ES2393963T3 - HBcAg expression and therapeutic and diagnostic uses - Google Patents

Abstract

Procedure for the detection of anti-HBc antibodies in a biological sample to be tested, such as blood, plasma or serum, of an individual or an animal that is likely to be infected or has been infected with HBV, depending on which are carried out at least the following steps: - a mixture is prepared, comprising: i) a highly purified recombinant HBcAg protein, the protein being produced by expressing Pichia yeast cells, by using a expression system or cassette that allows the expression of HBc DNA or fragments thereof encoding HBcAg, placed under the control of elements necessary for its expression, in which said recombinant HBcAg protein is immobilized on a solid support, (ii ) the sample to be tested comprising, if present, anti-HBc antibodies, (iii) a labeled ligand that may react with the sample anti-HBc antibodies ; said labeled ligand being said labeled recombinant HBcAg protein produced by expression in Pichia yeast cells - the mixture is incubated for a predetermined time; - the solid phase is separated from the liquid phase; and - the possible presence of anti-HBc antibodies is revealed by measuring the level of labeling in the solid phase.

Description

Expression of HBcAg and therapeutic and diagnostic uses.

Hepatitis B virus (HBV) is the most important of the hepatotrophic viruses in terms of the number of chronically infected people and the severity of infection complications. It is a leading cause of human kidney disease that can lead to chronic infection, cirrhosis and hepatocellular carcinoma, resulting in more than one million deaths worldwide each year.

HBV is a double-stranded DNA virus that can have up to 20% or more of the apparently healthy population in certain parts of the world, such as Africa, Asia and the Pacific region (Principles and Practice of Clinical Virology, 3rd edition, chapter 2: Hepatitis Viruses, pp. 162-180). It is estimated that the reservoir of carriers worldwide is more than 300 million. Originally it was thought that HBV was spread exclusively through blood and blood products, although now it seems that HBV can also be transmitted through intimate contact, such as sexual contact and other routes may be possible. Therefore, transmission of the infection may result from accidental inoculation of minimal amounts of blood, or fluid contaminated with blood, during medical, surgical and dental procedures; immunization with improperly sterilized syringes and needles; intravenous or percutaneous drug addiction; tattoos; perforations in the ear, nose and others; acupuncture; laboratory accidents; and accidental inoculation with blades and similar objects that have been contaminated with blood.

The genomes of a variety of HBV isolates have been cloned and their complete nucleotide sequence determined. Although there is some variation in the sequence (up to approximately 12% of the nucleotides) among these isolates, genetic organization and other essential characteristics are preserved. The genome is about 3200 base pairs in length and the analysis of the protein coding potential reveals four conserved ORFs. The four ORFs are located in the same DNA chain and the genome chains have therefore been designated as positive (incomplete chain) and negative (complete chain).

HBV belongs to the hepadnaviridae family and consists of an outer shell of host-derived lipids that contain a virion-encoded surface antigen (HBsAg). This 42 nm lipoprotein shell surrounds an icosahedral nucleocapsid assembled from the central antigen (HBcAg) that contains the viral genomic DNA and the viral polymerase (for review, see Nassal and Schaller, 1993). The central protein is the cytoplasmic product of the C gene, composed of 183 or 185 amino acid residues (21 kDa) depending on serosubtypes, which can be divided into an N-terminal assembly domain (residues 1-149) and a C-terminal domain similar to very basic protamine (residues 150-185), responsible respectively for particle polymerization and RNA packaging. The HBc protein has the ability to form disulfide bonded homodimers that spontaneously assemble to give particles (Zhou and Standring, 1992).

HBcAg is a very powerful immunogen that induces humoral, cooperative T cell (Th) and cytotoxic T cell (CTL) responses and functions as both a T cell dependent and a T cell dependent antigen (Milich et al., 1997a, b). Virtually all infected individuals show anti-HBc antibodies. They occur very soon after infection and can be detected a few days after the detection of HBsAg in the blood of infected subjects. In addition, in acute infections, HBsAg decreases over a period of several weeks and is replaced by detectable levels of the anti-HBsAg antibody (anti-HBs). During a "window" period, in which neither HBsAg nor its homologous antibody is detectable, the anti-HBc antibody may be the only detectable serological marker of HBV infection. In addition, the anti-HBc antibody usually persists much more than any other HBV marker. Therefore, the anti-HBc antibody is the most useful marker for the diagnosis of a current or past HBV infection and for epidemiological purposes.

Intensive studies have shown that HBcAg can occur in a variety of heterologous expression systems including E. coli and undergoes correct folding and self assembly to form central particles similar to native capsids (Pasek et al., 1979; Cohen and Richmond, 1982; Naito et al., 1997; Wizeman and von Brunn, 1999). Bacterially expressed HBc molecules are assembled to give particles of two sizes arranged respectively with an icosahedral symmetry of triangulation number T = 3 (90 dimers) or T = 4 (120 dimers) (Crowther et al., 1994; Wingfield et al., 1995). The physiological implications of this dimorphic change are not clear, although it is reported that form T = 4 outnumber form T = 3 in ~ 13 to 1 in capsids isolated from the human liver (Kenney et al., 1995). The crystal structure of the T = 4 capsid of the truncated protein expressed in a bacterial manner (aa 1-149) has been resolved by X-ray crystallography at a resolution of 3.3 Å (Wynne et al., 1999). The monomer fold is characterized by four α helices and the absence of β sheets. According to previous biochemical analyzes, structural data revealed two regions required for dimerization of central monomers and for subsequent assembly of dimers to give central particles (Wynne et al., 1999). HBcAg is also produced in Pichia pastoris (Rolland et al, Journal of Chromatography 8,753 (2001) 51-65.

Many different procedures for purifying HBcAg have been described. Common purification procedures are based on sedimentation of the central particles in sucrose gradients that do not allow the removal of all contaminating E. coli material and are often associated with poor performance. As a consequence, most commercially available anti-HBc antibody detection systems are immunoassays based on inhibition or competition, in which human anti-HBc antibodies inhibit a labeled anti-HBc antibody from binding to an immobilized recombinant HBcAg ( Pujol et al., 1994). Consequently, the presence of anti-HBc in the sample generates a low signal value, while its absence results in a high signal value. This conventional test format avoids the need for highly purified HBcAg, but presents possible drawbacks that include poor specificity and poor reproducibility especially near the cut-off point of the test (Dodd and Popovsky, 1991). The reactivity of the false positive anti-HBc antibody has been attributed to antibodies that produce cross-reactions or interference substances in human serum (Robertson et al., 1991). It has been shown that pretreatment of serum samples with reducing agents could significantly improve the specificity of the determination of anti-HBc antibody in competitive assay (Robertson et al., 1991; Spronk et al., 1991; Weare et al., 1991 ). WO99 / 06837 discloses a complex of HBcAg and albumin for detecting anti-HBcAg antibodies. However, in order to avoid very expensive additional measurements in routine diagnosis and discard blood donations due to anti-HBc (false) positive antibody results, there is still a need to increase the specificity of the test.

Summary of the invention

In an attempt to improve the production of a high quality, highly purified recombinant antigen, for use in the diagnosis of anti-HBc antibodies in biological samples, HBcAg was expressed in yeast. The highly purified recombinant protein was characterized and its suitability as a diagnostic antigen was evaluated, by way of example, in a new sandwich-type enzyme immunoassay (EIA) in which anti-HBc antibodies were captured by recombinant HBcAg binding in a solid phase and then were detected using recombinant HBcAg labeled with an appropriate marker.

As explained hereinbefore, assays for the diagnosis of the possible presence of HBV in a patient are known in the art, as indicated by the presence of anti-HBc antibodies. However, it is believed that such assays are not sufficiently sensitive and specific and there is a need for the production of a high quality recombinant HBcAg that allows the development of reliable tests, in particular sandwich assays.

Consequently, an expression system or cassette that is functional in a cell derived from a yeast selected from the group consisting of the strain Pichia and Schizosaccharomyces, especially selected from the group consisting of Pichia pastoris, Pichia methanolica and Schizosaccharomyces pombe and that allows the expression of HBc DNA or fragments thereof encoding HBcAg or fragments thereof, placed under the control of the elements necessary for its expression. A large number of these cells are commercially available in collections such as ATCC (Rockville, MD, USA) and AFRC (Agriculture and Food Research Council, Norfolk, UK). For the purpose of the present invention, said cell may be of the natural or mutant type. The expression cassette as described above comprises elements necessary for the expression of HBcAg or fragments thereof in the cells considered. The expression "components necessary for expression" means all the elements that allow the transcription of a DNA or DNA fragment into mRNA and the translation of the latter into protein. Among these, the promoter region is of special importance. The promoter region can be autologous, that is, the promoter region of the HBV C gene, or heterologous, that is, the promoter region can correspond to a plasmid promoter or promoter of a gene in the host cell. It can be constitutive, that is, it can allow a constant level of transcription throughout the cell cycle. However, it may be advantageous to use an adjustable promoter region that makes it possible to vary the transcription levels according to the culture conditions or the cell growth phase depending on the presence of an inducer (transcription activation) or a repressor (repression) . Generally, regulating promoter regions are derived from regulable genes for which the regulatory mechanisms can vary highly. On the other hand, an expression cassette as described above may also contain other elements that contribute to the expression of DNA or fragments thereof as well as transcription activation sequences.

A vector comprising an expression cassette as described above is disclosed. It may be a replicating plasmid vector before the integration of DNA or fragments thereof. It may be a multicopy vector present in between about 1 and 500 copies, preferably between 1 and 20 copies, in the host cell. Mention may be made, by way of example, of vectors derived from pPIC3.5K (Invitrogen).

A yeast cell selected from the group consisting of Pichia and Schizosaccharomyces strain cells is disclosed, especially selected from the group consisting of Pichia pastoris, Pichia methanolica and Schizosaccharomyces pombe and comprising an expression cassette as described above or integrated into the cell genome or inserted into a vector.

