ES2385905A1 - Method of detection and quantification of the pathogenic races of the fusarium fusarium oxysporum f. Sp. Ciceris. (Machine-translation by Google Translate, not legally binding) - Google Patents

Abstract

Method of detection and quantification of the pathogenic races of the fungus fusarium oxysporum f. Sp. Ciceris The present invention provides a method, based on conventional or quantitative real-time pcr (qpcr), reliable, rapid, accurate and reproducible for the detection and quantification of any of the eight pathogenic races of the fungus fusarium oxysporum f. Sp. Ciceris (0, 1a, 1b/c, 2, 3, 4, 5 or 6) in an isolated biological sample. Said method allows the detection and quantification of at least 1 pg of pathogen dna in complex biological samples including different tissues of the chickpea plant and infested soils, without its accuracy and efficacy being altered. The invention also relates to two pairs of primers useful for carrying out the method of the invention. (Machine-translation by Google Translate, not legally binding)

Description

Method of detection and quantification of the pathogenic races of the fungus Fusarium oxysporum f. sp. ciceris

The present invention falls within the field of molecular biology and

5 agriculture, specifically within the PCR-based methods for the detection and quantification of the pathogenic races of the fungus Fusaríum oxysporum f. sp. citrus in isolated biological samples of chickpea plants and in soil.

1 OR STATE OF THE PREVIOUS TECHNIQUE

Chickpea (Cícer aríetínum L.) is an important source of human and animal food, and helps increase soil fertility, especially in arid and semi-arid tropical areas where its production is concentrated. 15 It is described as the third largest legume crop in the world after beans (Phaseolus vulgarís L.) and peas (Písum satívum L.). Chickpea Vascular Fusariosis, caused by F. oxysporum Schlechtend. emend W. C. Snyder. & H. N. Hans. F. sp. Ciccerís (Padwick) W. C. Snyder & H.

N. Hans., Is the most important disease caused by pathogens

20 that inhabit the soil that limits chickpea production worldwide, but mainly in the Mediterranean basin and the Indian subcontinent. Annual yield losses from this disease have been estimated between 10 and 15%, but the epidemics of Vascular Fusariosis can be devastating causing 100% losses under favorable conditions. In

In particular, the disease attacks are devastating if they occur under conditions of high temperature cultivation and water stress during the seed reproduction and filling phases.

F. oxysporum f. sp. Cícerís shows a high pathogenic variability. Until the

30 date eight pathogenic races have been described in F. oxysporum f. sp. Ciccerís (races O, 1A, 1B / C, 2, 3, 4, 5 and 6) (Cabrera de la Colina et al., 1985, Int. Chíckpea Newsl., 13: 24-26; Haware and Nene, 1982, Plant Hear yourself, 66: 809-810;

3d

Jiménez-Díaz et al., 1993, Proc. Eur. Sem. Fusaríum Mycotoxíns, Taxonomy, Pathogenícíty and Host Resístance, Radzíkóv, Poland: Plant Breedíng and Acclímatízatíon Instítute, pp 87-94), which can be grouped into the wilting and yellowing patotypes based on the symptoms they induce in pathogenicity tests. The yellowish patotype induces progressive leaf yellowing with vascular discoloration, followed by the death of the plant within 40 days after inoculation. The wilt pattern induces severe chlorosis and sagging, vascular discoloration and death of the plant within 20 days after inoculation. Races O and 1 B / C belong to the yellowness patotype and are considered less virulent compared to races 1 A and 2 to 6 that belong to the wilt patotype and are considered more virulent. Races 2, 3 and 4 have only been described in India, while races O, 1 B / C, 5 and 6 are mainly found in the Mediterranean basin and in California. Race 1 A has been described in India, California, and the Mediterranean basin.

The use of resistant cultivars is one of the few measures available and the most effective for the management of chickpea Vascular Fusariosis, however, its use is not widespread due to the presence of undesirable agronomic characteristics in some of the cultivars developed , and the high pathogenic variability in the populations of F. oxysporum f. sp. You may limit the effectiveness or extensive use of the resistance available. Several sources of race-specific resistance to Vascular Fusariosis have been identified and have been used in several chickpea improvement programs, which have allowed the development of a limited number of chickpea germplasm with operational resistance against specific breeds of this pathogen. Although the characterization of pathogenic races of F. oxysporum f. sp. Ciccerís is well established, the genetics of resistance to each of these races has not yet been fully clarified. Therefore, the proper characterization of the resistance of chickpea lines and cultivars to specific breeds of F. oxysporum f. sp. Cicceris is essential for the use of resistance.

While the isolates of F. oxysporum f. sp. The cherries can be identified or assigned to races by different protocols based on the Polymerase Chain Reaction (PCR) (García-Pedrajas et al., 1999, European Journal of Plant Pathology, 105: 251-259; Jiménez-Gasco et al ., 2001, European Journal of Plant Pathology, 107: 237-248; Jiménez-Gasco and Jiménez-Díaz, 2003, Phytopathology, 93: 200-209; Kelly et al., 1998, Physiological and Molecular Plant Pathology, 52: 397 -409; ES2193861 81), the characterization of resistance reactions in chickpea germplasm depends on the traditional pathogenicity bioassays. This method of resistance characterization is conceptually simple but expensive in time (from 50 to 60 days), facilities and resources needed. In addition, the development of the disease during pathogenic typing can be influenced by several factors (for example, soil moisture and inoculum density of the pathogen), as well as temperature, which has been shown to influence the expression of resistance or susceptibility of chickpea cultivars to Vascular Fusariosis. Consequently, the lack of adjustment of these sources of variability can lead to the incorrect identification of breeds of F. oxysporum f. sp. or the incorrect appreciation of resistance in chickpea genotypes. Therefore, new methods are needed for rapid, reliable and reproducible identification, and for quantification, of the pathogen in plant tissues, mainly in the stem, which would be evidence of vascular infection, and therefore, could facilitate the Evaluation of the complete resistance response of the chickpea genotypes to their pathogenic races. On the other hand, it would also be useful to have a method to quantify the inoculum of the pathogen in the soil and thus help in the choice of free soils or with low inoculum contents of the pathogen and the use of chickpea seeds free of it. Quantitative PCR protocols have allowed the exact and independent quantification of culture media of a variety of microorganisms associated with soil or plants, including plant pathogens of plant tissues, seeds and soils. In various studies, in which a large collection of isolates of F. oxysporum f. sp. cícerís from all over the world, PCR methodologies based on the Random Polymorphic Amplification of the AON (RAPO), as well as specific primers, which allow the characterization of the specíalís citcerís form of F. oxysporum, its pathotypes and some of the eight described breeds of the pathogen (García-Pedrajas et al., 1999, European Journal of Plant Pathology, 105: 251-259; Kelly et al., 1998, Physiological and Molecular Plant Pathology, 52: 397-409; ES2193861 81; Jiménez-Gasco et al., 2001, European Journal of Plant Pathology, 107: 237-248; Jiménez-Gasco and Jiménez-Oíaz, 2003, Phytopathology, 93: 200209). However, although some of these protocols have been developed to be applied both in plant and in soil (Kelly et al., 1998, Physiological and Molecular Plant Pathology, 52: 397-409; ES2193861 81; García-Pedrajas et al., 1999, European Journal of Plant Pathology, 105: 251259), the main limitation of these is that they do not allow quantifying the pathogen in the soil or its level of infection in the plant. Solving this limitation would be particularly useful for: (i) discriminating between resistant and susceptible chickpea germplasm in improvement programs by quantifying symptomatic and asymptomatic infections, (ii) correlating the amount of pathogen in the tissues of infected plants with the level subsequent development of the disease (expression of symptoms) in resistant or tolerant germplasm and / or the subsequent use of other measures (biological, physical or chemical) to control the disease, and (iii) the selection of crop soils with quantities not detectable or minimal of the pathogenic agent.

Therefore, the availability of a protocol to detect and quantify any of the eight pathogenic races of Fusaríum oxysporum f. sp. Soils and chickpea tissue in the soil may be of great importance in epidemiological studies, quarantine and genetic improvement programs for the development of race-specific resistance to Vascular Fusariosis.

