ES2384777B1 - PLASTIDIAL TIORREDOXINS: OVEREXPRESSION AND BIOTECHNOLOGICAL APPLICATIONS. - Google Patents

Abstract

Plastidial thioredoxins: overexpression and biotechnological applications. The genetic sequence of the chloroplastic f (Trx) thioredoxin of the N. tabacum species, its method of cloning, expression in plastids and applications is described. Plastidial coexpression vectors containing DNA molecules encoding Trx f are also provided, the hosts that incorporate them, especially E. coli and, particularly, transgenic plants obtained with such vectors, as well as their method of obtaining and their application in the overexpression of Trx in soluble and active form in said plants and in the increased production of starch and sucrose. # The aforementioned plastidial vectors are also applied to the increased plastidial production of recombinant heterologous proteins, coexpressed with the Trx f sequences, specifically serum albumin. (HSA) and human cardiotrophin-1 (hCT1). Methods of obtaining heterologous proteins coexpressed with Trx f, biologically active and in native conformation are also described; as well as obtaining recombinant hCT1 in soluble form and with increased bioactivity.

Description

Plastidial thioredoxins: overexpression and biotechnological applications.

FIELD OF THE INVENTION

The present invention relates to the field of Biotechnology, and specifically to specific plastidial vectors that incorporate the chloroplastic thioredoxin f (Trx) gene sequence of the N. tabacum species, its method of cloning, expression in plastids and applications. The invention further provides the hosts that incorporate said vectors and, particularly, transgenic plants obtained with such vectors, as well as their method of obtaining and their application to the overexpression of Trx f in soluble and active form in said plants and to the increased production of starch. and sucrose.

The invention further applies to the increased plastidial production of recombinant heterologous proteins, coexpressed with the Trx sequences, specifically human serum albumin (HSA) and human cardiotrophin-1 (hCT1). Methods of obtaining heterologous proteins coexpressed with Trx, biologically active and in native conformation are also described; as well as obtaining recombinant proteins in soluble form and with increased bioactivity.

BACKGROUND OF THE INVENTION

Thioredoxins are small thermostable proteins (12 kDa) present in all organisms that catalyze thiol-disulfide exchanges and regulate the redox environment of the cell, controlling a wide range of biochemical processes. This regulation depends, in most cases, on the ability of thioredoxins to reduce disulfide bridges of target proteins. In plants, the thioredoxin system is particularly complex, since there are multiple isoforms and multiple genes that code for each type of thioredoxin; all these genes being nuclear encoded, regardless of their subcellular location.

The multiplicity of thioredoxin isoforms found in chloroplasts of Arabidopsis thaliana, four isoforms of thioredoxin m, two f, one x, and two and raises doubts regarding their specificity and functions. The most studied thioredoxins to date have been the thioredoxins m and f, as they are the only ones associated with the light-dependent regulation of carbon metabolism, through the pentose phosphate cycle and the C4 cycle.

The chloroplast thioredoxins were called m and f depending on the enzyme they are capable of activating, NADP-malate dehydrogenase (NADP-MDH) and fructose-1,6-bis-phosphatase (FBPase) respectively. Phylogenetic studies and structural comparisons have shown that thioredoxins m have a prokaryotic origin, are nuclear encoded and are weakly associated with the external membranes of the thylakoid. The thioredoxins f are also nuclear encoded and have a eukaryotic origin.

Chloroplastic thioredoxins can regulate such important processes as: the Calvin cycle; the C4 cycle; the metabolism of nitrogen and sulfur; the biosynthesis of fatty acids, isoprenoids, tetrapyrroles and vitamins; the translation; the pentose phosphate cycle; oxidative stress; protein assembly / folding and degradation thereof; starch degradation; glycolysis; Plastidial division and DNA replication. Recently the existence of a complete ferredoxin / thioredoxin system has also been described in amyloplasts, regulating the activity of enzymes involved in processes such as starch metabolism; the biosynthesis of lipids, amino acids and nucleotides; protein folding and other various reactions.

Despite the existence of multiple studies on the structure of chloroplastic thioredoxins, their functions and their regulation in the plant, it is difficult to know which thioredoxin acts in each process in vivo, due to the loss of specificity of the mutated myf thioredoxins used in Proteomics and affinity chromatography.

Plastidial transformation

The genetic information of the plants is distributed in three cellular compartments: the nucleus, the mitochondria and the plastids. The plastidial genome (plastoma) is circular double helix, and in higher plants differs in size according to the species between 120 and 160 kb. The number of plastid copies in the plastid is variable, depending on the type of plastid and the type of cell, and may contain up to 10,000 copies in a leaf mesophyll cell.

In the process of plastidial transformation, the integration of DNA into the plastidial genome is produced by homologous recombination. Up to 14 different insertion sites have been tested in which there have been no negative effects, although the most commonly used have been the intergenic region of trnI-trnA and that of rrn16 / trnV-rps7 / 12. The most commonly used method to insert vectors into plastidial DNA has been high pressure helium bombardment (biolistic method). Selection markers are often used to detect the regeneration of transformants. The most efficient so far has been the aadA gene of bacteria, which encodes the enzyme 3’-adenylyl transferase, and is capable of inactivating aminoglycoside-type antibiotics, such as spectinomycin and streptomycin.

ES 2 384 777 Al

To achieve high levels of recombinant protein accumulation, transgenes are expressed under strong constitutive promoters that ensure high levels of mRNA. Also usually include 5’UTR regions that promote active translation and stabilize transgenes. The choice of these elements is crucial to determine the final amounts of protein accumulation, since the beginning of the translation is the limiting step. In contrast, the 3’UTR region is important for stabilizing mRNA and does not appear to influence the level of transgene expression.

The plastidial transformation has a number of advantages, including the ability to obtain high levels of expression of the recombinant protein, and can reach up to 46% of the total soluble protein, probably due to the high number of copies of the transgene in the cell. Other notable advantages are: the absence of "position effect", allowing a uniform and reproducible expression of the gene; the low probability in the flow of transgenes to other crops or related wild species, since in the majority of the cultivated species the plastomas are inherited by maternal route; and the polycistronic processing capacity, which enables them to process several transgenes under the control of a single promoter.

The biotechnological applications of plastidial transformation are wide (Bock et al, 2001, Trends Biotech. 22, 311-318; Maliga, 2004, Annu. Rev. Plant. Biol. 55, 289-313). On the one hand, there have been numerous studies to provide agronomic advantages to crops, such as resistance to insects or herbicides and phytoremediation. The expression of molecules of industrial interest such as xylanase, trehalose or PHB has also been published. In a review (Heifetz, 2000, Biochim. 82, 655-666), other plastidial expression works that have already been patented (E5 cellulase, bovine aprotinin and herbicide tolerance norflorazon and bromoxynil) are also collected. The most widespread application has been the production of biopharmaceutical compounds in plastids, probably because market expectations are high and great benefits can be expected (Bock, 2007 Curr. Opin. Biotechnol. 18, 100-106; Daniell, 2006, Biotech. J 1, 1071-1079).

Overexpression of recombinant Trx in plants

There are very few works in which thioredoxins have been overexpressed in plants. Cho et al (Cho et al, 1999, Proc. Natl. Acad. Sci. USA 96, 14641-14646) overexpressed a wheat thioredoxin h in the endosperm of transgenic barley, obtaining an increase of up to 4 times in the activity of the 'starchdebranching enzyme', an enzyme that specifically breaks alpha-1,6 bonds in starch, in the endosperm of germinated transgenic grains. It has also been seen that the emergence of the radicle was accelerated during the germination process (Wong et al, 2002, Proc. Natl. Acad. Sci. USA 99, 16325-16330). Likewise, it has been described that overexpression of thioredoxin h in cereals (wheat and barley) can be used to improve the flour-bakery quality of wheat, increasing the strength of the dough (Joudrier et al, 2005, Biotech. Adv. 23, 81 -85) and to mitigate the allergenic response to wheat proteins (Buchanan et al, 1997, Proc. Natl. Acad. Sci. USA 94, 5372-5377) producing more digestive hypoallergenic foods (Joudrier et al, cited above). WO 00/14239, refers to a DNA fragment encoding Trx h, as well as its use for the production of altered levels of thioredoxin in a transformed host cell. All these publications refer to Trx h, cytosolic, with different subcellular localization and biochemical properties than plastidial Trx, in addition, unlike the invention, in none of them reference is made to expression in chloroplasts, nor to chloroplastic Trx. To date, overexpression of no chloroplast thioredoxin in plant chloroplasts has been published.

Relationship between Trx and sugar and starch production

Starch is the main form of carbohydrate storage in plants. It accumulates in large quantities in organs such as seeds (wheat, barley, corn, pea, etc.) and tubers (potato and sweet potato among others) and is a fundamental constituent of the human being's diet. On the other hand, starch is frequently used in the paper, cosmetic, pharmaceutical and food industry, and is also used as a fundamental component for the manufacture of biodegradable plastics and in the production of biofuels. The study of the processes involved in the synthesis of this polysaccharide is a topic of vital importance in various fields of industrial production.

Carbon metabolism begins in chloroplasts by fixing inorganic carbon in the complex process of photosynthesis. Atmospheric CO2 is incorporated into the Calvin cycle and, subsequently, is exported to the cytosol in the form of a triosaphosphate to become sucrose, which in many plants constitutes the main form of transport of sugar from the leaves to other parts of it.

Plastidial thioredoxins, activated by light, play an important role in carbohydrate metabolism. Specifically, thioredoxins f play a fundamental role in the specific activation of many of the enzymes involved in the Calvin cycle, so they are considered to exert some control in the photosynthetic assimilation of carbon. Specific activation for fructose 1,6-bisphosphatase (FBPase), Rubisco-activase, phosphoribulokinase (PRK), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and sedoheptulose 1,7-bisphosphatase (SBPase) has been demonstrated. Thioredoxins m seem to show more specificity in the activation of glucose-6-phosphate dehydrogenase (G6PDH), involved in the catabolism of sugars through the pentose phosphate cycle in the stroma, and NADP-malate dehydrogenase ( NADP-MDH), key enzyme in the

ES 2 384 777 Al

carbon assimilation in C4 plants and participating in the export to the cytosol of reducing power in C3 plants. The evidence currently available points to a stimulating role of carbohydrate biosynthesis by Trx f and an inhibition of catabolic pathways by Trx m.

Recently, thanks to the genomics and proteomics revolution, other enzymes involved in carbohydrate metabolism that are regulated by thioredoxins have been identified, such as ADP-glucosopyrophosphorylase (AGPase), which catalyzes the first step in starch biosynthesis, and beta amylase (TR-BAMY) (Buchanan et al, 2002) (Lemaire et al, 2007). Likewise, plastidial thioredoxins are related to other metabolic processes, regulating enzymes such as CF1 ATP synthase, acetyl-CoA-carboxylase, which leads the de novo synthesis of fatty acids, and 3-deoxy-arabino-heptulosonate-7- phosphate synthase (DAHP synthase), the first enzyme in the shikimic acid pathway (Lemaire et al, 2007).

There are many jobs in which enzymes related to carbohydrate metabolism have been overexpressed in plants. Much of the patents and scientific publications related to obtaining starch producing plants revolve around the use of AGPase (Stark et al, 1992, Science 258, 287-292; Slattery et al, 2000, Trends Plant Sci. 5, 291-298). However, it has also been possible to increase starch levels by producing transgenic plants that overexpress sucroseintase (SS) (Baroja-Fernández et al, 2004, Proc. Natl. Acad. Sci. USA 101, 13080-13085). Overexpression of a FBPase / SBPase of cyanobacteria in tobacco chloroplasts by nuclear transformation improved photosynthesis and growth of transgenic plants (Miyagawa et al, 2001). However, when this same protein has been expressed from the chloroplast genome, despite presenting higher levels of expression, no significant changes in photosynthesis, growth and sugar levels have been observed with respect to those obtained by nuclear transformation (Yabuta et al, 2008).

WO 200036126, WO 200198509 and US 7009087 describe transgenic plants that incorporate in their nuclear genome Trx hy / or Trx-reductases, producing an increase in the extractability of starch from their seeds, due to the alteration of the physicochemical interaction between proteins and starch within of the starch granules. However, this effect is limited to the ease of extraction and not to the production of starch itself.

Unlike the state of the art, the invention shows the very increased production of sugars and starch in transgenic plants that incorporate Trx f with respect to the corresponding wild plants, grown under identical conditions.

Production of recombinant proteins in plants

Recombinant proteins are a component of great importance in research, medicine and industry, being necessary for multiple applications, including therapeutics, vaccines, monoclonal antibodies, hormones, blood proteins, diagnostic agents or enzymes, which represents a great demand for the production of recombinant proteins on an industrial scale.