Recombinant HBcAg or fragments thereof produced by an expression cassette, a vector or a cell as described above are disclosed. Within the framework of the present invention, they can

HBcAg or fragments thereof be modified in vitro, especially by the addition or deletion of chemical groups, such as phosphates, sugars or myristic acid to enhance their stability or the presentation of one or more epitopes.

The use of recombinant HBcAg or fragments thereof is disclosed as described above in the diagnosis of anti-HBc antibodies in samples to be tested. With respect to recombinant HBcAg expressed in prokaryotic cells, such as E. coli cells; The recombinant protein or fragments as described above is particularly interesting since it is produced in highly purified form and does not need additional purification steps or require a lot of time since the protein is folded, that means close to the native form. Consequently, a test that uses the protein as described above in the diagnosis of anti-HBc antibodies in a sample to be tested is more reliable, more specific and more sensitive. The protein as described above is particularly attractive in the sandwich process. In the following examples, the comparison between HBcAg expressed in E. coli cells and HBcAg expressed in Pichia is made, when used in a diagnostic test.

A reagent for the detection and / or monitoring of a HBV infection is disclosed, comprising, as a reactive substance, the recombinant protein or fragments thereof as described above. The above reagent is bound or will be attached directly or indirectly on an appropriate support. The support can be, without limitation, in the form of a cone, a tube, a well, beads or the like. The term "solid support" as used herein includes all materials on which a reagent can be immobilized for use in diagnostic tests. Natural or synthetic, chemically modified materials can be used

or otherwise, as solid support, especially polysaccharides such as cellulose materials, cellulose derivatives; polymers such as polystyrene, polyacrylate, polyethylene, vinyl chloride or copolymers such as propylene polymer and vinyl chloride, vinyl chloride polymer and vinyl acetate; styrene-based copolymers; natural fibers and synthetic fibers. Preferably, the support is a polystyrene polymer or a butadiene-styrene copolymer. The binding of the reagent on the solid support can be performed directly or indirectly. All techniques for binding a reagent on a solid support are well known.

The present invention relates to a method for the detection of anti-HBc antibodies in a biological sample to be tested, such as blood, plasma or serum, of an individual or an animal that is likely to be or that is infected with HBV according to claims 1 or 2.

A method for the detection of anti-HBc antibodies in a biological sample to be tested, such as blood, plasma or serum, of an individual or an animal that is likely to be infected or has been disclosed is disclosed. HBV infected, according to which at least the following stages are carried out:

-

 a mixture is prepared comprising:

(i)

 a reagent as defined above that is immobilized or will be immobilized on a solid support,

(ii)

 the sample to be tested comprising, if present, anti-HBc antibodies,

(iii) a labeled ligand that may react with the anti-HBc antibodies in the sample;

-

 the mixture is incubated for a predetermined time;

-

 the solid phase is separated from the liquid phase; Y

-

 The possible presence of anti-HBc antibodies is revealed by measuring the level of labeling in the solid phase.

This procedure called "sandwich type assay" can be performed in one or more stages and the ligand is either a labeled recombinant HBcAg as described above or a labeled anti-immunoglobulin.

A method for the detection of anti-HBc antibodies in a biological sample to be tested, such as blood, plasma or serum, of an individual or an animal that is likely to be infected or has been disclosed is disclosed. HBV infected, according to which at least the following stages are carried out:

-

 a mixture is prepared comprising:

(i)

 a reagent as defined above that is immobilized or will be immobilized on a solid support,

(ii)

 the sample to be tested comprising, if present, anti-HBc antibodies,

(iii) labeled anti-HBc antibodies that may react with the reagent;

-

 the mixture is incubated for a predetermined time;

-

 the solid phase is separated from the liquid phase; Y

-

 The possible presence of anti-HBc antibodies is revealed by measuring the level of labeling in the solid phase.

This procedure is called "proficiency testing."

Since HBcAg is a very powerful immunogen that induces a strong humoral response, recombinant HBcAg as described above is used for the production of monoclonal or polyclonal antibodies or fragments thereof obtained by the immunological reaction of an animal organism, preferably a mouse, a rat or a rabbit with an immunogenic agent consisting of the recombinant HBcAg or fragments thereof as described above. The production of polyclonal and monoclonal antibodies is part of the general knowledge of those skilled in the art. By way of reference, Köhler G. and Milstein C. (1975) and Galfre G. et al. (1977) for the production of monoclonal antibodies and Roda A., Bolelli G.F. (1980), for the production of polyclonal antibodies. Antibodies can also be produced by immunizing mice, rats or rabbits with HBcAg or fragments thereof as described above. For the production of monoclonal antibodies, the immunogen can be coupled to California limpet hemocyanin (KLH peptide) as a support for immunization or to serum albumin (SA peptide). Animals are subjected to an immunogen injection using complete Freund's adjuvant. Serums and hybridoma culture supernatants derived from immunized animals are analyzed to determine their specificity and selectivity, using conventional techniques such as, for example, ELISA assays or Western blotting. The hybridomas that produce the most specific and the most sensitive antibodies are selected. Monoclonal antibodies can also be produced in vitro by cell culture of the hybridomas produced.

or recovering ascites fluid after intraperitoneal injection of hybridomas in mice. Whatever the production process, by supernatant or by ascites, then the antibodies are purified. The purification procedures used are essentially gel filtration by ion exchange and exclusion chromatography or affinity chromatography (protein A or G). A sufficient number of antibodies are examined in functional assays in order to identify the most effective antibodies. Those skilled in the art are well aware of the in vitro production of antibodies, antibody fragments or antibody derivatives, such as chimeric antibodies produced by genetic engineering.

More particularly, the term "antibody fragment" is intended to mean F (ab) 2, Fab, Fab 'and sFv fragments (Blazar et al., (1997) and Bird et al., (1988,)) of a native antibody, and the term "derivative" is intended to mean, among others, a chimeric derivative of a native antibody (see, for example, Arakawa et al., (1966) and Chaudray et al., (1989)).

The monoclonal or polyclonal antibody thus obtained is incorporated into a diagnostic composition that is used in a procedure to detect at least the HBc protein in a biological sample after pretreatment, if necessary, of the sample to break the cells and release the cell. HBc protein, according to which the biological sample is contacted with said diagnostic composition under predetermined conditions that allow the formation of antibody / antigen complexes and the formation of said complexes is detected. Said composition may also comprise at least one monoclonal or polyclonal antibody or fragments thereof, directed against the HBsAg protein.

A sandwich or competition type method is disclosed for detecting at least the HBc protein in a biological sample, if necessary after pretreatment of the sample, to break the cells and release the HBc protein, using said procedures preferably by less a monoclonal antibody as described above.

A sandwich type process is disclosed comprising at least the following steps:

-

 a mixture is prepared, comprising:

(i)

a reagent consisting of at least one monoclonal antibody as described above that is immobilized or will be immobilized on a solid support,

(ii)

 the sample to be tested comprising, if present, HBcAg,

(iii) a labeled ligand that may react with the HBcAg of the sample;

-

 the mixture is incubated for a predetermined time;

-

the solid phase is separated from the liquid phase; Y

-

 The possible presence of HBcAg is revealed by measuring the level of labeling in the solid phase. The labeled ligand can be a monoclonal or polyclonal antibody.

A sandwich type process is disclosed comprising at least the following steps:

-

a mixture is prepared, comprising:

(i)

 a reagent consisting of at least one polyclonal antibody as described above that is immobilized or will be immobilized on a solid support,

(ii)

 the sample to be tested comprising, if present, HBcAg,

(iii) a labeled ligand that may react with the HBcAg of the sample;

-

 the mixture is incubated for a predetermined time;

-

 the solid phase is separated from the liquid phase; Y

-

 The possible presence of HBcAg is revealed by measuring the level of labeling in the solid phase. The labeled ligand can be a monoclonal or polyclonal antibody.

A competition procedure is disclosed that comprises at least the following stages:

-

a mixture is prepared, comprising:

(i)

 a reagent consisting of at least one monoclonal antibody or polyclonal antibody as described above that is immobilized or will be immobilized on a solid support,

(ii)

 the sample to be tested comprising, if present, HBcAg,

(iii) a labeled ligand that may react with reagent (i) and consisting of a recombinant HBcAg as described above;

-

the mixture is incubated for a predetermined time;

-

the solid phase is separated from the liquid phase; Y

-

The possible presence of HBcAg is revealed by measuring the level of labeling in the solid phase.

Since HBcAg is a very powerful immunogen that induces a strong humoral response, recombinant HBcAg as described above can be used as an active component of the immune response. Therefore, a vaccine against the HBV virus is disclosed. This vaccine is prepared according to known procedures used to prepare commercially available vaccines. This vaccine comprises at least the recombinant HBcAg protein as described above or fragments thereof. The recombinant HBcAg protein is obtained using an expression cassette as described above.

An immunogenic or vaccine composition is disclosed which is a composition comprising a recombinant HBcAg protein or a protein fragment as defined above, optionally combined with a vehicle and / or adjuvant and / or a suitable pharmaceutically acceptable excipient. Vaccines comprising the HBcAg protein or fragments thereof, are prepared in a conventional manner and contain an immunoprotective amount of the HBcAg protein or fragments thereof, preferably in a buffered saline solution and mixed or adsorbed using known adjuvants such as hydroxide or aluminum phosphate.

The term "immunoprotective" means that an amount of the recombinant HBcAg protein as described above or of the fragments thereof that is sufficient to induce antibody production (humoral immune response) that is sufficient to induce an individual is administered to an individual. be protective or an immune response mediated by cytotoxic cells (cellular immune response), to confer protection against the infectious agent without inducing side effects. The two types of response differ in that the antibodies recognize the antigens in their three-dimensional form, while the cytotoxic cells recognize parts of said antigens, associated with glycoproteins encoded by the main histocompatibility complex (MHC). Cytotoxic T lymphocytes (CTL) play an essential role in the defense of virus-infected cells. They act directly by cytotoxicity, but also by providing specific and non-specific help to other hematopoietic cells, such as macrophages, B cells and other T cells. Infected cells transform the antigen through intracellular events that involve proteases. The transformed antigen is then presented on the surface of the cells, in the form of peptides bound to HLA class I molecules, to the T-cell receptors in the CTLs. MHC class I molecules can also bind to exogenous peptides and present them to CTL without intracellular transformation. Chisari et al., (Microbiol. Pathogen. 6:31

(1989)) have suggested that liver lesions could be mediated by a CD8 + cytotoxic T cell response restricted to HLA class I to HBV-encoded antigens.