Therefore, there is a need to develop a protocol that allows selectively identifying isolates belonging to any of the eight races of F. oxysporum f. sp. zyceris, against non-pathogenic isolates of F.

oxysporum, against other special forms of F. oxysporum and against other Fusarium spp., in complex environmental samples such as plant and soil tissues, and at the same time allow the quantification of the DNA of any race of the pathogen present in them .

DESCRIPTION OF THE INVENTION

The present invention provides a method, based on conventional or quantitative real-time PCR (qPCR), reliable, fast, accurate and reproducible for the detection and quantification of any of the eight pathogenic races of the fungus Fusarium oxysporum f. sp. ciceris (O, 1A, 1 B / C, 2, 3, 4, 5 or 6) in an isolated biological sample. Said method, hereafter "method of the invention", allows the detection and quantification of, at least, but not limited to, 1 pg of pathogen DNA in complex biological samples including, but not limited to, different tissues of the plant. Chickpea and infested soils, without their accuracy and effectiveness being altered.

The information obtained by the method of the invention is not only useful for the identification of Fusarium oxysporum f. sp. ciceris in plants or in soils infested by their pathogenic races, but also, since the amount of pathogen DNA in plants at the beginning of the development of Vascular Fusariosis symptoms is correlated with the final incidence of dead plants due to the disease This method is also useful in the early prediction of resistance / susceptibility of chickpea cultivars to specific breeds of this fungus, as well as in the assessment of the risk of chickpea crops from suffering Vascular Fusariosis by analyzing the soil in which they find and in the selection of agricultural soils free of the presence of the pathogen or with minimum inoculum levels of it.

Thus, one aspect of the invention relates to a method of detection and quantification of any of the pathogenic races of the Fusarium fungus.

oxysporum f. sp. cherries in an isolated biological sample, or method of

invention or protocol of the invention, comprising:

to.

extract the AON from an isolated biological sample,

b.

contacting the AON extracted in step (a) with a reaction mixture comprising a pair of primers capable of amplifying SEO ID NO: 1 or SEO ID NO: 2,

C.

amplify SEO ID NO: 1 or SEO ID NO: 2, and

d.

detect and / or quantify the amplification product obtained in step (c).

Fusaríum oxysporum f. sp. cícerís, belongs to the Ascomycotic division, Sordaríomícetes class, subclass Hípocreomícetídae, order Hípocreales, group Mitospóricos Hípocreales, Fusaríum genus, Fusaríum oxysporum species. It is the causative pathogen of chickpea Vascular Fusariosis and has a high diversity, having described eight pathogenic races of Fusaríum oxysporum f. sp. Cicceris: O, 1A, 1 B / C, 2, 3, 4, 5 and 6.

The term "isolated biological sample", as used in the description, refers to, but is not limited to, tissues and / or biological fluids of a plant as well as samples from soil, obtained by any method known by a expert in the field that serves this purpose. The biological sample can be a tissue from, for example, but not limited to, a stem or root of a chickpea plant, or it can be a biological fluid from that plant, and it can also be a fresh or frozen sample. Therefore, in a preferred embodiment of this aspect of the invention, the biological sample isolated from step (a) comes from soil or from a chickpea plant. In a more preferred embodiment, the isolated biological sample from a chickpea plant comes from the root or stem.

It is understood by "chickpea", "chícharo" or "Cícer aríetínum L.", the legume of the Fabáceas family, widespread, for example, in India and in the Mediterranean area. It is a herbaceous plant, with white flowers, pale or purple lilac (depending on the variety) that develop a pod inside whose seeds are, usually one. Chickpea is an annual diploid plant, its reproduction is by autogamy and has a chromosomal number of 2n = 16. The roots deepen the soil considerably, hence it develops well in semi-arid conditions

or in arid or dry soils.

The extraction of the AON from an isolated biological sample can be carried out by protocols known to a person skilled in the art, for example, but not limited to, by QIAmp ONA kit, Qiagen, Hilden, Germany; ONA Isolation Kit, G-Spin ™ IIp Plant Genomic ONA Extraction Kit, Fast-Prep FP-120, MoBio Ultra Clea n ™ Soil ONA Isolation, etc.

Once extracted, the AON of the isolated biological sample is contacted with a reaction mixture for the enzymatic amplification of the AON, which comprises, in addition to primers capable of amplifying SEO ID NO: 1 or primers capable of amplifying the SEO ID NO: 2, the reagents necessary for performing a conventional or quantitative real-time PCR, for example, but not limited to, ultrapure water, dNTPs (dATP, dCTP, dGTP and dTTP), a buffer suitable for the reaction of Enzymatic amplification, a thermostable AON polymerase, a magnesium salt, etc. and in the case of quantitative real-time PCR, in addition, one or more fluorochromes

or probes. Probes commonly used for real-time PCR are, but not limited to, TaqMan, Molecular Beacons or Scorpion probes.

For the amplification of SEO ID NO: 1 or SEO ID NO: 2, numerous primers complementary to the 5'and 3'ends of said nucleotide sequences can be designed by methods well known to those skilled in the art. Thus, such primers can be designed, for example, but not limited to, using Bionumerics 6.0 software (Applied Maths, Belgium). However, when designing primers it is necessary to make a series of predictions, such as melting temperature (Tm), the presence of undesirable pairs (a) or the possibility of fork formation

(b)

that can reduce, by competition, the effectiveness of pairing with the target AON sequence. Thus, in another preferred embodiment the primers of step (b) of the method of the invention capable of amplifying the SEO ID NO: 1 are the nucleotide sequence primers SEO ID NO: 3 and SEO ID NO: 4. In another preferred embodiment , the primers of step (b) of the method of the invention capable of amplifying the SEO ID NO: 2 are the nucleotide sequence primers SEO ID NO: 5 and SEO ID NO: 6.

Enzymatic amplification of SEO ID NO: 1 or SEO ID NO: 2 can be carried out by using conventional techniques, preferably by conventional or quantitative real-time PCR (qPCR), under conditions in which these sequences amplifiers, which may or may not be present in the AON extracted in step (a) of the method of the invention, are amplified to generate the corresponding amplification products. Thus, in another preferred embodiment, step amplification

(C)

of the method of the invention is carried out by quantitative real-time PCR or qPCR.

For the detection of the enzyme amplification product obtained in the step

(c) of the method of the invention, it can be separated and analyzed by any conventional method that serves this purpose. In another preferred embodiment, the enzyme amplification product obtained in step (c) is separated by agarose, acrylamide gel electrophoresis or, in general, in any matrix to which an electric current that allows separation of molecules can be applied; and is visualized by conventional methods, for example, but not limited to, by ultraviolet light after staining with ethidium bromide.

For the quantification of the enzyme amplification product obtained in step "c" of the method of the invention, it is necessary that the previous step of amplification be performed by quantitative PCR, also called qPCR, QPCR or real-time PCR, which is a variant of the PCR used to amplify and simultaneously quantify the amplification product absolutely. For this purpose, it uses the same components as the conventional PCR in the reaction mixture, and also a substance marked with a fluorophore that, in a thermocycler that houses sensors to measure fluorescence after exciting the fluorophore at the appropriate wavelength, allows measuring the rate of generation of one or more specific products. This measurement can be performed after each amplification cycle. Quantification can be done in absolute or relative terms. In the first case, the strategy is to relate the amplification signal obtained with the DNA content using a calibration curve; For this approach it is crucial that the PCR of the sample and the elements of the calibration line have the same amplification efficiency. Relative quantification is easier to perform, since it does not require a calibration curve, and is based on the comparison between the amplified amount of the sequence of interest versus a control gene or nucleotide sequence (also called reference, internal or normalizer or housekeeping gene).

Therefore, unlike conventional PCR, real-time quantitative PCR allows quantification of the level of amplification product obtained at any time of amplification by means of the fluorescence signal (in fact, by its level over a threshold). Fluorescence values, expressed as logarithms in order to easily study the exponential phase of amplification, which appears as a straight line by graphically depicting the logarithm of the fluorescence against the cycle number; This segment, called the quantifiable segment, allows you to assess the amount of initial DNA.

