NaCl). After the final wash, the plate was transferred to paper towels to remove excess wash buffer and air dried for 5 min. 60 µl of elution buffer (5mM Tris-HCl pH 7.6), preheated to 70 ° C, was added to each well, the plate was incubated on a hot plate at 90 ° C for 5 min, and then the eluate was transferred to a new 96-well plate.

Cells grown in 100mm plates or other conventional plates can be treated similarly, using adequate volumes of all solutions.

Example 12

Isolation of total RNA

Total RNA was isolated using the RNEASY 96 ™ kit and buffers purchased from Qiagen Inc. (Valencia CA) following the procedures described by the manufacturer. Briefly, to grow cells in 96-well plates, the growth medium was removed from the cells and each well was washed with 200 µl cold PBS. 100 µl of RLT buffer was added to each well and the plate was shaken vigorously for 20 seconds. Then 100 µl of 70% ethanol was added to each well and the contents were mixed by loading and unloading the pipette 3 times. The samples were then transferred to the RNEASY 96 ™ 96-well plate attached to a QIAVAC ™ collector equipped with a

5 waste collection attached to a vacuum source. Vacuum was applied for 15 s. 1 ml of RW1 buffer was added to each well of the RNEASY 96 ™ plate and the vacuum was reapplied for 15 seconds. Then, 1 ml of RPE buffer was added to each well of the RNEASY 96 ™ plate and the vacuum was applied over a period of 15 seconds. The RPE wash was then repeated and vacuum was applied for an additional 10 min. The QIAVAC ™ collector plate was then removed and dry transferred onto paper towels. The plate was then reattached to the QIAVAC ™ manifold equipped with a rack with a collection tube rack containing 1.2 ml collection tubes. The RNA was then eluted by pipetting 60 µl of water into each well, incubating for 1 min and then applying the vacuum for 30 seconds. The elution step was repeated with an additional 60 µl of water.

The repetitive pipetting and elution steps can be automated with a QIAGEN Bio-Robot 9604 kit (Qiagen, Inc., Valencia CA). Essentially, after lysis of the cells in the culture plate, the plate is transferred to the

15 robot platform where the pipetting, DNase treatment and elution stages are carried out.

Example 13

Real-time quantitative PCR analysis of apolipoprotein B mRNA levels

Quantification of apolipoprotein B mRNA levels were determined using the ABI PRISM ™ 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. This is a closed tube, non-gel based fluorescence detection system that enables high-capacity quantification of polymerase chain reaction (PCR) products in real time. Unlike conventional PCR, in which amplification products are quantified after PCR is complete, products in quantitative real-time PCR are quantified when accumulated. This is accomplished by including in the PCR reaction an oligonucleotide probe that specifically anneals between the forward and reverse PCR primers, and contains two fluorescent dyes. An indicator dye (eg JOE, FAM, or VIC, obtained from Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA) binds to the 5 'end of the probe and an attenuator dye (eg, TAMRA, obtained from Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA) binds to the 3 'end of the probe. When the probe and dye are intact, the emission of the indicator dye is attenuated by the proximity of the 3 'quenching dye. During amplification, reassociation of the probe with the target sequence creates a substrate that can be cleaved by the 5'-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the indicator dye from the rest of the probe (and therefore the quencher residue) and a sequence specific fluorescent signal is generated . With each cycle, additional indicator molecules are cleaved from their respective

35 probes, and fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM ™ 7700 Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from control samples did not Treated generates a standard curve that is used to quantify the percent inhibition after treatment of the test samples with antisense oligonucleotide.

Prior to quantitative PCR analysis, the ability of the primer-probe sets specific for the target gene being measured is evaluated to "multiplex" with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal reference gene GAPDH are simultaneously amplified in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific only for GAPDH, only for the target gene

45 ("individual plexing"), or for both (multiplexing). Following PCR amplification, the standard curves of the GADPH and target mRNA signal are generated as a function of dilution, from both the single and multiplexed plexing samples. If both the slope and the correlation coefficient of the GADPH and target signals generated from the multiplexed samples are within 10% of their corresponding values generated from individual plexed samples, the specific primer-probe set for that target it is considered that it can be multiplexed. Other PCR methods are also known in the art.

The PCR reagents were obtained from PE-Applied Biosystems, Foster City, CA. RT-PCR reactions were carried out by adding 25 µl of PCR cocktail (1x A TAQMAN ™ buffer, 5.5 mM MgCl2, 300 µM each of dATP, dCTP and dGTP, 600 µM dUTP, 100 nM of each one from the forward primer, reverse primer and probe, 1.25 units of AMPLITAQ GOLD ™, and 12.5 units of MuLV reverse transcriptase) to 96-well plates that

55 contained 25 µl of total RNA solution. The RT reaction was carried out by incubation for 30 min at 48 ° C. After a 10 min incubation at 95 ° C to activate AMPLITAQ GOLD ™, 40 cycles of a two-step PCR protocol were performed: 95 ° C for 15 seconds (denaturation) followed by 60 ° C for 1.5 minutes (reassociation / extension).

Amounts of the target gene obtained by real-time RT-PCR were normalized using the expression level of GAPDH, a gene whose expression is constant, or by quantification of total RNA using RiboGreen ™ (Molecular

Probes, Inc. Eugene, OR). GAPDH expression is quantified by real-time RT-PCR, carried out simultaneously with the target, multiplexed, or separately. Total RNA is quantified using the Molecular Probes RiboGreen ™ RNA Quantification Reagent. RiboGreen ™ RNA quantification methods are taught in Jones, L.J., et al, Analytical Biochemistry, 1998, 265, 368-374.

In this assay, 175 µl of RiboGreen ™ working reagent (RiboGreen ™ reagent diluted 1: 2865 in 10mM Tris-HCl, 1mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 25 µl of purified cellular RNA. The plate is read on a CytoFluor 4000 apparatus (PE Applied Biosystems) with excitation at 480 nm and emission at 520 nm.

Probes and primers for human apolipoprotein B were designed to hybridize to a sequence of human apolipoprotein B, using the published sequence information (GenBank accession number NM_000384.1, incorporated herein as SEQ ID NO: 3) . For human apolipoprotein B the PCR primers were: forward primer: TGCTAAAGGCACATATGGCCT (SEQ ID NO: 4) reverse primer: CTCAGGTTGGACTCTCCATTGAG (SEQ ID NO: 5) and the PCR probe was: FAM-CTTGTCAGAGGGATCCTAACGTG NO: 6) where FAM (PE-Applied Biosystems, Foster City, CA) is the fluorescent indicator dye and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye. For human GAPDH the PCR primers were: forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 7) reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 8) and the PCR probe was: 5 'JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID NO: 9) where JOE (PE-Applied Biosystems, Foster City, CA) is the fluorescent indicator dye and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye.

Probes and primers for mouse apolipoprotein B were designed to hybridize with a mouse apolipoprotein B sequence, using the published sequence information (GenBank accession number M35186, incorporated herein as SEQ ID NO: 10) . For mouse apolipoprotein B the PCR primers were: forward primer: CGTGGGCTCCAGCATTCTA (SEQ ID NO: 11) reverse primer: AGTCATTTCTGCCTTTGCGTC (SEQ ID NO: 12) and the PCR probe was: FAM-CCAATGGTCGGGCACTGCTCAA-T NO: 13) where FAM (PE-Applied Biosystems, Foster City, CA) is the fluorescent indicator dye and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye. For mouse GAPDH the PCR primers were: forward primer: GGCAAATTCAACGGCACAGT (SEQ ID NO: 14) reverse primer: GGGTCTCGCTCCTGGAAGAT (SEQ ID NO: 15) and the PCR probe was: 5 'JOE-AAGGCCGAGAATGGGAAGCTTTC '(SEQ ID NO: 16) where JOE (PE-Applied Biosystems, Foster City, CA) is the fluorescent indicator dye and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye.

Example 14

Northern blot analysis of apolipoprotein B mRNA levels

Eighteen hours after antisense treatment, the cell monolayers were washed twice with cold PBS and lysed in 1 ml of RNAZOL ™ (TEL-TEST "B" Inc., Friendswood, TX). Total RNA was prepared following the manufacturer's recommended protocols. 20 micrograms of total RNA was fractionated by electrophoresis by 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, OH). RNA was transferred from the gel to HYBOND ™ -N + nylon membranes (Amersham Pharmacia Biotech, Piscataway, NJ) by capillary transfer overnight using a Northern / Southern transfer buffer system (TEL-TEST "B" Inc., Friendswood, TX). RNA transfer was confirmed by UV visualization. Membranes were fixed by UV crosslinking using a STRATALINKER ™ UV Crosslinker 2400 UV crosslinker (Stratagene, Inc, La Jolla, CA) and then probe treated using QUICKHYB ™ hybridization solution (Stratagene, La Jolla, CA) using the recommendations from the manufacturer for restrictive conditions.

To detect human apolipoprotein B, a human apolipoprotein B specific probe was prepared by PCR using the TGCTAAAGGCACATATGGCCT forward primer (SEQ ID NO: 4) and the CTCAGGTTGGACTCTCCATTGAG reverse primer (SEQ ID NO: 5). To normalize variations in loading and transfer efficiency, membranes were cut into strips and treated with probes for human glyceraldehyde-3phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, CA).

To detect mouse apolipoprotein B, a human apolipoprotein B specific probe was prepared by PCR using the forward primer CGTGGGCTCCAGCATTCTA (SEQ ID NO: 11) and reverse primer AGTCATTTCTGCCTTTGCGTC (SEQ ID NO: 12). To normalize variations in loading and transfer efficiency, membranes were cut into strips and treated with probes for mouse glyceraldehyde-3phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, CA).

Hybridized membranes were visualized and quantified using the phosphoRIMAGER ™ and IMAGEQUANT ™ V3.3 Software (Molecular Dynamics, Sunnyvale, CA). Data were normalized for GAPDH levels in untreated controls.

Example 15

Antisense inhibition of human apolipoprotein B expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

A series of oligonucleotides were designed to target different regions of human apolipoprotein B RNA,

5 using the published sequence (GenBank accession number NM_000384.1, incorporated herein as SEQ ID NO: 3). The oligonucleotides are shown in Table 1. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 1 are chimeric oligonucleotides ("gammers") 20 nucleotides in length, composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which are flanked on both sides

10 (5 'and 3' directions) for 5-nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels in HepG2 cells was analyzed by quantitative real-time PCR, as described in other examples herein. Data are means of two experiments in which the

15 HepG2 cells were treated with the compounds in Table 1 in 150 nM concentration. If present, "N.D." indicates "no data".

Table 1

Inhibition of mRNA levels of human apolipoprotein B by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

147780

5'UTR 3 one CCGCAGGTCCCGGTGGGAAT 40 17

147781

5'UTR 3 twenty-one ACCGAGAAGGGCACTCAGCC 35 18

147782

5'UTR 3 71 GCCTCGGCCTCGCGGCCCTG 67 19

147783

Start codon 3 114 TCCATCGCCAGCTGCGGTGG N.D. twenty

147784

Coding 3 151 CAGCGCCAGCAGCGCCAGCA 70 twenty-one

147785

Coding 3 181 GCCCGCCAGCAGCAGCAGCA 29 22

147786

Coding 3 321 CTTGAATCAGCAGTCCCAGG 3. 4 2. 3

147787

Coding 3 451 CTTCAGCAAGGCTTTGCCCT N.D. 24

147788

Coding 3 716 TTTCTGTTGCCACATTGCCC 95 25

147789

Coding 3 911 GGAAGAGGTGTTGCTCCTTG 24 26

147790

Coding 3 951 TGTGCTACCATCCCATACTT 33 27

147791

Coding 3 1041 TCAAATGCGAGGCCCATCTT N.D. 28

147792

Coding 3 1231 GGACACCTCAATCAGCTGTG 26 29

147793

Coding 3 1361 TCAGGGCCACCAGGTAGGTG N.D. 30

147794

Coding 3 1561 GTAATCTTCATCCCCAGTGC 47 31

147795

Coding 3 1611 TGCTCCATGGTTTGGCCCAT N.D. 32

147796

Coding 3 1791 GCAGCCAGTCGCTTATCTCC 8 33

147797

Coding 3 2331 GTATAGCCAAAGTGGTCCAC N.D. 3. 4

147798

Coding 3 2496 CCCAGGAGCTGGAGGTCATG N.D. 35

147799

Coding 3 2573 TTGAGCCCTTCCTGATGACC N.D. 36

147800

Coding 3 2811 ATCTGGACCCCACTCCTAGC N.D. 37

147801

Coding 3 2842 CAGACCCGACTCGTGGAAGA 38 38

147802

Coding 3 3367 GCCCTCAGTAGATTCATCAT N.D. 39

147803

Coding 3 3611 GCCATGCCACCCTGTTGGAA N.D. 40

147804

Coding 3 3791 AACCCACGTGCCGGAAAGTC N.D. 41

147805

Coding 3 3841 AGTCCCAGATGCCTTCTGAA N.D. 42

147806

Coding 3 4281 ATGTGGTAACGAGCCCGAAG 100 43

147807

Coding 3 4391 GGCGTAGAGACCGATCACAT 25 44

147808

Coding 3 4641 GTGTTAGGATCCCTCTGACA N.D. Four. Five

147809

Coding 3 5241 CCCAGTGATAGCTCTGTGAG 60 46

147810

Coding 3 5355 ATTTCAGCATATGAGCCCAT 0 47

147811

Coding 3 5691 CCCTGAACCTTAGCAACAGT N.D. 48

147812

Coding 3 5742 GCTGAAGCCAGCCCAGCGAT N.D. 49

147813

Coding 3 5891 ACAGCTGCCCAGTATGTTCT N.D. fifty

147814

Coding 3 7087 CCCAATAAGATTTATAACAA 3. 4 51

147815

Coding 3 7731 TGGCCTACCAGAGACAGGTA Four. Five 52

147816

Coding 3 7841 TCATACGTTTAGCCCAATCT 100 53

147817

Coding 3 7901 GCATGGTCCCAAGGATGGTC 0 54

147818

Coding 3 8491 AGTGATGGAAGCTGCGATAC 30 55

147819

Coding 3 9181 ATGAGCATCATGCCTCCCAG N.D. 56

147820

Coding 3 9931 GAACACATAGCCGAATGCCG 100 57

147821

Coding 3 10263 GTGGTGCCCTCTAATTTGTA N.D. 58

147822

Coding 3 10631 CCCGAGAAAGAACCGAACCC N.D. 59

147823

Coding 3 10712 TGCCCTGCAGCTTGACTGAA 19 60

147824

Coding 3 11170 GAAATCCCATAAGCTCTTGT N.D. 61

147825

Coding 3 12301 AGAAGCTGCCTCTTCTTCCC 72 62

147826

Coding 3 12401 TCAGGGTGAGCCCTGTGTGT 80 63

147827

Coding 3 12471 CTAATGGCCCCTTGATAAAC 13 64

147828

Coding 3 12621 ACGTTATCCTTGAGTCCCTG 12 65

147829

Coding 3 12741 TATATCCCAGGTTTCCCCGG 64 66

147830

Coding 3 12801 ACCTGGGACAGTACCGTCCC N.D. 67

147831

3'UTR 3 13921 CTGCCTACTGCAAGGCTGGC 0 68

147832

3'UTR 3 13991 AGAGACCTTCCGAGCCCTGG N.D. 69

147833

3'UTR 3 14101 ATGATACACAATAAAGACTC 25 70

As shown in Table 1, SEQ ID NOs 17, 18, 19, 21, 23, 25, 27, 31, 38, 43, 46, 51, 52, 53, 55, 57, 62, 63, and 66 demonstrated at least 30% inhibition of human apolipoprotein B expression in this assay and are therefore preferred. The target sites to which these preferred sequences are complementary are referred to herein as "active sites" and are therefore preferred sites for targeting the compounds herein

5 description. Since apolipoprotein B exists in two mammalian forms (ApoB-48 and ApoB-100) that are collinear at the amino terminus, antisense oligonucleotides that target nucleotides 1-6530 hybridize to both forms, whereas those that are target nucleotides 6531-14121 are specific to the long form of apolipoprotein B.

Example 16

10 Antisense Inhibition of Human Apolipoprotein B Expression by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap - Dose-response Study

A subset of antisense oligonucleotides from Example 15 were further investigated in dose-response studies. The treatment doses were 50, 150 and 250 nM. The effect of the compounds on human apolipoprotein B mRNA levels in HepG2 cells was analyzed by quantitative real-time PCR, as described in

15 other examples herein. Data are means from two experiments and are shown in Table 2.

Table 2

Inhibition of mRNA levels of human apolipoprotein B by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

Inhibition percentage

ISIS number

50 nM 150 nM 250 nM

147788

54 63 72

147806

2. 3 Four. Five 28

147816

25 81 65

147820

10 0 73

20 Example 17

Antisense inhibition of mouse apolipoprotein B expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

A series of oligonucleotides were designed to target different regions of mouse apolipoprotein B RNA, using the published sequence (GenBank accession number M35186, incorporated herein by SEQ ID NO: 10). The oligonucleotides are shown in Table 3. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 3 are 20 nucleotide long chimeric oligonucleotides ("gammers"), composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5 'directions and 3 ') by "wings" of 5 nucleotides. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. The links

Internucleosides (main chain) are phosphorothioate (P = S) linkages throughout the entire oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on mouse apolipoprotein B mRNA levels in primary mouse hepatocytes was analyzed by quantitative real-time PCR, as described in other examples herein. Primary mouse hepatocytes were treated with the 150 mM compounds in Table 3. Data are means from two experiments. If present, "N.D." indicates "no data".

Table 3

Inhibition of mouse apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

147475

Coding 10 13 ATTGTATGTGAGAGGTGAGG 79 71

147476

Coding 10 66 GAGGAGATTGGATCTTAAGG 13 72

147477

Coding 10 171 CTTCAAATTGGGACTCTCCT N.D 73

147478

Coding 10 211 TCCAGGAATTGAGCTTGTGC 78 74

147479

Coding 10 238 TTCAGGACTGGAGGATGAGG N.D 75

147480

Coding 10 291 TCTCACCCTCATGCTCCATT 54 76

147481

Coding 10 421 TGACTGTCAAGGGTGAGCTG 24 77

147482

Coding 10 461 GTCCAGCCTAGGAACACTCA 59 78

147483

Coding 10 531 ATGTCAATGCCACATGTCCA N.D 79

147484

Coding 10 581 TTCATCCGAGAAGTTGGGAC 49 80

147485

Coding 10 601 ATTTGGGACGAATGTATGCC 64 81

147486

Coding 10 711 AGTTGAGGAAGCCAGATTCA N.D 82

147487

Coding 10 964 TTCCCAGTCAGCTTTAGTGG 73 83

147488

Coding 10 1023 AGCTTGCTTGTTGGGCACGG 72 84

147489

Coding 10 1111 CCTATACTGGCTTCTATGTT 5 85

147490

Coding 10 1191 TGAACTCCGTGTAAGGCAAG N.D 86

147491

Coding 10 1216 GAGAAATCCTTCAGTAAGGG 71 87

147492

Coding 10 1323 CAATGGAATGCTTGTCACTG 68 88

147493

Coding 10 1441 GCTTCATTATAGGAGGTGGT 41 89

147494

Coding 10 1531 ACAACTGGGATAGTGTAGCC 84 90

147495

Coding 10 1631 GTTAGGACCAGGGATTGTGA 0 91

147496

Coding 10 1691 ACCATGGAAAACTGGCAACT 19 92

147497

Coding 10 1721 TGGGAGGAAAAACTTGAATA N.D 93

147498

Coding 10 1861 TGGGCAACGATATCTGATTG 0 94

147499

Coding 10 1901 CTGCAGGGCGTCAGTGACAA 29 95

147500

Coding 10 1932 GCATCAGACGTGATGTTCCC N.D 96

147501

Coding 10 2021 CTTGGTTAAACTAATGGTGC 18 97

147502

Coding 10 2071 ATGGGAGCATGGAGGTTGGC 16 98

147503

Coding 10 2141 AATGGATGATGAAACAGTGG 26 99

147504

Coding 10 2201 ATCAATGCCTCCTGTTGCAG N.D 100

147505

Coding 10 2231 GGAAGTGAGACTTTCTAAGC 76 101

147506

Coding 10 2,281 AGGAAGGAACTCTTGATATT 58 102

147507

Coding 10 2321 ATTGGCTTCATTGGCAACAC 81 103

147759

Coding 10 one AGGTGAGGAAGTTGGAATTC 19 104

147760

Coding 10 121 TTGTTCCCTGAAGTTGTTAC N.D 105

147761

Coding 10 251 GTTCATGGATTCCTTCAGGA Four. Five 106

147762

Coding 10 281 ATGCTCCATTCTCACATGCT 46 107

147763

Coding 10 338 TGCGACTGTGTCTGATTTCC 3. 4 108

147764

Coding 10 541 GTCCCTGAAGATGTCAATGC 97 109

147765

Coding 10 561 AGGCCCAGTTCCATGACCCT 59 110

147766

Coding 10 761 GGAGCCCACGTGCTGAGATT 59 111

147767

Coding 10 801 CGTCCTTGAGCAGTGCCCGA 5 112

147768

Coding 10 1224 CCCATATGGAGAAATCCTTC 24 113

147769

Coding 10 1581 CATGCCTGGAAGCCAGTGTC 89 114

147770

Coding 10 1,741 GTGTTGAATCCCTTGAAATC 67 115

147771

Coding 10 1781 GGTAAAGTTGCCCATGGCTG 68 116

147772

Coding 10 1841 GTTATAAAGTCCAGCATTGG 78 117

147773

Coding 10 1931 CATCAGACGTGATGTTCCCT 85 118

147774

Coding 10 1956 TGGCTAGTTTCAATCCCCTT 84 119

147775

Coding 10 2002 CTGTCATGACTGCCCTTTAC 52 120

147776

Coding 10 2091 GCTTGAAGTTCATTGAGAAT 92 121

147777

Coding 10 2291 TTCCTGAGAAAGGAAGGAAC N.D 122

147778

Coding 10 2331 TCAGATATACATTGGCTTCA 14 123

As shown in Table 3, SEQ ID No. 71, 74, 76, 78, 81, 83, 84, 87, 88, 90, 101, 102, 103, 109, 111, 111, 114, 115, 116, 117, 118, 119, 120 and 121 demonstrated at least 50% inhibition of mouse apolipoprotein B expression in this assay and are therefore preferred. Target sites to which these preferred sequences are complementary are referred to herein as "active sites" and are therefore preferred sites for targeting the compounds of the present disclosure.

Example 18

5 Antisense Inhibition of Mouse Apolipoprotein B Expression by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap - Dose-response Study

A subset of antisense oligonucleotides from Example 17 were further investigated in dose-response studies. The treatment doses were 50, 150 and 300 nM. The effect of the compounds on mouse apolipoprotein B mRNA levels in primary hepatocyte cells was analyzed by quantitative real-time PCR, such as

10 is described in other examples herein. Data are means from two experiments and are shown in Table 4.

Table 4

Inhibition of mouse apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

Inhibition percentage

ISIS number

50 nM 50 nM 300 nM

147483

56 88 89

147764

48 84 90

147769

3 14 28

147776

0 17 44

Example 19

Western blot analysis of apolipoprotein B protein levels

Western blot analysis (immunoblot analysis) was carried out using standard methods. Cells were harvested 16-20 h after oligonucleotide treatment, washed 20 times with PBS, suspended in Laemmli buffer (100 µl / well), boiled for 5 min, and loaded on SDS-gel. PAGE at 16%. Gels were run for 1.5 hr at 150 V, and membrane transferred for Western blotting. The appropriate primary antibody directed against apolipoprotein B, with a radiolabelled secondary antibody, or with fluorescent labeling directed against the primary antibody was used. The bands were visualized using fosfoRIMAGER ™ (Molecular Dynamics, Sunnyvale CA) or the detection system of

Chemiluminescent ECL + (Amersham Biosciences, Piscataway, NJ).

Example 20

Effects of antisense inhibition of apolipoprotein B (ISIS 147764) in C57BL / 6 mice: Lean animals versus animals fed a high fat diet.

C57BL / 6 mice were used, a strain that has been described as susceptible to plaque formation

30 atherosclerotic hyperlipidemia-induced in the following studies to evaluate antisense oligonucleotides as potential lipid-lowering compounds in lean mice versus those fed a high-fat diet.

Male C57BL / 6 mice were divided into two groups; (1) non-genetically manipulated control animals (lean animals) and (2) animals that received a high-fat diet (60% kcal of fat). Control animals received saline treatment and were maintained on a normal rodent diet. After fasting

Overnight, mice in each group were administered intraperitoneally every 3 days, saline or ISIS 147764 50 mg / kg (SEQ ID No: 109) for 6 weeks. At the end of the study and 48 h after the final injections, the animals were sacrificed and the target mRNA levels in the liver, cholesterol and triglyceride levels, liver enzyme levels and serum glucose levels were evaluated.

The results of the comparative studies are shown in Table 5. Table 5 Effects of ISIS 147764 treatment on apolipoprotein B mRNA levels, cholesterol, lipids,

triglycerides, liver enzymes and glucose, in lean mice and with a high fat diet.

Group of

Percentage of change

treatment

Lipoproteins Hepatic enzymes

MRNA

CABBAGE. VLDL LDL HDL TRIG. AST ALT GLUC.

Lean control

-73 -63 there are no changes -64 -44 -3. 4 slight decrease there are no changes there are no changes

High fat diet group

-87 -67 there are no changes -87 -65 there are no changes slight decrease slight increase -28

It is evident from these data that treatment with ISIS 147764 lowered cholesterol as well as LDL and HDL lipoproteins and serum glucose in both lean and high-fat diet mice, and that the demonstrated effects should be , in fact, to the inhibition of apolipoprotein B expression as it supports the decrease of mRNA levels. No significant changes in liver enzyme levels were observed,

10 indicating that the antisense oligonucleotide was not toxic to any of the treatment groups.

Example 21

Effects of antisense inhibition of apolipoprotein B (ISIS 147764) in mice fed a high-fat diet; Study of the temporal evolution of 6 weeks

A 6-week time course study was conducted to further investigate the effects of ISIS 147764 15 on lipid and glucose metabolism in mice fed the high-fat diet.

Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) over a period of 6 weeks were evaluated for the effects of treatment with the antisense oligonucleotide, ISIS 147764. Control animals received treatment with saline solution (50 mg / kg). A subset of animals received a daily oral dose (20 mg / kg) of atorvastatin calcium (Lipitor®, Pfizer Inc.). All mice, 20 except atorvastatin-treated animals, were administered intraperitoneally every 3 days (twice weekly), after an overnight fast, 5, 25, 50 mg / kg of ISIS 147764 (SEQ ID No. : 109) or saline solution (50 mg / kg) for 6 weeks. Serum cholesterol and lipoproteins were analyzed at the intermediate measurement times of 0, 2 and 6 weeks. At the end of the study, the animals were sacrificed 48 h after the final injections and the levels of target mRNA in the liver, levels of cholesterol, lipoprotein, triglycerides, liver enzymes (AST and ALT) and glucose in serum were evaluated, as well as body, liver, spleen and fat pad weights.

Example 22

Effects of antisense inhibition of apolipoprotein B (ISIS 147764) in mice fed a high-fat diet - mRNA expression in the liver

Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) were evaluated throughout

30 of a 6-week period, the effects of ISIS 147764 on mRNA expression. Control animals received treatment with saline solution (50 mg / kg). Mice were administered intraperitoneally every 3 days (twice weekly) 5, 25, 50 mg / kg ISIS 147764 (SEQ ID No: 109) or saline (50 mg / kg) for 6 weeks. At the end of the study, the animals were sacrificed 48 h after the final injections and the target mRNA levels in the liver were evaluated. ISIS 147764 showed a dose-response effect, reducing

35 mRNA levels at 15, 75 and 88% with doses of 5, 25 and 50 mg / kg, respectively.

Liver protein samples collected at the end of the treatment period were subjected to immunoblot analysis using an antibody directed against mouse apolipoprotein B protein (Gladstone Institute, San Francisco, CA). These data demonstrate that treatment with ISIS 147764 decreases the expression of apolipoprotein B protein in the liver, in a dose-dependent manner, in addition to reducing levels of

40 mRNA.

Example 23

Effects of antisense inhibition of apolipoprotein B (ISIS 147764) on serum cholesterol and triglycerides levels

Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) were evaluated throughout

45 of a 6-week period, the effects of ISIS 147764 on serum cholesterol and triglyceride levels. Control animals received treatment with saline solution (50 mg / kg). Mice were administered intraperitoneally every 3 days (twice weekly) 5, 25, 50 mg / kg ISIS 147764 (SEQ ID No: 109) or saline (50 mg / kg) for 6 weeks.

Serum cholesterol levels were measured at 0, 2 and 6 weeks and these data are shown in Table 6. The values in the table are expressed as percentage of inhibition and are normalized with respect to the control of saline dissolution.

In addition to serum cholesterol, at the end of the study, animals were sacrificed 48 h after the final injections and triglyceride levels were assessed.

Mice treated with ISIS 147764 showed a reduction in both serum cholesterol (240 mg / dl for control animals and 225, 125 and 110 mg / dl for doses of 5, 25 and 50 mg / kg, respectively) and of the

10 triglycerides (115 mg / dl for control animals and 125, 150 and 85 mg / dl for doses of 5, 25 and 50 mg / kg, respectively) with respect to the normal levels at the end of the study. These data were also compared with the effects of calcium atorvastatin at an oral dose of 20 mg / kg, which showed only a minimal decrease in serum cholesterol of 20% at the end of the study.

Table 6

15 Percentage of inhibition of apolipoprotein B in cholesterol levels by ISIS 147764

Inhibition percentage

weather

Saline dissolution 5 mg / kg 25 mg / kg 50 mg / kg

0 weeks

0 0 0 0

2 weeks

0 5 12 twenty

6 weeks

0 10 Four. Five 55

Example 24

Effects of antisense inhibition of apolipoprotein B (ISIS 147764) on lipoprotein levels

Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) were evaluated throughout

20 of a 6-week period, the effects of ISIS 147764 on lipoprotein levels (VLDL, LDL, and HDL). Control animals received treatment with saline solution (50 mg / kg). Mice were administered intraperitoneally every 3 days (twice weekly) 5, 25, 50 mg / kg ISIS 147764 (SEQ ID No: 109) or saline (50 mg / kg) for 6 weeks.

Lipoprotein levels were measured at 0, 2 and 6 weeks and these data are shown in Table 7. The values

25 in the table are expressed as percent inhibition and are normalized with respect to saline control. Negative values indicate an observed increase in lipoprotein levels.

These data were also compared with the effects of atorvastatin calcium at a daily oral dose of 20 mg / kg at 0, 2, and 6 weeks.

These data demonstrate that at a dose of 50 mg / kg, ISIS 147764 is able to reduce all investigated serum lipoprotein 30 categories to a greater extent than atorvastatin.

Table 7

Percentage of inhibition of mouse apolipoprotein B by ISIS 147764 in lipoprotein levels compared to atorvastatin

Inhibition percentage

Dose

Lipoprotein

Time (weeks) saline solution 5 mg / kg 25 mg / kg 50 mg / kg atorvastatin (20 mg / kg)

VLDL

0 0 0 0 0 0

2

0 25 30 40 fifteen

6

0 10 -30 fifteen -5

LDL

0 0 0 0 0 0

2

0 -30 10 40 10

6

0 -10 55 90 -10

HDL

0 0 0 0 0 0

2

0 5 10 10 fifteen

6

0 10 Four. Five fifty twenty

Example 25

Effects of antisense inhibition of apolipoprotein B (ISIS 147764) on serum AST and ALT levels

Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) over a period of 6 weeks were evaluated for the effects of ISIS 147764 on liver enzyme levels ( AST and ALT). Higher levels of liver enzymes ALT and AST indicate toxicity and liver damage. Control animals received treatment with saline solution (50 mg / kg). Mice were administered intraperitoneally every 3 days (twice weekly) 5, 25, 50 mg / kg ISIS 147764 (SEQ ID No: 109) or saline (50 mg / kg) for 6 weeks. AST and ALT levels were measured at 6 weeks.

Mice treated with ISIS 147764 did not show a significant change in AST levels over the duration of the study compared to saline controls (105, 70, and 80 IU / l for doses of 5, 25, and 50 mg / kg, respectively, compared to 65 IU / l for the control with saline solution). Mice treated with atorvastatin at a daily oral dose of 20 mg / kg had AST levels of 85 IU / l.

ALT levels increased with all ISIS 147764 treatments over the duration of the study compared with saline controls (50, 70, and 100 IU / l for doses of 5, 25, and 50 mg / kg, respectively, compared to 25 IU / l for saline controls). Mice treated with atorvastatin at a daily oral dose of 20 mg / kg had AST levels of 40 IU / l.

Example 26

Effects of antisense inhibition of apolipoprotein B (ISIS 147764) on serum glucose levels

Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) over a period of 6 weeks were evaluated for the effects of ISIS 147764 on glucose levels in the serum. Control animals received treatment with saline solution (50 mg / kg). Mice were administered intraperitoneally every 3 days (twice weekly) 5, 25, 50 mg / kg ISIS 147764 (SEQ ID No: 109) or saline (50 mg / kg) for 6 weeks.

At the end of the study, the animals were sacrificed 48 h after the final injections and the serum glucose levels were evaluated. ISIS 147764 showed a dose-response effect, reducing serum glucose levels to 225, 190, and 180 mg / dl at doses of 5, 25, and 50 mg / kg, respectively, compared to the saline control of 300 mg / dl. Mice treated with atorvastatin at a daily oral dose of 20 mg / kg had serum glucose levels of 215 mg / dl. These data demonstrate that ISIS 147764 is able to reduce serum glucose levels in mice fed a high-fat diet.

Example 27

Effects of antisense inhibition of apolipoprotein B (ISIS 147764) on body weight, spleen, liver and fat pads

Male C57BL / 6 mice (n = 8) receiving a high fat diet (60% fat kcal) over a period of 6 weeks were evaluated for the effects of ISIS 147764 on body weight of the spleen , liver and fat pads. Control animals received treatment with saline solution (50 mg / kg). Mice were administered intraperitoneally every 3 days (twice weekly) 5, 25, 50 mg / kg ISIS 147764 (SEQ ID No: 109) or saline (50 mg / kg) for 6 weeks.

At the end of the study, the animals were sacrificed 48 h after the final injections and body, spleen, liver and fat pad weights were measured. These data are shown in Table 8. Values are expressed as percent change in body weight or organ weight compared to control animals treated with saline. Data from mice treated with atorvastatin at a daily dose of 20 mg / kg are also shown in the table. Negative values indicated a decrease in weight.

Table 8

Effects of mouse apolipoprotein B antisense inhibition on body and organ weight

Percentage of change

Dose

Atorvastatin

Tissue

5 mg / kg 25 mg / kg 50 mg / kg 20 mg / kg

Total body weight

5 5 -4 one

Spleen

10 10 46 10

Liver

18 70 80 fifteen

Grease

10 6 -47 7

These data show a decrease in fat over the ISIS 147764 dosing interval offset by an increase in both spleen and liver weight with a higher dose to give an overall decrease in total body weight.

Example 28

Effects of antisense inhibition of apolipoprotein B (ISIS 147764) in mice that do not express B6.129P-Apoetm1Unc: Lean animals versus animals fed a high fat diet.

Mice not expressing B6.129P-ApoEtm1Unc (referred to herein as non-ApoE-expressing mice) obtained from The Jackson Laboratory (Bar Harbor, ME), are homozygous for the Apoetm1Unc mutation and show a marked increase in total levels of cholesterol in the plasma that are not affected by age or sex. These animals present fatty striae in the proximal aorta at the age of 3 months. These lesions increase with age and evolve into lesions with fewer lipids but more elongated cells, typical of a more advanced stage of pre-atherosclerotic injury.

The mutation in these mice resides in the apolipoprotein E (ApoE) gene. The main function of the ApoE protein is to transport cholesterol and triglycerides throughout the body. It stabilizes the structure of lipoproteins, binds to the low-density lipoprotein receptor (LDLR) and related proteins, and is present in a subclass of HDL, giving them the ability to bind to LDLR. ApoE is most abundantly expressed in the liver and brain. Female mice that do not express B6.129P-Apoetm1Unc (mice that do not express ApoE) were used in the following studies to evaluate antisense oligonucleotides as potential lipid-lowering compounds.

The female mice that do not express ApoE were between 5 and 7 weeks old and were put on a normal diet for 2 weeks before starting the study. The non-ApoE-expressing mice were then fed at will with a 60% fat diet, with 0.15% added cholesterol to induce dyslipidemia and obesity. Control animals were maintained on a high fat diet with no added cholesterol. After fasting overnight, mice in each group were administered intraperitoneally every 3 days, saline, 50 mg / kg of a control antisense oligonucleotide (ISIS 29837; TCGATCTCCTTTTATGCCCG; SEQ. ID. NO. 124) or 5, 25 or 50 mg / kg ISIS 147764 (SEQ ID No: 109) for 6 weeks.

The control oligonucleotide is a 20 nucleotide long chimeric oligonucleotide ("gammers"), composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5 'and 3' directions ) by "wings" of 5 nucleotides. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines.

At the end of the study and 48 h after the final injections, the animals were sacrificed and the target mRNA levels in the liver were evaluated by RT-PCR methods verified by Northern blot analysis, glucose levels, cholesterol levels and lipids by separation methods of HPLC and levels of triglycerides and liver enzymes (performed by LabCorp Preclinical Services; San Diego, CA). Data from non-ApoE-expressing mice treated with atorvastatin at a daily dose of 20 mg / kg are also shown in the table for comparison.

The results of the comparative studies are shown in Table 9. The data is normalized with respect to saline controls.

Table 9

Effects of ISIS 147764 treatment on apolipoprotein B mRNA levels, cholesterol, glucose, lipids, triglycerides and liver enzymes, in mice that do not express ApoE.

Inhibition percentage

Dose

Control

5 mg / kg 25 mg / kg 50 mg / kg atorvastatin (20 mg / kg)

MRNA

0 2 42 70 10

Glucose

Glucose levels (mg / dl)

225

195 209 191 162

Cholesterol levels (mg / dl)

Cholesterol

1750 1630 1750 1490 938

Lipoprotein levels (mg / dl)

Lipoprotein

HDL 51 49 62 61 42

LDL

525 475 500 325 250

VLDL

1190 1111 1194 1113 653

Liver enzyme levels (IU / l)

Hepatic enzymes

AST 55 fifty 60 85 75

ALT

56 48 59 87 76

5 It is evident from these data that treatment with ISIS 147764 lowered glucose and cholesterol as well as all investigated lipoproteins (HDL, LDL, and VLDL) in mice that do not express ApoE. Furthermore, these decreases are correlated with a decrease in both apolipoprotein B protein and RNA levels, demonstrating an antisense-type mechanism of action. No significant changes in liver enzyme levels were observed, indicating that the antisense oligonucleotide was not toxic to

10 none of the treatment groups.

Example 29

Antisense Inhibition of Human Apolipoprotein B Expression by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap: Additional Oligonucleotides

Another series of oligonucleotides was designed to target different regions of human apolipoprotein B RNA,

15 using the published sequence (GenBank accession number NM_000384.1, incorporated herein as SEQ ID NO: 3). The oligonucleotides are shown in Table 10. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 10 are 20 nucleotide long chimeric oligonucleotides ("gammers"), composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides

20 (5 'and 3' directions) for 5-nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels in HepG2 cells was analyzed by quantitative real-time PCR, as described in other examples herein. Data are means of two experiments in which the

25 HepG2 cells were treated with the compounds in Table 10 in 150 nM concentration. If present, "N.D." indicates "no data".