The amount of HBcAg protein as described above or fragments thereof depends on whether or not adjuvant is added, but is generally between 10 and 50 µg / ml protein or fragment. Therefore, 20 μg / 0.5 ml of protein in adults and 10 μg / 0.5 ml in children are usually administered per dose. Vaccines can also comprise other proteins that enhance the immune response. The HBcAg interacts with certain potentiation proteins, preferably an albumin and / or an unprocessed structural protein of a positive chain RNA virus, to provide a complex composed of the HBcAg and the unprocessed structural albumin or protein of the RNA RNA virus. positive chain According to such complexity, HBcAg is believed to undergo conformational changes that enhance the antigenicity of HBcAg compared to HBcAg only in terms of both affinity and specificity. The HBcAg protein as described above or fragments thereof, can also be mixed with HBsAg and / or Pre-S proteins or fragments of said proteins, for the formulation of a vaccine. They can also be mixed with hybrid particles that carry epitopes of proteins from other organisms or with other immunogenic compounds, for the formulation of bivalent or multivalent vaccines. Vaccine preparation is described in particular in "Vaccines", ed. Voller et al., University Park Press, Baltimore, Md., USA, 1978.

The vaccine is administered at a given dose in one or more intramuscular or subcutaneous injections, followed by a booster (s), if necessary. The immunizing effect of the vaccine is monitored by testing anti-HBc antibodies in the vaccinated individual.

The administration of a protein (s) or a derivative peptide (s) of interest or the fragment (s) thereof, alone or in combination, is used for prophylaxis and / or therapy. . These administered proteins or peptides are characterized in that they do not show the virulence of HBV, but they can induce a humoral or cellular immune response in the individual to whom they are administered. Such proteins are called "modified", but their immunogenicity is preserved.

The identification of a vaccine protein (s) or fragment (s) is carried out as follows:

"Modified" candidate molecules are analyzed in a functional assay to be sure that they have lost their toxicity and to verify their immunogenicity, (i) carrying out an in vitro assay of proliferation of CD4 + T lymphocytes specific for the administered antigen (assay T cell) or an in vitro cytotoxicity assay of CD8 + lymphocytes specific for the administered antigen and (ii) measuring, among others, the level of circulating antibodies directed against the natural protein. These modified forms are used to immunize humans using standard procedures with suitable adjuvants.

Prepared vaccines are injectable, that is, they are in liquid solution or in suspension. As an option, the preparation can also be emulsified. The antigenic molecule can be mixed with excipients that are pharmaceutically acceptable and compatible with the active substance. Examples of favorable excipients are water, a saline solution, dextrose, glycerol, ethanol or equivalent, and combinations thereof. If desired, the vaccine may contain smaller amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents or adjuvants such as aluminum hydroxide, muramyl dipeptide or variations thereof. In the case of peptides, their coupling to a larger molecule (KLH, tetanus toxin) sometimes increases immunogenicity. Vaccines are administered in a conventional manner by injection, for example intramuscular injection.

The term "pharmaceutically acceptable carrier" is intended to mean the carriers and carriers that can be administered to humans or animals, as described, for example, in Remington's Pharmaceutical Sciences 16th ed., Mack Publishing Co. The pharmaceutically acceptable carrier is preferably isotonic, hypotonic or weakly hypertonic with a relatively low ionic strength. Definitions of pharmaceutically acceptable adjuvants and excipients are also provided in the Remington’s Pharmaceutical Sciences mentioned above.

A pharmaceutical composition intended for the treatment or prevention of HBV infection in an individual or animals, comprising a therapeutically effective amount of the expression cassette, the vector or the cell as defined above, is disclosed.

Finally, a procedure for vaccination of an individual (human or animal) according to an active immunotherapeutic composition, especially a vaccine preparation, is injected into the individual as defined above; and a procedure for the treatment or for the prevention of a HBV infection in which a pharmaceutical composition as defined above (human or animal) is administered to the individual.

The peptide sequence of Figure 1A corresponds to an adw2 subtype sequence, but naturally the expression cassette as described above allows the expression of any genotype or subtype.

The examples below will make it possible to demonstrate the characteristics and advantages of the present invention in which the following abbreviations mean:

amu, unit of mass average; BMGY, conventional rich medium containing glycerol; BMMY, conventional rich medium containing methanol; ELISA, enzyme-linked immunosorbent assay; G418, geneticin; HBV, hepatitis B virus; HBcAg, central HBV antigen; HBeAg, HBV e antigen; HBsAg, HBV surface antigen; anti-HBc antibody, antibody against HBcAg; MALDI-TOF, laser assisted desorption / ionization by flight time matrix; Mut +, use of natural type methanol; Muts, slower use of methanol.

Brief description of the drawings

Figure 1: Schematic representation of the amino acid sequences of HBcAg expressed in P. pastoris (yBW63) and in E. coli (bOL32). The sequences are shown as open lines with the N-terminal end of native HBcAg (residue 1) on the left and the C-terminal end with its protamine domain (+++) on the right. The two recombinant proteins bOL32 and yBW63 differ in the presence of an additional tetrapeptide (MRGS) at the N-terminal end and a hexahistidine sequence at the C-terminal end of bOL32.

Figure 2: SDS-PAGE analysis of recombinant HBcAg expressed in E. coli and P. pastoris. Purified recombinant HBcAg, and BW63 (lanes 1 and 3) and bOL32 (lanes 2 and 4) were resolved by SDS-PAGE and visualized by staining with Coomassie Brillant blue (A) or immunoblotting using a human serum positive for HBc (B). Samples were reduced (lanes 1-2) or not reduced (3-4).

Figure 3: Electron microscopy showing purified particles assembled from HBcAg and BW63 (A) or bOL32 (B) proteins. The purified particles were examined by electron microscopy after negative staining. The bar in the micrograph represents 100 nm.

Figure 4: Analysis of central particles associated with nucleotide by agarose gel electrophoresis. The purified proteins yBW63 and bOL32 were treated with DNase or RNase or with both nucleases and separated by agarose gel (1%, w / v) stained with ethidium bromide (A) or Coomassie Brillant blue (B) Sd, marker of Conventional Smart molecular size of DNA (Eurogentec), lane 1, untreated, lane 2, treated with DNase and RNase, lane 3, treated with RNase, lane 4, treated with DNase.

Examples

1. MATERIALS AND METHODS

1.1. Whey Panels

All samples were tested with anti-HBc antibody EIA: VIDAS HBcT I and II (bioMérieux, Marcyl'Etoile, France) and IMx Core ™ revision 2 (Abbott, Delkenheim, Germany), and with other anti-antibody EIA -HBc including AxSYM Core and Corzyme (Abbott), ORTHO ™ HBc ELISA (Ortho clinical diagnostics, Buckinghamshire, UK), Monolisa anti-HBc (Bio-Rad, Hercules, CA, USA) and Elcesys anti-HBc (Roche Diagnostic, Mannheim , Germany). Other serological markers specific for HBV were determined: HBsAg, anti-HBs antibody, anti-HBc-IgM antibody, HBeAg and anti-HBc antibody using respectively VIDAS HBsAg, VIDAS anti-HBs T, VIDAS HBc IgM, VIDAS HBc / anti-HBe (bioMérieux) and / or anti-HBe IMx antibody (Abbott) and HBV DNA PCR (Amplicor VHB Monitor ™ test, Roche Diagnostic). IMx Core ™ review 2, AxSYM Core and Elecsys anti-HBc are based on a competitive test principle and include a pretreatment of serum samples with reducing agents in order to minimize false positive reactions. The detection limit of VIDAS HBc IgM is 10 PEI / ml units (PEI, Paul Ehrlich Institute, Frankfurt, Federal Republic of Germany). All assays and PCR amplification were performed and interpreted according to the manufacturer's instructions.

The human sera panel included 22 negative sera and 20 positive sera. Negative sera were from vaccinated or unvaccinated patients. Negative sera were selected from a large population of blood donors (from Etablissement Français du Sang, France), the criteria presenting disagreement results with the specific commercial EIAs for anti-HBc antibodies performed (see Table 1) except for the us 51 and 94. Among them, 17 samples gave false positive or doubtful results only with anti-HBc antibody EIA that do not include serum pretreatment with reducing agents (VIDAS HBcT I or II, ORTHO ™ HBc ELISA, Monolisa anti-HBc or Corzyme ) but were negative with trials that included such treatment as IMx Core, AxSYM Core and Elecsys anti-HBc. In addition, after pretreatment of these sera with a reducing agent or the addition of anti-IgM antibody, they became negative with the EIAs of the first group (not shown) confirming the presence of non-specific sensitive reducing IgM reactivity as described above. (Robertson et al., 1991). The other 3 negative samples were false positive with some commercial EIAs, whether or not they included pretreatment with a reducing agent.

The positive panel (table II) was obtained from blood donors. This panel included a low positive sample with ORTHO ™ HBc ELISA (# 63) and 3 samples for which it was found to be positive for anti-HBc antibody with some commercial EIAs but negative for other markers of ongoing HBV infection or passed in all comparative tests performed (see table II).

For the evaluation of the specificity of sandwich-type EIA, a population of serum samples negative for 184 HBV of healthy individuals (voluntary blood donors from Etablissement Français du Sang, France) was used. The specimens were kept at -20 ° C for prolonged storage.

1.2. Construction of an E. coli HBcAg expression vector, E. coli transformant culture and purification of the recombinant HBcAg bOL32 by metal chelate chromatography.