In another preferred embodiment, the pathogenic races of the fungus Fusarium oxysporum f. sp. ciceris that the method of the invention allows to detect and

quantify in an isolated biological sample, are selected from the list that

It comprises: O, 1A, 1B / C, 2, 3, 4, 5 or 6.

As can be seen in the examples, the method of the invention makes it possible to clearly distinguish susceptible and resistant reactions in chickpea cultivars to breeds of the pathogen at very early stages after infection (for example, but not limited to, 15 days after sowing ), as well as differences in the virulence of the pathogen races. The examples also show that the method of the invention makes it possible to identify, before the expression of disease symptoms is evident, resistance / susceptibility in infected chickpea cultivars based on the amount of AON of F. oxysporum f. sp. citrus trees present in the root of the plant. In addition, the level of susceptibility to Vascular Fusariosis, indicated by the incidence of dead plants at the end of the growing season, is highly, positively and significantly correlated with the amount of AON of the quantified pathogen in the chickpea root. Thus, the method of the invention has proven to be a fast, efficient and cost effective technique for the quantification of F. oxysporum f. sp. asymptomatic chickpea tissues in the early stages of the infection process, thus being useful for breeders both in the growth chamber and in the greenhouse and in the field. In addition, the ability of the method of the invention to detect and quantify the pathogen both in the soil and in the plant will facilitate a better knowledge and understanding of the biology of the pathogen and the epidemiology of the disease and will help in its control.

Another aspect of the invention relates to the nucleotide sequence primers SEO ID NO: 3 and SEO ID NO: 4, hereafter "first pair of primers of the invention" or "FOCP1".

Another aspect of the invention relates to the SEO ID NO: 5 and SEO ID NO: 6 nucleotide sequence primers, hereafter "second pair of primers of the invention" or "FOCP2".

Another aspect of the invention relates to the use of the first or second pair of primers of the invention for the detection of any of the pathogenic races of the fungus Fusarium oxysporum f. sp. Ciceris In a preferred embodiment of this aspect of the invention, the pathogenic races of the fungus Fusarium oxysporum f. sp. Ciceris are selected from the list comprising: O, 1A, 1B / C, 2, 3, 4, 5 or 6.

Another aspect of the invention relates to the use of the first or second pair of primers of the invention for the quantification of any of the pathogenic races of the fungus Fusarium oxysporum f. sp. Ciceris In a preferred embodiment of this aspect of the invention, the pathogenic races of the fungus Fusarium oxysporum f. sp. Ciceris are selected from the list comprising: O, 1A, 1B / C, 2, 3, 4, 5 or 6.

Another aspect of the invention relates to a detection and quantification kit of any of the pathogenic races of the Fusarium oxysporum f. sp. Ciceris, hereinafter "kit of the invention", comprising a pair of primers capable of amplifying the SEO ID NO: 1 and / or a pair of primers capable of amplifying the SEO ID NO: 2. In a preferred embodiment of In this aspect of the invention, the pair of primers capable of amplifying the SEO ID NO: 1 is the first pair of primers of the invention. In a more preferred embodiment, the primer pair capable of amplifying the SEO ID NO: 2 is the second primer pair of the invention. Thus, in an even more preferred embodiment, the kit of the invention comprises the first and / or second pair of primers of the invention.

In general, the kit of the invention comprises all those reagents necessary to carry out the method of the invention as described above. The kit can also include, without any limitation, buffers, enzymes, such as, but not limited to, polymerases, cofactors to obtain optimal activity of these, dNTPs, a magnesium salt, probes, fluorochromes, agents to prevent contamination , etc.

The kit may also contain other molecules, genes, proteins or probes of interest, which serve as positive and negative controls; as well as otrals parejals of primers for the amplification of one or several control nucleotide sequences. On the other hand, the kit can include all the supports and containers necessary for commissioning and optimization. Preferably, the kit further comprises instructions for carrying out the method of the invention.

Another aspect of the invention relates to the use of the kit of the invention for the detection and quantification of any of the pathogenic races of the Fusarium oxysporum f. sp. Ciceris In a preferred embodiment of this aspect of the invention, the pathogenic races of the fungus Fusarium oxysporum f. sp. Ciceris are selected from the list comprising: O, 1A, 1B / C, 2, 3, 4, 5 or 6.

Throughout the description and the claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and characteristics of the invention will be derived partly from the description and partly from the practice of the invention. The following examples and drawings are provided by way of illustration, and are not intended to be limiting of the present invention.

DESCRIPTION OF THE FIGURES

Fig. 1. Agarose gel showing PCR amplification products using primer pairs (A) FOCP3 or (B) FOCP4, reaction conditions M1 and genomic DNA of Fusarium oxysporum f. sp. Ciceris M, Generuler ™ DNA ladder mix molecular weight marker (Fermentas, St Leon-Rot, Germany). Lanes 1 to 4 and 6 to 9, isolated from Fusarium oxysporum f. sp. ciceris Foc-7802 and Foc-9605 (Race O), Foc-8012 and Foc-USA W6-1 (Race 5), respectively; lanes 5 and 10 negative control (water).

Fig. 2. Agarose gel showing the PCR amplification products using the FOCP4 primer pair, M1 reaction conditions and genomic DNA from Fusarium oxysporum f. sp. ciceris and Fusarium oxysporum. M, Gene-ruler ™ DNA ladder mix molecular weight marker (Fermentas, St Leon-Rot, Germany). Lanes 1 to 10, isolated from F. oxysporum f. sp. Foc-7802 and Foc-9605 (Race O), Foc-1987-W17 and Foc9602 (Race 1B / C), Foc-9166 (Race 1A), Foc-1992 R2N (Race 2), Foc-1992 R3N (Race 3), Foc-1992 R4N (Race 4), Foc-8508 (Race 5) and Foc-9170 (Race 6), respectively; lane 11 isolated F. oxysporum Fo-90105; lane 12 negative control (water).

Fig. 3. Agarose gel showing the PCR amplification products using the FOCP4 primer pair, M2 reaction conditions and genomic DNA from Fusarium oxysporum f. sp. ciceris and Fusarium oxysporum. M, Gene-ruler ™ DNA ladder mix molecular weight marker (Fermentas, St Leon-Rot, Germany). Lanes 1 to 10, isolated from F. oxysporum f. sp. Foc-7802 and Foc-9605 (Race O), Foc-1987-W17 and Foc9602 (Race 1B / C), Foc-9166 (Race 1A), Foc-1992 R2N (Race 2), Foc-1992 R3N (Race 3), Foc-1992 R4N (Race 4), Foc-8508 (Race 5) and Foc-9170 (Race 6), respectively; lane 11 isolated F. oxysporum Fo-90105; lane 12 negative control (water).

Fig. 4. Agarose gel showing PCR amplification products using the FOCP4 primer pair, M1 reaction conditions and genomic DNA from Fusarium oxysporum f. sp. ciceris and Fusarium oxysporum. M, Gene-ruler ™ DNA ladder mix molecular weight marker (Fermentas, St Leon-Rot, Germany). Lanes 1 to 10, isolated from F. oxysporum f. sp. Foc-7802 and Foc-9605 (Race O), Foc-1987-W17 and Foc9602 (Race 1B / C), Foc-9166 (Race 1A), Foc-1992 R2N (Race 2), Foc-1992 R3N (Race 3), Foc-1992 R4N (Race 4), Foc-8508 (Race 5) and Foc-9170 (Race 6), respectively; lane 11 isolated F. oxysporum Fo-90105; lane 12 negative control (water).

Fig. 5. Agarose gel showing PCR amplification products using the FOCP4 primer pair, M1 reaction conditions and genomic DNA from Fusarium oxysporum f. sp. ciceris and Fusarium oxysporum. M, Gene-ruler ™ DNA ladder mix molecular weight marker (Fermentas, St Leon-Rot, Germany). Lanes 1 to 10, isolated from F. oxysporum f. sp. Foc-7802 and Foc-9605 (Race O), Foc-1987-W17 and Foc9602 (Race 1B / C), Foc-9166 (Race 1A), Foc-1992 R2N (Race 2), Foc-1992 R3N (Race 3), Foc-1992 R4N (Race 4), Foc-8508 (Race 5) and Foc-9170 (Race 6), respectively; lane 11 isolated F. oxysporum Fo-90105; lane 12 negative control (water).