Table 10

Inhibition of mRNA levels of human apolipoprotein B by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

270985

5'UTR 3 199 TTCCTCTTCGGCCCTGGCGC 75 124

270986

coding 3 299 CTCCACTGGAACTCTCAGCC 0 125

270987

 exon junction: exon 3 359 CCTCCAGCTCAACCTTGCAG 0 126

270988

coding 3 429 GGGTTGAAGCCATACACCTC 6 127

270989

exon junction: exon 3 509 CCAGCTTGAGCTCATACCTG 64 128

270990

coding 3 584 CCCTCTTGATGTTCAGGATG 42 129

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

270991

coding 3 669 GAGCAGTTTCCATACACGGT twenty-one 130

270992

coding 3 699 CCCTTCCTCGTCTTGACGGT 8 131

270993

coding 3 756 TTGAAGCGATCACACTGCCC 69 132

270994

coding 3 799 GCCTTTGATGAGAGCAAGTG 51 133

270995

coding 3 869 TCCTCTTAGCGTCCAGTGTG 40 134

270996

coding 3 1179 CCTCTCAGCTCAGTAACCAG 0 135

270997

coding 3 1279 GCACTGAGGCTGTCCACACT 24 136

270998

coding 3 1419 CGCTGATCCCTCGCCATGTT one 137

270999

coding 3 1459 GTTGACCGCGTGGCTCAGCG 76 138

271000

coding 3 1499 GCAGCTCCTGGGTCCCTGTA 22 139

271001

coding 3 1859 CCCATGGTAGAATTTGGACA 53 140

271002

exon junction: exon 3 2179 AATCTCGATGAGGTCAGCTG 48 141

271003

coding 3 2299 GACACCATCAGGAACTTGAC 46 142

271004

coding 3 2459 GCTCCTCTCCCAAGATGCGG 10 143

271005

coding 3 2518 GGCACCCATCAGAAGCAGCT 32 144

271006

coding 3 2789 AGTCCGGAATGATGATGCCC 42 145

271007

coding 3 2919 CTGAGCAGCTTGACTGGTCT 26 146

271008

coding 3 3100 CCCGGTCAGCGGATAGTAGG 37 147

271010

 exon junction: exon 3 3449 TGTCACAACTTAGGTGGCCC 57 148

271011

coding 3 3919 GTCTGGCAATCCCATGTTCT 51 149

271012

coding 3 4089 CCCACAGACTTGAAGTGGAG 55 150

271013

coding 3 4579 GAACTGCCCATCAATCTTGA 19 151

271014

coding 3 5146 CCCAGAGAGGCCAAGCTCTG 54 152

271015

coding 3 5189 TGTGTTCCCTGAAGCGGCCA 43 153

271016

coding 3 5269 ACCCAGAATCATGGCCTGAT 19 154

271017

coding 3 6049 GGTGCCTGTCTGCTCAGCTG 30 155

271018

coding 3 6520 ATGTGAAACTTGTCTCTCCC 44 156

271019

coding 3 6639 TATGTCTGCAGTTGAGATAG fifteen 157

271020

coding 3 6859 TTGAATCCAGGATGCAGTAC 35 158

271021

coding 3 7459 GAGTCTCTGAGTCACCTCAC 38 159

271022

coding 3 7819 GATAGAATATTGCTCTGCAA 100 160

271023

coding 3 7861 CCCTTGCTCTACCAATGCTT 44 161

271025

coding 3 8449 TCCATTCCCTATGTCAGCAT 16 162

271026

coding 3 8589 GACTCCTTCAGAGCCAGCGG 39 163

271027

coding 3 8629 CCCATGCTCCGTTCTCAGGT 26 164

271028

coding 3 8829 CGCAGGTCAGCCTGACTAGA 98 165

271030

coding 3 9119 CAGTTAGAACACTGTGGCCC 52 166

271031

coding 3 10159 CAGTGTGATGACACTTGATT 49 167

271032

coding 3 10301 CTGTGGCTAACTTCAATCCC 22 168

271033

coding 3 10349 CAGTACTGTTATGACTACCC 3. 4 169

271034

coding 3 10699 CACTGAAGACCGTGTGCTCT 35 170

271035

coding 3 10811 TCGTACTGTGCTCCCAGAGG 2. 3 171

271036

coding 3 10839 AAGAGGCCCTCTAGCTGTAA 95 172

271037

coding 3 11039 AAGACCCAGAATGAATCCGG 2. 3 173

271038

coding 3 11779 GTCTACCTCAAAGCGTGCAG 29 174

271039

coding 3 11939 TAGAGGCTAACGTACCATCT 4 175

271041

coding 3 12149 CCATATCCATGCCCACGGTG 37 176

271042

coding 3 12265 AGTTTCCTCATCAGATTCCC 57 177

271043

coding 3 12380 CCCAGTGGTACTTGTTGACA 68 178

271044

coding 3 12526 CCCAGTGGTGCCACTGGCTG 22 179

271045

coding 3 12579 GTCAACAGTTCCTGGTACAG 19 180

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

271046

coding 3 12749 CCCTAGTGTATATCCCAGGT 61 181

271048

coding 3 13009 CTGAAGATTACGTAGCACCT 7 182

271049

coding 3 13299 GTCCAGCCAACTATACTTGG 54 183

271050

coding 3 13779 CCTGGAGCAAGCTTCATGTA 42 184

281586

exon junction: exon 3 229 TGGACAGACCAGGCTGACAT 80 185

281587

coding 3 269 ATGTGTACTTCCGGAGGTGC 77 186

281588

coding 3 389 TCTTCAGGATGAAGCTGCAG 80 187

281589

coding 3 449 TCAGCAAGGCTTTGCCCTCA 90 188

281590

coding 3 529 CTGCTTCCCTTCTGGAATGG 84 189

281591

coding 3 709 TGCCACATTGCCCTTCCTCG 90 190

281592

coding 3 829 GCTGATCAGAGTTGACAAGG 56 191

281593

coding 3 849 TACTGACAGGACTGGCTGCT 93 192

281594

coding 3 889 GATGGCTTCTGCCACATGCT 74 193

281595

coding 3 1059 GATGTGGATTTGGTGCTCTC 76 194

281596

coding 3 1199 TGACTGCTTCATCACTGAGG 77 195

281597

coding 3 1349 GGTAGGTGACCACATCTATC 36 196

281598

coding 3 1390 TCGCAGCTGCTGTGCTGAGG 70 197

281599

exon junction: exon 3 1589 TTCCAATGACCCGCAGAATC 74 198

281600

coding 3 1678 GATCATCAGTGATGGCTTTG 52 199

281601

coding 3 1699 AGCCTGGATGGCAGCTTTCT 83 200

281602

coding 3 1749 GTCTGAAGAAGAACCTCCTG 84 201

281603

coding 3 1829 TATCTGCCTGTGAAGGACTC 82 202

281604

coding 3 1919 CTGAGTTCAAGATATTGGCA 78 203

281605

exon junction: exon 3 2189 CTTCCAAGCCAATCTCGATG 82 204

281606

coding 3 2649 TGCAACTGTAATCCAGCTCC 86 205

281607

 exon junction: exon 3 2729 CCAGTTCAGCCTGCATGTTG 84 206

281608

coding 3 2949 GTAGAGACCAAATGTAATGT 62 207

281609

coding 3 3059 CGTTGGAGTAAGCGCCTGAG 70 208

281610

exon junction: exon 3 3118 CAGCTCTAATCTGGTGTCCC 69 209

281611

coding 3 3189 CTGTCCTCTCTCTGGAGCTC 93 210

281612

coding 3 3289 CAAGGTCATACTCTGCCGAT 83 211

281613

coding 3 3488 GTATGGAAATAACACCCTTG 70 212

281614

coding 3 3579 TAAGCTGTAGCAGATGAGTC 63 213

281615

coding 3 4039 TAGATCTCTGGAGGATTTGC 81 214

281616

coding 3 4180 GTCTAGAACACCCAGGAGAG 66 215

281617

coding 3 4299 ACCACAGAGTCAGCCTTCAT 89 216

281618

coding 3 4511 AAGCAGACATCTGTGGTCCC 90 217

281619

coding 3 4660 CTCTCCATTGAGCCGGCCAG 96 218

281620

coding 3 4919 CCTGATATTCAGAACGCAGC 89 219

281621

coding 3 5009 CAGTGCCTAAGATGTCAGCA 53 220

281622

coding 3 5109 AGCACCAGGAGACTACACTT 88 221

281623

coding 3 5212 CCCATCCAGACTGAATTTTG 59 222

281624

coding 3 5562 GGTTCTAGCCGTAGTTTCCC 75 223

281625

coding 3 5589 AGGTTACCAGCCACATGCAG 94 224

281626

coding 3 5839 ATGTGCATCGATGGTCATGG 88 225

281627

coding 3 5869 CCAGAGAGCGAGTTTCCCAT 82 226

281628

coding 3 5979 CTAGACACGAGATGATGACT 81 227

281629

coding 3 6099 TCCAAGTCCTGGCTGTATTC 83 228

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

281630

coding 3 6144 CGTCCAGTAAGCTCCACGCC 82 229

281631

coding 3 6249 TCAACGGCATCTCTCATCTC 88 230

281632

coding 3 6759 TGATAGTGCTCATCAAGACT 75 231

281633

coding 3 6889 GATTCTGATTTGGTACTTAG 73 232

281634

coding 3 7149 CTCTCGATTAACTCATGGAC 81 233

281635

coding 3 7549 ATACACTGCAACTGTGGCCT 89 2. 3. 4

281636

coding 3 7779 GCAAGAGTCCACCAATCAGA 68 235

281637

coding 3 7929 AGAGCCTGAAGACTGACTTC 74 236

281638

coding 3 8929 TCCCTCATCTGAGAATCTGG 66 237

281640

coding 3 10240 CAGTGCATCAATGACAGATG 87 238

281641

coding 3 10619 CCGAACCCTTGACATCTCCT 72 239

281642

coding 3 10659 GCCTCACTAGCAATAGTTCC 59 240

281643

coding 3 10899 GACATTTGCCATGGAGAGAG 61 241

281644

coding 3 11209 CTGTCTCCTACCAATGCTGG 26 242

281645

exon junction: exon 3 11979 TCTGCACTGAAGTCACGGTG 78 243

281646

coding 3 12249 TCCCGGACCCTCAACTCAGT 76 244

281648

3'UTR 3 13958 GCAGGTCCAGTTCATATGTG 81 245

281649

3'UTR 3 14008 GCCATCCTTCTGAGTTCAGA 76 246

301012

exon junction: exon 3 3249 GCCTCAGTCTGCTTCGCACC 87 247

301013

5'UTR 3 3 CCCCGCAGGTCCCGGTGGGA 82 248

301014

5'UTR 3 6 CAGCCCCGCAGGTCCCGGTG 88 249

301015

5'UTR 3 2. 3 CAACCGAGAAGGGCACTCAG 53 250

301016

5'UTR 3 35 CCTCAGCGGCAGCAACCGAG 62 251

301017

5'UTR 3 36 TCCTCAGCGGCAGCAACCGA 47 252

301018

5'UTR 3 37 CTCCTCAGCGGCAGCAACCG Four. Five 253

301019

5'UTR 3 39 GGCTCCTCAGCGGCAGCAAC 70 254

301020

5'UTR 3 43 GGCGGGCTCCTCAGCGGCAG 85 255

301021

5'UTR 3 116 GGTCCATCGCCAGCTGCGGT 89 256

301022

Start codon 3 120 GGCGGGTCCATCGCCAGCTG 69 257

301023

Stop codon 3 13800 TAGAGGATGATAGTAAGTTC 69 258

301024

3'UTR 3 13824 AAATGAAGATTTCTTTTAAA 5 259

301025

3'UTR 3 13854 TATGTGAAAGTTCAATTGGA 76 260

301026

3'UTR 3 13882 ATATAGGCAGTTTGAATTTT 57 261

301027

3'UTR 3 13903 GCTCACTGTATGGTTTTATC 89 262

301028

3'UTR 3 13904 GGCTCACTGTATGGTTTTAT 93 263

301029

3'UTR 3 13908 GGCTGGCTCACTGTATGGTT 90 264

301030

3'UTR 3 13909 AGGCTGGCTCACTGTATGGT 90 265

301031

3'UTR 3 13910 AAGGCTGGCTCACTGTATGG 90 266

301032

3'UTR 3 13917 CTACTGCAAGGCTGGCTCAC 63 267

301033

3'UTR 3 13922 ACTGCCTACTGCAAGGCTGG 77 268

301034

3'UTR 3 13934 TGCTTATAGTCTACTGCCTA 88 269

301035

3'UTR 3 13937 TTCTGCTTATAGTCTACTGC 82 270

301036

3'UTR 3 13964 TTTGGTGCAGGTCCAGTTCA 88 271

301037

3'UTR 3 13968 CAGCTTTGGTGCAGGTCCAG 90 272

301038

3'UTR 3 13970 GCCAGCTTTGGTGCAGGTCC 86 273

301039

3'UTR 3 13974 TGGTGCCAGCTTTGGTGCAG 73 274

301040

3'UTR 3 13978 GCCCTGGTGCCAGCTTTGGT 74 275

301041

3'UTR 3 13997 GAGTTCAGAGACCTTCCGAG 85 276

301042

3'UTR 3 14012 AAATGCCATCCTTCTGAGTT 81 277

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

301043

3'UTR 3 14014 AAAAATGCCATCCTTCTGAG 81 278

301044

3'UTR 3 14049 AAAATAACTCAGATCCTGAT 76 279

301045

3'UTR 3 14052 AGCAAAATAACTCAGATCCT 90 280

301046

3'UTR 3 14057 AGTTTAGCAAAATAACTCAG 80 281

301047

3'UTR 3 14064 TCCCCCAAGTTTAGCAAAAT 56 282

301048

3'UTR 3 14071 TTCCTCCTCCCCCAAGTTTA 67 283

301217

3'UTR 3 14087 AGACTCCATTTATTTGTTCC 81 284

Example 30

Antisense inhibition of apolipoprotein B - Displacement over gene

A "gene shift" was performed in which another series of oligonucleotides were designed to target the

5 regions of human apolipoprotein B RNA (GenBank accession number NM_000384.1, incorporated herein as SEQ ID NO: 3) that are close to the target site of SEQ ID No. 224 or 247. Oligonucleotides are shown in Table 11. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 11 are 20 nucleotide long chimeric oligonucleotides ("gammers"), composed of a "gap" region

Central 10 consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5 'and 3' directions) by 5 'nucleotide' wings'. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels in HepG2 cells was analyzed by quantitative real-time PCR, as described in other examples herein.

The treatment doses were 50 nM and 150 nM and are indicated in Table 11. Data are means from two experiments. If present, "N.D." indicates "no data".

Table 11

Inhibition of human apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap - Displacement over gene

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. 150 nM % of INHIB. 50 nM SEQ ID NO

308589

 exon junction: exon 3 3230 CTTCTGCTTGAGTTACAAAC 94 twenty 285

308590

 exon junction: exon 3 3232 ACCTTCTGCTTGAGTTACAA 98 26 286

308591

 exon junction: exon 3 3234 GCACCTTCTGCTTGAGTTAC 92 76 287

308592

 exon junction: exon 3 3236 TCGCACCTTCTGCTTGAGTT 96 49 288

308593

 exon junction: exon 3 3238 CTTCGCACCTTCTGCTTGAG 80 41 289

308594

 exon junction: exon 3 3240 TGCTTCGCACCTTCTGCTTG 88 57 290

308595

 exon junction: exon 3 3242 TCTGCTTCGCACCTTCTGCT 82 60 291

308596

 exon junction: exon 3 3244 AGTCTGCTTCGCACCTTCTG 94 81 292

308597

 exon junction: exon 3 3246 TCAGTCTGCTTCGCACCTTC 91 66 293

308598

 exon junction: exon 3 3248 CCTCAGTCTGCTTCGCACCT 85 59 294

308599

 exon junction: exon 3 3250 AGCCTCAGTCTGCTTCGCAC 94 79 295

308600

coding 3 3252 GTAGCCTCAGTCTGCTTCGC 89 72 296

308601

coding 3 3254 TGGTAGCCTCAGTCTGCTTC 91 63 297

308602

coding 3 3256 ICATGGTAGCCTCAGTCTGCT 92 83 298

308603

coding 3 3258 GTCATGGTAGCCTCAGTCTG 97 56 299

308604

coding 3 3260 ATGTCATGGTAGCCTCAGTC 90 73 300

308605

coding 3 3262 GAATGTCATGGTAGCCTCAG 81 fifty 301

308606

coding 3 3264 TTGAATGTCATGGTAGCCTC 97 54 302

308607

coding 3 3266 ATTTGAATGTCATGGTAGCC 77 9 303

308608

coding 3 3268 ATATTTGAATGTCATGGTAG 85 70 304

308609

coding 3 5582 CAGCCACATGCAGCTTCAGG 96 78 305

308610

coding 3 5584 ACCAGCCACATGCAGCTTCA 90 40 306

308611

coding 3 5586 TTACCAGCCACATGCAGCTT 95 59 307

308612

coding 3 5588 GGTTACCAGCCACATGCAGC 90 75 308

308613

coding 3 5590 TAGGTTACCAGCCACATGCA 87 43 309

308614

coding 3 5592 TTTAGGTTACCAGCCACATG 92 74 310

308615

coding 3 5594 CTTTTAGGTTACCAGCCACA 85 Four. Five 311

308616

coding 3 5596 TCCTTTTAGGTTACCAGCCA 81 39 312

308617

coding 3 5598 GCTCCTTTTAGGTTACCAGC 87 77 313

308618

coding 3 5600 AGGCTCCTTTTAGGTTACCA 77 61 314

308619

coding 3 5602 GTAGGCTCCTTTTAGGTTAC 74 69 315

308620

coding 3 5604 TGGTAGGCTCCTTTTAGGTT 88 69 316

308621

coding 3 5606 TTTGGTAGGCTCCTTTTAGG 91 56 317

As shown in Tables 10 and 11, SEQ ID No. 124, 128, 129, 132, 133, 134, 138, 140, 141, 142, 144, 145, 147, 148, 149, 150, 152, 153, 155, 156, 158, 159, 160, 161, 163, 165, 166, 167, 169, 170, 172, 176, 177, 178, 181, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228,

229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, and 317 demonstrated at least 5 30% inhibition of human apolipoprotein B expression in this assay and are therefore preferred. SEQ ID Nos. 224, 247 and 262 are more preferred. Target regions of which these preferred sequences are complementary are referred to herein as "preferred target segments" and are therefore preferred sites for targeting the compounds of the present disclosure . These preferred target segments are shown in Table 18. The sequences represent the reverse complement of the preferred antisense compounds shown.

10 in Tables 10 and 11. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target nucleic acid, to which the oligonucleotide binds. The species in which each of the preferred target segments were found are also shown in Table 18.

Example 31

Antisense inhibition of human apolipoprotein B expression by chimeric phosphorothioate oligonucleotides 15 having 2'-MOE wings and a deoxy gap: Targeted at accession number in GenBank M14162.1

Another series of oligonucleotides were designed to target different regions of human apolipoprotein B RNA, using the published sequence (GenBank accession number M14162.1, incorporated herein as SEQ ID NO: 318). The oligonucleotides are shown in Table 12. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 12 are chimeric oligonucleotides ("gammers") 20 nucleotides in length, composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which are flanked on both sides (5 'directions and 3 ') by 5 nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on the mRNA levels of the

Human apolipoprotein B in HepG2 cells by quantitative real-time PCR, as described in other examples herein. Data are means from two experiments in which HepG2 cells were treated with the compounds in Table 12 in 150 nM concentration. If present, "N.D." indicates "no data".

Table 12

Inhibition of human apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

271009

coding 318 3121 GCCTCAGTCTGCTTCGCGCC 75 319

271024

coding 318 8031 GCTCACTGTTCAGCATCTGG 27 320

271029

coding 318 8792 TGAGAATCTGGGCGAGGCCC N.D. 321

271040

coding 318 11880 GTCCTTCATATTTGCCATCT 0 322

271047

coding 318 12651 CCTCCCTCATGAACATAGTG 32 323

281639

coding 318 9851 GACGTCAGAACCTATGATGG 38 324

281647

coding 318 12561 TGAGTGAGTCAATCAGCTTC 73 325

Example 32

Antisense inhibition of human apolipoprotein B - Displacement over gene directed to accession number in GenBank M14162.1

A "gene shift" was performed in which another series of oligonucleotides were designed to target the human apolipoprotein B RNA regions (GenBank accession number M14162.1, incorporated herein as SEQ ID NO: 318) that are close to the target site of SEQ ID NO: 319. The oligonucleotides are shown in Table 13. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, at that binds the oligonucleotide. All compounds in table 13 are

40 chimeric oligonucleotides ("gammers") 20 nucleotides long, composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5 'and 3' directions) by "wings" of 5 nucleotides. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels was analyzed.

In HepG2 cells by quantitative real-time PCR, as described in other examples herein. The treatment doses were 50 nM and 150 nM and are indicated in Table 13. Data are means from two experiments. If present, "N.D." indicates "no data".

Table 13

Inhibition of mRNA levels of human apolipoprotein B by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. 150 nM % of INHIB. 50 nM SEQ ID NO

308622

coding 318 3104 GCCTTCTGCTTGAGTTACAA 87 25 326

308623

coding 318 3106 GCGCCTTCTGCTTGAGTTAC 71 62 327

308624

coding 318 3108 TCGCGCCTTCTGCTTGAGTT 89 69 328

308625

coding 318 3110 CTTCGCGCCTTCTGCTTGAG 83 64 329

308626

coding 318 3116 AGTCTGCTTCGCGCCTTCTG 94 38 330

308627

coding 318 3118 TCAGTCTGCTTCGCGCCTTC 89 67 331

308628

coding 318 3120 CCTCAGTCTGCTTCGCGCCT 92 61 332

308629

coding 318 3122 AGCCTCAGTCTGCTTCGCGC 95 77 333

5 As shown in Tables 12 and 13, SEQ ID No. 319, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, and 333 demonstrated at least 30% inhibition of the expression of human apolipoprotein B in this assay and are therefore preferred. SEQ ID NO: 319 is more preferred. The target regions of which these preferred sequences are complementary are referred to herein as "preferred target segments" and are therefore preferred sites for targeting the compounds of the present disclosure. These preferred target segments

10 are shown in Table 18. The sequences represent the reverse complement of the preferred antisense compounds shown in Tables 12 and 13. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target nucleic acid, to which the oligonucleotide is attached. The species in which each of the preferred target segments were found are also shown in Table 18.

Example 33

15 Antisense Inhibition of Human Apolipoprotein B Expression by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap - Targeted at Genomic Sequence

Another series of oligonucleotides were designed to target different regions of human apolipoprotein B RNA, using the published sequence (complement of nucleotides 39835 to 83279 of the sequence with GenBank accession number NT_022227.9, representing a genomic sequence , incorporated herein as SEQ ID NO: 334). The oligonucleotides are shown in Table 14. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 14 are chimeric oligonucleotides ("gammers") 20 nucleotides in length, composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which are flanked on both sides (5 'directions and 3 ') by "wings" of 5 nucleotides. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. The links

Internucleoside (main chain) are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels in HepG2 cells was analyzed by quantitative real-time PCR, as described in other examples herein. Data are means from two experiments in which HepG2 cells were treated with 150 nM oligonucleotides from Table 14. If present, "N.D." indicates "no data".

30 Table 14

Inhibition of mRNA levels of human apolipoprotein B by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

301049

intron junction: exon 334 904 TCTGTAAGACAGGAGAAAGA 41 335

301050

intron junction: exon 334 913 ATTTCCTCTTCTGTAAGACA 22 336

301051

exon junction: intron 334 952 GATGCCTTACTTGGACAGAC 27 337

301052

intron 334 1945 AGAAATAGCTCTCCCAAGGA 13 338

301053

intron: exon junction 334 1988 GTCGCATCTTCTAACGTGGG Four. Five 339

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

301054

exon junction: intron 334 2104 TCCTCCATACCTTGCAGTTG 0 340

301055

intron 334 2722 TGGCTCATGTCTACCATATT 49 341

301056

intron 334 2791 CAGTTGAAATGCAGCTAATG 35 342

301057

intron 334 3045 TGCAGACTAGGAGTGAAAGT 30 343

301058

intron 334 3117 AGGAGGATGTCCTTTTATTG 27 344

301059

intron 334 3290 ATCAGAGCACCAAAGGGAAT 12 3. 4. 5

301060

intron junction: exon 334 3381 CCAGCTCAACCTGAGAATTC 17 346

301061

exon junction: intron 334 3527 CATGACTTACCTGGACATGG 52 347

301062

intron 334 3566 CCTCAGCGGACACACACACA twenty-one 348

301063

intron 334 3603 GTCACATCCGTGCCTGGTGC 41 349

301064

intron 334 3864 CAGTGCCTCTGGGACCCCAC 60 350

301065

intron 334 3990 AGCTGCAGTGGCCGATCAGC fifty 351

301066

intron 334 4251 GACCTCCCCAGCCACGTGGA 61 352

301067

intron 334 4853 TCTGATCACCATACATTACA Four. Five 353

301068

intron 334 5023 ATTTCCCACTGGGTACTCTC 44 354

301069

intron 334 5055 GGCTGAAGCCCATGCTGACT 44 355

301070

intron 334 5091 GTTGGACAGTCATTCTTTTG 38 356

301071

intron 334 5096 CACTTGTTGGACAGTCATTC 48 357

301072

intron 334 5301 ATTTTAAATTACAGTAGATA 43 358

301073

intron 334 5780 CTGTTCTCCACCCATATCAG 37 359

301074

intron junction: exon 334 6353 GAGCTCATACCTGTCCCAGA 75 360

301075

intron 334 6534 TTCAAGGGCCACTGCTATCA 52 361

301076

intron 334 6641 CCAGTATTTCACGCCAATCC 36 362

301077

intron 334 6661 GGCAGGAGGAACCTCGGGCA 55 363

301078

intron 334 6721 TTTTAAAATTAGACCCAACC 22 364

301079

intron 334 6727 TGACTGTTTTAAAATTAGAC twenty 365

301080

intron 334 6788 CCCAGCAAACACAGGTGAAG 25 366

301081

intron 334 7059 GAGTGTGGTCTTGCTAGTGC 46 367

301082

intron 334 7066 CTATGCAGAGTGTGGTCTTG 41 368

301083

intron 334 7189 AGAAGATGCAACCACATGTA 29 369

301084

intron junction: exon 334 7209 ACACGGTATCCTATGGAGGA 49 370

301085

exon junction: intron 334 7365 TGGGACTTACCATGCCTTTG eleven 371

301086

intron 334 7702 GGTTTTGCTGCCCTACATCC 30 372

301087

intron 334 7736 ACAAGGAGTCCTTGTGCAGA 40 373

301088

intron 334 8006 ATGTTCACTGAGACAGGCTG 41 374

301089

intron 334 8215 GAAGGTCCATGGTTCATCTG 0 375

301090

intron 334 8239 ATTAGACTGGAAGCATCCTG 39 376

301091

intron 334 8738 GAGATTGGAGACGAGCATTT 35 377

301092

exon junction: intron 334 8881 CATGACCTACTTGTAGGAGA 22 378

301093

intron 334 9208 TGGATTTGGATACACAAGTT 42 379

301094

intron 334 9244 ACTCAATATATATTCATTGA 22 380

301095

intron 334 9545 CAAGGAAGCACACCATGTCA 38 381

301096

intron junction: exon 334 9563 ATACTTATTCCTGGTAACCA 24 382

301097

intron 334 9770 GGTAGCCAGAACACCAGTGT fifty 383

301098

intron 334 9776 ACTAGAGGTAGCCAGAACAC 3. 4 384

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

301099

intron 334 10149 ACCACCTGACATCACAGGTT 24 385

301100

intron 334 10341 TACTGTGACCTATGCCAGGA 55 386

301101

intron 334 10467 GGAGGTGCTACTGTTGACAT 42 387

301102

intron 334 10522 TCCAGACTTGTCTGAGTCTA 47 388

301103

intron 334 10547 TCTAAGAGGTAGAGCTAAAG 7 389

301104

intron 334 10587 CCAGAGATGAGCAACTTAGG 38 390

301105

intron 334 10675 GGCCATGTAAATTGCTCATC 7 391

301106

intron 334 10831 AAAGAAACTATCCTGTATTC 12 392

301107

intron junction: exon 334 10946 TTCTTAGTACCTGGAAGATG 2. 3 393

301108

exon junction: intron 334 11166 CATTAGATACCTGGACACCT 29 394

301109

intron 334 11337 GTTTCATGGAACTCAGCGCA 44 395

301110

intron 334 11457 CTGGAGAGCACCTGCAATAG 35 396

301111

intron 334 11521 TGAAGGGTAGAGAAATCATA 9 397

301112

exon junction: intron 334 12111 GGAAACTCACTTGTTGACCG 25 398

301113

intron 334 12155 AGGTGCAAGATGTTCCTCTG 46 399

301114

intron 334 12162 TGCACAGAGGTGCAAGATGT 16 400

301115

intron 334 12221 CACAAGAGTAAGGAGCAGAG 39 401

301116

intron 334 12987 GATGGATGGTGAGAAATTAC 33 402

301117

intron 334 13025 TAGACAATTGAGACTCAGAA 39 403

301118

intron 334 13057 ATGTGCACACAAGGACATAG 33 404

301119

intron 334 13634 ACATACAAATGGCAATAGGC 33 405

301120

intron 334 13673 TAGGCAAAGGACATGAATAG 30 406

301121

coding 334 14448 TTATGATAGCTACAGAATAA 29 407

301122

exon junction: intron 334 14567 CTGAGATTACCCGCAGAATC 32 408

301123

intron 334 14587 GATGTATGTCATATAAAAGA 26 409

301124

intron junction: exon 334 14680 TTTCCAATGACCTGCATTGA 48 410

301125

intron 334 15444 AGGGATGGTCAATCTGGTAG 57 411

301126

intron 334 15562 GGCTAATAAATAGGGTAGTT 22 412

301127

intron 334 15757 TCCTAGAGCACTATCAAGTA 41 413

301128

intron junction: exon 334 15926 CCTCCTGGTCCTGCAGTCAA 56 414

301129

intron 334 16245 CATTTGCACAAGTGTTTGTT 35 415

301130

intron 334 16363 CTGACACACCATGTTATTAT 10 416

301131

intron junction: exon 334 16399 CTTTTTCAGACTAGATAAGA 0 417

301132

exon junction: intron 334 16637 TCACACTTACCTCGATGAGG 29 418

301133

intron 334 17471 AAGAAAATGGCATCAGGTTT 13 419

301134

intron junction: exon 334 17500 CCAAGCCAATCTGAGAAAGA 25 420

301135

exon junction: intron 334 17677 AAATACACACCTGCTCATGT twenty 421

301136

exon junction: intron 334 17683 CTTCACAAATACACACCTGC twenty 422

301137

intron 334 18519 AGTGGAAGTTTGGTCTCATT 41 423

301138

intron 334 18532 TTGCTAGCTTCAAAGTGGAA 44 424

301139

intron 334 18586 TCAAGAATAAGCTCCAGATC 41 425

301140

intron 334 18697 GCATACAAGTCACATGAGGT 3. 4 426

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

301141

intron 334 18969 TACAAGGTGTTTCTTAAGAA 38 427

301142

intron 334 19250 ATGCAGCCAGGATGGGCCTA 54 428

301143

intron junction: exon 334 19340 TTACCATATCCTGAGAGTTT 55 429

301144

intron 334 19802 GCAAAGGTAGAGGAAGGTAT 32 430

301145

intron 334 19813 AAGGACCTTCAGCAAAGGTA 36 431

301146

intron 334 20253 CATAGGAGTACATTTATATA 2. 3 432

301147

intron 334 20398 ATTATGATAAAATCAATTTT 19 433

301148

intron 334 20567 AGAAATTTCACTAGATAGAT 31 434

301149

intron 334 20647 AGCATATTTTGATGAGCTGA 44 435

301150

intron 334 20660 GAAAGGAAGGACTAGCATAT 39 436

301151

intron junction: exon 334 20772 CCTCTCCAATCTGTAGACCC 28 437

301152

intron 334 21316 CTGGATAACTCAGACCTTTG 40 438

301153

intron 334 21407 AGTCAGAAAACAACCTATTC eleven 439

301154

intron junction: exon 334 21422 CAGCCTGCATCTATAAGTCA 31 440

301155

exon junction: intron 334 21634 AAAGAATTACCCTCCACTGA 33 441

301156

intron 334 21664 TCTTTCAAACTGGCTAGGCA 39 442

301157

intron 334 21700 GCCTGGCAAAATTCTGCAGG 37 443

301158

intron 334 22032 CTACCTCAAATCAATATGTT 28 444

301159

intron 334 22048 TGCTTTACCTACCTAGCTAC 36 445

301160

intron 334 22551 ACCTTGTGTGTCTCACTCAA 49 446

301161

intron 334 22694 ATGCATTCCCTGACTAGCAC 3. 4 447

301162

intron 334 22866 CATCTCTGAGCCCCTTACCA 24 448

301163

intron 334 22903 GCTGGGCATGCTCTCTCCCC 51 449

301164

intron 334 22912 GCTTTCGCAGCTGGGCATGC 55 450

301165

intron 334 23137 ACTCCTTTCTATACCTGGCT 47 451

301166

intron 334 23170 ATTCTGCCTCTTAGAAAGTT 38 452

301167

intron 334 23402 CCAAGCCTCTTTACTGGGCT 29 453

301168

intron 334 23882 CACTCATGACCAGACTAAGA 35 454

301169

intron 334 23911 ACCTCCCAGAAGCCTTCCAT 22 455

301170

intron 334 24184 TTCATATGAAATCTCCTACT 40 456

301171

intron 334 24425 TATTTAATTTACTGAGAAAC 7 457

301172

intron junction: exon 334 24559 TAATGTGTTGCTGGTGAAGA 35 458

301173

exon junction: intron 334 24742 CATCTCTAACCTGGTGTCCC twenty-one 459

301174

intron 334 24800 GTGCCATGCTAGGTGGCCAT 37 460

301175

intron 334 24957 AGCAAATTGGGATCTGTGCT 29 461

301176

intron 334 24991 TCTGGAGGCTCAGAAACATG 57 462

301177

intron 334 25067 TCAAGACAGGAGCCACCTA 40 463

301178

intron 334 25152 AGGATTCCCAAGACTTTGGA 38 464

301179

intron junction: exon 334 25351 CAGCTCTAATCTAAAGACAT 22 465

301180

exon junction: intron 334 25473 GAATACTCACCTTCTGCTTG 6 466

301181

intron 334 26047 ATCTCTCTGTCCTCATCTTC 28 467

301182

intron 334 26749 CCAACTCCCCCTTTCTTTGT 37 468

301183

intron 334 26841 TCTGGGCCAGGAAGACACGA 68 469

301184

intron 334 27210 TATTGTGTGCTGGGCACTGC 52 470

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

301185

intron junction: exon 334 27815 TGCTTCGCACCTGGACGAGT 51 471

301186

exon junction: intron 334 28026 CCTTCTTTACCTTAGGTGGC 37 472

301187

intron 334 28145 GCTCTCTCTGCCACTCTGAT 47 473

301188

intron 334 28769 AACTTCTAAAGCCAACATTC 27 474

301189

intron junction: exon 334 28919 TGTGTCACAACTATGGTAAA 63 475

301190

exon junction: intron 334 29095 AGACACATACCATAATGCCA 22 476

301191

intron junction: exon 334 29204 TTCTCTTCATCTGAAAATAC twenty-one 477

301192

intron 334 29440 TGAGGATGTAATTAGCACTT 27 478

301193

intron junction: exon 334 29871 AGCTCATTGCCTACAAAATG 31 479

301194

intron 334 30181 GTTCTCATGTTTACTAATGC 40 480

301195

intron 334 30465 GAATTGAGACAACTTGATTT 26 481

301196

intron junction: exon 334 30931 CCGGCCATCGCTGAAATGAA 54 482

301197

exon junction: intron 334 31305 CATAGCTCACCTTGCACATT 28 483

301198

intron 334 31325 CGGTGCACCCTTTACCTGAG 28 484

301199

intron junction: exon 334 31813 TCTCCAGATCCTAACATAAA 19 485

301200

intron 334 39562 TTGAATGACACTAGATTTTC 37 486

301201

intron 334 39591 AAAATCCATTTTCTTTAAAG 12 487

301202

intron 334 39654 CAGCTCACACTTATTTTAAA 7 488

301203

intron junction: exon 334 39789 GTTCCCAAAACTGTATAGGA 36 489

301204

exon junction: intron 334 39904 AGCTCCATACTGAAGTCCTT 37 490

301205

intron 334 39916 CAATTCAATAAAAGCTCCAT 31 491

301206

intron 334 39938 GTTTTCAAAAGGTATAAGGT 28 492

301207

intron junction: exon 334 40012 TTCCCATTCCCTGAAAGCAG 13 493

301208

exon junction: intron 334 40196 TGGTATTTACCTGAGGGCTG twenty-one 494

301209

intron 334 40412 ATAAATAATAGTGCTGATGG 39 495

301210

intron 334 40483 CTATGGCTGAGCTTGCCTAT 33 496

301211

intron 334 40505 CTCTCTGAAAAATATACCCT 17 497

301212

intron 334 40576 TTGATGTATCTCATCTAGCA 41 498

301213

intron 334 40658 TAGAACCATGTTTGGTCTTC 35 499

301214

intron 334 40935 TTTCTCTTTATCACATGCCC 29 500

301215

intron 41066 TATAGTACATAAAACTTCA one 501

301216

intron junction: exon 334 41130 CTGGAGAGGACTAAACAGAG 49 502

As shown in Table 14, SEQ ID No.s 335, 339, 341, 342, 343, 347, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 367, 368, 370, 372, 373, 374, 376, 377, 379, 381, 383, 384, 386, 387, 388, 390, 395, 396, 399, 401, 402, 403, 404, 405, 406, 408, 410, 411, 413, 414, 415, 423, 424, 425, 426, 427, 428, 429, 430, 431, 434, 435, 436, 438, 440, 441, 442, 443, 445, 446, 447, 449, 450, 451, 452, 454, 456, 458, 460, 462, 463, 464, 468, 469, 470, 471, 472, 473, 475, 479, 480, 482, 486, 489, 490, 491, 495, 496, 498, 499, and 502 demonstrated at least 30% inhibition of human apolipoprotein B expression in this assay, and are therefore preferred. Target regions of which these preferred sequences are complementary are referred to herein as "preferred target segments" and are therefore preferred for targeting the compounds of the present disclosure. These preferred target segments are shown in Table 18. The sequences represent the reverse complement of the preferred antisense compounds shown in Table 14. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target nucleic acid. , to which the oligonucleotide is attached.

5 The species in which each of the preferred target segments were found are also shown in Table 18.

Example 34

Antisense Inhibition of Human Apolipoprotein B Expression by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap - Targeted at GenBank Accession Number AI249040.1

Another series of oligonucleotides were designed to target different target regions of human apolipoprotein B RNA, using the published sequence (the complement of the sequence with accession number in GenBank AI249040.1, incorporated herein as SEQ ID NO. : 503). The oligonucleotides are shown in Table 15. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 15 are chimeric oligonucleotides ("gammers") of 20

15 nucleotides in length, composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5 'and 3' directions) by 5 nucleotide "wings". The wings are made up of 2'methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels in HepG2 cells was analyzed by real-time PCR

20 quantitative, as described in other examples herein. Data are means from two experiments in which HepG2 cells were treated with 150 nM oligonucleotides from Table 15. If present, "N.D." indicates "no data".

Table 15

Inhibition of human apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

ISIS number

REGION SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

301218

3'UTR 503 484 ACATTTTATCAATGCCCTCG 2. 3 504

301219

3'UTR 503 490 GCCAGAACATTTTATCAATG 35 505

301220

3'UTR 503 504 AGAGGTTTTGCTGTGCCAGA 51 506

301221

3'UTR 503 506 CTAGAGGTTTTGCTGTGCCA 61 507

301222

3'UTR 503 507 TCTAGAGGTTTTGCTGTGCC 14 508

301223

3'UTR 503 522 AATCACACTATGTGTTCTAG 26 509

301224

3'UTR 503 523 AAATCACACTATGTGTTCTA 33 510

301225

3'UTR 503 524 TAAATCACACTATGTGTTCT 3 511

301226

3'UTR 503 526 CTTAAATCACACTATGTGTT 39 512

301227

3'UTR 503 536 TATTCTGTTACTTAAATCAC 2. 3 513

As shown in Table 15, SEQ ID No.s 505, 506, 507, 510, and 512 demonstrated at least 30% inhibition of human apolipoprotein B expression in this assay and are therefore preferred. Target regions of which these preferred sequences are complementary are referred to herein as "segments

Preferred targets "and therefore are preferred sites for targeting the compounds of the present disclosure. These preferred target segments are shown in Table 18. The sequences represent the reverse complement of the preferred antisense compounds shown in Table 15. The" "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target nucleic acid to which the oligonucleotide binds. Table 18 also shows the species in which each of the preferred target segments was found.

35 Example 35

Antisense inhibition of human apolipoprotein B expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap - Variation in gap position

A series of antisense compounds were designed to target different regions of human apolipoprotein B RNA, using published sequences (GenBank accession number NM_000384.1, incorporated herein as SEQ ID NO: 3). The compounds are shown in Table 16. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the compound binds. All of the compounds in Table 16 are chimeric oligonucleotides ("gammers") 20 nucleotides in length. The "gap" region consists of 2'-deoxynucleotides, which are flanked on both sides (5 'and 3' directions) by "wings" composed of 2'methoxyethyl (2'-MOE) nucleotides. The number of 2'-MOE-nucleotides on each side of the gap varies so that the total number of 2'-MOE-nucleotides is always equal to 10 and the total length of the chimeric oligonucleotide is 20 nucleotides. The exact structure of each oligonucleotide is designated in Table 16 as "gap structure" and the 2'-deoxynucleotides are in bold. An 8-10-2 designation, for example, indicates that the first (most 5 ') 5 8 nucleotides and the last (most 3') 2 nucleotides are 2'-MOE-nucleotides and the 10 nucleotides in the gap they are 2'deoxynucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels was analyzed by quantitative real-time PCR, as described in other examples herein. The data shown in Table 16 are means from three experiments in the

10 that HepG2 cells were treated with antisense oligonucleotides of the present disclosure with doses of 50 nM and 150 nM. If present, "N.D." indicates "no data".

Table 16

Inhibition of Human Apolipoprotein B mRNA Levels by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Variable Deoxy Gap

ISIS number

SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. 150 nM % of INHIB. 50 nM hollow structure SEQ ID NO

308631

3 5589 AGGTTACCAGCCACATGCAG. 94 74 0∼10∼10 224

308632

3 3249 GCCTCAGTCTGCTTCGCACC 97 41 0∼10∼10 247

308634

3 5589 AGGTTACCAGCCACATGCAG 67 Four. Five 10 ~ 10 ~ 0 224

308635

3 3249 GCCTCAGTCTGCTTCGCACC 93 69 10 ~ 10 ~ 0 247

308637

3 5589 AGGTTACCAGCCACATGCAG 95 79 1∼10∼9 224

308638

3 3249 GCCTCAGTCTGCTTCGCACC 94 91 1 ~ 10 ~ 9 247

308640

3 5589 AGGTTACCAGCCACATGCAG 96 76 2 ~ 10 ~ 8 224

308641

3 3249 GCCTCAGTCTGCTTCGCACC 89 77 2∼10∼8 247

308643

3 5589 AGGTTACCAGCCACATGCAG. 96 56 3 ~ 10 ~ 7 224

308644

3 3249 GCCTCAGTCTCCTTCGCACC: 93 71 3∼10∼7 247

308646

3 5589 AGGTTACCAGCCACATGCAG 76 fifty 4∼10∼6 224

308647

3 3249 GCCTCAGTCTGCTTCGCACC 86 53 4 ~ 10 ~ 6 247

308649

3 5589 AGGTTACCAGCCACATGCAG 91 68 6∼10∼4 224

308650

3 3249 GCCTCAGTCTGCTTCGCACC 94 74 6 ~ 10 ~ 4 247

308652

3 5589 AGGTTACCAGCCACATGCAG 95 73 7∼10∼3 224

308653

3 3249 GCCTCAGTCTGCTTCGCACC 89 73 7∼10∼3 247

308655

3 5589 AGGTTACCAGCCACATGCAG 83 84 8∼10∼2 224

308656

3 3249 GCCTCAGTCTGCTTCGCACC 97 37 8 ~ 10 ~ 2 247

308658

3 5589 AGGTTACCAGCCACATGCAG 78 86 9∼10∼1 224

308659

3 3249 GCCTCAGTCTGCTTCGCACC 93 70 9∼10∼1 247

308660

3 3254 TGGTAGCCTCAGTCTGCTTC 92 72 2 ~ 10 ~ 8 514

308662

3 3254 TGGTAGCCTCAGTCTGCTTC 83 76 8 ~ 10 ~ 2 514

As shown in Table 16, SEQ ID No.s 224, 247 and 514 demonstrated at least 30% inhibition of human apolipoprotein B expression in this assay at both doses. These data suggest that oligonucleotides are effective with a number of variations in the gap situation. The target regions from which these preferred sequences are complementary are referred to herein as "preferred target segments" and are therefore preferred sites for targeting the compounds of the present disclosure. These preferred target segments are shown in Table 18. The sequences represent the reverse complement of the preferred antisense compounds shown in Table 16. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target nucleic acid , to which the oligonucleotide is attached. They are also shown in table 18

10 species in which each of the preferred target segments were found.