The HBV C gene was amplified by PCR from a plasmid containing a copy of the sequence coding for HBcAg (strain adw2) of a HBV strain isolated from an infected patient (E3CB, bioMérieux). The sense primer used 5’ACTGGGATCCATGGACATTGACCCTTATAAAGAA3 ’included a BamHI site (underlined) and the initiation codon of the central gene (in bold type). The antisense primer used 5’GATCGGAATTCCTAGTGGTGGTGGTGGTGGTGACATTGAGATTCCCG3 ’included an EcoRI site (underlined), a termination codon (in bold) and a sequence encoding a hexahistidine tail. The purified PCR product was digested with the appropriate enzymes and ligated to the BamHI-EcoRI sites of the pMR80 expression vector (Cheynet et al., 1993), under the transcriptional control of the tac promoter. The resulting construct pOL032, verified by automated DNA sequence analysis, was used to transform the E. coli BL21 strain and the HBcAg protein called bOL32 was expressed in this strain.

A new overnight culture of E. coli BL21 that carries construct pOL032 in a liter of 2x YT broth (DIFCO) containing 2% glucose (2xYT-G) and ampicillin (100 μg / ml) was diluted 1:25 It was grown at 37 ° C at a stirring speed of 250 rpm until D600 reached 0.9 / 1.0. The culture was induced by adding isopropyl-β-Dthiogalactopyranoside to a final concentration of 1 mM for 4 hours at 37 ° C. The culture was then collected by centrifugation at 6,000 g for 30 min. and the cell pellet was frozen at -80 ° C until use. The cell pellet was resuspended in 80 ml of lysis buffer [100 mM sodium phosphate / 300 mM NaCl (pH 8.0) containing 1 mg / ml lysozyme and protease inhibitor cocktail (Roche Diagnostic Systems)]. After an incubation of 30 min. at 4 ° C, 20 μg / ml DNase was added and incubated 30 min. at 4 ° C. Urea (8 M final concentration), 5 mM β-mercaptoethanol and 20 mM imidazole were added to the cell lysate for a final volume of 160 ml and the pH was adjusted to 8.0. After complete dissolution, the cell lysate was centrifuged at 10,000 g for 20 min. The supernatant was then incubated with 5 ml of Ni2-nitrilotriacetic acid-Sepharose resin (Qiagen, Courtaboeuf, France) overnight at 4 ° C. The resin was then packed in a column and washed with 100 mM sodium phosphate, 300 mM NaCl, 6 M urea, 20 mM imidazole, 5 mM β-mercaptoethanol (pH 7.4) until A280 reached the reference (approximately 10 column volumes; 60 ml / h). Elution of HBcAg was carried out with 3 volumes of buffer column containing 50 mM sodium phosphate, 150 mM NaCl, 3 M urea, 400 mM imidazole, 5 mM β-mercaptoethanol, 20% glycerol (w / v) (pH 7.0). The fractions of interest were collected and dialyzed for 72 hours against a 50 mM sodium phosphate buffer, 150 mM NaCl, 1 M urea (pH 7.8) containing 2 mM reduced glutathione, 0.2 mM oxidized glutathione and inhibitors of protease The 48 hour fractions were further dialyzed against PBS containing 2 mM EDTA, 20% glycerol (w / v) and protease inhibitors (pH 7.5). Protein content was estimated using the Bio-Rad protein assay kit, based on the Bradford dye binding procedure, with BSA as the standard (Bio-Rad).

1.3. Construction of an HBcAg expression vector of P. pastoris, transformation of P. pastoris, culture conditions and fermentation.

The HBV C gene was amplified by PCR using plasmid DNA E3CB as a template. The 5′AGCGGATCCACCATGGACATTGACCCTTATAAAGAATTTGC3 ’primer included a BamHI site (underlined) and the initiation codon of the central gene (in bold) in the context of a Kozac sequence. The 5'GATCGGAATTCCTAACATTGAGATTCCCG3 ’antisense primer included an EcoRI site (underlined) and a termination codon (in bold). The purified PCR product was digested with the appropriate enzymes and ligated to the P. pastoris expression vector treated in BamHI and EcoRI pPIC3.5K (Invitrogen BV, Groningen, The Netherlands). The construct called pBW006 was used to transform E. coli strain XL1 and its DNA sequence was verified.

Plasmid pBW006 plasmid was linearized by SacI digestion to select integration events in the 5'AOX1 locus, which codes for alcohol oxidase, of the yeast genome by means of an individual crossing event and was used to transform the GS115 strain of P pastoris his4 (His-Mut + phenotype) and strain KM71 of his4 aox1 derived (His-Muts phenotype) (Invitrogen) by the spheroplast transformation procedure (Invitrogen). Stable transformants were selected for histidine prototrophy by plating on plates with minimum dextrose medium [1.34% (w / v) of yeast nitrogen base, 6 x 10-5% biotin, 1% (w / v ) dextrose and 1.5% (w / v) agar] without histidine. These His + clones were pooled and additionally selected to determine geneticin resistance (G418) by plating them on YPD agar plates [1% yeast extract (w / v), 2% peptone (w / v), 2% dextrose (w / v) and 2% agar (w / v)]

which contained increasing concentrations of G418 (0.25-4 mg / ml) in order to identify those that carry multiple copies of the relevant gene. The resulting G418 His + resistant clones were isolated and plated again on minimal dextrose agar, without histidine and containing G418, to confirm their phenotype.

Transformants resistant to G418 His + from P. pastoris were grown in a shaker flask (250 rpm at 30 ° C) in 100 ml of a rich conventional medium [1% yeast extract (w / v), 2% peptone (p / v), 1.34% yeast nitrogen base (w / v), 0.4 mg / l biotin and 100 mM potassium phosphate (pH 6.0)] containing 1% glycerol (w / v) (BMGY), until the D600 reached 2-6. To begin the induction phase, the cells were collected by centrifugation and resuspended to a value of D600 of 1 in conventional rich medium containing 0.5% methanol (BMMY). Each subsequent day, 100% methanol was added to a final concentration of 1%. On the third day the yeast cells were collected. Methanol-induced cultures were analyzed for HBcAg expression using the EIA described below. A transformant was selected, isolated from the original GS115 strain and that could grow with G418 1.75 mg / ml, for its high level of expression and preserved for fermentation studies.

The following fermentation conditions were used: the concentration of dissolved oxygen was maintained above 20% saturation using 40% oxygen enriched air and a stirring speed of up to 1200 rpm; the pH was maintained at pH 5.0 throughout the fermentation process [with 28% (v / v) ammonium hydroxide] and the temperature was set at 28 ° C. The transformant was grown in a flask at 28 ° C until D600 reached 2-6 in a 100 ml BMGY culture medium. The cells were collected and used to inoculate a 2-liter bioreactor (Biolaffite-Pierre Guerin S.A., Niort, France) containing 1 liter of BMGY. After extracting glycerol from the culture medium, a 50% (w / v) glycerol supply was set at 20 ml / h / l for 2 h. The glycerol supply then gradually decreased every hour to 10 ml / h / l, 7.5 ml / h / l, 5 ml / h / l, while a supply of methanol (100% methanol) was initiated at a rate of 2.7 g / h / l and then maintained at 5.5 g / h / l in the culture medium over a period of 3 days. To prevent extensive foaming, defoamer 204 (Sigma) was added. The culture was collected by centrifugation at 3000 g for 10 min. at 4 ° C and the cell pellet was recovered and stored at -80 ° C until purification.

1.4. Purification of the yBW63 of recombinant HBcAg produced in P. pastoris.

Cell extracts were prepared by stirring with vortexed yeast sediment resuspended at 0.2 g / ml (wet yeast biomass) in rupture buffer [50 mM sodium phosphate, 5% glycerol (w / v), 1 mM PMSF, EDTA 1 mM (pH 7.4)] with 425-600 μm glass beads washed with acid in a beater (PolyLabo, Strasbourg, France) in five 1 minute pulses. After rupture, the cell suspension was separated from the glass beads and centrifuged for 20 min. at 10,000 rpm at 4 ° C. The supernatant was recovered. The HBcAg in the supernatant was filtered over a 0.22 µm membrane and treated by heating at 65 ° C for 60 min. as previously described (Naito et al., 1997). Cloudy proteins were removed by centrifugation at 10,000 rpm for 30 min. at 4 ° C and the supernatant was collected as the fraction of HBcAg. The heat purified product was concentrated on a YM3 membrane (cut-off point 3,000) in an AMICON cell (Millipore S.A., St-Quentin-Yvelines, France).

1.5. Sucrose gradient.

Heat-purified yBW63 and bOL32 purified with metal chelates were layered on top of a sucrose gradient formed in polycarbonate tubes [10 ml of 60% sucrose (w / v), 5 ml of sucrose at 50 % (w / v), 5 ml of 40% sucrose (w / v); 5 ml of 30% sucrose (w / v) and 5 ml of 20% sucrose (w / v) in 50 mM Tris-HCI (pH 7.8)] and centrifuged in a JA25.5 rotor (Beckman Instruments , Gagny, France) at 75,600g for 21 h at 4 ° C. Gradients were fractionated from the top and HBcAg positive fractions were detected by EIA as described below in 50-60% (w / v) sucrose fractions and concentrated and dialyzed against a phosphate buffer 10 mM (pH 7.8) in a Vivaspin concentrator (Sartorius SA, Palaiseau, France) on a 30,000 Da cut-off membrane. The concentration of HBcAg was determined by measuring the absorbance at 280 and 320 nm and using the formula: [1.55 (A280-A320) - 0.76 (A260-A320)] to take into account the presence of nucleic acids trapped in the central particles (Scheif and Wensink, 1981).