Fig. 6. Agarose gels showing the amplification products of polymerase chain reactions (PCR) using primer pairs (A) FOCP1 or (B) FOCP2 and genomic DNA from Fusarium oxysporum f. sp. Ciceris M, Generuler ™ DNA molecular weight marker (Fermentas, St Leon-Rot, Germany). Lanes 1 to 11, F.oxysporum

F. sp. Foc-cc62R and Foc-9032 (Race O), Foc-cc-22D (Race 1B / C), Foc-9166 and Foc-9027 PV1 (Race 1 A), Foc-8605 (Race 2), Foc- 8606 (Race 3), Foc-8607 (Race 4), Foc-8508 and Foc-USA 1-1 JG-62 (Race 5), and Foc8924 (Race 6), respectively; lane 12, negative control (chickpea DNA), and lane 13, negative control (water).

Fig. 7. Representative agarose gel showing the PCR amplification products using the FOCP1 primer pair. M, Gene-ruler ™ DNA molecular weight marker (Fermentas, St Leon-Rot, Germany). Lanes 1 to 16, Fusaríum oxysporum f. sp. Foc7802 and Foc-9605 (Race O), Foc-1987-W-17 and Foc-9602 (Race 1 B / C), Foc-7989 and Foc-8272 (Race 1 A), Foc-1992 R2N and Foc -8605 (Race 2), Foc-1992 R3N and Foc-8606 (Race 3), Foc-1992 R4N and Foc-8607 (Race 4), Foc-8012 and Foc-USA W6-1 (Race 5), and Foc -8905 and Foc-KC1 (Race 6), respectively; lane 17, F. oxysporum f. sp. / ycopersící Fol-325-3, lane 18, F. oxysporum f. sp. me / onís Fom-9616, lane 19, F. oxysporum f. sp. písí F-42, lane 20, F. oxysporum f. sp.

level Fon-8822, lane 21, F. oxysporum f. sp. phaseolí Fop-DR85, lane 22, F. oxysporum Fo-901 01, lane 23, F. culmorum 11427, lane 24, F. nísíkadoí 10758.

Fig. 8. Standard linear regression lines of a 10x serial dilution of Fusarium oxysporum f. DNA. sp. ciceris (Foc-9605) (10 ng / J-ll) diluted in sterile ultrapure water or in DNA (10 ng) extracted from chickpea stem or ground fragments (10 ng). The threshold cycle (CT) values are plotted against the genomic DNA logarithm of the standard curves of known concentration.

Fig. 9. Disease reaction (mean values ± standard deviation) of cultivars JG-62 and P-2245 growing in an artificially infested soil with races O and 5 of Fusarium oxysporum f. sp. ciceris, differing in their level of resistance to each race (R: Resistant; S: Susceptible) at 15 days after planting under controlled ambient conditions. The amount of pathogen DNA in the root (A) or stem (B) was estimated using the specific qPCR protocol of F. oxysporum

F. sp. cherries of the invention. (C) Severity value of the disease reaction (scale 0-4). The percentage values correspond to the number of samples that were amplified by the qPCR protocol (A and B) or to the incidence of plants showing symptoms of Vascular Fusariosis (C). Bars with different letters indicate significant differences (P <0.05) between the amount of each breed detected in the same cultivar; and the asterisk (*) indicates significant differences (P <0.05) between cultivars for the same pathogen race.

Fig. 10. Amount of DNA of the pathogen (mean values ± standard deviation) in the root of 12 chickpea cultivars estimated using the qPCR protocol specific to Fusarium oxysporum f. sp. Ciceris of the invention at 35 days after sowing (DDS) on a plot of a field infested with the 0.5 and 6 races of F. oxysporum f. sp. Ciceris The disease reaction of each cultivar to races O, 5, and 6 (R: Resistant; M: Moderately susceptible; S: Susceptible); the final incidence of disease (%) estimated as the percentage of dead plants at 85 DOS; The percentage of samples amplified by the qPCR protocol of the invention and the threshold cycle (CT) values are indicated for each cultivar. Bars with different letters indicate significant differences (P <O, 05) in the amount of F. oxysporum f. sp cícerís detected by means of the qPCR protocol of the invention. DL = Detection limit (CT ~ 35).

Fig. 11. DNA concentrations of Fusarium oxysporum f. sp. ciceris estimated using the specific qPCR protocol of F. oxysporum f. sp. ciceris of the invention compared to the number of colony forming units (cfu) per gram of soil present in an artificially infested soil (AIS) or in a naturally infested soil (Rabanales Campus).

EXAMPLES

The invention will now be illustrated by tests carried out by the inventors, which show the specificity and effectiveness of the method of the invention for the detection and quantification of any of the eight pathogenic races of Fusaríum oxysporum f. sp. citrus, as well as the specificity and effectiveness of the primers of the invention to carry out said method. These specific examples provided serve to illustrate the nature of the present invention and are included for illustrative purposes only, and therefore should not be construed as limitations on the invention claimed herein.

EXAMPLE 1. Design of the method of the invention based on specific PCR for the detection and quantification of F. oxysporum f. sp. Ciceris

1.1. Isolated from the pathogen and culture conditions.

A collection of 115 Fusarium spp. Isolates was used, of which 50 were representative of F. oxysporum ff. spp .: ciceris (42), / ycopersici (one), me / onis (one), niveum (one), phaseoli (one) and pisi (four), and six non-pathogenic isolates of F. oxysporum. The 59 isolated from Fusarium spp. Remaining were obtained from the Fusarium spp. from the Department of Phytopathology of the Kansas State University, Manhatan, Kansas, USA. These latter isolates were representative of the sections of

Fusarium, Disc% r, E / egans, Gibbosum, Lateritium, Líseo / a, Martiella, Roseum, Spicarioides and Sporotrichiella.

The 42 isolates of F. oxysporum f. sp. ciceris came from various geographical origins and were representative of the eight races of the pathogen described to date; and the 6 non-pathogenic isolates of F. oxysporum were obtained from roots of healthy chickpea plants. All isolates were stored in tubes containing sterile soil at 4 ° C and in sterile 35% glycerol at -80 ° C for long-term storage.

The active cultures of the isolates were obtained by placing small aliquots of soil containing the isolates in Petri dishes with dextrose potato agar (APD) (Difco Laboratories, Detroit, Michigan, USA) and incubating them for 4 days at 25 ° C and a photo period 12-h fluorescent light and close to UV with an intensity of 360! -lE m-2 S-1. For the extraction of DNA from the fungus, a small piece of the active cultures of the Fusarium spp. Isolates was placed. on a sterile cellophane film spread on an APD plate and incubated for 5-7 days as described above. Subsequently, the mycelium grown on the cellophane surface was scraped directly with a sterile scalpel, lyophilized and stored at -20 ° C until use.

1.2. Chickpea vegetable material.

Chickpea cultivars 12071/10054 (PV-1), PV-60, BG-212, P-2245, ICCV-2, UC-15, JG-62, CA334.20A, ICC14216, PV61, WR-315 were used and CPS

1. These cultivars show a reaction of differential resistance to infection by the different races of F. oxysporum f. sp. You will grow up Different chickpea cultivars and tissues were used in each experiment: i) to optimize the new quantitative real-time PCR (qPCR) protocol developed, the plant's DNA was extracted from sampled stem and root fragments of 'PV60' plants after 30 days of growth in sterile sand in a growth chamber adjusted to a temperature of 25 ± 2 ° C and a relative humidity of 60 to 90% with a 14-h photoperiod of fluorescent light at an intensity of 360 ~ Em-2 · S-1 Sampled tissues were washed under tap water, superficially disinfested with 0.5% NaOCI for 1.5 min, dried between sterile filter paper sheets, lyophilized, ground and stored at -20 ° C until use. . ii) For resistance assessment using the qPCR protocol, the total genomic DNA was extracted directly from frozen stem and stem tissues of cultivars 'P-2245' and 'JG62' (see example 2). iii) For the field experiment, the 12 chickpea cultivars referred to above were used and the DNA was extracted from lyophilized and ground radical tissue (see example 2).