Example 36

Antisense inhibition of human apolipoprotein B expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap - Variation in gap position of SEQ ID No: 319 and 515

A series of antisense compounds based on SEQ ID No. 319 and 515 were designed, with variations in

15 structure of the hole. The compounds are shown in Table 17. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the compound binds. All of the compounds in Table 17 are chimeric oligonucleotides ("gammers") 20 nucleotides in length. The "gap" region consists of 2'-deoxynucleotides, which are flanked on both sides (5 'and 3' directions) by "wings" composed of 2'-methoxyethyl (2'-MOE) nucleotides. The number of 2'-MOE-nucleotides on each side of the gap varies so that the total number

20 of 2'-MOE-nucleotides is always equal to 10 and the total length of the chimeric oligonucleotide is 20 nucleotides. The exact structure of each oligonucleotide is designated in Table 17 as "gap structure" and the 2'-deoxynucleotides are in bold. An 8-10-2 designation, for example, indicates that the first (most 5 ') 8 nucleotides and the last (most 3') 2 nucleotides are 2'-MOE-nucleotides and the 10 nucleotides in the gap are 2'deoxynucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of the compounds on human apolipoprotein B mRNA levels was analyzed by quantitative real-time PCR, as described in other examples herein. The data shown in Table 17 are means from three experiments in which HepG2 cells were treated with antisense oligonucleotides of the present disclosure at doses of 50 nM and 150 nM. If present, "N.D." indicates "no data".

Table 17

Inhibition of Human Apolipoprotein B mRNA Levels by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Variable Deoxy Gap

ISIS number

SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. 150 nM % of INHIB. 50 nM hollow structure SEQ ID NO

308630

318 3121 GCCTCAGTCTGCTTCGCGCC 89 69 0 ~ 10 ~ 10 319

30863

318 3121 GCCTCAGTCTGCTTCGCGCC 83 66 10∼10 ~ 0 319

308636

318 3121 GCCTCAGTCTGCTTCGCGCC 91 81 1 ~ 10 ~ 9 319

308639

318 3121 GCCTCAGTCTGCTTCGCGCC 94 86 2 ~ 10 ~ 8 319

308642

318 3121 GCCTCAGTCTGCTTCGCGCC 95 85 3 ~ 10∼7 319

308645

318 3121 GCCTCAGTCTGCTTCGCGCC 98 57 4 ~ 20 ~ 6 319

308648

318 3121 GCCTCAGTCTGCTTCGCGCC 89 78 6 ~ 10 ~ 4 319

308651

318 3121 GCCTCAGTCTGCTTCGCGCC 88 87 7 ~ 10 ~ 3 319

308654

318 3121 GCCTCAGTCTGCTTCGCGCC 90 81 8 ~ 10 ~ 2 319

308657

318 3121 GCCTCAGTCTGCTTCGCGCC 78 61 9 ~ 10 ~ 1 319

308661

318 3116 AGTCTGCTTCGCGCCTTCTG 91 70 2 ~ 10 ~ 8 515

308663

318 3116 AGTCTGCTTCGCGCCTTCTG 84 44 8 ~ 10∼2 515

10 As shown in Table 17, SEQ ID No.s, 319 and 515 demonstrated at least 44% inhibition of human apolipoprotein B expression in this assay for either dose. These data suggest that the compounds are effective with a number of variations in the gap situation. Target regions of which these preferred sequences are complementary are referred to herein as "preferred target segments" and are therefore preferred sites for targeting the compounds of the present disclosure. These

15 preferred target segments are shown in Table 18. The sequences represent the reverse complement of the preferred antisense compounds shown in Table 17. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target nucleic acid , to which the oligonucleotide is attached. The species in which each of the preferred target segments were found are also shown in Table 18.

Table 18

20 Sequence and position of the preferred target segments identified in apolipoprotein B.

SITE ID

SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO

187342

3 199 GCGCCAGGGCCGAAGAGGAA 124 H. sapiens 516

187346

3 509 CAGGTATGAGCTCAAGCTGG 128 H. sapiens 517

187347

3 584 CATCCTGAACATCAAGAGGG 129 H. sapiens 518

187350

3 756 GGGCAGTGTGATCGCTTCAA 132 H. sapiens 519

187351

3 799 CACTTGCTCTCATCAAAGGC 133 H. sapiens 520

SITE ID

SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO

187352

3 869 CACACTGGACGCTAAGAGGA 134 H. sapiens 521

187356

3 1459 CGCTGAGCCACGCGGTCAAC 138 H. sapiens 522

187358

3 1859 TGTCCAAATTCTACCATGGG 140 H. sapiens 523

187359

3 2179 CAGCTGACCTCATCGAGATT 141 H. sapiens 524

187360

3 2299 GTCAAGTTCCTGATGGTGTC 142 H. sapiens 525

187362

3 2518 AGCTGCTTCTGATGGGTGCC 144 H. sapiens 526

187363

3 2789 GGGCATCATCATTCCGGACT 145 H. sapiens 527

187365

3 3100 CCTACTATCCGCTGACCGGG 147 H. sapiens 528

187367

3 3449 GGGCCACCTAAGTTGTGACA 148 H. sapiens 529

187368

3 3919 AGAACATGGGATTGCCAGAC 149 H. sapiens 530

187369

3 4089 CTCCACTTCAAGTCTGTGGG 150 H. sapiens 531

187371

3 5146 CAGAGCTTGGCCTCTCTGGG 152 H. sapiens 532

187372

3 5189 TGGCCGCTTCAGGGAACACA 153 H. sapiens 533

187374

3 6049 CAGCTGAGCAGACAGGCACC 155 H. sapiens 534

187375

3 6520 GGGAGAGACAAGTTTCACAT 156 H. sapiens 535

187377

3 6859 GTACTGCATCCTGGATTCAA 158 H. sapiens 536

187378

3 7459 GTGAGGTGACTCAGAGACTC 159 H. sapiens 537

187379

3 7819 TTGCAGAGCAATATTCTATC 160 H. sapiens 538

187380

3 7861 AAGCATTGGTAGAGCAAGGG 161 H. sapiens 539

187383

3 8589 CCGCTGGCTCTGAAGGAGTC 163 H. sapiens 540

187385

3 8829 TCTAGTCAGGCTGACCTGCG 165 H. sapiens 541

187387

3 9119 GGGCCACAGTGTTCTAACTG 166 H. sapiens 542

187388

3 10159 AATCAAGTGTCATCACACTG 167 H. sapiens 543

187390

3 10349 GGGTAGTCATAACAGTACTG 169 H. sapiens 544

187391

3 10699 AGAGCACACGGTCTTCAGTG 170 H. sapiens 545

187393

3 10839 TTACAGCTAGAGGGCCTCTT 172 H. sapiens 546

187398

3 12149 CACCGTGGGCATGGATATGG 176 H. sapiens 547

187399

3 12265 GGGAATCTGATGAGGAAACT 177 H. sapiens 548

187400

3 12380 TGTCAACAAGTACCACTGGG 178 H. sapiens 549

187403

3 12749 ACCTGGGATATACACTAGGG 181 H. sapiens 550

187406

3 13299 CCAAGTATAGTTGGCTGGAC 183 H. sapiens 551

187407

3 13779 TACATGAAGCTTGCTCCAGG 184 H. sapiens 552

197724

3 229 ATGTCAGCCTGGTCTGTCCA 185 H. sapiens 553

197725

3 269 GCACCTCCGGAAGTACACAT 186 H. sapiens 554

197726

3 389 CTGCAGCTTCATCCTGAAGA 187 H. sapiens 555

197727

3 449 TGAGGGCAAAGCCTTGCTGA 188 H. sapiens 556

197728

3 529 CCATTCCAGAAGGGAAGCAG 189 H. sapiens 557

197729

3 709 CGAGGAAGGGCAATGTGGCA 190 H. sapiens 558

197730

3 829 CCTTGTCAACTCTGATCAGC 191 H. sapiens 559

197731

3 849 AGCAGCCAGTCCTGTCAGTA 192 H. sapiens 560

197732

3 889 AGCATGTGGCAGAAGCCATC 193 H. sapiens 561

197733

3 1059 GAGAGCACCAAATCCACATC 194 H. sapiens 562

197734

3 1199 CCTCAGTGATGAAGCAGTCA 195 H. sapiens 563

197735

3 1349 GATAGATGTGGTCACCTACC 196 H. sapiens 564

197736

3 1390 CCTCAGCACAGCAGCTGCGA 197 H. sapiens 565

197737

3 1589 GATTCTGCGGGTCATTGGAA 198 H. sapiens 566

197738

3 1678 CAAAGCCATCACTGATGATC 199 H. sapiens 567

197739

3 1699 AGAAAGCTGCCATCCAGGCT 200 H. sapiens 568

197740

3 1749 CAGGAGGTTCTTCTTCAGAC 201 H. sapiens 569

197741

3 1829 GAGTCCTTCACAGGCAGATA 202 H. sapiens 570

197742

3 1919 TGCCAATATCTTGAACTCAG 203 H. sapiens 571

197743

3 2189 CATCGAGATTGGCTTGGAAG 204 H. sapiens 572

197744

3 2649 GGAGCTGGATTACAGTTGCA 205 H. sapiens 573

SITE ID

SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO

197745

3 2729 CAACATGCAGGCTGAACTGG 206 H. sapiens 574

197746

3 2949 ACATTACATTTGGTCTCTAC 207 H. sapiens 575

197747

3 3059 CTCAGGCGCTTACTCCAACG 208 H. sapiens 576

197748

3 3118 GGGACACCAGATTAGAGCTG 209 H. sapiens 577

197749

3 3189 GAGCTCCAGAGAGAGGACAG 210 H. sapiens 578

197750

3 3289 ATCGGCAGAGTATGACCTTG 211 H. sapiens 579

197751

3 3488 CAAGGGTGTTATTTCCATAC 212 H. sapiens 580

197752

3 3579 GACTCATCTGCTACAGCTTA 213 H. sapiens 581

197753

3 4039 GCAAATCCTCCAGAGATCTA 214 H. sapiens 582

197754

3 4180 CTCTCCTGGGTGTTCTAGAC 215 H. sapiens 583

197755

3 4299 ATGAAGGCTGACTCTGTGGT 216 H. sapiens 584

197756

3 4511 GGGACCACAGATGTCTGCTT 217 H. sapiens 585

197757

3 4660 CTGGCCGGCTCAATGGAGAG 218 H. sapiens 586

197758

3 4919 GCTGCGTTCTGAATATCAGG 219 H. sapiens 587

197759

3 5009 TGCTGACATCTTAGGCACTG 220 H. sapiens 588

197760

3 5109 AAGTGTAGTCTCCTGGTGCT 221 H. sapiens 589

197761

3 5212 CAAAATTCAGTCTGGATGGG 222 H. sapiens 590

197762

3 5562 GGGAAACTACGGCTAGAACC 223 H. sapiens 591

197763

3 5589 CTGCATGTGGCTGGTAACCT 224 H. sapiens 592

197764

3 5839 CCATGACCATCGATGCACAT 225 H. sapiens 593

197765

3 5869 ATGGGAAACTCGCTCTCTGG 226 H. sapiens 594

197766

3 5979 AGTCATCATCTCGTGTCTAG 227 H. sapiens 595

197767

3 6099 GAATACAGCCAGGACTTGGA 228 H. sapiens 596

197768

3 6144 GGCGTGGAGCTTACTGGACG 229 H. sapiens 597

197769

3 6249 GAGATGAGAGATGCCGTTGA 230 H. sapiens 598

197770

3 6759 AGTCTTGATGAGCACTATCA 231 H. sapiens 599

197771

3 6889 CTAAGTACCAAATCAGAATC 232 H. sapiens 600

197772

3 7149 GTCCATGAGTTAATCGAGAG 233 H. sapiens 601

197773

3 7549 AGGCCACAGTTGCAGTGTAT 2. 3. 4 H. sapiens 602

197774

3 7779 TCTGATTGGTGGACTCTTGC 235 H. sapiens 603

197775

3 7929 GAAGTCAGTCTTCAGGCTCT 236 H. sapiens 604

197776

3 8929 CCAGATTCTCAGATGAGGGA 237 H. sapiens 605

197778

3 10240 CATCTGTCATTGATGCACTG 238 H. sapiens 606

197779

3 10619 AGGAGATGTCAAGGGTTCGG 239 H. sapiens 607

197780

3 10659 GGAACTATTGCTAGTGAGGC 240 H. sapiens 608

197781

3 10899 CTCTCTCCATGGCAAATGTC 241 H. sapiens 609

197783

3 11979 CACCGTGACTTCAGTGCAGA 243 H. sapiens 610

197784

3 12249 ACTGAGTTGAGGGTCCGGGA 244 H. sapiens 611

197786

3 13958 CACATATGAACTGGACCTGC 245 H. sapiens 612

197787

3 14008 TCTGAACTCAGAAGGATGGC 246 H. sapiens 613

216825

3 3249 GGTGCGAAGCAGACTGAGGC 247 H. sapiens 614

216826

3 3 TCCCACCGGGACCTGCGGGG 248 H. sapiens 615

216827

3 6 CACCGGGACCTGCGGGGCTG 249 H. sapiens 616

216828

3 2. 3 CTGAGTGCCCTTCTCGGTTG 250 H. sapiens 617

216829

3 35 CTCGGTTGCTGCCGCTGAGG 251 H. sapiens 618

216830

3 36 TCGGTTGCTGCCGCTGAGGA 252 H. sapiens 619

216831

3 37 CGGTTGCTGCCGCTGAGGAG 253 H. sapiens 620

216832

3 39 GTTGCTGCCGCTGAGGAGCC 254 H. sapiens 621

216833

3 43 CTGCCGCTGAGGAGCCCGCC 255 H. sapiens 622

216834

3 116 ACCGCAGCTGGCGATGGACC 256 H. sapiens 623

216835

3 120 CAGCTGGCGATGGACCCGCC 257 H. sapiens 624

216836

3 13800 GAACTTACTATCATCCTCTA 258 H. sapiens 625

216838

3 13854 TCCAATTGAACTTTCACATA 260 H. sapiens 626

SITE ID

SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO

216839

3 13882 AAAATTCAAACTGCCTATAT 261 H. sapiens 627

216840

3 13903 GATAAAACCATACAGTGAGC 262 H. sapiens 628

216841

3 13904 ATAAAACCATACAGTGAGCC 263 H. sapiens 629

216842

3 13908 AACCATACAGTGAGCCAGCC 264 H. sapiens 630

216843

3 13909 ACCATACAGTGAGCCAGCCT 265 H. sapiens 631

216844

3 13910 CCATACAGTGAGCCAGCCTT 266 H. sapiens 632

216845

3 13917 GTGAGCCAGCCTTGCAGTAG 267 H. sapiens 633

216846

3 13922 CCAGCCTTGCAGTAGGCAGT 268 H. sapiens 634

216847

3 13934 TAGGCAGTAGACTATAAGCA 269 H. sapiens 635

216848

3 13937 GCAGTAGACTATAAGCAGAA 270 H. sapiens 636

216849

3 13964 TGAACTGGACCTGCACCAAA 271 H. sapiens 637

216850

3 13968 CTGGACCTGCACCAAAGCTG 272 H. sapiens 638

216851

3 13970 GGACCTGCACCAAAGCTGGC 273 H. sapiens 639

216852

3 13974 CTGCACCAAAGCTGGCACCA 274 H. sapiens 640

216853

3 13978 ACCAAAGCTGGCACCAGGGC 275 H. sapiens 641

216854

3 13997 CTCGGAAGGTCTCTGAACTC 276 H. sapiens 642

216855

3 14012 AACTCAGAAGGATGGCATTT 277 H. sapiens 643

216856

3 14014 CTCAGAAGGATGGCATTTTT 278 H. sapiens 644

216857

3 14049 ATCAGGATCTGAGTTATTTT 279 H. sapiens 645

216858

3 14052 AGGATCTGAGTTATTTTGCT 280 H. sapiens 646

216859

3 14057 CTGAGTTATTTTGCTAAACT 281 H. sapiens 647

216860

3 14064 ATTTTGCTAAACTTGGGGGA 282 H. sapiens 648

216861

3 14071 TAAACTTGGGGGAGGAGGAA 283 H. sapiens 649

217030

3 14087 GGAACAAATAAATGGAGTCT 284 H. sapiens 650

224316

3 3230 GTTTGTAACTCAAGCAGAAG 285 H. sapiens 651

224317

3 3232 TTGTAACTCAAGCAGAAGGT 286 H. sapiens 652

224318

3 3234 GTAACTCAAGCAGAAGGTGC 287 H. sapiens 653

224319

3 3236 AACTCAAGCAGAAGGTGCGA 288 H. sapiens 654

224320

3 3238 CTCAAGCAGAAGGTGCGAAG 289 H. sapiens 655

224321

3 3240 CAAGCAGAAGGTGCGAAGCA 290 H. sapiens 656

224322

3 3242 AGCAGAAGGTGCGAAGCAGA 291 H. sapiens 657

224323

3 3244 CAGAAGGTGCGAAGCAGACT 292 H. sapiens 658

224324

3 3246 GAAGGTGCGAAGCAGACTGA 293 H. sapiens 659

224325

3 3248 AGGTGCGAAGCAGACTGAGG 294 H. sapiens 660

224326

3 3250 GTGCGAAGCAGACTGAGGCT 295 H. sapiens 661

224327

3 3252 GCGAAGCAGACTGAGGCTAC 296 H. sapiens 662

224328

3 3254 GAAGCAGACTGAGGCTACCA 297 H. sapiens 663

224329

3 3256 AGCAGACTGAGGCTACCATG 298 H. sapiens 664

224330

3 3258 CAGACTGAGGCTACCATGAC 299 H. sapiens 665

224331

3 3260 GACTGAGGCTACCATGACAT 300 H. sapiens 666

224332

3 3262 CTGAGGCTACCATGACATTC 301 H. sapiens 667

224333

3 3264 GAGGCTACCATGACATTCAA 302 H. sapiens 668

224334

3 3266 GGCTACCATGACATTCAAAT 303 H. sapiens 669

224335

3 3268 CTACCATGACATTCAAATAT 304 H. sapiens 670

224336

3 5582 CCTGAAGCTGCATGTGGCTG 305 H. sapiens 671

224337

3 5584 TGAAGCTGCATGTGGCTGGT 306 H. sapiens 672

224338

3 5586 AAGCTGCATGTGGCTGGTAA 307 H. sapiens 673

224339

3 5588 GCTGCATGTGGCTGGTAACC 308 H. sapiens 674

224340

3 5590 TGCATGTGGCTGGTAACCTA 309 H. sapiens 675

224341

3 5592 CATGTGGCTGGTAACCTAAA 310 H. sapiens 676

224342

3 5594 TGTGGCTGGTAACCTAAAAG 311 H. sapiens 677

224343

3 5596 TGGCTGGTAACCTAAAAGGA 312 H. sapiens 678

224344

3 5598 GCTGGTAACCTAAAAGGAGC 313 H. sapiens 679

SITE ID

SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO

224345

3 5600 TGGTAACCTAAAAGGAGCCT 314 H. sapiens 680

224346

3 5602 GTAACCTAAAAGGAGCCTAC 315 H. sapiens 681

224347

3 5604 AACCTAAAAGGAGCCTACCA 316 H. sapiens 682

224348

3 5606 CCTAAAAGGAGCCTACCAAA 317 H. sapiens 683

187366

318 3121 GGCGCGAAGCAGACTGAGGC 319 H. sapiens 684

187404

318 12651 CACTATGTTCATGAGGGAGG 323 H. sapiens 685

197777

318 9851 CCATCATAGGTTCTGACGTC 324 H. sapiens 686

197785

318 12561 GAAGCTGATTGACTCACTCA 325 H. sapiens 687

224349

318 3104 TTGTAACTCAAGCAGAAGGC 326 H. sapiens 688

224350

318 3106 GTAACTCAAGCAGAAGGCGC 327 H. sapiens 689

224351

318 3108 AACTCAAGCAGAAGGCGCGA 328 H. sapiens 690

224352

318 3110 CTCAAGCAGAAGGCGCGAAG 329 H. sapiens 691

224353

318 3116 CAGAAGGCGCGAAGCAGACT 330 H. sapiens 692

224354

318 3118 GAAGGCGCGAAGCAGACTGA 331 H. sapiens 693

224355

318 3120 AGGCGCGAAGCAGACTGAGG 332 H. sapiens 694

224356

318 3122 GCGCGAAGCAGACTGAGGCT 333 H. sapiens 695

224328

3 3254 GAAGCAGACTGAGGCTACCA 514 H. sapiens 696

224353

318 3116 CAGAAGGCGCGAAGCAGACT 515 H. sapiens 697

216862

334 904 TCTTTCTCCTGTCTTACAGA 335 H. sapiens 698

216866

334 1988 CCCACGTTAGAAGATGCGAC 339 H. sapiens 699

216868

334 2722 AATATGGTAGACATGAGCCA 341 H. sapiens 700

216869

334 2791 CATTAGCTGCATTTCAACTG 342 H. sapiens 701

216870

334 3045 ACTTTCACTCCTAGTCTGCA 343 H. sapiens 702

216874

334 3527 CCATGTCCAGGTAAGTCATG 347 H. sapiens 703

216876

334 3603 GCACCAGGCACGGATGTGAC 349 H. sapiens 704

216877

334 3864 GTGGGGTCCCAGAGGCACTG 350 H. sapiens 705

216878

334 3990 GCTGATCGGCCACTGCAGCT 351 H. sapiens 706

216879

334 4251 TCCACGTGGCTGGGGAGGTC 352 H. sapiens 707

216880

334 4853 TGTAATGTATGGTGATCAGA 353 H. sapiens 708

216881

334 5023 GAGAGTACCCAGTGGGAAAT 354 H. sapiens 709

216882

334 5055 AGTCAGCATGGGCTTCAGCC 355 H. sapiens 710

216883

334 5091 CAAAAGAATGACTGTCCAAC 356 H. sapiens 711

216884

334 5096 GAATGACTGTCCAACAAGTG 357 H. sapiens 712

216885

334 5301 TATCTACTGTAATTTAAAAT 358 H. sapiens 713

216886

334 5780 CTGATATGGGTGGAGAACAG 359 H. sapiens 714

216887

334 6353 TCTGGGACAGGTATGAGCTC 360 H. sapiens 715

216888

334 6534 TGATAGCAGTGGCCCTTGAA 361 H. sapiens 716

216889

334 6641 GGATTGGCGTGAAATACTGG 362 H. sapiens 717

216890

334 6661 TGCCCGAGGTTCCTCCTGCC 363 H. sapiens 718

216894

334 7059 GCACTAGCAAGACCACACTC 367 H. sapiens 719

216895

334 7066 CAAGACCACACTCTGCATAG 368 H. sapiens 720

216897

334 7209 TCCTCCATAGGATACCGTGT 370 H. sapiens 721

216899

334 7702 GGATGTAGGGCAGCAAAACC 372 H. sapiens 722

216900

334 7736 TCTGCACAAGGACTCCTTGT 373 H. sapiens 723

216901

334 8006 CAGCCTGTCTCAGTGAACAT 374 H. sapiens 724

216903

334 8239 CAGGATGCTTCCAGTCTAAT 376 H. sapiens 725

216904

334 8738 AAATGCTCGTCTCCAATCTC 377 H. sapiens 726

216906

334 9208 AACTTGTGTATCCAAATCCA 379 H. sapiens 727

216908

334 9545 TGACATGGTGTGCTTCCTTG 381 H. sapiens 728

216910

334 9770 ACACTGGTGTTCTGGCTACC 383 H. sapiens 729

216911

334 9776 GTGTTCTGGCTACCTCTAGT 384 H. sapiens 730

216913

334 10341 TCCTGGCATAGGTCACAGTA 386 H. sapiens 731

216914

334 10467 ATGTCAACAGTAGCACCTCC 387 H. sapiens 732

SITE ID

SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO

216915

334 10522 TAGACTCAGACAAGTCTGGA 388 H. sapiens 733

216917

334 10587 CCTAAGTTGCTCATCTCTGG 390 H. sapiens 734

216922

334 11337 TGCGCTGAGTTCCATGAAAC 395 H. sapiens 735

216923

334 11457 CTATTGCAGGTGCTCTCCAG 396 H. sapiens 736

216926

334 12155 CAGAGGAACATCTTGCACCT 399 H. sapiens 737

216928

334 12221 CTCTGCTCCTTACTCTTGTG 401 H. sapiens 738

216929

334 12987 GTAATTTCTCACCATCCATC 402 H. sapiens 739

216930

334 13025 TTCTGAGTCTCAATTGTCTA 403 H. sapiens 740

216931

334 13057 CTATGTCCTTGTGTGCACAT 404 H. sapiens 741

216932

334 13634 GCCTATTGCCATTTGTATGT 405 H. sapiens 742

216933

334 13673 CTATTCATGTCCTTTGCCTA 406 H. sapiens 743

216935

334 14567 GATTCTGCGGGTAATCTCAG 408 H. sapiens 744

216937

334 14680 TCAATGCAGGTCATTGGAAA 410 H. sapiens 745

216938

334 15444 CTACCAGATTGACCATCCCT 411 H. sapiens 746

216940

334 15757 TACTTGATAGTGCTCTAGGA 413 H. sapiens 747

216941

334 15926 TTGACTGCAGGACCAGGAGG 414 H. sapiens 748

216942

334 16245 AACAAACACTTGTGCAAATG 415 H. sapiens 749

216950

334 18519 AATGAGACCAAACTTCCACT 423 H. sapiens 750

216951

334 18532 TTCCACTTTGAAGCTAGCAA 424 H. sapiens 751

216952

334 18586 GATCTGGAGCTTATTCTTGA 425 H. sapiens 752

216953

334 18697 ACCTCATGTGACTTGTATGC 426 H. sapiens 753

216954

334 18969 TTCTTAAGAAACACCTTGTA 427 H. sapiens 754

216955

334 19250 TAGGCCCATCCTGGCTGCAT 428 H. sapiens 755

216956

334 19340 AAACTCTCAGGATATGGTAA 429 H. sapiens 756

216957

334 19802 ATACCTTCCTCTACCTTTGC 430 H. sapiens 757

216958

334 19813 TACCTTTGCTGAAGGTCCTT 431 H. sapiens 758

216961

334 20567 ATCTATCTAGTGAAATTTCT 434 H. sapiens 759

216962

334 20647 TCAGCTCATCAAAATATGCT 435 H. sapiens 760

216963

334 20660 ATATGCTAGTCCTTCCTTTC 436 H. sapiens 761

216965

334 21316 CAAAGGTCTGAGTTATCCAG 438 H. sapiens 762

216967

334 21422 TGACTTATAGATGCAGGCTG 440 H. sapiens 763

216968

334 21634 TCAGTGGAGGGTAATTCTTT 441 H. sapiens 764

216969

334 21664 TGCCTAGCCAGTTTGAAAGA 442 H. sapiens 765

216970

334 21700 CCTGCAGAATTTTGCCAGGC 443 H. sapiens 766

216972

334 22048 GTAGCTAGGTAGGTAAAGCA 445 H. sapiens 767

216973

334 22551 TTGAGTGAGACACACAAGGT 446 H. sapiens 768

216974

334 22694 GTGCTAGTCAGGGAATGCAT 447 H. sapiens 769

216976

334 22903 GGGGAGAGAGCATGCCCAGC 449 H. sapiens 770

216977

334 22912 GCATGCCCAGCTGCGAAAGC 450 H. sapiens 771

216978

334 23137 AGCCAGGTATAGAAAGGAGT 451 H. sapiens 772

216979

334 23170 AACTTTCTAAGAGGCAGAAT 452 H. sapiens 773

216981

334 23882 TCTTAGTCTGGTCATGAGTG 454 H. sapiens 774

216983

334 24184 AGTAGGAGATTTCATATGAA 456 H. sapiens 775

216985

334 24559 TCTTCACCAGCAACACATTA 458 H. sapiens 776

216987

334 24800 ATGGCCACCTAGCATGGCAC 460 H. sapiens 777

216989

334 24991 CATGTTTCTGAGCCTCCAGA 462 H. sapiens 778

216990

334 25067 TAGGTGGCTCCCTGTCTTCA 463 H. sapiens 779

216991

334 25152 TCCAAAGTCTTGGGAATCCT 464 H. sapiens 780

216995

334 26749 ACAAAGAAAGGGGGAGTTGG 468 H. sapiens 781

216996

334 26841 TCGTGTCTTCCTGGCCCAGA 469 H. sapiens 782

216997

334 27210 GCAGTGCCCAGCACACAATA 470 H. sapiens 783

216998

334 27815 ACTCGTCCAGGTGCGAAGCA 471 H. sapiens 784

216999

334 28026 GCCACCTAAGGTAAAGAAGG 472 H. sapiens 785

SITE ID

SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE COMP. INV OF SEQ ID NO ACTIVE IN SEQ ID NO

217000

334 28145 ATCAGAGTGGCAGAGAGAGC 473 H. sapiens 786

217002

334 28919 TTTACCATAGTTGTGACACA 475 H. sapiens 787

217006

334 29871 CATTTTGTAGGCAATG4GCT 479 H. sapiens 788

217007

334 30181 GCATTAGTAAACATGAGAAC 480 H. sapiens 789

217009

334 30931 TTCATTTCAGCGATGGCCGG 482 H. sapiens 790

217013

334 39562 GAAAATCTAGTGTCATTCAA 486 H. sapiens 791

217016

334 39789 TCCTATACAGTTTTGGGAAC 489 H. sapiens 792

217017

334 39904 AAGGACTTCAGTATGGAGCT 490 H. sapiens 793

217018

334 39916 ATGGAGCTTTTATTGAATTG 491 H. sapiens 794

217022

334 40412 CCATCAGCACTATTATTTAT 495 H. sapiens 795

217023

334 40483 ATAGGCAAGCTCAGCCATAG1 496 H. sapiens 796

217025

334 40576 TGCTAGATGAGATACATCAA 498 H. sapiens 797

217026

334 40658 GAAGACCAAACATGGTTCTA 499 H. sapiens 798

217029

334 41130 CTCTGTTTAGTCCTCTCCAG 502 H. sapiens 799

1217032

503 490 CATTGATAAAATGTTCTGGC 505 H. sapiens 800

217033

503 504 TCTGGCACAGCAAAACCTCT 506 H. sapiens 801

217034

503 506 TGGCACAGCAAAACCTCTAG 507 H. sapiens 802

217037

503 523 TAGAACACATAGTGTGATTT 510 H. sapiens 803

217039

503 526 AACACATAGTGTGATTTAAG 512 H. sapiens 804

Since these "preferred target segments" have been found by experimentation to be open to, and therefore accessible to, hybridization with antisense compounds of the present disclosure, one of skill in the art will recognize, or be able to determine, using only routine experimentation. , other aspects of the description that

5 encompass other compounds that specifically hybridize to these preferred target segments and therefore inhibit apolipoprotein B expression.

According to the present description, antisense compounds include antisense oligomer compounds, antisense oligonucleotides, ribozymes, external guide sequence oligonucleotides (EGS), alternative splices, primers, probes, and other short oligomeric compounds that hybridize to at least part of the nucleic acid.

10 target.

Example 37

Antisense inhibition of human apolipoprotein B expression - dose-response of oligonucleotides

The 12 oligonucleotides described in Examples 29 and 31 were further investigated in a dose-response study. The control oligonucleotides used in this study were ISIS 18076 (SEQ ID NO: 805) and ISIS 13650 (SEQ ID NO:

15 806).

All compounds in this study, including controls, were 20 nucleotide long chimeric oligonucleotides ("gammers"), composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which are flanked on both sides (directions 5 'and 3') by 5 nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) bonds are phosphorothioate bonds

20 (P = S) throughout the oligonucleotides. All cytidine residues are 5-methylcytidines.

In the dose-response experiment, with mRNA levels as the end point, HepG2 cells were treated with the antisense oligonucleotides or the control oligonucleotides with doses of 37, 75, 150, and 300 nM of the oligonucleotide. Data were obtained by quantitative real-time PCR as described in other examples herein, and are the average of two experiments with mRNA levels in treatment groups.

25 normalized with respect to an untreated control group. The data is shown in Table 19.

Table 19

Inhibition of apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap - Dose-response

Dose

37 nM

75 nM 150 nM 300 nM

ISIS number

% inhibition SEQ ID NO

271009

82 91 94 96 319

281625

62 76 84 94 224

301014

75 90 96 98 249

301027

80 90 95 96 262

301028

70 79 85 92 263

301029

54 67 79 85 264

301030

64 75 87 92 265

301031

61 82 92 96 266

301034

73 87 93 97 269

301036

67 83 92 95 271

301037

73 85 89 96 272

301045

77 86 94 98 280

5 Example 38

Antisense inhibition of human apolipoprotein B expression - dose-response - Lower dose range

The 7 oligonucleotides described in Examples 29, 31, 35, and 36 were further investigated in a dose-response study. The control oligonucleotides used in this study were ISIS 18076 (SEQ ID NO: 805), ISIS 13650 (SEQ ID NO: 806), and ISIS 129695 (SEQ ID NO: 807).

10 All of the compounds in this study, including controls, were chimeric oligonucleotides ("gammers") 20 nucleotides in length, composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which are flanked on both sides ( directions 5 'and 3') by 5 nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages along oligonucleotides. All cytidine residues are 5-methylcytidines.

In the dose-response experiment, with mRNA levels as the end point, HepG2 cells were treated with the antisense oligonucleotides or the control oligonucleotides with doses of 12.5, 37, 75, 150 and 300 nM of the oligonucleotide. Data were obtained by quantitative real-time PCR as described in other examples herein, and are the average of two experiments with mRNA levels in standardized treatment groups relative to an untreated control group. The data is shown in Table 20.

20 Table 20

Inhibition of apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap - Dose-response

Dose

12.5 nM

37 nM 75 nM 150 nM 300 nM

ISIS number

% inhibition SEQ ID No

271009

67 86 92 94 95 319

281625

44 66 83 85 94 224

301012

63 79 90 92 95 247

308638

42 73 91 96 97 247

308642

59 84 91 97 98 319

308651

57 76 84 90 88 319

308658

29 61 73 78 90 224

Example 39

RNA synthesis

In general, the chemistry of RNA synthesis is based on the selective incorporation of different protecting groups in strategic intermediate reactions. Although the person skilled in the art will understand the use of protecting groups in organic synthesis, a useful class of protecting groups includes silyl ethers. In particular, bulky silyl ethers are used to protect the 5'-hydroxyl in combination with an acid-labile orthoester protecting group on the 2'-hydroxyl. This set of protecting groups is then used in conventional solid phase synthesis technology. It is important to remove the acid labile orthoester protecting group last, after all other synthetic steps. Furthermore, the prompt use of silyl protecting groups during synthesis facilitates removal when desired, without unwanted deprotection of the 2'-hydroxyl.

Following this procedure for sequential protection of 5'-hydroxyl in combination with protection of 2'-hydroxyl by protecting groups that are removed differently and are chemically labile differently, RNA oligonucleotides were synthesized.

RNA oligonucleotides are synthesized in steps. Each nucleotide is added sequentially (3'- to 5'- direction) to an oligonucleotide attached to a solid support. The first nucleoside at the 3 'end of the chain is covalently attached to a solid support. The precursor nucleotide, a phosphoramidite and activator ribonucleoside are added, coupling the second base to the 5 'end of the first nucleoside. The support is washed and any unreacted 5'-hydroxyl group is capped with acetic anhydride to give 5'-acetyl residues. The bond is then oxidized to the more stable and ultimately desired bond of P (V). At the end of the nucleotide addition cycle, the 5'-silyl group is cleaved with fluoride. The cycle is repeated for each nucleotide that follows.

Following the synthesis, the methyl protecting groups on the phosphates are cleaved in 30 min using 1M disodium 2-carbamoyl-2-cyanoethylene-1,1-dithiolate trihydrate (S2Na2) in DMF. The deprotection solution is washed from the oligonucleotide bound to the solid support using water. The support is then treated with 40% methylenamine in water for 10 min at 55 ° C. This releases the RNA oligonucleotides into solution, deprotects the exocyclic amines and modifies the 2 'groups. Oligonucleotides can be analyzed by anion exchange HPLC at this stage.

2'-Orthoester groups are the last protecting groups to be removed. The ethylene glycol monoacetate orthoester protecting group developed by Dharmacon Research, Inc. (Lafayette, CO), is an example of a useful orthoester protecting group having the following important properties. It is stable under the conditions of synthesis of the nucleoside phosphoramidite and the synthesis of the oligonucleotide. However, after synthesis of the oligonucleotide, the oligonucleotide is treated with methylamine which not only cleaves the oligonucleotide from the solid support but also removes the acetyl groups from the orthoesters. The resulting 2-ethyl-hydroxyl substituents on the orthoester are less electron-attracting than the acetylated precursor. As a result, the modified orthoester becomes more labile to acid catalyzed hydrolysis. Specifically, the cleavage rate is approximately 10 times faster after removing acetyl groups. Therefore, the orthoester has sufficient stability in order to be compatible with the synthesis of oligonucleotides and furthermore, when it is subsequently modified, it allows the deprotection to be carried out under relatively mild aqueous conditions compatible with the final RNA oligonucleotide product.

Furthermore, RNA synthesis methods are well known in the art (Scaringe, SA Ph.D. Thesis, University of Colorado, 1996; Scaringe, SA, et al., J. Am. Chem. Soc., 1998, 120 , 11820-11821; Matteucci, MD and Caruthers, MHJ Am. Chem. Soc., 1981, 103, 3185-3191; Beaucage, SL and Caruthers, MH Tetrahedron Lett., 1981, 22, 1859-1862; Dahl, BJ, et al., Acta Chem. Scand ,. 1990, 44, 639-641; Reddy, MP, et al., Tetrahedron Lett., 1994, 25, 4311-4314; Wincott, F. et al., Nucleic Acids Res. , 1995, 23, 2677-2684; Griffin, BE, et al., Tetrahedron, 1967, 23, 2301-2313; Griffin, BE, et al., Tetrahedron, 1967, 23, 2315-2331).

The antisense RNA compounds (RNA oligonucleotides) of the present invention can be synthesized by methods herein or purchased from Dharmacon Research, Inc (Lafayette, CO). Once synthesized, complementary antisense RNA compounds can then be stably reassociated by methods known in the art to form double-stranded antisense compounds (duplexes). For example, duplexes can be formed by combining 30 µl of each of the complementary strands of the RNA oligonucleotides (50 µM RNA oligonucleotide solution) and 15 µl of 5X annealing buffer (100mM potassium acetate, 30mM HEPES-KOH pH 7.4, 2mM magnesium acetate) followed by heating for 1 min at 90 ° C, then 1 h at 37 ° C. The resulting duplex antisense compounds can be used in kits, assays, screens, or other methods to investigate the function of a target nucleic acid.

Example 40

Design and screening of duplex antisense compounds targeting apolipoprotein B

A series of nucleic acid duplexes comprising the antisense compounds of the present invention and their complements are designed to target them to apolipoprotein B. The nucleic base sequence of the duplex antisense chain comprises at least a part of an oligonucleotide described in present memory.

The ends of the chains can be modified by the addition of one or more natural or modified nucleic bases to form a protruding end. The same-way strand of double-stranded RNA is then engineered and synthesized as the complement of the antisense strand and may also contain modifications or additions at the ends. For example, in one embodiment, both strands of the dsRNA duplex would be

5 complementary around the central nucleic bases, each with projecting ends at one or both ends. The duplex antisense and same-sense strands comprise from about 17 to 25 nucleotides, or from about 19 to 23 nucleotides. Alternatively, the antisense and sense chains comprise 20, 21, or 22 nucleotides.

For example, a duplex comprising an antisense strand that has the sequence

10 CGAGAGGCGGACGGGACCG and which has a protruding end of two deoxythymidine (dT) nucleic bases would have the following structure:

Antisense chain

Complement

In another embodiment, a duplex comprising an antisense strand having the same CGAGAGGCGGACGGGACCG sequence can be prepared with blunt ends (with no protruding end on any strand)

15 as shown:

Antisense chain

Complement

Duplex RNA strands can be synthesized by methods described herein or purchased from Dharmacon Research Inc., (Lafayette, CO). Once synthesized, the complementary strands are stably reassociated. Aliquots of the individual chains are taken and diluted to a concentration of 50 µM. Once diluted, 30 µl of each chain is combined with 15 µl of a 5X annealing buffer solution. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, and 2 mM magnesium acetate. The final volume is 75 µl. This solution is incubated for 1 min at 90 ° C and then centrifuged for 15 s. The tube is left to settle for 1 hr at 37 ° C at which time dsRNA duplexes are used in experimentation. The final concentration of the dsRNA duplexes is 20 µM. The dissolution

25 can be stored frozen (-20ºC) and freeze-thaw up to 5 times.