Commercial production of heterologous proteins has traditionally taken place in microbial fermenters

(E. coli and yeasts mainly) and in mammalian cell cultures. The documents closest to the invention are detailed below:

EP-1609867 describes a construct and a vector for expression in E. coli and a method for increasing the production of high performance recombinant polypeptides in which a first nucleic acid sequence encodes a thioredoxin and a second nucleic acid sequence encodes another protein. such as hemoglobin or an enzyme. It is cloned into a host cell to obtain the product of interest avoiding oxidative stress that occurs as a result of overexpression (summary). The expression of both genes is controlled by the same or different, constitutive or inducible promoters and activating sequences can be introduced at the 5 'ends of the promoters (paragraphs (0044) to (0047)). The genes are expressed as a fusion protein formed by thioredoxin and another polypeptide (paragraph (0062)) that can be purified by chromatography or any other standard method (paragraph (0056)). It is also described that genes can be co-expressed independently (paragraph (0052)), the proteins obtained being more soluble than when they are not expressed together with TRX (either in fusion or in coexpression). However, the technique is not performed on plant plastids but in E.coli.

Similar is the teaching of application US 2002/0146793, which suggests the joint expression of a protein capable of catalyzing the formation of disulfide bonds and a heterologous protein, with yeast being the preferred host. WO 92/13955, meanwhile, specifically refers to a fusion protein obtained from a Trx-like protein and the coding part of a heterologous protein. The host is, again, a bacterium.

EP0768382: refers to 2 vectors that transform E.coli. One of them carries a construct for TRX expression and the other to express a protein of interest.

ES 2 384 777 Al

WO9213955: refers to the expression in E. coli of fusion proteins containing TRX and a protein of interest in a stable and soluble form. These proteins must subsequently be separated and folded correctly.

WO9741207: details a method to express a soluble heterologous protein in a bacterium transformed with a vector containing a gene that encodes the heterologous protein and a gene that encodes a TRX, both of which are expressed separately.

US7655436: describes the coexpression of TRX in E. coli with other heterologous proteins in the form of fusion proteins. They are obtained in soluble and active form. He mentions the problem of accumulation in inclusion bodies, but simply with the fusion construction solves the problem (see col. 2 ln 7). (The fusion construction in plant plastids, described in the present application, does not prevent the accumulation of the protein of interest in inclusion bodies).

WO9837208 (EP1007698 and ES2286844): refers to the expression of heterologous proteins in a host organism that is transformed with a vector that carries a construct with a gene that encodes a TRX and a construct that carries the heterologous protein gene. It refers to the problem of accumulation in inclusion bodies. The transformed organism is a yeast.

These production systems in microorganisms have certain disadvantages in terms of cost, production at scale and biological safety, which has led to the study of other alternatives. The production of recombinant proteins in plants has appeared as one of the most promising platforms, since it allows reducing costs while eliminating risks of contamination with human endotoxins or pathogens. In addition, the production of recombinant proteins in plants allows to obtain oral vaccines that can be administered in crude after a previous dosing. The production of therapeutic proteins in plants began more than a decade ago, and the most used species have been tobacco, corn, potatoes, alfalfa, rice and soybeans.

To date, most of the recombinant proteins of biopharmaceutical interest have been produced by nuclear transformation. Although this technique is well known in many species, it has some disadvantages, such as short-term large-scale production, low levels of expression (usually less than 1% of the total soluble protein), problems arising from post-modification. translational, silencing or position effects (Bogorad, 2000, Trends Biotech. 18, 257-263). Currently, the weakest point in the production of recombinant proteins in plants is the lack of information regarding the processes that include stability, extraction, purification and final performance of the same, issues of great importance for industrial viability (Fischer et al, 2004, Curr. Op. Plant Biol. 7, 152-158; Menkhaus, 2004, Biotech. Prog. 20, 1001-1014).

A variant is the plastidial transformation, with which it has already been possible to express several proteins of biopharmaceutical interest with very high levels of accumulation.

The expression of eukaryotic peptides in plant plastids (WO 00/03012) and, in particular, human serum albumin (HSA) and human cardiotrophin-1 (hCT1) (US 2006/0253935, US 2006/0117412, US 2006 / 0253935; Fernández San-Millán et al, 2003, Plant Biotech. J. 1, 71-79; Farran et al, 2008, Plant Biotech. J. 6 (5): 516-27). WO0357834 (EP1456390): on the production of recombinant vaccines in chloroplasts. It does not carry TRX.

WO2007053183: refers to a system for multigenic expression in tobacco chloroplasts. Various lines of transgenic chloroplasts with multigenic constructs that contain the following characteristics are analyzed: the aadA gene that confers spectinomycin resistance downstream of the promoter of the 16S RNA gene constituting chloroplast (Prr). The heterologous genes of interest are arranged downstream of the aadA gene and are flanked by the psbA region responsible for chloroplast stability. In some cases the heterologous gene contains the psbA promoter and its 5’UTR regulatory sequence. Multigenic constructs are integrated by homologous recombination in the trn region of the plastidial chromosome (area in which more than 30 genes have been successfully integrated) (Daniell et al. 2004 a, b). Does not express TRX.

WO0250289: describes a procedure for coexpressing a thioredoxin in vegetable plastids together with a second polypeptide (p. 14, lines 11-15). The expression system, which consists of a construct that includes the psbA promoter and a 5'UTR sequence, is inserted into a plasmid through homologous recombination zones and expressed in a plant cell or a transformed plant (see p. 56, lines 20 onwards and page 57, paragraph 1). As a transcription activator, it uses the sequence of the G10L region of bacteriophage T7 (p. 58, lines 1-10). The fusion peptides obtained are separated by enzymatic breakdown of a binding sequence (page 8, paragraph 1).

However, to date the expression in chloroplasts of heterologous proteins with Plastidial Trx has not been studied. In the present invention, heterologous Trx m chloroplastics heterologous proteins of the invention have been coexpressed in plastids, observing various totally unexpected effects, such as the high levels of expression of the heterologous protein fused with Trx, far superior to those obtained in chloroplasts in isolation absence of said Trx.

ES 2 384 777 Al

The accumulation, by pastidial transformation, of high levels of recombinant protein can lead to the formation of inclusion bodies (Fernández-San Millán et al, 2003). Although the formation of inclusion bodies can mean, on the one hand, a decrease in proteolysis in recombinant proteins (Enfors, 1992), and may facilitate their purification; On the other hand, it requires an in vitro refolding that does not always guarantee the native conformation of the protein, it implies a decrease in yield and an increase in the process. These procedures hinder the practical production of recombinant proteins for therapeutic, diagnostic or other use. To solve these problems, certain peptides or proteins fused to heterologous proteins have been used. However, translation initiation is very sensitive to the nucleotide sequence surrounding the initiation codon of the heterologous protein, for this reason, fusion can affect the expression levels of said protein.

In bacteria, the fusion of the protein of interest with the thioredoxin of E. coli (TrxA) has proven to be especially useful avoiding the formation of inclusion bodies and increasing the solubility of heterologous proteins (LaVallie et al, 1993). Other studies have shown that bacterial TrxA is capable of increasing the solubility of heterologous proteins by coexpression of both (Yuan et al, 2004).

Despite the efforts made in this field, no method has yet been described that allows solubilization of inclusion bodies in production systems of heterologous proteins in chloroplasts.

In the present invention, solubilization of inclusion bodies is described for the first time when Trx m is coexpressed with heterologous proteins in tobacco chloroplasts, which would guarantee the preservation of the native conformation of the co-expressed protein and, therefore, would prevent loss of functional activity. The technical problem solved by the invention at this point is how to achieve an active folding and solubilization of the heterologous protein that does not accumulate in inclusion bodies. This solution is found in EP1609867 or WO9837208. However, these documents refer to E. coli or yeasts as transformed organisms. No prior art document induces the person skilled in the art to modify the fusion vector described in WO0250289 with a construction such as that described in EP1609867 or in WO9837208 and use it as a coexpression vector in plastids to obtain heterologous proteins in soluble and active conformation without accumulating in inclusion bodies as the invention does. In fact, in EP1609867, both fusion and coexpression cause increased solubility, while in plastids, fusion constructs produce heterologous proteins that accumulate in inclusion bodies, which indicates that plastids and bacteria behave in this case so Different as expression systems. On the other hand, the construction described in WO9837208 is very different from that of the invention.

BRIEF DESCRIPTION OF THE INVENTION

The present invention relates to plastidial expression vectors that incorporate nucleic acid molecules encoding the plastidial thioredoxin f and its precursor, from Nicotiana tabacum, (SEQ ID No. 1 and 3), which produce the corresponding polypeptides (SEQ ID No. : 2 and 4), as well as molecules substantially homologous to them (minimum homology percentage of 60%) or their allelic variants.

The invention also relates to host organisms that incorporate them, particularly plants.

A further aspect of the invention describes the method of obtaining the aforementioned transgenic plants, which comprises the integration of one of the vectors described, by any appropriate means, in the plastoma of a plant.

It was also observed that the transgenic plants that incorporated Trxf into the plastidial vectors described, produced amounts of starch and sucrose greater than 5 or 10 times those obtained from the same tissues or organs of the corresponding wild plants, grown under identical conditions. Therefore, a further embodiment of the invention is the use of said transgenic plant for obtaining sucrose and starch.

In some cases, coexpression has produced recombinant heterologous proteins with different properties. Thus, the invention describes a pharmaceutical composition comprising the recombinant hCT1 protein obtained from the transgenic plant incorporating said protein coexpressed with the Trx of the invention. This recombinant protein shows greater bioactivity than the protein produced in chloroplasts when hCT1 expresses itself. Additionally, a method for determining the bioactivity of said recombinant hCT1 is described.

The aforementioned vectors and recombinant hosts have also been used for overexpression of recombinant heterologous proteins in chloroplasts, in soluble and active form, whose sequences have been coexpressed with those of Trx f. A further embodiment of the invention relates to a method of producing biologically active heterologous proteins and / or folded in their correct conformation, from transplastomic plants that coexpress the sequences of said proteins together with those of Trx f.

ES 2 384 777 Al

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to plastidial expression vectors that incorporate nucleic acid molecules encoding the plastidial thioredoxin f and its precursor, from Nicotiana tabacum, (SEQ ID No. 1 and 3), which produce the corresponding polypeptides (SEQ ID No. : 2 and 4), as well as molecules substantially homologous to them (minimum homology percentage of 60%) or their allelic variants (see Fig. 1).

The invention further provides expression vectors containing DNA molecules encoding Trx f. Integration into the plastidial genome was performed by homologous recombination sequences ZRI and ZRD (Fig. 4) whereby a further embodiment of the invention consists of plastidial vectors that include said sequences. In the case of SEQ ID NO: 3, an ATG initiation codon, corresponding to methionine, at 5 'position had to be added for translation initiation.

To optimize the synthesis of Trx in chloroplasts it is necessary to consider other elements. The final level of protein synthesis depends on several factors such as gene dose, promoter strength, mRNA stability and translation efficiency. Therefore, in the design of the transformation vectors, the expression of the transgenes in transgenic chloroplasts can be regulated at three levels: (a) transcriptionally by the choice of the promoter; (b) post-transcriptionally by the choice of the 5’UTR that regulates the stability of mRNAs and (c) translationally, also by choosing the 5’UTR region that directs the translational level. Although the presence of the 3’UTR is important for conferring stability to the mRNA, there are generally no translational differences when changing some 3’UTR regions for others. Therefore, this region is not considered as a variable to be modified in the different vectors. In preferred embodiments of the invention, endogenous promoters constituting plastids are introduced to direct the gene of interest in the transformation and translation inducing sequences (5'UTRs).

The plastidial promoters tested for the expression of heterologous proteins so far have been several, but the best levels of expression have been obtained with the Prrn and PpsbA promoters, both constitutive. It is known that PpsbA is a very active promoter, producing one of the most abundant mRNAs in the chloroplast (Yukawa et al, 2007). The results of several studies regarding the strength of the promoters are ambiguous, opting for the Prrn and others for the PpsbA (Farran et al, 2008).

Several options were available for the choice of 5’UTR regions. One of the most interesting regions was the 5'UTR of the tobacco psbA gene, which had originally been used for functional studies with GUS and was known to be, among several, the one that most induced translation in light conditions and gave great stability to transcripts (Eibl et al, 1999). Expression levels of 31.1% of total soluble protein have been achieved in tobacco plastids (Molina et al, 2004) using said 5’UTR. Another element of interest was the ribosome binding site (RBS) of the leading region of gene 10 of bacteriophage T7 (G10L). This RBS is complementary to the anti-RBS of the 16SrRNA, which provides very efficient and light independent translation signals. In addition, it had already been proven that the translation capacity of exogenous genes in E.coli (Olins et al, 1988) and plastids (Staub et al, 2000) was increasing, reaching 25% expression levels of total soluble protein ( Tregoning et al, 2003). As a result of the study of the promoters and 5'UTR regions available, it was decided to choose the following elements: Prrn promoter with its own 5'UTR, Prrn promoter and RBS of gene 10 of bacteriophage T7 (G10L), and promoter and 5'UTR of the psbA gene. Therefore, the vectors of the invention incorporate the insert operatively linked to the promoter and the 5'UTR of the psbA gene of N. tabacum. Also, the insert binds to the Prrn promoter and the RBS of G10L.