1.6. SDS-PAGE and Western blot analysis.

Samples were resolved on 4-12% Bis-Tris Novex Nu-PAGE ™ in Nu-PAGE ™ MES-SDS run buffer according to the manufacturer's instructions (Invitrogen). Or the proteins were stained with Coomassie Brillant blue

or they were electrophoretically transferred onto a Protran nitrocellulose membrane (Schleicher & Schuell, Ecquevilly, France). The membranes were blocked with 3% BSA (w / v) in PBS and incubated with a positive serum for human anti-HBc antibody (1: 1000 dilution) in PBS containing 0.05% Tween 20 and 1 BSA % (w / v) (PBS / BSA / Tween). It was used as a secondary antibody conjugated to horseradish peroxidase-goat anti-human IgG antibody (Jackson Immunoresearch Laboratories, West Grove, PA, USA) (1: 5000 dilution) in PBS / BSA / Tween.

1.7. Detection of recombinant HBcAg reactivity by EIA.

A microtiter plate was coated with a monoclonal anti-HBc antibody (P1D10, bioMérieux, 5 μg / ml, 100 μl / well) for 2 hours at 37 ° C, then saturated with 1% milk (w / v) in PBS. The sample was incubated at a dilution

1: 100 in PBS / Tween (100 μl / well) for one hour at 37 ° C. After three washes, a serum positive for human anti-HBc antibody (1: 1500 in PBS / Tween) was applied for one hour. After three washes, a labeled horseradish peroxidase-goat anti-human IgG antibody (Jackson) conjugate (1: 15000 in PBS / Tween) was incubated for 30 min. at room temperature. After further washing, 100 µl of the color development reagent of O-phenylenediamine dihydrochloride (bioMérieux) was added to each well for 10 min. at room temperature. The reaction was stopped by adding 50 µl of 1.8 N sulfuric acid and the absorbance was read at 492 nm.

1.8. N-terminal sequencing.

Purified HBcAg was resolved by SDS-PAGE under reducing conditions, transferred to a PVDF membrane and visualized by Ponceau S staining (Sigma-Aldrich, St Quentin Fallavier, France). Protein bands were cleaved and subjected to Edman N-terminal sequence analysis in a protein sequencer (model 492, Applied Biosystems, les Ulis, France).

1.9. Enzymatic "gel" digestion of HBcAg and peptide analysis.

Purified HBcAg was resolved by SDS-PAGE and the band corresponding to the monomer form was gelled. In summary, 30 μg of reduced HBcAg was loaded on gel rails. The proteins were then identified by staining with Coomassie Brillant blue, cleaved, stained in 100 mM acetonitrile / ammonium carbonate (pH 8.5) (50:50, v / v) and dried in a vacuum concentrator. Proteins were reduced and alkylated by incubation in 100 µl of 10 mM DTT / 100 mM ammonium carbonate (pH 8.5). After an incubation of 30 min. at 37 ° C, 100 µl of 50 mM iodoacetamide / 100 mM ammonium carbonate (pH 8.5) was added and incubated for another 30 min. The bands were then washed twice with 300 µl of ammonium carbonate buffer and once with 300 µl of acetonitrile / ammonium carbonate buffer (50:50, v / v) before drying. Proteolytic digestion was performed by incubating gel fragments with 50 µl of 25 mM bicarbonate buffer, 1 mM CaCl2 (pH 8.5) containing trypsin (enzyme / substrate, 1:50, w / w) for 18 h at 37 ° C (Roche Diagnostics ). The supernatants were subsequently grouped with those obtained after two additional extractions with water / acetonitrile / formic acid (50: 50: 5 in vol.).

Samples were concentrated and dropped on a laser-assisted time-matrix desorption / ionization plate and subjected to molecular mass analysis on a MALDI-TOF Biflex III mass spectrometer (Bruker, Wissembourg, France).

1.10. Phosphorylation Analysis

BOL032 and yBW063 of HBcAg (10 μg) were resolved in 4-12% Bis-Tris Novex Nu-PAGE ™ as described above. To detect phosphorylated proteins, the gel was stained with the Gelcode® phosphoprotein staining kit (Perbio Science, Erembodegen-Aalst, Belgium), following the manufacturer's instructions. Phosvitin (10 μg) and soy trypsin inhibitor (10 μg) were used respectively as positive and negative control phosphoprotein.

1.11 Titration of free thiol groups in purified proteins.

The free thiol content of each recombinant protein was determined using Ellman reagent (5,5’-dithiobis-2-nitrobenzoic acid) (Perbio Science). A standard curve was prepared with cysteine hydrochloride monohydrate (Perbio Science) following the manufacturer's instructions. In summary, 50 μl of 10 mM Ellman reagent and 2.5 ml of a 100 mM phosphate buffer (pH 8.0) were added to 100 μl of standard or sample protein (2.5 mg of HBcAg). After incubation at room temperature for 15 min., The absorbance at 412 nm was read. The thiol concentration was then calculated using the standard curve.

1.12. Electron microscopy of HBcAg derived from E. coli and P. pastoris.

To prepare samples for electron microscopy, purified proteins (5 μl of yBW63 at 0.5 mg / ml and 0.8 mg / ml of bOL32) were applied to 200 mesh copper gratings coated with a carbon collodion film, air dried and then stained negatively with 2% phosphotungstic acid. The particles were examined using a Phillips CM120 transmission electron microscope with an acceleration voltage of 80 kV.

1.13. Detection of HBcAg-nucleic acid interactions by agarose gel electrophoresis.

1 µl of RNase A (2477 units / ml, Sigma) or DNase (1 / ml, Promega) was added to 10 μl of purified HBc. After incubation for 30 min. at 22 ° C, 2 µl of loading buffer [50 mM NaPO4, 50% glycerin (v / v) and 0.1% bromophenol blue (w / v) (pH 7.4)] were added and the sample on a 1% agarose gel (w / v) containing ethidium bromide (10 μg / ml). The gel buffer and electrophoresis buffer was 1X TAE [40 mM Tris-acetate, 1 mM EDTA (pH 8.3)]. Nucleotides were visualized by UV light and proteins were visualized by Coomassie Brilliant blue staining.

1.14. Detection of anti-HBc antibody by means of a four-stage sandwich EIA.

Magnetic microparticles (M280 microparticles activated with tosyl, Dynal, Oslo, Norway) were coated with recombinant HBcAg of E. coli or P. pastoris (6 μg of HBcAg per mg of magnetic microparticles) following the manufacturer's recommendations. The beads were subsequently incubated with a blocking solution [100 mM Tris-HCl, 150 mM NaCl, 2% (w / v) BSA (pH 7.5)] and stored until use at 4 ° C, as a suspension at 1% (w / v) in this blocking solution.

For the test, 20 μl of the HBcAg coated beads (already diluted 1:20 in blocking solution) were added to 20 μl of human serum (1: 8 in blocking solution) and 160 μl of 3 M urea in dissolution of blocking. After a 10 min incubation. at 37 ° C, the beads were subsequently washed four times with 500 µl of buffer A [50 mM Tris-HCl, 150 mM NaCl, 0.2% Triton X-100, 0.9 ‰ sodium azide (w / v) (pH 8)] and incubated for 10 min. at 37 ° C with 100 µl of a 1 or 2 µg / ml solution of biotinylated recombinant HBcAg expressed from E. coli or P. pastoris respectively. After four additional washes in buffer A, the beads were incubated with 100 µl of a solution containing streptavidin conjugated with alkaline phosphatase, for 10 min. at 37 ° C. After three additional washes, the alkaline phosphatase activity was tested by adding Lumi-Phos® 530 substrate (200 µl) (Lumigen, Inc., Southfield MI, USA) and incubation for 10 min. at 37 ° C. The luminescence was measured with a Leader 450i luminometer (Gene-probe, San Diego, CA, USA).

The results were first expressed as a ratio between the sample signal and the reference signal (s / r). The reference serum corresponds to 0.5 PEI units per ml. The optimum s / r cut-off point was set at 3.0 for the test performed with recombinant yBW63 and 2.6 for the test performed with bOL32 according to the best sensitivity / specificity balance. A sample was considered positive if it had an s / r greater than or equal to the cut-off point value.

2. RESULTS

2.1. Expression of HBcAg in E. coli and purification.

The bOL32 protein corresponds to amino acids 1-185 of the HBc subtype adw2 sequence, already described by Valenzuela et al., 1980, followed by six histidine residues at the C-terminal end and four additional amino acid residues at the end N-terminal due to cloning strategy (figure 1). BOL32 was expressed in E. coli and purified under denaturing conditions using the metal chelate chromatography procedure described in the Materials and methods section.

In preliminary experiments, the HBcAg expressed in E. coli could not bind the metal chelate column under native conditions. The protein had to be denatured using 8 M urea and β-mercaptoethanol to allow binding to the column, suggesting that, under native conditions, the hexahistidine tag located at the C-terminal end was not accessible. In order to increase the renaturation / reoxidation performance of the protein, the purified protein with metal chelates was subjected to dialysis against a folding buffer containing a non-denaturing concentration of urea and reduced / oxidized glutathione as an "exchange system" of oxides ”and was finally stored in a urea-free buffer containing glycerol (see Materials and methods section). The addition of glycerol in the storage buffer was required as a stabilizing additive to prevent precipitation of the recombinant protein. This presumably "renatured" protein was obtained with a yield of 25 mg of HBcAg per liter of initial E. coli culture and was further purified by sedimentation on a sucrose gradient as described in the Materials and Methods section. The final yield after this second purification was approximately 2.5 mg / l of initial E. coli culture.

2.2. Expression of HBcAg in P. pastoris and purification.

The yBW63 protein, corresponding to the complete HBc sequence (Figure 1), was expressed in P. pastoris using the expression vector pPIC3.5K so that gene expression was under the control of the inducible alcohol oxidase (AOX1) promoter by methanol HBcAg yBW63 was purified by heat treatment followed by a sucrose gradient as described in the Materials and methods section. The final yield after this two-stage purification was approximately 50 mg / l of initial P. pastoris culture.