Once prepared, the ability of duplex antisense compounds to modulate apolipoprotein B expression is evaluated.

When the cells reach 80% confluence, they are treated with the duplex antisense compounds of the invention. For cells grown in 96-well plates, the wells are washed once with 200 µl of OPTI medium

Serum reduced MEM-1 (Gibco BRL) and then treated with 130 µl OPTI-MEM-1 containing 12 µg / ml LIPOFECTIN (Gibco BRL) and the desired duplex antisense compound at a final concentration of 200 nM. After 5 h of treatment, the medium is replaced by fresh addition. Cells are harvested 16 h after treatment, at which time RNA is isolated and target reduction is measured by RT-PCR.

Example 41

35 Design of phenotypic assays and in vivo studies to use apolipoprotein B inhibitors

Phenotypic assays

Once apolipoprotein B inhibitors have been identified by the methods described herein, the compounds are further investigated in one or more phenotypic assays, each with measurable endpoints that predict efficacy in treating a condition. pathological or particular condition. Phenotypic assays, kits, and reagents for use are well known to those of skill in the art and are used herein to investigate the function and / or association of apolipoprotein B with health and disease. Representative phenotypic assays, which may be purchased from one or more commercial suppliers, include those to determine cell viability, cytotoxicity, proliferation, or cell survival (Molecular Probes, Eugene, OR; PerkinElmer, Boston, MA), protein-based assays, including enzymatic assays (Panvera,

45 LLC, Madison, WI; BD Biosciences, Franklin Lakes, NJ; Oncogene Research Products, San Diego, CA), cell regulation, signal transduction, inflammation, oxidative processes, and apoptosis (Assay Designs Inc., Ann Arbor, MI), triglyceride accumulation (Sigma-Aldrich, St. Louis, MO), angiogenesis assays, tube formation assays, cytokine and hormone assays, and metabolic assays (Chemicon International Inc., Temecula, CA; Amersham Biosciences, Piscataway, NJ).

In a non-limiting example, cells determined to be suitable for a particular phenotypic assay (ie, MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies) are treated with identified apolipoprotein B inhibitors in in vitro studies, as well as control compounds, at optimal concentrations that are determined by the methods described above. At the end of the treatment period, treated and untreated cells will be analyzed by one or more specific assay methods to determine phenotypic results and endpoints.

Phenotypic endpoints include changes in cell morphology over time or dose of treatment as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides, or metals. Measurements of cell status including pH, cell cycle stage, absorption or excretion of biological indicators by the cell, are also endpoints of interest.

Analysis of the cell genotype (measurement of the expression of one or more cell genes) after treatment is also used as an indicator of the efficacy or potency of apolipoprotein B inhibitors. The distinctive genes, or those Genes suspected to be associated with a specific disease state, condition, or genotype are measured in both treated and untreated cells.

In Vivo Studies

The individual subjects of the in vivo studies described herein are warm blooded vertebrate animals, including humans.

The clinical trial undergoes rigorous controls that ensure that individuals are not unnecessarily put at risk and that they are fully informed of their role in the study.

To account for the psychological effects of receiving the treatments, volunteers are randomly given placebo or apolipoprotein B inhibitor. Also, to prevent doctors from being impartial, they are not informed if the medication they are administering is a apolipoprotein B inhibitor or a placebo. Using this randomization procedure, each volunteer is equally likely to be given the new treatment or the placebo.

The volunteers received the apolipoprotein B inhibitor or the placebo for a period of 8 weeks, measuring the biological parameters associated with the pathological state or the condition indicated at the beginning (measurement of the initial values before any treatment), at the end (after the final treatment), and at regular intervals during the study period. Such measurements include levels of nucleic acid molecules encoding apolipoprotein B or levels of apolipoprotein B protein in body fluids, tissues, or organs purchased at levels prior to treatment. Other measurements include, but are not limited to, indices of the disease state or condition to be treated, body weight, blood pressure, serum titer of pharmacological indicators of disease or toxicity as well as ADME measurements (absorption, distribution, metabolism, and excretion) .

The information recorded for each patient includes age (years), gender, height (cm), family history of disease state or condition (yes / no), motivation assessment (somewhat / moderate / large), and number and type of regimens of previous treatment for the indicated disease or condition.

The volunteers taking part in this study are healthy adults (ages 18 to 65) and approximately the same number of men and women participate in this study. Volunteers with certain characteristics are equally distributed on placebo and apolipoprotein B inhibitor treatment. In general, placebo-treated volunteers have little or no response to treatment, whereas volunteers treated with apolipoprotein inhibitor B show positive trends in their index of disease state or condition at the end of the study.

Example 42

Antisense inhibition of rabbit apolipoprotein B expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

A series of oligonucleotides were designed to target different regions of rabbit apolipoprotein B RNA, using the sequences published (GenBank accession number X07480.1, incorporated herein as SEQ ID NO: 808, accession number in GenBank M17780.1, incorporated herein as SEQ ID NO: 809, and a sequence was obtained using the primers previously described (Tanaka, Journ. Biol. Chem., 1993, 268, 12713-12718) representing the mRNA of rabbit apolipoprotein B, incorporated herein as SEQ ID NO: 810). The oligonucleotides are shown in Table 21. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the oligonucleotide is attached. All of the compounds in Table 21 are 20 nucleotide long chimeric oligonucleotides ("gammers"), composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5 'directions and 3 ') by "wings" of 5 nucleotides. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The effect of compounds on rabbit apolipoprotein B mRNA levels in primary rabbit hepatocytes was analyzed by quantitative real-time PCR, as described in other examples herein. The primary rabbit hepatocytes were treated with the 150 mM compounds in Table 21. For the rabbit apolipoprotein B the PCR primers were:

5 forward primer: AAGCACCCCCAATGTCACC (SEQ ID NO: 811) reverse primer: GGGATGGCAGAGCCAATGTA (SEQ ID NO: 812) and the PCR probe was: FAM-TCCTGGATTCAAGCTTCTATGTGCCTTCA -TAMRA (SEQ ID NO: 813) where F Foster City, CA) is the fluorescent indicator dye) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quenching dye. Data are means from two experiments. If present, "N.D." indicates "no data".

10 Table 21

Inhibition of rabbit apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

ISIS number

SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE % of INHIB. SEQ ID NO

233149

808 one TGCTTGGAGAAGGTAAGATC 0 814

233150

810 one GCGTTGTCTCCGATGTTCTG twenty 815

233151

809 13 TAATCATTAACTTGCTGTGG twenty 816

233152

808 22 TCAGCACGTAGCAATGCATT 0 817

233153

808 31 GCCTGATACTCAGCACGTAG 0 818

233154

809 31 CAATTGAATGTACTCAGATA 18 819

233155

808 51 ACCTCAGTGACTTGTAATCA 47 820

233156

809 51 CACTGGAAACTTGTCTCTCC 2. 3 821

233157

809 71 AGTAGTTAGTTTCTCCTTGG 0 822

233159

808 121 TCAGTGCCCAAGATGTCAGC 0 823

233160

810 121 ATTGGAATAATGTATCCAGG 81 824

233161

809 130 TTGGCATTATCCAATGCAGT 28 825

233162

808 151 GTTGCCTTGTGAGCAGCAGT 0 826

233163

810 151 ATTGTGAGTGGAGATACTTC 80 827

233164

809 171 CATATGTCTGAAGTTGAGAC 8 828

233165

808 181 GTAGATACTCCATTTTGGCC 0 829

233166

810 181 GGATCACATGACTGAATGCT 82 830

233167

808 201 TCAAGCTGGTTGTTGCACTG 28 831

233168

808 211 GGACTGTACCTCAAGCTGGT 0 832

233169

808 231 GCTCATTCTCCAGCATCAGG 14 833

233170

809 251 TTGATCTATAATACTAGCTA 2. 3 834

233172

810 282 ATGGAAGACTGGCAGCTCTA 86 835

233173

808 301 TTGTGTTCCTTGAAGCGGCC 3 836

233174

809 301 TGTGCACGGATATGATAACG twenty-one 837

233175

810 306 GACCTTGAGTAGATTCCTGG 90 838

233176

810 321 GAAATCTGGAAGAGAGACCT 62 839

233177

808 331 GTAGCTTTCCCATCTAGGCT 0 840

233178

808 346 GATAACTCTGTGAGGGTAGC 0 841

233179

810 371 ATGTTGCCCATGGCTGGAAT 65 842

233180

809 381 AAGATGCAGTACTACTTCCA 13 843

233181

808 382 GCACCCAGAATCATGGCCTG 0 844

233182

809 411 CTTGATACTTGGTATCCACA 59 845

233183

810 411 CAGTGTAATGATCGTTGATT 88 846

233184

810 431 TAAAGTCCAGCATTGGTATT 69 847

233185

810 451 CAACAATGTCTGATTGGTTA 73 848

233186

810 473 GAAGAGGAAGAAAGGATATG 60 849

233187

810 481 TGACAGATGAAGAGGAAGAA 66 850

233188

810 500 TTGTACTGTAGTGCATCAAT 74 851

233189

809 511 GCCTCAATCTGTTGTTTCAG 46 852

233190

810 520 ACTTGAGCGTGCCCTCTAAT 69 853

233191

809 561 GAAATGGAATTGTAGTTCTC 31 854

Example 43

Antisense Inhibition of Rabbit Apolipoprotein B Expression by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap - Dose and Response Study

A subset of antisense oligonucleotides from Example 42 was further investigated in dose-response studies.

5 The treatment doses were 10, 50, 150 and 300 nM. ISIS 233160 (SEQ ID NO: 824), ISIS 233166 (SEQ ID NO: 830), ISIS 233172 (SEQ ID NO: 835), ISIS 233175 (SEQ ID NO: 838), and ISIS 233183 (SEQ ID NO: 846) were analyzed for their effect on rabbit apolipoprotein B mRNA levels in primary rabbit hepatocytes by quantitative real-time PCR, as described in other examples herein. Data are means from two experiments and are shown in Table 22.

10 Table 22

Inhibition of rabbit apolipoprotein B mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap

Inhibition percentage

ISIS number

300 nM 150 nM 50 nM 10 nM

233160

80 74 67 33

233166

73 79 81 66

233172

84 81 76 60

233175

93 90 85 67

233183

80 81 71 30

Example 44

15 Effects of Antisense Inhibition of Apolipoprotein B in LDLr - / - Dose-Response Mice

Mice deficient in the LDL receptor (LDLr (- / -) mice), a strain that cannot modify apolipoprotein B mRNA and therefore exclusively synthesizes apolipoprotein B-100, have levels of LDL cholesterol and apolipoprotein B- 100 markedly elevated and develop extensive atherosclerosis.

LDLr (- / -) mice purchased from Taconic (Germantown, NY) were used to assess the potential of the

Antisense oligonucleotides to decrease apolipoprotein B mRNA or protein levels, as well as phenotypic endpoints associated with apolipoprotein B. LDLr (- / -) mice were separated into groups of males and females. Mice were administered LDLr (- / -) intraperitoneally, twice weekly for 6 weeks, 10, 25, or 50 mg / kg of ISIS 147764 (SEQ ID NO: 109) or ISIS 270906 (SEQ ID NO: 856) which is ISIS 147764 with 4 wrong base pairings, or saline or 20 mg / kg atorvastatin. At the end of

In the study, animals were euthanized and various phenotypic markers were evaluated.

ISIS 147764 was able to reduce cholesterol, triglyceride and mRNA levels in a dose-dependent manner in both male and female mice, while ISIS 270906 with 4 base mismatches was unable to do this. The results of the study are summarized in Table 23.

Table 23

Effects of ISIS 147764 treatment in male and female LDLr - / - mice on levels of apolipoprotein B mRNA, liver enzymes, cholesterol and triglycerides

Dose

Hepatic enzymes IU / l Lipoproteins mg / dl % of control mRNA

ISIS No.

mg / kg AST ALT CABBAGE. HDL LDL TRIG.

Males

Saline Dissolution

68.4 26.6 279.2 125.4 134.7 170.6 100.0

147764

10 57.6 29.8 314.2 150.0 134.7 198.6 61.7

25

112.6 78.8 185.0 110.6 66.2 104.2 30.7

fifty

163.6 156.8 165.6 107.8 51.2 113.4 16.6

270906

fifty 167.4 348.0 941.0 244.2 541.9 844.8 N.D.

Atorvastatin

twenty N.D. N.D. N.D. N.D. N.D. N.D. 110.9

Females

Saline Dissolution

65.0 23.4 265.8 105.8 154.9 121.4 100.0

147764

1.0 82.0 27.2 269.6 121.0 127.8 140.8 64.2

25

61.4 32.2 175.8 99.5 68.9 100.4 41.3

fifty

134.6 120.4 138.2 92.2 45.9 98.0 18.5

270906

fifty 96.0 88.6 564.6 200.0 310.0 240.4 N.D.

Atorvastatin

twenty N.D. N.D. N.D. N.D. N.D. N.D. 109.0

5 Example 45

Effects of antisense inhibition of apolipoprotein B in crab-eating macaques

Crabeater macaques fed an atherogenic diet develop atherosclerosis with many similarities to atherosclerosis in humans. Female crab-eating macaques share several similarities in lipoproteins and the cardiovascular system with humans. In addition to these characteristics, there are similarities in

10 reproductive biology. Female crabsmen have a 28-day menstrual cycle like that of women. Hormone concentrations throughout the menstrual cycle of crab-eating macaques have been measured, and the duration of the follicular and luteal phases, as well as plasma estradiol and progesterone concentrations throughout the cycle, are also remarkably similar to those Women's.

Crab-eating macaques (male or female) can be used to assess the potential of oligonucleotides

Antisense to reduce apolipoprotein B protein or mRNA levels, as well as phenotypic endpoints associated with apolipoprotein B including, but not limited to, cardiovascular indicators, atherosclerosis, lipid diseases, obesity, and plaque formation. One study could include normal and induced hypercholesterolemic monkeys fed diets that are normal or high in lipids and cholesterol. Administration to crab macaques can be in a variety of regimes, one per

20 subcutaneous route of 10-20 mg / kg of oligomeric compound for 1-2 months. The parameters that can be observed during the test period could include: total plasma cholesterol, LDL cholesterol, HDL cholesterol, triglycerides, cholesterol content in the arterial wall and thickening of the coronary intima.

Example 46

Sequencing of the preferred target segment of apolipoprotein B from crab-eating macaques (Macaca fascicularis)

A portion of the crab-eating macaque apolipoprotein B mRNA that is not available in the art was amplified. Positions 2920 to 3420 of the human apolipoprotein B mRNA sequence (GenBank accession number NM_000384.1, incorporated herein as SEQ ID NO: 3) contain the preferred target segment with which it hybridizes ISIS 301012 and the corresponding segments of the crab-eating macaque apolipoprotein B mRNA were amplified and sequenced. The site with which ISIS 301012 hybridizes in the

Human apolipoprotein B was amplified by setting the 5 'primers at position 2920 and 3' at position 3420. Crab macaque hepatocytes were purchased from In Vitro Technologies (Gaithersburg, MD). Fragments of 500 bp were produced using cDNAs from human 1st hepatocytes and crab-eating macaque and were produced by reverse transcription of total RNA followed by 40 cycles of PCR amplification. After gel purification of the human and crab-eating macaque amplicons, forward and reverse sequencing reactions were performed

35 of each product by Retrogen (the Invitrogen kit was used to create the DNA, single-stranded and to provide the reagents for the PCR reaction with Amplitaq). The crab-eating macaque sequence is incorporated herein as SEQ ID NO: 855 and is 96% identical to the 2920 to 3420 positions of human apolipoprotein B mRNA.

Example 47

Effects of antisense inhibition of the apolipoprotein B gene (ISIS 281625 and 301012) in C57BL / 6NTac-TgN transgenic mice (APOB100)

Transgenic C57BL / 6NTac-TgN mice (APOB100) have the human apolipoprotein B gene "introduced by replacement." These mice express high levels of human apolipoprotein B100 resulting in mice with elevated serum LDL cholesterol levels. These mice are useful for identifying and evaluating compounds to reduce elevated LDL cholesterol levels and the risk of atherosclerosis. When fed a diet high in fat and cholesterol, these mice develop significant lipid accumulation below the endothelium and in the median, and have significantly more complex atherosclerotic lesions than control animals.

The C57BL / 6NTac-TgN (APOB100) mice were divided into two groups, one group receiving the oligonucleotide treatment and the control animals receiving the saline treatment. After fasting overnight, mice were intraperitoneally administered twice weekly with saline or 25 mg / kg ISIS 281625 (SEQ ID No: 224) or ISIS 301012 (SEQ ID No: 247) for 8 weeks. . At the end of the study and 48 h after the final injections, the animals were sacrificed and the target mRNA levels in the liver, cholesterol and triglyceride levels and liver enzyme levels were evaluated. In addition, liver endogenous mouse apolipoprotein B levels were measured to assess any effects of antisense oligonucleotides targeting human apolipoprotein B.

After treatment with ISIS 281625 or ISIS 301012, AST and ALT levels were higher, although they still did not exceed normal values (∀300 IU / l). Cholesterol levels were slightly higher compared to saline treatment, while triglyceride levels were slightly lower. Treatment with any of those oligonucleotides targeting human apolipoprotein B that is expressed in these mice markedly decreased levels of human apolipoprotein mRNA, whereas levels of endogenous mouse apolipoprotein B were unaffected, indicating that these oligonucleotides they have specificity for human apolipoprotein B. The results of the comparative studies are shown in Table 24.

Table 24

Effects of treatment with ISIS 281625 and 301012 in mice on apolipoprotein B mRNA levels, liver enzymes, cholesterol and triglycerides.

ISIS No.

Saline dissolution

281625 301012

Hepatic enzymes IU / l

AST

70.3 265.8 208.4

ALT

32.8 363.8 137.4

Lipoproteins mg / dl

CABBAGE.

109.5 152.0 145.1

HDL

67.3 84.6 98.6

LDL

30.2 49.8 36.6

TRIG.

194.5 171.1 157.8

% of control mRNA

Human mRNA

100.0 45.2 23.7

Mouse mRNA

100.0 111.0 94.6

After 2 and 4 weeks of treatment with ISIS 301012, LDL cholesterol levels were significantly reduced to 22 mg / dl and 17 mg / dl, respectively.

Apolipoprotein B protein levels in the liver were also assessed at the end of the 8-week treatment period. Liver protein was isolated and subjected to immunoblot analysis using antibodies specific for mouse or human apolipoprotein B protein (US Biologicals, Swampscott, MA and Santa Cruz Biotechnology, Inc., Santa Cruz, CA, respectively). Immunoblot analysis of liver protein samples revealed reduced expression of both forms of human apolipoprotein B, apolipoprotein B-100 and apolipoprotein B-48. The levels of mouse apolipoprotein B in the liver had not changed significantly, according to the immunoblot analysis.

Serum samples were also collected at 2, 4, 6, and 8 weeks and apolipoprotein B expression was assessed using an ELISA kit specific for human apolipoprotein B (ALerCHEK Inc., Portland, ME). ELISA quantification of human apolipoprotein B protein in serum revealed that treatment with ISIS 281625 reduced human apolipoprotein B protein in serum by 31, 26, 11, and 26% at 2, 4, 6, and 8

weeks, respectively, with respect to the animals treated with saline solution. Treatment with ISIS 301012 reduced human apolipoprotein B protein in serum by 70, 87, 81, and 41% at 2, 4, 6, and 8 weeks, respectively, relative to control animals treated with saline. The serum from the transgenic mice was also subjected to immunoblot analysis using specific antibodies against both human and mouse apolipoprotein B (US Biologicals, Swampscott, MA and Santa Cruz Biotechnology, Inc., Santa Cruz, CA, respectively). Immunoblot analysis of serum samples taken from animals shows a similar pattern of expression of human apolipoprotein B, with a significant reduction in serum of apolipoprotein B protein after 2, 4, and 6 weeks of treatment and a slight reduction at 8 weeks. Mouse apolipoprotein B in serum did not change significantly, according to the analysis of

10 immunoblot.

Example 48

Effects of antisense inhibition of apolipoprotein B (ISIS 233172, 233175, 281625, 301012, and 301027) in C57BL / 6 mice

C57BL / 6 mice, a strain presented as susceptible to atherosclerotic plaque formation induced by

Hyperlipidemia was used in the following studies to assess the toxicity in mice of various antisense oligonucleotides targeting mouse or human apolipoprotein B.

C57BL / 6 mice were divided into two groups, one receiving oligonucleotide treatment and control animals receiving saline treatment. After fasting overnight, mice were intraperitoneally administered twice weekly with saline or 25 mg / kg of one of several oligonucleotides.

20 for 2 weeks. The antisense oligonucleotides used in the present study were ISIS 233172 (SEQ ID NO: 835) and ISIS 233175 (SEQ ID NO: 838), both targeting rabbit apolipoprotein B, and ISIS 281625 (SEQ ID NO: 224), ISIS 301012 (SEQ ID NO: 247), and ISIS 301027 (SEQ ID NO: 262), targeting human apolipoprotein B. At the end of the study and 48 h after the final injections, the animals were euthanized and liver enzyme levels, body weight, liver weight, and spleen weight were evaluated.

25 Liver enzyme levels in mice were lower with respect to saline treatment for three of the antisense oligonucleotides. However, rabbit oligonucleotide ISIS 233175 and human oligonucleotide ISIS 301027 both produced dramatically higher levels of liver enzymes, indicating toxicity. For all oligonucleotides tested, the change in body, liver and spleen weight was small. The results of the comparative studies are shown in Table 25.

30 Table 25

Effects of mouse or human apolipoprotein B antisense oligonucleotides on levels of apolipoprotein B mRNA, liver enzymes, cholesterol and triglycerides.

ISIS No.

Saline dissolution

233172 233175 281625 301012 301027

Hepatic enzymes

AST IU / l

104.5 94.3 346.7 89.5 50.6 455.3

ALT IU / l

39.5 43.3 230.2 36.2 21.2 221.3

Body weight

21.2 21.3 21.5 20.9 21.3 21.2

Liver

1.1 1.3 1.4 1.2 1.1 1.3

Spleen

0.1 0.1 0.1 0.1 0.1 0.1

Example 49

35 Evaluation of the evolution of the oligonucleotide with two different doses

C57BL / 6 mice, a strain presented as susceptible to hyperlipidemia-induced atherosclerotic plaque formation, were used in the following studies to assess the toxicity in mice of various antisense oligonucleotides targeting human apolipoprotein B.

Female C57BL / 6 mice were divided into two groups, one receiving oligonucleotide treatment and

40 control animals receiving saline treatment. After fasting overnight, mice were intraperitoneally administered twice weekly with saline or 25 mg / kg or 50 mg / kg ISIS 281625 (SEQ ID No: 224), ISIS 301012 (SEQ ID NO: 247), or ISIS 301027 (SEQ ID NO: 262). After 2 weeks, a blood sample was taken from the tail of the mice and liver enzymes were evaluated. After 4 weeks and at the end of the study, the animals were euthanized and liver enzyme levels were assessed.

45 For ISIS 281625 and ISIS 301012, AST and ALT levels remained close to those of the saline solution, with either dose after 2 weeks. After 4 weeks, AST and ALT levels showed a moderate increase compared to animals treated with saline for the lowest dose, but a large increase for the highest dose. ISIS 301027, administered with either dose, showed a small increase in AST and ALT levels after 2 weeks and a large increase in AST and ALT levels after 4 weeks. The results of the studies are summarized in Table 26.

Table 26

AST and ALT levels in mice treated with ISIS 281625, 301012 or 301027 after 2 and 4 weeks

AST (IU / l)

ALT (IU / l)

2 weeks

4 weeks  2 weeks 4 weeks

Saline dissolution

49.6 63.2 22.4 25.2

ISIS No.

Dose (mg / kg)

281625

25 40.8 75 21.2 31.8

fifty

44.4 152.4 30.8 210.4

301012

25 37.2 89.8 22.4 24.8

fifty

38.4 107.4 23.2 29.2

301027

25 55.4 537.6 27.2 311.2

fifty

64 1884 34.8 1194

Example 50

Effects of antisense inhibition of apolipoprotein B (ISIS 147483 and 147764) in ob / ob mice

10 Leptin is a hormone produced by fat that regulates appetite. Deficiencies in this hormone in both humans and non-human animals leads to obesity. The ob / ob mice have a mutation in the leptin gene that results in leptin and hyperglycemia. As such, these mice are a useful model for obesity and diabetes research, and treatments designed to treat these conditions.

Ob / ob mice receiving a high-fat, high-cholesterol diet (60% kcal of fat supplemented with

0.15% cholesterol) were treated with one of several oligonucleotides to assess their effect on apolipoprotein B-related phenotypic endpoints in ob / ob mice. After fasting overnight, mice in each group were administered intraperitoneally, twice weekly, 50 mg / kg of ISIS 147483 (SEQ ID No: 79) or 147764 (SEQ ID NO: 109) or controls ISIS 116847 (SEQ ID NO: 857) or 141923 (SEQ ID NO: 858) or saline, for 6 weeks. At the end of the study and 48 h after the final injections, the

20 animals were euthanized and target mRNA levels in the liver, cholesterol and triglyceride levels, liver enzyme levels, serum glucose levels and PTEN levels were evaluated.

ISIS 147483 and 147764 both were able to decrease apolipoprotein B mRNA levels, as well as glucose, cholesterol and triglyceride levels. The results of the comparative studies are shown in Table 27.

Table 27

25 Effects of treatment with ISIS 147483 and 147764 in ob / ob mice on apolipoprotein B mRNA levels, cholesterol, lipids, triglycerides, liver enzymes, glucose and PTEN.

ISIS No.

Saline dissolution

116847 141923 147483 147764

Glucose mg / dl

269.6 135.5 328.5 213.2 209.2

Hepatic enzymes

IU / l

AST 422.3 343.2 329.3 790.2 406.5

ALT

884.3 607.5 701.7 941.7 835.0

Lipoproteins

mg / dl

CABBAGE. 431.9 287.5 646.3 250.0 286.3

TRIG.

128.6 196.5 196.5 99.8 101.2

MRNA

% of control

ApoB

100.0 77.0 100.0 25.2 43.1

PTEN

100.0 20.0 113.6 143.2 115.3

Example 51

Antisense inhibition of apolipoprotein B in mice fed a high-fat diet: time-dependent effects

In a further embodiment of the invention, inhibition of apolipoprotein B mRNA in mice was compared

5 with the concentration of oligonucleotide in the liver, total cholesterol, LDL cholesterol and HDL cholesterol. Male C57B1 / 6 mice receiving a high fat (60% fat) diet were evaluated throughout the course of 6 weeks, with intraperitoneal injections twice a week of 50 mg / kg of ISIS 147764 ( SEQ ID NO: 109) or 50 mg / kg of the control oligonucleotide ISIS 141923 (SEQ ID NO: 858). Control animals received saline treatment. Animals were sacrificed after 2 days, 1, 2, 4 and 6 weeks of

10 treatment. Each treatment group at each measurement time consisted of 8 mice.

Target expression in the liver was measured by real-time PCR as described by other examples herein and is expressed as percent inhibition relative to mice treated with saline. Total, LDL and HDL cholesterol levels were measured by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY) and are reported in mg / dl. Animal results

15 treated with saline are shown for comparison. The intact oligonucleotide in liver tissue was measured by capillary gel electrophoresis and is presented as micrograms of oligonucleotides per gram of tissue. All results are the mean of 8 animals and are shown in Table 28.

Table 28

Correlation between drug concentration in the liver, apolipoprotein B mRNA expression and 20 lipids in serum during treatment with ISIS 147764

Treatment period

ISIS number

2 days 1 week 2 weeks 4 weeks 6 weeks

% inhibition of apolipoprotein B mRNA

141923 9 4 7 0 0

147764

fifty 57 73 82 88

Intact oligonucleotide! G / g

141923 58 61 152 261 631

147764

85 121 194 340 586

Total cholesterol mg / dl

saline solution 105 152 144 180 191

141923

99 146 152 169 225

147764

101 128 121 75 73

LDL cholesterol

saline solution 8 32 28 fifty 46

mg / dl

141923 8 27 27 38 56

147764

7 19 14 7 7

HDL cholesterol mg / dl

saline solution 74 117 114 127 141

141923

70 116 122 128 166

147764

76 107 105 66 64

These results illustrate that the inhibition of apolipoprotein B mRNA by ISIS 147764 occurred within 2 days of treatment, increased with successive treatments, and persisted for 6 weeks of treatment. Quantification of oligonucleotide levels in the liver reveals a strong correlation between the extent of target inhibition and the concentration of drug in the liver. In addition, at 1, 2, 3 and 4 weeks of treatment, an inverse correlation is observed between inhibition of the target mRNA and cholesterol levels (total, HDL and LDL), decreasing cholesterol levels as the percentage of inhibition of apolipoprotein B mRNA. Serum samples were subjected to immunoblot analysis using an antibody to detect mouse apolipoprotein B protein (Gladstone Institute, San Francisco, CA). The

The expression of the protein follows the same pattern as that of the mRNA, with the protein apolipoprotein B markedly reduced in the space of 48 h and decreased throughout the 6-week treatment period.

The oligonucleotide treatments described in this example were done in duplicate to investigate the extent to which the effects of ISIS 147764 persist after cessation of treatment. Mice were treated as described, and were sacrificed 1, 2, 4, 6, and 8 weeks after cessation of oligonucleotide treatment. I know

35 analyzed the same parameters and the results are shown in Table 29.

Table 29

Correlation between drug concentration in the liver, expression of apolipoprotein B mRNA and lipids in serum after dosing ceased

Treatment period

ISIS number

1 week 2 weeks 4 weeks 6 weeks 8 weeks

% inhibition of apolipoprotein B mRNA

141923 fifteen 2 7 eleven 7

147764

82 78 49 37 19

Intact oligonucleotide ug / g

141923 297 250 207 212 128

147764

215 168 124 70 43

Total cholesterol mg / dl

saline solution 114 144 195 221 160

141923

158 139 185 186 151

147764

69 67 111 138 135

LDL cholesterol mg / dl

saline solution twenty-one 24 3. 4 37 22

141923

24 24 32 32 24

147764

14 14 18 24 twenty-one

HDL cholesterol mg / dl

saline solution 86 109 134 158 117

141923

121 105 135 136 108

147764

51 49 79 100 94

These data demonstrate that upon termination of the oligonucleotide treatment, the effects of ISIS 147764, including inhibition of apolipoprotein B mRNA, and decreased cholesterol, persist for up to 8 weeks. Immunoblot analyzes demonstrate that the apolipoprotein B protein follows a similar pattern to that observed for mRNA expression levels.

Example 52

Effects of antisense inhibition of the human apolipoprotein B gene by 301012 in C57BL / 6NTac-TgN transgenic mice (APOB100): study of dosage

Transgenic C57BL / 6NTac-TgN mice (APOB100) have the human apolipoprotein B gene "introduced by replacement." These mice express high levels of human apolipoprotein B resulting in mice with elevated serum LDL cholesterol levels. These mice are useful for identifying and evaluating compounds to reduce elevated LDL cholesterol levels and the risk of atherosclerosis. When fed a diet high in fat and cholesterol, these mice develop significant lipid accumulation below the endothelium and in the median, and have significantly more complex atherosclerotic plaque lesions than control animals.

A long-term study of human apolipoprotein B inhibition by ISIS 301012 was conducted in C57BL / 6NTac-TgN (APOB100) mice (Taconic, Germantown, NY) over a period of 3 months. Mice were administered intraperitoneally twice weekly, 10 or 25 mg / kg ISIS 301012 (SEQ ID No: 247) for 12 weeks. Animals injected with saline served as controls. Each treatment group comprised 4 animals.

After 2, 4, 6, 8 and 12 weeks of treatment, serum samples were collected for the purpose of measuring human apolipoprotein B protein. Protein in serum was quantified using an ELISA kit specific for human apolipoprotein B (ALerCHEK Inc., Portland, ME). The data is shown in Table 30 and each result represents the mean of 4 animals. The data is normalized with respect to the control animals treated with saline solution.

Table 30

Reduction of human apolipoprotein B in the serum of transgenic mice after treatment with ISIS 301012

% reduction in serum apolipoprotein B protein

Oligonucleotide dose mg / kg

2 weeks 4 weeks 6 weeks 8 weeks 12 weeks

10

76 78 73 42 85

25

80 87 86 47 79

These data illustrate that after 2, 4, 6 or 12 weeks of treatment with ISIS 301012, the level of human apolipoprotein B protein in the serum of transgenic mice has decreased by approximately 80%, demonstrating that in addition to inhibiting mRNA expression, ISIS 301012 effectively inhibits the expression of human apolipoprotein B protein in mice bearing the human apolipoprotein B transgene. Protein 5 apolipoprotein B in serum was also evaluated by immunoblot analysis, using an antibody directed against human apolipoprotein B protein (US Biologicals, Swampscott, MA). This analysis shows that levels of human apolipoprotein B protein, both apolipoprotein B-100 and apolipoprotein B-48, decrease at 2, 4, 6 and 12 weeks of treatment. Immunoblot analysis using an antibody specific for mouse apolipoprotein B (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) reveals

10 that there is no significant change in the expression of mouse protein in serum.

At the start of treatment (start) and after 2, 4, 6 and 8 weeks of treatment, serum samples were collected and total cholesterol, HDL and LDL levels were measured by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY), and these data are presented in Table 31. Results are presented as mg / dl and represent the mean of 4 animals. Control animals are also shown.

15 saline solution.

Table 31

Effects of ISIS 301012 on serum lipids in transgenic mice with human apolipoprotein B

Treatment period

Treatment

Start 2 weeks 4 weeks 6 weeks 8 weeks

Total cholesterol mg / dl

Saline dissolution 120 110 129 121 126

10

115 97 111 120 122

25

107 101 107 124 147

HDL cholesterol mg / dl

Saline dissolution 67 61 69 62 64

10

70 69 78 72 79

25

64 73 76 80 91

LDL cholesterol mg / dl

Saline dissolution 39 41 fifty Four. Five 47

10

35 twenty 2. 3 37 33

25

33 19 19 37 44

These data demonstrate that LDL cholesterol decreases by treatment with 10 or 25 mg / kg of ISIS 147764 20 during the first 4 weeks of treatment.

The study was completed 48 h after the final injections in the 8 weeks of treatment, when the animals were sacrificed and the levels of target mRNA in the liver, levels of apolipoprotein B protein in the liver and serum cholesterol and levels were evaluated. of liver enzymes. In addition, expression of endogenous mouse apolipoprotein B levels in serum was measured to assess any effect of ISIS 301012 on expression of the

25 apolipoprotein B mRNA.

Mouse and human apolipoprotein B mRNA levels in the livers of treated animals were measured during 12 weeks of treatment, by real-time PCR as described herein. Each result represents the mean of the data from 4 animals. The data were normalized with respect to the saline controls and are shown in Table 32.

30 Table 32

Effects of ISIS 301012 on mouse and human apolipoprotein B mRNA levels in transgenic mice

% inhibition

ISIS Dose 301012

measured mRNA species

10 mg / kg 25 mg / kg

human apolipoprotein B

65 75

mouse apolipoprotein B

6 6

These data demonstrate that after 12 weeks of treatment with ISIS 301012, human apolipoprotein B mRNA is reduced by as much as 75% in the livers of transgenic mice, whereas apolipoprotein B mRNA from mouse liver was not affected. Furthermore, ELISA analysis of the apolipoprotein B protein in livers of transgenic mice revealed an 80% and 82% reduction in human protein after 10 and 20 mg / kg of ISIS 301012, respectively. Immunoblot analysis using an antibody directed against human apolipoprotein B also demonstrates reduced expression.

of human apolipoprotein B, both apolipoprotein B-100 and apolipoprotein B-48, in the livers of transgenic mice. Immunoblot analysis using an antibody directed against mouse apolipoprotein B protein (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) shows that the expression of mouse protein in the liver does not change significantly.

ALT and AST levels in serum were also measured using the Olympus clinical analyzer (Olympus America Inc., Melville, NY) and showed that after treatment with ISIS 301012, AST and ALT levels increased, but did not exceed levels. normal (-300 IU / l), indicating lack of toxicity due to treatment with ISIS 301012.

Example 53

Evaluation of the in vitro immunostimulatory effects of ISIS 301012

Immunostimulatory activity is defined by the production of cytokines after exposure to a proinflammatory agent. In a further embodiment of the invention, the immunostimulatory or proinflammatory activity of ISIS 301012 was assayed. These studies were performed at MDS Pharma Services (Saint Germain sur l'Arbresle, France). Whole blood was collected from B6C3F1 mice without prior treatment, which had not been consciously exposed to viral, chemical, or radiation treatment. The cultured blood cells were exposed to 0.5, 5 or 50 µM ISIS 301012 for a period of 14 to 16 h. Antisense oligonucleotides known to have proinflammatory activity served as positive controls. Each treatment was performed in triplicate. At the end of the treatment period, the supernatant fluids were collected and cytokine analysis was performed using a flow cytometric method with the CBA Mouse Inflammation Kit (Becton Dickinson, Franklin Lakes, NJ). The results showed that ISIS 301012 does not stimulate the release of any of the cytokines tested, which were interleukin 12p70 (IL-12p70), tumor necrosis factor alpha (TNF-alpha), interferon gamma (IFN-gamma), interleukin. 6 (IL-6), macrophage chemoattractor protein 1 (MCP-1) and interleukin 10 (IL-10). Therefore, ISIS 301012 has no immunostimulatory activity, as determined by the in vitro immunostimulatory assay.

Example 54

Comparative genomic analysis of apolipoprotein B

A comparative genomic analysis of human, mouse and monkey apolipoprotein B sequences was performed and illustrated that apolipoprotein B sequences are conserved across species. The organization of the human and mouse apolipoprotein B genes is also conserved. The human and mouse genes are made up of 29 and 26 exons, respectively. Mouse mRNA has approximately 81% homology to the human sequence. The complete sequence and gene structure of the apolipoprotein B gene in non-human primates has not been identified. However, as illustrated in Example 46, a 500 base pair fragment containing the ISIS 301012 target sequence has approximately 96% identity to the human sequence.

The binding site for ISIS 301012 is within the coding region, in exon 22 of the human apolipoprotein B mRNA. When human, mouse and monkey ISIS 301012 binding sites were compared, significant sequence diversity was observed. Although the total conservation of the sequence between human and monkey throughout the 500 nucleotide region was approximately 96%, the ISIS 301012 binding site of the monkey sequence contains 2 mismatches with respect to the human sequence. Similarly, although the mouse apolipoprotein B mRNA sequence has approximately 81% homology to human, at the ISIS 301012 binding site, there are 5 divergent nucleotides. Sequence comparisons for the ISIS 301012 binding site for human, mouse and monkey apolipoprotein B sequences are shown in Table 33. Nucleotides mismatched with respect to the target sequence for ISIS 301012 are underlined.

Table 33

Comparison of the ISIS 301012 binding site between human, monkey and mouse apolipoprotein B sequences

Species

no. of mismatches ISIS target sequence 301012

Human being

0 aggtgcgaagcagactgagg

Monkey

2 aggtgtaaagcagactgagg

Mouse

5 aggagtgcagcagtctgaag

The target sequence with which the mouse antisense oligonucleotide ISIS 147764 hybridizes is in exon 24 of the mouse apolipoprotein B gene. Sequence comparisons for the ISIS 147764 binding site on mouse and human apolipoprotein B sequences are shown in Table 34. Mismatched nucleotides

with respect to the target sequence of ISIS 147764 they are underlined. Table 34 Comparison of the ISIS 147764 binding site between mouse and human apolipoprotein B sequences

Species

no. of mismatches ISIS binding site 147764

Human being

5 gcattgacatdttcagggac

Mouse

0 gcatggacttcttctggaaa

5 Example 55

BLAST Analysis of ISIS 301012

The number of regions in the human genome with which ISIS 301012 will hybridize with perfect complementarity was determined. The percentage of complementarity of an antisense compound with a region of a target nucleic acid was determined using BLAST programs (alignment search tools

10 basic premises) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). This analysis evaluated sequence complementarity in genomic or pre-mRNA regions and in coding sequences.

In genomic regions, ISIS 301012 shows perfect sequence complementarity with the apolipoprotein B gene alone. No target sequences were found with a mismatch with respect to ISIS

301012. Two mismatches are found between the ISIS 301012 target sequence and the heparanase gene, and 3 mismatches are found between the ISIS 301012 target sequence and 28 unique genomic sites.

In RNA sequences, perfect sequence complementarity is found between ISIS 301012 and apolipoprotein B mRNA and 3 expressed sequence markers that bear moderate similarity to

20 precursor of human apolipoprotein B. A single mismatch is found between ISIS 301012 and an expressed sequence marker similar to the smooth muscle myosin light chain form.

Example 56

Antisense inhibition of apolipoprotein B in primary human hepatocytes: dose-response studies

Antisense oligonucleotides targeting human apolipoprotein B were tested in dose studies

25 response in primary human hepatocytes. Plaque precultured primary human hepatocytes were purchased from InVitro Technologies (Baltimore, MD). Cells were grown in high glucose DMEM (Invitrogen Corporation, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitrogen Corporation, Carlsbad, CA), 100 units / ml and 100 µg / ml streptomycin (Invitrogen Corporation , Carlsbad, CA).

Human primary hepatocytes were treated with ISIS 301012 (SEQ ID NO: 247) 10, 50, 150, or 300 nM. The

30 untreated cells and cells treated with ISIS 113529 messy control oligonucleotide (CTCTTACTGTGCTGTGGACA, SEQ ID NO: 859) served as two groups of control cells. ISIS 113529 is a chimeric oligonucleotide ("gapmer") 20 nucleotides in length, consisting of a "gap" region consisting of ten 2'-deoxynucleotides, which is flanked on both sides (5 'and 3' directions) by " wings ”of 5 nucleotides. The wings are made up of 2'-methoxyethyl (2'-MOE) nucleotides. Internucleoside linkages

35 (main chain) are phosphorothioate (P = S) linkages throughout the entire oligonucleotide. All cytidines are 5-methylcytidines.