The vector used for overexpression of Trx f by plastidial transformation was pL3 that has been tested for the expression of human cardiotrophin-1, hCT1 (Farran et al, 2008). This vector integrates the genes of interest by homologous recombination within the open reading frames (ORFs) 70 and 131 located between the rrn16 / trnV and rps7 / 12 genes, in the inverted repeated zone of the plastidial genome. The insertion in this area has been previously used (Maliga, 2004), and allows the integration of genes without interfering with coding regions and without phenotypic consequences. The integration of the genes of interest occurs within the inverted duplicate region, so each plastoma will contain two copies of the genes of interest as a result of the plastid copy copy process (Maliga, 2004), resulting in a very high number of transgenes per cell (up to 20,000). Consequently, embodiments of the invention referring to vectors derived from pL3 are preferred. The constructions finally analyzed to study the overexpression of Trx f in tobacco plastids were: pL3psbATRXf, pL3PrrTRXf and pL3PrrnG10LTRXf (Fig. 2). Of these, the ones that provided the best results for Trx overexpression were the first and the last.

The present invention is further applied to the production of heterologous proteins coexpressed with trx f in a non-native host organism. In the coexpression vectors the two proteins, Trx and heterologous protein, have been expressed in free form, directed by a different promoter in order to avoid possible recombination between the sequences of said promoters that would be a deletion of one of the transgenes. Co-expression vectors comprising the Trx sequences (SEQ ID NO: 1 or ATG start codon linked to SEQ ID NO: 3) linked to the endogenous constitutive promoter plastidial Prrn and the RBS translation inducing sequence, independent of the promoter and 5 'UTR translation inducing sequence of the psbA gene of N. tabacum, operably linked to the heterologous protein. The vectors that coexpress human serum albumin correspond to

ES 2 384 777 Al

a preferred embodiment, and the use of plasmid pAF is especially preferred, the preferred vector being pAFpsbABHSA :: PrrnG10LTRXf. The other protein coexpressed with Trx was hCT1, its coexpression vector being another preferred embodiment, especially that which includes pL3 as a plasmid, in particular the most preferred vector is pL3PrrnG10LTRXf :: psbAhCT1.

The following embodiments of the invention relate to host organisms that incorporate the different coexpression plastidial vectors detailed above. Such hosts may be transgenic plants, their seeds or propagation material, which incorporate in their plastids the described recombinant vectors. In preferred embodiments, transgenic plants that include the coexpression vectors described above are described successively, preferably said plants belong to the Nicotiana tabacum or Solanum tuberosum species.

A further embodiment of the invention describes methods of obtaining the new transgenic plants described, which allow the recombinant vectors described above to be integrated into its plastoma. A preferred method includes the following steps:

a) bombardment of in vitro grown leaves with a gene gun loaded with the vector of any one of claims 18 to 48;

b) obtaining the first regenerated transformants in culture medium supplemented with an antibiotic against which the bombed vector confers resistance;

c) realization of at least a second regeneration cycle in selective medium with the same antibiotic, to obtain homoplasmic plants;

d) selection of homoplasmic plants by any method of selecting DNA by size.

Those methods in which the leaves come from the species Nicotiana tabacum or Solanum tuberosum are preferred and the antibiotic used is spectinomycin.

In further embodiments, the various uses for which the hosts were used and, above all, the transgenic plants described are described.

Plants that produce higher levels of Trx f (PrrnG10LTRXf and PpsbATRXf) in the chloroplast show an accumulation of starch in leaves, considerably higher than that obtained in control plants (Fig. 7). In addition, in the leaves of these transplastomic plants, there is no nocturnal degradation of starch, indicating that the glycolysis process could also be affected. G6PDH catalyzes the first step of the oxidative cycle of pentose phosphate, and is therefore involved in the catabolism of sugars. This enzyme is active at night and is inactivated in the presence of light by the action of thioredoxins (Wenderoth et al, 1997; Wendt et al, 2000), so one might think that the cells of plant leaves that overexpress Trx f have such a high reducing power that G6PDH remains inactive even during the dark period, thus explaining the high levels of starch in the leaves of these plants. It can also be seen that the transgenic plants constructed using the transcriptional control of the Prrn promoter, which produces very low levels of Trx f (Fig. 5, were not detected by immunodetection) have a behavior very similar to the control plants in terms of amount of starch accumulated in leaf, which could explain the absence of a physiological response.

Another significant difference between the control and transplastomic plants lies in the sucrose presented by the latter leaves, being more than double that of the control plants at all times sampled (Fig. 7). This could facilitate a greater export of this disaccharide to the reserve organs. Thus, potato or cereal plants that overexpress Trx f in their plastids could potentially accumulate more starch in their reserve tissues (tubers or seeds). From all of this, the high industrial interest of these plants in obtaining starch is evident. The effects regarding increased sucrose and starch are described in Example 5. Consequently with these facts, a further embodiment of the invention is related to the use of transgenic plants that produce increased levels of Trx f for obtaining sucrose and starch. Preferably, said plants produce between 5 and 10 times more amounts of sucrose and starch than those obtained from the same tissues or organs of the corresponding wild plants grown under the same conditions. The obtaining of said starch was carried out through the following stages:

to)

leaf collection and freezing in liquid nitrogen;

b)

spray;

C)

homogenization with ethanol;

d)

incubation for 90 min at 70 ° C;

ES 2 384 777 Al

e) centrifugation for 10 min at 14000 rpm.

d) obtaining starch from the pellet obtained.

Another aspect of the invention lies in the analysis of the effects produced in plants that include the HSA or hCT1 proteins, fused or coexpressed in their chloroplasts with the new Trx. First, the amounts of accumulated HSA in adult plant leaves grown in phytotron were analyzed, from which the total protein was extracted (Farran et al, 2002). By immunodetection and using an anti-HSA as the primary antibody, it was found that the plants expressing the HSA fused to either of the two thioredoxins had a band pattern (Fig. 14a, lanes 2-4) similar to that observed in the samples of plants that express HSA alone (Fig. 14a, lane 1; Fernández-San Millán et al, 2003). A large number of high molecular weight aggregates can be observed, which could be indicating the accumulation in the chloroplast of the fusion protein in inclusion bodies, as occurs when the HSA expresses itself (Fernández-San Millán et al, 2003). However, these aggregates disappear when albumin is co-expressed with any of the thioredoxins (Fig. 14a, lanes 5-7), suggesting a possible role of Trx in the solubilization of HSA inclusion bodies. Furthermore, it seems that the expression of thioredoxin in free or fused form has a different mode of action on the solubility of recombinant proteins (Yuan et al, 2004), which would explain the fact that only the dissolution of aggregates is achieved when both proteins are coexpressed. Although the formation of inclusion bodies can mean a decrease in proteolysis in recombinant proteins (Enfors, 1992), and may facilitate their purification, on the other hand it requires an in vitro refolding that does not always guarantee native conformation. of the protein, supposes a decrease of the yield and an increase of the process. Therefore, in many cases it may be interesting to have a solubilization system for the expression of heterologous proteins in chloroplasts

Given the large amount of recombinant protein observed in the immunodetection of the plants that express the fusion of the Trx with the HSA, the samples were analyzed by SDS-PAGE (Fig. 14b). In the extracts of the leaves that express the fusion of the Trx with the HSA, in addition to the band corresponding to the large subunit of the RuBisCo (approx. 50 kDa), an intense band stained with CBB (Coomassie Brillant Blue) of an approximate size of 80 kDa (Fig. 14b, lanes 1-4). This band does not appear in leaf extracts of unprocessed plants (Fig. 14b, PH) or in those of plants that express HSA alone (Fig. 14b, lane 5). In the latter, however, a thinner band, of about 67 kDa, corresponding to the HSA can be visualized. These results indicate that a large amount of Trxm / fHSA fusion protein accumulates in tobacco chloroplasts, even at levels higher than those obtained in plants expressing HSA alone (: 11% of total protein; Fernández-San Millán et al, 2003). It is known that the large subunit of the RuBisCo represents approximately 50% of the total soluble leaf protein (Whitney et al, 1999). If we compare the intensity of the 80 kDa band, corresponding to the fusion protein, with that of the large subunit of the RuBisCo, we could estimate Trxm / fHSA expression levels between 15-20% of the total soluble protein .

The amounts of hCT1 accumulated in fully developed leaves of adult plants grown in phytotron were also analyzed, from which the total protein was extracted (Farran et al, 2002). Preliminary studies on the expression of hCT1 in tobacco chloroplasts showed that rhCT1 (recombinant hCT1) accumulated at high levels (: 3% of the total soluble protein) in young leaves, and these levels could be doubled by subjecting plants to 30 hours of continuous light (Farran et al, 2008). By immunodetection and using a monoclonal against hCT1 as primary antibody, it was found that plants expressing fused hCT1 to either of the two thioredoxins (Trxm / fCT1) had higher levels of rhCT1 than control plants (CT1; Farran et al, 2008), regardless of the light condition used (Fig. 15). Therefore, we can conclude that the fusion of any of the Trx with hCT1 provides greater stability to the protein of interest, which translates into a greater accumulation of it even in mature leaves and without the need to subject the plants to conditions of continuous light. However, when the plants that coexpress Trxm / f with hCT1 (Trxm / f + hCT1) were analyzed, the expression levels of hCT1 were similar to those obtained in control plants (Fig. 15). In addition, no increases in protein were observed in conditions of continuous light (30 h light), suggesting some effect of the coexpression of Trx on the redox state of chloroplast, which somehow affects the translation of the 5'UTR of psbA .

To study the functionality of rhCT1 produced in tobacco chloroplasts, its ability to induce phosphorylation of the STAT-3 transcription factor was studied. The assay was carried out in the HepG2 line of human hepatocarcinoma. Extracts from stimulated cells were analyzed by immunodetection with specific antibodies of the phosphorylated form of STAT-3 (Fig. 16). As a negative control, unprocessed tobacco protein extract was used and as a positive commercial hCT1 (PrepoTech) alone or added to the raw unprocessed tobacco extract was used (Fig. 16a). When the bioassay was performed with the rhCT1 obtained from the different transformed plants, it was found that it was capable of inducing the phosphorylation of STAT-3 independently of the plant extract used (Fig. 16b). However, said phosphorylation was much more intense in the case of cells stimulated with plant extract expressing the fused or coexpressed CT1 with any of the chloroplastic thioredoxins tested, suggesting that thioredoxins may play an important role in improving the bioactivity of the rhCT1 produced in chloroplasts of tobacco leaves.

ES 2 384 777 Al

The determination of the differential activity of the recombinant hCT1 obtained from the transgenic plants, with respect to the commercial one, was carried out by a method that included the following steps:

a) stimulate hepatocytes with recombinant human cardiotrophin-1, from said transgenic plant and with commercial human cardiotrophin-1;

b) analyze cell extracts stimulated with each type of hCT1 with antibodies specific for the phosphorylated form of STAT-3;

c) compare the results of both types of extract, using as a negative control unprocessed tobacco protein extract, and as a positive control commercial hCT1, alone or added to the unprocessed extract.

Therefore, a use contemplated in the invention refers to the use of the described transgenic plants that coexpress hCT1, to obtain a recombinant human cardiotrophin-1 heterologous bioactivity protein increased by at least double that of the hCT1 protein produced in chloroplasts when It expresses itself.

Given the high activity of the recombinant hCT1 protein obtained from the transgenic plant that includes the described coexpression vector (pL3PrrnG10LTRXf :: psbAhCT1), an embodiment of the invention is established relating to a pharmaceutical composition incorporating said recombinant protein, together with an adjuvant and / or a pharmaceutically acceptable carrier.

A further embodiment of the invention considers the use of transgenic plants incorporating the plastidial vectors described in detail above, which contain the new Trx or their precursors coexpressed with heterologous proteins, for the production of increased amounts of said heterologous proteins, preferably HSA or hCT1, which are also obtained in soluble and active form.

A further aspect of the invention relates to a method of producing biologically active heterologous proteins and / or in their native conformation which employs the plants described above, comprising:

a) cultivate the described transgenic plants, which coexpress the Trx f of the invention and heterologous proteins, under conditions appropriate for their growth;

b) separate the green parts of the plant;

c) purify the heterologous protein using affinity chromatography, size separation with a standard or ion exchange techniques.

In a preferred embodiment, the application of said method for the production of HSA is described.

DESCRIPTION OF THE FIGURES

Fig. 1. Nucleotide sequences of the f (a) and m (b) chloroplastic thioredoxins of tobacco. In italics, precursor sequence or transit peptide; Underlined triplet indicates the beginning of the mature protein. Protein sequences of chloroplastic thioredoxins f (c) and m (d) of tobacco: underlined amino acids indicate the protein sequence corresponding to the precursor or transit peptide; * stop the translation.