2.3. Characterization of recombinant HBcAg from E. coli and P. pastoris.

The two purified recombinant HBcAg bOL32 and yBW63 were analyzed by SDS-PAGE and Western blot with human serum specific for anti-HBc antibody. Figure 2A-B, lanes 1-2 showed that under reducing conditions, both proteins migrated as the main band with an apparent molecular mass of 20-22 kDa close to the theoretical molecular mass of 21395 and 22650 Da expected respectively for the monomeric protein and BW63 and bOLB32. Western blot analysis also indicated the presence of HBcAg with an apparent molecular mass of 40-44 kDa that should correspond to reducing non-sensitive dimer molecules (Figure 2B, lanes 1, 2). In fact, it has been shown that HBc molecules associate to give dimers and that a disulfide bridge stabilizes the dimeric form but is not required for its formation (Zhou and Standring, 1992). Gel was stained with Coomassie Brillant blue a faint band above the expected size for the HBc bOL32 monomer under reducing conditions (Figure 2A, lane 2) and a faint band below the monomer size. The lower molecular weight band (16 kDa) was slightly reactive with the human polyclonal anti-HBc antibody and probably corresponds to a limited proteolysis of the C-terminal domain of bOL32, while the higher molecular weight band was not reactive which suggests which is a contaminating protein (figure 2). As a result, molecular mass heterogeneity corresponding to dimeric bOL32 molecules was also observed (p22-p22; p22-p16; p16-p16) (Figure 2B, lane 2).

Under non-reducing conditions, both recombinant proteins and BW63 and bOL32 did not enter the gel or migrate in a very wide band with an apparent molecular mass of 40 kDa and higher, consistent with the presence of dimers stabilized by interchain chain disulfide bonds and higher multimers. These results are in agreement with previous reports, showing that the majority of HBcAg polypeptides self assemble to give capsid-like particles composed of dimer molecules stabilized by intermolecular disulfide bonds (Zheng et al., 1992).

From samples of HBcAg expressed in freshly prepared E. coli, directly after chromatography of metal chelates, predominantly monomeric forms were observed with non-reducing SDS-PAGE. The proportion of higher dimers and multimers increased with storage time (not shown) suggesting a time-dependent increase in intermolecular disulfide bound molecules. To limit the variations between batches, a dialysis was introduced in an "oxide exchange" buffer in the HBc purification protocol expressed in E. coli to favor the folding and self-assembly of HBc molecules to give capsid-like particles before of storage (see Materials and methods section).

2.4. N-terminal, molecular, co- or post-translational modification.

The two monomeric recombinant proteins of SDS-PAGE were isolated and subjected to N-terminal amino acid sequencing. Edman's sequencing analysis indicated that the first five amino acids of bOL32 were Met-Arg-Gly-Ser-Met which corresponds to the expected N-terminal sequence (Figure 1). The N-terminal sequence of yBW63 could not be determined using the same procedure suggesting a blocked N-terminal end or N-terminal modification.

In order to confirm the sequence of the two recombinant proteins, proteolytic degradation with trypsin was used followed by MALDI-TOF-MS analysis. Trypsin gel digestion of the reduced and alkylated recombinant proteins (carboxyamidomethylated cysteine) was carried out. The resulting peptides were detected by MALDI-TOF-MS. All peptides related to the bOL32 protein coincided with the theoretical molecular mass of the expected sequences, which allows the verification of the first 153 amino acid residues of bOL32. However, the 150-185 sequence rich in C-terminal arginine could not be verified. In fact, the masses of the fragments induced by trypsin digestion were below the range of our MALDI-TOF-MS (500 amu). The analysis of trypsin-derived yBW63 fragments in a proteolytic manner allows the verification of the 8-149 amino acid sequence. As for the bOL32 protein, the 150-185 sequence rich in C-terminal arginine could not be identified. In addition, the N-terminal peptide was not found with or without the first methionine (aa 1-7 or 2-7 with respective theoretical mass of 881.4 or 750.4) but a 923.4 mass peptide was detected that should correspond to aa 1-7 N-acetylated peptide. The conservation of the first methionine is in accordance with the literature showing that methionine aminopeptidase does not act on proteins with penultimate large residues such as aspartic acid (Polevoda and Sherman, 2000). On the other hand, acetylation is described as one of the most common modifications that occur in the vast majority of eukaryotic proteins but rarely in prokaryotic proteins. The N-acetylation of the yBW63 protein is not surprising since all eukaryotic proteins that start with Met-Asp (such as yBW63) or Met-Glu discovered in literature searches and databases were N-terminal acetylated (Polevoda and Sherman, 2000).

No other co-or post-translational modification was detected in the recombinant proteins. Using a specific staining procedure of phosphorylated proteins directly on SDS-PAGE (described in the Materials and Methods section), no phosphorylation of the bOL32 and yBW63 recombinant proteins (not shown) was shown. These results confirmed those obtained by Machida et al. (1991) which show that the HBcAg proteins expressed in E. coli and yeast were not phosphorylated, while central proteins were found

isolated from human tissues as well as recombinant HBcAg expressed in phosphorylated mammalian or insect cells in serine residues in the C-terminal domain (Lanford and Notvall, 1990; Liao and Ou, 1995). On the other hand, circular dichroism was used to examine the global secondary structures of the two recombinant HBcAg capsids and both particles showed identical spectra (not shown).

2.5 Free thiol groups in recombinant HBcAg proteins.

In order to clarify the possible similarity or difference between bOL32 and HBWA63 of HBcAg, the presence of free thiol groups in these purified recombinant proteins was evaluated by reaction with the Ellman reagent. Under native conditions, 0.322 and 0.235 sulfhydryl groups measurable by bOL32 and yBW63 protein of monomeric HBcAg were found respectively.

2.6. Electron microscopy of the particles of yBW63 and bOL32.

Using electron microscopy, the bOL32 particles showed a spherical native-like particle shape with an average of 34 ± 2 nm in diameter and the particles of yBW63 28 ± 2 nm (n = 15 particles) (see Figure 3).

2.7. Core-nucleic acid interactions.

Electrophoresis of the two recombinant HBcAg on agarose gel stained with ethidium bromide followed by staining with Coomassie Brillant blue showed that the HBcAg particles, purified either from P. pastoris or from

E. coli, contained nucleic acid components (Figure 4AB, lanes 1). The particles of yBW63 migrated as an individual band on agarose gel while the preparation of bOL32 particles migrated as a main band for which the migration was slightly shorter than the migration of yBW63 and two smaller bands (Figure 4B). These discrepancies suggested differences in load or size between the two preparations consistent with the electron microscopy analysis. After DNase digestion, nucleic acids trapped in the particles of yBW63 or bOL32 were not affected (Figure 4AB, compare lanes 1 and 4). After digestion with RNase, the nucleic acid components remained associated with yBW63, indicating the presence of DNase protected DNA or RNAse protected RNA in yBW63 capsids. However, the association of nucleic acids with bOL32 disappeared after treatment with RNase. In addition, the Coomassie Brillant blue-stained agarose gel indicated that the degradation of RNA associated with HBc induced a strong modification in the migration of bOL32 proteins onto agarose gel, suggesting structural modifications of the HBc particles (Figure 4B) after the release of RNA. The presence of RNA and no DNA in HBcAg particles is in agreement with previous results (Birnbaum and Nassal, 1990; Zheng et al., 1992).

2.8. Detection of reactivity of anti-HBc antibody in human serum.

A sandwich-type EIA was prepared for the detection of anti-HBc antibody reactivity in human sera. First, the purified recombinant HBcAg, bOL32 or yBW63, was coated on magnetic microparticles as described in Materials and methods, then the HBcAg coated beads were incubated with human serum (final dilution 1:80 in the presence of urea 2, 4M). After washing, the presence of anti-HBc antibody was revealed using biotin-labeled recombinant HBcAg, homologous to the HBcAg used in the solid phase, followed by an alkaline streptavidin phosphatase conjugate.

The reactivity of recombinant HBcAg against human sera was tested including a panel of 22 negative sera (table I) and a panel of 20 positive sera (table II) well characterized by their reactivity of specific commercial anti-HBc antibodies with EIA.

With the recombinant protein yBW63, anti-HBc antibody was detected in all positive specimens whereas with the bOL32 protein a weak positive serum (# 63) was not detected (table II). Among the negative specimens, selected because they gave false positive results with some commercial EIAs, it was confirmed that all were negative with the sandwich-type EIA performed with yBW63, including the 17 samples containing non-specific sensitive reducing IgM (Table I). However, for samples 86 and 87, which were found to be false positive with VIDAS HBcT I, it was also found to be false positive with bOL32. Among the three samples classified as positive for anti-HBc antibody, samples 43 and 46, positive with the commercial EIAs performed, were confirmed as positive with the sandwich-type EIA performed with both recombinant proteins. Sample 98, for which it was found to be positive for anti-HBc antibody with VIDAS HBcT I and negative with current anti-HBc antibody EIAs was also found to be positive for anti-HBc IgM antibody (25 PEI unit / ml ) by means of the HBcM VIDAS and positive in the sandwich-type assay performed with both recombinant proteins. Although the clinical importance of detecting anti-HBc antibody in the absence of other HBV markers is uncertain (Luo et al., 1991), this sample is probably false negative with most current commercial trials but it was isolated and identified as an anti-HBV antibody. -HBc through our sandwich test.

Therefore, the sandwich-type EIA performed with the bOL32 protein seemed to suffer a lower sensitivity and specificity than the test performed with the yBW63 protein since a false negative result and two false positive results were obtained using the bOL32 protein.

TABLE I: Negative panel, results obtained with the sandwich type EIA of anti-HBc antibody performed with recombinant yBW63 and bOL32 of HBcAg.

Results of anti-HBc antibody

Serum No.

EIA sells a b Sandwich type EIA with YBW63 bOL32

51, 94

- - - -

39, 40, 41, 71, 76, 77, 79, 80, 81, 83, 84, 85, 88, 89, 99

3- -, D or + - -

86, 87

3- 1-, 1+ - +

fifty

3+ 2-, 1D, 1+ - -

70

1-, 2+ 3-, 1+ - -

82

1-, 1D, 1+ 1-, 3D - -

Results indicated as + positive, - negative or D, doubtful based on the cut-off point for each trial.