Oligonucleotides were introduced into cells by LIPOFECTIN mediated transfection as described in other examples herein. Cells were harvested both 24 and 48 h after oligonucleotide treatment, and both RNA and protein were isolated. In addition, the culture medium was collected

40 of the cells treated for ELISA analysis of apolipoprotein B protein secretion.

Apolipoprotein B mRNA expression was determined by real-time PCR of the RNA samples as described in other examples herein. Each result represents 6 experiments. The data is normalized with respect to the untreated control cells and is shown in Table 35.

Table 35 Inhibition of apolipoprotein B mRNA by antisense oligonucleotides in human primary hepatocytes

% inhibition of apolipoprotein B mRNA

ISIS number

Oligonucleotide dose

Treatment (hours) 301012 113529

10 nM

24 65 N.D.

48

33 N.D.

50 nM

24 75 N.D.

48

48

N.D.

150 nM

24 90 16

48

78 5

300 nM

24 89 10

48

72 18

These data demonstrate that ISIS 301012 inhibits apolipoprotein B expression in a dose dependent manner in primary human hepatocytes.

The apolipoprotein B protein secreted to the cultured cell medium was measured in the samples treated with the 50 and 150 nM oligonucleotide, using an ELISA kit specific for the target protein (ALerCHEK Inc., Portland, ME). Each result represents 3 experiments. The data is normalized with respect to the untreated control cells and is shown in Table 36.

10 Table 36

Inhibition of Apolipoprotein B Protein Secretion from Primary Human Hepatocytes by ISIS 301012

% change in apolipoprotein B protein secretion

ISIS number

Dose

Treatment (hours) 301012 113529

150 nM

24 -57 +6

48

-75 +4

300 nM

24 -41 -2

48

-48 -5

Protein samples from the 50, 150 and 300 nM doses after 24 h and the 150 and 300 nM doses after 48 h were subjected to immunoblot analysis as described in other examples in

This specification uses the human apolipoprotein B protein specific antibody purchased from US Biological (Swampscott, MA). Immunoblot analysis demonstrates that apolipoprotein B protein in human hepatocytes decreases in a dose dependent manner after treatment with antisense oligonucleotide with ISIS 301012.

A further experiment was carried out to test the effects of ISIS 271009 (SEQ ID NO: 319), ISIS 281625

20 (SEQ ID NO: 224) and ISIS 301027 (SEQ ID NO: 262) on human apolipoprotein B mRNA in primary human hepatocytes. Cells were grown as described herein, and treated with ISIS 271009, ISIS 281625, or ISIS 301027, 5, 10, 50, or 150 nM over a 24 h period. Control oligonucleotides ISIS 13650 (SEQ ID NO: 806) and ISIS 113529 (SEQ ID NO: 859) were used in 50 or 150 nM concentration. Human apolipoprotein B mRNA expression was evaluated by real-time PCR as described in other examples

25 herein. The apolipoprotein B protein secreted to the cultured cell medium was measured in the samples treated with the 50 and 150 nM oligonucleotide, using an ELISA kit specific for the target protein (ALerCHEK Inc., Portland, ME).

The data shown in Table 37 represent the average of 2 experiments and are normalized with respect to the control cells. When present, a "+" indicates that gene expression was higher.

Table 37 Antisense inhibition of human apolipoprotein B mRNA by ISIS 271009, ISIS 281625 and ISIS 301027

Oligonucleotide dose

ISIS 271009 ISIS 281625 ISIS 301027 ISIS 13650 ISIS 113529

% inhibition of the expression of

5 nM +4 8 eleven N.D. N.D.

Apolipoprotein B mRNA

10 nM 5 22 37 N.D. N.D.

50 nM

52 49 fifty 38 0

150 nM

81 52 70 26 14

% inhibition of the secretion of

50 nM 17 18 twenty-one N.D. N.D.

apolipoprotein B protein

150 nM 32 18 32 +18 +1

These data demonstrate that ISIS 271009, ISIS 281625 and ISIS 301027 inhibit apolipoprotein B mRNA expression in a dose-dependent manner in primary human hepatocytes. ISIS 271009 and ISIS 301027 inhibit apolipoprotein B protein secretion from cells in a dose-dependent manner.

Example 57

Effects of apolipoprotein B-100 antisense oligonucleotides on apolipoprotein expression (a)

Lipoprotein (a) [Lp (a)] contains two distinct disulfide-bound proteins, apolipoprotein (a) and

10 apolipoprotein B (Rainwater and Kammerer, J. Exp. Zool., 1998, 282, 54-61). The effects of apolipoprotein B-directed antisense oligonucleotides on the expression of the apolipoprotein component (a) of the lipoprotein particle (a) were tested in primary human hepatocytes.

Primary human hepatocytes (Invitro Technologies, Baltimore, MD), cultured and transfected as described herein, were treated with 5, 10, 50, or 150 nM concentrations of ISIS 271009 (SEQ ID NO:

15 319), 281625 (SEQ ID NO: 224), 301012 (SEQ ID NO: 247) or 301027 (SEQ ID NO: 262). The cells were also treated with 50 or 150 nM concentrations of the control oligonucleotides ISIS 113529 (SEQ ID NO: 859) or ISIS 13650 (SEQ ID NO: 806). Untreated cells served as controls. After 24 hr of treatment with the oligonucleotide, apolipoprotein (a) mRNA expression was measured by quantitative real-time PCR as described in other examples herein.

Probes and primers for human apolipoprotein (a) were designed to hybridize with a sequence of human apolipoprotein (a), using the published sequence information (GenBank accession number NM_005577.1, incorporated herein as SEQ ID NO: 860). For human apolipoprotein (a) the PCR primers were:

forward primer: CAGCTCCTTATTGTTATACGAGGGA (SEQ ID NO: 861)

Reverse primer: TGCGTCTGAGCATTGCGT (SEQ ID NO: 862) and the PCR probe was: FAM-CCCGGTGTCAGGTGGGAGTACTGC-TAMRA (SEQ ID NO: 863) where FAM is the fluorescent dye and TAMRA is the quencher dye.

Data are the average of 3 experiments and are expressed as percentage of inhibition with respect to untreated controls. The results are shown in Table 38. A "+" or "-" preceding the number indicates that the expression

30 of the apolipoprotein (a) had increased or decreased, respectively, after treatment with the antisense oligonucleotides.

Table 38

Effects of apolipoprotein B antisense oligonucleotides on apolipoprotein (a) expression These results illustrate that ISIS 301012 did not inhibit apolipoprotein (a) expression in primary human hepatocytes. ISIS 271009 inhibited apolipoprotein (a) expression at the highest dose. ISIS 281625 and ISIS 301027 decreased apolipoprotein mRNA levels (a).

% change in apolipoprotein (a) mRNA expression after antisense inhibition of apolipoprotein B

Dose

ISIS number

oligonucleotide

271009 281625 301012 301027 13650 113529

5 nM

+70 -9 +34 -16 N.D. N.D.

10 nM

+31 -2. 3 +86 -Four. Five N.D. N.D.

50 nM

+25 -3. 4 +30 -39 -68 +14

150 nM

-47 +32 +38 -43 -37 -9

Example 58

5 Inhibition of the secretion of lipoprotein (a) particles with antisense oligonucleotides directed at apolipoprotein B-100

Secretion of lipoprotein particles (a), which are composed of an apolipoprotein molecule, was evaluated.

(a) covalently bound to an apolipoprotein B molecule, in primary human hepatocytes treated with antisense oligonucleotides targeting the apolipoprotein B component of lipoprotein (a).

10 Primary human hepatocytes (InVitro Technologies, Baltimore, MD), cultured and transfected as described herein, were treated for 24 h with 50 or 150 nM of ISIS 271009 (SEQ ID NO: 319), 281625 (SEQ ID NO : 224), 301012 (SEQ ID NO: 247) or 301027 (SEQ ID NO: 262). Cells were also treated with 150 nM concentration of control oligonucleotides ISIS 113529 (SEQ ID NO: 859) or ISIS 13650 (SEQ ID NO: 806). Untreated cells served as controls. After 24 h of treatment with the oligonucleotide, the

Amount of lipoprotein (a) in the culture medium collected from the treated cells, using a commercially available ELISA kit (ALerCHEK Inc., Portland, ME). Results are the average of 3 experiments and are expressed as the percentage change in lipoprotein secretion (a) with respect to untreated controls. Data are shown in Table 39. A "+" or "-" preceding the number indicates that the secretion of lipoprotein (a) particles increased or decreased, respectively, after treatment with antisense oligonucleotides

20 targeting apolipoprotein B.

Table 39

Inhibition of the secretion of lipoprotein (a) particles with antisense oligonucleotides targeting apolipoprotein B

% change in lipoprotein secretion (a)

Oligonucleotide dose

ISIS number

271009

281625 301012 301027 13650 113529

50 nM

-25 -26 -27 -33 N.D. N.D.

150 nM

-42 -24 -37 -44 +14 +14

These data demonstrate that antisense inhibition of apolipoprotein B, a component of the lipoprotein particle (a), can reduce lipoprotein (a) secretion from primary human hepatocytes. Furthermore, this reduction in lipoprotein (a) secretion is not necessarily simultaneous with a decrease in apolipoprotein (a) mRNA expression, as shown in Example 57.

Example 59

30 Derivatives with Erroneous and Truncated Matches of ISIS 301012

As demonstrated herein, ISIS 301012 (SEQ ID NO: 247) reduces apolipoprotein B mRNA levels in cultured human cell lines as well as in primary human hepatocytes. In a further embodiment of the invention, a study was conducted using derivatives of the ISIS 301012 nucleotide sequence. A series of oligonucleotides containing 1 to 7 base mismatches were designed, 35 starting in the middle of the sequence of ISIS 301012. This series was designed to introduce the consecutive loss of Watson-Crick base pairings between ISIS 301012 and its target mRNA sequence. These compounds are shown in Table 40. Antisense compounds with mismatched nucleotides relative to ISIS 301012 are chimeric oligonucleotides ("gammers") 20 nucleotides in length, composed of a central "gap" region containing ten 2'- deoxynucleotides, which are flanked on both sides (5 'and 3' directions)

40 for 5 nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) -nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide.

An additional derivative of ISIS 301012 was designed that comprised the sequence of ISIS 301012 with 2'MOEnucleotides along the oligonucleotide (uniform 2'-MOE). This compound is 20 nucleotides in length, with phosphorothioate linkages along the oligonucleotide. This compound is also shown in Table 40.

HepG2 cells were treated with the compounds in Table 40 with 50 or 150 nM, over a 24 h period, after which RNA was isolated and target expression was measured by real-time PCR as described herein. memory. Untreated cells served as controls. The results are shown in Table 40 and are normalized with respect to the control samples.

Table 40

Effects of oligonucleotides with ISIS 301012 mismatches and a uniform 2'MOE-oligonucleotide on apolipoprotein B expression in HepG2 cells

% change in apolipoprotein B mRNA expression

ISIS number

SEQUENCE no. of mismatches Oligonucleotide dose SEQ ID NO

fifty

150

301012

GCCTCAGTCTGCTTCGCACC 0 -44 -75 247

Series with mismatches, chimeric oligonucleotides

332770

GCCTCAGTCTTCTTCGCACC one +7 -22 864

332771

GCCTCAGTCTTATTCGCACC 2 +37 +37 865

332772

GCCTCAGTATTATTCGCACC 3 +99 +84 866

332773

GCCTCATTATTATTCGCACC 4 +75 +80 867

332774

GCCTCATTATTATTAGCACC 5 +62 +66 868

332775

GCCTCATTATTATTATCACC 6 -one +10 869

332776

GCCTAATTATTATTATCACC 7 +10 +20 870

2'-MOE-uniform oligonucleotide

332769

GCCTCAGTCTGCTTCGCACC 0 -eleven -14 247

5 The results of treatment of HepG2 cells with the compounds in Table 40 show that none of the compounds exhibits the dose dependent inhibition observed after treatment with the original ISIS 301012 sequence. ISIS 332770, which has only one thymidine to cytosine substitution at the center of the oligonucleotide, was 3 times less potent than ISIS 301012. Additional nucleotide substitutions nullify antisense inhibition of apolipoprotein B expression.

Chimeric phosphorothioate oligonucleotides are metabolized in vivo predominantly by endonucleolytic cleavage. A series of oligonucleotides were designed by truncating the sequence of ISIS 301012 in 1 or 2 base increments from the 5 'and / or 3' end. Truncated oligonucleotides represent possible products that result from endonucleolytic cleavage. These compounds are shown in Table 41. The compounds in Table 41 are chimeric oligonucleotides ("gammers") of different lengths, composed of

15 a central "gap" region consisting of 2'-deoxynucleotides, which is flanked at both ends by 2'methoxyethyl (2'-MOE) nucleotides. The exact structure of each chimeric oligonucleotide is designated in Table 41 as "chimeric structure". For example, a 4 ~ 10 ~ 4 designation indicates that the first 4 (most 5 ') and last 4 (most 3') are 2'-MOE-nucleotides, and the 10 nucleotides in the gap are 2'- deoxynucleotides. The 2'MOE-nucleotides are indicated in bold. Internucleoside (backbone) bonds are phosphodiester (P = O) between

20 highlighted nucleotides; all other internucleoside linkages are phosphorothioate (P = S).

These compounds were tested for their ability to reduce apolipoprotein B mRNA expression. HepG2 cells were treated with each of the antisense compounds in Table 41, in 10, 50, or 150 nM concentration, over a period of 24 h, after which RNA was isolated and target expression was measured by real-time PCR as described herein. Untreated cells served as controls. The results are shown

25 in Table 41 and are normalized with respect to untreated control samples.

Table 41 Effect of truncated ISIS 301012 mutants on apolipoprotein B expression in HepG2 cells

% change in apolipoprotein B mRNA expression

ISIS number

SEQ ID NO OF THE DAILY DIANA SITE SEQUENCE Chimeric structure Oligonucleotide dose SEQ ID NO

10

fifty 150

301012

3 3249 GCCTCAGTCTGCTTCGCACC 5 ~ 10 ~ 5 -51 -72 -92 247

331022

3 3249 GCCTCAGTCTGCTTCGCAC 5 ~ 10 ~ 4 -33 -49 -87 871

332777

3 3249 GCCTCAGTCTGCTTCGCA 5 ~ 10 ~ 3 -27 -53 -80 872

332778

3 3249 GCCTCAGTCTGCTTC 5 ~ 10 ~ 0 -eleven -twenty -58 873

332780

3 3248  CCTCAGTCTGCTTCGCAC 4 ~ 10 ~ 4 -3 -43 -74 874

332781

3 3247  CTCAGTCTGCTTCGCA 3 ~ 10 ~ 3 -9 -35 -60 875

332782

3 3246  TCAGTCTGCTTCGC 2 ~ 10 ~ 2 -16 -16 -69 876

332784

3 3249 GCCTCAGTCT 5 ~ 5 ~ 0 +12 -one +7 877

332785

3 3238                          GCTTCGCACC 0 ~ 5 ~ 5 +5 -2 - 4 878

The results in Table 41 illustrate that apolipoprotein B inhibition depends on sequence length, 5 as well as sequence and dose complementarity, as demonstrated in Table 41, but truncated versions of ISIS 301012 are capable to some extent inhibit apolipoprotein B mRNA expression.

Example 60

Design and screening of dsRNAs targeting human apolipoprotein B

A series of nucleic acid duplexes were designed comprising the antisense compounds herein

10 description, and its complements to target apolipoprotein B and are shown in Table 42. All compounds in Table 42 are 20 nucleotide long oligoribonucleotides with phosphodiester internucleoside linkages throughout the compound. Compounds were prepared with blunt ends. Table 41 shows the antisense strand of the dsRNA, and the same strand is synthesized as a complement to the antisense strand. These sequences are shown to contain uracil (U) but one skilled in the art

15 will appreciate that uracil (U) is generally replaced by thymine (T) in DNA sequences. The "target site" indicates the number of the first nucleotide (plus 5 ') in the particular target sequence, to which the compound binds. A subset of the compounds in Table 42 are the RNA equivalents of the antisense oligonucleotides described herein, and when applied, this is indicated by the ISIS # of the DNA oligonucleotide in the "RNA equivalent to # from ISIS "

Table 42 dsRNAs Targeting Human Apolipoprotein B

ISIS number

Region SEQ ID NO OF THE DAILY DIANA SITE Sequence SEQ ID NO RNA equivalent to ISIS number

342855

coding 3 3249 GCCUCAGUCUGCUUCGCACC 247 301012

342856

3 'UTR 3 13903 GCUCACUGUAUGGUUUUAUC 262 301027

342857

coding 3 5589 AGGUUACCAGCCACAUGCAG 224 308361

342858

coding 3 669 GAGCAGUUUCCAUACACGGU 130 270991

342859

coding 3 1179 CCUCUCAGCUCAGUAACCAG 135 270996

342860

coding 3 2331 GUAUAGCCAAAGUGGUCCAC 3. 4 147797

342861

coding 3 3579 UAAGCUGUAGCAGAUGAGUC 213 281614

342862

5 'UTR 3 6 CAGCCCCGCAGGUCCCGGUG 249 301014

342863

5 'UTR 3 116 GGUCCAUCGCCAGCUGCGGU 256 301021

342864

3 'UTR 3 13910 AAGGCUGGCUCACUGUAUGG 266 301031

342865

3 'UTR 3 13970 GCCAGCUUUGGUGCAGGUCC 273 301038

342866

coding 3 426 UUGAAGCCAUACACCUCUUU 879 None

342867

coding 3 3001 UGACCAGGACUGCCUGUUCU 880 None

342868

coding 3 5484 GAAUAGGGCUGUAGCUGUAA 881 None

342869

coding 3 6662 UAUACUGAUCAAAUUGUAUC 882 None

342870

coding 3 8334 UGGAAUUCUGGUAUGUGAAG 883 None

342871

coding 3 9621 AAAUCAAAUGAUUGCUUUGU 883 None

342872

coding 3 10155 GUGAUGACACUUGAUUUAAA 885 None

342873

coding 3 12300 GAAGCUGCCUCUUCUUCCCA 886 None

342874

coding 3 113629 GAGAGUUGGUCUGAAAAAUC 887 None

The effects of the dsRNAs from Table 42 on the human apolipoprotein mRNA were tested in HepG2 cells.

HepG2 cells were treated with 100 nM dsRNA compounds mixed with 5 µg / ml LIPOFECTIN (Invitrogen Corporation, Carlsbad, CA) for a period of 16 h. In the same experiment, HepG2 cells were also treated with a subset of 150 nM antisense oligonucleotides described herein mixed with 3.75 µg / ml LIPOFECTIN; these compounds are listed in Table 43. Control oligonucleotides included ISIS 18078 (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 888). ISIS 18078 is a chimeric oligonucleotide

20 nucleotide "gammer" 10, composed of a central "gap" region consisting of 9 2'-deoxynucleotides, which is flanked at the 5 'and 3' ends by a 5-nucleotide "wing" and a 6 nucleotide "wing", respectively. The wings are made up of 2'-methoxyethyl (2'-MOE) -nucleotides. Internucleoside (backbone) linkages are phosphorothioate (P = S) linkages throughout the oligonucleotide. All cytidines are 5-methylcytidines. ISIS Duplex 263188 (CUUCUGGCAUCCGGUUUAGTT, SEQ ID NO: 889) and its

Supplementary 15 are also used as a control. ISIS 263188 is a 21 nucleotide long oligoribonucleotide with the 2 nucleotides being the 3'-oligodeoxyribonucleotide (TT) end and with internucleoside phosphodiester linkages (backbone) throughout the compound.

Cells were treated for 4 hr, after which expression of human apolipoprotein B mRNA was measured as described in the examples herein. The results were normalized with respect to

The untreated control cells, which were not treated with LIPOFECTIN or oligonucleotide. Data are the average of 4 experiments and are presented in Table 43.

Table 43 Inhibition of apolipoprotein B mRNA by dsRNA in HepG2 Cells

ISIS number

Dose % inhibition SEQ ID No

342855

100 nM 53 247

342856

100 nM 3. 4 262

342857

100 nM 55 224

342858

100 nM 44 130

342859

100 nM 2. 3 135

342860

100 nM 3. 4 3. 4

342861

100 nM 42 213

342862

100 nM 16 249

342863

100 nM 3. 4 256

342864

100 nM 53 266

342865

100 nM fifty 273

342866

100 nM 12 879

342867

100 nM 26 880

342868

100 nM 36 881

342869

100 nM 78 882

342870

100 nM 71 883

342871

100 nM 9 883

342872

100 nM 2 885

342873

100 nM 53 886

342874

100 nM 73 887

281625

150 nM 79 224

301012

150 nM 77 247

301014

150 nM 88 249

301021

150 nM 67 256

301027

150 nM 79 262

301028

150 nM 85 263

301029

150 nM 77 264

301030

150 nM 70 265

301031

150 nM 73 266

301037

150 nM 80 272

301038

150 nM 84 273

301045

150 nM 77 280

263188

150 nM 26 888

18078

150 nM 13 889

Example 61

5 Antisense inhibition of apolipoprotein B in primary hepatocytes of crab-eating macaque

As demonstrated in Example 46, the region containing the target site to which ISIS 301012 hybridizes shares a 96% identity with the corresponding region of the crab-eating macaque apolipoprotein B mRNA sequence. ISIS 301012 contains two nucleotides mismatched with respect to the crab-eating macaque apolipoprotein B mRNA sequence with which it hybridizes. In a further aspect of the description, 10 oligonucleotides were designed to target the monkey apolipoprotein B mRNA, using the crab-eating macaque apolipoprotein B partial sequence described herein (SEQ ID NO: 855) and an additional part of the crab-eating macaque apolipoprotein B RNA sequence, incorporated herein as SEQ ID NO: 890. The target site indicates the number of the first nucleotide (plus 5 ') in the particular target sequence to which the oligonucleotide. For ISIS 326358 (GCCTCAGTCTGCTTTACACC, SEQ ID NO: 891) the target site is nucleotide 168 of SEQ ID NO: 855 and for ISIS 315089 (AGATTACCAGCCATATGCAG, SEQ ID NO: 892) the target site is nucleotide 19 of SEQ ID NO: 890. ISIS 326358 and ISIS 315089 are 20 nucleotide long chimeric oligonucleotides ("gammers"), composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (directions 5 'and 3') by 5 nucleotide "wings". The wings are made up of 2'-methoxyethyl (2'-MOE) -nucleotides. The internucleoside bonds (main chain) are 20 phosphorothioate bonds (P = S) throughout the entire oligonucleotide. All cytidine residues are 5-methylcytidines.

ISIS 326358 and ISIS 315089 are the crab macaque equivalents of the antisense oligonucleotides for human apolipoprotein B ISIS 301012 (SEQ ID NO: 247) and ISIS 281625 (SEQ ID NO: 224), respectively.

The antisense inhibition of ISIS 301012 was compared with that of ISIS 326358, which has a perfect correspondence with the sequence of the crab-eating macaque apolipoprotein B with which hybridizes ISIS 301012. The effect 5 of the compounds on mRNA levels of Apolipoprotein B from crab macaque in primary hepatocytes of crab macaque purchased from Vitro Technologies (Gaithersburg, MD). Pre-cultured plaque macaque primary hepatocytes were purchased from InVitro Technologies (Baltimore, MD). Cells were grown in high glucose DMEM (Invitrogen Corporation, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitrogen Corporation, Carlsbad, CA), 100 units / ml and 100 µg / ml streptomycin (Invitrogen

10 Corporation, Carlsbad, CA).

Primary crab macaque hepatocytes were treated with 10, 50, 150, or 300 nM antisense oligonucleotides for 48 h. ISIS 113529 (SEQ ID NO: 859) was used as a control oligonucleotide. Untreated cells also served as controls. Crab macaque apolipoprotein B mRNA levels were quantified by real-time PCR using the human apolipoprotein B and GAPDH primers and probes described in

15 the examples herein. The results, shown in Table 44, are the average of 6 experiments and are expressed as percent inhibition of apolipoprotein B mRNA normalized with respect to untreated control cells.

Table 44

Inhibition of crab-eating macaque apolipoprotein B mRNA by ISIS 301012 and ISIS 326358

% inhibition of apolipoprotein B mRNA

ISIS number

Oligonucleotide dose

Treatment time 326358 301012 113529

(hours)

10 nM

24 35 24 N.D.

48

85 76 N.D.

50 nM

24 66 60 N.D.

48

88 77 N.D.

150 nM

24 61 56 5

48

82 88 42

300 nM

24 64 61 19

48

87 86 13

These data demonstrate that both ISIS 326359 and ISIS 301012 (despite two mismatches with the crab-eating macaque apolipoprotein B sequence) can inhibit apolipoprotein B mRNA expression in crab-eating macaque primary hepatocytes in a manner dependent on the dose and time.

The apolipoprotein B protein secreted by crab macaque primary hepatocytes treated with 150 and 300 nM oligonucleotide was measured by ELISA, using a specific apolipoprotein B protein kit (ALerCHEK Inc., Portland, ME). Each result represents the average of 3 experiments. The data is normalized with respect to the untreated control cells and is shown in Table 45.

Table 45

30 Reduction of Apolipoprotein B Protein Secreted by Crab Macaque Hepatocytes After Treatment with Antisense Oligonucleotide

% reduction of secreted apolipoprotein B protein

ISIS number

Oligonucleotide dose

Treatment time (hours) 326358 301012 113529

150 nM

24 twenty-one 31 eleven

48

29 25 18

300 nM

24 17 10 12

48

35 17 8

These results demonstrate that antisense inhibition by ISIS 301012 and ISIS 326358 leads to decreased secretion of apolipoprotein B protein from cultured primary crab-eating macaque hepatocytes.

In addition, the protein was isolated from oligonucleotide-treated primary crab macaque hepatocytes and subjected to immunoblot analysis to better assess apolipoprotein B protein expression. Immunoblotting was performed as described herein using an anti-antibody the human apolipoprotein B protein (US Biologicals, Swampscott, MA). Immunoblot analysis of apolipoprotein B expression after treatment with antisense oligonucleotide with ISIS 326358 and ISIS 301012 reveals a substantial reduction in apolipoprotein B expression.

In a further aspect of the description, the antisense inhibition by ISIS 281625 was compared with that of ISIS 315089, which is a perfect correspondence with the sequence of apolipoprotein B of the crab-eating macaque with that hybridizing ISIS 281625. Crab macaque primary hepatocytes, grown as described herein, treated with ISIS 315089 or ISIS 281625, 10, 50, 150, or 300 nM for 24 h. Cells were treated with the 150 and 300 nM ISIS 13650 control oligonucleotide (SEQ ID NO: 806) or with 300 nM ISIS 113529 (SEQ ID NO: 859). Untreated cells also served as controls. Apolipoprotein B mRNA levels in crab-eating macaque primary hepatocytes were quantified using real-time PCR with human primers and probe as described in other examples herein. The results, shown in Table 46, are the average of 3 experiments and are expressed as percent inhibition of apolipoprotein B mRNA normalized with respect to untreated control cells. When present, a "+" preceding the value indicates increased mRNA expression.

Table 46

Antisense inhibition of apolipoprotein B mRNA expression in crab-eating macaque hepatocytes

% inhibition of apolipoprotein B mRNA

ISIS number

Oligonucleotide dose

315089 281625 13650 113529

10 nM

70 +5 N.D. N.D.

50 nM

83 41 N.D. N.D.

150 nM

81 35 +50 N.D.

300 nM

82 69 33 28

These data demonstrate that both ISIS 315089 and ISIS 281625 can inhibit apolipoprotein B mRNA expression in primary crab macaque hepatocytes in a dose-dependent manner.

The apolipoprotein B protein secreted by crab macaque primary hepatocytes treated with ISIS 315089 and ISIS 281625, 50 and 150 nM, was measured by ELISA using a specific kit for apolipoprotein B protein (ALerCHEK Inc., Portland, ME). Each results represents the average of 3 experiments. The data is normalized with respect to the untreated control cells and is shown in Table 47.

Table 47

Reduction of Apolipoprotein B Protein Secreted by Crab Macaque Hepatocytes After Treatment with Antisense Oligonucleotide

% reduction in monkey apolipoprotein B protein secretion

ISIS number

Oligonucleotide dose

315089 281625 13650 113529

50 nM

eleven 6 16 N.D.

150 nM

25 13 13 12

These results demonstrate that 150 mM ISIS 315089 antisense inhibition leads to decreased secretion of apolipoprotein B protein from cultured primary crab-eating macaque hepatocytes.

The effects of ISIS 271009 (SEQ ID NO: 319) and ISIS 301027 (SEQ ID NO: 262) on apolipoprotein B mRNA and protein expression in primary hepatocytes of crab macaque were also tested. Cells grown as described herein were treated with ISIS 271009 or ISIS 301027, 10, 50, and 150 nM for 24 hr. The cells were treated with the 150 nM ISIS 113529 control oligonucleotide (SEQ ID NO: 859). Untreated cells also served as controls. Apolipoprotein B mRNA levels in crab-eating macaque primary hepatocytes were quantified using real-time PCR with human primers and probe as described in other examples herein. The results, shown in Table 48, are the mean of 2

experiments and are expressed as percent inhibition of apolipoprotein B mRNA normalized with respect to untreated control cells. Table 48 Antisense inhibition of apolipoprotein B mRNA expression in crab-eating macaque hepatocytes

% inhibition of apolipoprotein B mRNA

ISIS number

Oligonucleotide dose

271009 301027 113529

10 nM

42 40 N.D.

50 nM

66 54 N.D.

150 nM

69 67 eleven

These data demonstrate that both ISIS 271009 and ISIS 301027 can inhibit apolipoprotein B mRNA expression in primary crab macaque hepatocytes in a dose-dependent manner.

The apolipoprotein B protein secreted by crawler macaque primary hepatocytes treated with ISIS 271009 and ISIS 301027, 50 and 150 nM, was measured by ELISA using a specific kit for apolipoprotein B protein (ALerCHEK Inc., Portland, ME). Each results represents the average of 3 experiments. Data are shown as percent reduction of secreted protein, normalized relative to untreated control cells, and are shown in Table 49. When present, a "+" indicates that protein secretion was higher.

Table 49

Reduction of Apolipoprotein B Protein Secreted by Crab Macaque Hepatocytes After Treatment with Antisense Oligonucleotide

% reduction in monkey apolipoprotein B protein secretion

ISIS number

Oligonucleotide dose

271009 301027 13650 113529

50 nM

+30 25 N.D. N.D.

150 nM

26 31 +1 fifteen

These results demonstrate that antisense inhibition by ISIS 315089 and ISIS 281625 leads to decreased secretion of apolipoprotein B protein from cultured primary crab macaque hepatocytes.

Example 62

Methods for evaluating liver steatosis

Hepatic steatosis refers to the accumulation of lipids in the liver, or "fatty liver," which is frequently caused by alcohol consumption, diabetes, and hyperlipidemia. The presence of steatosis was evaluated in the livers of animals treated with antisense oligonucleotides directed at apolipoprotein B. Steatosis is evaluated by histological analysis of liver tissue and measurement of triglyceride levels in the liver.

The resected liver tissue is immediately dipped in Tissue Tek OCT dipping compound (Ted Pella, Inc., Redding, CA) and frozen in a 2-methyl-butane dry ice suspension. The tissue sections are cut 4-5 µm thick and then fixed in 5% neutral buffered formalin. The tissue sections are stained with hematoxylin and eosin following standard histological procedures to visualize the nuclei and cytoplasm, respectively, and oily red O according to the manufacturer's instructions (Newcomers Supply, Middleton, WI) to visualize lipids.

Alternatively, the tissues are fixed in 10% neutral buffered formalin, dipped in paraffin, cut into sections 4-5 µm thick, deparaffinized, and stained with hematoxylin and eosin, all according to standard histological procedures.

Triglyceride content quantification is also used to assess statosis. Tissue triglyceride levels are measured using a GPO triglyceride assay (Sigma-Aldrich, St. Louis, MO).

Example 63

Effects of antisense inhibition by ISIS 301012 in lean mice: long-term study

The toxicity of ISIS 301012 (SEQ ID NO: 247) is investigated in a 3-month, long-term study in mice. 2-month-old male and female CD-1 mice (Charles River Laboratories, Wilmington, MA) are administered 2, 5, 12.5, 25 or 50 mg / kg ISIS 301012 twice weekly for the first week , and then every 4 days. Mice are kept on a standard rodent diet. Animals with saline or control oligonucleotide serve as controls and injections follow the same schedule. Each treatment group contains 6 to 10 mice of each sex, and each treatment group is in duplicate, one group to complete the study in 1 month, the other to complete the study in 3 months. After the treatment periods of 1 or 3 months, the mice are sacrificed and the expression of the target in the liver, the lipid levels in the serum and the indicators of toxicity are evaluated. Liver samples are obtained, RNA is isolated, and apolipoprotein B mRNA expression is measured by real-time PCR as described in other examples herein. Serum lipids including total cholesterol, LDL cholesterol, HDL cholesterol, and triglycerides were evaluated by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY). The ratios of LDL cholesterol to HDL cholesterol and total cholesterol to HDL cholesterol were also calculated. Analysis of ALT and AST in serum, inflammatory tissue infiltrates, and basophilic granules in tissue provide an assessment of treatment-related toxicities. Hepatic steatosis, or lipid accumulation in the liver, is assessed by routine histological analysis with oil-red O staining and measurement of triglycerides in liver tissue, using a GPO triglyceride assay (Sigma-Aldrich, St. Louis, MO).

The toxicity study also includes groups of animals that are allowed to recover after cessation of oligonucleotide treatment. Both male and female CD-1 mice (Charles River Laboratories, Wilmington, MA) are treated with 5, 10, 50 mg / kg ISIS 301012 twice weekly for the first week and every 4 days thereafter. Animals injected with saline and control oligonucleotide serve as controls. Each treatment group includes 6 animals per sex. After 3 months of treatment, the animals remain untreated for an additional 3 months, after which they are euthanized. The same parameters are evaluated as in the sacrificed mice immediately after 3 months of treatment.

After 1 month of treatment, real-time PCR quantification shows that apolipoprotein B mRNA levels in the liver are reduced by 53%. In addition, the expected dose response toxicities were observed. ALT and AST levels, measured by routine clinical procedures on an Olympus clinical analyzer (Olympus America Inc., Melville, NY), are highest in mice treated with 25 or 50 mg / kg ISIS 301012. The tissues were prepared for the analysis by routine histological procedures. Basophilic granules were observed in the liver and kidney tissue with doses of ISIS 301012 greater than 12.5 mg / kg. Lymphohistocytic infiltrates were observed in different tissues with doses greater than 12.5 mg / kg of ISIS 301012. Staining of the tissue sections with oil red O shows that there is no statosis after the oligonucleotide treatments.

Example 64

Effects of antisense inhibition by ISIS 301012 in lean crabeater macaques: long-term study

As described in Example 45, crab-eating macaques (male or female) are used to assess the potential of antisense oligonucleotides to reduce apolipoprotein B protein or mRNA levels, as well as phenotypic endpoints associated with apolipoprotein B including , but without limitation, cardiovascular indicators, atherosclerosis, lipid diseases, obesity and plaque formation. Accordingly, in a further embodiment of the invention, the effects of ISIS 301012 (SEQ ID NO: 247) are investigated in a long-term study on the expression of apolipoprotein B and serum lipids in crab-eating macaques. Such a long-term study is also used to assess the toxicity of antisense compounds.

Male and female crab macaques are treated with 2, 4 or 12 mg / kg of ISIS 301012 intravenously, or with 2 or 20 mg / kg subcutaneously every two days the first week, and then every 4 days thereafter. , during periods of 1 and 3 months of treatment. Animals treated with saline solution serve as controls. Each treatment group includes 2 to 3 animals of each sex.

At one month interval and 3 months after the end of the study, the animals are sacrificed and the expression of the target in the liver, serum lipid levels and toxicity indicators are evaluated. Liver samples are obtained, RNA is isolated, and apolipoprotein B mRNA expression is measured by real-time PCR as described in other examples herein. Serum lipids including total cholesterol, LDL cholesterol, HDL cholesterol, and triglycerides were evaluated by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY). The ratios of LDL cholesterol to HDL cholesterol and total cholesterol to HDL cholesterol were also calculated. Analysis of ALT and AST in serum, inflammatory tissue infiltrates, and basophilic granules in tissue provide an assessment of treatment-related toxicities. Hepatic steatosis, or lipid accumulation in the liver, is assessed by routine histological analysis with Oil Red O staining and measurement of triglycerides in liver tissue, using a

GPO triglyceride assay (Sigma-Aldrich, St. Louis, MO).

Additional treatment groups consisted of 2 animals per sex, treated with saline (0 mg / kg), 12 or 20 mg / kg ISIS 301012 every other day for the first week, and then every 4 days, over a period of 3 months. After the treatment period, animals are not treated for an additional 3 months. These treatment groups are aimed at studying the effects of apolipoprotein B inhibition 3 months after stopping treatment. At the end of the 3-month recovery period, animals are euthanized and the same parameters as for animals euthanized immediately after 1 and 3 months of treatment are evaluated.

The results from the one-month interval of long-term treatment are shown in Table 50 and are normalized with respect to saline-treated animals, for mRNA and with respect to untreated reference values, for lipid levels . Serum levels of total cholesterol, LDL cholesterol, HDL cholesterol, LDL particle concentration, and triglycerides were measured by nuclear magnetic resonance spectroscopy using Liposcience (Raleigh, NC). Furthermore, the concentration of intact oligonucleotide in the liver was measured by capillary gel electrophoresis and is presented as micrograms of oligonucleotide per gram of liver tissue. Each result represents the average of the data from 4 animals (2 males and 2 females).

Table 50

Effects of antisense inhibition by ISIS 301012 in lean crabeater macaques:

Intravenous administration

Subcutaneous injection

2 mg / kg

4 mg / kg 12 mg / kg 3.5 mg / kg 20 mg / kg

% change in expression of apolipoprotein B normalized with respect to saline

-Four. Five -76 -96 N.D. -94

Concentration of the antisense oligonucleotide μg / g

92 179 550 N.D. 855

Lipid parameters,% change normalized against the untreated reference value

Saline dissolution 2 mg / kg 4 mg / kg 12 mg / kg 3.5 mg / kg 20 mg / kg

Total cholesterol

+1 -6 -2 -2 +5 -5

LDL cholesterol

+17 +15 +9 +3 -4 -16

HDL cholesterol

-eleven -2. 3 -fifteen -8 +13 +5

LDL / HDL

+62 +94 +38 +44 -fifteen -19

Total / HDL cholesterol

+30 +44 +22 +21 -7 -10

Triglyceride

+37 +26 +32 +15 +1 -3

LDL particle concentration

+15 +8 +8 -eleven -14 -twenty-one

These data show that ISIS 301012 inhibits apolipoprotein B expression in a dose-dependent manner in a primate species and concomitantly lowers lipid levels with higher doses of ISIS 301012. Furthermore, these results demonstrate that the oligonucleotide Antisense accumulates in the liver in a dose-dependent manner.

No hepatic steatosis, or lipid accumulation in the liver, was observed after 4 weeks of treatment with the indicated doses. Expected dose-related toxicity, with the highest doses of 12 and 20 mg / kg, including a 1.2-1.3 fold transient increase in time of activated partial thromboplastin (APTT), was observed during the first 4 hours and basophilic granules in the liver and kidney (as determined by routine histological examination with tissue samples). No functional changes were observed in the kidney.

In a similar experiment, male and female crab-eating monkeys received an intravenous dose of ISIS 301012 of 4 mg / kg, every other day for the first week and every 4 days thereafter. The groups of animals were sacrificed after the first dose and the fourth dose, as well as on days 11, 15 and 23 after the fourth dose and the final dose. RNA was isolated from the liver and apolipoprotein B mRNA levels were assessed by real-time PCR as described herein. The results of this experiment demonstrate a 40% reduction in apolipoprotein B mRNA expression after a single 4 mg / kg intravenous dose of ISIS 301012. In addition, after 4 doses of 4 mg / kg ISIS 301012, target mRNA was reduced by approximately 85% and a 50% reduction in target mRNA was maintained for up to 16 days after cessation of treatment with the antisense oligonucleotide.

Example 65

Microarray analysis: gene expression patterns in lean mice vs. high-fat fed mice

C57B1 / 6 mice were divided into the following groups, consisting of 5 animals each: (1) mice on a lean diet, injected with saline (lean control); (2) mice on a high fat diet; (3) mice on a high fat diet injected with 50 mg / kg of control oligonucleotide 141923 (SEQ ID NO: 858); (4) mice on a high fat diet given 20 mg / kg atorvastatin calcium (Lipitor®, Pfizer Inc.); (5) high-fat diet mice injected with 10, 25, or 50 mg / kg ISIS 147764 (SEQ ID NO: 109). The saline and oligonucleotide treatments were administered intraperitoneally twice a week for 6 weeks. Atorvastatin was administered daily for 6 weeks. At the end of the study, liver samples were isolated from each animal and RNA was isolated for qualitative evaluation by Northern blotting, DNA microarray and quantitative real-time PCR. Northern blot evaluation and quantitative real-time PCR were performed as described in other examples herein.