Fig. 2. Trx overexpression vectors in plastidium. The areas of the vector that are inserted into the plastidial genome are described. The two homologous recombination zones that the vector includes (ZRI and ZRD) appear at the ends. Among the homologous recombination zones, the different Trx m / f and aadA transgenes (adenylyl transferase gene, for antibiotic inactivation) are schematized. The 5’UTR promoters and regions chosen are shown in the 5 ’position of the transgenes. Prrn: promoter of the 16SrRNA of tobacco; PpsbA5’UTR: promoter and 5’UTR of the tobacco psbA gene; PrrnG10L: promoter of 16SrRNA and leader region of gene 10 of bacteriophage T7. In the 3 ’region of Trx m / f is the Trps16 terminator of ribosomal protein 16. In the 3’ region of aadA is the TpsbANt terminator of the psic gene of Nicotiana tabacum. Arrows indicate the direction of transcription.

Fig. 3. PCR analysis of the correct integration of transgenes in regenerated plants after gene gun bombardment. Genomic DNA was extracted from seedlings in vitro. The PCR was performed with primers L1 and L2 to check insertion in the plastidial genome. The fragment obtained in case of integration is 1,516 bp. Streets: M, molecular weight marker; WT, unprocessed control plant DNA;

(a) 1-6, DNA from plants regenerated from bombardment with the vector pL3psbATRXf; (a) 7-10, DNA of plants regenerated from bombardment with the vector pL3PrrnG10LTRXf; (b) 1-3, DNA from plants regenerated from bombardment with the vector pL3PrrTRTR.

Fig. 4. Analysis of the integration of Trx f and m in the plastoma and selection of homoplasmic plants by Southern blotting. 10 μg of genomic DNA obtained from

ES 2 384 777 Al

in vitro seedlings with BglII. The fragments were separated on a 0.7% agarose gel. After depurination, they were transferred to a nylon membrane and hybridized with specific probes. (a) Scheme of the insertion zone of the transgenes in the plastidial genome with the BglII restriction sites. Homologous recombination regions are underlined and are indicated as ZRD and ZRI. Also shown are the different transgenes that integrate with the transformation vectors and to their right the size of the fragments generated after digestion of the DNA with BglII. SH: probe homologous to the areas adjacent to the transgenes inserted in the plastidial genome. ORF: open reading frames. LOX: P1 phage recombinase recognition sequence CRE; rps: ribosomal protein; trnV: valine transfer RNA gene. (b) Southern autoradiography. Streets: PH, DNA of a non-transformed Petit Havana line as a negative control; 1-3, DNA of transgenic lines generated by transformation with the vector pL3psbATRXm / f; 4-6, pL3PrrTRTRmm / f; 7-9, pL3PrrnG10LTRXm / f.

Fig. 5. Immunodetection of leaf proteins from transgenic tobacco plants. Total protein extracts were separated on a 13% SDS-PAGE gel and transferred to a nitrocellulose membrane. The membrane was hybridized with a peroxidase-conjugated anti-polyHistidine monoclonal antibody. Streets: M, molecular weight marker in kDa; PH, 2 μl of unprocessed Petit Havana plant protein; the rest of the streets are plant leaf protein transformed with vectors 1-3, pL3psbATRXF (2 μl / well); 4-7, pL3PrrnG10LTRXf (2 μl / well); 8-11, pL3PrrTRTR (5μl / well).

Fig. 6. Transcriptional patterns of transgenic plants observed in Northern blotting. 20 μg of RNA obtained from mature leaves of adult potted plants were separated on a formaldehyde gel and transferred to a nylon membrane. They hybridized with a specific Trx f probe. (a) The expected size of the transcript in the transgenic lines generated by the different vectors is shown with arrows. ORF: open reading frames. LOX: P1 phage recombinase recognition sequence CRE; rps: ribosomal protein; trnV: valine transfer RNA gene. (b) Autoradiography resulting from hybridization with the Trx probe f. On the right, the sizes of the molecular weight marker of RNA in kb are shown. (c) Load control: rRNA stained with ethidium bromide. Streets: PH, RNA of Petit Havana plant without transforming; the rest are RNAs from plants transformed with 1, 2 and 3, pL3psbATRXf; 4 and 5, pL3PrrTRTRf; 6 and 7, pL3PrrnG10LTRXf.

Fig. 7. Concentration of soluble sugars and starch, during the diurnal cycle, in leaves of transplastomic plants and unprocessed control plants. Carbohydrate concentrations were measured in young leaves of adult tobacco plants, grown in the greenhouse. Samples were taken every 4 hours, with 12 repetitions per sample and construction. The data represents the mean and the standard error. Symbols; 0, control plant without transforming; ., plants transformed with the vector pL3PrrnTrxf; ., plants transformed with the vector pL3PrrnG10LTrxf; ., plants transformed with the vector pL3PpsbATrxf.

Fig. 8. Expression of recombinant Trx in E. coli. Equal amounts of protein were loaded per well on a 13% SDS-PAGE gel and transferred to a nitrocellulose membrane. (a) The membrane was hybridized with a peroxidase-conjugated anti-polyHistidine monoclonal antibody, and (b) stained with Ponceau S. Calles: M, molecular weight marker; pL3, empty pL3 vector as a negative control; the rest of the streets are E. coli protein transformed with the following vectors: 1 and 2, pL3 PrrnG10LTRX m and f; 3 y4, pL3 psbATRX m and f; 5 y6, pL3PrrTRTR f and m. Molecular weights in kDa are indicated.

Fig. 9. Purification of recombinant Trx in E. coli. Equal amounts of each fraction obtained in the purification process were loaded on a 15% SDS-PAGE gel that was stained with coomassie brilliant blue (a) or transferred to a nitrocellulose membrane (b). The membrane was hybridized with a monoclonal antibody antipoliHistidine conjugated with peroxidase. Streets: M, molecular weight marker; FT, protein fraction not retained by the column; W, wash; E1 to E4, fractions of 1 ml eluted. Molecular weights in kDa are indicated.

Fig. 10. Trx-dependent insulin reduction by dithiothreitol action. The incubated mixtures contained in a final volume of 600ul: 0.1M potassium phosphate (pH 7.0), 2mM EDTA, 0.13mM bovine insulin and 0.33mM DTT (dithiothreitol). Symbols:., 5 mM Trx from commercial E.coli, 0.5 mM Trx f. The absorbance at 650nm versus time in minutes is shown.

Fig. 11. Cloning of the fusion and coexpression vectors of thioredoxins and human serum albumin in the plasmid pAF. (ad) Expression cassettes of the fusion of thioredoxins (TRX) to human serum albumin (HSA) (a and b) or coexpression of TRX with HSA (c and d) that are inserted into the multiple cloning site (MCS) of the pAF vector. 16S / trnI and trnA / 23S: homologous recombination zones; aadA spectinomycin and streptomycin resistance gene; 3’psbA: 3 ’untranslated region terminator of the tobacco psbA gene; Prrn: promoter of the 16SrRNA operon; PpsbA5’UTR: promoter and region 5 ’not translated from the tobacco psbA gene; PrrnG10L: promoter of the 16SrRNA operon plus the sequence of the ribosome binding site (rbs) of the leading region of gene 10 of bacteriophage T7 (G10L). EK: Recognition sequence for cutting with enterokinase. EcoRV, HindIII, SmaI, Notl, EcoR1: restriction enzyme cut sites. The direction of transcription is indicated by arrows.

ES 2 384 777 Al

Fig. 12. Cloning of the fusion and coexpression vectors of human thioredoxins and cardiotrophin-1 in plasmid pL3. (ad) Expression cassettes of the fusion of thioredoxins (TRX) to human cardiotrophin1 (hCT1) (a and b) or coexpression of TRX with hCT1 (c and d) that are inserted into the multiple cloning site (MCS) of the pL3 vector. ZRD and ZRI: homologous recombination zones; aadA spectinomycin and streptomycin resistance gene; TpsbANt: terminator of the psic gene of Nicotiana tabacum; Trps16: ribosomal protein terminator 16; LOX: CRE recombinase recognition sequence; Prrn: promoter of the 16SrRNA operon; PpsbA5’UTR: promoter and region 5 ’not translated from the tobacco psbA gene; PrrnG10L: promoter of the 16SrRNA operon plus the sequence of the ribosome binding site (rbs) of the leading region of gene 10 of bacteriophage T7 (G10L). EK: Recognition sequence for cutting with enterokinase. EcoRV, HindIII, SmaI, Notl, EcoR1: restriction enzyme cut sites. The direction of transcription is indicated by arrows.

Fig. 13. Analysis of the integration of fusions and coexpressions of Trx with heterologous proteins in the plastoma and selection of homoplasmic plants by Southern blotting. 10 μg of genomic DNA obtained from seedlings in vitro were digested with BglII (pL3) or HindIII (pAF). The fragments were separated on a 0.7% agarose gel. After depurination, they were transferred to a nylon membrane and hybridized with probes homologous to the areas adjacent to the transgenes inserted in the plastidial genome. (a-d) Southern autoradiographs. PH, DNA of an unprocessed Petit Havana line as a negative control. Other streets, DNA of transgenic lines generated by the transformation with the vector pAFTRXm / fHSA (a); pL3TRXm / fCT1 (b); pAFTRXm / f + HSA (c); pL3TRXm / f + CT1 (d). TRXm / f: thioredoxins m or f; HSA: human serum albumin; CT1: cardiotrophin-1.

Fig. 14. Production of recombinant human albumin in tobacco plants. (a) Immunodetection of the total protein extracted from leaves of transgenic tobacco plants. A polyclonal antibody against human serum albumin (HSA) has been used. Streets: 1, plants that express HSA alone (Fernández-San Millán et al, 2003); 2-4, plants expressing the Trxm / fHSA fusion protein; 5-7, plants that coexpress the Trxm / f and HSA proteins; PH, unprocessed plant. (b) SDS-PAGE gel stained with Coomasie Brilliant Blue (CBB). Streets: PH, non-transformed plant; M, molecular weight marker in kDa; 1-2, plants expressing the TrxmHSA fusion protein; 3-4, plants expressing the TrxfHSA fusion protein; 5, plants that express HSA alone (Fernández-San Millán et al, 2003). Trx m / f: thioredoxin m or f.

Fig. 15. Analysis of the accumulation of recombinant human cardiotrophin-1 after different lighting periods. Immunodetection of the total protein extracted from leaves of transgenic tobacco plants. A monoclonal antibody against recombinant human cardiotrophin-1 (rhCT1) has been used. Ripe leaves harvested after 15 hours of darkness or at 12:30 pm of continuous light have been used. Streets: M, molecular weight marker (kDa). CT-1: plants that express human cardiotrophin-1 alone (Farran at at, 2008). OSC: darkness; 12L: 12 h of continuous light; 30L: 30 h of continuous light.

Fig. 16. Test of the activity of rhCT1 through the analysis of the activation of the phosphorylation of STAT-3. Immunodetection with specific antibody for the phosphorylated form of STAT-3. (a and b) Streets: hCT-1, positive control of cells stimulated with commercial human CT-1; C, negative control of unstimulated cells. (a) Streets: wt extract, negative control of cells stimulated with non-transformed plant extract; hCT-1 in wt extract, positive control of cells stimulated with extract of non-transformed plants to which commercial human CT-1 has been added. (b) Streets: CT1, cells stimulated with different amounts of plant extract transformed with CT1 alone; Trxm / fCT1, cells stimulated with different amounts of plant extract transformed with the Trxm / fCT1 fusion; Trxm / f + CT1, cells stimulated with different amounts of plant extract transformed with CT1 coexpressed with Trxm / f.

EXAMPLES

-Example 1.-Obtaining the mature sequences of the plastidial Trx m and f.

The mature Trx m and f sequences of Nicotiana tabacum not yet described were obtained by amplifying their 5 ’and 3’ ends. For this, the RLM-RACE Kit (Ambion) was used, following the manufacturer's specifications and designing internal primers from the Solanaceae Trx conserved regions (TxfRACEup, TxfRACEdown, TxmRACEup, TxmRACEdown; Table 1). As a template, cDNA of tobacco var. Petit Havana. Based on the sequences amplified by RACE, primers NtTrxm-5 ', NtTrxm-3', NtTrxf-5 'and NtTrxf-3' (Table 1) were designed to clone mature myf tobacco Trx (SEQ ID No. 3 and 7; see also Fig. 1). These primers incorporate in the 5 ’region the NcoI target for fusion with the 3’ end of the corresponding promoter followed by a histidine tail, and in the 3 ’region a NotI target.

ES 2 384 777 Al

Table 1 Primers used in cloning the sequences of mature Trx m and f tobacco.