10 a, commercial EIA between IMx Core ™, AxSYM Core and Elecsys anti-HBc, that is, including serum pretreatment with DTT. b, Commercial EIA between VIDAS HBcT I or II and ORTHO ™ HBc, Monolisa anti-HBc and Corzyme. a When discrepancies were observed regarding the results of anti-HBc antibody, the number of positive or negative results obtained with the different commercial EIAs of anti antibody was specified

15 HBc performed.

TABLE II: Positive panel, comparison of HBV serological markers and results obtained with the sandwich type EIA of anti-HBc antibody performed with recombinant yBW63 and bOL32 of HBcAg.

Results of anti-HBc antibody

Other HBV specific serological markers

State

serum # EIA commercializes a b Sandwich type EIA with yBW63 bOL32 HBcAg  anti-HBs antibody anti-HBe antibody

Positive Recovered

5, 12, 19, 23, 24, 26, 90 + + + + - + +

Four. Five

 + + + + - + -

63

 3+ 3+ + - - + +

Chronic positive

52  + + + + + - +

54

 + + + + + + +

56, 59, 62, 65, 68, 97

+ + + + + - -

HBc isolated

43, 46 + + + + - - -

98

 3- 1+, 1 + + - - -

20 Results indicated as + positive or - negative based on the cut-off point for each trial. a, commercial EIA performed between IMx Core ™, AxSYM Core and Elecsys anti-HBc, that is, including serum pretreatment with DTT. b, Commercial EIA conducted between VIDAS HBcT I and II, ORTHO ™ HBc ELISA, Monolisa anti-HBc and Corzyme.

25 a When discrepancies regarding the result of anti-HBc antibody were observed, the number of positive or negative results obtained with the different commercial anti-HBc antibody tests performed was specified.

To further assess the specificity of the developed sandwich immunoassay, it was tested

30 a population of 184 serum samples from healthy individuals (blood donors) with the recombinant protein and BW63 (see table III). With a cut-off point adjustment at s / r = 3, the 184 specimens were identified as negative, their values of s / r being much lower than the cut-off point (table III). These results assumed a specificity of 100% for the sandwich type EIA made with the protein yBW63.

TABLE III: Anti-HBc antibody reactivity in blood donor sera (n = 184) using ybW63 of P. pastoris HBcAg in a sandwich-type EIA.

Serum

Sample ratio with respect to reference

N = 180

0.08-0.68 average value: 0.19

n = 4

0.75-1.07

known negative # 51

0.17 ± 0.08b

positive known # 45

20.15 ± 4.45b

cutting point = 3 bmedia of 15 tests

3. DISCUSSION

It has been previously shown that the 40 basic C-terminal residues of recombinant HBcAg are not required for capsid assembly (Milich et al., 1988; Gallina et al., 1989) but enhance the stability of the capsid. Several groups have described that the fusion of heterologous sequences to the C-terminal end allows in some cases the detection of heterologous sequences with specific antibodies indicating the external location of the foreign epitopes (Borisova et al., 1989; von Brunn et al., 1993; Yoshikawa et al., 1993). Since HBc capsids contain holes on their particulate surfaces (Böttcher et al., 1997; Conway et al., 1997), it was speculated that the foreign polypeptide chains exited through the holes thus becoming located on the surface and being accessible to antibodies. Therefore, it was believed that a C-terminal hexahistidine tag would be less vulnerable to the HBcAg structure and would be more exposed on the particle surface than an N-terminal extension previously described as being inaccessible to the surface (Karpenko et al. , 1997). However, our results showed that the C-terminal hexahistidine tag could not be achieved for purification purposes on the surface of the denatured particles and was probably located within the capsid shell as suggested by Wingfield et al. (1995) or alternatively it was not accessible in folded structures erroneously expressed in E. coli.

Zheng et al. (1992) have shown that disulfide bond formation is not essential for the assembly of the HBcAg capsid. It is a maturation procedure; The protein initially assembled in the reducing environment of the E. coli cytoplasm is probably completely reduced, but during isolation and storage, oxidation occurs, which especially implies highly reactive C-terminal cysteines. Our results obtained with the HBc expressed in E. coli are mainly in agreement with these observations showing that the purified HBc under denaturing and reducing conditions could reform the nucleocapsids taking advantage of the self-assembly properties of HBcAg.

HBcAg has four cysteine residues, so a large number of possible disulfide binding patterns are possible. There are no intra-chain disulfide bonds but two or three inter-chain disulfide bonds can occur (Zheng et al., 1992). The Cys183 residue is always involved in a disulfide bond with another Cys183, resulting in the formation of a dimer. These pairs of dimers are linked by homologous intermolecular disulfide bridges between two Cys61 residues (Zheng et al., 1992). Cys107 exists as a hidden free sulfhydryl within the particle structure and is not reactive under non-denaturing conditions while Cys48 can participate in disulfide bonding between the same monomers as those bound by Cys61 and exists as both disulfide and free sulfhydryl in approximately equal amounts (Zheng et al., 1992). The proportion of free sulfhydryl groups that were measured by bOL32 and yBW63 monomer of HBcAg (0.372 and 0.235 respectively) was lower than that found by Zheng et al. (1992). In addition, it was observed that nucleic acids trapped with the yBW63 particles were better protected than those associated with bOL32 particles. These results suggest that the binding of additive disulfide in yBW63, which probably involves Cys48s, could contribute to further stabilization of HBcAg particles and explain the superior stability of the yBW63 particles that were observed in comparison to bOL32. Alternatively, C-terminal hexahistidine and / or the N-terminal extension of bOL32 could imply an increase in the size of the holes that penetrate the assembled particle protein shell (Crowther et al., 1994) allowing accessibility of RNase to RNA associated with HBc.

It has been reported that the central particles of the hepatitis B virus native to human liver visualized by negative staining have diameters of 27-30 nm and an icosahedral appearance (Onodera et al., 1982). Similar dimensions and morphologies have also been reported for recombinant capsids produced in E. coli (Winfield et al., 1995) or eukaryotic cells (Yamaguchi et al., 1988; Zhou and Strandring, 1991) and confirmed by electron microscopy (Crowther et al., 1994). The observation of the particles of yBW63 expressed in

P. pastoris agree with a diameter of 28 ± 2 nm while bOL32 particles appeared slightly larger with a diameter of 34 ± 2 nm. This difference could be caused by the

sequence modifications introduced into the bOL32 construct (4 amino acids added in an N-terminal manner and 6 histidines in a C-terminal manner).

The global discrepancies observed between the bOL32 and yBW63 of HBcAg (difference in accessibility of RNase,

5 amount of free sulfhydryl groups, particle size) were associated with differences in the yields of these proteins as the main component in the developed sandwich EIA. E. coli bOL32 protein, compared to yeast protein and BW63, provided lower sensitivity and specificity. This could be due to an incomplete in vitro folding of bOL32 after its denaturing purification procedure, which is suggested by the higher proportion of free thiol groups found for bOL32 compared to yBW63.

In addition, the presence of remaining E. coli contaminating protein in the bOL32 preparation as assessed by Figure 2 could explain the lower specificity of bOL32.

However, the HBcAg expressed in P. pastoris allowed the high-yield production (50 mg / l of initial P. pastoris culture) of high-quality recombinant HBcAg allowing the development of a sandwich-type EIA of anti-antibody antibody. HBc which, unlike the competitive EIA, avoids the use of anti-HBc antibody. Preliminary results indicate that this assay could reduce the frequency of false positive results that result from interference substances in human sera observed with some commercial EIAs (see Table I). The sandwich-type assay could also avoid false negative results that could be explained by the presence of antibodies against non-immunodominant epitopes (see table II). In fact, current competition or inhibition format assays are based on observation regarding the presence of an immunodominant epitope in HBcAg. However, other minor epitopes have been described (Salfeld et al., 1989; Pujol et al., 1994; Pusko et al., 1994). Therefore, it could be speculated that the use in the current inhibition assay of anti-HBc antibody directed against the immunodominant epitope may mediate in some cases only a partial inhibition of human serum binding that contains antibodies against non-immunodominant epitope in an EIA.

25 competitive and therefore implies a false negative result.

Bibliography

Arakawa et al., 1966, J. Biochem 120: 657-662. 30 Bird et al., 1988, Science 242: 423-426.

Birnbaum, F. and Nassal, M. 1990. Hepatitis B virus nucleocapsid assembly: primary structure requirements in the core protein. J. Virol. 64: 3319-3330. 35 Blazar et al., 1997, Journal of Immunology 159: 5821-5833 and Bird et al., 1988, Science 242: 423-426.

Borisova, GP, Berzins, I., Pushko, PM, Pumpen, P., Gren, EJ, Tsibinogin, VV, Loseva, V., Ose, V., Ulrich, R., Siakkou, H. and Rosenthal HA, 1989 Recombinant core particles of hepatitis B virus exposing foreign antigenic 40 determinants on their surface. FEBS Lett. 259, 121-124.

Böttcher, B., Wynne, S. A. and Crowther, R. A., 1997. Determination of the fold of the core protein of hepatitis B virus by electron cryomicroscopy. Nature 386, 88-91.

45 Chaudray et al., 1989, Nature 339: 394-397.

Cheynet, V., Verrier, B. and Mallet, F., 1993. Overexpression of HIV-1 proteins in Escherichia coli by a modified expression vector and their one-step purification. Prot. Expr. Purif. 4, 367-372.

50 Cohen, B. J. and Richmond, J. E., 1982. Electron microscopy of hepatitis B core antigen synthesized in E. coli. Nature 296, 677-678.

Conway, J. F., Cheng, N., Zlotnick, A., Wingfield, P. T., Stahl, S. J. and Steven, A. C., 1997. Visualization of a 4-helix bundle in the hepatitis B virus capsid by cryo-electron microscopy. Nature 386, 91-94.