For DNA microarray analysis, hybridization samples were prepared from 10 µg of total RNA isolated from each mouse liver according to the Affymetrix Expression Analysis Technical Manual (Affymetrix, Inc., Santa Clara, CA) . Samples were hybridized to a mouse gene chip containing approximately 22,000 genes, which was subsequently washed, double stained using Fluidics Station 400 (Affymetrix, Inc., Santa Clara, CA) as defined by the manufacturer's protocol. The cell intensity stained chips of the probe were scanned with the GeneArray scanner (Affymetrix, Inc., Santa Clara, CA). The signal values of each probe set were calculated using the Affymetrix Microarray Suite v5.0 software (Affymetrix, Inc., Santa Clara, CA). Each condition was profiled from 5 biological samples per group, one chip per sample. The number of changes in the expression was computed using the geometric mean of the Microarray Suite v5.0 signal values. Statistical analysis used one-way ANOVA followed by 9 pairwise comparisons. All groups were compared to the high fat group to determine changes in gene expression resulting from treatment with ISIS 147764. Microarray data was interpreted using a hierarchical grouping to visualize global gene expression patterns.

The results of microarray analyzes revealed that treatment with ISIS 147764 brings the gene expression profile in high-fat fed mice to the profile observed in lean mice. Real-time PCR analysis confirmed the reduction of mRNA expression for the following genes involved in lipid metabolism: hepatic lipase, fatty acid ATP synthase binding cassette, member 2 of subfamily D (ALD), protein of binding to intestinal fatty acids 2, stearoyl-CoA desaturase-1 and HMG CoA reductase.

Serum cholesterol and mouse apolipoprotein B mRNA levels were evaluated as described herein to confirm antisense inhibition by ISIS 147764 and ISIS 147483. Both mRNA and cholesterol levels decreased by one dose dependent form after treatment with ISIS 147764 or ISIS 147483, as demonstrated in other examples herein. The 50 mg / kg dose of ISIS 147483 increased ALT and AST levels. The 10, 25, and 50 mg / kg doses of ISIS 147764 and the 10 and 25 mg / kg doses of ISIS 147483 did not significantly elevate ALT or AST levels.

Example 66

Evaluation of hepatic steatosis in animals treated with apolipoprotein B antisense oligonucleotides

The presence of steatosis was evaluated in the livers of animals treated with antisense oligonucleotides directed at apolipoprotein B. Steatosis is evaluated by histological analysis of liver tissue and measurement of triglyceride levels in the liver.

Evaluation of steatosis in animals fed with high fat content, treated with ISIS 147764 for 6 weeks

Steatosis at the end of the study after 6 weeks of treatment was evaluated in the liver tissue of animals treated with ISIS 147764 (SEQ ID NO: 109) and control described in Example 21. Tissue sections were stained with oily red O and hematoxylin to visualize the lipids and nuclei respectively. Tissue sections were also stained with hematoxylin and eosin to visualize the nuclei and cytoplasm, respectively. Histological analysis of tissue sections stained by either method revealed that there was no difference in steatosis between animals treated with saline and those treated with ISIS 147764, demonstrating that a 6-week treatment with ISIS 147764 does not lead to lipid accumulation in the liver.

Evaluation of steatosis after long-term treatment with apolipoprotein B inhibitor in animals fed with high fat content

Male C57B1 / 6 mice were treated twice weekly with intraperitoneal injections of 25 mg / kg ISIS 147764 (SEQ ID NO: 109) or 25 mg / kg ISIS 141923 (SEQ ID NO: 858) for 6, 12, and 20 weeks. Animals treated with saline solution served as controls. Each treatment group contained 4 animals. Animals were sacrificed at 6, 12 and 20 weeks and liver tissue was obtained for histological analysis and measurement of the triglyceride content in the tissue. The results showed that there were no significant differences in the triglyceride content of liver tissue when comparing animals treated with ISIS 147764 with animals treated with saline. Furthermore, histological analyzes of the liver tissue section demonstrate that steatosis is reduced at 12 and 20 weeks after treatment of high-fat-fed mice with ISIS 147764, compared to control animals.

10 saline that received a high fat diet.

Assessment of statosis in lean mice

Lipid accumulation in liver tissue was also evaluated in lean mice. Male C67B1 / 6 mice (Charles River Laboratories (Wilmington, MA) 6 to 7 weeks old, maintained on a standard rodent diet and treated twice weekly with 25 or 50 mg / kg intraperitoneal injections of 147764 ( I KNOW THAT

15 ID NO: 109) or 147483 (SEQ ID NO: 79) for 6 weeks. Animals treated with saline solution served as controls. Each treatment group was composed of 4 animals. Animals were sacrificed after the 6 week treatment period, at which time liver tissue and serum were collected.

Apolipoprotein B mRNA levels were measured by real-time PCR, as described in other examples herein. The data shown in Table 51 represent the mean of 4 animals and are

20 present as the inhibition with respect to the controls treated with saline solution. The results demonstrate that both ISIS 147483 and ISIS 147764 inhibit apolipoprotein B mRNA expression in lean mice in a dose-dependent manner.

Table 51

Antisense inhibition of apolipoprotein B mRNA in lean mice

Treatment and dosage

ISIS

ISIS

147483

147764

25 mg / kg

50 mg / kg  25 mg / kg 50 mg / kg

% inhibition of apolipoprotein B mRNA

79 91 48 77

Total cholesterol, LDL cholesterol, HDL cholesterol, and serum triglycerides were measured by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY). ALT and ALT liver enzymes in serum were also measured using the Olympus clinical analyzer. These results demonstrate that ISIS 147764 lowers serum lipids relative to control animals treated with saline. The levels

30 of ALT and AST do not exceed the normal range for mice (300 IU / l), indicating lack of toxicity associated with treatment. The results are the mean of the data from 4 animals and are shown in Table 52.

Table 52

Serum lipid and liver enzyme levels in lean mice treated with ISIS 147764 and ISIS 147483

Treatment and dosage

Saline dissolution

ISIS 147483 ISIS 147764

25

fifty  25 fifty

mg / kg

mg / kg

mg / kg

mg / kg

Lipids in serum

Total cholesterol mg / dl

164 153 183 114 57

LDL cholesterol mg / dl

25 26 39 29 18

HDL cholesterol mg / dl

127 117 131 79 38

Triglycerides mg / dl

121 138 127 80 30

Hepatic enzymes

ALT IU / l

105 73 57 47 48

AST IU / l

109 78 72 81 101

Liver tissue was prepared by routine histological methods to assess statosis, as described herein. Examination of tissue samples stained with oily red O or hematoxylin and eosin shows that treatment of lean mice with antisense oligonucleotides for apolipoprotein B does not produce statosis.

6-month study to better assess statosis in mice treated with apolipoprotein B antisense oligonucleotide

Long-term treatment of mice with apolipoprotein B-directed antisense oligonucleotides is used to assess the toxic and pharmacological effects of prolonged treatment with antisense compounds. Male and female C57B1 / 6 mice at 2 months of age are treated with 2, 5, 25, or 50 mg / kg apolipoprotein B antisense oligonucleotide. Treatments are administered intraperitoneally every 2 days for the first week and then every 4 days. Mice with saline alone or control oligonucleotide serve as control groups. Each treatment group contains 25 to 30 mice. After 6 months of treatment, a subset of mice is sacrificed in each treatment group. The rest of the mice are left a recovery period of 3 months without treatment, after which they are sacrificed. Apolipoprotein B mRNA expression is measured by real-time PCR as described for other methods herein. Liver tissue is also prepared to measure triglyceride content using the GPO Triglyceride Assay (Sigma-Aldrich, St. Louis, MO). Serum is collected and lipid content, including total cholesterol, LDL cholesterol, HDL cholesterol, and triglycerides, is evaluated using an Olympus clinical analyzer (Olympus America Inc., Melville, NY). ALT and AST liver enzymes in serum are also measured, also using the clinical analyzer. Serum samples are subjected to immunoblot analysis using an antibody directed to apolipoprotein B (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Liver, kidney and other tissues are prepared by routine procedures for histological analysis. Tissues are evaluated for the presence of inflammatory basophilic granules and infiltrates. Steatosis is assessed by staining with oil red O of liver tissue sections.

Example 67

A mouse model for atherosclerotic plaque formation: apolipoprotein B transgenic mice lacking the LDL receptor gene

The LDL receptor is responsible for removing apolipoprotein B-containing LDL particles. Without the LDL receptor, animals cannot effectively remove apolipoprotein B-containing LDL particles from plasma. Therefore, plasma levels of apolipoprotein B and LDL cholesterol are remarkably high. Both mice expressing the human apolipoprotein B transgene (TgN-hApoB + / +) and LDL receptor deficient (LDLr - / -) mice are used as animal models of development of atherosclerotic plaque. When the LDL receptor deficiency genotype is combined with the human apolipoprotein B transgenic genotype (TgN-hApoB + / +; LDLr - / -), atherosclerotic plaques develop rapidly. Mice with this genetic background are used to investigate the ability of the compounds to prevent atherosclerosis and plaque formation.

Male TgN-hApoB + / +; LDLr - / - mice are treated twice weekly with 10 or 20 mg / kg antisense oligonucleotide for apolipoprotein B for 12 weeks. Control groups are treated with either saline or control oligonucleotide. Total serum cholesterol, HDL cholesterol, LDL cholesterol, and triglycerides are measured at 2, 4, 6, 8, and 12 weeks by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY). Human apolipoprotein B protein is measured in serum at 2, 4, 6, 8, and 12 weeks using an ELISA kit (ALerCHEK Inc., Portland, ME). The human and mouse apolipoprotein mRNA in the liver is measured at 12 weeks. The results of the 12-week study serve to evaluate the pharmacological behavior of ISIS 301012 in a double transgenic model.

In addition, a 4-month study was conducted in TgN-hApoB + / +; LDLr - / - mice, with the treatment conditions used in the 12-week study. Mice are treated for 4 months with antisense oligonucleotides directed against human apolipoprotein B to assess the ability of such compounds to prevent atherosclerotic plaque formation. At the end of the 4 month treatment period, the mice are anesthetized and perfused with 10% formalin. The perfused arterial tree is isolated and the presence of atherosclerotic plaques is examined. Sections of the arterial tree are paraffinized and prepared for histological analysis using routine models. Total serum cholesterol, HDL cholesterol, LDL cholesterol, and triglycerides are measured at 2, 4, 6, 8, 12, and 16 weeks by routine clinical analysis using an Olympus clinical analyzer (Olympus America Inc., Melville, NY). Human apolipoprotein B protein is measured in serum at 2, 4, 6, 8, 12, and 16 weeks using an ELISA kit (ALerCHEK Inc., Portland, ME). Mouse and human apolipoprotein mRNA in the liver is measured at 16 weeks by real-time PCR.

Example 68

Rabbit models to study atherosclerotic plaque formation

The Watanabe rabbit variety with inheritable hyperlipidemia (WHHL) is used as a model for atherosclerotic plaque formation. New Zealand white rabbits on a high-fat diet were also used as a model of atherosclerotic plaque formation. Treatment of WHHL rabbits or New Zealand white rabbits fed high fat content with antisense compounds for apolipoprotein B is used to test their potential as therapeutic or prophylactic treatments for atherosclerotic plaque disease. Rabbits are injected with 5, 10, 25, or 50 mg / kg apolipoprotein B-targeted antisense oligonucleotides. Animals treated with saline alone or a control oligonucleotide serve as controls. Throughout the treatment serum samples are collected and the levels of apolipoprotein B protein are evaluated by ELISA (kit from ALerCHEK Inc., Portland, ME) and the lipids in the serum (cholesterol, LDL cholesterol, VLDL cholesterol, HDL cholesterol, triglycerides) by routine clinical analysis. Liver tissue triglyceride content is measured using a GPO triglyceride assay (Sigma-Aldrich, St. Louis, MO). Tissues from liver, kidney, heart, aorta, and other tissues are obtained and processed for histological analysis using routine procedures. Tests for basophil granules and inflammatory infiltrates are examined in liver and kidney tissues. Steatosis is evaluated in liver tissue using O-red staining. In addition, aortic sections stained with O-red O and hematoxylin are examined to assess the formation of atherosclerotic lesions.

Example 69

Oral supply of apolipoprotein B inhibitors

Oligonucleotides can be formulated for in vivo delivery in an acceptable dosage form, e.g. eg, as parenteral or non-parenteral formulations. Parenteral formulations include intravenous (IV), subcutaneous (SC), intraperitoneal (IP), intravitreal and intramuscular (IM) formulations, as well as formulations for delivery by pulmonary inhalation, intranasal administration, topical administration, etc. Non-parenteral formulations include formulations for delivery via the alimentary canal, e.g. eg, oral administration, rectal administration, intrajejunal instillation etc. Rectal administration includes administration such as an enema or a suppository. Oral administration includes the administration of a capsule, a gel capsule, a pill, an elixir, etc.

In some embodiments, an oligonucleotide can be administered to a subject by an oral route of administration. The subject can be an animal or a human being (man). An animal subject may be a mammal, such as a mouse, rat, mouse, rat, dog, guinea pig, monkey, non-human primate, cat, or pig. Non-human primates include monkeys and chimpanzees. A suitable animal subject can be an experimental animal, such as a mouse, rat, mouse, rat, dog, monkey, non-human primate, cat, or pig.

In some embodiments, the subject may be a human. In some embodiments, the subject may be a human patient in need of therapeutic treatment as discussed in more detail herein. In some embodiments, the subject may require modulation of the expression of one or more genes as discussed in more detail herein. In some particular embodiments, the subject may require inhibition of the expression of one or more genes as discussed in more detail herein. In particular, the subject may need modulation, i.e., inhibition or potentiation, of apolipoprotein B in order to obtain the therapeutic indications discussed in more detail herein.

In some embodiments, the non-parenteral (eg, oral) oligonucleotide formulations according to the present invention produce enhanced bioavailability of the oligonucleotide. In this context, the term "bioavailability" refers to a measurement of the portion of an administered drug that reaches the circulatory system (eg, blood, especially blood plasma) when a particular mode of administration is employed to deliver the drug. . Enhanced bioavailability refers to the ability of a particular mode of administration to deliver the oligonucleotide to a subject's peripheral blood plasma, relative to another mode of administration. For example, when a non-parenteral mode of administration (eg, an oral mode) is used to introduce the drug into a subject, the bioavailability for that mode of administration can be compared to a different mode of administration, eg. eg, an IV mode of administration. In some embodiments, the area under the curve of the concentration of the compound in blood plasma (AUC0) after non-parenteral administration (eg oral, rectal, intrajejunal) can be divided by the area under the concentration curve of drug in plasma after intravenous (iv) administration (AUCiv) to provide a dimensionless ratio (relative bioavailability, RB) representing the fraction of compound absorbed by a non-parenteral route compared to route IV. The bioavailability of one composition is said to be enhanced compared to the bioavailability of another composition, when the relative bioavailability of the first composition (RB1) is greater than the relative bioavailability of the second composition (RB2).

In general, bioavailability correlates with therapeutic efficacy when the therapeutic efficacy of a compound is related to the blood concentration obtained, even if the final site of action of the drug is intracellular (van Berge-Henegouwen et al., Gastroenterol., 1977 , 73, 300). Bioavailability studies have been used to determine the degree of intestinal absorption of a drug, measuring the change in drug levels in the peripheral blood after an oral dose (DiSanto, Chapter 76 In: Remington = s Pharmaceutical Sciences, 18th Ed. , Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, pages 1451-1458).

In general, the bioavailability of an oral composition is said to be "enhanced" when its relative bioavailability is greater than the bioavailability of a composition consisting substantially of the pure oligonucleotide, ie, the oligonucleotide in the absence of a penetration enhancer.

Organ bioavailability refers to the concentration of a compound in an organ. Organ bioavailability can be measured in test subjects by a variety of means, such as by whole body radiography. Bioavailability in an organ can be modified, eg, enhanced, with one or more modifications of an oligonucleotide, through the use of one or more vehicle or excipient compounds, etc., as described in more detail herein. In general, an increase in bioavailability will result in an increase in the bioavailability of an organ.

Oral oligonucleotide compositions according to the present invention may comprise one or more "mucosal penetration enhancers" also known as "absorption enhancers" or simply as "penetration enhancers". Accordingly, some embodiments of the invention comprise at least one oligonucleotide in combination with at least one penetration enhancer. In general, a penetration enhancer is a substance that facilitates the transport of a drug through the mucous membrane (s) associated with the desired mode of administration, e.g. eg, intestinal epithelial membranes. Accordingly, it is desirable to select one or more penetration enhancers that facilitate the absorption of an oligonucleotide, without interfering with the activity of the oligonucleotide, and so that the oligonucleotide can be introduced into the body of an animal without unacceptable side effects such as toxicity, irritation or allergic responses.

Embodiments of the present invention provide compositions comprising one or more pharmaceutically acceptable penetration enhancers and methods of using such compositions, which result in improved bioavailability of oligonucleotides administered by non-parenteral modes of administration. Until now, some penetration enhancers have been used to improve the bioavailability of certain drugs. See Muranishi, Crit. Rev. Ther. Drug Carrier Systems, 1990, 7, 1 and Lee et al., Crit. Rev. Ther. Drug Carrier Systems, 1991, 8, 91. The uptake and delivery of oligonucleotides, relatively complex molecules known to be difficult to administer to animals and humans, have been found to be greatly improved even when administered by unsuitable means. parenterals by using a number of different classes of penetration enhancers.

In some embodiments, compositions for non-parenteral administration include one or more modifications of naturally occurring oligonucleotides (ie, fully phosphodiester deoxyribosyl-oligonucleotides and fully phosphodiester ribosyloligonucleotides). Such modifications can increase binding affinity, nuclease stability, cellular or tissue permeability, tissue distribution, or other biological or pharmacokinetic property. Modifications to the base, linker, or sugar can be made, as generally discussed in more detail herein, in connection with oligonucleotide chemistry. In some embodiments of the invention, compositions for administration to a subject, and in particular oral compositions for administration to an animal or human subject, will comprise modified oligonucleotides having one or more modifications to enhance affinity, stability, tissue distribution, or otherwise. biological properties.

Suitable modified connectors include phosphorothioate connectors. In some embodiments according to the invention, the oligonucleotide has at least one phosphorothioate linker. Phosphorothioate linkages provide stability against nucleases, as well as binding characteristics of plasma proteins to the oligonucleotide. Nuclease stability is useful for increasing the in vivo life of oligonucleotides, while binding to plasma proteins decreases the first pass clearance rate of the oligonucleotide through renal excretion. In some embodiments according to the present invention, the oligonucleotide has at least two phosphorothioate linkers. In some embodiments where the oligonucleotide has exactly n nucleosides, the oligonucleotide has 1 to n-1 phosphorothioate linkages. In some embodiments where the oligonucleotide has exactly n nucleosides, the oligonucleotide has n-1 phosphorothioate linkages. In other embodiments where the oligonucleotide has exactly n nucleosides, and n is even, the oligonucleotide has 1 to n / 2 phosphorothioate bonds, or when n is odd, 1 to (n-1) / 2 phosphorothioate bonds. In some embodiments, the oligonucleotide has alternating phosphodiester (PO) and phosphorothioate (PS) bonds. In other embodiments, the oligonucleotide has a stretch of two or more consecutive PO bonds and at least a stretch of two or more PS bonds. In other embodiments, the oligonucleotide has at least two stretches of PO bonds interrupted by at least one PS bond.

In some embodiments, at least one of the nucleosides is modified in the ribosyl sugar unit by a modification that imparts nuclease stability, binding affinity, or some other beneficial biological property. In some cases, the sugar modification includes a 2 'modification, e.g. ex. the 2'-OH of ribosyl sugar is replaced or substituted. Suitable replacements for 2'-OH include 2'-F and 2'-arabino-F. Suitable substitutions for OH include 2'-O-alkyl, e. ex. 2-O-methyl and 2'-O-substituted alkyl, e.g. ex. 2'-Omethoxyethyl, 2'-O-aminopropyl, etc. In some embodiments, the oligonucleotide contains at least one 2 'modification. In some embodiments, the oligonucleotide contains at least 2 2 'modifications. In some embodiments, the oligonucleotide has at least one 2 'modification at each end (ie, the 3' and 5 'terminal nucleosides each have the same or different 2' modifications). In some embodiments, the oligonucleotide has at least two 2 'sequential modifications at each end of the oligonucleotide. In some embodiments, the oligonucleotides further comprise at least one deoxynucleoside. In particular embodiments, the oligonucleotides comprise a stretch of deoxynucleosides such that the stretch is capable of triggering cleavage by RNase (eg, RNase H) of an RNA with which it is capable of hybridizing the oligonucleotide. In some embodiments, a stretch of deoxynucleosides capable of activating RNase-mediated cleavage of the RNA comprises from about 6 to about 16, e.g. ex. from about 8 to about 16 consecutive deoxynucleosides.

Oral compositions for administration of non-parenteral oligonucleotide compositions of the present invention can be formulated in different dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The term "food supply" encompasses, eg. eg, oral, rectal, endoscopic, and sublingual / buccal administration. A common requirement for these modes of administration is the absorption in some or all of the digestive tract and the need for effective penetration into the mucosa of the acid or nucleic acids thus administered.

The delivery of a drug by the oral mucosa, as is the case with buccal and sublingual administration, has several desirable characteristics, including, in many cases, a faster rise in the plasma concentration of the drug than by oral delivery (Harvey, Chapter 35 in: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, page 711).

Endoscopy can be used to deliver the drug directly to an inner part of the alimentary tract. For example, endoscopic retrograde cholangiopancreatography (ERCP) takes advantage of extended gastroscopy and allows selective access to the biliary tract and pancreatic duct (Hirahata et al., Gan To Kagaku Ryoho, 1992, 19 (10 Suppl.), 1591). Pharmaceutical compositions, including liposome formulations, can be delivered directly into portions of the digestive canal, such as, e.g. eg, the duodenum (Somogyi et al., Pharm. Res., 1995, 12, 149) or the gastric submucosa (Akamo et al., Japanese J. Cancer Res., 1994, 85, 652) by endoscopic means. Gastric lavage devices (Inoue et al., Artif. Organs, 1997, 21, 28) and percutaneous endoscopic feeding devices (Pennington et al., Ailment. Pharmacol. Ther., 1995, 9, 471) can also be used to direct food supply of pharmaceutical compositions.

In some embodiments, the oligonucleotide formulations can be administered through the anus into the rectum or lower intestine. Rectal suppositories, retention enemas, or rectal catheters may be used for this purpose and may be preferred when patient compliance may otherwise be difficult to achieve (eg, in pediatric and geriatric applications, or when the patient is vomiting or is unconscious). Oral administration can produce faster and higher blood levels than the oral route. (Harvey, Chapter 35 in: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, page 711). Because approximately 50% of the drug that is absorbed from the rectum will not pass through the liver, administration by this route significantly reduces the potential for first-pass metabolism (Benet et al., Chapter 1 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., Eds., McGraw-Hill, New York, NY, 1996).

An advantageous method of non-parenterally administered oligonucleotide compositions is oral delivery. Some embodiments use different penetration enhancers in order to carry out the transport of oligonucleotides and other nucleic acids through the mucous and epithelial membranes. Penetration enhancers can be classified as belonging to one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Accordingly, some embodiments comprise oral oligonucleotide compositions comprising at least one member consisting of surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Other embodiments comprise the oral oligonucleotide comprising at least one fatty acid, e.g. eg, capric or lauric acid, or combinations or salts thereof. Other embodiments comprise methods of enhancing the oral bioavailability of an oligonucleotide, the method comprising co-administration of the oligonucleotide and at least one penetration enhancer.

Other excipients that can be added to oral oligonucleotide compositions include surfactants (or "surfactants"), which are chemical entities that, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interface tension between the aqueous solution. and another liquid, with the result that the absorption of oligonucleotides through the digestive mucosa and other epithelial membranes is enhanced. In addition to bile salts and fatty acids, surfactants include, for example, sodium lauryl sulfate, lauryl ether, and polyoxyethylene-9 and cetyl ether and polyoxyethylene-20 (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991 , p.92); and perfluorochemical emulsions, such as FC-43 (Takahashi et al., J. Pharm. Phamacol., 1988, 40, 252).

Fatty acids and their derivatives that act as penetration enhancers and can be used in compositions of the present invention include, for example, oleic acid, lauric acid, capric acid (ndecanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurine, caprylic acid, arachidonic acid, glyceryl 1-monocaprate, 1-docylazacycloheptan-2-one, acylcarnitines, acylcholine and its glycerides and / or their physiologically acceptable salts (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; El-Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651).

In some embodiments, the oligonucleotide compositions for oral delivery comprise at least two discrete phases, the phases of which may comprise particles, capsules, gel caps, microspheres, etc. Each phase may contain one or more oligonucleotides, penetration enhancers, surfactants, bioadhesives, effervescent agents, or other adjuvants, excipients, or diluents. In some embodiments, a phase comprises at least one oligonucleotide and at least one penetration enhancer. In some embodiments, a first phase comprises at least one oligonucleotide and at least one penetration enhancer, while a second phase comprises at least one penetration enhancer. In some embodiments, a first phase comprises at least one oligonucleotide and at least one penetration enhancer, while a second phase comprises at least one penetration enhancer and substantially does not comprise oligonucleotide. In some embodiments, at least one phase is mixed with at least one degradation retardant, such as a coating or matrix, that delays the release of the content of this phase. In some embodiments, at least one phase, in some embodiments, a first phase comprises at least one oligonucleotide, at least one penetration enhancer, while a second phase comprises at least one penetration enhancer and one release retardant. In particular embodiments, an oral oligonucleotide comprises a first phase comprising particles containing an oligonucleotide and a penetration enhancer, and a second phase comprising particles coated with a release retarding agent and containing penetration enhancer.

A variety of bile salts also function as penetration enhancers to facilitate drug absorption and bioavailability. The physiological functions of bile include facilitating the dispersion and absorption of fat-soluble lipids and vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., Eds., McGraw- Hill, New York, NY, 1996, pages 934-935). Different natural bile salts and their synthetic derivatives act as penetration enhancers. Therefore the term "bile salt" includes any of the natural components of bile as well as any of its synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocolic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glycolic acid (sodium glucolate) , Glycolic Acid (Sodium Glycocholate), Glycodeoxycholic Acid (Sodium Glycodeoxycholate), Taurocholic Acid (Sodium Taurocholate), Taurodeoxycholic Acid (Sodium Taurodeoxycholate), CDCA, Sodium Chenodeoxycholate), Ursodeoxycholic Acid (UD) -24,25-sodium dihydrofusidate (STDHF), sodium lauryl ether polyoxyethylene glycol dihydrofusidate9 (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, chapter 39 in: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, pages 782783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; Yamamoto et al., J. Pharm Exp. Th er., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579).

In some embodiments, the penetration enhancers useful in some embodiments of the present invention are mixtures of penetration enhancing compounds. One such penetration enhancer is a mixture of UDCA (and / or CDCA) with capric and / or lauric acids or salts thereof, eg. eg, sodium. Such mixtures are useful to enhance the supply of biologically active substances through the mucous membranes, in particular the intestinal mucosa. Other mixtures of penetration enhancers comprise approximately 5-95% bile acids or UDCA and / or CDCA salt (s) with 5-95% capric and / or lauric acid. Particular penetration enhancers are mixtures of the sodium salts of UDCA, capric acid, and lauric acid, in a ratio of approximately 1: 2: 2, respectively. Another such penetration enhancers is a mixture of capric and lauric acid (or salts thereof) in a ratio of 0.01: 1 to 1: 0.01 (basis in moles). In particular embodiments, capric acid and lauric acid are present in molar ratios of from about 0.1: 1 to about 1: 0.1, in particular from about 0.5: 1 to about 1: 0.5.

Other excipients include chelating agents, that is, compounds that remove metal ions from the solution by complexing with them, with the result that the absorption of the oligonucleotides through the digestive mucosa and other mucosa is enhanced. In relation to their use as penetration enhancers in the present invention, chelating agents have the added advantage that they also serve as DNase inhibitors, since most characterized DNA nucleases require a divalent metal ion for catalysis and for therefore they are inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315). Chelating agents of the invention include, but are not limited to, sodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (eg, salicylate, sodium 5-methoxysalicylate), N-acyl derivatives of collagen, derivatives of laureth-9 and N-aminoacyl of beta-diketones (enamines) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; Buur et al., J. Control Rel., 1990, 14, 43).

As used herein, non-chelating non-surfactant penetration enhancers can be defined as compounds that demonstrate negligible activity as chelating agents or as surfactants but, nevertheless, enhance the absorption of oligonucleotides through the digestive mucosa and other mucous membranes (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1). This class of penetration enhancers includes, but is not limited to, unsaturated cyclic ureas, 1-alkyl-and 1-alkenylzacyclocycloalkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin, and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621).

Agents that enhance oligonucleotide uptake at the cellular level may also be added to the pharmaceutical compositions and other compositions of the present invention. For example, cationic lipids such as lipofectin (Junichi et al., US Patent No. 5,705,188), cationic glycerol derivatives and polycationic molecules, such as polylysine (Lollo et al., PCT application WO) can be used 97/30731).

Some oral oligonucleotide compositions also incorporate vehicle compound in the formulation. As used herein, the "vehicle compound" or "vehicle" may refer to a nucleic acid or analog thereof, which may be inert (ie, has no biological activity by itself) or may be necessary for the transport, recognition, or activation or mediation pathway, or is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of nucleic acid that has biological activity, for example, by degrading biologically active nucleic acid or promoting its elimination from circulation . Co-administration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction in the amount of nucleic acid recovered in the liver, kidney or other extracirculatory deposits, presumably due to competition between the vehicle compound and nucleic acid by a common receptor. For example, the recovery of a partially phosphorothioate oligonucleotide in liver tissue can be reduced when co-administered with polyinosinic acid, dextran sulfate, polycytidic acid or 4acetamido-4'-isothiocyanyl-stilbene-2,2'-disulfonic acid (Miyao et al ., Antisense Res. Dev., 1995, 5, 5; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177).

A "pharmaceutical vehicle" or an "excipient" can be a pharmaceutically acceptable solvent, a suspending agent, or any other pharmacologically inert vehicle for supplying one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned administration form in mind, to provide volume, consistency, etc. desired, when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (eg, pregelatinized corn starch, polyvinylpyrrolidone or hydroxypropylmethylcellulose, etc.); fillers (eg, lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (eg, magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (eg, starch, sodium starch glycolate, EXPLOTAB); and wetting agents (eg, sodium lauryl sulfate, etc.).

Oral oligonucleotide compositions may additionally contain other auxiliary components conventionally found in pharmaceutical compositions, at their use levels established in the art. Thus, for example, the compositions may contain additional, compatible, pharmaceutically active materials such as, for example, antipruritic, astringent, local anesthetic or anti-inflammatory agents, or they may contain additional materials useful in the physical formulation of various pharmaceutical forms of the composition of the present invention, such as colorants, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents, and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. Further embodiments of the invention are described below:

one.

An antisense compound 8 to 50 nucleic bases in length, in which said compound specifically hybridizes with nucleotides 2920-3420 exposed in SEQ ID NO: 3 and inhibits the expression of mRNA encoding human apolipoprotein B after 16 to 24 h at least 30%, in HepG2 cells at 80% confluence in a culture at a concentration of 150 nM.

2.

 The antisense compound of embodiment 1, wherein said compound specifically hybridizes to nucleotides 3230-3288 set forth in SEQ ID NO: 3 and inhibits expression of the mRNA encoding human apolipoprotein B after 16 to 24 h in at least 30%, in HepG2 cells at 80% confluence in a culture at a concentration of 150 nM.

3.

 The antisense compound of embodiment 2, which is an antisense oligonucleotide.

Four.

The antisense compound of embodiment 3, wherein the antisense oligonucleotide is an oligonucleotide mimetic compound.

5.

 The antisense compound of embodiment 2, 12 to 30 nucleic bases in length.

6.

 The antisense compound of embodiment 5, 14 to 20 nucleic bases in length.

7.

The antisense compound of embodiment 4, wherein the oligonucleotide mimetic compound comprises at least one phosphorothioate bond.

8.

The antisense compound of embodiment 4, wherein the oligonucleotide mimetic compound comprises at least one 2'-O-methoxyethyl sugar moiety.

9.

The antisense compound of embodiment 4, wherein the oligonucleotide mimetic compound comprises at least one 5-methylcytosine.

10.

 The antisense compound of embodiment 2, wherein the antisense compound is a chimeric antisense compound.

eleven.

 The antisense compound of embodiment 10, wherein the chimeric antisense compound is a chimeric phosphorothioate antisense compound.

12.

 The antisense compound of embodiment 11, wherein the chimeric phosphorothioate antisense compound comprises 2'-methoxyethoxy-nucleotide wings and a 2'-deoxynucleotide gap.

13.

 The antisense compound of embodiment 12, wherein the chimeric phosphorothioate antisense compound comprises 10 2'-deoxynucleotides.

14.

 The antisense compound of any one of embodiments 1-13, wherein said antisense compound inhibits expression of the human apolipoprotein B encoding mRNA after 16 to 24 h by at least 50%, in HepG2 cells at 80% confluence. in culture at a concentration of 150 nM.

fifteen.

 The antisense compound of any one of embodiments 1-13, wherein the at least one nucleic base is covalently linked to a conjugate.

16.

 A composition comprising the antisense compound of any one of embodiments 1-13, and a pharmaceutically acceptable carrier or diluent.

17.

 The composition of embodiment 16, further comprising a colloidal dispersion system.

18.

 A composition comprising an antisense compound of any one of embodiments 1-13, hybridized to a complementary strand.

19.

 The composition of embodiment 18, wherein the hybridization of the antisense compound to the complementary strand forms at least one blunt end.

twenty.

 The composition of embodiment 19, wherein the hybridization of the antisense compound to the complementary strand forms at least two blunt ends.

twenty-one.

 An antisense oligonucleotide compound 8 to 50 nucleic bases in length, comprising at least 8 contiguous nucleotides of SEQ ID NO: 247.

22.

 The antisense oligonucleotide compound of embodiment 21, wherein the antisense oligonucleotide compound has a sequence comprising SEQ ID NO: 247.

2. 3.

 The antisense oligonucleotide compound of embodiment 22, 12 to 30 nucleic bases in length.

24.

 The antisense oligonucleotide compound of embodiment 23, 14-20 nucleic bases in length.

25.

 The antisense oligonucleotide compound of embodiment 24, wherein the antisense oligonucleotide compound has a sequence consisting of SEQ ID NO: 247.

26.

 The antisense oligonucleotide compound of embodiment 25, wherein the antisense oligonucleotide compound is an oligonucleotide mimetic compound.

27.

 The antisense oligonucleotide compound of embodiment 26, wherein the oligonucleotide mimetic compound is a chimeric phosphorothioate oligonucleotide compound.

28.

 The antisense oligonucleotide compound of embodiment 27, wherein the chimeric phosphorothioate oligonucleotide compound comprises 2'-methoxyethoxyl-nucleotide wings and a 2'-deoxynucleotide gap.

29.

 The antisense oligonucleotide compound of embodiment 28, wherein the chimeric phosphorothioate oligonucleotide compound comprises 10 2'-deoxynucleotides.

30.

 The antisense oligonucleotide compound of any one of embodiments 21-29, wherein the at least one oligonucleotide is covalently linked to a conjugate.

31.

A composition comprising the antisense oligonucleotide compound of any one of embodiments 21-29, and a pharmaceutically acceptable carrier or diluent.

32.

 The composition of embodiment 31, further comprising a colloidal dispersion system.

33.

 A composition comprising an oligonucleotide compound of any one of embodiments 22-29, hybridized to a complementary strand.

3. 4.

 The composition of embodiment 33, wherein the hybridization of the oligonucleotide compound with the chain

complementary forms at least one blunt end.

35.

 The composition of embodiment 34, wherein hybridization of the oligonucleotide compound with the complementary strand forms at least two blunt ends.

36.

 A method of inhibiting the expression of apolipoprotein B in cells or tissues, comprising contacting said cells or tissues with a compound of embodiment 2, under conditions such that the expression of apolipoprotein B is inhibited.

37.

 A method of inhibiting the expression of apolipoprotein B in cells or tissues, comprising contacting said cells or tissues with a compound of embodiment 21, under conditions such that the expression of apolipoprotein B is inhibited.

38.

 The method of embodiment 36 or embodiment 37, wherein the cells or tissues are contacted in vivo.

39.

 The method of embodiment 38, wherein said contacting comprises the step of administering the compound to an animal.

40.

 The method of embodiment 39, wherein the animal is a human.

41.

 The method of embodiment 40, wherein the human has a disease or condition associated with apolipoprotein B expression, and a therapeutically or prophylactically effective amount of the compound is administered.

42.

 The method of embodiment 41, wherein the human has a condition associated with abnormal lipid metabolism.

43.

 The method of embodiment 41, wherein the human has a condition associated with abnormal cholesterol metabolism.

44.

 The method of embodiment 41, wherein the human being has cardiovascular disease.

Four. Five.

 The method of embodiment 44, wherein the cardiovascular disease is atherosclerosis.

46.

 The method of embodiment 41, wherein the human being has an abnormal metabolic condition associated with apolipoprotein B expression.

47.

 The method of embodiment 46, wherein the abnormal metabolic condition is hyperlipidemia.

48.

 The method of embodiment 41, wherein the human being has diabetes.

49.

 The method of embodiment 41, wherein the human is obese.

fifty.

 The method of embodiment 40, wherein an effective amount of the compound is administered to prevent a disease or condition associated with apolipoprotein B expression.

51.

 The method of embodiment 40, wherein an effective amount of the compound is administered to delay a disease or condition associated with apolipoprotein B expression.

52.

 A method of preventing or delaying the onset of an increase in glucose levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of the compound of embodiment 1.

53.

 A method of preventing or delaying the onset of an increase in glucose levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of the compound of embodiment 22.

54.

 The method of embodiment 52 or embodiment 53, wherein the animal is a human.

55.

 The method of embodiment 54, wherein the glucose levels are serum or plasma glucose levels.

56.

 A method of modulating serum cholesterol levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of the compound of embodiment 1 or 21.

57.

 The method of embodiment 56, wherein the animal is a human.

58.

 A method of modulating lipoprotein levels in an animal, comprising administering to said animal a therapeutically or prophylactically effective amount of the compound of embodiment 1.

59.

 A method of modulating lipoprotein levels in an animal, which comprises administering to said animal

a therapeutically or prophylactically effective amount of the compound of embodiment 22.

60.

 The method of embodiment 58 or embodiment 59, wherein the animal is a human.

61.

 The method of embodiment 60, wherein the lipoprotein is VLDL.

62.

 The method of embodiment 60, wherein the lipoprotein is HDL.

63.

 The method of embodiment 60, wherein the lipoprotein is LDL.

64.

 The method of any one of embodiments 39, 52, 53, 56, 58 and 59, wherein the compound is administered intravenously.

65. The method of any one of embodiments 39, 52, 53, 56, 58 and 59, wherein the compound is administered subcutaneously.

66.

 A 20 nucleic length antisense oligonucleotide compound having a nucleic base sequence as set forth in SEQ ID NO: 247 and comprising 5-methylcytidine at nucleic bases 2, 3, 5, 9, 12, 15, 17 , 19 and 20, in which each internucleoside bond is a phosphorothioate bond, nucleic bases 1-5 and 16-20 comprise a 2'-methoxyethoxy modification, and nucleic bases 6-15 are deoxynucleotides.

67.

 The antisense oligonucleotide compound of embodiment 66, wherein an oligonucleotide is covalently linked to a conjugate.

68.

A composition comprising the antisense oligonucleotide compound of embodiment 66, and a pharmaceutically acceptable carrier or diluent.

69.

 The composition of embodiment 68, further comprising a colloidal dispersion system.

70.

 A composition comprising the antisense oligonucleotide compound of embodiment 66, hybridized to a complementary strand.

71.

 A method of inhibiting the expression of apolipoprotein B in cells or tissues, which comprises contacting said cells or tissues with a compound of embodiment 66, so that the expression of apolipoprotein B is inhibited.

72.

 The method of embodiment 72 or embodiment 71, wherein the cells or tissues are contacted in vivo.

73.

 The method of embodiment 72, wherein said contacting comprises the step of administering the compound to an animal.

74.

 The method of embodiment 73, wherein the animal is a human.

75.

 The method of embodiment 74, wherein the human has a disease or condition associated with apolipoprotein B expression, and a therapeutically or prophylactically effective amount of the compound is administered.

76.

 The method of embodiment 75, wherein the human has a condition associated with abnormal lipid metabolism.

77.

 The method of embodiment 75, wherein the human has a condition associated with abnormal cholesterol metabolism.

78.

 The method of embodiment 75, wherein the human being has cardiovascular disease.

79.

 The method of embodiment 78, wherein the cardiovascular disease is atherosclerosis.

80.

 The method of embodiment 75, wherein the human has an abnormal metabolic condition associated with apolipoprotein B expression.

81.

 The method of embodiment 80, wherein the abnormal metabolic condition is hyperlipidemia.

82.

 The method of embodiment 75, wherein the human being has diabetes.

83.

 The method of embodiment 75, wherein the human is obese.

84.

 The method of embodiment 74, wherein an effective amount of the compound is administered to prevent a disease or condition associated with apolipoprotein B expression.

85.

 The method of embodiment 74, wherein an effective amount of the compound is administered to delay a disease or condition associated with apolipoprotein B expression.

86.

 A method of preventing or delaying the onset of an increase in glucose levels in a human, comprising administering to said human a therapeutically or prophylactically effective amount of the compound of embodiment 66.

87.

 The method of embodiment 86, wherein the glucose levels are serum glucose levels.

88.

 The method of embodiment 86, wherein the glucose levels are plasma glucose levels.

89.

A method of modulating serum cholesterol levels in a human, comprising administering to said human a therapeutically or prophylactically effective amount of the compound of embodiment 66.

90.

A method of modulating lipoprotein levels in a human, comprising administering to said human a therapeutically or prophylactically effective amount of the compound of embodiment 66.

91.

 The method of embodiment 90, wherein the lipoprotein is VLDL.

92.

 The method of embodiment 90, wherein the lipoprotein is HDL.

93.

 The method of embodiment 90, wherein the lipoprotein is LDL.

94.

 The method of any one of embodiments 73-93, wherein the compound is administered intravenously.

95.

 The method of any one of embodiments 73-93, wherein the compound is administered subcutaneously.

96.