Sites of

Primers

 Sequence1 Recognition of

restriction enzymes

TxfRACEup

GTTGCAATCAAGCTTCAGAAAGAC

TxfRACEdown

 GTCTTTCTGAAGCTTGATTGCAAC

TxmRACEup

GAGGGGCTTTCATCTGTATTCAG

TxmRACEdown

 CTGAATACAGATGAAAGCCCCTC

NtTrxm-5’2

 CCATGGGTCACCATCACCATCACCATGAAGCGCAAA NcoI

NtTrxm-3 ’

GCGGCCGCTTACAAGAATTTCTCTATGCAGGTGG NotI

NtTrxf-5’2

 CCATGGGTCACCATCACCATCACCATAGCTCCGATGCT NcoI

ACTG

NtTrxf-3 ’

GCGGCCGCTTAACTTGACCGCACATCCTCAATTG NotI

1 Primer sequence in orientation 5’�3 ’.

2 In italics: histidine tail.

-Example 2.-Obtaining thioredoxin expression vectors.

5 pL3psbATRXm / f: the mature Trx m and f sequences were obtained by NcoI-NotI digestion of the pGEMTRXm and pGEMTRXf vectors, resulting in a fragment of 366 and 390 bp respectively. These fragments were cloned into the vector pBS-psbAHSA (Fernández-San Millán et al, 2003), digested with NcoI-NotI, to incorporate the promoter and the 5'UTR of the tobacco psbA gene. The promoter and the 5’UTR of the psbA gene together with the Trx m or f were subcloned, by EcoRI-NotI digestion, into the vector pPCR2.1 (pPCR2.1psbATRXm / f). Finally the

The EcoRI-XhoI fragment of said vectors was inserted into the plastidial transformation vector pL3, thus obtaining the final vectors pL3psbATRXm and pL3psbATRXf (see Fig. 2)

pL3PrrTRXm / f: the 215 bp fragment belonging to the promoter of the plastid ribosomal RNA operon (Prrn) was obtained from the vector pBS-PrrnaadA (del Rio, unpublished results). In this vector the NcoI-NotI fragment of Trx m or f was cloned. By EcoRI-NotI digestion of the intermediate vectors obtained (pBS

15 KSPrrnTRXm / f) the fusion of Trx m or f with the rRNA operon promoter was obtained, which was cloned into the vector pPCR2.1 (pPCR2.1PrrTRTRmm / f). Finally, the EcoRI-XhoI fragment of said vectors was inserted into the plastidial transformation vector pL3, thus obtaining the final vectors pL3PrrTRTRmm and pL3PrrTRTRf (see Fig. 2)

pL3PrrnG10LTRXm / f: the NcoI-NotI fragment corresponding to the mature Trx m or f sequence was introduced into the vector pBS-PrrnG10LCTF (Farran et al, 2008). In this way the pBS vectors were obtained

20 PrrnG10LTRXm / f, which by EcoRI-SalI digestion released the fusion of the Trx mof with the 150 bp fragment that includes the constitutive promoter of the plastidium ribosomal RNA (Prrn) operon, which has been substituted for the 5'UTR by the sequence of the ribosome binding site (RBS) of the leading region of gene 10 of bacteriophage T7 (G10L). The fragments obtained were ligated with the vector pL3 to give rise to the plastidial transformation vectors pL3PrrnG10LTRXm and pL3PrrnG10LTRXf (see Fig. 2)

25 -Example 3.-Generation of transgenic plants.

The plastidial transformation was based on the Daniell protocol (1997) with slight modifications discussed below. It was split from in vitro tobacco leaves obtained after micropropagation after germination. An hour before the bombing the tobacco leaves were cut, discarding the apical and basal. They were placed on sterile filter paper in RMOP medium (MS salts, 30 g / l sucrose, 0.1 mg / l ANA, 1

30 mg / l BAP, 100 mg / l myo-inositol, 1 mg / l thiamine and 6 g / l Phytagar pH 5.8) in Petri dishes with the underside facing up. Gold particles of 0.6 microns were used at a rate of 100 ng gold and 300 ng of DNA per bombed sheet. The rupture pressure was 1,100 psi. All fungible material used was from Bio-Rad. After the bombardment with the Helios Gene Gun PDS-1000 (Bio-Rad) gene gun, the leaves were kept in darkness for 48 hours inside the Petri plates sealed with parafilm. After this period, the leaves were cut into pieces of about 0.5 cm side

35 discarding the central nerve. The pieces of leaf were placed with the underside (part bombed) in contact with the RMOP medium supplemented with 500 mg / l spectinomycin in Magenta boxes sealed with parafilm. The first transformants began to emerge from the leaf pieces at 3-4 weeks after the bombing. The shoots thus obtained were allowed to grow until they had sufficient size to extract the DNA and check the integration of the Trx and the aadA by PCR. The primers used L1 (5’-GGAAATACAAAAAGGGGG-3 ’) and L2 (5’

40 CCTCGTTCAATTCTTTCG-3 ’) were designed to eliminate possible spectinomycin resistant mutants. He

ES 2 384 777 Al

primer L1 ring in Trps16, about 131 bp from the end thereof, and primer L2 ring in the plastidial genome, about 223 bp after the ZRD. Thus, if there has been integration of the genes of interest, the expected product should be 1.5 kb (Fig. 3a, lanes 4-9 and 3b, lanes 1-3). The absence of the PCR product indicates that these regenerants are spontaneous mutants capable of growing in spectinomycin without the presence of the aadA gene. As can be seen in Fig. 3, mutants appeared among the sampled regenerants (lanes 1-3 and 10). A high incidence of spectinomycin-resistant regenerants as a result of a mutation in the 16S plastidial rRNA gene has been demonstrated several times.

Obtaining stable transformed lines involves the cultivation of the transformants in the presence of spectinomycin for the time necessary for the cells to divide at least 16 to 17 times. During this time the transformed plastids have a selective advantage over the non-transformed ones, gradually increasing in number. The first regenerants obtained are usually totally green but chimeric, with transformed and untransformed sectors due to masking by the transgenic tissue. Therefore, it is necessary, at least, a second cycle of regeneration in selective medium to obtain homoplasmic plants. Thus, the leaves of the transformed shoots were cut into pieces of about 3 mm side and were subjected to two or three new rounds of regeneration in RMOP medium with 500 mg / l of spectinomycin until homoplasmia was achieved. When the new regenerated plants were rooted, the analysis was carried out by Southern blotting. Using a probe from a fragment of the homologous recombination zones (SH probe, see Fig. 4a) it is possible to confirm a specific and stable integration of the transgenes within the inverted duplicate regions of the plastoma and select the homoplasmic plants. Transformed plant DNA digested with BglII and hybridized with the SH probe should produce 6.7 or 4.9 and 1.8 kb fragments according to the vector used (see Fig. 4a). In the event that the genome is untransformed, a 4.5 kb fragment should appear. The presence of both types of bands indicates heteroplasmia. As can be seen in Fig. 4b, homoplasmic plants were obtained in all constructions.

-

Example 4.-Detection of recombinant Trx in transgenic tobacco plants.

First, the presence of recombinant Trx in transgenic tobacco plants was detected by immunodetection with an anti-histidine antibody. The total protein of mature leaves of the transformed plants was analyzed. As can be seen in Fig. 5, a 12 kDa band corresponding to Trx f was detected in the plants transformed with the vectors pL3psbATRXf and pL3PrrnG10LTRXf, the expression thereof being of comparable magnitude. However, in the lines obtained with the vector pL3PrrTRTRf Trx f was not detected by this technique, although more total protein was loaded in the gel than in the rest. Similar results were obtained when Trx m was overexpressed. The bands that appear above the Trx f, of approximately 23, 27 and 40 kDa, correspond to endogenous plant proteins that react with the anti-histidine antibody used, since these bands also appear in the plant extract without transform (Fig. 5, PH street).

The factors that influence the performance of a heterologous protein can be transcriptional, such as promoter activity; post-transcriptional, such as messenger RNA stability or translation efficiency; and post-translational, such as protein stability. Since, a priori, the stability of the protein should be exactly the same in all the plants obtained, studies were carried out at the level of messenger RNA to elucidate the causes of the differences in accumulation of Trx f between transgenic lines.

Mature leaves RNA was extracted from the transformed plants and hybridized with a specific Trx f probe. Trx transcript levels varied between the different transgenic lines obtained (Fig. 6). You can see how the line transformed with pL3PrrTRXf (lanes 4 and 5) has a similar number of transcripts than the line transformed with pL3PrrGG10LTRXf (lanes 6 and 7), which was expected, since both are under the control of it Prrn promoter. However, when Trx is directed by the promoter of the psbA gene, a greater amount of transcript is produced (lanes 1, 2 and 3).

In summary, the vectors that have most efficiently expressed Trx in transgenic tobacco chloroplasts have been pL3psbATRXm / f and pL3PrrnG10LTRXm / f (Fig. 5). It has been proven that the promoter of the psbA gene is very active in plastid, being much stronger than Prrn (Fig. 6). On the other hand, the RBS of the G10L leader sequence of bacteriophage T7 is an element of great efficiency in the translation of Trx, since presenting less transcripts of Trx f than the promoter of psbA, the protein levels obtained are similar (Figures 5 and 6). Thus, plants that overexpress Trx m or f are obtained at different levels.

-

Example 5.-Effect of overexpression of Trx f on carbohydrate metabolism.

Young leaves of plants grown in the greenhouse were sampled (photoperiod of 15h light, with temperatures of 30 / 17ºC day / night). Samples were collected every four hours, over a period of 24 hours and stored frozen at -80 ° C. The leaf disks frozen in liquid nitrogen were sprayed with the aid of a Microdismembrator (Braun) apparatus. They were homogenized with 500 µl of 100% ethanol and 500 µl of 80% ethanol were added. The samples were incubated for 90 min at 70 ° C, and centrifuged (14000 rpm, 10 min). The concentration of soluble sugars was determined from the supernatant by high pressure chromatography (HPLC) with amperometric detection, in a Dionex DX-500 system fitted to a Carbo-Pac PA1 column.

ES 2 384 777 Al

(Rolletscheck et al, 2002). The starch concentration was determined in the pellet as follows. The pellet was washed with 1 ml of 80% ethanol, suspended again in 400 µl of 1M KOH, incubated for 60 min at 95 ° C and neutralized with 70 µl of 1M acetic acid. The starch content was measured according to the indications of a commercial kit (Boehringer Mannheim, Roche), based on an enzymatic hydrolysis and a photometric determination of the amount of glucose. The results obtained are reflected in Fig. 7. Plants that produce higher levels of Trx f (PrrnG10L and PpsbA) in the chloroplast show an accumulation of starch in leaves between 5 and 10 times higher than that obtained in the control plants (Fig .7). In addition, in the leaves of these transplastomic plants, there is no nocturnal degradation of starch, indicating that the glycolysis process could also be affected. G6PDH catalyzes the first step of the oxidative cycle of pentose phosphate and, therefore, is involved in the catabolism of sugars. This enzyme is active at night and is inactivated in the presence of light by the action of thioredoxins (Wenderoth et al, 1997; Wendt et al, 2000). Therefore, one might think that the cells of the leaves of plants that overexpress the Trx f have such a high reducing power that the G6PDH remains inactive even during the dark period, thus explaining the high levels of starch that the leaves of said plants present. . It can also be observed that the transgenic plants constructed using the transcriptional control of the Prrn promoter, which produces very low levels of Trx f (Fig. 5, were not detected by Immunodetection), have a behavior very similar to the control plants in terms of quantity of starch accumulated in leaf, which could explain the absence of a physiological response.

In summary, the amount of starch detected in transgenic tobacco leaf is around 6% of the fresh weight. In a test of tobacco varieties made in Cadreita and Murieta (Navarra), the control variety Petit Havana gave average yields of 1.5 t of leaves / ha, values much lower than those obtained with commercial varieties in which they could be obtained up to 50 t of tobacco leaves / ha. This would mean, in the case of using productive varieties, about 3 tons of starch per ha.

Another significant difference between the control and transplastomic plants lies in the sucrose presented by the latter leaves, being more than double that of the control plants at all times sampled (Fig. 7). This could facilitate a greater export of this disaccharide to the reserve organs. Thus, potato or cereal plants that overexpress Trx f in their plastids could potentially accumulate more starch in their reserve tissues (tubers or seeds). From all of this, the high industrial interest of these plants in obtaining starch is evident.

-

Example 6.-Obtaining soluble and active recombinant Trx in Escherichia coli.

Since there are great similarities between the transcription and translation machinery of bacteria and plastids (Brixey et al. 1997), the functionality of the vectors designed for plastidial transformation in E.coli was verified. These vectors were used to transform E.coli TOP 10F ’strain. The transformants were cultured in LB Broth medium with 100 mg / l of spectinomycin for 20 h at 37 ° C in orbital shaker, and the production of recombinant Trx was analyzed by immunodetection with anti-histidine antibody (Fig. 8). All vectors produced immunoreactive Trx, although the vector that produced more Trx in this model was pL3PrrnG10LTRXm / f, which seems to be due to the presence of RBS of gene 10 of bacteriophage T7, which is capable of increasing the translation of exogenous genes into E. coli (Olins et al. 1988). Thus, the strains with the vectors pL3PrrnG10LTRXm / f were selected to continue the purification process.