55 Crowther, R. A., Kiselev, N. A., Böttcher, B., Berriman, J. A., Borisova, G. P., Ose, V. and Pumpens, P., 1994. Three-Dimensional structure of hepatitis B virus core particles determined by electron cryomicroscopy. Cell 77, 943-950.

Dodd, R. Y. and Popovsky, M. A., 1991. Antibodies to hepatitis B core antigen and the infectivity of the blood supply. 60 Scientific Section Coordinating Committee [published errata appears in Transfusion September 1991; 31 (7): 594]. Transfusion 31, 443-449.

Galfre G. et al., 1977 Nature, 266: 522-550.

Gallina, A., Bonelli, F., Zentilin, L., Rindi, G., Muttini, M. and Milanesi, G., 1989. A recombinant hepatitis B core antigen polypeptide with the protamine-like domain deleted self-assembles into capsid particles but fails to bind nucleic acids.

J. Virol. 63, 4645-4652.

Karpenko, L. I., Ryazankin, I. A., Chikaev, N. A., Kolesnikova, L. V. and Hyichev, A. A., 1997. Localization of the amino terminus of the hepatitis B virus core antigen within the core particle. Virus Res. 52, 15-23.

Kenney, J. M., von Bonsdorff, C. H., Nassal, M. and Fuller, S. D., 1995. Evolutionary conservation in the hepatitis B virus core structure: comparison of human and duck cores. Structure 3, 1009-1019.

Köhler G. and Milstein C., 1975: Continuous culture of fused cells secreting antibody of predefined specificity, Nature

256: 495-497.

Lanford, R. E. and Notvall, L., 1990. Expression of Hepatitis B Virus Core and Precore Antigens in Insects Cells and Characterization of a Core-Associated Kinase Activity. Virology 176, 222-233.

Liao, W. and Ou, J. H., 1995. Phosphorylation and nuclear localization of the hepatitis B virus core protein: significance of serine in the three repeated SPRRR motifs. J. Virol. 69, 1025-1029.

Luo, K. X., Zhou, R., He, C., Liang, Z. S., and Jiang, S. B., 1991. Hepatitis B virus DNA in sera of virus carriers positive exclusively for antibodies to the hepatitis B core antigen. J. Med. Virol. 35, 55-59.

Machida, A., Ohnuma, H., Tsuda. F., Yoshizawa, H., Hoshi, Y., Tanaka, T., Kishimoto, S., Akahane, Y., Miyakawa, Y. and Mayumi, M., 1991. Phosphorylation in the carboxy-terminal domain of the capsid perotein of hepatitis B virus: evaluation with a monoclonal antibody. J. Virol. 65, 6024-6030.

Milich, D. R., Chen, M., Schodel, F., Peterson, D. L., Jones, J. E. and Hughes, J. L., 1997a. Role of B cells in antigen presentation of the hepatitis B core. Proc. Natl Acad. Sci U S A 94, 14648-14653.

Milich, D. R., McLachlan, A., Stahl, S., Wingfield, P., Thornton, G. B., Hughes, J. L. and Jones, J. E., 1988. Comparative immunogenicity of hepatitis B virus core and E antigens. J. Immunol. 141, 3617-3624.

Milich, D. R., Schodel, F., Hughes, J. L., Jones, J. E. and Peterson, D. L., 1997b. The hepatitis B virus core and e antigens elicit different Th cell subsets: antigen structure can affect Th cell phenotype. J. Virol. 71, 2192-2201.

Naito, M., Ishii, K., Nakamura, Y., Kobayashi, M., Takada, S. and Koike, K., 1997. Simple method for efficient production of hepatitis B virus core antigen in Escherichia coli. Res. Virol. 148, 299-305.

Nassal, M. and Schaller, H., 1993. Hepatitis B virus replication. Trends Microbiol. 1, 221-228.

Onodera, S., Ohori, H., Yamaki, M. and Ishida, N., 1982. Electron microscopy of human hepatitis B virus cores by negative staining-carbon film technique. J. Med. Virol. 10, 147-155.

Pasek, M., Goto, T., Gilbert, W., Zink, B., Schaller, H., MacKay, P., Leadbetter, G. and Murray, K., 1979. Hepatitis B virus genes and their expression in E. coli. Nature 282, 575-579.

Polevoda, B. and Sherman, F., 2000. Nalpha -terminal acetylation of eukaryotic proteins. J. Biol. Chem. 275, 3647936482.

Pujol, F. H., Bertolotti, A., Fields, H. A., Khudyakov, Y. E., Kalinina, T. I. and Liprandi, F., 1994. A monoclonal inhibition enzyme immunoassay for detection of antibodies against hepatitis B core antigen: confirmation of an immunodominant epitope. J. Immunoassay 15, 239-249.

Pushko, P., Sallberg, M., Borisova, G., Ruden, U., Bichko, V., Wahren, B., Pumpens, P. and Magnius, L., 1994. Identification of hepatitis B virus core protein regions exposed or internalized at the surface of HBcAg particles by scanning with monoclonal antibodies. Virology 202, 912-920.

Robertson, EF, Weare, JA, Randell, R., Holland, PV, Madsen, G. and Decker, RH, 1991. Characterization of a reduction-sensitive factor from human plasma responsible for apparent false activity in competitive assays for antibody to hepatitis B core antigen. J. Clin. Microbiol 29, 605-610.

Roda A., Bolelli G.F .: Production of high-titre antibody to bile acids, Journal of Steroid Biochemistry, vol. 13, p. 449-454 (1980).

Salfeld, J., Pfaff, E., Noah, M. and Schaller, H., 1989. Antigenic determinants and functional domains in core antigen and e antigen from hepatitis B virus. J. Virol. 63, 798-808.

Schleif, R. F. and Wensink, P. C., 1981. Practicals Methods in Molecular Biology. New York, Springer-Verlag, p. 74.

Spronk, AM, Schmidt, L., Krenc, C., Pavlis-Jenkins, L., Brady, J., Taskar, S., Angus-Finn, L. and Mimms, L., 1991. 5 Improvements in detection of antibody to hepatitis B core antigen by treating specimens with reducing agent in an automated microparticle enzyme immunoassay. J. Clin. Microbiol 29,611-616.

Valenzuela, P., Quiroga, M., Zalvidar, J., Gray, P. and Rutter, W.J. 1980. The nucleotide sequence of the hepatitis B viral genome and the identification of the major viral genes Animal Virus Genetics, 57-70, Fields, B.N., Jaenisch, R. and 10 Fox, C.F. (Eds.) Academic Press, New York

von Brunn, A., Brand, M., Reichhuber, C., Morys-Wortmann, C., Deinhardt, F. and Schodel, F., 1993 .: Principal neutralizing domain of HIV-1 is highly immunogenic when expressed on the surface of hepatitis B core particles. Vaccine 11, 817-824.

15 Weare, J. A., Robertson, E. F., Madsen, G., Hu, R. and Decker, R. H., 1991. Improvement in the specificity of assays for detection of antibody to hepatitis B core antigen. J. Clin. Microbiol 29, 600-604.

Wingfield, P. T., Stahl, S. J., Williams, R. W. and Steven, A. C., 1995 .: Hepatitis core antigen produced in Escherichia 20 coli: Subunit composition, conformational analysis, and in vitro capsid assembly. Biochemistry 34, 4919-4932.

Wizemann, H. and von Brunn, A., 1999. Purification of E. coli-expressed HIS-tagged hepatitis B core antigen by Ni2 + chelate affinity chromatography. J. Virol. Methods 77, 189-197.

25 Wynne, S. A., Crowther, R. A. and Leslie, A. G., 1999. The crystal structure of the human hepatitis B virus capsid. Mol. Cell 3, 771-780.

Yamaguchi, M., Hirano, T., Sugahara, K., Mizokami, H., Araki, M. and Matsubara, K., 1988. Electron microscopy of hepatitis B virus core antigen expressing yeast cells by freeze-substitution fixation. Eur. J. Cell Biol. 47, 138-143.

30 Yoshikawa, A., Tanaka, T., Hoshi, Y., Kato, N., Tachibana, K., lizuka, H., Machida, A., Okamoto, H., Yamasaki, M., Miyakawa, Y. , and., 1993. Chimeric hepatitis B virus core particles with parts or copies of the hepatitis C virus core protein. J. Virol. 67, 6064-6070.

35 Zheng, J., Schodel, F. and Peterson, D. L., 1992. The structure of hepadnaviral core antigens. Identification of free thiols and determination of the disulfide bonding pattern. J. Biol. Chem. 267, 9422-9429.

Zhou, S. and Standring, D. N., 1992. Cys residues of the hepatitis B virus capsid protein are not essential for the assembly of viral core particles but can influence their stability. J. Virol. 66, 5393-5398. 40

Claims (2)

1. Procedure for the detection of anti-HBc antibodies in a biological sample to be tested, such as blood, plasma or serum, of an individual or an animal that is likely to be infected or has been infected with HBV, according to which at least the following stages are carried out:

-

a mixture is prepared, comprising:

i) a highly purified recombinant HBcAg protein, the protein being produced by expression 10 of Pichia yeast cells, through the use of an expression system or cassette that allows the expression of HBc DNA or fragments thereof encoding HBcAg, placed under the control of elements necessary for its expression, wherein said recombinant HBcAg protein is immobilized on a solid support, (ii) the sample to be tested comprising, if present, anti-HBc antibodies, (iii) a labeled ligand that may react with the sample anti-HBc antibodies; being the ligand labeled said labeled recombinant HBcAg protein produced by expression in Pichia yeast cells

-

the mixture is incubated for a predetermined time;

-

the solid phase is separated from the liquid phase; and 25

-

The possible presence of anti-HBc antibodies is revealed by measuring the level of labeling in the solid phase.

2. A method according to claim 1, wherein the recombinant HBcAg protein is produced by the expression in yeast cells selected from the group consisting of Pichia pastoris and Pichia 30 methanolica.