 The method of any one of embodiments 73-93, wherein the compound is administered orally.

97.

 A kit comprising a compound of any one of Embodiments 1-15, 21-30 and 66-67.

98.

 A compound comprising a first nucleic base chain hybridized to a second nucleic base chain, each chain 8 to 50 nucleic bases in length, said first nucleic base chain comprising a sequence of at least 8 contiguous nucleic bases of the exposed sequence in SEQ ID NO: 3, said second nucleic base chain comprising a sequence sufficiently complementary to said first chain to allow stable hybridization, said compound inhibiting the expression of human apolipoprotein B mRNA after 16 to 24 h in at least 30%, in HepG2 cells at 80% confluence in culture at a concentration of 100 nM.

99.

 The compound of embodiment 98, wherein the first strand comprises a sequence of 12 to 30 contiguous nucleic bases of the sequence set forth in SEQ ID NO: 3.

100.

 The compound of embodiment 98, wherein the first strand comprises a sequence of 20 contiguous nucleic bases of the sequence set forth in SEQ ID NO: 3.

101.

 The compound of embodiments 98, 99 or 100, wherein the second strand comprises a perfectly complementary sequence of at least 8 contiguous nucleic bases of the sequence set forth in SEQ ID NO: 3.

102.

 The compound of embodiment 101, wherein the second strand comprises a perfectly complementary sequence of 12 to 30 nucleic bases from the sequence set forth in SEQ ID NO: 3.

103.

 The compound of embodiment 101, wherein the second strand comprises a perfectly complementary sequence of 20 nucleic bases from the sequence set forth in SEQ ID NO: 3.

104.

 The compound of any of embodiments 98-103, wherein the at least one chain comprises RNA.

105.

 The compound of any one of embodiments 98-104, wherein the at least one chain comprises one or more deoxynucleosides.

106.

 The compound of any one of embodiments 98-105, wherein the hybridized chains form at least one protruding end.

107.

 The compound of embodiment 106, wherein the projecting end comprises at least one modified base.

108.

 The compound of any of embodiments 98-107, wherein said compound inhibits expression of the human apolipoprotein B encoding mRNA after 16 to 24 h by at least 50%, in HepG2 cells at 80% confluence in culture in a 100 nM concentration.

109.

 A vesicle comprising a compound of any one of embodiments 98-108.

110.

 The vesicle of embodiment 109, wherein the vesicle is a liposome.

111.

 A composition comprising the compound of any one of embodiments 98-108, and a pharmaceutically acceptable carrier or diluent.

112.

 The composition of embodiment 111, further comprising a colloidal dispersion system.

113.

 A method of inhibiting the expression of apolipoprotein B in cells or tissues, comprising contacting said cells or tissues with the compound of any one of embodiments 98-108, under conditions such that the expression of apolipoprotein B is inhibited.

114.

 The method of embodiment 113, wherein the cells or tissues are contacted in vivo.

115.

 The method of embodiment 114, wherein said contacting comprises the step of administering the compound to an animal.

116.

 The method of embodiment 115, wherein the animal is a human.

117.

 The method of embodiment 116, wherein the human has a condition associated with apolipoprotein B expression, and a therapeutically or prophylactically effective amount of the compound is administered.

118.

 The method of embodiment 117, wherein said condition is associated with abnormal lipid metabolism.

119.

 The method of embodiment 117, wherein said condition is associated with abnormal cholesterol metabolism.

120.

 The method of embodiment 117, wherein said condition is cardiovascular disease.

121.

 The method of embodiment 120, wherein the cardiovascular disease is atherosclerosis.

122.

 The method of embodiment 117, wherein said condition is an abnormal metabolic condition associated with apolipoprotein B expression.

123.

The method of embodiment 122, wherein the abnormal metabolic condition associated with apolipoprotein B expression is hyperlipidemia.

124.

 The method of embodiment 117, wherein the condition is diabetes.

125.

 The method of embodiment 117, wherein the condition is obesity.

126.

 The method of embodiment 116, wherein an effective amount of the compound is administered to prevent a condition associated with apolipoprotein B expression.

127.

 The method of embodiment 126, wherein an effective amount of the compound is administered to delay a condition associated with apolipoprotein B expression.

128.

 A method of reducing lipoprotein (a) secretion by hepatocytes, comprising:

(to)

 contacting hepatocytes with an amount of a composition comprising a non-catalytic compound 8 to 50 nucleic bases in length, which specifically hybridizes with the mRNA encoding human apolipoprotein B and inhibits mRNA expression after 16 to 24 h in at least 30%, in HepG2 cells at 80% confluence in culture at a concentration of 150 nM, in which said amount is effective to inhibit the expression of apolipoprotein B in hepatocytes; and

(b)

 measure the secretion of lipoprotein (a) by hepatocytes.

129.

 The method of embodiment 128, wherein the non-catalytic compound specifically hybridizes to nucleotides 3230-3288 set forth in SEQ ID NO: 3.

130.

The method of embodiment 129, wherein the non-catalytic compound comprises a nucleic base sequence as set forth in SEQ ID NO: 247.

131.

 The method of any of embodiments 128-130, wherein the non-catalytic compound is an antisense oligonucleotide mimetic.

132.

 A method of treating a condition associated with the expression of human apolipoprotein B in a primate, comprising administering to the primate a therapeutically or prophylactically effective amount of a non-catalytic compound of 8 to 50 nucleic bases in length that specifically hybridizes with mRNA encoding human apolipoprotein B and inhibits mRNA expression after 16 to 24 h by at least 30%, in HepG2 cells at 80% confluence in culture at a concentration of 150 nM.

133.

 The method of embodiment 132, wherein the primate is a human.

134.

 The method of embodiment 133, wherein the condition is selected from the group consisting of abnormal lipid metabolism, abnormal cholesterol metabolism, cardiovascular disease, hyperlipidemia, diabetes and obesity.

135.

 A method of reducing the expression of apolipoprotein B in the liver of an animal, which comprises administering to the animal between 2 mg / kg and 20 mg / kg of a non-catalytic compound 8 to 50 nucleic bases in length that specifically hybridizes with the MRNA encoding human apolipoprotein B at least 30%, in HepG2 cells at 80% confluence in cultures at a concentration of 150 nM.

136.

 The method of embodiment 135, wherein the compound is administered subcutaneously.

137.

 The method of embodiment 135, wherein the compound is administered intravenously.

138.

 The method of embodiment 135, wherein the compound is administered orally.

139.

 The method of any one of embodiments 135-138, wherein administration to the animal is repeated.

140.

 The method of any one of claims 135-139, wherein the animal is a human.

141.

 Use of a compound of any one of claims 1-15, 21-30, 66-67 and 98-108, in the production of a medicament.

142.

 Use of a compound of any one of claims 1-15, 21-30, 66-67 and 98-108, in a medicament for altering lipid metabolism.

143.

 Use of a compound of any one of claims 1-15, 21-30, 66-67 and 98-108, in a medicament for a disease or condition associated with apolipoprotein B expression.

144.

 A method of manufacturing a compound of any one of embodiments 98-108, which specifically hybridizes in vitro to a first nucleic base chain comprising a sequence of at least 8 contiguous nucleic bases of the sequence set forth in SEQ ID NO: 3 with a second nucleic base chain comprising a sequence sufficiently complementary to said first chain so as to allow stable hybridization.

SEQUENCE LIST

<110> Genzyme Corporation

<120> ANTI-SENSE MODULATION OF THE EXPRESSION OF APOLIPOPROTEIN B

<130> P055617EP

<150> US 60 / 426,234

<151>

<150> PCT / US03 / 015493

<151>

<150> PCT / US03 / 036411

<151>

<150> EP 03789763.4

<151>

<160> 892

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 1

tccgtcatcg ctcctcaggg 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 2

atgcattctg cccccaagga 20

<210> 3

<211> 14121

<212> DNA

<213> Homo sapiens

<220>

<221> CDS

<222> (129) .. (13820)

<400> 3

<210> 4 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> PCR primer

<400> 4

tgctaaaggc acatatggcc t

twenty-one

<210> 5 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> PCR primer

<400> 5

ctcaggttgg actctccatt gag

2. 3

<210> 6 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> PCR probe

<400> 6

cttgtcagag ggatcctaac actggccg

28

<210> 7 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> PCR primer

<400> 7

gaaggtgaag gtcggagtc

19

<210> 8 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> PCR primer

<400> 8

gaagatggtg atgggatttc

twenty

<210> 9 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> PCR probe

<400> 9

caagcttccc gttctcagcc

twenty

<210> 10 <211> 2354 <212> DNA <213> Mus musculus

<400> 10

<210> 11

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> PCR primer

<400> 11

cgtgggctcc agcattcta

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> PCR primer

<400> 12

agtcatttct gcctttgcgt c

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> PCR probe

<400> 13

ccaatggtcg ggcactgctc aa

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> PCR primer

<400> 14

ggcaaattca acggcacagt

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> PCR primer

<400> 15

gggtctcgct cctggaagat

<210> 16

<211> 27

<212> DNA

<213> Artificial Sequence

<220>

<223> PCR probe

<400> 16 aaggccgaga atgggaagct tgtcatc 27

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 17 ccgcaggtcc cggtgggaat 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 18 accgagaagg gcactcagcc 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 19 gcctcggcct cgcggccctg 20

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 20 tccatcgcca gctgcggtgg 20

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 21 cagcgccagc agcgccagca 20

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 22

gcccgccagc agcagcagca

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 23

cttgaatcag cagtcccagg

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 24

cttcagcaag gctttgccct

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 25

tttctgttgc cacattgccc

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 26

ggaagaggtg ttgctccttg

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 27 tgtgctacca tcccatactt

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 28 tcaaatgcga ggcccatctt

<210> 29

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 29 ggacacctca atcagctgtg

<210> 30

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 30 tcagggccac caggtaggtg

<210> 31

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 31 gtaatcttca tccccagtgc

<210> 32

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 32 tgctccatgg tttggcccat

<210> 33

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 33

gcagccagtc gcttatctcc

<210> 34

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 34

gtatagccaa agtggtccac

<210> 35

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 35

cccaggagct ggaggtcatg

<210> 36

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 36

ttgagccctt cctgatgacc

<210> 37

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 37

atctggaccc cactcctagc

<210> 38

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 38 cagacccgac tcgtggaaga

<210> 39

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 39 gccctcagta gattcatcat

<210> 40

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 40 gccatgccac cctcttggaa

<210> 41

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 41 aacccacgtg ccggaaagtc

<210> 42

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 42 actcccagat gccttctgaa

<210> 43

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 43 atgtggtaac gagcccgaag

<210> 44

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 44

ggcgtagaga cccatcacat

<210> 45

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 45

gtgttaggat ccctctgaca

<210> 46

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 46

cccagtgata gctctgtgag

<210> 47

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 47

atttcagcat atgagcccat

<210> 48

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 48

ccctgaacct tagcaacagt

<210> 49

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 49 gctgaagcca gcccagcgat

<210> 50

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 50 acagctgccc agtatgttct

<210> 51

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 51 cccaataaga tttataacaa

<210> 52

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 52 tggcctacca gagacaggta

<210> 53

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 53 tcatacgttt agcccaatct

<210> 54

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 54 gcatggtccc aaggatggtc

<210> 55

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 55

agtgatggaa gctgcgatac

<210> 56

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 56

atgagcatca tgcctcccag

<210> 57

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 57

gaacacatag ccgaatgccg

<210> 58

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 58

gtggtgccct ctaatttgta

<210> 59

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 59

cccgagaaag aaccgaaccc

<210> 60

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 60 tgccctgcag cttcactgaa

<210> 61

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 61 gaaatcccat aagctcttgt

<210> 62

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 62 agaagctgcc tcttcttccc

<210> 63

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 63 tcagggtgag ccctgtgtgt

<210> 64

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 64 ctaatggccc cttgataaac

<210> 65

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 65 acgttatcct tgagtccctg

<210> 66

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 66

tatatcccag gtttccccgg

<210> 67

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 67

acctgggaca gtaccgtccc

<210> 68

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 68

ctgcctactg caaggctggc

<210> 69

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 69

agagaccttc cgagccctgg

<210> 70

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 70

atgatacaca ataaagactc

<210> 71

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 71 attgtatgtg agaggtgagg

<210> 72

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 72 gaggagattg gatcttaagg

<210> 73

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 73 cttcaaattg ggactctcct

<210> 74

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 74 tccaggaatt gagcttgtgc

<210> 75

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 75 ttcaggactg gaggatgagg

<210> 76

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 76 tctcaccctc atgctccatt

<210> 77

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 77

tgactgtcaa gggtgagctg

<210> 78

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 78

gtccagccta ggaacactca

<210> 79

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 79

atgtcaatgc cacatgtcca

<210> 80

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 80

ttcatccgag aagttgggac

<210> 81

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 81

atttgggacg aatgtatgcc

<210> 82

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 82 20 agttgaggaa gccagattca

<210> 83

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 83 ttcccagtca gctttagtgg

<210> 84

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 84 agcttgcttg ttgggcacgg

<210> 85

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 85 cctatactgg cttctatgtt

<210> 86

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 86 tgaactccgt gtaaggcaag

<210> 87

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 87

gagaaatcct tcagtaaggg

<210> 88

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 88

caatggaatg cttgtcactg

<210> 89

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 89

gcttcattat aggaggtggt

<210> 90

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 90

acaactggga tagtgtagcc

<210> 91

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 91

gttaggacca gggattgtga

<210> 92

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 92

accatggaaa actggcaact

<210> 93

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 93 tgggaggaaa aacttgaata

<210> 94

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 94 tgggcaacga tatctgattg

<210> 95

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 95 ctgcagggcg tcagtgacaa

<210> 96

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 96 gcatcagacg tgatgttccc

<210> 97

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 97 cttggttaaa ctaatggtgc

<210> 98

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 98

atgggagcat ggaggttggc

<210> 99

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 99

aatggatgat gaaacagtgg

<210> 100

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 100

atcaatgcct cctgttgcag

<210> 101

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 101

ggaagtgaga ctttctaagc

<210> 102

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 102

aggaaggaac tcttgatatt

<210> 103

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 103

attggcttca ttggcaacac

<210> 104

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 104 aggtgaggaa gttggaattc

<210> 105

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 105 ttgttccctg aagttgttac

<210> 106

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 106 gttcatggat tccttcagga

<210> 107

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 107 atgctccatt ctcacatgct

<210> 108

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 108 tgcgactgtg tctgatttcc

<210> 109

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 109

gtccctgaag atgtcaatgc

<210> 110

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 110

aggcccagtt ccatgaccct

<210> 111

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 111

ggagcccacg tgctgagatt

<210> 112

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 112

cgtccttgag cagtgcccga

<210> 113

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 113

cccatatgga gaaatccttc

<210> 114

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 114

catgcctgga agccagtgtc

<210> 115

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 115 gtgttgaatc ccttgaaatc

<210> 116

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 116 ggtaaagttg cccatggctg

<210> 117

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 117 gttataaagt ccagcattgg

<210> 118

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 118 catcagacgt gatgttccct

<210> 119

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 119 tggctagttt caatcccctt

<210> 120

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 120

ctgtcatgac tgccctttac

<210> 121

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 121

gcttgaagtt cattgagaat

<210> 122

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 122

ttcctgagaa aggaaggaac

<210> 123

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 123

tcagatatac attggcttca

<210> 124

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 124

ttcctcttcg gccctggcgc

<210> 125

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 125

ctccactgga actctcagcc

<210> 126

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 126 cctccagctc aaccttgcag

<210> 127

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 127 gggttgaagc catacacctc

<210> 128

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 128 ccagcttgag ctcatacctg

<210> 129

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 129 ccctcttgat gttcaggatg

<210> 130

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 130 gagcagtttc catacacggt

<210> 131

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 131

cccttcctcg tcttgacggt

<210> 132

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 132

ttgaagcgat cacactgccc

<210> 133

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 133

gcctttgatg agagcaagtg

<210> 134

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 134

tcctcttagc gtccagtgtg

<210> 135

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 135

cctctcagct cagtaaccag

<210> 136

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 136

gcactgaggc tgtccacact

<210> 137

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 137 cgctgatccc tcgccatgtt

<210> 138

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 138 gttgaccgcg tggctcagcg

<210> 139

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 139 gcagctcctg ggtccctgta

<210> 140

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 140 cccatggtag aatttggaca

<210> 141

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 141 aatctcgatg aggtcagctg

<210> 142

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 142

gacaccatca ggaacttgac

<210> 143

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 143

gctcctctcc caagatgcgg

<210> 144

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 144

ggcacccatc agaagcagct

<210> 145

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 145

agtccggaat gatgatgccc

<210> 146

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 146

ctgagcagct tgactggtct

<210> 147

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 147

cccggtcagc ggatagtagg

<210> 148

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 148 tgtcacaact taggtggccc

<210> 149

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 149 gtctggcaat cccatgttct

<210> 150

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 150 cccacagact tgaagtggag

<210> 151

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 151 gaactgccca tcaatcttga

<210> 152

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 152 20 cccagagagg ccaagctctg

<210> 153

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 153

tgtgttccct gaagcggcca

<210> 154

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 154 acccagaatc atggcctgat

<210> 155

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 155 ggtgcctgtc tgctcagctg

<210> 156

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 156 atgtgaaact tgtctctccc

<210> 157

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 157 tatgtctgca gttgagatag

<210> 158

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 158 ttgaatccag gatgcagtac

<210> 159

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 159 gagtctctga gtcacctcac

<210> 160

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 160 gatagaatat tgctctgcaa

<210> 161

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 161 cccttgctct accaatgctt

<210> 162

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 162 tccattccct atgtcagcat

<210> 163

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 163 gactccttca gagccagcgg

<210> 164

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 164

cccatgctcc gttctcaggt

<210> 165

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 165

cgcaggtcag cctgactaga

<210> 166

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 166

cagttagaac actgtggccc

<210> 167

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 167

cagtgtgatg acacttgatt

<210> 168

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 168

ctgtggctaa cttcaatccc

<210> 169

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 169

cagtactgtt atgactaccc

<210> 170

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 170 cactgaagac cgtgtgctct

<210> 171

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 171 tcgtactgtg ctcccagagg

<210> 172

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 172 aagaggccct ctagctgtaa

<210> 173

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 173 aagacccaga atgaatccgg

<210> 174

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 174 gtctacctca aagcgtgcag

<210> 175

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 175

tagaggctaa cgtaccatct

<210> 176

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 176

ccatatccat gcccacggtg

<210> 177

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 177

agtttcctca tcagattccc

<210> 178

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 178

cccagtggta cttgttgaca

<210> 179

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 179

cccagtggtg ccactggctg

<210> 180

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 180

gtcaacagtt cctggtacag

<210> 181

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 181 ccctagtgta tatcccaggt

<210> 182

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 182 ctgaagatta cgtagcacct

<210> 183

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 183 gtccagccaa ctatacttgg

<210> 184

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 184 cctggagcaa gcttcatgta

<210> 185

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 185 tggacagacc aggctgacat

<210> 186

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 186

atgtgtactt ccggaggtgc

<210> 187

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 187

tcttcaggat gaagctgcag

<210> 188

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 188 tcagcaaggc tttgccctca

<210> 189

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 189

ctgcttccct tctggaatgg

<210> 190

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 190

tgccacattg cccttcctcg

<210> 191

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 191

gctgatcaga gttgacaagg

<210> 192

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 192 tactgacagg actggctgct

<210> 193

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 193 gatggcttct gccacatgct

<210> 194

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 194 gatgtggatt tggtgctctc

<210> 195

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 195 tgactgcttc atcactgagg

<210> 196

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 196 ggtaggtgac cacatctatc

<210> 197

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 197

tcgcagctgc tgtgctgagg

<210> 198

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 198

ttccaatgac ccgcagaatc

<210> 199

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 199

gatcatcagt gatggctttg

<210> 200

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 200

agcctggatg gcagctttct

<210> 201

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 201

gtctgaagaa gaacctcctg

<210> 202

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 202

tatctgcctg tgaaggactc

<210> 203

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 203 ctgagttcaa gatattggca

<210> 204

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 204 cttccaagcc aatctcgatg

<210> 205

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 205 tgcaactgta atccagctcc

<210> 206

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 206 ccagttcagc ctgcatgttg

<210> 207

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 207 gtagagacca aatgtaatgt

<210> 208

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 208

cgttggagta agcgcctgag

<210> 209

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 209

cagctctaat ctggtgtccc

<210> 210

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 210

ctgtcctctc tctggagctc

<210> 211

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 211

caaggtcata ctctgccgat

<210> 212

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 212

gtatggaaat aacacccttg

<210> 213

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 213

taagctgtag cagatgagtc

<210> 214

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 214 tagatctctg gaggatttgc

<210> 215

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 215 gtctagaaca cccaggagag

<210> 216

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 216 accacagagt cagccttcat

<210> 217

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 217 aagcagacat ctgtggtccc

<210> 218

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 218 ctctccattg agccggccag

<210> 219

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 219

cctgatattc agaacgcagc

<210> 220

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 220

cagtgcctaa gatgtcagca

<210> 221

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 221

agcaccagga gactacactt

<210> 222

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 222

cccatccaga ctgaattttg

<210> 223

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 223

ggttctagcc gtagtttccc

<210> 224

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 224

aggttaccag ccacatgcag

<210> 225

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 225 atgtgcatcg atggtcatgg

<210> 226

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 226 ccagagagcg agtttcccat

<210> 227

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 227 ctagacacga gatgatgact

<210> 228

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 228 tccaagtcct ggctgtattc

<210> 229

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 229 cgtccagtaa gctccacgcc

<210> 230

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 230

tcaacggcat ctctcatctc

<210> 231

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 231

tgatagtgct catcaagact

<210> 232

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 232

gattctgatt tggtacttag

<210> 233

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 233

ctctcgatta actcatggac

<210> 234

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 234

atacactgca actgtggcct

<210> 235

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 235

gcaagagtcc accaatcaga

<210> 236

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 236 agagcctgaa gactgacttc

<210> 237

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 237 tccctcatct gagaatctgg

<210> 238

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 238 cagtgcatca atgacagatg

<210> 239

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 239 ccgaaccctt gacatctcct

<210> 240

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 240 gcctcactag caatagttcc

<210> 241

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 241

gacatttgcc atggagagag

<210> 242

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 242

ctgtctccta ccaatgctgg

<210> 243

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 243

tctgcactga agtcacggtg

<210> 244

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 244

tcccggaccc tcaactcagt

<210> 245

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 245

gcaggtccag ttcatatgtg

<210> 246

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 246

gccatccttc tgagttcaga

<210> 247

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 247 gcctcagtct gcttcgcacc

<210> 248

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 248 ccccgcaggt cccggtggga

<210> 249

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 249 cagccccgca ggtcccggtg

<210> 250

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 250 caaccgagaa gggcactcag

<210> 251

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 251 cctcagcggc agcaaccgag

<210> 252

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 252

tcctcagcgg cagcaaccga

<210> 253

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 253

ctcctcagcg gcagcaaccg

<210> 254

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 254

ggctcctcag cggcagcaac

<210> 255

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 255

ggcgggctcc tcagcggcag

<210> 256

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 256

ggtccatcgc cagctgcggt

<210> 257

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 257

ggcgggtcca tcgccagctg

<210> 258

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 258 tagaggatga tagtaagttc

<210> 259

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 259 aaatgaagat ttcttttaaa

<210> 260

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 260 tatgtgaaag ttcaattgga

<210> 261

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 261 atataggcag tttgaatttt

<210> 262

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 262 gctcactgta tggttttatc

<210> 263

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 263

ggctcactgt atggttttat

<210> 264

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 264

ggctggctca ctgtatggtt

<210> 265

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 265

aggctggctc actgtatggt

<210> 266

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 266

aaggctggct cactgtatgg

<210> 267

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 267

ctactgcaag gctggctcac

<210> 268

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 268

actgcctact gcaaggctgg

<210> 269

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 269 tgcttatagt ctactgccta

<210> 270

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 270 ttctgcttat agtctactgc

<210> 271

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 271 tttggtgcag gtccagttca

<210> 272

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 272 cagctttggt gcaggtccag

<210> 273

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 273 gccagctttg gtgcaggtcc

<210> 274

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 274

tggtgccagc tttggtgcag

<210> 275

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 275

gccctggtgc cagctttggt

<210> 276

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 276

gagttcagag accttccgag

<210> 277

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 277

aaatgccatc cttctgagtt

<210> 278

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 278

aaaaatgcca tccttctgag

<210> 279

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 279

aaaataactc agatcctgat

<210> 280

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 280 agcaaaataa ctcagatcct

<210> 281

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 281 agtttagcaa aataactcag

<210> 282

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 282 tcccccaagt ttagcaaaat

<210> 283

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 283 ttcctcctcc cccaagttta

<210> 284

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 284 agactccatt tatttgttcc

<210> 285

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 285

cttctgcttg agttacaaac

<210> 286

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 286 20

accttctgct tgagttacaa

<210> 287

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 287 20

gcaccttctg cttgagttac

<210> 288

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 288 20

tcgcaccttc tgcttgagtt

<210> 289

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 289 20

cttcgcacct tctgcttgag

<210> 290

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 290

tgcttcgcac cttctgcttg

<210> 291

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 291 tctgcttcgc accttctgct

<210> 292

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 292 agtctgcttc gcaccttctg

<210> 293

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 293 tcagtctgct tcgcaccttc

<210> 294

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 294 cctcagtctg cttcgcacct

<210> 295

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 295 agcctcagtc tgcttcgcac

<210> 296

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 296

gtagcctcag tctgcttcgc

<210> 297

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 297

tggtagcctc agtctgcttc

<210> 298

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 298

catggtagcc tcagtctgct

<210> 299

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 299

gtcatggtag cctcagtctg

<210> 300

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 300

atgtcatggt agcctcagtc

<210> 301

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 301

gaatgtcatg gtagcctcag

<210> 302

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 302 ttgaatgtca tggtagcctc

<210> 303

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 303 atttgaatgt catggtagcc

<210> 304

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 304 atatttgaat gtcatggtag

<210> 305

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 305 cagccacatg cagcttcagg

<210> 306

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 306 accagccaca tgcagcttca

<210> 307

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 307

ttaccagcca catgcagctt

<210> 308

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 308

ggttaccagc cacatgcagc

<210> 309

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 309

taggttacca gccacatgca

<210> 310

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 310

tttaggttac cagccacatg

<210> 311

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 311

cttttaggtt accagccaca

<210> 312

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 312

tccttttagg ttaccagcca

<210> 313

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 313

gctcctttta ggttaccagc

<210> 314

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 314

aggctccttt taggttacca

<210> 315

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 315

gtaggctcct tttaggttac

<210> 316

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 316

tggtaggctc cttttaggtt

<210> 317

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 317

tttggtaggc tccttttagg

<210> 318

<211> 13993

<212> DNA

<213> H. sapiens

<220>

<221> CDS

<222> (1) .. (13692)

<400> 318

5

<210> 319 <211> 20 <212> DNA <213> Artificial Sequence

10

<220> <223> Antisense Oligonucleotide <400> 319

gcctcagtct gcttcgcgcc

twenty

fifteen

<210> 320 <211> 20 <212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 320 gctcactgtt cagcatctgg

<210> 321

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 321 tgagaatctg ggcgaggccc

<210> 322

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 322 gtccttcata tttgccatct

<210> 323

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 323 cctccctcat gaacatagtg

<210> 324

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 324 gacgtcagaa cctatgatgg

<210> 325

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 325

tgagtgagtc aatcagcttc

<210> 326

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 326

gccttctgct tgagttacaa

<210> 327

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 327

gcgccttctg cttgagttac

<210> 328

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 328

tcgcgccttc tgcttgagtt

<210> 329

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 329

cttcgcgcct tctgcttgag

<210> 330

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 330

agtctgcttc gcgccttctg

<210> 331

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 331 tcagtctgct tcgcgccttc 20

<210> 332

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 332 cctcagtctg cttcgcgcct 20

<210> 333

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 333 agcctcagtc tgcttcgcgc 20

<210> 334

<211> 43445

<212> DNA

<213> H. sapiens

<400> 334

<210> 335

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 335

tctgtaagac aggagaaaga 20

<210> 336

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 336

atttcctctt ctgtaagaca 20

<210> 337

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 337

gatgccttac ttggacagac

<210> 338

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 338

agaaatagct ctcccaagga

<210> 339

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 339

gtcgcatctt ctaacgtggg

<210> 340

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 340

tcctccatac cttgcagttg

<210> 341

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

* <400> 341

tggctcatgt ctaccatatt

<210> 342

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 342 cagttgaaat gcagctaatg

<210> 343

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 343 tgcagactag gagtgaaagt

<210> 344

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 344 aggaggatgt ccttttattg

<210> 345

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 345 atcagagcac caaagggaat

<210> 346

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 346 ccagctcaac ctgagaattc

<210> 347

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 347 catgacttac ctggacatgg

<210> 348

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 348

cctcagcgga cacacacaca

<210> 349

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 349

gtcacatccg tgcctggtgc

<210> 350

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 350

cagtgcctct gggaccccac

<210> 351

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 351

agctgcagtg gccgatcagc

<210> 352

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 352

gacctcccca gccacgtgga

<210> 353

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 353 tctgatcacc atacattaca

<210> 354

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 354 atttcccact gggtactctc

<210> 355

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 355 20 ggctgaagcc catgctgact

<210> 356

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 356 20 gttggacagt cattcttttg

<210> 357

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 357 20 cacttgttgg acagtcattc

<210> 358

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 358 attttaaatt acagtagata

<210> 359

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 359

ctgttctcca cccatatcag

<210> 360

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 360

gagctcatac ctgtcccaga

<210> 361

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 361

ttcaagggcc actgctatca

<210> 362

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 362

ccagtatttc acgccaatcc

<210> 363

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 363

ggcaggagga acctcgggca

<210> 364

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 364 ttttaaaatt agacccaacc

<210> 365

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 365 tgactgtttt aaaattagac

<210> 366

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 366 cccagcaaac acaggtgaag

<210> 367

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 367 gagtgtggtc ttgctagtgc

<210> 368

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 368 ctatgcagag tgtggtcttg

<210> 369

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 369 agaagatgca accacatgta

<210> 370

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 370

acacggtatc ctatggagga

<210> 371

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 371

tgggacttac catgcctttg

<210> 372

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 372

ggttttgctg ccctacatcc

<210> 373

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 373

acaaggagtc cttgtgcaga

<210> 374

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 374

atgttcactg agacaggctg

<210> 375

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 375 gaaggtccat ggttcatctg

<210> 376

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 376 attagactgg aagcatcctg

<210> 377

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 377 gagattggag acgagcattt

<210> 378

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 378 catgacctac ttgtaggaga

<210> 379

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 379 tggatttgga tacacaagtt

<210> 380

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 380 actcaatata tattcattga

<210> 381

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 381

caaggaagca caccatgtca

<210> 382

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 382

atacttattc ctggtaacca

<210> 383

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 383

ggtagccaga acaccagtgt

<210> 384

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 384

actagaggta gccagaacac

<210> 385

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 385

accacctgac atcacaggtt

<210> 386

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 386 tactgtgacc tatgccagga

<210> 387

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 387 ggaggtgcta ctgttgacat

<210> 388

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 388 tccagacttg tctgagtcta

<210> 389

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 389 tctaagaggt agagctaaag

<210> 390

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 390 ccagagatga gcaacttagg

<210> 391

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 391 ggccatgtaa attgctcatc

<210> 392

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 392

aaagaaacta tcctgtattc

<210> 393

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 393

ttcttagtac ctggaagatg

<210> 394

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 394

cattagatac ctggacacct

<210> 395

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 395

gtttcatgga actcagcgca

<210> 396

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 396

ctggagagca cctgcaatag

<210> 397

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 397 tgaagggtag agaaatcata

<210> 398

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 398 ggaaactcac ttgttgaccg

<210> 399

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 399 aggtgcaaga tgttcctctg

<210> 400

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 400 tgcacagagg tgcaagatgt

<210> 401

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 401 cacaagagta aggagcagag

<210> 402

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 402 gatggatggt gagaaattac

<210> 403

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 403

tagacaattg agactcagaa

<210> 404

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 404

atgtgcacac aaggacatag

<210> 405

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 405

acatacaaat ggcaataggc

<210> 406

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 406

taggcaaagg acatgaatag

<210> 407

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 407

ttatgatagc tacagaataa

<210> 408

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 408 ctgagattac ccgcagaatc

<210> 409

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 409 gatgtatgtc atataaaaga

<210> 410

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 410 tttccaatga cctgcattga

<210> 411

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 411 agggatggtc aatctggtag

<210> 412

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 412 ggctaataaa tagggtagtt

<210> 413

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 413 tcctagagca ctatcaagta

<210> 414

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 414

cctcctggtc ctgcagtcaa

<210> 415

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 415

catttgcaca agtgtttgtt

<210> 416

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 416

ctgacacacc atgttattat

<210> 417

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 417

ctttttcaga ctagataaga

<210> 418

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 418

tcacacttac ctcgatgagg

<210> 419

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 419 aagaaaatgg catcaggttt

<210> 420

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 420 ccaagccaat ctgagaaaga

<210> 421

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 421 aaatacacac ctgctcatgt

<210> 422

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 422 cttcacaaat acacacctgc

<210> 423

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 423 agtggaagtt tggtctcatt

<210> 424

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 424 ttgctagctt caaagtggaa

<210> 425

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 425

tcaagaataa gctccagatc

<210> 426

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 426

gcatacaagt cacatgaggt

<210> 427

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 427

tacaaggtgt ttcttaagaa

<210> 428

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 428

atgcagccag gatgggccta

<210> 429

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 429

ttaccatatc ctgagagttt

<210> 430

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 430 gcaaaggtag aggaaggtat

<210> 431

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 431 aaggaccttc agcaaaggta

<210> 432

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 432 cataggagta catttatata

<210> 433

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 433 attatgataa aatcaatttt

<210> 434

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 434 agaaatttca ctagatagat

<210> 435

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 435 agcatatttt gatgagctga

<210> 436

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 436

gaaaggaagg actagcatat

<210> 437

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 437

cctctccaat ctgtagaccc

<210> 438

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 438

ctggataact cagacctttg

<210> 439

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 439

agtcagaaaa caacctattc

<210> 440

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 440

cagcctgcat ctataagtca

<210> 441

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 441 aaagaattac cctccactga

<210> 442

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 442 tctttcaaac tggctaggca

<210> 443

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 443 gcctggcaaa attctgcagg

<210> 444

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 444 ctacctcaaa tcaatatgtt

<210> 445

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 445 tgctttacct acctagctac

<210> 446

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 446 accttgtgtg tctcactcaa

<210> 447

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 447

atgcattccc tgactagcac

<210> 448

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 448

catctctgag ccccttacca

<210> 449

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 449

gctgggcatg ctctctcccc

<210> 450

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 450

gctttcgcag ctgggcatgc

<210> 451

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 451

actcctttct atacctggct

<210> 452

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 452 attctgcctc ttagaaagtt

<210> 453

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 453 ccaagcctct ttactgggct

<210> 454

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 454 cactcatgac cagactaaga

<210> 455

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 455 acctcccaga agccttccat

<210> 456

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 456 ttcatatgaa atctcctact

<210> 457

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 457

tatttaattt actgagaaac

<210> 458

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 458

taatgtgttg ctggtgaaga

<210> 459

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 459

catctctaac ctggtgtccc

<210> 460

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 460

gtgccatgct aggtggccat

<210> 461

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 461

agcaaattgg gatctgtgct

<210> 462

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 462

tctggaggct cagaaacatg

<210> 463

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 463 tgaagacagg gagccaccta

<210> 464

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 464 aggattccca agactttgga

<210> 465

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 465 cagctctaat ctaaagacat

<210> 466

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 466 gaatactcac cttctgcttg

<210> 467

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 467 atctctctgt cctcatcttc

<210> 468

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 468

ccaactcccc ctttctttgt

<210> 469

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 469

tctgggccag gaagacacga

<210> 470

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 470

tattgtgtgc tgggcactgc

<210> 471

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 471

tgcttcgcac ctggacgagt

<210> 472

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 472

ccttctttac cttaggtggc

<210> 473

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 473

gctctctctg ccactctgat

<210> 474

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 474 aacttctaaa gccaacattc

<210> 475

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 475 tgtgtcacaa ctatggtaaa

<210> 476

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 476 agacacatac cataatgcca

<210> 477

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 477 ttctcttcat ctgaaaatac

<210> 478

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 478 tgaggatgta attagcactt

<210> 479

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 479

agctcattgc ctacaaaatg

<210> 480

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 480

gttctcatgt ttactaatgc

<210> 481

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 481

gaattgagac aacttgattt

<210> 482

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 482

ccggccatcg ctgaaatgaa

<210> 483

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 483

catagctcac cttgcacatt

<210> 484

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 484

cggtgcaccc tttacctgag

<210> 485

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 485 tctccagatc ctaacataaa

<210> 486

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 486 ttgaatgaca ctagattttc

<210> 487

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 487 aaaatccatt ttctttaaag

<210> 488

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 488 cagctcacac ttattttaaa

<210> 489

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 489 gttcccaaaa ctgtatagga

<210> 490

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 490

agctccatac tgaagtcctt

<210> 491

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 491 caattcaata aaagctccat

<210> 492

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 492 gttttcaaaa ggtataaggt

<210> 493

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 493 ttcccattcc ctgaaagcag

<210> 494

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 494 tggtatttac ctgagggctg

<210> 495

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 495 ataaataata gtgctgatgg

<210> 496

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 496 ctatggctga gcttgcctat

<210> 497

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 497 ctctctgaaa aatataccct

<210> 498

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 498 ttgatgtatc tcatctagca

<210> 499

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 499 tagaaccatg tttggtcttc

<210> 500

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 500 tttctcttta tcacatgccc

<210> 501

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 501

tatagtacac taaaacttca

twenty

5

<210> 502 <211> 20 <212> DNA <213> Artificial Sequence

10

<220> <223> Antisense Oligonucleotide

<400> 502

fifteen

ctggagagga ctaaacagag twenty

twenty

<210> 503 <211> 568 <212> DNA <213> H. sapiens

25

<220> <221> feature_misc <222> 44, 99, 156, 468 <223> n = A, T, C or G

<400> 503

30 35

<210> 504 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense Oligonucleotide