The purification of the Trx was carried out using the following procedure. The inoculums were grown in 50 ml of Broth TB medium with 100mg / l of spectinomycin for 12 h at 37 ° and under stirring, then diluted in 1.5 l of the same medium and left at 37 ° C and shaking until the optical density at 600 nm (DO600) reached values around 2. At that time the cultures were centrifuged to collect the cells, which were resuspended in sonication buffer (50mM sodium phosphate, 300mM sodium chloride, 25mM imidazole, 10% glycerol, X-triton 100 to 0.5%, protease inhibitor, pH 7.4) and stored frozen. The cells were subjected to ultrasound and centrifuged at 9000 rpm for 20 min at 4 ° C. Supernatants were collected and filtered through a 0.45 micron filter. The clarified supernatants were incubated with the Quiagen Ni-NTA Agarose resin for 2 h at 4 ° C in rotation. After that time, the entire volume was passed through a purification column and subsequently washed with wash buffer whose composition was identical to the sonication buffer but with a concentration of 45 mM imidazole. The protein was eluted with the same buffer containing 300mM imidazole. Fractions containing the protein were directly dialyzed to remove any trace of imidazole and stored frozen at -20 ° C. The different fractions obtained in the purification process were analyzed on an SDS-PAGE gel and by immunodetection with anti-histidine antibody (Fig. 9). The concentration of the purified protein was quantified by Bradford using the "Bio-Rad Protein Assay" assay, obtaining approximately 7 mg / l culture.

To verify that the recombinant Trx produced in E.coli maintained its oxidoreductase activity, its ability to catalyze the reduction of insulin disulfide bridges was tested by adding dithiothreitol (DTT) as a reducing agent (Holmgren, 1979) (Fig. 10 ). In view of the data, the oxidoreductase activity of the recombinant Trx was confirmed.

ES 2 384 777 Al

-

Example 7.-Obtaining the fusion plasmids and coexpression of the Trx with proteins of interest.

Fusion with HSA (pAFpsbATRXm-EK-HSA and pAFpsbATRXf-EK-HSA): The translational termination codon TAA codon was removed from the mature Trx m sequence using the SacII-TRXm-5 '5 primers and TRXm-SmaI-3 '(Table 2) on the pGEMTRXm template and was cloned into a pGEMT (pGEMTRXmLTAA). To fuse the Trx m to the 5 ’end of the HSA, the SacII-SmaI fragment of the pGEMTRXmLTAA vector was introduced into the pGEM-GPGP-EK-HSA vector (Del Rio, unpublished results) digested with said enzymes. This intermediate vector pGEM-TRXm-EK-HSA was opened with the HindIII enzyme and ligated with the HindIII fragment corresponding to the promoter, the 5’UTR of the psbA gene and the start of the TRX m obtained from the vector pBS-psbATRXm (described

10 above). The EcoRV-NotI fragment of this vector (pGEMpsbATRXm-EK-HSA) was introduced into the pAF vector to give rise to the pAFpsbATRXm-EK-HSA vector (Fig. 11a). The same strategy was carried out for the construction of the pAFpsbATRXf-EK-HSA vector, but using the SacII-TRXf-5 'and TRXf-SmaI-3' primers (Table 2) in the Trx f amplification PCR without the TAA of completion of the translation, on the pGEMTRXf mold (Fig. 11b).

15 Coexpression with HSA (pAFpsbAHSA :: PrrnG10LTRXm and pAFpsbAHSA :: PrrnG10LTRXf): By means of EcoRI-SacI digestion of the vector pBS-PrrnG10LTRXm a fragment was obtained with the PrrnG10L and Trx m promoter, which was introduced into vector p. This intermediate vector pPCR2.1PrrnG10LTRXm was digested with NotI to introduce fusion into the pLDpsbAHSA vector (Fernández-San Millán et al, 2003), giving rise to the vector pAFpsbAHSA :: PrrnG10LTRXm (Fig. 11c). Following the same cloning strategy, but starting from the pBS

20 PrrnG10LTRXf to obtain the PrrnG10L and Trx f promoter fragment, the vector pAFpsbAHSA :: PrrnG10LTRXf (Fig. 11d) was obtained.

Fusion with CT1 (pL3psbATRXm-EK-CT1 and pL3psbATRXf-EK-CT1): By means of HindIII digestion of the PCR2.1psbATRXm vector the fragment was obtained with the promoter, the 5'UTR of the psbA gene and the start of the Trx m, which was introduced in the pGEMTRXmLTAA to give rise to the pGEMpsbATRXmLTAA. The recognition site for cutting

25 per enterokinase was obtained by SmaI-SacII digestion of the pGEMCTB-link vector (Farran, unpublished results), and was introduced at the 3 'end of the Trx m of the pGEMpsbATRXmLTAA vector, giving rise to the pGEMpsbATRXm-EK vector. The mature hCT1 sequence was obtained by XbaI-NotI digestion of the pGEMCT1 vector (Farran et al, 2008), and introduced into the previous vector to give rise to the pGEMpsbATRXm-EK-CT1 vector. By restriction EcoRI of this last vector, the complete fusion fragment of Trx m to hCT1 was extracted and

30 introduced into vector pL3 to give rise to vector pL3psbATRXm-EK-CT1 (Fig. 12a). The strategy followed for the construction of the vector pL3psbATRXf-EK-CT1 was the same but starting from the vector pGEMTRXfLTAA (Fig. 12b).

Coexpression with CT1 (pL3PrrnG10LTRXm :: psbACT1 and pL3PrrnG10LTRXf :: psbACT1): The fragment corresponding to the PrrnG10L and Trx m promoter was obtained by EcoRI-SacI digestion of the vector pBS-PrrnG10LTRXm, and introduced into the vector pPCR2. 1PrrGG10LTRXm). The NotI fragment of this vector

35 was cloned into the vector pL3psbACT1 (Farran et al, 2008) that expresses the hCT1 under the promoter and the 5’UTR of the psbA gene, to finally obtain the vector pL3PrrnG10LTRXm :: psbACT1 (Fig. 12c). The cloning of the vector pL3PrrnG10LTRXf :: psbACT1 was carried out in a similar manner, except that it was based on the vector pBs-PrrnG10LTRXf (Fig. 12d).

 Table 2 Primers used in the cloning of plastidial expression vectors.

Recognition sites of Primers Sequence1 restriction enzymes

SacII-TRXm-5 ’

 CCGCGGAAGCTTAAATTCTTCAAGC SacII

TRXm-SmaI-3 ’

CCCGGGCAAGAATTTCTCTATGCAGG SmaI

SacII-TRXf-5 ’

CCGCGGAAGCTTGATTGCAACC SacII

TRXf-SmaI-3 ’

CCCGGGACTTGACCGCACC SmaI

40

1 Primer sequence in orientation 5’�3 ’.

-

Example 8.-Transformation of tobacco with fusion plasmids and coexpression by bombardment, and selection of transgenic plants.

The plastidial transformation was based on the Daniell protocol (1997) described above. Starting from the in vitro seedlings obtained after 2 or 3 regeneration cycles, a first selection of transgenic clones was performed by PCR with primers L1 and L2 in the case of using pL3 as a transformation vector and F1 (5'-AAAACCCGTCCTCAGTTCGGATTGC -3 ') and F2 (5'- CCGCGTTGTTTCATCAAGCCTTACG-3') in the case of using pAF (results not shown). Genomic DNA was extracted and 1 µg of DNA was used as a template in

ES 2 384 777 Al

a 30 cycle PCR. Finally, homoplasmic plants of all constructions were selected by Southern blotting (Fig. 13). Table 3 shows the different fragments generated by BglII digestion (in the case of pL3 vectors) or HindIII (for pAF vectors), and that will hybridize with each of the probes used in Southern blotting.

Table 3. Size of the fragments generated in the Southern blot, which will hybridize with the probes homologous to the recombination zones.

Transformed plants Digestion of the size of hybridized bands (kb)

with the genomic DNA vector

Control HindIII 7.7 pAFpsbATRXm / f-EK-HSA HindIII 8.2 + 3.3 pAFpsbAHSA :: PrrnG10LTRXm / f HindIII 10.2 + 1.5

Control PH BglII 4.5 pL3psbATRXm / f-EK-CT1 BglII 4.9 + 2.5 pL3psbACT1 :: PrrnG10LTRXm / f BglII 5.5 + 2.1

-

Example 9.-Effect of the fusion of Trx m or f with heterologous proteins.

First, the amounts of accumulated HSA in grown adult plant leaves were analyzed

10 in phytotron, from which total protein was extracted (Farran et al, 2002). By immunodetection and using an anti-HSA as the primary antibody, it was found that the plants expressing the HSA fused to either of the two thioredoxins had a band pattern (Fig. 14a, lanes 2-4) similar to that observed in the samples of plants that express HSA alone (Fig. 14a, lane 1). A large number of high molecular weight aggregates can be observed, which could be indicating the accumulation, in the chloroplast, of the fusion protein in bodies

15 of inclusion, as occurs when the HSA expresses itself (Fernández-San Millán et al, 2003). Given the large amount of recombinant protein observed in the immunodetection of plants that express the fusion of Trx’s with HSA, the samples were analyzed by SDS-PAGE (Fig. 14b). In the extracts of the leaves that express the fusion of the Trx's with the HSA, in addition to the band corresponding to the large subunit of the RuBisCo (approx. 50 kDa), an intense band stained with CBB (Coomassie Brillant Blue) of a size

20 approximately 80 kDa (Fig. 14b, lanes 1-4). This band does not appear in leaf extracts of unprocessed plants (Fig. 14b, PH) or in those of plants that express HSA alone (Fig. 14b, lane 5). In the latter, however, a dimmer band, of about 67 kDa, corresponding to the HSA can be visualized. These results indicate that a large amount of TrxHSA fusion protein accumulates in tobacco chloroplasts, even at levels higher than the maximum obtained in plants expressing HSA alone (: 11% of the total protein;

25 Fernández-San Millán et al, 2003). It is known that the large subunit of the RuBisCo represents approximately 50% of the total soluble leaf protein (Whitney et al, 1999). If we compare the intensity of the 80 kDa band, corresponding to the TrxHSA fusion protein, with that of the large RuBisCo subunit, we could estimate Trxm / fHSA expression levels between 15-20% of the soluble protein total.

Something similar occurs when we analyze the fusion of Trx with human cardiotrophin-1. Studies

Preliminary 30 on the expression of hCT1 in tobacco chloroplasts showed that rhCT1 accumulated at high levels (: 3% of the total soluble protein) in young leaves, and these levels were doubled by subjecting the plants to 32 hours of continuous light (Farran et al, 2008). By immunodetection and using a monoclonal against hCT1 as the primary antibody, it was found that plants expressing fused hCT1 to either of the two thioredoxins (Trxm / fCT1) had higher levels of rhCT1 than control plants

35 (CT1), regardless of the light condition used (Fig. 15).

So we can conclude that the fusion of any of the Trx with a heterologous protein

anyone, provides greater stability to the protein of interest, which results in greater accumulation

of the same even in mature leaves and without needing to subject the plants to continuous light conditions.

-

Example 10.- Effect of coexpression of Trx m or f with human serum albumin. Aggregates

40 that form the HSA alone (Fernández-San Millán et al, 2003) or fused to Trx (example 9) expressed in tobacco chloroplasts, disappear when albumin is co-expressed with any of the thioredoxins (Fig.

ES 2 384 777 Al

14a, lanes 5-7), suggesting a possible role of Trx in the solubilization of HSA inclusion bodies. Similar results have been described by other authors using bacterial TrxA and in unicellular expression systems (Yuan et al, 2004). Furthermore, it seems that the expression of thioredoxin in free or fused form has a different mode of action on the solubility of recombinant proteins, which would explain the fact that only the dissolution of the aggregates is achieved when both proteins are coexpressed. Although the formation of inclusion bodies can suppose on the one hand a decrease in proteolysis in recombinant proteins (Enfors, 1992), and can facilitate their purification; On the other hand, it requires an in vitro refolding that does not always guarantee the native conformation of the protein, it implies a decrease in yield and an increase in the process. So in many cases it may be interesting to have a system of

10 solubilization for the expression of heterologous proteins in the chloroplasts of any photosynthetic organism.

-

Example 11-Bioactivity of recombinant human cardiotrophin-1 obtained with the fusion or coexpression of Trx.