1.3. DNA extraction and quantification, and development of standard DNA curves.

DNA was extracted from 50 mg of lyophilized plant tissue or 100 mg of fresh tissue (according to the experiment), or from 50 mg of mycelium of the lyophilized pathogen, using the G-SpinTM IIp Plant Genomic DNA extraction kit (Intron Biotechnology, Korea ) and the Fast-Prep FP-120 system (MP biomedicals, IIlkirch, France). DNA was extracted from 250 mg soil samples using the FP-120 system running at 5.0 mi for 40 s combined with the use of the MoBio kit

Ultraclean ™ soil DNA isolation (MoBio laboratories, Inc; Carlsbad, CA, USA)

according to the manufacturer's instructions.

DNA quality was assessed by gel electrophoresis and ethidium bromide staining. All DNA samples were quantified using the Quant-iT DNA Assay Kit Broad Range fluorometric kit (Molecular Probes Inc., Leiden, The Netherlands) and a Tecan Safire fluorospectometer (Teca n Spain, Barcelona, Spain). It was ensured that exact concentrations of host and pathogen DNA were obtained by quantifying each sample in triplicate and in two independent microplates. As internal control of DNA quantification, DNA samples of known concentration were included in each quantification plate. The DNA was diluted with sterile ultrapure water (SUW) to obtain a total DNA concentration that varied from Oa 10 ng / lJl.

Standard DNA curves for qPCR assays were obtained from serial dilutions of 1 OX DNA from the F. oxysporum f isolate. sp. Cocísís Foc9605. For this purpose, the DNA of the isolate (10 ng / lJl) was serially diluted (1: 1, 1:10, 1: 102, 1: 103, 1: 104 and 1: 105) in SUW (W / Foc -9605), as well as in a fixed background of plant DNA (10 ng / lJl) extracted from stems (CS / Foc-9605) and roots (CR / Foc-9605) of the cultivar 'PV-60' or a artificial soil mixture (SM / Foc-9605). Previously it was found that the artificial soil mixture did not contain F. oxysporum f DNA. sp. Cicceris through a specific PCR assay. Each standard curve always included plant or soil DNA only and / or absence of DNA as negative controls. Two independent standard DNA curves were obtained using plant, soil and pathogen DNA.

1.4. Design of primers and development of the Fusaríum oxvsporum f. sp. You will grow up.

Initially, 4 pairs of primers were developed (Table 1), and their efficiency and reproducibility were tested independently under different reaction conditions (Table 2) in which parameters such as hybridization temperature and primer concentrations varied. of MgCI2, which were adjusted experimentally to optimize the amplification, with each pair of primers, of different isolates of F. oxysporum f. sp. Kindred type indicated in the figures.

The pairs of primers designed specifically amplified internal portions of a specific 1.5 kb SCAR sequence of F. oxysporum f. sp. Ciccerís (GenBank access number: AF492451). The primers were designed with Bionumerics 6.0 software (Applied Maths, Belgium). A 'in silico' test of primer specificity was carried out, comparing their sequences against the non-redundant GenBank database with established parameters for the identification of 'almost exact short matches' (short, nearly exact matches) , thus verifying the absence of homology with the sequences deposited in the GenBank database.

Different parameters were evaluated in the PCR protocol to optimize the amplification conditions. Thus, the reaction conditions such as the hybridization temperature and the concentrations of the primers and MgCl2 were experimentally adjusted to optimize the amplification with each pair of primers. All conditions were repeated at least twice and always included positive controls (DNA of F. oxysporum f. Sp. Citceris Foc9605) and negative controls (for example, DNA of other Fusaríum spp., F. non-pathogenic F. oxysporum or other ff. F. oxysporum spp. and absence of DNA). The amplification products were separated by electrophoresis in 2% agarose gels in 1 x TAE buffer for 60-120 min at 80 V, stained with ethidium bromide and visualized under UV light. The molecular weight marker Gene-ruler ™ DNA ladder mix (Fermentas, St Leon-Rot, Germany) was used for electrophoresis.

Couple Name Sense Sequence (5'-3 ') FOCP1 SEO ID NO: 3 Direct TACGGTACCAGATCATGGCGT

SEO ID NO: 4 Inverse CGCTTTCGATCGTGGCTATG FOCP2 SEO ID NO: 5 Direct CATGGTTTCGTTAGGCCAGT SEO ID NO: 6 Inverse CGCAGTCTTCGTCGTCATTA

FOCP3 SEO ID NO: 7 Direct GCTACTATCAGCATAACAAACG SEO ID NO: 8 Inverse GTCCTTCACACCATCATCC FOCP4 SEO ID NO: 9 Direct AAACCAAGCAGTGTGAATACC SEO ID NO: 10 Inverse CTCTCCTAGCCTCCAAGTCC ...

-

Table 1. Primers dlsenados Initially for the method of the Invention based on PCR and its sequence.

5 The two pairs of primers FOCP3 and FOCP4 were tested with two reaction mixtures (M1 and M2, Table 2) and with genomic DNA from Fusarium oxysporum f type isolates. sp. Ciceris

Components M1 1 x Final M2 1 x Final

10 x Buffer 2.00 1 x 2.00 1 X MgCl2 (50mM) 0.60 1.5 mM 0.60 1.5 mM dNTPs (5 mM each) 0.80 200 11M 0.4 100 11M

ddH20 14.80 15.20 FOCP3 Direct OR FOCP4 Direct (25 pmol /) ll) 0.30 0.35 11M 0.30 0.35 11M FOCP3 Reverse OR FOCP4

Inverse (25 pmol /) ll) 0.30 0.35 11M 0.30 0.35 11M Taq 0.20 1 U / 20 111 0.20 1 U / 20 111 DNA 1.00 1.00

Final volume 20.00 20.00. . . ..

Table 2. Initial reaction mixtures used in the PCR set-up with 10 pairs of primers FOCP3 and FOCP4.

The results of the agarose gels did not show amplification of any of the isolates used under any of the reaction conditions used for the FOCP3 primer pair (Fig. 1 A) so it was discarded

its use. In contrast, the pair of FOCP4 primers (Fig. 1B) provided moderate amplification products for the brief selection of type isolates tested, so it was decided to continue with their optimization including more representative isolates of the other races of the pathogen, using both the conditions of reaction M1 as the M2 (Table 2), since both had shown amplification products of similar intensity. In this case the results showed that not all Fusarium oxysporum f. sp. Ciceris amplified and also presented very different signal strength when the amplification products were separated by electrophoresis in agarose gels (Fig. 2 and 3).

As a result, it was decided to experiment with other amplification conditions and more permissive reaction mixtures with the amplification by increasing the amount of primers to a final concentration of 0.5 ~ MY by reducing the banding temperature by 7 ° C first and 5 ° C at a second experimental test (Fig. 4 and 5, respectively). However, the results showed that none of the experimental conditions optimized the amplification of the desired DNA fragment, so this pair of primers was also ruled out.

In view of these results, the other two pairs of designed primers were then tested. Table 3 shows the designation of these two pairs of primers of the invention, FOCP1 and FOCP2, and the size of the PCR products that amplify with the optimized amplification conditions.

Partner

Name

FOCP1

SEO ID NO: 3

SEO ID NO: 4

FOCP2

SEO ID NO: 5

SEO ID NO: 6

Sense

Direct Inverse Direct Direct Inverse

Size

of the

Melting Temperature (ºC)

amplicon

(pb)

71

160

70

68

158

68

Table 3. Couples of primers of the invention finally selected for peRo

5 The pairs of primers FOCP1 and FOCP2 were suitable for the specific identification of F. oxysporum f. sp. You will grow up The optimized reaction mixture was similar for both primer pairs, and for a final volume of 20 111, it consisted of 2.0 111 of 10x reaction buffer [160mM (NH4hS04, 670mM Tris-HCI (pH 8.8 at 25 ° C), 0.1% stabilizer], 0.35 11M of

10 each primer, 200 11M of each dNTP, 1 unit of BíoTaq DNA Polymerase (Bioline, London, United Kingdom), 1.5 mM MgCI2, and 1111 of template DNA (20 to 40 ng of DNA). The amplification reactions were carried out in a C1000 thermocycler (Bio-Rad) with the amplification conditions: denaturation for 1 min at 94 ° C, followed by 25 cycles of 30 s of

15 denaturation at 94 ° C, 30 s at a hybridization temperature of 55 ° C and 30 s extension at 72 ° C. The final cycle consisted of 5 min at 72 ° C followed by cooling at 4 ° C.