40

<400> 504 acattttatc aatgccctcg twenty

Four. Five

<210> 505 <211> 20 <212> DNA <213> Artificial Sequence

fifty

<220> <223> Antisense Oligonucleotide <400> 505

gccagaacat tttatcaatg

<210> 506

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 506

agaggttttg ctgtgccaga

<210> 507

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 507

ctagaggttt tgctgtgcca

<210> 508

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 508

tctagaggtt ttgctgtgcc

<210> 509

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 509

aatcacacta tgtgttctag

<210> 510

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 510

aaatcacact atgtgttcta

<210> 511

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 511 taaatcacac tatgtgttct

<210> 512

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 512 cttaaatcac actatgtgtt

<210> 513

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 513 tattctgtta cttaaatcac

<210> 514

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 514 tggtagcctc agtctgcttc

<210> 515

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 515 agtctgcttc gcgccttctg

<210> 516

<211> 20

<212> DNA

<213> H. sapiens

<400> 516 gcgccagggc cgaagaggaa

<210> 517

<211> 20

<212> DNA

<213> H. sapiens

<400> 517

caggtatgag ctcaagctgg

<210> 518

<211> 20

<212> DNA

<213> H. sapiens

<400> 518

catcctgaac atcaagaggg

<210> 519

<211> 20

<212> DNA

<213> H. sapiens

<400> 519

gggcagtgtg atcgcttcaa

<210> 520

<211> 20

<212> DNA

<213> H. sapiens

<400> 520

cacttgctct catcaaaggc

<210> 521

<211> 20

<212> DNA

<213> H. sapiens

<400> 521

cacactggac gctaagagga

<210> 522

<211> 20

<212> DNA

<213> H. sapiens

<400> 522

cgctgagcca cgcggtcaac

<210> 523

<211> 20

<212> DNA

<213> H. sapiens

<400> 523

tgtccaaatt ctaccatggg

<210> 524

<211> 20

<212> DNA

<213> H. sapiens

<400> 524 cagctgacct catcgagatt

<210> 525

<211> 20

<212> DNA

<213> H. sapiens

<400> 525 gtcaagttcc tgatggtgtc

<210> 526

<211> 20

<212> DNA

<213> H. sapiens

<400> 526 agctgcttct gatgggtgcc

<210> 527

<211> 20

<212> DNA

<213> H. sapiens

<400> 527 gggcatcatc attccggact

<210> 528

<211> 20

<212> DNA

<213> H. sapiens

<400> 528 cctactatcc gctgaccggg

<210> 529

<211> 20

<212> DNA

<213> H. sapiens

<400> 529 gggccaccta agttgtgaca

<210> 530

<211> 20

<212> DNA

<213> H. sapiens

<400> 530 agaacatggg attgccagac

<210> 531

<211> 20

<212> DNA

<213> H. sapiens

<400> 531

ctccacttca agtctgtggg

<210> 532

<211> 20

<212> DNA

<213> H. sapiens

<400> 532 cagagcttgg cctctctggg

<210> 533

<211> 20

<212> DNA

<213> H. sapiens

<400> 533 tggccgcttc agggaacaca

<210> 534

<211> 20

<212> DNA

<213> H. sapiens

<400> 534 cagctgagca gacaggcacc

<210> 535

<211> 20

<212> DNA

<213> H. sapiens

<400> 535 gggagagaca agtttcacat

<210> 536

<211> 20

<212> DNA

<213> H. sapiens

<400> 536 gtactgcatc ctggattcaa

<210> 537

<211> 20

<212> DNA

<213> H. sapiens

<400> 537 gtgaggtgac tcagagactc

<210> 538

<211> 20

<212> DNA

<213> H. sapiens

<400> 538 ttgcagagca atattctatc

<210> 539

<211> 20

<212> DNA

<213> H. sapiens

<400> 539

aagcattggt agagcaaggg

<210> 540

<211> 20

<212> DNA

<213> H. sapiens

<400> 540

ccgctggctc tgaaggagtc

<210> 541

<211> 20

<212> DNA

<213> H. sapiens

<400> 541

tctagtcagg ctgacctgcg

<210> 542

<211> 20

<212> DNA

<213> H. sapiens

<400> 542

gggccacagt gttctaactg

<210> 543

<211> 20

<212> DNA

<213> H. sapiens

<400> 543

aatcaagtgt catcacactg

<210> 544

<211> 20

<212> DNA

<213> H. sapiens

<400> 544

gggtagtcat aacagtactg

<210> 545

<211> 20

<212> DNA

<213> H. sapiens

<400> 545

agagcacacg gtcttcagtg

<210> 546

<211> 20

<212> DNA

<213> H. sapiens

<400> 546 ttacagctag agggcctctt

<210> 547

<211> 20

<212> DNA

<213> H. sapiens

<400> 547 caccgtgggc atggatatgg

<210> 548

<211> 20

<212> DNA

<213> H. sapiens

<400> 548 gggaatctga tgaggaaact

<210> 549

<211> 20

<212> DNA

<213> H. sapiens

<400> 549 tgtcaacaag taccactggg

<210> 550

<211> 20

<212> DNA

<213> H. sapiens

<400> 550 acctgggata tacactaggg

<210> 551

<211> 20

<212> DNA

<213> H. sapiens

<400> 551 ccaagtatag ttggctggac

<210> 552

<211> 20

<212> DNA

<213> H. sapiens

<400> 552 tacatgaagc ttgctccagg

<210> 553

<211> 20

<212> DNA

<213> H. sapiens

<400> 553

atgtcagcct ggtctgtcca

<210> 554

<211> 20

<212> DNA

<213> H. sapiens

<400> 554 gcacctccgg aagtacacat

<210> 555

<211> 20

<212> DNA

<213> H. sapiens

<400> 555 ctgcagcttc atcctgaaga

<210> 556

<211> 20

<212> DNA

<213> H. sapiens

<400> 556 tgagggcaaa gccttgctga

<210> 557

<211> 20

<212> DNA

<213> H. sapiens

<400> 557 ccattccaga agggaagcag

<210> 558

<211> 20

<212> DNA

<213> H. sapiens

<400> 558 cgaggaaggg caatgtggca

<210> 559

<211> 20

<212> DNA

<213> H. sapiens

<400> 559 ccttgtcaac tctgatcagc

<210> 560

<211> 20

<212> DNA

<213> H. sapiens

<400> 560 agcagccagt cctgtcagta

<210> 561

<211> 20

<212> DNA

<213> H. sapiens

<400> 561

agcatgtggc agaagccatc

<210> 562

<211> 20

<212> DNA

<213> H. sapiens

<400> 562

gagagcacca aatccacatc

<210> 563

<211> 20

<212> DNA

<213> H. sapiens

<400> 563

cctcagtgat gaagcagtca

<210> 564

<211> 20

<212> DNA

<213> H. sapiens

<400> 564

gatagatgtg gtcacctacc

<210> 565

<211> 20

<212> DNA

<213> H. sapiens

<400> 565

cctcagcaca gcagctgcga

<210> 566

<211> 20

<212> DNA

<213> H. sapiens

<400> 566

gattctgcgg gtcattggaa

<210> 567

<211> 20

<212> DNA

<213> H. sapiens

<400> 567

caaagccatc actgatgatc

<210> 568

<211> 20

<212> DNA

<213> H. sapiens

<400> 568 agaaagctgc catccaggct

<210> 569

<211> 20

<212> DNA

<213> H. sapiens

<400> 569 caggaggttc ttcttcagac

<210> 570

<211> 20

<212> DNA

<213> H. sapiens

<400> 570 gagtccttca caggcagata

<210> 571

<211> 20

<212> DNA

<213> H. sapiens

<400> 571 tgccaatatc ttgaactcag

<210> 572

<211> 20

<212> DNA

<213> H. sapiens

<400> 572 catcgagatt ggcttggaag

<210> 573

<211> 20

<212> DNA

<213> H. sapiens

<400> 573 ggagctggat tacagttgca

<210> 574

<211> 20

<212> DNA

<213> H. sapiens

<400> 574 caacatgcag gctgaactgg

<210> 575

<211> 20

<212> DNA

<213> H. sapiens

<400> 575

acattacatt tggtctctac

<210> 576

<211> 20

<212> DNA

<213> H. sapiens

<400> 576 ctcaggcgct tactccaacg

<210> 577

<211> 20

<212> DNA

<213> H. sapiens

<400> 577 gggacaccag attagagctg

<210> 578

<211> 20

<212> DNA

<213> H. sapiens

<400> 578 gagctccaga gagaggacag

<210> 579

<211> 20

<212> DNA

<213> H. sapiens

<400> 579 atcggcagag tatgaccttg

<210> 580

<211> 20

<212> DNA

<213> H. sapiens

<400> 580 caagggtgtt atttccatac

<210> 581

<211> 20

<212> DNA

<213> H. sapiens

<400> 581 gactcatctg ctacagctta

<210> 582

<211> 20

<212> DNA

<213> H. sapiens

<400> 582 gcaaatcctc cagagatcta

<210> 583

<211> 20

<212> DNA

<213> H. sapiens

<400> 583

ctctcctggg tgttctagac

<210> 584

<211> 20

<212> DNA

<213> H. sapiens

<400> 584 20

atgaaggctg actctgtggt

<210> 585

<211> 20

<212> DNA

<213> H. sapiens

<400> 585

gggaccacag atgtctgctt

<210> 586

<211> 20

<212> DNA

<213> H. sapiens

<400> 586

ctggccggct caatggagag

<210> 587

<211> 20

<212> DNA

<213> H. sapiens

<400> 587

gctgcgttct gaatatcagg

<210> 588

<211> 20

<212> DNA

<213> H. sapiens

<400> 588

tgctgacatc ttaggcactg

<210> 589

<211> 20

<212> DNA

<213> H. sapiens

<400> 589 20

aagtgtagtc tcctggtgct

<210> 590

<211> 20

<212> DNA

<213> H. sapiens

<400> 590 20 caaaattcag tctggatggg

<210> 591

<211> 20

<212> DNA

<213> H. sapiens

<400> 591 gggaaactac ggctagaacc

<210> 592

<211> 20

<212> DNA

<213> H. sapiens

<400> 592 ctgcatgtgg ctggtaacct

<210> 593

<211> 20

<212> DNA

<213> H. sapiens

<400> 593 ccatgaccat cgatgcacat

<210> 594

<211> 20

<212> DNA

<213> H. sapiens

<400> 594 atgggaaact cgctctctgg

<210> 595

<211> 20

<212> DNA

<213> H. sapiens

<400> 595 agtcatcatc tcgtgtctag

<210> 596

<211> 20

<212> DNA

<213> H. sapiens

<400> 596 gaatacagcc aggacttgga

<210> 597

<211> 20

<212> DNA

<213> H. sapiens

<400> 597

ggcgtggagc ttactggacg

<210> 598

<211> 20

<212> DNA

<213> H. sapiens

<400> 598 gagatgagag atgccgttga

<210> 599

<211> 20

<212> DNA

<213> H. sapiens

<400> 599 agtcttgatg agcactatca

<210> 600

<211> 20

<212> DNA

<213> H. sapiens

<400> 600 ctaagtacca aatcagaatc

<210> 601

<211> 20

<212> DNA

<213> H. sapiens

<400> 601 gtccatgagt taatcgagag

<210> 602

<211> 20

<212> DNA

<213> H. sapiens

<400> 602 aggccacagt tgcagtgtat

<210> 603

<211> 20

<212> DNA

<213> H. sapiens

<400> 603 tctgattggt ggactcttgc

<210> 604

<211> 20

<212> DNA

<213> H. sapiens

<400> 604 gaagtcagtc ttcaggctct

<210> 605

<211> 20

<212> DNA

<213> H. sapiens

<400> 605

ccagattctc agatgaggga

<210> 606

<211> 20

<212> DNA

<213> H. sapiens

<400> 606

catctgtcat tgatgcactg

<210> 607

<211> 20

<212> DNA

<213> H. sapiens

<400> 607

aggagatgtc aagggttcgg

<210> 608

<211> 20

<212> DNA

<213> H. sapiens

<400> 608

ggaactattg ctagtgaggc

<210> 609

<211> 20

<212> DNA

<213> H. sapiens

<400> 609

ctctctccat ggcaaatgtc

<210> 610

<211> 20

<212> DNA

<213> H. sapiens

<400> 610

caccgtgact tcagtgcaga

<210> 611

<211> 20

<212> DNA

<213> H. sapiens

<400> 611

actgagttga gggtccggga

<210> 612

<211> 20

<212> DNA

<213> H. sapiens

<400> 612

cacatatgaa ctggacctgc

<210> 613

<211> 20

<212> DNA

<213> H. sapiens

<400> 613

tctgaactca gaaggatggc

<210> 614

<211> 20

<212> DNA

<213> H. sapiens

<400> 614

ggtgcgaagc agactgaggc

<210> 615

<211> 20

<212> DNA

<213> H. sapiens

<400> 615

tcccaccggg acctgcgggg

<210> 616

<211> 20

<212> DNA

<213> H. sapiens

<400> 616 20

caccgggacc tgcggggctg

<210> 617

<211> 20

<212> DNA

<213> H. sapiens

<400> 617

ctgagtgccc ttctcggttg

<210> 618

<211> 20

<212> DNA

<213> H. sapiens

<400> 618

ctcggttgct gccgctgagg

<210> 619

<211> 20

<212> DNA

<213> H. sapiens

<400> 619 tcggttgctg ccgctgagga

<210> 620

<211> 20

<212> DNA

<213> H. sapiens

<400> 620 cggttgctgc cgctgaggag

<210> 621

<211> 20

<212> DNA

<213> H. sapiens

<400> 621 gttgctgccg ctgaggagcc

<210> 622

<211> 20

<212> DNA

<213> H. sapiens

<400> 622 ctgccgctga ggagcccgcc

<210> 623

<211> 20

<212> DNA

<213> H. sapiens

<400> 623 accgcagctg gcgatggacc

<210> 624

<211> 20

<212> DNA

<213> H. sapiens

<400> 624 cagctggcga tggacccgcc

<210> 625

<211> 20

<212> DNA

<213> H. sapiens

<400> 625 gaacttacta tcatcctcta

<210> 626

<211> 20

<212> DNA

<213> H. sapiens

<400> 626 tccaattgaa ctttcacata

<210> 627

<211> 20

<212> DNA

<213> H. sapiens

<400> 627

aaaattcaaa ctgcctatat

<210> 628

<211> 20

<212> DNA

<213> H. sapiens

<400> 628

gataaaacca tacagtgagc

<210> 629

<211> 20

<212> DNA

<213> H. sapiens

<400> 629

ataaaaccat acagtgagcc

<210> 630

<211> 20

<212> DNA

<213> H. sapiens

<400> 630

aaccatacag tgagccagcc

<210> 631

<211> 20

<212> DNA

<213> H. sapiens

<400> 631

accatacagt gagccagcct

<210> 632

<211> 20

<212> DNA

<213> H. sapiens

<400> 632

ccatacagtg agccagcctt

<210> 633

<211> 20

<212> DNA

<213> H. sapiens

<400> 633

gtgagccagc cttgcagtag

<210> 634

<211> 20

<212> DNA

<213> H. sapiens

<400> 634

ccagccttgc agtaggcagt

<210> 635

<211> 20

<212> DNA

<213> H. sapiens

<400> 635

taggcagtag actataagca

<210> 636

<211> 20

<212> DNA

<213> H. sapiens

<400> 636

gcagtagact ataagcagaa

<210> 637

<211> 20

<212> DNA

<213> H. sapiens

<400> 637

tgaactggac ctgcaccaaa

<210> 638

<211> 20

<212> DNA

<213> H. sapiens

<400> 638

ctggacctgc accaaagctg

<210> 639

<211> 20

<212> DNA

<213> H. sapiens

<400> 639

ggacctgcac caaagctggc

<210> 640

<211> 20

<212> DNA

<213> H. sapiens

<400> 640

ctgcaccaaa gctggcacca

<210> 641

<211> 20

<212> DNA

<213> H. sapiens

<400> 641 accaaagctg gcaccagggc

<210> 642

<211> 20

<212> DNA

<213> H. sapiens

<400> 642 ctcggaaggt ctctgaactc

<210> 643

<211> 20

<212> DNA

<213> H. sapiens

<400> 643 aactcagaag gatggcattt

<210> 644

<211> 20

<212> DNA

<213> H. sapiens

<400> 644 ctcagaagga tggcattttt

<210> 645

<211> 20

<212> DNA

<213> H. sapiens

<400> 645 atcaggatct gagttatttt

<210> 646

<211> 20

<212> DNA

<213> H. sapiens

<400> 646 aggatctgag ttattttgct

<210> 647

<211> 20

<212> DNA

<213> H. sapiens

<400> 647 ctgagttatt ttgctaaact

<210> 648

<211> 20

<212> DNA

<213> H. sapiens

<400> 648 attttgctaa acttggggga

<210> 649

<211> 20

<212> DNA

<213> H. sapiens

<400> 649

taaacttggg ggaggaggaa

<210> 650

<211> 20

<212> DNA

<213> H. sapiens

<400> 650

ggaacaaata aatggagtct

<210> 651

<211> 20

<212> DNA

<213> H. sapiens

<400> 651

gtttgtaact caagcagaag

<210> 652

<211> 20

<212> DNA

<213> H. sapiens

<400> 652

ttgtaactca agcagaaggt

<210> 653

<211> 20

<212> DNA

<213> H. sapiens

<400> 653

gtaactcaag cagaaggtgc

<210> 654

<211> 20

<212> DNA

<213> H. sapiens

<400> 654

aactcaagca gaaggtgcga

<210> 655

<211> 20

<212> DNA

<213> H. sapiens

<400> 655

ctcaagcaga aggtgcgaag

<210> 656

<211> 20

<212> DNA

<213> H. sapiens

<400> 656

caagcagaag gtgcgaagca

<210> 657

<211> 20

<212> DNA

<213> H. sapiens

<400> 657

agcagaaggt gcgaagcaga

<210> 658

<211> 20

<212> DNA

<213> H. sapiens

<400> 658

cagaaggtgc gaagcagact

<210> 659

<211> 20

<212> DNA

<213> H. sapiens

<400> 659

gaaggtgcga agcagactga

<210> 660

<211> 20

<212> DNA

<213> H. sapiens

<400> 660

aggtgcgaag cagactgagg

<210> 661

<211> 20

<212> DNA

<213> H. sapiens

<400> 661

gtgcgaagca gactgaggct

<210> 662

<211> 20

<212> DNA

<213> H. sapiens

<400> 662

gcgaagcaga ctgaggctac

<210> 663

<211> 20

<212> DNA

<213> H. sapiens

<400> 663 gaagcagact gaggctacca

<210> 664

<211> 20

<212> DNA

<213> H. sapiens

<400> 664 agcagactga ggctaccatg

<210> 665

<211> 20

<212> DNA

<213> H. sapiens

<400> 665 cagactgagg ctaccatgac

<210> 666

<211> 20

<212> DNA

<213> H. sapiens

<400> 666 gactgaggct accatgacat

<210> 667

<211> 20

<212> DNA

<213> H. sapiens

<400> 667 ctgaggctac catgacattc

<210> 668

<211> 20

<212> DNA

<213> H. sapiens

<400> 668 gaggctacca tgacattcaa

<210> 669

<211> 20

<212> DNA

<213> H. sapiens

<400> 669 ggctaccatg acattcaaat

<210> 670

<211> 20

<212> DNA

<213> H. sapiens

<400> 670 ctaccatgac attcaaatat

<210> 671

<211> 20

<212> DNA

<213> H. sapiens

<400> 671

cctgaagctg catgtggctg

<210> 672

<211> 20

<212> DNA

<213> H. sapiens

<400> 672

tgaagctgca tgtggctggt

<210> 673

<211> 20

<212> DNA

<213> H. sapiens

<400> 673

aagctgcatg tggctggtaa

<210> 674

<211> 20

<212> DNA

<213> H. sapiens

<400> 674

gctgcatgtg gctggtaacc

<210> 675

<211> 20

<212> DNA

<213> H. sapiens

<400> 675 20

tgcatgtggc tggtaaccta

<210> 676

<211> 20

<212> DNA

<213> H. sapiens

<400> 676

catgtggctg gtaacctaaa

<210> 677

<211> 20

<212> DNA

<213> H. sapiens

<400> 677

tgtggctggt aacctaaaag

<210> 678

<211> 20

<212> DNA

<213> H. sapiens

<400> 678

tggctggtaa cctaaaagga

<210> 679

<211> 20

<212> DNA

<213> H. sapiens

<400> 679

gctggtaacc taaaaggagc

<210> 680

<211> 20

<212> DNA

<213> H. sapiens

<400> 680

tggtaaccta aaaggagcct

<210> 681

<211> 20

<212> DNA

<213> H. sapiens

<400> 681

gtaacctaaa aggagcctac

<210> 682

<211> 20

<212> DNA

<213> H. sapiens

<400> 682

aacctaaaag gagcctacca

<210> 683

<211> 20

<212> DNA

<213> H. sapiens

<400> 683

cctaaaagga gcctaccaaa

<210> 684

<211> 20

<212> DNA

<213> H. sapiens

<400> 684

ggcgcgaagc agactgaggc

<210> 685

<211> 20

<212> DNA

<213> H. sapiens

<400> 685 cactatgttc atgagggagg

<210> 686

<211> 20

<212> DNA

<213> H. sapiens

<400> 686 ccatcatagg ttctgacgtc

<210> 687

<211> 20

<212> DNA

<213> H. sapiens

<400> 687 gaagctgatt gactcactca

<210> 688

<211> 20

<212> DNA

<213> H. sapiens

<400> 688 ttgtaactca agcagaaggc

<210> 689

<211> 20

<212> DNA

<213> H. sapiens

<400> 689 gtaactcaag cagaaggcgc

<210> 690

<211> 20

<212> DNA

<213> H. sapiens

<400> 690 aactcaagca gaaggcgcga

<210> 691

<211> 20

<212> DNA

<213> H. sapiens

<400> 691 ctcaagcaga aggcgcgaag

<210> 692

<211> 20

<212> DNA

<213> H. sapiens

<400> 692 cagaaggcgc gaagcagact

<210> 693

<211> 20

<212> DNA

<213> H. sapiens

<400> 693

gaaggcgcga agcagactga

<210> 694

<211> 20

<212> DNA

<213> H. sapiens

<400> 694

aggcgcgaag cagactgagg

<210> 695

<211> 20

<212> DNA

<213> H. sapiens

<400> 695

gcgcgaagca gactgaggct

<210> 696

<211> 20

<212> DNA

<213> H. sapiens

<400> 696

gaagcagact gaggctacca

<210> 697

<211> 20

<212> DNA

<213> H. sapiens

<400> 697

cagaaggcgc gaagcagact

<210> 698

<211> 20

<212> DNA

<213> H. sapiens

<400> 698

tctttctcct gtcttacaga

<210> 699

<211> 20

<212> DNA

<213> H. sapiens

<400> 699

cccacgttag aagatgcgac

<210> 700

<211> 20

<212> DNA

<213> H. sapiens

<400> 700

aatatggtag acatgagcca

<210> 701

<211> 20

<212> DNA

<213> H. sapiens

<400> 701

cattagctgc atttcaactg

<210> 702

<211> 20

<212> DNA

<213> H. sapiens

<400> 702

actttcactc ctagtctgca

<210> 703

<211> 20

<212> DNA

<213> H. sapiens

<400> 703

ccatgtccag gtaagtcatg

<210> 704

<211> 20

<212> DNA

<213> H. sapiens

<400> 704

gcaccaggca cggatgtgac

<210> 705

<211> 20

<212> DNA

<213> H. sapiens

<400> 705

gtggggtccc agaggcactg

<210> 706

<211> 20

<212> DNA

<213> H. sapiens

<400> 706

gctgatcggc cactgcagct

<210> 707

<211> 20

<212> DNA

<213> H. sapiens

<400> 707 tccacgtggc tggggaggtc

<210> 708

<211> 20

<212> DNA

<213> H. sapiens

<400> 708 tgtaatgtat ggtgatcaga

<210> 709

<211> 20

<212> DNA

<213> H. sapiens

<400> 709 gagagtaccc agtgggaaat

<210> 710

<211> 20

<212> DNA

<213> H. sapiens

<400> 710 agtcagcatg ggcttcagcc

<210> 711

<211> 20

<212> DNA

<213> H. sapiens

<400> 711 caaaagaatg actgtccaac

<210> 712

<211> 20

<212> DNA

<213> H. sapiens

<400> 712 gaatgactgt ccaacaagtg

<210> 713

<211> 20

<212> DNA

<213> H. sapiens

<400> 713 tatctactgt aatttaaaat

<210> 714

<211> 20

<212> DNA

<213> H. sapiens

<400> 714 ctgatatggg tggagaacag

<210> 715

<211> 20

<212> DNA

<213> H. sapiens

<400> 715

tctgggacag gtatgagctc

<210> 716

<211> 20

<212> DNA

<213> H. sapiens

<400> 716

tgatagcagt ggcccttgaa

<210> 717

<211> 20

<212> DNA

<213> H. sapiens

<400> 717

ggattggcgt gaaatactgg

<210> 718

<211> 20

<212> DNA

<213> H. sapiens

<400> 718 20

tgcccgaggt tcctcctgcc

<210> 719

<211> 20

<212> DNA

<213> H. sapiens

<400> 719

gcactagcaa gaccacactc

<210> 720

<211> 20

<212> DNA

<213> H. sapiens

<400> 720

caagaccaca ctctgcatag

<210> 721

<211> 20

<212> DNA

<213> H. sapiens

<400> 721

tcctccatag gataccgtgt

<210> 722

<211> 20

<212> DNA

<213> H. sapiens

<400> 722

ggatgtaggg cagcaaaacc

<210> 723

<211> 20

<212> DNA

<213> H. sapiens

<400> 723

tctgcacaag gactccttgt

<210> 724

<211> 20

<212> DNA

<213> H. sapiens

<400> 724

cagcctgtct cagtgaacat

<210> 725

<211> 20

<212> DNA

<213> H. sapiens

<400> 725 20

caggatgctt ccagtctaat

<210> 726

<211> 20

<212> DNA

<213> H. sapiens

<400> 726

aaatgctcgt ctccaatctc

<210> 727

<211> 20

<212> DNA

<213> H. sapiens

<400> 727

aacttgtgta tccaaatcca

<210> 728

<211> 20

<212> DNA

<213> H. sapiens

<400> 728 20

tgacatggtg tgcttccttg

<210> 729

<211> 20

<212> DNA

<213> H. sapiens

<400> 729 20 acactggtgt tctggctacc

<210> 730

<211> 20

<212> DNA

<213> H. sapiens

<400> 730 gtgttctggc tacctctagt

<210> 731

<211> 20

<212> DNA

<213> H. sapiens

<400> 731 tcctggcata ggtcacagta

<210> 732

<211> 20

<212> DNA

<213> H. sapiens

<400> 732 atgtcaacag tagcacctcc

<210> 733

<211> 20

<212> DNA

<213> H. sapiens

<400> 733 tagactcaga caagtctgga

<210> 734

<211> 20

<212> DNA

<213> H. sapiens

<400> 734 cctaagttgc tcatctctgg

<210> 735

<211> 20

<212> DNA

<213> H. sapiens

<400> 735 tgcgctgagt tccatgaaac

<210> 736

<211> 20

<212> DNA

<213> H. sapiens

<400> 736 ctattgcagg tgctctccag

<210> 737

<211> 20

<212> DNA

<213> H. sapiens

<400> 737

cagaggaaca tcttgcacct

<210> 738

<211> 20

<212> DNA

<213> H. sapiens

<400> 738

ctctgctcct tactcttgtg

<210> 739

<211> 20

<212> DNA

<213> H. sapiens

<400> 739

gtaatttctc accatccatc

<210> 740

<211> 20

<212> DNA

<213> H. sapiens

<400> 740

ttctgagtct caattgtcta

<210> 741

<211> 20

<212> DNA

<213> H. sapiens

<400> 741

ctatgtcctt gtgtgcacat

<210> 742

<211> 20

<212> DNA

<213> H. sapiens

<400> 742

gcctattgcc atttgtatgt

<210> 743

<211> 20

<212> DNA

<213> H. sapiens

<400> 743

ctattcatgt cctttgccta

<210> 744

<211> 20

<212> DNA

<213> H. sapiens

<400> 744

gattctgcgg gtaatctcag

<210> 745

<211> 20

<212> DNA

<213> H. sapiens

<400> 745

tcaatgcagg tcattggaaa

<210> 746

<211> 20

<212> DNA

<213> H. sapiens

<400> 746

ctaccagatt gaccatccct

<210> 747

<211> 20

<212> DNA

<213> H. sapiens

<400> 747

tacttgatag tgctctagga

<210> 748

<211> 20

<212> DNA

<213> H. sapiens

<400> 748

ttgactgcag gaccaggagg

<210> 749

<211> 20

<212> DNA

<213> H. sapiens

<400> 749

aacaaacact tgtgcaaatg

<210> 750

<211> 20

<212> DNA

<213> H. sapiens

<400> 750

aatgagacca aacttccact

<210> 751

<211> 20

<212> DNA

<213> H. sapiens

<400> 751 ttccactttg aagctagcaa

<210> 752

<211> 20

<212> DNA

<213> H. sapiens

<400> 752 gatctggagc ttattcttga

<210> 753

<211> 20

<212> DNA

<213> H. sapiens

<400> 753 acctcatgtg acttgtatgc

<210> 754

<211> 20

<212> DNA

<213> H. sapiens

<400> 754 ttcttaagaa acaccttgta

<210> 755

<211> 20

<212> DNA

<213> H. sapiens

<400> 755 taggcccatc ctggctgcat

<210> 756

<211> 20

<212> DNA

<213> H. sapiens

<400> 756 aaactctcag gatatggtaa

<210> 757

<211> 20

<212> DNA

<213> H. sapiens

<400> 757 ataccttcct ctacctttgc

<210> 758

<211> 20

<212> DNA

<213> H. sapiens

<400> 758 tacctttgct gaaggtcctt

<210> 759

<211> 20

<212> DNA

<213> H. sapiens

<400> 759

atctatctag tgaaatttct

<210> 760

<211> 20

<212> DNA

<213> H. sapiens

<400> 760

tcagctcatc aaaatatgct

<210> 761

<211> 20

<212> DNA

<213> H. sapiens

<400> 761

atatgctagt ccttcctttc

<210> 762

<211> 20

<212> DNA

<213> H. sapiens

<400> 762

caaaggtctg agttatccag

<210> 763

<211> 20

<212> DNA

<213> H. sapiens

<400> 763

tgacttatag atgcaggctg

<210> 764

<211> 20

<212> DNA

<213> H. sapiens

<400> 764

tcagtggagg gtaattcttt

<210> 765

<211> 20

<212> DNA

<213> H. sapiens

<400> 765

tgcctagcca gtttgaaaga

<210> 766

<211> 20

<212> DNA

<213> H. sapiens

<400> 766

cctgcagaat tttgccaggc

<210> 767

<211> 20

<212> DNA

<213> H. sapiens

<400> 767

gtagctaggt aggtaaagca

<210> 768

<211> 20

<212> DNA

<213> H. sapiens

<400> 768

ttgagtgaga cacacaaggt

<210> 769

<211> 20

<212> DNA

<213> H. sapiens

<400> 769

gtgctagtca gggaatgcat

<210> 770

<211> 20

<212> DNA

<213> H. sapiens

<400> 770

ggggagagag catgcccagc

<210> 771

<211> 20

<212> DNA

<213> H. sapiens

<400> 771

gcatgcccag ctgcgaaagc

<210> 772

<211> 20

<212> DNA

<213> H. sapiens

<400> 772

agccaggtat agaaaggagt

<210> 773

<211> 20

<212> DNA

<213> H. sapiens

<400> 773 aactttctaa gaggcagaat

<210> 774

<211> 20

<212> DNA

<213> H. sapiens

<400> 774 tcttagtctg gtcatgagtg

<210> 775

<211> 20

<212> DNA

<213> H. sapiens

<400> 775 agtaggagat ttcatatgaa

<210> 776

<211> 20

<212> DNA

<213> H. sapiens

<400> 776 tcttcaccag caacacatta

<210> 777

<211> 20

<212> DNA

<213> H. sapiens

<400> 777 atggccacct agcatggcac

<210> 778

<211> 20

<212> DNA

<213> H. sapiens

<400> 778 catgtttctg agcctccaga

<210> 779

<211> 20

<212> DNA

<213> H. sapiens

<400> 779 taggtggctc cctgtcttca

<210> 780

<211> 20

<212> DNA

<213> H. sapiens

<400> 780 tccaaagtct tgggaatcct

<210> 781

<211> 20

<212> DNA

<213> H. sapiens

<400> 781

acaaagaaag ggggagttgg

<210> 782

<211> 20

<212> DNA

<213> H. sapiens

<400> 782

tcgtgtcttc ctggcccaga

<210> 783

<211> 20

<212> DNA

<213> H. sapiens

<400> 783

gcagtgccca gcacacaata

<210> 784

<211> 20

<212> DNA

<213> H. sapiens

<400> 784

actcgtccag gtgcgaagca

<210> 785

<211> 20

<212> DNA

<213> H. sapiens

<400> 785

gccacctaag gtaaagaagg

<210> 786

<211> 20

<212> DNA

<213> H. sapiens

<400> 786

atcagagtgg cagagagagc

<210> 787

<211> 20

<212> DNA

<213> H. sapiens

<400> 787

tttaccatag ttgtgacaca

<210> 788

<211> 20

<212> DNA

<213> H. sapiens

<400> 788

cattttgtag gcaatgagct

<210> 789

<211> 20

<212> DNA

<213> H. sapiens

<400> 789

gcattagtaa acatgagaac

<210> 790

<211> 20

<212> DNA

<213> H. sapiens

<400> 790

ttcatttcag cgatggccgg

<210> 791

<211> 20

<212> DNA

<213> H. sapiens

<400> 791

gaaaatctag tgtcattcaa

<210> 792

<211> 20

<212> DNA

<213> H. sapiens

<400> 792

tcctatacag ttttgggaac

<210> 793

<211> 20

<212> DNA

<213> H. sapiens

<400> 793

aaggacttca gtatggagct

<210> 794

<211> 20

<212> DNA

<213> H. sapiens

<400> 794

atggagcttt tattgaattg

<210> 795

<211> 20

<212> DNA

<213> H. sapiens

<400> 795 ccatcagcac tattatttat

<210> 796

<211> 20

<212> DNA

<213> H. sapiens

<400> 796 ataggcaagc tcagccatag

<210> 797

<211> 20

<212> DNA

<213> H. sapiens

<400> 797 tgctagatga gatacatcaa

<210> 798

<211> 20

<212> DNA

<213> H. sapiens

<400> 798 gaagaccaaa catggttcta

<210> 799

<211> 20

<212> DNA

<213> H. sapiens

<400> 799 ctctgtttag tcctctccag

<210> 800

<211> 20

<212> DNA

<213> H. sapiens

<400> 800 cattgataaa atgttctggc

<210> 801

<211> 20

<212> DNA

<213> H. sapiens

<400> 801 tctggcacag caaaacctct

<210> 802

<211> 20

<212> DNA

<213> H. sapiens

<400> 802 tggcacagca aaacctctag

<210> 803

<211> 20

<212> DNA

<213> H. sapiens

<400> 803

tagaacacat agtgtgattt

<210> 804

<211> 20

<212> DNA

<213> H. sapiens

<400> 804

aacacatagt gtgatttaag

<210> 805

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 805

ctttccgttg gacccctggg

<210> 806

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 806

tcccgcctgt gacatgcatt

<210> 807

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 807

ttctacctcg cgcgatttac

<210> 808

<211> 432

<212> DNA

<213> O. cuniculus

<400> 808

<210> 809

<211> 660

<212> DNA

<213> O. cuniculus

<400> 809

<210> 810 15 <211> 543

<212> DNA

<213> O. cuniculus

<220>

20 <221> misc_feature

<222> (45)

<223> n = a, c, g, or t

<220>

25 <221> misc_feature

<222> (118)

<223> n = a, c, g, or t

<220>

30 <221> misc_feature

<222> (148)

<223> n = a, c, g, or t

<220>

35 <221> misc_feature

<222> (173)

<223> n = a, c, g, or t

<220>

40 <221> misc_feature

<222> (180)

<223> n = a, c, g, or t

<400>

 810

<400>

 814 tgcttggaga aggtaagatc

10

<210> 811 <211> 19 <212> DNA <213> Artificial Sequence

fifteen

<220> <223> Primer <400> 811

aagcaccccc aatgtcacc

19

twenty

<210> 812 <211> 20 <212> DNA <213> Artificial Sequence

25

<220> <223> Primer

<400> 812

30

gggatggcag agccaatgta twenty

35

<210> 813 <211> 29 <212> DNA <213> Artificial Sequence

<220> <223> Probe

40

<400> 813

tcctggattc aagcttctat gtgccttca

29

Four. Five

<210> 814 <211> 20 <212> DNA <213> Artificial Sequence

fifty

<220> <223> Antisense Oligonucleotide

<210> 815

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 815 gcgttgtctc cgatgttctg

<210> 816

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 816 taatcattaa cttgctgtgg

<210> 817

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 817 tcagcacgta gcaatgcatt

<210> 818

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 818 gcctgatact cagcacgtag

<210> 819

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 819 caattgaatg tactcagata

<210> 820

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 820

acctcagtga cttgtaatca

<210> 821

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 821

cactggaaac ttgtctctcc

<210> 822

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 822

agtagttagt ttctccttgg

<210> 823

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 823

tcagtgccca agatgtcagc

<210> 824

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 824

attggaataa tgtatccagg

<210> 825

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 825 ttggcattat ccaatgcagt

<210> 826

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 826 gttgccttgt gagcagcagt

<210> 827

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 827 attgtgagtg gagatacttc

<210> 828

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 828 catatgtctg aagttgagac

<210> 829

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 829 gtagatactc cattttggcc

<210> 830

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 830 ggatcacatg actgaatgct

<210> 831

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 831

tcaagctggt tgttgcactg

<210> 832

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 832

ggactgtacc tcaagctggt

<210> 833

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 833

gctcattctc cagcatcagg

<210> 834

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 834

ttgatctata atactagcta

<210> 835

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 835

atggaagact ggcagctcta

<210> 836

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 836 ttgtgttcct tgaagcggcc

<210> 837

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 837 tgtgcacgga tatgataacg

<210> 838

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 838 gaccttgagt agattcctgg

<210> 839

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 839 gaaatctgga agagagacct

<210> 840

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 840 gtagctttcc catctaggct

<210> 841

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 841 gataactctg tgagggtagc

<210> 842

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 842

atgttgccca tggctggaat

<210> 843

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 843

aagatgcagt actacttcca

<210> 844

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 844

gcacccagaa tcatggcctg

<210> 845

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 845

cttgatactt ggtatccaca

<210> 846

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 846

cagtgtaatg atcgttgatt

<210> 847

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 847 taaagtccag cattggtatt

<210> 848

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 848 caacaatgtc tgattggtta

<210> 849

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 849 gaagaggaag aaaggatatg

<210> 850

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 850 tgacagatga agaggaagaa

<210> 851

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 851 ttgtactgta gtgcatcaat

<210> 852

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 852 gcctcaatct gttgtttcag

<210> 853

<211> 20

<212> DNA <213> Artificial Sequence

5

<220> <223> Antisense Oligonucleotide

<400> 853

10 15

acttgagcgt gccctctaat <210> 854 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense Oligonucleotide twenty

twenty

<400> 854 gaaatggaat tgtagttctc

twenty

25

<210> 855 <211> 479 <212> DNA <213> M. fascicularis

30

<220> <221> misc_characteristic <222> (7) <223> n = A, T, C or G

35

<220> <221> misc_characteristic <222> (469) .. (474) <223> n = A, T, C or G

40

<220> <221> misc_characteristic <222> (476) .. (479) <223> n = A, T, C or G

<400> 855

<210> 856

<211> 20

<212> DNA 50 <213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 856 gtccctcaac atctgaatgc

<210> 857

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 857 ctgctagcct ctggatttga

<210> 858

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 858 ccttccctga aggttcctcc

<210> 859

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 859 ctcttactgt gctgtggaca

<210> 860

<211> 13938

<212> DNA

<213> H. sapiens

<400> 860

<210> 861

<211> 25

<212> DNA <213> Artificial Sequence

<220> <223> PCR primer

<400> 861

cagctcctta ttgttatacg aggga

25

<210> 862 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> PCR primer

<400> 862

tgcgtctgag cattgcgt

18

<210> 863 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> PCR probe

<400> 863

cccggtgtca ggtgggagta ctgc

24

<210> 864 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Antisense Oligonucleotide

<400> 864

gcctcagtct tcttcgcacc

twenty

<210> 865 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Antisense Oligonucleotide

<400> 865

gcctcagtct tattcgcacc

twenty

<210> 866 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Antisense Oligonucleotide

<400> 866 gcctcagtat tattcgcacc

<210> 867

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 867 gcctcattat tattcgcacc

<210> 868

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 868 gcctcattat tattagcacc

<210> 869

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 869 gcctcattat tattatcacc

<210> 870

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 870 gcctaattat tattatcacc

<210> 871

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 871 gcctcagtct gcttcgcac

<210> 872

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 872

gcctcagtct gcttcgca 18

<210> 873

<211> 15

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 873

gcctcagtct gcttc 15

<210> 874

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 874

cctcagtctg cttcgcac 18

<210> 875

<211> 16

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 875 16

ctcagtctgc ttcgca 16

<210> 876

<211> 14

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 876

tcagtctgct tcgc 14

<210> 877

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 877 gcctcagtct 10

<210> 878

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 878 gcttcgcacc 10

<210> 879

<211> 20

<212> RNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 879 uugaagccau acaccucuuu 20

<210> 880

<211> 20

<212> RNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 880 ugaccaggac ugccuguucu 20

<210> 881

<211> 20

<212> RNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 881 gaauagggcu guagcuguaa 20

<210> 882

<211> 20

<212> RNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 882 uauacugauc aaauuguauc 20

<210> 883

<211> 20

<212> RNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 883

uggaauucug guaugugaag

<210> 884

<211> 20

<212> RNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 884

aaaucaaaug auugcuuugu

<210> 885

<211> 20

<212> RNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 885

gugaugacac uugauuuaaa

<210> 886

<211> 20

<212> RNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 886

gaagcugccu cuucuuccca

<210> 887

<211> 20

<212> RNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 887

gagaguuggu cugaaaaauc

<210> 888

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Antisense Oligonucleotide

<400> 888

gtgcgcgcga gcccgaaatc

twenty

5

<210> 889 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Antisense Oligonucleotide

<400> 889

fifteen

cuucuggcau ccgguuuagt t twenty-one

<210> 890 <211> 466 <212> DNA <213> M. fascicularis

25

<220> <221> misc_characteristic <222> 9 <223> n = A, T, C or G

<400> 890

35

<210> 891 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense Oligonucleotide

<400> 891

gcctcagtct gctttacacc

twenty

Four. Five

<210> 892 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Antisense Oligonucleotide

<400> 892

agattaccag ccatatgcag

twenty

55

Claims (16)

one.

A 20 nucleic length antisense oligonucleotide compound having a nucleic base sequence as set forth in SEQ ID NO: 247 and comprising 5-methylcytidine at nucleic bases 2, 3, 5, 9, 12, 15, 17 , 19 and 20, in which each internucleoside bond is a phosphorothioate bond, nucleic bases 1-5 and 16-20 comprise a 2'-methoxyethoxy modification, and nucleic bases 6-15 are deoxynucleotides.

2.

 The antisense oligonucleotide compound of claim 1, wherein the compound is a pharmaceutically acceptable salt.

3.

The antisense oligonucleotide compound of claim 2, wherein the pharmaceutically acceptable salt is a salt formed with the cationic sodium.

Four.

A composition comprising the antisense oligonucleotide compound of any one of embodiments 1 to 3, and a pharmaceutically acceptable carrier or diluent.

5.

The antisense oligonucleotide compound of any one of claims 1 to 3, or the composition of claim 4, for use in the therapy or prophylaxis of a disease.

6.

The antisense oligonucleotide compound of any one of claims 1 to 3, or the composition of claim 4, for use in the treatment of hypercholesterolemia in a human.

7.

 The antisense oligonucleotide compound of any of claims 1 to 3, or the composition of claim 4, for use in the treatment of cardiovascular disease, such as atherosclerosis, in a human.

8.

The antisense oligonucleotide compound of any one of claims 1 to 3, or the composition of claim 4, for use in treating hyperlipidemia in a human.

9.

 The antisense oligonucleotide compound of any one of claims 1 to 3, or the composition of claim 4, for use in the treatment of diabetes in a human.

10.

The antisense oligonucleotide compound of any one of claims 1 to 3, or the composition of claim 4, for use in the treatment of obesity in a human.

eleven.

Use of the antisense oligonucleotide compound of any of claims 1 to 3, to prepare a medicament for treating hypercholesterolemia in a human.

12.

 Use of the antisense oligonucleotide compound of any one of claims 1 to 3, to prepare a medicament for treating cardiovascular disease, such as atherosclerosis, in a human.

13.

Use of the antisense oligonucleotide compound of any of claims 1 to 3, to prepare a medicament for treating hyperlipidemia in a human.

14.

Use of the antisense oligonucleotide compound of any of claims 1 to 3, to prepare a medicament for treating diabetes in a human.

fifteen.

Use of the antisense oligonucleotide compound of any one of claims 1 to 3, to prepare a medicament for treating obesity in a human.

16.

The antisense oligonucleotide compound or composition of claim 6, or the use of claim 11, wherein the hypercholesterolemia is familial hypercholesterolemia.