To study the functionality of rhCT1 produced in tobacco chloroplasts, its ability to induce phosphorylation of the STAT-3 transcription factor was studied. The assay was carried out in the HepG2 line of human hepatocarcinoma. Extracts from stimulated cells were analyzed by immunodetection with antibodies specific for the phosphorylated form of STAT-3 (Figure 16). As a negative control, unprocessed tobacco protein extract was used and as a positive commercial hCT1 (PrepoTech) alone or added to the raw unprocessed tobacco extract was used (Fig. 16a). When the bioassay was performed with rhCT1 obtained from the different transformed plants, it was found that it was capable of inducing the phosphorylation of STAT-3

20 regardless of the plant extract used (Fig. 16b). However, said phosphorylation was much more intense in the case of cells stimulated with plant extract expressing the fused or coexpressed CT1 with any of the chloroplastic thioredoxins tested, suggesting that thioredoxins may play an important role in improving the bioactivity of the rhCT1 produced in chloroplasts of tobacco leaves.

ES 2 384 777 Al

Claims (19)

one.

Plastidial coexpression vector derived from a plasmid comprising a DNA fragment encoding thioredoxin fo its precursor selected from the group consisting of: SEQ ID No. 1 and ATG start codon linked to SEQ ID No. 3, operatively linked to the Prrn promoter the sequence of the ribosome binding site (RBS) of the leading region of gene 10 of bacteriophage T7 (G10L); and a sequence encoding a heterologous protein, operably linked to the psic promoter of Nicotiana tabacum.

2.

Vector according to claim 1 derived from plasmid pAF, wherein the heterologous protein encoded is human serum albumin (HSA), operably linked to the psbA promoter of Nicotiana tabacum, which is the plasmid represented as pAFpsbAHSA :: PrrnG10L TRXf.

3.

Vector according to claim 1 derived from plasmid pL3, wherein the heterologous protein encoded is human cardiotrophin-1 (hCT1), which is the plasmid represented as pL3PrrnG10LTRXf :: psbAhCT1.

Four.

A host organism transformed with a plastidial vector according to any one of claims 1-3.

5.

Host organism according to claim 4, consisting of a transgenic plant, its seeds or propagation material, characterized in that its plastidial genome has integrated the sequence between the homologous recombination sequences of the vectors according to any one of claims 1-3 .

6.

Transgenic plant according to claim 5, whose plastidial genome has integrated the sequence comprised between the homologous recombination sequences of the vector of claim 2.

7.

Transgenic plant according to claim 5, whose plastidial genome has integrated the sequence between the homologous recombination sequences of the vector of claim 3.

8.

Transgenic plant according to any one of claims 5-7, belonging to the species Nicotiana tabacum or Solanum tuberosum.

9.

Method of obtaining the transgenic plants of claims 5-8, comprising the integration of a vector of any one of claims 1-3, by any appropriate means, into the plastoma of a plant.

10. Method according to claim 11, comprising the following steps: a) bombardment of in vitro grown leaves with a gene gun loaded with the vector of any one of claims 1-3; b) obtaining the first regenerated transformants in culture medium supplemented with an antibiotic against which the bombed vector confers resistance; c) realization of at least a second regeneration cycle in selective medium with the same antibiotic, to obtain homoplasmic plants; d) selection of homoplasmic plants by any method of selecting DNA by size.

eleven.

Method according to any one of claims 9-10, wherein the leaves come from the species Nicotiana tabacum or Solanum tuberosum and the antibiotic used is spectinomycin.

12.

Use of a transgenic plant transformed with a recombinant plastidial expression vector comprising: a nucleic acid fragment encoding a polypeptide selected from the group consisting of: thioredoxin f precursor, mature thioredoxin f; and, additionally, homologous recombination sequences that allow the insertion into the plastidial genome of the fragments comprised between them, an endogenous plastidial constitutive promoter and a translation inducing sequence; said vector being selected from the group formed by plasmid pL3psbATRXf and plasmid pL3PrrnG10LTRXf, to increase the amounts of starch and sucrose accumulated in the plant, said amounts being up to 10 times higher than those accumulated in the same tissues or organs of the corresponding wild plants, grown under identical conditions.

13.

Use of the transgenic plant described in claim 8, for the production of recombinant human cardiotrophin-1 protein of bioactivity increased by at least double the human cardiotrophin-1 protein expressed alone in chloroplasts.

14.

Pharmaceutical composition comprising the recombinant protein obtained from the transgenic plant described in claim 8, together with an adjuvant and / or a pharmaceutically acceptable carrier.

fifteen.

Method for overexpressing heterologous proteins in soluble and active form, comprising the following steps:

ES 2 384 777 Al a) obtaining the plastidial coexpression vector described in any one of claims 1-3; b) transform a bacterial host organism or a plant with the vector of step a). 16. A method according to claim 15 for overexpressing HSA, wherein: a) the co-expression vector is that described in claim 2; Y b) the host organism is the transgenic plant described in claim 6. 17. Method according to claim 15 for overexpressing hCT1, wherein: a) the co-expression vector is that described in claim 3; and 10 b) the host organism is the transgenic plant described in claim 7. 18. Method of production of biologically active heterologous proteins and / or in their native conformation, comprising: a) cultivating the transgenic plants described in claims 5-8, under appropriate conditions for their growth; 15 b) separate the green parts of the plant; c) purify the heterologous protein using affinity chromatography, size separation with a standard or ion exchange techniques. 19. Method according to claim 18 for producing recombinant human serum albumin in soluble form and native conformation, wherein the transgenic plant of step a) is that described in claim 6.  SEQUENCE LIST <110> PUBLIC UNIVERSITY OF NAVARRA-SUPERIOR COUNCIL OF SCIENTIFIC RESEARCH <120> Plastidial thioredoxins: overexpression and biotechnological applications <130> P-100710 <160> 8 <170> PatentIn version 3.3 <210> 1 <211> 528 <212> DNA <213> Nicotiana tabacum <220> <221> CDS <222> (1) .. (528) <223> Trx f precursor protein coding DNA <220> <221> Transit Peptide <222> (1) .. (165) <223> Transit peptide coding DNA <400> 1 atg gcg ttg caa gtg caa gta aac ggc gta tcc ttg aag cct tca acg 48 Met Ala Leu Gln Val Gln Val Asn Gly Val Ser Leu Lys Pro Ser Thr1 5 10 15 gtg cct tca tct tct gca tgg agg tcc agc aag caa tca gtg gtc tgc 96 Val Pro Ser Be Ser Wing Trp Arg Ser Ser Lys Gln Ser Val Val Cys 20 25 30 gtt gca gga gat tat ggc ttt tcg cct agg gtt ttt aac aac agg ggg 144 Val Wing Gly Asp Tyr Gly Phe Ser Pro Arg Val Phe Asn Asn Arg Gly 35 40 45 ctg agt ttg aag gtg aag tgt agc tcc gat gct act gct act acc agt 192 Leu Ser Leu Lys Val Lys Cys Ser Ser Asp Wing Thr Wing Thr Thr Ser 50 55 60 gtg acg gta ggg cag gtg act gaa gtt tgt aaa gat acc ttt tgg cct 240 Val Thr Val Gly Gln Val Thr Glu Val Cys Lys Asp Thr Phe Trp Pro65 70 75 80 att gtt gaa gct gcc ggt gat aaa act gtc gta gtt gac atg tac act 288 Ile Val Glu Ala Wing Gly Asp Lys Thr Val Val Val Asp Met Tyr Thr 85 90 95 cag tgg tgt ggt cct tgc aaa gtg att gct cca aag ttt caa gaa ctg 336 Gln Trp Cys Gly Pro Cys Lys Val Ile Wing Pro Lys Phe Gln Glu Leu 100 105 110

tcg aag aat tat aat gac gtg gtc ttt ctg aag ctt gat tgc aac cagSer Lys Asn Tyr Asn Asp Val Val Phe Leu Lys Leu Asp Cys Asn Gln115 120 125 gat aat agg cca cta gcc aag gaa cta ggc ata aag gtg As Arg Pro Leu Ala Lys Glu Leu Gly Ile Lys Val Val Pro Thr130 135 140 ttc aag att ctg aag aat aat aag gtc gtt aaa gaa gtc act gga gcaPhe Lys Ile Leu Lys Asn Asn Lys Val Val Lys Glu Val Thr Gly Ala145 150 155 160 aaa ctt gat aat tta ata gcg gca att gag gat gtg cgg tca agt taaLys Leu Asp Asn Leu Ile Wing Ile Glu Asp Val Arg Ser Ser165 170 175

384 432 480 528

<210> 2 <211> 175 <212> PRT <213> Nicotiana tabacum <400> 2 Met Ala Leu Gln Val Gln Val Asn Gly Val Ser Leu Lys Pro Ser Thr1 5 10 15

Val Pro Be Be Be Wing Trp Arg Be Be Lys Gln Be Val Val Cys20 25 30

Val Wing Gly Asp Tyr Gly Phe Ser Pro Arg Val Phe Asn Asn Arg Gly35 40 45

Leu Ser Leu Lys Val Lys Cys Ser Ser Asp Ala Thr Ala Thr Thr Ser50 55 60

Val Thr Val Gly Gln Val Thr Glu Val Cys Lys Asp Thr Phe Trp Pro65 70 75 80

Ile Val Glu Ala Wing Gly Asp Lys Thr Val Val Val Asp Met Tyr Thr85 90 95 Gln Trp Cys Gly Pro Cys Lys Val Ile Pro Wing Lys Phe Gln Glu Leu100 105 110

Ser Lys Asn Tyr Asn Asp Val Val Phe Leu Lys Leu Asp Cys Asn Gln115 120 125

Asp Asn Arg Pro Leu Wing Lys Glu Leu Gly Ile Lys Val Val Pro Thr130 135 140

Phe Lys Ile Leu Lys Asn Asn Lys Val Val Lys Glu Val Thr Gly Ala145 150 155 160

Lys Leu Asp Asn Leu Ile Wing Ile Glu Asp Val Arg Ser Ser165 170 175 <210> 3 <211> 363 <212> DNA <213> Nicotiana tabacum <220> <221> CDS <222> (1) .. (363) <223> Mature Trx f protein coding DNA <400> 3 agc tcc gat gct act gct act acc agt gtg acg gta ggg cag gtg act 48 Ser Ser Asp Ala Thr Ala Thr Thr Ser Val Thr Val Gly Gln Val Thr1 5 10 15 gaa gtt tgt aaa gat acc ttt tgg cct att gtt gaa gct gcc ggt gat 96 Glu Val Cys Lys Asp Thr Phe Trp Pro Ile Val Glu Ala Wing Gly Asp 20 25 30 aaa act gtc gta gtt gac atg tac act cag tgg tgt ggt cct tgc aaa 144 Lys Thr Val Val Val Asp Met Tyr Thr Gln Trp Cys Gly Pro Cys Lys 35 40 45 gtg att gct cca aag ttt caa gaa ctg tcg aag aat tat aat gac gtg 192 Val Ile Wing Pro Lys Phe Gln Glu Leu Ser Lys Asn Tyr Asn Asp Val 50 55 60 gtc ttt ctg aag ctt gat tgc aac cag gat aat agg cca cta gcc aag 240 Val Phe Leu Lys Leu Asp Cys Asn Gln Asp Asn Arg Pro Leu Wing Lys65 70 75 80 gaa cta ggc ata aag gtg gtt cca acg ttc aag att ctg aag aat aat 288 Glu Leu Gly Ile Lys Val Val Pro Thr Phe Lys Ile Leu Lys Asn Asn 85 90 95 aag gtc gtt aaa gaa gtc act gga gca aaa ctt gat aat tta ata gcg 336 Lys Val Val Lys Glu Val Thr Gly Ala Lys Leu Asp Asn Leu Ile Ala 100 105 110 gca att gag gat gtg cgg tca agt taa 363 Ile Glu Asp Val Arg Ser Ser 115 120 <210> 4 <211> 120 <212> PRT <213> Nicotiana tabacum <400> 4 Be Be Asp Wing Thr Wing Thr Thr Be Val Thr Val Gly Gln Val Thr1 5 10 15 Glu Val Cys Lys Asp Thr Phe Trp Pro Ile Val Glu Ala Wing Gly Asp20 25 30 Lys Thr Val Val Val Asp Met Tyr Thr Gln Trp Cys Gly Pro Cys Lys35 40 45 Val Ile Ala Pro Lys Phe Gln Glu Leu Ser Lys Asn Tyr Asn Asp Val50 55 60 Val Phe Leu Lys Leu Asp Cys Asn Gln Asp Asn Arg Pro Leu Wing Lys65 70 75 80 Glu Leu Gly Ile Lys Val Val Pro Thr Phe Lys Ile Leu Lys Asn Asn85 90 95 Lys Val Val Lys Glu Val Thr Gly Ala Lys Leu Asp Asn Leu Ile Ala100 105 110 Ile Glu Asp Wing Val Arg Ser Ser115 120 <210> 5 <211> 513 <212> DNA <213> Nicotiana tabacum <220> <221> CDS <222> (1) .. (513) <223> Trx m precursor protein coding DNA <220> <221> Transit Peptide <222> (1) .. (174) <223> Transit peptide coding DNA <400> 5 cct tcg gca ctg ccg tcg tcg tca ctg gct ccg gta gcc ggt tct tcc 48 Pro Ser Ala Leu Pro Ser Ser Ser Leu Ala Pro Val Ala Gly Ser Ser1 5 10 15 ttc tca agt cct cgt tcc tcc gtt aga ttc tct caa ttc aga ggc ctt 96 Phe Be Ser Pro Arg Be Ser Val Arg Phe Ser Gln Phe Arg Gly Leu 20 25 30 aag atc cag tca act cgc tca tcc gtc tcc act acc tca tgc tca aaa 144 Lys Ile Gln Ser Thr Arg Ser Ser Val Ser Thr Thr Ser Cys Ser Lys 35 40 45 atc att ccc gga cga gct cga atc gtc tgc gaa gcg caa aat act gcc 192 Ile Ile Pro Gly Arg Ala Arg Ile Val Cys Glu Ala Gln Asn Thr Ala 50 55 60