In simple PCR assays using primer pairs FOCP1 and

20 FOCP2 and genomic DNA from 42 isolates of F. oxysporum f. sp. representative cherries of the races O, 1A, 1B / C, 2, 3, 4, 5, Y 6, Y of a wide range of geographical origin, only a product of 160 and 158 bp was amplified, respectively (Fig. 6; Table 3). Occasionally, some dimers were observed in the FOCP2 primer pair (Fig. 6). None of these

25 specific products were amplified when DNA from 7 non-pathogenic isolates of F. oxysporum, of another 8 ff, was used. spp. of F. oxysporum, or other 59 species of Fusarium spp. as template DNA in the specific PCR assays with the primer pairs FOCP1 and FOCP2 (Fig. 7; only the results for the FOCP1 primer are presented).

1.5. Optimization, reproducibility and sensitivity of the developed qPCR protocol.

To optimize the qPCR protocol, the reaction conditions for both pairs of FOCP1 and FOCP2 primers were adjusted experimentally (e.g., reaction volume, hybridization temperature, primer concentration, amplicon fluorescence signal measurement temperature, etc. ). All qPCR amplifications were performed using the iQ SYBR Green Supermix reaction mixture, iQ 96-thin well PCR plates, and optical sealing sheets (Bio-Rad, Madrid, Spain), and the iCycler IQ thermal cycler (Bio-Rad ). After the final amplification cycle, a profile of the melting or melting curve temperature was obtained by heating up to 95 ° C, cooling to 55 ° C and slowly heating up to 95 ° C at intervals of 0.5 ° C every 10 s with measurement Continuous fluorescence at 520 nm. All reactions were analyzed by gel electrophoresis to confirm that only one PCR product was amplified from samples containing genomic DNA from isolates of F. oxysporum f. sp. ciceris and no amplified product was obtained in the negative controls.

The potential influence of the host DNA and / or its origin (plant tissue: root versus stem) as well as soil DNA on the efficiency of the amplifications of the qPCR in different experiments was also assessed. For that purpose, only the primer pair FOCP1 was used. For those experiments, DNA background comparisons were performed on the same 96-well PCR plate. Quantitative PCR amplifications of each standard DNA curve series included three repetitions per treatment and plate. All experiments were repeated twice independently (different PCR plates, operators and standard DNA curves) and always included a common standard DNA curve to compare the variability between, as well as within, the experiments. Finally, the sensitivity of the qPCR protocol was determined with two sets of three standard DNA curves (W / Foc9605, CR / Foc-9605 and SM / Foc-9605) and compared with the simple PCR protocol using primers FOCP1.

A precise step-by-step adjustment process was carried out for each of the pairs of FOCP1 and FOCP2 primers that included the following PCR parameters: primer concentration, hybridization temperature, and final volume of the PCR reactions. For this, the standard DNA curves W / Foc-9605, and CS / Foc-9605 were used. The reduction in the standard volume of the reaction from 50 to 20! JI did not change the accuracy of the assay; consequently, a final volume of 20! JI was selected to minimize the cost per qPCR assay.

The optimized PCR reaction mixture for a final volume of 20 IJI consisted of: 1 IJI of DNA sample, 1 x iQ SYBR Green Supermix (Bio-Rad, Madrid, Spain), and 0.3 IJM of each primer. The amplification conditions consisted of an initial denaturation at 95 oC for 1 min followed by 40 cycles of 30 s at 95 oC, 30 s at 55 oC, and 30 s at 72 oC. The fluorescence emitted by the target amplicon was detected at 72 oC. Occasionally, small peaks between 72-75 ° C were observed in the melting temperature curve, especially for the FOCP2 primer pair. This fact was due to the presence of dimers of the primer pair, since these nonspecific amplifications were not detected by 1.2% agarose gel electrophoresis (weight / vol). No fluorescence signal was observed in the negative controls using water or DNA samples extracted from the different organs of chickpea plants. For all experiments, a threshold value of 200 Relative Fluorescence Units (URF) was set to determine the CT values.

The use of both pairs of primers produced highly reproducible amplifications. The standard regression lines obtained for the FOCP1 primer pair indicated an amplification efficiency of 93.9-102.6% and a determination coefficient value (Ff) of 0.991-0.999, and for the FOCP2 primer pair the efficiency of amplification was 81.7-104.9% and the value of the coefficient of determination was 0.989-0.998. FOCP1 primer pair was selected for subsequent experiments.

After optimization of the qPCR protocol, standard regression lines were generated for each standard DNA curve using a DNA range from 10 ng to 0.1 pg. The use of the qPCR protocol with standard DNA curves constructed independently or by different operators did not influence the reproducibility and consistency of the results. A high reproducibility was obtained in the amplifications with a high efficiency that was maintained above five orders of magnitude in the DNA dilutions and that showed a linear range of amplification. The DNA of F. oxysporum f. sp. Cicceris was not adequately quantified at a concentration of 0.1 pg, either in DNA diluted in water or in DNA extracted from stem or root tissues of chickpea plants, or soil; that is, CT value of 34.5 ± 2 or absence of amplification. Consequently, the detection limit of the qPCR protocol was set at a DNA concentration of F. oxysporum of 0.1 pg or a CT value of 35 cycles.

The analysis of the standard variance (ANOVA) of the CT values obtained for the different standard DNA curves W / Foc-9605, CR / Foc-9605, CS / Foc-9605 and SM / Foc-9605 indicated homogeneity of the variances between the different treatments (P ~ 0.05). The origin of the DNA background (water vs. root or stem or soil) did not change the results of the qPCR assays (Fig. 8). Thus, the statistical comparison of the parameter estimates of the four standard linear regression lines indicated the absence of significant differences between the ordinates in the origin (P = 0.0970) or pending (P = 0.2555). Since the use of DNA backgrounds of different host tissues

or soil did not influence the reproducibility and efficiency of the protocols, the standard DNA curve CR / Foc-9605 was selected to estimate the amount of biomass of F. oxysporum f. sp. zyceris in plant tissues naturally infected by the pathogen, and the standard DNA curve SM / Foc-9605 to estimate such biomass in natural or artificially infested soils.

EXAMPLE 2. Evaluation of the resistance of the chickpea plant and the virulence of Fusarium oxysporum f. sp. ciceris by means of the method of the invention based on qPCR.

An experiment was carried out to determine the usefulness of the qPCR protocol developed to evaluate the resistance of chickpea cultivars to Vascular Fusariosis. F. oxysporum f. Isolates were used. sp. Foc-USA W6-1 (race 5; highly virulent) and Foc-7802 (race O; less virulent). The inoculum of the pathogen isolates for the experiment was increased in a mixture of sand: cornmeal: water (AMA) previously described. The inoculum density in the mixture (number of colony forming units (cfu) per gram of infested AMA) was determined by the plate dilution method using a semi-selective medium for Fusaríum spp. (juice V8-oxgall-pentachloronitrobenzeno agar; VOPA). Subsequently, the infested AMA was carefully mixed with a soil mixture (silt / sand / peat, 1: 1: 1, v / v / v) autoclaved (121 ° C, for 75 min, twice) in the proper proportion to obtain an inoculum density of 105 cfu per gram of soil.