ctt gaa gtg ggt gct gtt aat gat aaa here tgg aag tca ctt gtt gtaLeu Glu Val Gly Ala Val Asn Asp Lys Thr Trp Lys Ser Leu Val Val65 70 75 80 gag tct gat ata cct gtc ctg gtt gaa ttt tgg gct ccg tgg tgt ggt Ser Asp Ile Pro Val Leu Val Glu Phe Trp Pro Wing Trp Cys Gly85 90 95 cca tgc cga atg atc cac ccg gtc att gat gaa ctg gca aag gaa tatPro Cys Arg Met Ile His Pro Val Ile Asp Glu Leu Wing Lys Glu Tyr100 105 110 gct ggc aag ctt aaa ttc ttc aag ctg aac acg gac gaa agc cct tccAla Gly Lys Leu Lys Phe Phe Lys Leu Asn Thr Asp Glu Ser Pro Ser115 120 125 here gca acc gaa ttg ggg att cga agc atc cca act ttt athr Thr Glu Leu Gly Ile Arg Ser Ile Pro Thr Val Met Ile Phe130 135 140 aag aat gga gag aag aaa gat gca gtc att ggt gca gtt cct aaa tcaLys Asn Gly Glu Lys Lys Asp Ala Val Ile Gly Ala Val Pro Lys Ser145 150 155 160 here cta acc acc tgc ata gag aaa ttc ttg taaThr Leu Thr Thr Cys Ile Glu Lys Phe Leu165 170

240 288 336 384 432 480 513

<210> 6 <211> 170 <212> PRT <213> Nicotiana tabacum <400> 6 Pro Ser Ala Leu Pro Ser Ser Ser Leu Ala Pro Val Ala Gly Ser Ser1 5 10 15

Phe Be Be Pro Arg Be Be Val Arg Phe Be Gln Phe Arg Gly Leu20 25 30

Lys Ile Gln Ser Thr Arg Ser Ser Val Ser Thr Thr Ser Cys Ser Lys35 40 45

Ile Ile Pro Gly Arg Ala Arg Ile Val Cys Glu Ala Gln Asn Thr Ala50 55 60

Leu Glu Val Gly Ala Val Asn Asp Lys Thr Trp Lys Ser Leu Val Val65 70 75 80

Glu Ser Asp Ile Pro Val Leu Val Glu Phe Trp Wing Pro Trp Cys Gly85 90 95

Pro Cys Arg Met Ile His Pro Val Ile Asp Glu Leu Ala Lys Glu Tyr100 105 110

Wing Gly Lys Leu Lys Phe Phe Lys Leu Asn Thr Asp Glu Ser Pro Ser115 120 125

Thr Wing Thr Glu Leu Gly Ile Arg Ser Ile Pro Thr Val Met Ile Phe130 135 140

Lys Asn Gly Glu Lys Lys Asp Ala Val Ile Gly Ala Val Pro Lys Ser145 150 155 160

Thr Leu Thr Thr Cys Ile Glu Lys Phe Leu165 170

<210> <211> <212> <213>

7 339 DNA Nicotiana tabacum

<220> <221> CDS <222> (1) .. (339) <223> Mature Trx m protein coding DNA <400> 7 gaa gcg caa aat act gcc ctt gaa gtg ggt gct gtt aat gat aaa acaGlu Ala Gln Asn Thr Ala Leu Glu Val Gly Ala Val Asn Asp Lys Thr1 5 10 15

48

tgg aag tca ctt gtt gta gag tct gat ata cct gtc ctg gtt gaa tttTrp Lys Ser Leu Val Val Glu Ser Asp Ile Pro Val Leu Val Glu Phe20 25 30

96

tgg gct ccg tgg tgt ggt cca tgc cga atg atc cac ccg gtc att gatTrp Wing Pro Trp Cys Gly Pro Cys Arg Met Ile His Pro Val Ile Asp35 40 45

144

gaa ctg gca aag gaa tat gct ggc aag ctt aaa ttc ttc aag ctg aacGlu Leu Ala Lys Glu Tyr Ala Gly Lys Leu Lys Phe Phe Lys Leu Asn50 55 60

192

acg gac gaa agc cct tcc aca gca acc gaa ttg ggg att cga agc atcThr Asp Glu Ser Pro Ser Thr Ala Thr Glu Leu Gly Ile Arg Ser Ile65 70 75 80

240

cca act gtg atg att ttc aag aat gga gag aag aaa gat gca gtc attPro Thr Val Met Ile Phe Lys Asn Gly Glu Lys Lys Asp Ala Val Ile85 90 95

288

ggt gca gtt cct aaa tca aca cta acc acc tgc ata gag aaa ttc ttgGly Ala Val Pro Lys Ser Thr Leu Thr Thr Cys Ile Glu Lys Phe Leu100 105 110

336

sooo

339

<210> 8 <211> 112 <212> PRT <213> Nicotiana tabacum <400> 8 Glu Wing Gln Asn Thr Wing Leu Glu Val Gly Wing Val Asn Asp Lys Thr1 5 10 15 Trp Lys Ser Leu Val Val Glu Ser Asp Ile Pro Val Leu Val Glu Phe20 25 30 Trp Wing Pro Trp Cys Gly Pro Cys Arg Met Ile His Pro Val Ile Asp35 40 45 Glu Leu Ala Lys Glu Tyr Ala Gly Lys Leu Lys Phe Phe Lys Leu Asn50 55 60 Thr Asp Glu Ser Pro Ser Thr Ala Thr Glu Leu Gly Ile Arg Ser Ile65 70 75 80 Pro Thr Val Met Ile Phe Lys Asn Gly Glu Lys Lys Asp Ala Val Ile85 90 95 Gly Ala Val Pro Lys Ser Thr Leu Thr Thr Cys Ile Glu Lys Phe Leu100 105 110 SPANISH OFFICE OF THE PATENTS AND BRAND Application no .: 201130078 SPAIN Date of submission of the application: 01.25.2011 Priority Date: REPORT ON THE STATE OF THE TECHNIQUE 51 Int. Cl.: C12N9 / 02 (2006.01) C12N15 / 82 (2006.01) RELEVANT DOCUMENTS

Category

Documents cited Claims Affected

TO

EP 1609867 A1 (UNIV. FENG CHIA) 25.12.2005, paragraphs [0044] - [0047], [0052]. 1-11,13-19

TO

WO 0250289 A1 (SEMBIOSYS GENETICS INC./SYNGENTA PARTICIPATIONS AG.) 27.06.2002, page. 14, lines 11-15, pages. 56-58; page 67, lines 13-19. 1-11,13-19

TO

WO 2005011367 A1 (UNIV. CENTRAL FLORIDA) 10.02.2005, all in document. 1-11,13-19

TO

FARRAN, I. et al. "High-density seedling expression system for the production of bioactive human cardiotrophin-1, a potential therapeutic cytokine, in transgenic tobacco chloroplasts". Plant Biotechnol. J. Volume 6 Issue 5, Pages 516-527. DOI 10.1111 / j.1467-7652.2008.00334.x. Whole document. 1-11,13-19

TO

WO 0014239 A2 (DU PONT) 16.03.2000, page. 1, lines 37-38; page. 11, lines 31-37; page. 21, lines 35 onwards; example 6. 12

TO

WO 2007053183 A2 (UNIV. CENTRAL FLORIDA) 10.05.2007, pages 109,110, paragraph [0670]. 1-11,13-19

Category of the documents cited X: of particular relevance Y: of particular relevance combined with other / s of the same category A: reflects the state of the art O: refers to unwritten disclosure P: published between the priority date and the date of priority submission of the application E: previous document, but published after the date of submission of the application

This report has been prepared • for all claims • for claims no:

Date of realization of the report 10.05.2011

Examiner M. Martín-Falquina Garre Page 1/4

REPORT OF THE STATE OF THE TECHNIQUE Application number: 201130078 Minimum documentation sought (classification system followed by classification symbols) C12N Electronic databases consulted during the search (name of the database and, if possible, terms of search used) INVENES, EPODOC, EPO-Internal, EBI, MEDLINE, BIOSIS, EMBASE, NPL, XPESP State of the Art Report Page 2/4  WRITTEN OPINION Application number: 201130078 Date of Completion of Written Opinion: 05.10.2011 Statement

Novelty (Art. 6.1 LP 11/1986)

Claims 1-19 Claims IF NOT

Inventive activity (Art. 8.1 LP11 / 1986)

Claims 1-19 Claims IF NOT

The application is considered to comply with the industrial application requirement. This requirement was evaluated during the formal and technical examination phase of the application (Article 31.2 Law 11/1986).  Opinion Base.- This opinion has been made on the basis of the patent application as published.  Considerations: The documents of the patent application on which this Written Opinion is based are the result of the modifications made during the process of formal and technical examination of the patent application. State of the Art Report Page 3/4  WRITTEN OPINION Application number: 201130078 1. Documents considered.- The documents belonging to the state of the art taken into consideration for the realization of this opinion are listed below.

Document

Publication or Identification Number publication date

EP 1609867 A1 (UNIV. FENG CHIA)

25.12.2005

WO 0250289 A1 (SEMBIOSYS GENETICS INC./SYNGENTA PARTICIPATIONS AG.)

06.27.2002

WO 2005011367 A1 (UNIV. CENTRAL FLORIDA)

02.10.2005

FARRAN, I. et al. "High-density seedling expression system for the production of bioactive human cardiotrophin-1, a potential therapeutic cytokine, in transgenic tobacco chloroplasts". Plant Biotechnol. J. Volume 6 Issue 5, Pages 516-527. DOI 10.1111 / j.1467-7652.2008.00334.x. Whole document.

04.01.2008

WO 0014239 A2 (DU PONT)

16.03.2000

2. Statement motivated according to articles 29.6 and 29.7 of the Regulations for the execution of Law 11/1986, of March 20, on Patents on novelty and inventive activity; quotes and explanations in support of this statement Documents D01 and D02 are considered the closest to claim 1. D01 refers to constructs and vectors for coexpressing a thioredoxin (Trx) together with a second polypeptide in tobacco plastics and D02 discloses constructs and expression vectors comprising a first nucleic acid sequence that encodes a thioredoxin and a second sequence that encodes a heterologous protein or an enzyme. On the other hand, D03 and D04 respectively disclose recombinant serum albumin (HSA) and recombinant human cardiotrophin-1 (hCT-1) expression systems in tobacco chloroplasts. However, none of the aforementioned documents, considered in isolation or in combination, would induce the person skilled in the art to perform a coexpression system in plastids such as that of the invention, which allows the expression of HSA or hCT-1 with high yield without that accumulation occurs in inclusion bodies. Consequently, the following claims or groups of claims are new and inventive (arts. 6 and 8 LP): claims 1-3 which refer to vectors for coexpression of Trx f with heterologous proteins and specifically with HSA or hCT-1; claims 4 and 5 corresponding to organisms transformed with said constructions and claims 6-8 that specify transgenic plants; claims 10 and 11 on the method of obtaining said plants and claims 15-17 relating to the method for overexpressing heterologous proteins. Following the same reasoning, claim 13 which refers to the use of transgenic plants for the production of recombinant human cardiotrophin-1 (hCT-1), claim 14 on the pharmaceutical composition containing the recombinant protein and claims 18 and 19 on the method to produce biologically active heterologous proteins and / or in their native conformation, they also meet the requirements of novelty and inventive activity (Arts. 6 and 8 LP). Document D05 is considered the closest in relation to claim 12. It refers to a system for the overexpression of thioredoxins in corn grains and other cereals that makes it possible to improve the production of starch. The disclosed chimeric construction facilitates the extraction of starch from the grain, but it is not suggested that it causes its accumulation or that of sucrose in the rest of the plant. Therefore claim 12 also meets the requirements of novelty and inventive activity (Arts. 6 and 8 LP). State of the Art Report Page 4/4