In this experiment, chickpea cultivars P-2245 and JG-62 were used, which show well-characterized differential resistance reactions to Foc-USA W6-1 and Foc-7802 isolates (P-2245, susceptible to both races; JG -62, resistant to Foc-7802 and susceptible to Foc-USA W6-1). Germinated seeds selected for their uniformity (radicle length = 1 to 2 cm) were sown in clay pots 15 cm in diameter (one plant per pot), filled with the soil mixture and incubated in a chamber of Visitable growth adjusted to a temperature of 25 ± 1oC and a 14-hour period photo of fluorescent light at an intensity of 360! -lE m-2 's-1 for 5 weeks. 14 chickpea plants were arranged per isolate-cultivar combination. For each experimental combination, six plants were sampled at 15 days after sowing for DNA extraction, and the remaining eight plants were used to assess disease development up to 45 days after sowing, period of time used usually for the evaluation of chickpea resistance to Vascular Fusariosis. The plants were extracted from the pots, lightly washed under tap water, disinfested in 2% NaOCI for 1.5 min and dried between sheets of sterile filter paper. For each sampled plant, the stem and root were frozen independently in liquid nitrogen and stored at -80 ° C. DNA was extracted from 100 mg of frozen root or stem tissues as described above. The incidence, /, (O to 1 scale) and the severity of foliar symptoms, S, (considered on an O to 4 scale) of individual plants at 2-3 day intervals were assessed. Average severity values <1 and> 3 were considered resistant and susceptible reactions, respectively, and severity values included among them (~ 1 Y :: ;; 3) were considered moderately susceptible reactions.

No symptoms of Vascular Fusariosis were observed in plants of resistant 'JG-62' or susceptible 'P-2245', when they were inoculated with race O, the less virulent of F. oxysporum f. sp. cícerís, when they were sampled at 15 after planting. On the contrary, in that same period, the plants inoculated with race 5, the most virulent of the pathogen, showed an incidence of disease in 'JG-62' and 'P-2245' of 33.3 and 54.3%, respectively. However, the level of severity of symptoms of the disease reached was very low (S <0.5) (Fig. 9C). At the end of the experiment, 45 days after planting, all plants of compatible combinations (ie, 'P-2245' / race O, 'P-2245' / race 5 and 'JG62' / race 5) died as a result of the infection (i.e., S = 4).

The use of the developed qPCR protocol allowed the detection of F. oxysporum f. sp. You will grow all the root samples of all the plants and all the breed-cultivation combinations at 15 days after planting. However, the amounts of pathogen DNA estimated in plant root tissues of the most compatible combination (highly susceptible cultivar / highly virulent race; that is, 'P-2245' / race 5 and 'JG-62' / race 5 ) was significantly (P = 0.0002) higher compared to that estimated for the resistant incompatible combination ('JG-62' / race O), as well as the least compatible ('P-2245' / race O). No significant differences (P = 0.2017) were observed for the estimated DNA concentration of the pathogen at the root of the two chickpea cultivars (Fig. 9A).

The pathogen could not be detected in DNA samples extracted from chickpea stems of the incompatible, resistant combination 'JG-62' / race O, but was able to be detected in 33.3% of plant stem samples' P-2245 'inoculated with race O (Fig. 98). However, significantly higher amounts of the pathogen (P = 0.0083) were detected and in a larger percentage of the stem samples of the most compatible combination (ie, 'P-2245' / race 5 and 'JG-62' / race 5); the quantity detected in the stem for race 5 in 'P2245' being significantly greater (P = 0.0006) than that detected in 'JG-62' (Fig. 98).

The use of the qPCR protocol to quantify the biomass of

F. oxysporum f. sp. Zucchini in chickpea plants growing in natural conditions. To achieve this goal, DNA was extracted from roots of chickpea cultivars PV-1, PV-60, 8G-212, P-2245, ICCV-2, UC-15, JG-62, CA334.20A, ICC14216, PV- 61, WR-315 and CPS-1 that grew on a plot located in the experimental station of the 'Campus de Rabanales', University of Córdoba, Spain. The soil of this plot (Vertisol, Haploxerets; 50% clay, 33% silt, 17% sand; pH 8.6, 1.4% organic matter) was infested with a combination of different populations of F. oxysporum including races O , 5 and 6 of F. oxysporum f. sp. You will grow up Three repetitions (blocks) were arranged with two rows per block for each cultivar; each row was 40 m long and 25 cm apart. The seeds were sown by hand at 5 cm deep. Weeds were removed by hand from the plot, and insecticides and fertilizers were applied according to usual agricultural practices.

At the beginning of the flowering phase (approximately 35 days after planting), three plants were removed without disease symptoms selected arbitrarily within each row, excess soil was removed from the roots by slightly shaking the plant and the radical system Complete of the six plants of each block was joined as a single sample, they were transferred to the laboratory in a plastic bag and stored at 4 ° C until use. DNA was extracted from 50 mg of lyophilized chickpea roots as described above. In this experiment, lyophilized roots were used instead of fresh frozen to increase the uniformity of the processed samples. No significant differences were found in the result of the amplification of qPCR when the background DNA of the extracted plant came from fresh or lyophilized radical tissues. After sampling asymptomatic plants, the disease reaction of the 12 chickpea cultivars in the plot was assessed, recording the incidence of plants with symptoms and deaths from Vascular Fusariosis at intervals of 10-15 days during the entire growth period .

The amount of F. oxysporum f. sp. cherries in root and stem samples were estimated using the optimized qPCR conditions and the standard CR / Foc-9605 curve (serial dilutions of Foc-9605 DNA in a fixed background of 10 ng chickpea root DNA) and six repetitions per floor The PCR assay was repeated twice for each sample.

The use of the developed qPCR protocol allowed the detection of DNA from

F. oxysporum f. sp. 100% of the root samples of 'PV-61', 'P2245', 'PV-1', 'JG-62', and 'PV-60', the six chickpea cultivars planted in the experimental plot Infested used in the study and that are susceptible to some of the pathogen races (O, 5 and 6) that are present in this soil. Similarly, there was a positive detection in 83.3% of 'ICCV-2' root samples, which is resistant to race O but susceptible to races 5 and 6, and only a detection of 41.7% of the root samples of 'CPS-1', which is moderately susceptible to race 5 but resistant to races O and 6 (Fig. 10). The relative amount of F. oxysporum f. DNA. sp. cherries in root samples of chickpea cultivars susceptible to races O, 5 and 6 varied significantly (P <0.0001) among cultivars, ranging from 0.21% in the ICCV-2 cultivar to 10.21% in the cultivar P-2245 (Fig. 10). On the other hand, the final incidence values of dead plants due to the disease was positive and significantly correlated (r = 0.8722; P = 0.0235) with the amount of pathogen DNA estimated 35 days after planting, before planting. onset of the development of symptoms of Vascular Fusariosis (Fig. 10). These results demonstrate the usefulness of the qPCR protocol of the invention for predicting the resistance / susceptibility reaction of chickpea cultivars to Vascular Fusariosis under field conditions. It is also noteworthy that the pathogen could be quantified in 25 to 66.7% of the samples of the rest of the chickpea cultivars in the experiment that were resistant to races O, 5 and 6 of F. oxysporum f. sp. cherries that infest the soil of the plot (except for cultivars 8G-212 and WR-315), although in these cultivars the values of CT were close to those established as detection limit CT = 35 (that is, 32.6- 34.0) (Fig. 10).

EXAMPLE 3. Quantification of F. oxysporum f. sp. Ciceris in soil by the method of the invention based on qPCR.

To perform the artificial inoculation of the soil, the inoculum of the isolates of

F. oxysporum f. sp. Cocceris Foc-7802 and Foc-USA W6-1 were increased by 100 ml of dextrose potato broth (Difco Laboratories). The liquid cultures were filtered through eight layers of sterile gauze, the conidia were separated by centrifugation (10,000 x 9 for 10 min) and washed twice with sterile distilled water to remove traces of nutrients. The inoculum concentration (mainly microconidia) in the suspension was estimated using a hematocytometer and adjusted to 2x104 cfu / ml with SUW. A natural soil (Entisol, Xerofluvents; 27% clay, 9.3% silt and 63.8% sand; pH 7.4, 1.9% organic matter) in which the absence of F. oxysporum f. sp. ciceris, was pasteurized at 74 ° C for 30 min, dried at room temperature (24 to 28 ° C) for one week and screened with a 1 x 1 cm mesh. Subsequently, 10 ml of the microconidia suspension (2x104 cfu / ml) of each isolate was thoroughly mixed with 100 g of soil in a plastic bag to obtain approximately 2x103 cfu / g. Finally, the infested soil was dried at room temperature and stored at 4 ° C for 5 months before use. Additionally, a sample of naturally infested soil from the plot located on the 'Rabanales Campus' was used. The soil was dried and screened as previously described prior to DNA extraction.

The number of propagules of F. oxysporum f. sp. Ciceris in natural and artificially infested soil samples was determined at the same time as DNA extraction by plate dilution using six repetitions of 1 g each per soil type. Serial dilutions of the soil suspensions were inoculated in Petri dishes with semi-selective VOPA medium for Fusarium spp. and they were incubated at a temperature of 25 ± 1 ºC with a 12 h photo period of fluorescent light and close to UV with an intensity of 36 IJE.m-2 .s-1 for 5 days. Two repetitions were performed per dilution and soil type. At 5 days of incubation, the total number of cfu of Fusarium spp. (natural soil) or F. oxysporum f. sp. ciceris (artificially infested soil). Subsequently, approximately 10% of colonies from samples of naturally infested soil with morphology similar to F. oxysporum were randomly selected under observation under a microscope and transferred to APD. The DNA of putative isolates of F. oxysporum was obtained as described above and used to

PCR assays using the FOCP1 primer pair specific for F.

oxysporum f. sp. You will grow up

The amount of F. oxysporum f. sp. cysceris in soil samples was estimated using the optimized qPCR conditions and the standard curve SM / Foc-9605 (serial dilutions of Foc-9605 DNA in a fixed background of 10 ng soil DNA). Six repetitions of each sample were performed per soil type and two PCR assays per sample.

As for the data analysis, initially the threshold cycle (CT) values for each reaction were calculated by determining the PCR cycle number at which the fluorescence signal exceeded the threshold value using the default estimation criteria in the iCycler package IQ version 3.0a (Bio-Rad). Subsequently, to compare and establish relationships between the different standard DNA curves generated in the different treatments, the threshold position was defined manually and with the same value for all treatments and experiments. The amplification efficiency (AE) was calculated from the slopes of the standard curves using the equation AE =

10 (1 / pending) -1.

Linear regressions of the logarithm were made on the basis of 10 known concentrations of target DNA against the CT values for each standard curve using the SAS GLM module (Statistical Analysis System, version 9.1; SAS Institute, Cary, NC, USA). The standard regression lines estimated on each plate from the reference DNA curves were used to transform the experimental CT values into amounts of pathogenic DNA (ng). All regression lines obtained for the different DNA backgrounds of the plant were statistically compared for the homogeneity (P ~ 0.05) of variance (Bartlett's Test) and for the equality of slopes and sorted at the origin by the Fauna Test P <0.05.

Population data of F. oxysporum f. sp. Cicceris were converted to log (cfu / g) of fresh root weight to meet the conditions of the parametric statistical test used. Differences in the concentration of F. oxysporum f. sp. Cyceris between the chickpea cultivars and the pathogen races were determined by a standard variance analysis and the means of each treatment were compared according to the Fisher significant minimum differences test protected at P <0.05 using SAS GLM module . Finally, linear regression analysis was carried out to determine the relationship between the inoculum concentration of F. oxysporum f. sp. cherries in the roots of the different chickpea cultivars and the incidence of final disease through the GLM module of SAS.

Planting of a dilution of artificially infested soil with F. oxysporum

F. sp. Cocceris Foc-7802 and Foc-USA W6-1 on VOPA medium indicated an average population density of 4.96x103 and 2.98x103 cfu / g of soil, respectively. The densities of indigenous populations of Fusaríum spp. and of F. oxysporum f. sp. Naturally infested soil cherries from the 'Rabanales Campus' averaged 8.92x102 and 44.5 cfu / g of soil, respectively (Fig. 11). The colonies of F. oxysporum f. sp. Cicceris accounted for less than 5% of the total colonies of Fusaríum spp. In this plot. This population level was lower and showed greater variability between repetitions compared to that observed in artificially infested soils.

The use of the qPCR protocol allowed the detection of F. oxysporum f. sp. 100% of the samples (six independent DNA extractions) taken from artificially infested soil, reaching 692.6 ± 149.4 and 10.7 ± 5.6 pg DNA / g of dry soil for Foc-7802 and Foc -USA W6-1, respectively (Fig. 11). On the contrary, it was possible to quantify DNA from

F. oxysporum f. sp. You grow in 66.7% of samples from six independent DNA extractions from the naturally infested 'Rabanales Campus'. The amount of F. oxysporum f. sp. citrus in the soil was variable, and ranged from 2.7 to 9.4 pg DNA / g of soil (Fig. 11).

Claims (17)

1. Method of detection and quantification of any of the pathogenic races of the fungus Fusarium oxysporum f. sp. ciceris in an isolated biological sample comprising:

to.

extract the DNA from an isolated biological sample,

b.

contacting the DNA extracted in step (a) with a reaction mixture comprising a pair of primers capable of amplifying the SEO ID NO: 1 or the SEO ID NO: 2,

C.

amplify SEO ID NO: 1 or SEO ID NO: 2, and

d.

detect and / or quantify the amplification product obtained in step (c).

2.

Method according to claim 1 wherein the biological sample isolated from step (a) comes from soil or from a chickpea plant.

3.

Method according to claim 2 wherein the isolated biological sample from a chickpea plant comes from root or stem.

Four.

Method according to any of claims 1 to 3 wherein the primers of step (b) capable of amplifying the SEO ID NO: 1 are the nucleotide sequence primers SEO ID NO: 3 and SEO ID NO: 4.

5.

Method according to any of claims 1 to 4 wherein the primers of step (b) capable of amplifying the SEO ID NO: 2 are the nucleotide sequence primers SEO ID NO: 5 and SEO ID NO: 6.

6.

Method according to any of claims 1 to 5 wherein the amplification of step (c) is carried out by quantitative real-time PCR.

7.

Method according to any of claims 1 to 6 wherein the races

pathogenic fungus Fusarium oxysporum f. sp. Ciceris are selected from the list comprising: O, 1 A, 1 B / C, 2, 3, 4, 5 or 6.

8.

Nucleotide sequence primers SEO ID NO: 3 and SEO ID NO: 4.

9.

Nucleotide sequence primers SEO ID NO: 5 and SEO ID NO: 6.

10.

Use of the primers according to any of claims 8 or 9 for the detection of any of the pathogenic races of the fungus Fusarium oxysporum f. sp. Ciceris

eleven.

Use of the primers according to any of claims 8 or 9 for the quantification of any of the pathogenic races of the Fusarium oxysporum f. sp. Ciceris

12.

Use of the primers according to any of claims 10 or 11 wherein the pathogenic races of the fungus Fusarium oxysporum f. sp. Ciceris are selected from the list comprising: O, 1A, 1B / C, 2, 3, 4, 5 or 6.

13.

Kit for detection and quantification of any of the pathogenic races of the fungus Fusarium oxysporum f. sp. Ciceris comprising a pair of primers capable of amplifying the SEO ID NO: 1 and / or a pair of primers capable of amplifying the SEO ID NO: 2.

14.

Kit according to claim 13 wherein the primers capable of amplifying the SEO ID NO: 1 are the nucleotide sequence primers SEO ID NO: 3 and SEO ID NO: 4.

fifteen.

Kit according to any of claims 13 or 14 wherein the primers capable of amplifying the SEO ID NO: 2 are the nucleotide sequence primers SEO ID NO: 5 and SEO ID NO: 6.

16.

Use of the kit according to any of claims 13 to 15 for the detection and quantification of any of the pathogenic races of the fungus Fusarium oxysporum f. sp. Ciceris

17.

Use of the kit according to claim 16 wherein the pathogenic races of the fungus Fusarium oxysporum f. sp. Ciceris are selected from the list comprising: O, 1A, 1B / C, 2, 3, 4, 5 or 6.